WorldWideScience

Sample records for adult human keratinocytes

  1. Rho kinase inhibitor y-27632 prolongs the life span of adult human keratinocytes, enhances skin equivalent development, and facilitates lentiviral transduction.

    NARCIS (Netherlands)

    Bogaard, E.H.J. van den; Rodijk-Olthuis, D.; Jansen, P.A.M.; Vlijmen-Willems, I.M.J.J. van; Erp, P.E.J. van; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.

    2012-01-01

    The use of tissue-engineered human skin equivalents (HSE) for fundamental research and industrial application requires the expansion of keratinocytes from a limited number of skin biopsies donated by adult healthy volunteers or patients. A pharmacological inhibitor of Rho-associated protein kinases,

  2. Human keratinocytes are vanilloid resistant.

    Directory of Open Access Journals (Sweden)

    László Pecze

    Full Text Available BACKGROUND: Use of capsaicin or resiniferatoxin (RTX as analgesics is an attractive therapeutic option. RTX opens the cation channel inflammatory pain/vanilloid receptor type 1 (TRPV1 permanently and selectively removes nociceptive neurons by Ca(2+-cytotoxicity. Paradoxically, not only nociceptors, but non-neuronal cells, including keratinocytes express full length TRPV1 mRNA, while patient dogs and experimental animals that underwent topical treatment or anatomically targeted molecular surgery have shown neither obvious behavioral, nor pathological side effects. METHODS: To address this paradox, we assessed the vanilloid sensitivity of the HaCaT human keratinocyte cell line and primary keratinocytes from skin biopsies. RESULTS: Although both cell types express TRPV1 mRNA, neither responded to vanilloids with Ca(2+-cytotoxicity. Only ectopic overproduction of TRPV1 rendered HaCaT cells sensitive to low doses (1-50 nM of vanilloids. The TRPV1-mediated and non-receptor specific Ca(2+-cytotoxicity ([RTX]>15 microM could clearly be distinguished, thus keratinocytes were indeed resistant to vanilloid-induced, TRPV1-mediated Ca(2+-entry. Having a wider therapeutic window than capsaicin, RTX was effective in subnanomolar range, but even micromolar concentrations could not kill human keratinocytes. Keratinocytes showed orders of magnitudes lower TRPV1 mRNA level than sensory ganglions, the bona fide therapeutic targets in human pain management. In addition to TRPV1, TRPV1b, a dominant negative splice variant was also noted in keratinocytes. CONCLUSION: TRPV1B expression, together with low TRPV1 expression, may explain the vanilloid paradox: even genuinely TRPV1 mRNA positive cells can be spared with therapeutic (up to micromolar doses of RTX. This additional safety information might be useful for planning future human clinical trials.

  3. Isolation, cultivation and transfection of human keratinocytes.

    Science.gov (United States)

    Zare, Sona; Zarei, Mohammad Ali; Ghadimi, Tayyeb; Fathi, Fardin; Jalili, Ali; Hakhamaneshi, Mohammad Saeed

    2014-04-01

    Human keratinocytes could be used in the repair of damaged skin, in tissue engineering applications, gene therapy and recently, the generation of iPS cells. We isolated human keratinocytes from foreskin and subsequently cultured them on fibronectin, collagen type I, gelatin and laminin-coated dishes that contained three different types of serum-free medium (epilife, KSM or CnT). We developed improved conditions for efficient transfection of these human keratinocytes by testing three common transfection methods and a GFP plasmid vector. The isolated cells showed typical keratinocyte morphology and expressed the epithelial cell specific antigen, cytokeratin 14. Collagen type 1, epilife medium and lipofectamin 2000 gave the best results for isolation and transfection of human keratinocytes. Our protocol can be used as a reproducible, simple and efficient method for isolation, cultivation and genetic manipulation of human keratinocytes, which may be useful in cell and gene therapy applications.

  4. Radiosensitivity of cultured human and mouse keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Parkinson, E.K.; Hume, W.J.; Potten, C.S.

    1986-10-01

    Clonogenic survival assays after ..gamma..-radiation in vitro were performed on freshly isolated and subcultured keratinocytes from mouse skin, mouse tongue and human skin. Survival curves were constructed by fitting the data to a multi-target model of cell survival. When subcultured, keratinocytes from all sites produced survival curves which showed a reduced shoulder region and an increased D/sub 0/ when compared with their freshly isolated counterparts. Freshly isolated human skin keratinocytes were more radiosensitive than mouse keratinocytes from either skin or tongue.

  5. Peroxisome Proliferator-Activated Receptor-alpha Is a Functional Target of p63 in Adult Human Keratinocytes

    DEFF Research Database (Denmark)

    Pozzi, Silvia; Boergesen, Michael; Sinha, Satrajit;

    2009-01-01

    healing process, is a target of p63 in human keratinocytes. Silencing of p63 by RNA interference and transient transfections showed that p63 represses PPARalpha through a functional region of promoter B. Chromatin immunoprecipitation analyses indicate that p63 is bound to this region, in the absence......p63 is a master switch in the complex network of signaling pathways controlling the establishment and maintenance of stratified epithelia. We provide evidence that peroxisome proliferator-activated receptor-alpha (PPARalpha), a ligand-activated nuclear receptor that participates in the skin wound...

  6. Karyotypic analysis of gene transformed human keratinocyte line

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    @@ INTRODUCTION In order to solve the difficult problem of long term in vitro culture of human keratinocytes, the technique of gene transfer was utilized to transform human keratinocytes with simian virus 40 (SV40).

  7. In Vitro Toxicity of Aluminum Nanoparticles in Human Keratinocytes

    Science.gov (United States)

    2008-03-01

    absorption of aluminum has been reported after application of underarm deodorant (Becaria, 2002:311). Two adult volunteers were dermally exposed to one...NPs can be classified as a sensitizer agent. Since sensitization has been identified in persons exposed to aluminum in deodorant , vaccines, and...IN VITRO TOXICITY OF ALUMINUM NANOPARTICLES IN HUMAN KERATINOCYTES THESIS Stephanie McCormack-Brown, Major, USAF, BSC AFIT/GIH/ENV

  8. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  9. Functional genomic and radiosensitivity of human keratinocytes: from differentiated to stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Lamartine, J.; Rachidi, W.; Franco, N.; Lemaitre, G.; Vaigot, P.; Le Minter, P.; Waksman, G.; Martin, M.T. [Evry Univ. Lab. of Genomic and Radiobiology of Keratinocytes, Service de Genomique Fonctionnelle, CEA, 91 (France)

    2006-07-01

    Despite improvements in radiation techniques, patients can still experience radiation toxicity on the skin. Keratinocytes from the basal layer of the epidermis have been long proposed by ICRP as the main target of ionizing radiation in human skin, both for early and late effects of radiation. But the exact roles of these cells in radiation skin damage are still largely unknown., This is why a new program was started to define the radiosensitivity of human keratinocytes according to their differentiation. In a first study was characterized the response of differentiated keratinocytes to low and high doses of gamma radiation (1). To examine whether the response to low doses was different from that induced by high doses, cultured primary keratinocytes isolated from adult normal skin were irradiated with single doses of 1 c Gray or 2 c Gy. A major finding of this study was the identification of an important number of low dose specific genes (140), most of which were modulated at 48 h. Clustering analysis also revealed low dose specific profiles. These results show for the first time that low dose ionizing irradiation is able to induce specific transcriptional responses in human keratinocytes. Then came the part to characterize the radiosensitivity of human basal keratinocytes. The results show for the first time that keratinocytes stem cells from human epidermis are more resistant than proliferative basal keratinocytes. In summary, using cellular biology and functional genomics, we are improving the knowledge on the effects of ionizing radiation on human epidermis, one of the main target tissue of radiation in the human body. (N.C.)

  10. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  11. Thermolysin in human cultured keratinocyte isolation

    Directory of Open Access Journals (Sweden)

    A. Gragnani

    Full Text Available BACKGROUND: When treating extensively burned patients using cultured epidermal sheets, the main problem is the time required for its production. Conventional keratinocyte isolation is usually done using Trypsin. We used a modification of the conventional isolation method in order to improve this process and increase the number of colonies from the isolated epidermal cell population. PURPOSE: To compare the action of trypsin and thermolysin in the keratinocyte isolation using newborn foreskin. METHODS: This method used thermolysin as it selectively digests the dermo-epidermal junction. After dermis separation, the epidermis was digested by trypsin in order to obtain a cell suspension. RESULTS: Compared to the conventional procedure, these experiments demonstrated that in the thermolysin group, the epidermis was easily detached from the dermis, there was no fibroblast contamination and there were a larger number of keratinocyte colonies which had a significant statistical difference. CONCLUSION: The number of colonies in the thermolysin group was significantly greater than in the trypsin group.

  12. Ultraviolet B light-induced apoptosis in human keratinocytes enriched with epidermal stem cells and normal keratinocytes

    Institute of Scientific and Technical Information of China (English)

    MEI Xue-ling; LIAN Shi

    2011-01-01

    Background The stem-cell compartment is the primary target for the accumulation of oncogenic mutations.Overexposure to solar ultraviolet radiation is responsible for the development and progression of >90% of skin cancers.Ultraviolet B (UVB) light-induced keratinocyte apoptosis is a strong preventive mechanism against carcinogenesis. The aim of this study was to isolate keratinocytes enriched with putative human epidermal stem cells and to investigate their apoptotic induction by UVB.Methods Keratinocytes enriched with putative human epidermal stem cells were isolated by adherence to collagen Ⅳ and the expressions of β1-integrin and p63 were investigated. Keratinocytes enriched with putative human epidermal stem cells and normal keratinocytes were irradiated with UVB at 0-80 mJ/cm2. The apoptotic response was investigated with phase-contrast microscopy, Hoechst 33342 staining, flow cytometry of annexin V/PI, and procaspase-3 Western blotting.Results Keratinocyte enriched with stem cells expressed high levels of p63 protein and β1-integrin and low level of pan-keratin (C11). In comparison to non-irradiated cells, significant apoptosis of keratinocyte enriched with stem cells was found with 40 and 80 mJ/cm2 UVB. However, significant apoptosis of normal keratinocytes was only found for 80 mJ/cm2 UVB.Conclusions Human epidermal stem cells can undergo apoptosis in response to UVB radiation and are more susceptible than other keratinocytes. The method could be used in vitro studies of human epidermal stem cells.

  13. Human keratinocytes synthesize and secrete the extracellular matrix protein, thrombospondin.

    Science.gov (United States)

    Wikner, N E; Dixit, V M; Frazier, W A; Clark, R A

    1987-02-01

    Thrombospondin (TSP) a glycoprotein originally identified as the endogenous lectin of platelets, is also synthesized by fibroblasts, endothelial cells, pneumocytes, smooth muscle cells, and macrophages. Thrombospondin is subdivided into functional domains which bind specifically to heparin, fibronectin, collagen, and to specific cellular receptors. It is found within the basement membranes of kidney, lung, smooth muscle, and skin. Thus TSP may serve as an important link between cells and matrices. Thrombospondin also has been reported at the epidermal-dermal junction. We wished to determine whether human keratinocytes synthesize and secrete TSP. Pure human keratinocytes were grown in defined medium without fibroblast feeder layers. Immunofluorescent staining with either rabbit polyclonal or mouse monoclonal antibodies to human platelet TSP yielded specific granular staining within the cytoplasm of keratinocytes. Culture media and cellular lysates were harvested from cultures metabolically labeled with [35S]methionine. Trichloroacetic acid precipitation, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and autoradiography revealed a major labeled band comigrating with purified platelet TSP in both the media and the cellular lysates. Immunoprecipitation with either the polyclonal or the monoclonal anti-TSP antibodies followed by SDS-PAGE and autoradiography identified this band as TSP. Thus keratinocytes in culture synthesize and secrete TSP. Thrombospondin may play an important role in epidermal interactions with extracellular matrix.

  14. Effect of silver nanoparticles on human primary keratinocytes.

    Science.gov (United States)

    Szmyd, Radoslaw; Goralczyk, Anna Grazyna; Skalniak, Lukasz; Cierniak, Agnieszka; Lipert, Barbara; Filon, Francesca Larese; Crosera, Matteo; Borowczyk, Julia; Laczna, Eliza; Drukala, Justyna; Klein, Andrzej; Jura, Jolanta

    2013-01-01

    Silver nanoparticles (AgNPs) have many biological applications in biomedicine, biotechnology and other life sciences. Depending on the size, shape and the type of carrier, AgNPs demonstrate different physical and chemical properties. AgNPs have strong antimicrobial, antiviral and antifungal activity, thus they are used extensively in a range of medical settings, particularly in wound dressings but also in cosmetics. This study was undertaken to examine the potential toxic effects of 15 nm polyvinylpyrrolidone-coated AgNPs on primary normal human epidermal keratinocytes (NHEK). Cells were treated with different concentrations of AgNPs and then cell viability, metabolic activity and other biological and biochemical aspects of keratinocytes functioning were studied. We observed that AgNPs decrease keratinocyte viability, metabolism and also proliferatory and migratory potential of these cells. Moreover, longer exposure resulted in activation of caspase 3/7 and DNA damage. Our studies show for the first time, that AgNPs may present possible danger for primary keratinocytes, concerning activation of genotoxic and cytotoxic processes depending on the concentration.

  15. Transcriptional responses of human epidermal keratinocytes to Oncostatin-M.

    Science.gov (United States)

    Finelt, Nika; Gazel, Alix; Gorelick, Steven; Blumenberg, Miroslav

    2005-08-21

    Oncostatin-M (OsM) plays an important role in inflammatory and oncogenic processes in skin, including psoriasis and Kaposi sarcoma. However, the molecular responses to OsM in keratinocytes have not been explored in depth. Here we show the results of transcriptional profiling in OsM-treated primary human epidermal keratinocytes, using high-density DNA microarrays. We find that OsM strongly and specifically affects the expression of many genes, in particular those involved with innate immunity, angiogenesis, adhesion, motility, tissue remodeling, cell cycle and transcription. The timing of the responses to OsM comprises two waves, early at 1h, and late at 48 h, with much fewer genes regulated in the intervening time points. Secreted cytokines and growth factors and their receptors, as well as nuclear transcription factors, are primary targets of OsM regulation, and these, in turn, effect the secondary changes.

  16. Transcriptional network of p63 in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Silvia Pozzi

    Full Text Available p63 is a transcription factor required for the development and maintenance of ectodermal tissues in general, and skin keratinocytes in particular. The identification of its target genes is fundamental for understanding the complex network of gene regulation governing the development of epithelia. We report a list of almost 1000 targets derived from ChIP on chip analysis on two platforms; all genes analyzed changed in expression during differentiation of human keratinocytes. Functional annotation highlighted unexpected GO terms enrichments and confirmed that genes involved in transcriptional regulation are the most significant. A detailed analysis of these transcriptional regulators in condition of perturbed p63 levels confirmed the role of p63 in the regulatory network. Rather than a rigid master-slave hierarchical model, our data indicate that p63 connects different hubs involved in the multiple specific functions of the skin.

  17. C/EBPδ gene targets in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Serena Borrelli

    Full Text Available C/EBPs are a family of B-Zip transcription factors--TFs--involved in the regulation of differentiation in several tissues. The two most studied members--C/EBPα and C/EBPβ--play important roles in skin homeostasis and their ablation reveals cells with stem cells signatures. Much less is known about C/EBPδ which is highly expressed in the granular layer of interfollicular epidermis and is a direct target of p63, the master regular of multilayered epithelia. We identified C/EBPδ target genes in human primary keratinocytes by ChIP on chip and profiling of cells functionally inactivated with siRNA. Categorization suggests a role in differentiation and control of cell-cycle, particularly of G2/M genes. Among positively controlled targets are numerous genes involved in barrier function. Functional inactivation of C/EBPδ as well as overexpressions of two TF targets--MafB and SOX2--affect expression of markers of keratinocyte differentiation. We performed IHC on skin tumor tissue arrays: expression of C/EBPδ is lost in Basal Cell Carcinomas, but a majority of Squamous Cell Carcinomas showed elevated levels of the protein. Our data indicate that C/EBPδ plays a role in late stages of keratinocyte differentiation.

  18. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  19. Arsenite suppression of BMP signaling in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Marjorie A.; Qin, Qin [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States); Hu, Qin; Zhao, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Rice, Robert H., E-mail: rhrice@ucdavis.edu [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States)

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  20. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  1. Human papillomavirus (HPV) upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response

    NARCIS (Netherlands)

    Karim, R.; Tummers, B.; Meyers, C.; Biryukov, J.L.; Alam, S.; Backendorf, C.; Jha, V.; Offringa, R.; van Ommen, G.J.; Melief, C.J.; Guardavaccaro, D.; Boer, J.M.; van der Burg, S.H.

    2013-01-01

    Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV) may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs) but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity

  2. Forearm hair density and risk of keratinocyte cancers in Australian adults.

    Science.gov (United States)

    von Schuckmann, L A; Hughes, M C; Green, A C; van der Pols, J C

    2016-11-01

    Evidence suggests that progenitor cells of keratinocyte cancers (basal cell carcinoma (BCC) and squamous cell carcinoma (SCC)) may originate from epidermal stem cells including hair follicle stem cells. We hypothesised that, therefore, a relatively higher density of hair follicles on human skin may increase keratinocyte cancer risk. To evaluate this, we assessed density of mid-forearm hair in Australian adults who were randomly selected participants in a community-based cohort study of skin cancer. Hair density was assessed clinically against a set of four standard photographs showing grades of hair density, and incidence data on histologically confirmed BCC and SCC across a 20-year period were collected. Incidence rate ratios were calculated for categories of forearm hair density using multivariable regression analysis with adjustment for age, sex, phenotypic characteristics and markers of chronic sun exposure. Among the 715 participants (43 % male, average age 61 years), 237 developed at least one BCC and 115 persons developed at least one SCC. Participants with dense forearm hair (n = 169, all male) had a higher incidence of BCC (IRR = 2.24, 95 % CI 1.20, 4.18, P = 0.01) and SCC (IRR = 2.80, 95 % CI 1.20, 6.57, P = 0.02) compared to individuals with sparse forearm hair after multivariable adjustment. Stratified analyses showed that among men, those with dense versus sparse hair developed SCC more commonly (IRR = 3.01, 95 % CI 1.03, 8.78, P = 0.04). Women with moderate versus sparse hair density were more likely affected by BCC (IRR = 2.29, 95 % CI 1.05, 5.00, P = 0.038). Thus, our study suggests that in both men and women, a higher density of body hair may be associated with increased BCC and SCC risk.

  3. Asymmetric migration of human keratinocytes under mechanical stretch and cocultured fibroblasts in a wound repair model.

    Directory of Open Access Journals (Sweden)

    Dongyuan Lü

    Full Text Available Keratinocyte migration during re-epithelization is crucial in wound healing under biochemical and biomechanical microenvironment. However, little is known about the underlying mechanisms whereby mechanical tension and cocultured fibroblasts or keratinocytes modulate the migration of keratinocytes or fibroblasts. Here we applied a tensile device together with a modified transwell assay to determine the lateral and transmembrane migration dynamics of human HaCaT keratinocytes or HF fibroblasts. A novel pattern of asymmetric migration was observed for keratinocytes when they were cocultured with non-contact fibroblasts, i.e., the accumulative distance of HaCaT cells was significantly higher when moving away from HF cells or migrating from down to up cross the membrane than that when moving close to HF cells or when migrating from up to down, whereas HF migration was symmetric. This asymmetric migration was mainly regulated by EGF derived from fibroblasts, but not transforming growth factor α or β1 production. Mechanical stretch subjected to fibroblasts fostered keratinocyte asymmetric migration by increasing EGF secretion, while no role of mechanical stretch was found for EGF secretion by keratinocytes. These results provided a new insight into understanding the regulating mechanisms of two- or three-dimensional migration of keratinocytes or fibroblasts along or across dermis and epidermis under biomechanical microenvironment.

  4. Growth regulation of primary human keratinocytes by prostaglandin E receptor EP2 and EP3 subtypes.

    Science.gov (United States)

    Konger, R L; Malaviya, R; Pentland, A P

    1998-02-04

    We examined the contribution of specific EP receptors in regulating cell growth. By RT-PCR and northern hybridization, adult human keratinocytes express mRNA for three PGE2 receptor subtypes associated with cAMP signaling (EP2, EP3, and small amounts of EP4). In actively growing, non-confluent primary keratinocyte cultures, the EP2 and EP4 selective agonists, 11-deoxy PGE1 and 1-OH PGE1, caused complete reversal of indomethacin-induced growth inhibition. The EP3/EP2 agonist (misoprostol), and the EP1/EP2 agonist (17-phenyl trinor PGE2), showed less activity. Similar results were obtained with agonist-induced cAMP formation. The ability of exogenous dibutyryl cAMP to completely reverse indomethacin-induced growth inhibition support the conclusion that growth stimulation occurs via an EP2 and/or EP4 receptor-adenylyl cyclase coupled response. In contrast, activation of EP3 receptors by sulprostone, which is virtually devoid of agonist activity at EP2 or EP4 receptors, inhibited bromodeoxyuridine uptake in indomethacin-treated cells up to 30%. Although human EP3 receptor variants have been shown in other cell types to markedly inhibit cAMP formation via a pertussis toxin sensitive mechanisms, EP3 receptor activation and presumably growth inhibition was independent of adenylyl cyclase, suggesting activation of other signaling pathways.

  5. Human epidermal keratinocyte cell response on integrin-specific artificial extracellular matrix proteins.

    Science.gov (United States)

    Tjin, Monica Suryana; Chua, Alvin Wen Choong; Ma, Dong Rui; Lee, Seng Teik; Fong, Eileen

    2014-08-01

    Cell-matrix interactions play critical roles in regulating cellular behavior in wound repair and regeneration of the human skin. In particular, human skin keratinocytes express several key integrins such as alpha5beta1, alpha3beta1, and alpha2beta1 for binding to the extracellular matrix (ECM) present in the basement membrane in uninjured skin. To mimic these key integrin-ECM interactions, artificial ECM (aECM) proteins containing functional domains derived from laminin 5, type IV collagen, fibronectin, and elastin are prepared. Human skin keratinocyte cell responses on the aECM proteins are specific to the cell-binding domain present in each construct. Keratinocyte attachment to the aECM protein substrates is also mediated by specific integrin-material interactions. In addition, the aECM proteins are able to support the proliferation of keratinocyte stem cells, demonstrating their promise for use in skin tissue engineering.

  6. Study of HLA-DR synthesis in cultured human keratinocytes.

    Science.gov (United States)

    Wikner, N E; Huff, J C; Norris, D A; Boyce, S T; Cary, M; Kissinger, M; Weston, W L

    1986-11-01

    Within the normal human epidermis only Langerhans and indeterminate cells express HLA-DR. Human keratinocytes (HK), however, may also express HLA-DR in certain disease states characterized by mononuclear cell infiltrates. Previous studies have shown that HK synthesize HLA-DR in response to stimulation by interferon gamma (INF-gamma). The purposes of this study were to define conditions under which cultured HK might express HLA-DR and to compare the HLA-DR synthesis of HK with that of monocytes. HLA-DR expression by HK as determined by indirect immunofluorescence of HK cultures was absent under standard low calcium conditions and remained absent with the addition of calcium, serum, mitogens, and supernatants from Pam-212 cells containing epidermal thymocyte-activating factor. HLA-DR expression in HK was induced by cocultivation with concanavalin A-stimulated peripheral blood mononuclear cells (PBMC), but not unstimulated PBMC. This effect was time-dependent and directly related to the number of PBMC. HLA-DR expression was also induced in a time- and dose-dependent manner by addition of supernatant from stimulated PBMC (SS) or by addition of recombinant INF-gamma but not by addition of interleukin (IL)-1 or IL-2. Induction by either SS or INF-gamma was blocked by an antiserum to INF-gamma. As determined by a semiquantitative immunoprecipitation technique, HLA-DR synthesis by HK was directly related to INF-gamma concentration. The pattern of HLA-DR peptides produced by HK was similar to that of monocytes, but the relative quantity synthesized was far less than that of monocytes.

  7. Effects of titanium dioxide nanoparticles on human keratinocytes.

    Science.gov (United States)

    Wright, Clayton; Iyer, Anand Krishnan V; Wang, Liying; Wu, Nianqiang; Yakisich, Juan S; Rojanasakul, Yon; Azad, Neelam

    2017-01-01

    Titanium dioxide (TiO2) is a ubiquitous whitening compound widely used in topical products such as sunscreens, lotions and facial creams. The damaging health effects of TiO2 inhalation has been widely studied in rats, mice and humans showing oxidative stress increase, DNA damage, cell death and inflammatory gene upregulation in lung and throat cells; however, the effects on skin cells from long-term topical use of various products remain largely unknown. In this study, we assessed the effect of specific TiO2 nanoparticles (H2TiO7) on a human keratinocyte cell line (HaCaT). We performed a comparative analysis using three TiO2 particles varying in size (Fine, Ultrafine and H2TiO7) and analyzed their effects on HaCaTs. There is a clear dose-dependent increase in superoxide production, caspase 8 and 9 activity, and apoptosis in HaCaTs after treatment with all three forms of TiO2; however, there is no consistent effect on cell viability and proliferation with either of these TiO2 particles. While there is data suggesting UV exposure can enhance the carcinogenic effects of TiO2, we did not observe any significant effect of UV-C exposure combined with TiO2 treatment on HaCaTs. Furthermore, TiO2-treated cells showed minimal effects on VEGF upregulation and Wnt signaling pathway thereby showing no potential effect on angiogenesis and malignant transformation. Overall, we report here an increase in apoptosis, which may be caspase 8/Fas-dependent, and that the H2TiO7 nanoparticles, despite their smaller particle size, had no significant enhanced effect on HaCaT cells as compared to Fine and Ultrafine forms of TiO2.

  8. Remifentanil protects human keratinocytes against hypoxia-reoxygenation injury through activation of autophagy.

    Directory of Open Access Journals (Sweden)

    Jae-Young Kwon

    Full Text Available The proliferation, differentiation, and migration of keratinocytes are essential in the early stages of wound healing. Hypoxia-Reoxygenation (H/R injury to keratinocytes can occur in various stressful environments such as surgery, trauma, and various forms of ulcers. The effects of remifentanil on human keratinocytes under hypoxia-reoxygenation have not been fully studied. Therefore, we investigated the effects of remifentanil on the proliferation, apoptosis, and autophagic activation of human keratinocytes during hypoxic-reoxygenation. Human keratinocytes were cultured under 1% oxygen tension for 24 h. The cells were then treated with various concentrations of remifentanil (0.01, 0.1, 0.5, and 1 ng/mL for 2 h. Thereafter, the cells were reoxygenated for 12 h at 37°C. We measured cell viability via MTT assay. Using quantitative real-time PCR and western blot analysis, we measured the expression levels of proteins associated with apoptosis and autophagy. Quantification of apoptotic cells was performed using flow cytometer analysis and autophagic vacuoles were observed under a fluorescence microscope. Remifentanil treatment brought about an increase in the proliferation of human keratinocytes damaged by hypoxia-reoxygenation and decreased the apoptotic cell death, enhancing autophagic activity. However, the autophagy pathway inhibitor 3-MA inhibited the protective effect of remifentanil in hypoxia-reoxygenation injury. In conclusion, the current study demonstrated that remifentanil treatment stimulated autophagy and reduced apoptotic cell death in a hypoxia-reoxygenation model of human keratinocytes. Our results provide additional insights into the relationship between apoptosis and autophagy.

  9. Cytokine secretion profiles of human keratinocytes during Trichophyton tonsurans and Arthroderma benhamiae infections.

    Science.gov (United States)

    Shiraki, Yumi; Ishibashi, Yoshio; Hiruma, Masataro; Nishikawa, Akemi; Ikeda, Shigaku

    2006-09-01

    Dermatophytes cause intractable superficial infections in humans. Arthroderma benhamiae, a zoophilic dermatophyte, triggers severe inflammatory responses in humans, while Trichophyton tonsurans, an anthropophilic dermatophyte, triggers minimal ones. Cytokines and other factors derived from keratinocytes play important roles in inflammatory and immune responses in the skin. The authors performed an in vitro investigation to determine the human keratinocyte cytokine profiles during dermatophyte infection. The human keratinocyte cell line PHK16-0b was infected with A. benhamiae or T. tonsurans for 24 h, and the cytokines secreted were analysed using a human cytokine antibody array. Marked differences were observed in the cytokine profiles of the cells infected with the two dermatophytes. A. benhamiae infection resulted in the secretion of a broad spectrum of cytokines, including proinflammatory cytokines, chemokines, and immunomodulatory cytokines. In contrast, T. tonsurans-infected keratinocytes secreted only limited cytokines, including eotaxin-2, interleukin (IL)-8 and IL-16. cDNA microarray analysis confirmed that A. benhamiae infection upregulated genes encoding IL-1beta, IL-2, IL-4, IL-6, IL-10, IL-13, IL-15, IL-16, IL-17 and interferon (IFN)-gamma, while T. tonsurans infection upregulated only a few genes, such as those encoding IL-1beta and IL-16. RT-PCR demonstrated that infection by both dermatophytes enhanced IL-8 mRNA expression in keratinocytes. These results suggest that A. benhamiae-induced secretion of several cytokines from keratinocytes may be involved in a severe inflammatory response, and that the limited cytokine secretion from keratinocytes in response to T. tonsurans infection may result in a minimal inflammatory response in the skin. These cytokine profiles may aid in proving the clinical features of dermatophytosis.

  10. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  11. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Ramos-Jerz, Maria Del R; Villanueva, Socorro; Jerz, Gerold; Winterhalter, Peter; Deters, Alexandra M

    2013-01-01

    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  12. Human Keratinocyte Growth and Differentiation on Acellular Porcine Dermal Matrix in relation to Wound Healing Potential

    Directory of Open Access Journals (Sweden)

    Robert Zajicek

    2012-01-01

    Full Text Available A number of implantable biomaterials derived from animal tissues are now used in modern surgery. Xe-Derma is a dry, sterile, acellular porcine dermis. It has a remarkable healing effect on burns and other wounds. Our hypothesis was that the natural biological structure of Xe-Derma plays an important role in keratinocyte proliferation and formation of epidermal architecture in vitro as well as in vivo. The bioactivity of Xe-Derma was studied by a cell culture assay. We analyzed growth and differentiation of human keratinocytes cultured in vitro on Xe-Derma, and we compared the results with formation of neoepidermis in the deep dermal wounds treated with Xe-Derma. Keratinocytes cultured on Xe-Derma submerged in the culture medium achieved confluence in 7–10 days. After lifting the cultures to the air-liquid interface, the keratinocytes were stratified and differentiated within one week, forming an epidermis with basal, spinous, granular, and stratum corneum layers. Immunohistochemical detection of high-molecular weight cytokeratins (HMW CKs, CD29, p63, and involucrin confirmed the similarity of organization and differentiation of the cultured epidermal cells to the normal epidermis. The results suggest that the firm natural structure of Xe-Derma stimulates proliferation and differentiation of human primary keratinocytes and by this way improves wound healing.

  13. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts

    Directory of Open Access Journals (Sweden)

    Maria del R. Ramos-Jerz

    2013-01-01

    Full Text Available Methanolic avocado (Persea americana Mill., Lauraceae seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK and normal human dermal fibroblasts (NHDF. The methanol-water partition (M from avocado seeds and HSCCC fraction 3 (M.3 were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  14. Isorhamnetin Protects Human Keratinocytes against Ultraviolet B-Induced Cell Damage

    Science.gov (United States)

    Han, Xia; Piao, Mei Jing; Kim, Ki Cheon; Madduma Hewage, Susara Ruwan Kumara; Yoo, Eun Sook; Koh, Young Sang; Kang, Hee Kyoung; Shin, Jennifer H; Park, Yeunsoo; Yoo, Suk Jae; Chae, Sungwook; Hyun, Jin Won

    2015-01-01

    Isorhamnetin (3-methylquercetin) is a flavonoid derived from the fruits of certain medicinal plants. This study investigated the photoprotective properties of isorhamnetin against cell damage and apoptosis resulting from excessive ultraviolet (UV) B exposure in human HaCaT keratinocytes. Isorhamnetin eliminated UVB-induced intracellular reactive oxygen species (ROS) and attenuated the oxidative modification of DNA, lipids, and proteins in response to UVB radiation. Moreover, isorhamnetin repressed UVB-facilitated programmed cell death in the keratinocytes, as evidenced by a reduction in apoptotic body formation, and nuclear fragmentation. Additionally, isorhamnetin suppressed the ability of UVB light to trigger mitochondrial dysfunction. Taken together, these results indicate that isorhamnetin has the potential to protect human keratinocytes against UVB-induced cell damage and death. PMID:26157553

  15. Isorhamnetin Protects Human Keratinocytes against Ultraviolet B-Induced Cell Damage.

    Science.gov (United States)

    Han, Xia; Piao, Mei Jing; Kim, Ki Cheon; Madduma Hewage, Susara Ruwan Kumara; Yoo, Eun Sook; Koh, Young Sang; Kang, Hee Kyoung; Shin, Jennifer H; Park, Yeunsoo; Yoo, Suk Jae; Chae, Sungwook; Hyun, Jin Won

    2015-07-01

    Isorhamnetin (3-methylquercetin) is a flavonoid derived from the fruits of certain medicinal plants. This study investigated the photoprotective properties of isorhamnetin against cell damage and apoptosis resulting from excessive ultraviolet (UV) B exposure in human HaCaT keratinocytes. Isorhamnetin eliminated UVB-induced intracellular reactive oxygen species (ROS) and attenuated the oxidative modification of DNA, lipids, and proteins in response to UVB radiation. Moreover, isorhamnetin repressed UVB-facilitated programmed cell death in the keratinocytes, as evidenced by a reduction in apoptotic body formation, and nuclear fragmentation. Additionally, isorhamnetin suppressed the ability of UVB light to trigger mitochondrial dysfunction. Taken together, these results indicate that isorhamnetin has the potential to protect human keratinocytes against UVB-induced cell damage and death.

  16. Establishment of a novel method for primary culture of normal human cervical keratinocytes

    Institute of Scientific and Technical Information of China (English)

    LIU Yu-zhen; L(U) Xiu-ping; PAN Zi-xuan; ZHANG Wei; CHEN Zhao-ri; WANG Hui; LIU Hua

    2013-01-01

    Background Cervical keratinocytes are recovered at a low numbers and frequently associated with contaminating human fibroblasts which rapidly overgrow the epithelial cells in culture with medium supplemented with 10% fetal bovine serum (FBS).However,it is difficult to initiate keratinocyte cultures with serum-free keratinocyte growth medium alone because cell attachment can be poor.Therefore,the culture of these cells is extremely difficult.In this study,we described a modified culture medium and coated culture plastics for growing normal human cervical epithelial cells in vitro.Methods Normal cervical epithelial tissue pieces were obtained and digested with type Ⅰ collagenase to dissociate the cells and a single cell suspension produced.The cells were cultured on plastic tissue culture substrate alone or substrate coated with collagen type Ⅰ from rat tail,with modified keratinocyte serum-free medium (K-SFM) supplemented with 5% FBS.After attachment,the medium were replaced with K-SFM without FBS.The expression of basal keratins of the ectocervical epithelium,K5,K14 and K19 were assayed by immunofiuorescence with monoclonal antibodies to identify the cell purity.Results Our results indicate that cells attached to the culture plastic more quickly in K-SFM supplemented with 5%FBS than in K-SFM alone,as well as to tissue culture plastic coated with collagen type Ⅰ than plastic alone.The modified medium composed of K-SFM and 5% FBS combined with a specific tissue culture plastic coated with collagen type Ⅰ from rat tail was the best method for culture of normal cervical epithelial cells.K5,K14 and K19 were assayed and keratinocyte purity was nearly 100%.Conclusion A novel,simple and effective method can be used to rapidly obtain highly purified keratinocytes from normal human cervical epithelium.

  17. Paracoccidioides brasiliensis interacts with dermal dendritic cells and keratinocytes in human skin and oral mucosa lesions.

    Science.gov (United States)

    Silva, Wellington Luiz Ferreira da; Pagliari, Carla; Duarte, Maria Irma Seixas; Sotto, Mirian N

    2016-05-01

    Paracoccidioidomycosis (PCM) is a systemic disease caused by the fungus Paracoccidioides brasiliensis and Paracoccidioides lutzii. In PCM the skin and oral mucosa are often affected. Dendritic cells and keratinocytes of the integument play a role in innate and adaptive immune response against pathogens, due to their function as antigen presenting cells. Aiming to verify the interaction of P. brasiliensis with these cell populations, we studied 52 skin and 47 oral mucosa samples taken from patients with proven diagnosis of PCM. The biopsies were subjected to immunohistochemical and/or immunofluorescence staining with anti-factor XIIIa (marker of dermal dendrocytes), anti-CD207 (marker of mature Langerhans cells), anti-pan cytokeratins (AE1-AE3) and anti-P. brasiliensis antibodies. Analyses with confocal laser microscopy were also performed for better visualization of the interaction between keratinocytes and the fungi. In sum, 42% of oral mucosa samples displayed yeast forms in Factor XIIIa dermal dendrocytes cytoplasm. Langerhans cells in skin and oral mucosa samples did not show yeast cells in their cytoplasm. In sum, 54% of skin and 60% of mucosal samples displayed yeast cells in the cytoplasm of keratinocytes. The parasitism of keratinocytes may represent a possible mechanism of evasion of the fungus to local immune mechanisms. Factor XIIIa dendrocytes and keratinocytes may be acting as antigen-presenting cells to fulfill the probably impaired function of Langerhans cells in skin and oral mucosa of human PCM.

  18. Improvement of human keratinocyte migration by a redox active bioelectric dressing.

    Directory of Open Access Journals (Sweden)

    Jaideep Banerjee

    Full Text Available Exogenous application of an electric field can direct cell migration and improve wound healing; however clinical application of the therapy remains elusive due to lack of a suitable device and hence, limitations in understanding the molecular mechanisms. Here we report on a novel FDA approved redox-active Ag/Zn bioelectric dressing (BED which generates electric fields. To develop a mechanistic understanding of how the BED may potentially influence wound re-epithelialization, we direct emphasis on understanding the influence of BED on human keratinocyte cell migration. Mapping of the electrical field generated by BED led to the observation that BED increases keratinocyte migration by three mechanisms: (i generating hydrogen peroxide, known to be a potent driver of redox signaling, (ii phosphorylation of redox-sensitive IGF1R directly implicated in cell migration, and (iii reduction of protein thiols and increase in integrinαv expression, both of which are known to be drivers of cell migration. BED also increased keratinocyte mitochondrial membrane potential consistent with its ability to fuel an energy demanding migration process. Electric fields generated by a Ag/Zn BED can cross-talk with keratinocytes via redox-dependent processes improving keratinocyte migration, a critical event in wound re-epithelialization.

  19. Improvement of human keratinocyte migration by a redox active bioelectric dressing.

    Science.gov (United States)

    Banerjee, Jaideep; Das Ghatak, Piya; Roy, Sashwati; Khanna, Savita; Sequin, Emily K; Bellman, Karen; Dickinson, Bryan C; Suri, Prerna; Subramaniam, Vish V; Chang, Christopher J; Sen, Chandan K

    2014-01-01

    Exogenous application of an electric field can direct cell migration and improve wound healing; however clinical application of the therapy remains elusive due to lack of a suitable device and hence, limitations in understanding the molecular mechanisms. Here we report on a novel FDA approved redox-active Ag/Zn bioelectric dressing (BED) which generates electric fields. To develop a mechanistic understanding of how the BED may potentially influence wound re-epithelialization, we direct emphasis on understanding the influence of BED on human keratinocyte cell migration. Mapping of the electrical field generated by BED led to the observation that BED increases keratinocyte migration by three mechanisms: (i) generating hydrogen peroxide, known to be a potent driver of redox signaling, (ii) phosphorylation of redox-sensitive IGF1R directly implicated in cell migration, and (iii) reduction of protein thiols and increase in integrinαv expression, both of which are known to be drivers of cell migration. BED also increased keratinocyte mitochondrial membrane potential consistent with its ability to fuel an energy demanding migration process. Electric fields generated by a Ag/Zn BED can cross-talk with keratinocytes via redox-dependent processes improving keratinocyte migration, a critical event in wound re-epithelialization.

  20. Generation of Integration-free Human Induced Pluripotent Stem Cells Using Hair-derived Keratinocytes.

    Science.gov (United States)

    Hung, Sandy S C; Pébay, Alice; Wong, Raymond C B

    2015-08-20

    Recent advances in reprogramming allow us to turn somatic cells into human induced pluripotent stem cells (hiPSCs). Disease modeling using patient-specific hiPSCs allows the study of the underlying mechanism for pathogenesis, also providing a platform for the development of in vitro drug screening and gene therapy to improve treatment options. The promising potential of hiPSCs for regenerative medicine is also evident from the increasing number of publications (>7000) on iPSCs in recent years. Various cell types from distinct lineages have been successfully used for hiPSC generation, including skin fibroblasts, hematopoietic cells and epidermal keratinocytes. While skin biopsies and blood collection are routinely performed in many labs as a source of somatic cells for the generation of hiPSCs, the collection and subsequent derivation of hair keratinocytes are less commonly used. Hair-derived keratinocytes represent a non-invasive approach to obtain cell samples from patients. Here we outline a simple non-invasive method for the derivation of keratinocytes from plucked hair. We also provide instructions for maintenance of keratinocytes and subsequent reprogramming to generate integration-free hiPSC using episomal vectors.

  1. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes.

    Science.gov (United States)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-04-01

    The effects and the underlying mechanisms of hydrogen sulfide (H2S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H2S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H2S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H2S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation.

  2. KGF-transfected cells can stimulate growth and proliferation of human cultured keratinocytes in vitro

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    Objective: To establish two stably KGF-transfected, immortalized cell lines. Methods: HaCaT-keratinocytes and KMST-6-fibroblasts were transfected by liposome mediated gene transfer. Transfection effectivity, gene integration and configuration of the transgenic protein were investigated by ELISA, DANN-PCR and β-Gal-staining. Results: Most effective GF producing clones were tested by a colorimetric XTT-test. Conclusion: This is a significant acceleration of cell proliferation and mitosis of human keratinocytes in an Air Liquid Interface (ALI) test system.

  3. Low electromagnetic field (50 Hz) induces differentiation on primary human oral keratinocytes (HOK).

    Science.gov (United States)

    Manni, Vanessa; Lisi, Antonella; Rieti, Sabrina; Serafino, Annalucia; Ledda, Mario; Giuliani, Livio; Sacco, Donatella; D'Emilia, Enrico; Grimaldi, Settimio

    2004-02-01

    This work concerns the effect of low frequency electromagnetic fields (ELF) on biochemical properties of human oral keratinocytes (HOK). Cells exposed to a 2 mT, 50 Hz, magnetic field, showed by scanning electron microscopy (SEM) modification in shape and morphology; these modifications were also associated with different actin distribution, revealed by phalloidin fluorescence analysis. Moreover, exposed cells had a smaller clonogenic capacity, and decreased cellular growth. Indirect immunofluorescence with fluorescent antibodies against involucrin and beta-catenin, both differentiation and adhesion markers, revealed an increase in involucrin and beta-catenin expression. The advance in differentiation was confirmed by a decrease of expression of epidermal growth factor (EGF) receptor in exposed cells, supporting the idea that exposure to electromagnetic field carries keratinocytes to higher differentiation level. These observations support the hypothesis that 50 Hz electromagnetic fields may modify cell morphology and interfere in differentiation and cellular adhesion of normal keratinocytes.

  4. Development of a full-thickness human gingiva equivalent constructed from immortalized keratinocytes and fibroblasts

    NARCIS (Netherlands)

    J.K. Buskermolen; C.M.A. Reijnders; S.W. Spiekstra; T. Steinberg; C.J. Kleverlaan; A.J. Feilzer; A.D. Bakker; S. Gibbs

    2016-01-01

    Organotypic models make it possible to investigate the unique properties of oral mucosa in vitro. For gingiva, the use of human primary keratinocytes (KC) and fibroblasts (Fib) is limited due to the availability and size of donor biopsies. The use of physiologically relevant immortalized cell lines

  5. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  6. Investigation on etretin effects on expression of Fas/FasL ligand and apoptosis in cultured human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Ping Liu; Shunsheng Tan; Yanping Xi; Zhenping Cao

    2005-01-01

    Objective: To further illuminate a possibme mechanism of Fas/FasL in the treatment of psoriasis, the expression of it and apoptosis of KC were investigated. Methods: With cell culture,immunocytochemistry, the expression of Fas/FasL protein after the treatment with etretin was observed in cultured human normal keratinocytes. Then, the state of apoptosis in cultured keratinocyte after stimuwasn't involved in apoptosis in cultured normol human keratinocytes. But during limited period, the apoptosis of KC could be induced by etretin, thus it can antagonize benign proliferate of keratinocytes. Our data showed up-regulation of the expression of Fas/FasL and apoptosis in cultured human keratinocytes stimulated by etretin, and its function may be involved in the therapeutic machanism of psoriasis.

  7. Transcriptional profiling of ectoderm specification to keratinocyte fate in human embryonic stem cells.

    Science.gov (United States)

    Tadeu, Ana Mafalda Baptista; Lin, Samantha; Hou, Lin; Chung, Lisa; Zhong, Mei; Zhao, Hongyu; Horsley, Valerie

    2015-01-01

    In recent years, several studies have shed light into the processes that regulate epidermal specification and homeostasis. We previously showed that a broad-spectrum γ-secretase inhibitor DAPT promoted early keratinocyte specification in human embryonic stem cells triggered to undergo ectoderm specification. Here, we show that DAPT accelerates human embryonic stem cell differentiation and induces expression of the ectoderm protein AP2. Furthermore, we utilize RNA sequencing to identify several candidate regulators of ectoderm specification including those involved in epithelial and epidermal development in human embryonic stem cells. Genes associated with transcriptional regulation and growth factor activity are significantly enriched upon DAPT treatment during specification of human embryonic stem cells to the ectoderm lineage. The human ectoderm cell signature identified in this study contains several genes expressed in ectodermal and epithelial tissues. Importantly, these genes are also associated with skin disorders and ectodermal defects, providing a platform for understanding the biology of human epidermal keratinocyte development under diseased and homeostatic conditions.

  8. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.

    Science.gov (United States)

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD.

  9. Candida albicans phospholipomannan triggers inflammatory responses of human keratinocytes through Toll-like receptor 2.

    Science.gov (United States)

    Li, Min; Chen, Qing; Shen, Yongnian; Liu, Weida

    2009-07-01

    The Toll-like receptors (TLRs) play an important role in the recognition of Candida albicans components and activation of innate immunity. Phospholipomannan (PLM), a glycolipid, is expressed at the surface of C. albicans cell wall, which acts as a member of the pathogen-associated molecular patterns family. In this study, we sought to clarify whether C. albicans-native PLM could induce an inflammation response in human keratinocytes and to determine the underlying mechanisms. Exposure of cultured human primary keratinocytes to PLM led to the increased gene expression and secretion of proinflammatory cytokines (IL-6) and chemokines (IL-8). PLM hydrolysed with beta-d-mannoside mannohydrolase failed to induce gene expression and secretion of IL-6 and IL-8. PLM up-regulated the mRNA and protein levels of TLR2, whereas the mRNA level of TLR4 was not altered. Keratinocytes challenged with PLM resulted in the activation of NF-kappaB and mitogen-activated protein kinase (MAPKs) including p38. Anti-TLR2 neutralizing antibody, NFkappaB and p38MAPK inhibitors blocked the PLM-induced secretion of IL-6, IL-8 in keratinocytes, but no such effect was observed in pretreatment with anti-TLR4-neutralizing antibody and lipopolysaccharide inhibitor (polymyxin B). These data suggest C. albicans-native PLM may contribute to the inflammatory responses of cutaneous candidiasis in the TLR2-NF-kappaB and p38MAPK signalling pathway dependent manner.

  10. Enhancing effect of tazarotene on the HLA-DR expression of cultured human keratinocytes induced by interferon-gamma

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian-gan; TAN Sheng-shun

    2005-01-01

    Objective: To investigate the effect of tazarotene on the expression of HLA-DR induced by IFN-γ. Methods: (1) Keratinocytes from normal human skin were cultured in vitro;(2) Tazarotene, IFN-γ and the combination of the two compounds were incubated with the keratinocytes in medium, respectively. The expression of HLA-DR in keratinocytes was determined using immunocytochemistry techniques at 24h after incubation. Results: (1) There was rare expression of HLA-DR in normal human keratinocytes; (2) 10-6mol/L tazarotene failed to induce the expression of HLA-DR in keratinocytes at 24h after incubation; (3) 500 U/ml IFN-γ obviously induced the HLA-DR expression in keratinocytes at 24h after treatment; (4) After 24h, 10-7-10-5 mol/L tazarotene had a significantly enhancing effect on the expression of HLA-DR induced by IFN-γ (P<0.005). Conclusion: Tazarotene up-regulates the expression of HLA-DR in keratinocytes cultured in vitro when combined with IFN-γ . Therefore, the reduction of HLA-DR positive keratinocytes in psoriatic lesions may be attributed to not direct interaction of tazarotene in combination with IFN-γ but other pathways.

  11. Treatment of Hypertrophic Scar in Human with Autologous Transplantation of Cultured Keratinocytes and Fibroblasts along with Fibrin Glue

    Directory of Open Access Journals (Sweden)

    Ehsan Taghiabadi

    2015-04-01

    Full Text Available Objective: Hypertrophic scar involves excessive amounts of collagen in dermal layer and may be painful. Nowadays, we can’t be sure about effectiveness of procedure for hypertrophic scar management. The application of stem cells with natural scaffold has been the best option for treatment of burn wounds and skin defect, in recent decades. Fibrin glue (FG was among the first of the natural biomaterials applied to enhance skin deformity in burn patients. This study aimed to identify an efficient, minimally invasive and economical transplantation procedure using novel FG from human cord blood for treatment of hypertrophic scar and regulation collagen synthesis. Materials and Methods: In this case series study, eight patients were selected with hypertrophic scar due to full-thickness burns. Human keratinocytes and fibroblasts derived from adult skin donors were isolated and cultured. They were tested for the expression of cytokeratin 14 and vimentin using immunocytochemistry. FG was prepared from pooled cord blood. Hypertrophic scars were extensively excised then grafted by simply placing the sheet of FG containing autologous fibroblast and keratinocytes. Histological analyses were performed using Hematoxylin and eosin (H&E and Masson’s Trichrome (MT staining of the biopsies after 8 weeks. Results: Cultured keratinocytes showed a high level of cytokeratin 14 expression and also fibroblasts showed a high level of vimentin. Histological analyses of skin biopsies after 8 weeks of transplantation revealed re-epithelialization with reduction of hypertrophic scars in 2 patients. Conclusion: These results suggest may be the use of FG from cord blood, which is not more efficient than previous biological transporters and increasing hypertrophic scar relapse, but could lead to decrease pain rate.

  12. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation.

  13. Model of human epidermis reconstructed in vitro with keratinocytes and melanocytes on dead de-epidermized human dermis

    Directory of Open Access Journals (Sweden)

    Jussara Rehder

    Full Text Available CONTEXT: Recent progress in the field of epithelial culture techniques has allowed the development of culture systems in which the reconstructed epidermis presents characteristics of morphological differentiation similar to those seen in vivo. Human epidermis reconstructed in vitro may be used as the best alternative for the in vitro testing of the toxicology and efficiency of products for topical use, as well as in the treatment of skin burns and chronic skin ulcers. OBJECTIVE: To demonstrate a method for obtaining human epidermis reconstructed in vitro, using keratinocytes and melanocytes cultivated on dead de-epidermized human dermis. TYPE OF STUDY: Experimental/laboratory. SETTING: Skin Cell Culture Laboratory of the Faculdade de Ciências Médicas, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil. PROCEDURE: Human keratinocytes and melanocytes cultured in vitro were grown on a biological matrix (dead de-epidermized human dermis and the system was kept at an air-liquid interface, in a suitable culturing medium, until a stratified human epidermis was formed, maintaining the histological characteristics of the epidermis in vivo. RESULTS: It was histologically demonstrated that it is possible to reproduce a differentiated epidermis through keratinocytes and melanocytes cultured on dead de-epidermized human dermis, thus obtaining a correctly positioned human epidermis reconstructed in vitro with functional keratinocytes and melanocytes that is similar to in vivo epidermis. CONCLUSIONS: It is possible to obtain a completely differentiated human epidermis reconstructed in vitro from keratinocyte and melanocyte cultures on a dead de-epidermized human dermis.

  14. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  15. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  16. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  17. Induced multipotency in adult keratinocytes through down-regulation of ΔNp63 or DGCR8

    Science.gov (United States)

    Chakravarti, Deepavali; Su, Xiaohua; Cho, Min Soon; Bui, Ngoc Hoang Bao; Coarfa, Cristian; Venkatanarayan, Avinashnarayan; Benham, Ashley L.; Flores González, Ramón E.; Alana, Jennifer; Xiao, Weimin; Leung, Marco L.; Vin, Harina; Chan, Io Long; Aquino, Arianexys; Müller, Nicole; Wang, Hongran; Cooney, Austin J.; Parker-Thornburg, Jan; Tsai, Kenneth Y.; Gunaratne, Preethi H.; Flores, Elsa R.

    2014-01-01

    The roles of microRNAs (miRNAs) and the miRNA processing machinery in the regulation of stem cell biology are not well understood. Here, we show that the p53 family member and p63 isoform, ΔNp63, is a transcriptional activator of a cofactor critical for miRNA processing (DGCR8). This regulation gives rise to a unique miRNA signature resulting in reprogramming cells to multipotency. Strikingly, ΔNp63−/− epidermal cells display profound defects in terminal differentiation and express a subset of markers and miRNAs present in embryonic stem cells and fibroblasts induced to pluripotency using Yamanaka factors. Moreover, ΔNp63−/− epidermal cells transduced with an inducible DGCR8 plasmid can differentiate into multiple cell fates in vitro and in vivo. We found that human primary keratinocytes depleted of ΔNp63 or DGCR8 can be reprogrammed in 6 d and express a unique miRNA and gene expression signature that is similar but not identical to human induced pluripotent stem cells. Our data reveal a role for ΔNp63 in the transcriptional regulation of DGCR8 to reprogram adult somatic cells into multipotent stem cells. PMID:24449888

  18. Human papillomavirus (HPV upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response.

    Directory of Open Access Journals (Sweden)

    Rezaul Karim

    Full Text Available Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity for sustained periods of time. To understand the mechanisms underlying hrHPV's capacity to evade immunity, we studied PRR signaling in non, newly, and persistently hrHPV-infected keratinocytes. We found that active infection with hrHPV hampered the relay of signals downstream of the PRRs to the nucleus, thereby affecting the production of type-I interferon and pro-inflammatory cytokines and chemokines. This suppression was shown to depend on hrHPV-induced expression of the cellular protein ubiquitin carboxyl-terminal hydrolase L1 (UCHL1 in keratinocytes. UCHL1 accomplished this by inhibiting tumor necrosis factor receptor-associated factor 3 (TRAF3 K63 poly-ubiquitination which lead to lower levels of TRAF3 bound to TANK-binding kinase 1 and a reduced phosphorylation of interferon regulatory factor 3. Furthermore, UCHL1 mediated the degradation of the NF-kappa-B essential modulator with as result the suppression of p65 phosphorylation and canonical NF-κB signaling. We conclude that hrHPV exploits the cellular protein UCHL1 to evade host innate immunity by suppressing PRR-induced keratinocyte-mediated production of interferons, cytokines and chemokines, which normally results in the attraction and activation of an adaptive immune response. This identifies UCHL1 as a negative regulator of PRR-induced immune responses and consequently its virus-increased expression as a strategy for hrHPV to persist.

  19. NOVEL NON-CALCEMIC SECOSTEROIDS THAT ARE PRODUCED BY HUMAN EPIDERMAL KERATINOCYTES PROTECT AGAINST SOLAR RADIATION

    Science.gov (United States)

    Slominski, Andrzej T.; Janjetovic, Zorica; Kim, Tae-Kang; Wasilewski, Piotr; Rosas, Sofia; Hanna, Sherie; Sayre, Robert M.; Dowdy, John C.; Li, Wei; Tuckey, Robert C.

    2015-01-01

    CYP11A1 hydroxylates the side chain of vitamin D3 (D3) in a sequential fashion [D3→20S(OH)D3→20,23(OH)2D3→ 17,20,23(OH)3D3], in an alternative to the classical pathway of activation [D3→25(OH)D3→1,25(OH)2D3]. The products/intermediates of the pathway can be further modified by the action of CYP27B1. The CYP11A1-derived products are biologically active with functions determined by the lineage of the target cells. This pathway can operate in epidermal keratinocytes. To further define the role of these novel secosteroids we tested them for protective effects against UVB-induced damage in human epidermal keratinocytes, melanocytes and HaCaT keratinocytes, cultured in vitro. The secosteroids attenuated ROS, H2O2 and NO production by UVB-irradiated keratinocytes and melanocytes, with an efficacy similar to 1,25(OH)2D3, while 25(OH)D3 had lower efficacy. These attenuations were also seen to some extent for the 20(OH)D3 precursor, 20S-hydroxy-7-dehydrocholesterol. These effects were accompanied by upregulation of genes encoding enzymes responsible for defence against oxidative stress. Using immunofluorescent staining we observed that the secosteroids reduced the generation cyclobutane pyrimidine dimers in response to UVB and enhanced expression of p53 phosphorylated at Ser-15, but not at Ser-46. Additional evidence for protection against DNA damage in cells exposed to UVB and treated with secosteroids was provided by the Comet assay where DNA fragmentation was markedly reduced by 20(OH)D3 and 20,23(OH)2D3. In conclusion, novel secosteroids that can be produced by the action of CYP11A1 in epidermal keratinocytes have protective effects against UVB radiation. PMID:25617667

  20. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  1. COP1 contributes to UVB-induced signaling in human keratinocytes.

    Science.gov (United States)

    Kinyó, Agnes; Kiss-László, Zsuzsanna; Hambalkó, Szabolcs; Bebes, Attila; Kiss, Mária; Széll, Márta; Bata-Csörgo, Zsuzsanna; Nagy, Ferenc; Kemény, Lajos

    2010-02-01

    UVB irradiation has been shown to trigger a broad range of changes in gene expression in human skin; however, factors governing these events are still not well understood. In this study, we show that human constitutive photomorphogenic protein-1 (huCOP1), an E3 ligase, contributes to the orchestration of UVB response of keratinocytes. Accordingly, our data show that (i) huCOP1 protein is expressed both in the nucleus and in the cytoplasm of cultured keratinocytes, (ii) UVB reduces the levels of the huCOP1 mRNA and protein, and (iii) induces changes in the subcellular localization of huCOP1. Finally, we show that gene-specific silencing of huCOP1 induces the accumulation of the tumor suppressor p53 protein, which is further increased after UVB irradiation.

  2. Isorhamnetin Protects Human Keratinocytes against Ultraviolet B-Induced Cell Damage

    OpenAIRE

    Han, Xia; Piao, Mei Jing; Kim, Ki Cheon; Madduma Hewage, Susara Ruwan Kumara; Yoo, Eun Sook; Koh, Young Sang; Kang, Hee Kyoung; Jennifer H. Shin; PARK, YEUNSOO; Yoo, Suk Jae; Chae, Sungwook; Hyun, Jin Won

    2015-01-01

    Isorhamnetin (3-methylquercetin) is a flavonoid derived from the fruits of certain medicinal plants. This study investigated the photoprotective properties of isorhamnetin against cell damage and apoptosis resulting from excessive ultraviolet (UV) B exposure in human HaCaT keratinocytes. Isorhamnetin eliminated UVB-induced intracellular reactive oxygen species (ROS) and attenuated the oxidative modification of DNA, lipids, and proteins in response to UVB radiation. Moreover, isorhamnetin repr...

  3. In Vitro Cytotoxicity and Phototoxicity Assessment of Acylglutamate Surfactants Using a Human Keratinocyte Cell Line

    OpenAIRE

    Abhay Kyadarkunte; Milind Patole; Varsha Pokharkar

    2014-01-01

    In the current study, human keratinocyte cell line was used as in vitro cell culture model to elucidate the effects of the fatty acid chain length of acylglutamate (amino acid-based surfactant) namely, sodium cocoyl glutamate, sodium lauroyl glutamate, and sodium myristoyl glutamate on their cytotoxicity and the ultraviolet B induced phototoxicity. The endpoint used to assess toxicity was a tetrazolium-based assay whereas, the phototoxic potential of acylglutamate surfactants was predicted u...

  4. Transforming growth factor-beta stimulates the expression of fibronectin by human keratinocytes.

    Science.gov (United States)

    Wikner, N E; Persichitte, K A; Baskin, J B; Nielsen, L D; Clark, R A

    1988-09-01

    Transforming growth factor beta (TGF-beta) is a 25-kD protein which has regulatory activity over a variety of cell types. It is distinct from epidermal growth factor (EGF) and EGF analogs, and exerts its action via a distinct receptor. Its effect on proliferation or differentiation can be positive or negative depending on the cell type and the presence of other growth factors. It also modulates the expression of cellular products. TGF-beta causes fibroblasts to increase their production of the extracellular matrix components, fibronectin and collagen. Human keratinocytes (HK) are known to have TGF-beta receptors. We wished to study the effect of TGF-beta on the production of extracellular matrix proteins by human keratinocytes in culture. Human keratinocytes were grown in serum-free defined medium (MCDB-153) to about 70% confluence. Following a 16-h incubation in medium lacking EGF and TGF-beta, cells were incubated for 12 h in medium containing varying concentrations of EGF and TGF-beta. Cells were then labeled with 35S-methionine for 10 h in the same conditions. Labeled proteins from the medium were analyzed by SDS-PAGE and autoradiography. TGF-beta at 10 ng/ml induced a sixfold increase in the secretion of fibronectin, as well as an unidentified 50-kD protein. Thrombospondin production was also increased, but not over a generalized twofold increase in the production of all other proteins. EGF, at 10 ng/ml, caused a smaller additive effect. TGF-beta may be an important stimulator of extracellular matrix production by human keratinocytes.

  5. In Vitro Cytotoxicity and Phototoxicity Assessment of Acylglutamate Surfactants Using a Human Keratinocyte Cell Line

    Directory of Open Access Journals (Sweden)

    Abhay Kyadarkunte

    2014-07-01

    Full Text Available In the current study, human keratinocyte cell line was used as in vitro cell culture model to elucidate the effects of the fatty acid chain length of acylglutamate (amino acid-based surfactant namely, sodium cocoyl glutamate, sodium lauroyl glutamate, and sodium myristoyl glutamate on their cytotoxicity and the ultraviolet B induced phototoxicity. The endpoint used to assess toxicity was a tetrazolium-based assay whereas, the phototoxic potential of acylglutamate surfactants was predicted using two models namely, the Photo-Irritation Factor and Mean Photo Effect. The results of this study showed that the fatty acid chain length of acylglutamate greatly influences toxic effects on human keratinocyte cells. In addition, all the acylglutamate surfactants tested on human keratinocyte cells demonstrated significantly less cytotoxicity (when irradiated and non-irradiated with ultraviolet B light; p < 0.05 and no phototoxic potential was observed in any of the acylglutamate surfactants, when compared with the positive control chlorpromazine. In conclusion, the in vitro studies confirm the suitability of sodium lauroyl glutamate destined for the synthesis and stabilization of lipid nanoparticles.

  6. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  7. A sensitive sensor cell line for the detection of oxidative stress responses in cultured human keratinocytes.

    Science.gov (United States)

    Hofmann, Ute; Priem, Melanie; Bartzsch, Christine; Winckler, Thomas; Feller, Karl-Heinz

    2014-06-25

    In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells) expressing green fluorescent protein (GFP) under the control of the stress-inducible HSP70B' promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B'. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B' gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B' promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS) that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  8. Biological properties of differently-aged human keratinocytes:population doubling time growth curve and cell cycle analysis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective To explore the biological properties of keratinocytes from differently-aged healthy human beings. Methods Keratinocytes from fetus,teenager and middle-aged groups were separated and cultured. The population doubling time (PDT) and cell growth curve in different cells were compared,and the cell cycles were analyzed by flow cytometry. Results ① In primary culture of keratinocytes,the adherence time in middle-aged group was longer than that in fetus and teenager groups. However,all cell morphology sh...

  9. Impact of AQP3 inducer treatment on cultured human keratinocytes, ex vivo human skin and volunteers.

    Science.gov (United States)

    Garcia, N; Gondran, C; Menon, G; Mur, L; Oberto, G; Guerif, Y; Dal Farra, C; Domloge, N

    2011-10-01

    One of the main functions of the skin is to protect the organism against environmental threats, such as thermal stress. Aquaporin-3 (AQP3) facilitates water and glycerol transport across cell membranes and therefore regulates osmotic balance in different situations of stress. This mechanism seems to be particularly important for the resistance of different organisms to cold stress. Consequently, we were interested in investigating the effect of cold and osmotic stress on AQP3 expression in normal human keratinocytes. We developed a new active ingredient to stimulate aquaporins in skin and demonstrated the partial restoration of AQP3 expression in keratinocytes transfected with AQP3 siRNA. Moreover, we examined the effect of cold stress on cell morphology and the impact of a pre-treatment with the active ingredient. Our results indicated that induction of AQP3 helped maintain a correct organization of the actin cytoskeleton, preserving cell morphology and preventing cells from rounding. Immunofluorescent staining revealed cytoplasmic localization of AQP3 and its translocation to the cell membrane following osmotic stress. Histological ex vivo studies of skin under different conditions, such as cold environment and tape-stripping, indicated that increase in AQP3 expression appears to be involved in skin protection and showed that the pattern of AQP3 expression was more enhanced in the active ingredient-treated samples. In vivo confocal microscopy by Vivascope showed a generally healthier appearance of the skin in the treated areas. These results attest to the potential value of the active ingredient in optimizing environmental stress resistance and protecting the skin from stratum corneum damage.

  10. Long-term subculture of human keratinocytes under an anoxic condition.

    Science.gov (United States)

    Kino-oka, Masahiro; Agatahama, Yuka; Haga, Yuki; Inoie, Masukazu; Taya, Masahito

    2005-07-01

    The serial subculturing of human keratinocyte cells under the anoxic and normoxic conditions was examined. The cumulative number of population doublings in the subcultures under the former condition increased 2.1-fold while maintaining an appreciable growth rate of cells, as compared with that under the latter condition. Moreover, the migration ability, which was estimated by the rotation rate of paired cells, was maintained accompanied by fully developed filopodia of F-actin filaments under the anoxic condition, despite of the poor development of stress fibers at the center of the cellular body. The cells passaged under the anoxic condition possessed the sufficient clonogenic potential to form epithelial sheets, supporting the view that the long-term subculture of keratinocytes under the anoxic condition can be applied for cell expansion in the practical production of epithelial sheets.

  11. Entry pathways of herpes simplex virus type 1 into human keratinocytes are dynamin- and cholesterol-dependent.

    Directory of Open Access Journals (Sweden)

    Elena Rahn

    Full Text Available Herpes simplex virus type 1 (HSV-1 can enter cells via endocytic pathways or direct fusion at the plasma membrane depending on the cell line and receptor(s. Most studies into virus entry have used cultured fibroblasts but since keratinocytes represent the primary entry site for HSV-1 infection in its human host, we initiated studies to characterize the entry pathway of HSV-1 into human keratinocytes. Electron microscopy studies visualized free capsids in the cytoplasm and enveloped virus particles in vesicles suggesting viral uptake both by direct fusion at the plasma membrane and by endocytic vesicles. The ratio of the two entry modes differed in primary human keratinocytes and in the keratinocyte cell line HaCaT. Inhibitor studies further support a role for endocytosis during HSV-1 entry. Infection was inhibited by the cholesterol-sequestering drug methyl-β-cyclodextrin, which demonstrates the requirement for host cholesterol during virus entry. Since the dynamin-specific inhibitor dynasore and overexpression of a dominant-negative dynamin mutant blocked infection, we conclude that the entry pathways into keratinocytes are dynamin-mediated. Electron microscopy studies confirmed that virus uptake is completely blocked when the GTPase activity of dynamin is inhibited. Ex vivo infection of murine epidermis that was treated with dynasore further supports the essential role of dynamin during entry into the epithelium. Thus, we conclude that HSV-1 can enter human keratinocytes by alternative entry pathways that require dynamin and host cholesterol.

  12. Low dose chronic treatment of human keratinocytes with inorganic arsenic causes hyperproliferation and altered protein phosphorylation

    Energy Technology Data Exchange (ETDEWEB)

    Steinberg, M.L. [City College of New York, NY (United States); Su, L.; Snow, E.T. [New York Univ. Medical Center, Tuxedo, NY (United States)]|[City College of New York, NY (United States)

    1997-10-01

    Chronic exposure to arsenate [As(V)] or arsenite [As(III)] causes hyperproliferation of normal and SV40-transformed human epidermal keratinocytes. Line 327 SV40-infected human keratinocytes were grown in the presence of either As(III) or As(V) (0.01 to 10 {mu}M) in complete medium for seven days prior to harvesting and counting. Both As(III) and As(V) were cytotoxic at micromolar concentrations, however submicromolar arsenic caused a significant increase in cell growth. Cell numbers in cultures exposed to As(V) were increased more than 186% relative to controls, and an even larger stimulation in cell growth was observed after treatment with 50 nM As(III). Normal non-SV40 T-antigen. Preliminary cell cycle analysis using unselected, log-phase cultures of arsenic-treated keratinocytes shows an increased proportion of cells in S- and G2/M-phase. Isoelectric focusing of phosphotyrosine-containing proteins from cells labeled with {sup 32}P-inorganic phosphate showed that the hyperproliferation of keratinocytes grown in low concentrations of arsenic is accompanied by altered tyrosine-specific protein phosphorylation. A number of phosphorylated proteins were observed in As-treated cells that were not observed in the controls; and minor bands at IEPs of 3.0, 4.2, 7.2, 7.5 and 8.2. These results, together with the lack of direct enzyme inhibition by arsenic shown by Su et al., this volume, suggest that arsenic-induced skin lesions and carcinogenesis may be the result of altered cell cycle control rather than DNA damage or reduced DNA repair.

  13. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  14. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    Energy Technology Data Exchange (ETDEWEB)

    Senthilkumar, P.K. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Robertson, L.W. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States); Ludewig, G., E-mail: Gabriele-ludewig@uiowa.edu [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States)

    2012-02-15

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  15. Effects of Arsenic on Cell Proliferation and Its Related Gene Expression in Human Epidermal Keratinocyte

    Institute of Scientific and Technical Information of China (English)

    顾军; 毕新岭; 米庆胜; 文军慧

    2002-01-01

    Objective:To study the effects of low concentration of arsenic (As2O3) on DNA synthesisand related transcription factor gene E2F1 expression in keratinocyte. Methods: Human epidermal kerati-nocyte (cell line HaCaT) cultured in vitro was used. After treatment with various concentrations of arse-nic, DNA synthesis and E2F1 expression in HaCaT cells were detected by using 3 H-TdR method and RT-PCR. Results: Arsenic caused a modest increase of keratinocyte DNA synthesis when the concentrationreached the range within 0.5-16 nmol/L, but the amount of incorporated 3 H-TdR decreased and returnedto baseline level when the concentration of arsenic increased to over 16 nmol/L. RT-PCR analysis showedthe level of E2F1 mRNA was elevated in HaCaT cells with the increase of DNA synthesis. Conclusion:Ar-senic of a certain concentration could increase DNA synthesis and enhance E2F1 expression in HaCaT cellline, which might be one of the pathological mechanisms of skin disease related to arsenic.

  16. Caspase-1 activity is required for UVB-induced apoptosis of human keratinocytes.

    Science.gov (United States)

    Sollberger, Gabriel; Strittmatter, Gerhard E; Grossi, Serena; Garstkiewicz, Martha; Auf dem Keller, Ulrich; French, Lars E; Beer, Hans-Dietmar

    2015-05-01

    Caspase-1 has a crucial role in innate immunity as the protease activates the proinflammatory cytokine prointerleukin(IL)-1β. Furthermore, caspase-1 induces pyroptosis, a lytic form of cell death that supports inflammation. Activation of caspase-1 occurs in multi-protein complexes termed inflammasomes, which assemble upon sensing of stress signals. In the skin and in skin-derived keratinocytes, UVB irradiation induces inflammasome-dependent IL-1 secretion and sunburn. Here we present evidence that caspase-1 and caspase-4 are required for UVB-induced apoptosis. In UVB-irradiated human primary keratinocytes, apoptosis occurs significantly later than inflammasome activation but depends on caspase-1 activity. However, it proceeds independently of inflammasome activation. By a proteomics approach, we identified the antiapoptotic Bap31 as a putative caspase-1 substrate. Caspase-1-dependent apoptosis is possibly a recent process in evolution as it was not detected in mice. These results suggest a protective role of caspase-1 in keratinocytes during UVB-induced skin cancer development through the induction of apoptosis.

  17. Alcohol metabolism by oral streptococci and interaction with human papillomavirus leads to malignant transformation of oral keratinocytes.

    Science.gov (United States)

    Tao, Lin; Pavlova, Sylvia I; Gasparovich, Stephen R; Jin, Ling; Schwartz, Joel

    2015-01-01

    Poor oral hygiene, ethanol consumption, and human papillomavirus (HPV) are associated with oral and esophageal cancers. However, the mechanism is not fully known. This study examines alcohol metabolism in Streptococcus and its interaction with HPV-16 in the malignant transformation of oral keratinocytes. The acetaldehyde-producing strain Streptococcus gordonii V2016 was analyzed for adh genes and activities of alcohol and aldehyde dehydrogenases. Streptococcus attachment to immortalized HPV-16 infected human oral keratinocytes, HOK (HPV/HOK-16B), human oral buccal keratinocytes, and foreskin keratinocytes was studied. Acetaldehyde, malondialdehyde, DNA damage, and abnormal proliferation among keratinocytes were also quantified. We found that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB, and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol, and ethanol, respectively. S. gordonii V2016 did not show a detectable aldehyde dehydrogenase. AdhE is the major alcohol dehydrogenase in S. gordonii. Acetaldehyde and malondialdehyde production from permissible Streptococcus species significantly increased the bacterial attachment to keratinocytes, which was associated with an enhanced expression of furin to facilitate HPV infection and several malignant phenotypes including acetaldehyde adduct formation, abnormal proliferation, and enhanced migration through integrin-coated basement membrane by HPV-infected oral keratinocytes. Therefore, expression of multiple alcohol dehydrogenases with no functional aldehyde dehydrogenase contributes to excessive production of acetaldehyde from ethanol by oral streptococci. Oral Streptococcus species and HPV may cooperate to transform oral keratinocytes after ethanol exposure. These results suggest a significant clinical interaction, but further validation is warranted.

  18. The effect of the plasma needle on the human keratinocytes related to the wound healing process

    Science.gov (United States)

    Korolov, Ihor; Fazekas, Barbara; Széll, Márta; Kemény, Lajos; Kutasi, Kinga

    2016-01-01

    In the present study we aim to verify the influence of a non-thermal atmospheric pressure plasma on the wound healing process. In this process the major contributors are the keratinocytes, which migrate to fill in the gap created by the wound. Therefore, we performed the direct treatment of HPV-immortalized human keratinocytes, protected by a layer of phosphate buffered saline (PBS) solution, with the glow discharge generated in flowing helium by a plasma needle. To mimick a wound, a 4 mm scratch was performed on the cell culture (scratch assay). We conducted two types of experiments: (i) cell proliferation and (ii) wound-healing model experiments. The plasma needle configuration, the plasma treatment conditions and the thickness of the protecting PBS layer were set based on viability experiments. The proliferation studies showed that short, 5-10 s, and low power treatments, such as 18 W and 20 W input power, could positively influence the cell proliferation when keratinocytes were protected by PBS. On the other hand, the plasma treatment of cell medium covered keratinocytes resulted in the decrease of proliferation. The wound-healing model (scratch assay) studies showed, that there was a maximum in the wound reduction as a function of the input power and treatment time, namely, at 18 W and 5 s. Furthermore, the wound reduction strongly depended on the treated cell—PBS interaction time. To mimic an infected wound, the scratch assay was covered with a 1× {{10}9} cfu ml-1 Propionibacterium acnes suspension. The plasma treatment of this infected assay resulted in closing of the scratch, while in the non-treated assay the wound did not close at all.

  19. The expressions of ABCC4 and ABCG2 xenobiotic transporters in human keratinocytes are proliferation-related.

    Science.gov (United States)

    Bebes, Attila; Kis, Kornélia; Nagy, Tünde; Kurunczi, Anita; Polyánka, Hilda; Bata-Csörgo, Zsuzsanna; Kemény, Lajos; Dobozy, Attila; Széll, Márta

    2012-01-01

    Xenobiotic transporters of the ATP-binding cassette (ABC) protein superfamily play important roles in maintaining the biochemical barrier of various tissues, but their precise functions in the skin are not yet known. Screening of the expressions of the known xenobiotic transporter genes in two in vitro keratinocyte differentiation models revealed that the ABCC4 and ABCG2 transporters are highly expressed in proliferating keratinocytes, their expressions decreasing along with differentiation. Abrogation of the ABCC4 and ABCG2 protein functions by siRNA-mediated silencing and chemical inhibition did not affect the proliferation of HaCaT cells. In contrast, disruption of the ABCG2 function had no effect on normal human epidermal keratinocyte proliferation, while the inhibition of ABCC-type transporters by probenecid resulted in a striking decrease in the proliferation of the cells. These results indicate that, besides their possible therapy-modulating effects, xenobiotic transporters may contribute significantly to other keratinocyte functions, such as cell proliferation.

  20. Mu-opiate receptor and Beta-endorphin expression in nerve endings and keratinocytes in human skin.

    Science.gov (United States)

    Bigliardi-Qi, M; Sumanovski, L T; Büchner, S; Rufli, T; Bigliardi, P L

    2004-01-01

    We have previously shown that human epidermal keratinocytes express a functionally active micro-opiate receptor, which adds a new dimension to the recently developed research in neuroimmunodermatology and neurogenic inflammation in skin diseases. Human keratinocytes specifically bind and also produce beta-endorphin, the endogenous micro-opiate receptor ligand. Using confocal imaging microscopy, we could now demonstrate that micro-opiate receptors are not only expressed in keratinocytes, but also on unmyelinated peripheral nerve fibers in the dermis and epidermis. Some of the peripheral nerve fibers also express the ligand beta-endorphin. The keratinocytes positive for beta-endorphin staining are clustered around the terminal ends of the unmyelinated nerve fibers. Therefore the opiate receptor system seems to be crucial in the direct communication between nerves and skin. The keratinocytes can influence the unmyelinated nerve fibers in the epidermis directly via secreting beta-endorphin. On the other hand, nerve fibers can also secrete beta-endorphin and influence the migration, differentiation and probably also the cytokine production pattern of keratinocytes.

  1. Transcriptional repression in normal human keratinocytes by wild-type and mutant p53.

    Science.gov (United States)

    Alvarez-Salas, L M; Velazquez, A; Lopez-Bayghen, E; Woodworth, C D; Garrido, E; Gariglio, P; DiPaolo, J A

    1995-05-01

    Wild-type p53 is a nuclear phosphoprotein that inhibits cell proliferation and represses transcriptionally most TATA box-containing promoters in transformed or tumor-derived cell lines. This study demonstrates that p53 alters transcription of the long control region (LCR) of human papillomavirus type 18 (HPV-18). Wild-type and mutant p53 143Val to Ala repressed the HPV-18 LCR promoter in normal human keratinocytes, the natural host cell for HPV infections. Repression by wild-type p53 was also observed in C-33A cells and in an HPV-16-immortalized cell line with an inducible wild-type p53. However, when C-33A cells were cotransfected with the HPV-18 LCR and mutant 143Val to Ala, repression did not occur. Mutant p53 135Cys to Ser did not induce repression in either normal human keratinocytes or in the C-33A line; although like 143Val to Ala, it is thought to affect the DNA binding activity of the wild-type protein. The ability of mutant p53 143Val to Ala to inactivate the HPV early promoter in normal cells (by approximately 60% reduction) suggests that this mutant may be able to associate with wild-type p53 and interact with TATA box-binding proteins. Therefore, these results demonstrate that the transcriptional activities of p53 mutants may be dependent upon the cell type assayed and the form of its endogenous p53. Furthermore, normal human keratinocytes represent an alternative model for determining the activities of p53 mutants.

  2. Ecto-nucleoside triphosphate diphosphohydrolase 2 modulates local ATP-induced calcium signaling in human HaCaT keratinocytes.

    Directory of Open Access Journals (Sweden)

    Chia-Lin Ho

    Full Text Available Keratinocytes are the major building blocks of the human epidermis. In many physiological and pathophysiological conditions, keratinocytes release adenosine triphosphate (ATP as an autocrine/paracrine mediator that regulates cell proliferation, differentiation, and migration. ATP receptors have been identified in various epidermal cell types; therefore, extracellular ATP homeostasis likely determines its long-term, trophic effects on skin health. We investigated the possibility that human keratinocytes express surface-located enzymes that modulate ATP concentration, as well as the corresponding receptor activation, in the pericellular microenvironment. We observed that the human keratinocyte cell line HaCaT released ATP and hydrolyzed extracellular ATP. Interestingly, ATP hydrolysis resulted in adenosine diphosphate (ADP accumulation in the extracellular space. Pharmacological inhibition by ARL 67156 or gene silencing of the endogenous ecto-nucleoside triphosphate diphosphohydrolase (NTPDase isoform 2 resulted in a 25% reduction in both ATP hydrolysis and ADP formation. Using intracellular calcium as a reporter, we found that although NTPDase2 hydrolyzed ATP and generated sustainable ADP levels, only ATP contributed to increased intracellular calcium via P2Y2 receptor activation. Furthermore, knocking down NTPDase2 potentiated the nanomolar ATP-induced intracellular calcium increase, suggesting that NTPDase2 globally attenuates nucleotide concentration in the pericellular microenvironment as well as locally shields receptors in the vicinity from being activated by extracellular ATP. Our findings reveal an important role of human keratinocyte NTPDase2 in modulating nucleotide signaling in the extracellular milieu of human epidermis.

  3. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  4. Biological properties of differently-aged human keratinocytes:population doubling time growth curve and cell cycle analysis

    Institute of Scientific and Technical Information of China (English)

    Hui-qun Ma; Jie Feng; Lech Chyczewski; Jacek Niklinski

    2009-01-01

    Objective To explore the biological properties of keratinocytes from differently-aged healthy human beings. Methods Keratinocytes from fetus, teenager and middle-aged groups were separated and cultured. The population doubling time (PDT) and cell growth curve in different cells were compared, and the cell cycles were analyzed by flow cytometry. Results ① In primary culture of keratinocytes, the adherence time in middle-aged group was longer than that in fetus and teenager groups. However, all cell morphology showed no obvioas differences. In subculture of kecatinocytes, with donator's age increasing, time of cell adherence prolonged, passage number decreused and differences in cell morphology were obrioas. ② The average PDT of keratinocytes was shorter in fetus group than in teenager and middle-aged groups. Bat difference in cell growth curve between different passages was not observed. ③ Keratinocytes showed G2/M period in fetus group but G0/G1 period in teenager and middle-aged groups mainly. Conclusion As age increases, the biological properties of keratinocytes change obviously.

  5. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.

    1989-01-01

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  6. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays.Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation.  The most widespread, intense and uniform staining for PCNA

  7. 1,25-Dihydroxyvitamin D3 production by human keratinocytes. Kinetics and regulation.

    OpenAIRE

    Bikle, D D; Nemanic, M K; Gee, E; Elias, P

    1986-01-01

    Human foreskin keratinocytes in vitro metabolize 25-hydroxyvitamin D3 to a number of metabolites, including 1,25-dihydroxyvitamin D3 (1,25(OH)2D3). This metabolite remains mostly within the cell and does not accumulate in the medium under the conditions of these experiments. With time, 1,25(OH)2D3 is catabolized, and more polar metabolites appear in both the cells and the medium. The production of 1,25(OH)2D3 has an apparent Michaelis constant (Km) for 25-hydroxyvitamin D3 of 5.4 X 10(-8) M. ...

  8. Shuttling of the autoantigen La between nucleus and cell surface after uv irradiation of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bachmann, M.; Chang, S.; Slor, H.; Kukulies, J.; Mueller, W.E. (Universitaet, Mainz (Germany, F.R.))

    1990-12-01

    During the past years we have established that the nuclear autoantigen La shuttles between the nucleus and the cytoplasm in tumor cells after inhibition of transcription or virus infection. We reinvestigated this shuttling using primary human keratinocytes from both healthy donors and patients with xeroderma pigmentosum. Ultraviolet irradiation resulted in both an inhibition of transcription and a translocation of La protein from the nucleus to the cytoplasm. After a prolonged inhibition of transcription La protein relocated into the nucleus and assembled with nuclear storage regions. The uv-induced shuttling included a translocation to the cell surface, where La protein colocalized with epidermal growth factor receptors.

  9. Hyperthermia-induced micronucleus formation in a human keratinocyte cell line

    Energy Technology Data Exchange (ETDEWEB)

    Hintzsche, Henning; Riese, Thorsten [Universitaet Wuerzburg, Institut fuer Pharmakologie und Toxikologie, Versbacher Str. 9, 97078 Wuerzburg (Germany); Stopper, Helga, E-mail: Stopper@toxi.uni-wuerzburg.de [Universitaet Wuerzburg, Institut fuer Pharmakologie und Toxikologie, Versbacher Str. 9, 97078 Wuerzburg (Germany)

    2012-10-15

    Elevated temperature can cause biological effects in vitro and in vivo. Many studies on effects of hypo- and hyperthermia have been conducted, but only few studies systematically investigated the formation of genomic damage in the micronucleus test in human cells in vitro as a consequence of different temperatures. In the present study, HaCaT human keratinocytes were exposed to different temperatures from 37 Degree-Sign C to 42 Degree-Sign C for 24 h in a regular cell culture incubator. Micronucleus frequency as a marker of genomic damage was elevated in a temperature-dependent and statistically significant manner. Apoptosis occurred at temperatures of 39 Degree-Sign C or higher. Cell proliferation was unaffected up to 40 Degree-Sign C and decreased at 41 Degree-Sign C and 42 Degree-Sign C. Expression of the heat shock protein Hsp70 was elevated, particularly at temperatures of 40 Degree-Sign C and higher. These findings are in agreement with several in vivo studies and some in vitro studies looking at single, specific temperatures, but a systematically investigated temperature-dependent increase of genomic damage in human keratinocytes in vitro is demonstrated for the first time here.

  10. Asian dust storm particles induce a broad toxicological transcriptional program in human epidermal keratinocytes.

    Science.gov (United States)

    Choi, Hyun; Shin, Dong Wook; Kim, Wonnyon; Doh, Seong-Jae; Lee, Soo Hwan; Noh, Minsoo

    2011-01-15

    Exposure to airborne dust particles originated from seasonal Asian dust storms in Chinese and Mongolian deserts results in increased incidence of a range of diseases including asthma, contact dermatitis and conjunctivitis. The areas affected by Asian dust particles extend from East China to the west coast of North America. In order to study toxicological mechanisms in human skin, we evaluated the effects of dust particles collected during Asian dust storms (Asian dust particles) on gene expression in human epidermal keratinocytes (HEK). In HEK, exposure to Asian dust particles significantly increased gene expressions of cytochrome P450 1A1 (CYP1A1), CYP1A2, and CYP1B1, which is an indication of aryl hydrocarbon receptor (AHR) activation. In addition, Asian dust particles increased gene transcription of the cytokines IL-6, IL-8, and GM-CSF, which have broad pro-inflammatory and immunomodulatory properties. Asian dust particles significantly up-regulated expression of caspase 14 in HEK, suggesting that Asian dust particles directly affect keratinocyte differentiation. We also demonstrated that protein extract of pollen, a material frequently adsorbed onto Asian dust particles, potentially contributes to the increased transcription of IL-6, CYP1A1, CYP1A2, and CYP1B1. Taken together, these studies suggest that Asian dust particles can exert toxicological effects on human skin through the activation of the cellular detoxification system, the production of pro-inflammatory and immunomodulatory cytokines, and changes in the expression of proteins essential in normal epidermal differentiation.

  11. A fully autologous co-culture system utilising non-irradiated autologous fibroblasts to support the expansion of human keratinocytes for clinical use.

    Science.gov (United States)

    Jubin, K; Martin, Y; Lawrence-Watt, D J; Sharpe, J R

    2011-12-01

    Autologous keratinocytes can be used to augment cutaneous repair, such as in the treatment of severe burns and recalcitrant ulcers. Such cells can be delivered to the wound bed either as a confluent sheet of cells or in single-cell suspension. The standard method for expanding primary human keratinocytes in culture uses lethally irradiated mouse 3T3 fibroblasts as feeder cells to support keratinocyte attachment and growth. In an effort to eliminate xenobiotic cells from clinical culture protocols where keratinocytes are applied to patients, we investigated whether human autologous primary fibroblasts could be used to expand keratinocytes in culture. At a defined ratio of a 6:1 excess of keratinocytes to fibroblasts, this co-culture method displayed a population doubling rate comparable to culture with lethally irradiated 3T3 cells. Furthermore, morphological and molecular analysis showed that human keratinocytes expanded in co-culture with autologous human fibroblasts were positive for proliferation markers and negative for differentiation markers. Keratinocytes expanded by this method thus retain their proliferative phenotype, an important feature in enhancing rapid wound closure. We suggest that this novel co-culture method is therefore suitable for clinical use as it dispenses with the need for lethally irradiated 3T3 cells in the rapid expansion of autologous human keratinocytes.

  12. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Olerud John E

    2011-06-01

    Full Text Available Abstract Background Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. Results The impact of S. aureus soluble products in biofilm-conditioned medium (BCM or in planktonic-conditioned medium (PCM on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Conclusions Collectively the results indicate that S

  13. Development of a full-thickness human skin equivalent in vitro model derived from TERT-immortalized keratinocytes and fibroblasts

    NARCIS (Netherlands)

    C.M.A. Reijnders; A. van Lier; S. Roffel; D. Kramer; R.J. Scheper; S. Gibbs

    2015-01-01

    Currently, human skin equivalents (HSEs) used for in vitro assays (e.g., for wound healing) make use of primary human skin cells. Limitations of primary keratinocytes and fibroblasts include availability of donor skin and donor variation. The use of physiologically relevant cell lines could solve th

  14. Development of a Full-Thickness Human Skin Equivalent In Vitro Model Derived from TERT-Immortalized Keratinocytes and Fibroblasts

    NARCIS (Netherlands)

    Reijnders, Christianne M. A.; van Lier, Amanda; Roffel, Sanne; Kramer, Duco; Scheper, Rik J.; Gibbs, Susan

    2015-01-01

    Currently, human skin equivalents (HSEs) used for in vitro assays (e.g., for wound healing) make use of primary human skin cells. Limitations of primary keratinocytes and fibroblasts include availability of donor skin and donor variation. The use of physiologically relevant cell lines could solve th

  15. Effect of JP-8 jet fuel exposure on protein expression in human keratinocyte cells in culture.

    Science.gov (United States)

    Witzmann, F A; Monteiro-Riviere, N A; Inman, A O; Kimpel, M A; Pedrick, N M; Ringham, H N; Riviere, J E

    2005-12-30

    Dermal exposure to jet fuel is a significant occupational hazard. Previous studies have investigated its absorption and disposition in skin, and the systemic biochemical and immunotoxicological sequelae to exposure. Despite studies of JP-8 jet fuel components in murine, porcine or human keratinocyte cell cultures, proteomic analysis of JP-8 exposure has not been investigated. This study was conducted to examine the effect of JP-8 administration on the human epidermal keratinocyte (HEK) proteome. Using a two-dimensional electrophoretic approach combined with mass spectrometric-based protein identification, we analyzed protein expression in HEK exposed to 0.1% JP-8 in culture medium for 24 h. JP-8 exposure resulted in significant expression differences (p<0.02) in 35 of the 929 proteins matched and analyzed. Approximately, a third of these alterations were increased in protein expression, two-thirds declined with JP-8 exposure. Peptide mass fingerprint identification of effected proteins revealed a variety of functional implications. In general, altered proteins involved endocytotic/exocytotic mechanisms and their cytoskeletal components, cell stress, and those involved in vesicular function.

  16. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert;

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a......Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (Ha...

  17. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells. PMID:27529420

  18. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  19. Cysteine Prevents the Reduction in Keratin Synthesis Induced by Iron Deficiency in Human Keratinocytes.

    Science.gov (United States)

    Miniaci, Maria Concetta; Irace, Carlo; Capuozzo, Antonella; Piccolo, Marialuisa; Di Pascale, Antonio; Russo, Annapina; Lippiello, Pellegrino; Lepre, Fabio; Russo, Giulia; Santamaria, Rita

    2016-02-01

    L-cysteine is currently recognized as a conditionally essential sulphur amino acid. Besides contributing to many biological pathways, cysteine is a key component of the keratin protein by its ability to form disulfide bridges that confer strength and rigidity to the protein. In addition to cysteine, iron represents another critical factor in regulating keratins expression in epidermal tissues, as well as in hair follicle growth and maturation. By focusing on human keratinocytes, the aim of this study was to evaluate the effect of cysteine supplementation as nutraceutical on keratin biosynthesis, as well as to get an insight on the interplay of cysteine availability and cellular iron status in regulating keratins expression in vitro. Herein we demonstrate that cysteine promotes a significant up-regulation of keratins expression as a result of de novo protein synthesis, while the lack of iron impairs keratin expression. Interestingly, cysteine supplementation counteracts the adverse effect of iron deficiency on cellular keratin expression. This effect was likely mediated by the up-regulation of transferrin receptor and ferritin, the main cellular proteins involved in iron homeostasis, at last affecting the labile iron pool. In this manner, cysteine may also enhance the metabolic iron availability for DNA synthesis without creating a detrimental condition of iron overload. To the best of our knowledge, this is one of the first study in an in vitro keratinocyte model providing evidence that cysteine and iron cooperate for keratins expression, indicative of their central role in maintaining healthy epithelia.

  20. Analyses of the secondary particle radiation and the DNA damage it causes to human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E.; Rusek A.; Sivertz, M.; Yip, K.; Thompson, K.; Tafrov, S.

    2011-11-22

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  1. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  2. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Xiaoru Zhang

    Full Text Available Ultraviolet radiation (UVR from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR. A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  3. Phevalin (aureusimine B) production by Staphylococcus aureus biofilm and impacts on human keratinocyte gene expression.

    Science.gov (United States)

    Secor, Patrick R; Jennings, Laura K; James, Garth A; Kirker, Kelly R; Pulcini, Elinor Delancey; McInnerney, Kate; Gerlach, Robin; Livinghouse, Tom; Hilmer, Jonathan K; Bothner, Brian; Fleckman, Philip; Olerud, John E; Stewart, Philip S

    2012-01-01

    Staphylococcus aureus biofilms are associated with chronic skin infections and are orders of magnitude more resistant to antimicrobials and host responses. S. aureus contains conserved nonribosomal peptide synthetases that produce the cyclic dipeptides tyrvalin and phevalin (aureusimine A and B, respectively). The biological function of these compounds has been speculated to be involved in virulence factor gene expression in S. aureus, protease inhibition in eukaryotic cells, and interspecies bacterial communication. However, the exact biological role of these compounds is unknown. Here, we report that S. aureus biofilms produce greater amounts of phevalin than their planktonic counterparts. Phevalin had no obvious impact on the extracellular metabolome of S. aureus as measured by high-performance liquid chromatography-mass spectrometry and nuclear magnetic resonance. When administered to human keratinocytes, phevalin had a modest effect on gene expression. However, conditioned medium from S. aureus spiked with phevalin amplified differences in keratinocyte gene expression compared to conditioned medium alone. Phevalin may be exploited as potential biomarker and/or therapeutic target for chronic, S. aureus biofilm-based infections.

  4. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-05

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients.

  5. Solar Simulated Ultraviolet Radiation Induces Global Histone Hypoacetylation in Human Keratinocytes.

    Science.gov (United States)

    Zhang, Xiaoru; Kluz, Thomas; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

    2016-01-01

    Ultraviolet radiation (UVR) from sunlight is the primary effector of skin DNA damage. Chromatin remodeling and histone post-translational modification (PTM) are critical factors in repairing DNA damage and maintaining genomic integrity, however, the dynamic changes of histone marks in response to solar UVR are not well characterized. Here we report global changes in histone PTMs induced by solar simulated UVR (ssUVR). A decrease in lysine acetylation of histones H3 and H4, particularly at positions of H3 lysine 9, lysine 56, H4 lysine 5, and lysine 16, was found in human keratinocytes exposed to ssUVR. These acetylation changes were highly associated with ssUVR in a dose-dependent and time-specific manner. Interestingly, H4K16ac, a mark that is crucial for higher order chromatin structure, exhibited a persistent reduction by ssUVR that was transmitted through multiple cell divisions. In addition, the enzymatic activities of histone acetyltransferases were significantly reduced in irradiated cells, which may account for decreased global acetylation. Moreover, depletion of histone deacetylase SIRT1 in keratinocytes rescued ssUVR-induced H4K16 hypoacetylation. These results indicate that ssUVR affects both HDAC and HAT activities, leading to reduced histone acetylation.

  6. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin.

    Science.gov (United States)

    De Abrew, K Nadira; Thomas-Virnig, Christina L; Rasmussen, Cathy A; Bolterstein, Elyse A; Schlosser, Sandy J; Allen-Hoffmann, B Lynn

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial-stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin.

  7. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays. Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation. The most widespread, intense and uniform staining for PCNA and

  8. Development of a Full-Thickness Human Gingiva Equivalent Constructed from Immortalized Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Buskermolen, Jeroen K; Reijnders, Christianne M A; Spiekstra, Sander W; Steinberg, Thorsten; Kleverlaan, Cornelis J; Feilzer, Albert J; Bakker, Astrid D; Gibbs, Susan

    2016-08-01

    Organotypic models make it possible to investigate the unique properties of oral mucosa in vitro. For gingiva, the use of human primary keratinocytes (KC) and fibroblasts (Fib) is limited due to the availability and size of donor biopsies. The use of physiologically relevant immortalized cell lines would solve these problems. The aim of this study was to develop fully differentiated human gingiva equivalents (GE) constructed entirely from cell lines, to compare them with the primary cell counterpart (Prim), and to test relevance in an in vitro wound healing assay. Reconstructed gingiva epithelium on a gingiva fibroblast-populated collagen hydrogel was constructed from cell lines (keratinocytes: TERT or HPV immortalized; fibroblasts: TERT immortalized) and compared to GE-Prim and native gingiva. GE were characterized by immunohistochemical staining for proliferation (Ki67), epithelial differentiation (K10, K13), and basement membrane (collagen type IV and laminin 5). To test functionality of GE-TERT, full-thickness wounds were introduced. Reepithelialization, fibroblast repopulation of hydrogel, metabolic activity (MTT assay), and (pro-)inflammatory cytokine release (enzyme-linked immunosorbent assay) were assessed during wound closure over 7 days. Significant differences in basal KC cytokine secretion (IL-1α, IL-18, and CXCL8) were only observed between KC-Prim and KC-HPV. When Fib-Prim and Fib-TERT were stimulated with TNF-α, no differences were observed regarding cytokine secretion (IL-6, CXCL8, and CCL2). GE-TERT histology, keratin, and basement membrane protein expression very closely represented native gingiva and GE-Prim. In contrast, the epithelium of GE made with HPV-immortalized KC was disorganized, showing suprabasal proliferating cells, limited keratinocyte differentiation, and the absence of basement membrane proteins. When a wound was introduced into the more physiologically relevant GE-TERT model, an immediate inflammatory response (IL-6, CCL2, and

  9. Basement membrane reconstruction in human skin equivalents is regulated by fibroblasts and/or exogenously activated keratinocytes

    NARCIS (Netherlands)

    El Ghalbzouri, A; Jonkman, MF; Dijkman, R; Ponec, M

    2005-01-01

    This study was undertaken to examine the role fibroblasts play in the formation of the basement membrane (BM) in human skin equivalents. For this purpose, keratinocytes were seeded on top of fibroblast-free or fibroblast-populated collagen matrix or de-epidermized dermis and cultured in the absence

  10. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert;

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a...

  11. Transcriptional profiling defines the effects of nickel in human epidermal keratinocytes.

    Science.gov (United States)

    Gazel, Alix; Rosdy, Martin; Tornier, Carine; De Fraissinette, Anne De Brugerolle; Blumenberg, Miroslav

    2008-12-01

    Nickel is a ubiquitous and virtually unavoidable environmental pollutant and occupational hazard, but its molecular and cellular effects are not well understood. Human epidermal keratinocytes are the sentinel and the primary target for nickel. We treated with nickel salts skin equivalents containing differentiating epidermal keratinocytes grown on air-liquid interface in standard cell culture conditions. We identified the transcriptional profiles affected by nickel in reconstructed human epidermis (RHE) using DNA microarrays. The Ni-regulated genes were determined at two time points, immediate-early, 30 min after treatment, and late, at 6 h. Using in silico data analysis, we determined that 134 genes are regulated by nickel; of these, 97 are induced and 37 suppressed. Functional categories of regulated genes suggest that Ni inhibits apoptosis, promotes cell cycle and induces synthesis of extracellular matrix proteins and extracellular proteases. Importantly, Ni also regulates a set of secreted signaling proteins, inducing VEGF, amphiregulin, PGF, GDF15, and BST2, while suppressing IL-18, galectin-3, and LITAF. These secreted proteins may be important in Ni-caused allergic reactions. Ni induced inhibitors of the NFkappaB signaling pathway, and suppressed its activators. Correspondingly, NFkappaB binding sites were found to be overrepresented in the Ni-suppressed genes, whereas cFOS/AP1 binding sites were common in the Ni-induced genes. Significant parallels were found between the Ni-regulated genes and the genes regulated by TGFbeta, EGF, glucocorticoids, or Oncostatin-M. The comprehensive identification of Ni-regulated genes in human epidermal equivalents significantly advances our understanding of the molecular effects of nickel in skin.

  12. Keratinocyte-targeted expression of human laminin γ2 rescues skin blistering and early lethality of laminin γ2 deficient mice.

    Directory of Open Access Journals (Sweden)

    Tracy L Adair-Kirk

    Full Text Available Laminin-332 is a heterotrimeric basement membrane component comprised of the α3, ß3, and γ2 laminin chains. Laminin-332 modulates epithelial cell processes, such as adhesion, migration, and differentiation and is prominent in many embryonic and adult tissues. In skin, laminin-332 is secreted by keratinocytes and is a key component of hemidesmosomes connecting the keratinocytes to the underlying dermis. In mice, lack of expression of any of the three Laminin-332 chains result in impaired anchorage and detachment of the epidermis, similar to that seen in human junctional epidermolysis bullosa, and death occurs within a few days after birth. To bypass the early lethality of laminin-332 deficiency caused by the knockout of the mouse laminin γ2 chain, we expressed a dox-controllable human laminin γ2 transgene under a keratinocyte-specific promoter on the laminin γ2 (Lamc2 knockout background. These mice appear similar to their wild-type littermates, do not develop skin blisters, are fertile, and survive >1.5 years. Immunofluorescence analyses of the skin showed that human laminin γ2 colocalized with mouse laminin α3 and ß3 in the basement membrane zone underlying the epidermis. Furthermore, the presence of "humanized" laminin-332 in the epidermal basement membrane zone rescued the alterations in the deposition of hemidesmosomal components, such as plectin, collagen type XVII/BP180, and integrin α6 and ß4 chains, seen in conventional Lamc2 knockout mice, leading to restored formation of hemidesmosomes. These mice will be a valuable tool for studies of organs deficient in laminin-332 and the role of laminin-332 in skin, including wound healing.

  13. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  14. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  15. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity.

    Science.gov (United States)

    Mauro, Marcella; Crosera, Matteo; Pelin, Marco; Florio, Chiara; Bellomo, Francesca; Adami, Gianpiero; Apostoli, Piero; De Palma, Giuseppe; Bovenzi, Massimo; Campanini, Marco; Filon, Francesca Larese

    2015-07-17

    Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs) have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1) and needle-abraded human skin (experiment 2). Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled-Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm⁻²), while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm⁻²) and those with intact skin (1.08 ± 0.20 ng·cm⁻²). To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue and propidium iodide (PI) uptake assays. The results indicate that a long exposure time (i.e., seven days) was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10-4 M, 95% CL = 0.8-1.9 × 10⁻⁴ M, MTT essay; 3.7 × 10⁻⁵ M, 95% CI = 2.2-6.1 × 10⁻⁵ M, AlamarBlue assay) that seems to be associated to necrotic events (EC50 value: 1.3 × 10⁻⁴ M, 95% CL = 0.9-1.9 × 10⁻⁴ M, PI assay). This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  16. TELOMERE AND TELOMERASE MODULATION BY BERGAMOT POLYPHENOLIC FRACTION IN EXPERIMENTAL PHOTOAGEING IN HUMAN KERATINOCYTES.

    Science.gov (United States)

    Nisticò, S; Ehrlich, J; Gliozzi, M; Maiuolo, J; Del Duca, E; Muscoli, C; Mollace, V

    2015-01-01

    Photoageing represents the addition of extrinsic chronic ultraviolet radiation-induced damage on intrinsic ageing and accounts for most age-associated changes in skin appearance. In this study, we evaluated the effect of 38% BPF, a highly concentrated extract of the bergamot fruit (Citrus bergamia) on UVB-induced photoageing by examining inflammatory cytokine expression, telomere length/telomerase alterations and cellular viability in human immortalized HaCaT keratinocytes. Our results suggest that 38% BPF protects HaCaT cells against UVB-induced oxidative stress and markers of photoageing in a dose-dependent manner and could be a useful supplement in skin care products. Together with antioxidant properties, BPF, a highly concentrated extract of the bergamot fruit, appears to modulate basic cellular signal transduction pathways leading to anti-proliferative, anti-aging and immune modulating responses.

  17. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  18. Cloning and Expression of Human Keratinocyte Growth Factor in Escherichia coli for Recombinant Drug Production

    Directory of Open Access Journals (Sweden)

    Ebrahimzadeh

    2014-09-01

    Full Text Available Background Keratinocyte growth factor (KGF is a member of fibroblast growth factor (FGF family which induces proliferation and differentiation in a wide variety of epithelial tissues. KGF plays an important role in protection, repair of various types of epithelial cells, and re-epithelialization of wounds. Therefore, in patients with hematologic malignancies receiving high doses of chemotherapy and radiotherapy, treatment with KGF decreases the incidence and duration of severe oral mucositis. Objectives The aim of this study was to express the recombinant form of human keratinocyte growth factor in Escherichia coli. Materials and Methods KGF gene was amplified by PCR and cloned into the expression vector pET28a(+. The recombinant vectors were transformed into E. coli BL21(DE3 as expression host and expression of the desired protein was induced by IPTG. The expression was evaluated at RNA and protein levels by reverse transcriptase PCR (RT-PCR and SDS-PAGE analyses, respectively and the expressed protein was confirmed through western blotting. Results Cloning was confirmed by PCR and restriction digestion. RT-PCR and SDS-PAGE represented expression of KGF in E. coli. The optimized expression was achieved 16 hours after induction with 0.3 mM IPTG at 37°C in luria broth (LB containing kanamycin. The 18 kDa protein was confirmed by western blotting, using anti-His antibodies. Conclusions The result of the present study indicated that E. coli expression system was suitable for overexpression of recombinant human KGF and the expressed protein can be considered as a homemade product.

  19. Human melanocytes mitigate keratinocyte-dependent contraction in an in vitro collagen contraction assay.

    Science.gov (United States)

    Rakar, Jonathan; Krammer, Markus P; Kratz, Gunnar

    2015-08-01

    Scarring is an extensive problem in burn care, and treatment can be especially complicated in cases of hypertrophic scarring. Contraction is an important factor in scarring but the contribution of different cell types remains unclear. We have investigated the contractile behavior of keratinocytes, melanocytes and fibroblasts by using an in vitro collagen gel assay aimed at identifying a modulating role of melanocytes in keratinocyte-mediated contraction. Cells were seeded on a collagen type I gel substrate and the change in gel dimensions were measured over time. Hematoxylin & Eosin-staining and immunohistochemistry against pan-cytokeratin and microphthalmia-associated transcription factor showed that melanocytes integrated between keratinocytes and remained there throughout the experiments. Keratinocyte- and fibroblast-seeded gels contracted significantly over time, whereas melanocyte-seeded gels did not. Co-culture assays showed that melanocytes mitigate the keratinocyte-dependent contraction (significantly slower and 18-32% less). Fibroblasts augmented the contraction in most assays (approximately 6% more). Non-contact co-cultures showed some influence on the keratinocyte-dependent contraction. Results show that mechanisms attributable to melanocytes, but not fibroblasts, can mitigate keratinocyte contractile behavior. Contact-dependent mechanisms are stronger modulators than non-contact dependent mechanisms, but both modes carry significance to the contraction modulation of keratinocytes. Further investigations are required to determine the mechanisms involved and to determine the utility of melanocytes beyond hypopigmentation in improved clinical regimes of burn wounds and wound healing.

  20. Immunomodulatory effects of a set of amygdalin analogues on human keratinocyte cells.

    Science.gov (United States)

    Baroni, A; Paoletti, I; Greco, R; Satriano, R A; Ruocco, E; Tufano, M A; Perez, J J

    2005-11-01

    Peptide T (PT) is an octapeptide shown to resolve psoriatic lesions. Our previous investigations suggest that keratinocytes play an important role in conditioning the therapeutic effects of the PT in psoriasis. However, peptides are not good therapeutic agents, because they exhibit poor absorption, are easily metabolized and are immunogenic. Using computational methods, the natural product amygdalin was identified as peptidomimetic of PT. However, amygdalin exhibits a toxic profile due to its cyanide group. To overcome this deleterious effect, we synthesized analogues lacking the cyanide group. Human keratinocytes were treated with PT or with three different peptidomimetics of PT. To study its effects on the expression of HSP-70, TGF-beta, alpha-v integrin, ICAM-1 and cytokines, we analysed the protein levels by Western blot and ELISA. Our results show that the different peptidomimetics of PT tested exhibit a similar biological behaviour in regard to the overexpression of HSP-70, TGF-beta and alpha-v integrin than the native peptide. TNF-alpha is overexpressed by PT and SVT-03018; between the other two analogs, SVT-03016 do not produce any significant change in regard to the control, while SVT-03017 shows only a moderate increase in regard to control. SVT-03018 provokes a remarkable upregulation of IL-10, stronger than SVT-03016, SVT-03017 and PT. All the other three analogues reduce comparably to the PT, the expression of ICAM-1 and do not increase the release of proinflammatory cytokines. The results highlighted that the three analogues of amygdalin with the cyanide group removed exhibit the same biological effects of PT. Therefore, they can be considered peptidomimetics, suggesting their possible use in the treatment of psoriasis.

  1. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  2. Impairment of human keratinocyte mobility and proliferation by advanced glycation end products-modified BSA.

    Science.gov (United States)

    Zhu, Ping; Yang, Chuan; Chen, Li-Hong; Ren, Meng; Lao, Guo-Juan; Yan, Li

    2011-07-01

    The migration and proliferation of keratinocytes is critical to wound re-epithelialization and defects in this function are associated with the clinical phenomenon of chronic non-healing wounds. Advanced glycation end products (AGEs) occur through non-enzymatic glycation of long-lived proteins in diabetes and play important roles in diabetic complications. However, specific roles for AGEs in keratinocyte migration and proliferation, and the underlying molecular mechanisms, have not been fully established. The aim of the current study was to elucidate the interaction between AGE-modified bovine serum albumin (AGE-BSA) and keratinocytes. As a result, we found that AGE-BSA had no effect on the viability of keratinocytes for up to 48 h of incubation with 50 μg/ml of AGE-BSA. AGE-BSA (but not non-glycated BSA) exerted a concentration-dependent suppression of keratinocyte migration at a range of concentrations. The expression of matrix metalloproteinase-9 (MMP-9) was significantly up-regulated in keratinocytes incubated with increasing AGE-BSA, but tissue inhibitor of metalloproteinases-1 (TIMP-1) expression was down-regulated. AGE-BSA also profoundly depressed phospho-focal adhesion kinase-Tyr397 (p-FAK) and α2β1 integrin expression, while total-FAK expression levels remained constant, in keratinocytes. The proliferative capacity of keratinocytes was diminished after 72 h AGE-BSA incubation. Taken together, these findings suggested that in the presence of AGE-BSA, keratinocytes lose their migratory and proliferation abilities. These data also indicated that, in the context of the chronic hyperglycemia in diabetes, the effects of AGE-BSA on keratinocyte migration might be mediated through MMP-9/TIMP-1, p-FAK and α2β1 integrin.

  3. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  4. Modulation of the pro-inflammatory cytokines and matrix metalloproteinases production in co-cultivated human keratinocytes and melanocytes.

    Science.gov (United States)

    Decean, H; Perde-Schrepler, M; Tatomir, C; Fischer-Fodor, E; Brie, I; Virag, P

    2013-10-01

    The human epidermis exerts immunoregulatory functions through the variety of cytokines and other molecules elaborated by keratinocytes and melanocytes. Their constitutive production is very low; however, considerably increased upon stimulation. In vivo, keratinocytes and melanocytes have a typical exposure in the skin, referred as melanocyte epidermal unit. In the present study we co-cultivated these cells in vitro proposing to elucidate some communication links in close cell-to-cell association. We assessed the amounts of IL-6, IL-8, and matrix metalloproteinases (MMP-2 and MMP-9) in individually and co-cultured cells, exposed or not to UVB radiation. Normal human epidermal keratinocytes and melanocytes were grown in specific media and supplements. Cells were exposed to UVB radiation (100 mJ/cm(2)) to create comparable stress to the environmental one. Cytokines were determined with ELISA and confirmed with Western blot and metalloproteinases with gel zimography. Pure cultures of keratinocytes and melanocytes released low amounts of cytokines and metalloproteinases, these secretions being enhanced by UVB irradiation. In co-cultures, the cell-to-cell proximity triggered signals which markedly augmented the cytokines' secretions, whereas metalloproteinases were down-regulated. UVB irradiation did not influence either of these secretions in co-cultures. Concurrently with the highest levels of the pro-inflammatory cytokines, MMP-9 was up-regulated creating pro-inflammatory conditions and premises for changes in cellular survival, differentiation and phenotype. A complex network of interactions occurred between keratinocytes and melanocytes in co-cultures, resulting in modulated pro-inflammatory cytokines and metalloproteinases productions. Therefore, any disturbances in the microenvironmental signaling system and its molecular constituents may result in inflammation or even tumorigenesis in the epidermis.

  5. Pulmonary malformation in transgenic mice expressing human keratinocyte growth factor in the lung.

    Science.gov (United States)

    Simonet, W S; DeRose, M L; Bucay, N; Nguyen, H Q; Wert, S E; Zhou, L; Ulich, T R; Thomason, A; Danilenko, D M; Whitsett, J A

    1995-01-01

    Expression of human keratinocyte growth factor (KGF/FGF-7) was directed to epithelial cells of the developing embryonic lung of transgenic mice disrupting normal pulmonary morphogenesis during the pseudoglandular stage of development. By embryonic day 15.5(E15.5), lungs of transgenic surfactant protein C (SP-C)-KGF mice resembled those of humans with pulmonary cystadenoma. Lungs were cystic, filling the thoracic cavity, and were composed of numerous dilated saccules lined with glycogen-containing columnar epithelial cells. The normal distribution of SP-C proprotein in the distal regions of respiratory tubules was disrupted. Columnar epithelial cells lining the papillary structures stained variably and weakly for this distal respiratory cell marker. Mesenchymal components were preserved in the transgenic mouse lungs, yet the architectural relationship of the epithelium to the mesenchyme was altered. SP-C-KGF transgenic mice failed to survive gestation to term, dying before E17.5. Culturing mouse fetal lung explants in the presence of recombinant human KGF also disrupted branching morphogenesis and resulted in similar cystic malformation of the lung. Thus, it appears that precise temporal and spatial expression of KGF is likely to play a crucial role in the control of branching morphogenesis during fetal lung development. Images Fig. 1 Fig. 2 Fig. 3 PMID:8618921

  6. Interaction of Mycobacterium leprae with the HaCaT human keratinocyte cell line: new frontiers in the cellular immunology of leprosy.

    Science.gov (United States)

    Lyrio, Eloah C D; Campos-Souza, Ivy C; Corrêa, Luiz C D; Lechuga, Guilherme C; Verícimo, Maurício; Castro, Helena C; Bourguignon, Saulo C; Côrte-Real, Suzana; Ratcliffe, Norman; Declercq, Wim; Santos, Dilvani O

    2015-07-01

    Leprosy is a chronic granulomatous disease caused by Mycobacterium leprae affecting the skin and peripheral nerves. Despite M. leprae invasion of the skin and keratinocytes importance in innate immunity, the interaction of these cells in vitro during M. leprae infection is poorly understood. Conventional and fluorescence optical microscopy, transmission electronic microscopy, flow cytometry and ELISA were used to study the in vitro interaction of M. leprae with the HaCaT human keratinocyte cell line. Keratinocytes uptake of M. leprae is described, and modulation of the surface expression of CD80 and CD209, cathelicidin expression and TNF-α and IL-1β production of human keratinocytes are compared with dendritic cells and macrophages during M. leprae interaction. This study demonstrated that M. leprae interaction with human keratinocytes enhanced expression of cathelicidin and greatly increased TNF-α production. The highest spontaneous expression of cathelicidin was by dendritic cells which are less susceptible to M. leprae infection. In contrast, keratinocytes displayed low spontaneous cathelicidin expression and were more susceptible to M. leprae infection than dendritic cells. The results show, for the first time, an active role for keratinocytes during infection by irradiated whole cells of M. leprae and the effect of vitamin D on this process. They also suggest that therapies which target cathelicidin modulation may provide novel approaches for treatment of leprosy.

  7. Effect of lead on IL-8 production and cell proliferation in human oral keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Thaweboon Srosiri; Poomsawat Sopee; Thaweboon Boonyanit

    2010-01-01

    Objective:To investigate the effect of lead on the production of IL-8 and cell proliferation in normal human oral keratinocytes (NHKs). Methods: NHKs were prepared as outgrowths from normal human buccal mucosa. The cells were treated with three concentrations of lead glutamate (4.5í10-5M, 4.5í10-6M and 4.5í10-7M). NHKs grown in glutamic acid were used as control. The amounts of IL-8 secreted in the culture supernatants were evaluated at 12 and 24 h using enzyme-linked immunospecific assay (ELISA). Cell proliferation was determined by the MTT colorimetric assay. Three cultures were used for each experiment, and three independent experiments were performed. Analysis of variance and Duncan’s multiple range tests were used for statistical analysis. Results:An elevation of IL-8 in culture supernatants of NHKs treated with lead at all concentrations at 12 and 24 h after exposure in a dose-dependent manner was revealed. A significant increase in cell numbers was observed only at 24 h exposed to 4.5í10-5M lead glutamate. Conclusions: The capacity of NHKs, to secrete IL-8, enhanced by lead glutamate, is demonstrated here. Induction of cell proliferation is revealed only after exposure to high lead concentration. The elevation of secreted IL-8 is a probable initial sign for the acute inflammatory response and may be involved in the pathogenesis of lead stomatitis.

  8. Biocompatibility Evaluation of Dental Luting Cements Using Cytokine Released from Human Oral Fibroblasts and Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jae-Sung Kwon

    2015-10-01

    Full Text Available Dental luting cements are commonly used in dentistry for cementation of prosthetic restoration. Many previous studies focused on the measurement of the cell viability as the method of cytotoxicity evaluation during biocompatibility study for the material. In this study, the biocompatibility of various dental luting cements were evaluated using the new method of cytokine release measurement in order to better simulate inflammatory reactions in animal or clinical model using two different oral cells; immortalized human gingival fibroblast and immortalized human oral keratinocytes. Cells were exposed to extractions of various commercially available dental luting cements for different durations. Cytokines of IL-1α and IL-8 were measured from the supernatants of the cells and the results were then compared to the conventional MTT viability test. The result from the conventional cell viability study showed a relatively simple and straight forward indication that only one of the dental luting cements tested in this study was cytotoxic with increasing duration of exposure for both cells. Meanwhile, the result from the cytokine measurement study was much more complex at the time point they were measured, type of cells used for the study and the type of cytokines measured, all of which influenced the interpretation of the results. Hence, the better understanding of the cytokine release would be required for the application in biocompatibility evaluation.

  9. PAI-1 transcriptional regulation during the G0 --> G1 transition in human epidermal keratinocytes.

    Science.gov (United States)

    Qi, Li; Allen, Rosalie R; Lu, Qi; Higgins, Craig E; Garone, Rosemarie; Staiano-Coico, Lisa; Higgins, Paul J

    2006-10-01

    Plasminogen activator inhibitor type-1 (PAI-1) is the major negative regulator of the plasmin-dependent pericellular proteolytic cascade. PAI-1 gene expression is normally growth state regulated but frequently elevated in chronic fibroproliferative and neoplastic diseases affecting both stromal restructuring and cellular migratory activities. Kinetic modeling of cell cycle transit in synchronized human keratinocytes (HaCaT cells) indicated that PAI-1 transcription occurred early after serum stimulation of quiescent (G0) cells and prior to entry into a cycling G1 condition. PAI-1 repression (in G0) was associated with upstream stimulatory factor-1 (USF-1) occupancy of two consensus E box motifs (5'-CACGTG-3') at the PE1 and PE2 domains in the PF1 region (nucleotides -794 to -532) of the PAI-1 promoter. Chromatin immunoprecipitation (ChIP) analysis established that the PE1 and PE2 site E boxes were occupied by USF-1 in quiescent cells and by USF-2 in serum-activated, PAI-1-expressing keratinocytes. This reciprocal and growth state-dependent residence of USF family members (USF-1 vs. USF-2) at PE1/PE2 region chromatin characterized the G0 --> G1 transition period and the transcriptional status of the PAI-1 gene. A consensus E box motif was required for USF/E box interactions, as a CG --> AT substitution at the two central nucleotides inhibited formation of USF/probe complexes. The 5' flanking sites (AAT or AGAC) in the PE2 segment were not necessary for USF binding. USF recognition of the PE1/PE2 region E box sites required phosphorylation with several potential involved residues, including T153, maping to the USF-specific region (USR). A T153A substitution in USF-1 did not repress serum-induced PAI-1 expression whereas the T153D mutant was an effective suppressor. As anticipated from the ChIP results, transfection of wild-type USF-2 failed to inhibit PAI-1 induction. Collectively, these data suggest that USF family members are important regulators of PAI-1 gene

  10. EGF receptor signaling blocks aryl hydrocarbon receptor-mediated transcription and cell differentiation in human epidermal keratinocytes

    OpenAIRE

    Sutter, Carrie Hayes; Yin, Hong; Li, Yunbo; Mammen, Jennifer S.; Bodreddigari, Sridevi; Stevens, Gaylene; Cole, Judith A; Sutter, Thomas R.

    2009-01-01

    Dioxin is an extremely potent carcinogen. In highly exposed people, the most commonly observed toxicity is chloracne, a pathological response of the skin. Most of the effects of dioxin are attributed to its activation of the aryl hydrocarbon receptor (AHR), a transcription factor that binds to the Ah receptor nuclear translocator (ARNT) to regulate the transcription of numerous genes, including CYP1A1 and CYP1B1. In cultures of normal human epidermal keratinocytes dioxin accelerates cell diff...

  11. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    OpenAIRE

    Marcella Mauro; Matteo Crosera; Marco Pelin; Chiara Florio; Francesca Bellomo; Gianpiero Adami; Piero Apostoli; Giuseppe Palma; Massimo Bovenzi; Marco Campanini; Francesca Larese Filon

    2015-01-01

    Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs) have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1) and needle-abraded huma...

  12. Impact on Autophagy and Ultraviolet B Induced Responses of Treatment with the MTOR Inhibitors Rapamycin, Everolimus, Torin 1, and pp242 in Human Keratinocytes

    Science.gov (United States)

    Xu, Song; Li, Li; Li, Min; Zhang, Mengli

    2017-01-01

    The mechanistic target of Rapamycin (MTOR) protein is a crucial signaling regulator in mammalian cells that is extensively involved in cellular biology. The function of MTOR signaling in keratinocytes remains unclear. In this study, we detected the MTOR signaling and autophagy response in the human keratinocyte cell line HaCaT and human epidermal keratinocytes treated with MTOR inhibitors. Moreover, we detected the impact of MTOR inhibitors on keratinocytes exposed to the common carcinogenic stressors ultraviolet B (UVB) and UVA radiation. As a result, keratinocytes were sensitive to the MTOR inhibitors Rapamycin, everolimus, Torin 1, and pp242, but the regulation of MTOR downstream signaling was distinct. Next, autophagy induction only was observed in HaCaT cells treated with Rapamycin. Furthermore, we found that MTOR signaling was insensitive to UVB but sensitive to UVA radiation. UVB treatment also had no impact on the inhibition of MTOR signaling by MTOR inhibitors. Finally, MTOR inhibition by Rapamycin, everolimus, or pp242 did not affect the series of biological events in keratinocytes exposed to UVB, including the downregulation of BiP and PERK, activation of Histone H2A and JNK, and cleavage of caspase-3 and PARP. Our study demonstrated that MTOR inhibition in keratinocytes cannot always induce autophagy, and the MTOR pathway does not play a central role in the UVB triggered cellular response.

  13. An ascorbic acid-enriched tomato genotype to fight UVA-induced oxidative stress in normal human keratinocytes.

    Science.gov (United States)

    Petruk, Ganna; Raiola, Assunta; Del Giudice, Rita; Barone, Amalia; Frusciante, Luigi; Rigano, Maria Manuela; Monti, Daria Maria

    2016-10-01

    UVA radiations contribute up to 95% of the total UV exposure and are known to induce cell damage, leading to apoptosis. Since the benefic effects of ascorbic acid on human health are well known, a new tomato genotype (named DHO4), highly rich in ascorbic acid, has been recently obtained. Here, we compared the effects of ascorbic acid and hydrophilic DHO4 extracts in protecting human keratinocytes exposed to UVA stress. Keratinocytes were pre-incubated with ascorbic acid or with extracts from the ascorbic acid enriched tomato genotype and irradiated with UVA light. Then, ROS production, intracellular GSH and lipid peroxidation levels were quantified. Western blots were carried out to evaluate mitogen-activated protein kinases cascade, activation of caspase-3 and inflammation levels. We demonstrated that ROS, GSH and lipid peroxidation levels were not altered in cell exposed to UVA stress when cells were pre-treated with ascorbic acid or with tomato extracts. In addition, no evidence of apoptosis and inflammation were observed in irradiated pre-treated cells. Altogether, we demonstrated the ability of an ascorbic acid enriched tomato genotype to counteract UVA-oxidative stress on human keratinocytes. This protective effect is due to the high concentration of vitamin C that acts as free radical scavenger. This novel tomato genotype may be used as genetic material in breeding schemes to produce improved varieties with higher antioxidant levels.

  14. Tumor necrosis factor beta and ultraviolet radiation are potent regulators of human keratinocyte ICAM-1 expression

    Energy Technology Data Exchange (ETDEWEB)

    Krutmann, J.; Koeck, A.S.; Schauer, E.; Parlow, F.; Moeller, A.K.; Kapp, A.; Foerster, E.S.; Schoepf, E.L.; Luger, T.A. (Univ. of Freiburg (Germany, F.R.))

    1990-08-01

    Intercellular adhesion molecule-1 (ICAM-1) functions as a ligand of leukocyte function-associated antigen-1 (LFA-1), as well as a receptor for human picorna virus, and its regulation thus affects various immunologic and inflammatory reactions. The weak, constitutive ICAM-1 expression on human keratinocytes (KC) can be up-regulated by cytokines such as interferon-gamma (IFN gamma) and tumor necrosis factor alpha (TNF alpha). In order to further examine the regulation of KC ICAM-1 expression, normal human KC or epidermoid carcinoma cells (KB) were incubated with different cytokines and/or exposed to ultraviolet (UV) radiation. Subsequently, ICAM-1 expression was monitored cytofluorometrically using a monoclonal anti-ICAM-1 antibody. Stimulation of cells with recombinant human (rh) interleukin (IL) 1 alpha, rhIL-4, rhIL-5, rhIL-6, rh granulocyte/macrophage colony-stimulating factor (GM-CSF), rh interferon alpha (rhIFN alpha), and rh transforming growth factor beta (TGF beta) did not increase ICAM-1 surface expression. In contrast, rhTNF beta significantly up-regulated ICAM-1 expression in a time- and dose-dependent manner. Moreover, the combination of rhTNF beta with rhIFN gamma increased the percentage of ICAM-1-positive KC synergistically. This stimulatory effect of rhTNF beta was further confirmed by the demonstration that rhTNF beta was capable of markedly enhancing ICAM-1 mRNA expression in KC. Finally, exposure of KC in vitro to sublethal doses of UV radiation (0-100 J/m2) prior to cytokine (rhIFN tau, rhTNF alpha, rhTNF beta) stimulation inhibited ICAM-1 up-regulation in a dose-dependent fashion. These studies identify TNF beta and UV light as potent regulators of KC ICAM-1 expression, which may influence both attachment and detachment of leukocytes and possibly viruses to KC.

  15. Vitamin C Compound Mixtures Prevent Ozone-Induced Oxidative Damage in Human Keratinocytes as Initial Assessment of Pollution Protection.

    Directory of Open Access Journals (Sweden)

    Giuseppe Valacchi

    Full Text Available One of the main functions of cutaneous tissues is to protect our body from the outdoor insults. Ozone (O3 is among the most toxic stressors to which we are continuously exposed and because of its critical location, the skin is one of the most susceptible tissues to the oxidative damaging effect of O3. O3 is not able to penetrate the skin, and although it is not a radical per se, the damage is mainly a consequence of its ability to induce oxidative stress via the formation of lipid peroxidation products.In this study we investigated the protective effect of defined "antioxidant" mixtures against O3 induced oxidative stress damage in human keratinocytes and understand their underlying mechanism of action.Results showed that the mixtures tested were able to protect human keratinocytes from O3-induced cytotoxicity, inhibition of cellular proliferation, decrease the formation of HNE protein adducts, ROS, and carbonyls levels. Furthermore, we have observed the decreased activation of the redox sensitive transcription factor NF-kB, which is involved in transcribing pro-inflammatory cytokines and therefore constitutes one of the main players associated with O3 induced skin inflammation. Cells exposed to O3 demonstrated a dose dependent increase in p65 subunit nuclear expression as a marker of NF-kB activation, while pre-treatment with the mixtures abolished NF-kB nuclear translocation. In addition, a significant activation of Nrf2 in keratinocytes treated with the mixtures was also observed.Overall this study was able to demonstrate a protective effect of the tested compounds versus O3-induced cell damage in human keratinocytes. Pre-treatment with the tested compounds significantly reduced the oxidative damage induced by O3 exposure and this protective effect was correlated to the abolishment of NF-kB nuclear translocation, as well as activation of Nrf2 nuclear translocation activating the downstream defence enzymes involved in cellular detoxification

  16. Selective peroxidation and externalization of phosphatidylserine in normal human epidermal keratinocytes during oxidative stress induced by cumene hydroperoxide.

    Science.gov (United States)

    Shvedova, Anna A; Tyurina, Julia Y; Kawai, Kazuaki; Tyurin, Vladimir A; Kommineni, Choudari; Castranova, Vincent; Fabisiak, James P; Kagan, Valerian E

    2002-06-01

    Reactive oxygen species not only modulate important signal transduction pathways, but also induce DNA damage and cytotoxicity in keratinocytes. Hydrogen peroxide and organic peroxides are particularly important as these chemicals are widely used in dermally applied cosmetics and pharmaceuticals, and also represent endogenous metabolic intermediates. Lipid peroxidation is of fundamental interest in the cellular response to peroxides, as lipids are extremely sensitive to oxidation and lipid-based signaling systems have been implicated in a number of cellular processes, including apoptosis. Oxidation of specific phospholipid classes was measured in normal human epidermal keratinocytes exposed to cumene hydroperoxide after metabolic incorporation of the fluorescent oxidation-sensitive fatty acid, cis-parinaric acid, using a fluorescence high-performance liquid chromatography assay. In addition, lipid oxidation was correlated with changes in membrane phospholipid asymmetry and other markers of apoptosis. Although cumene hydroperoxide produced significant oxidation of cis-parinaric acid in all phospholipid classes, one phospholipid, phosphatidylserine, appeared to be preferentially oxidized above all other species. Using fluorescamine derivatization and annexin V binding it was observed that specific oxidation of phosphatidylserine was accompanied by phosphatidylserine translocation from the inner to the outer plasma membrane surface where it may serve as a recognition signal for interaction with phagocytic macrophages. These effects occurred much earlier than any detectable changes in other apoptotic markers such as caspase-3 activation, DNA fragmentation, or changes in nuclear morphology. Thus, normal human epidermal keratinocytes undergo profound lipid oxidation with preference for phosphatidylserine followed by phosphatidylserine externalization upon exposure to cumene hydroperoxide. It is therefore likely that normal human epidermal keratinocytes exposed to similar

  17. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress

    Science.gov (United States)

    KIM, KI CHEON; PIAO, MEI JING; HEWAGE, SUSARA RUWAN KUMARA MADDUMA; HAN, XIA; KANG, KYOUNG AH; JO, JIN OH; MOK, YOUNG SUN; SHIN, JENNIFER H.; PARK, YEUNSOO; YOO, SUK JAE; HYUN, JIN WON

    2016-01-01

    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The levels of intracellular reactive oxygen species (ROS) were determined using 2′,7′-dichlorodihydro-fluorescein diacetate and dihydroethidium was used to monitor superoxide anion production. Plasma induced the generation of ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals. N-acetyl cysteine, which is an antioxidant, prevented the decrease in cell viability caused by exposure to plasma. ROS generated by exposure to plasma resulted in damage to various cellular components, including lipid membrane peroxidation, DNA breaks and protein carbonylation, which was detected by measuring the levels of 8-isoprostane and diphenyl-1-pyrenylphosphine assay, comet assay and protein carbonyl formation. These results suggest that plasma exerts cytotoxic effects by causing oxidative stress-induced damage to cellular components. PMID:26573561

  18. Immunochemistry of a keratinocyte-fibroblast co-culture model for reconstruction of human skin.

    Science.gov (United States)

    Fleischmajer, R; MacDonald, E D; Contard, P; Perlish, J S

    1993-09-01

    Our purpose was to determine differentiation markers of an in vitro co-culture model in which fibroblasts grown in a three-dimensional nylon mesh were recombined with human keratinocytes. The cultures were kept for 5 weeks and then processed for electron microscopy and immunochemistry. The specimens revealed an epidermis, a basal lamina, an anchoring zone, and a dermis. Epidermal differentiation was confirmed by the presence of K10-keratin, trichohyalin, and filaggrin. The basal lamina contained Type IV collagen, laminin, nidogen, and heparan sulfate. Type IV collagen, laminin, and nidogen were also noted in the extracellular matrix. Type VI collagen was present in the anchoring zone and also gave a reticulated pattern in the rest of the dermis. There was a heavy signal for tenascin and fibronectin throughout the dermis. Osteonectin was restricted to the epidermis and dermal fibroblasts. Fibrillin stained at the anchoring zone and dermis but elastin and vitronectin were negative, suggesting early formation of elastic fibrils. Collagen fibrils stained for Types I, III, and V, as well as the amino propeptide of Types I and III procollagen, suggesting newly synthesized collagen. Decorin was present throughout the dermis. The model described appears suitable for in vitro reconstruction of the skin and may be useful to study the development of various supramolecular skin structures.

  19. Increase of integrin α6+p63+ cells after ultraviolet B irradiation in normal human keratinocytes

    Directory of Open Access Journals (Sweden)

    Gyeong-hun Park

    2009-12-01

    Full Text Available Epidermal stem cells (SC are believed to be resistant to environmental damage for the purpose of self renewal. Most promising SC markers include integrin a6 and p63. The aim of our study was to determine whether the integrin a6+p63+ cell fraction representative of the epidermal progenitor or SC is increased after ultraviolet B (UVB irradiation and to clarify the hypothesis that epidermal SC are resistant to high-dose UVB damage. We irradiated early passage normal human keratinocytes (NHK with 0, 25, 50, and 100 mJ/cm2 UVB. The percentage of cell death was calculated. Real-time reverse transcriptase-polymerase chain reaction (RT-PCR and western blotting analyses were performed to identify integrin a6 and p63, and flow cytometry analysis with integrin a6 and p63 antibodies was done. After 50 and 100 mJ/cm2 UVB, integrin a6+p63+cells were found to be much increased by fluorescence-activated cell sorting. Expression of integrin a6 and p63 was increased in NHK after UVB irradiation, which was shown with real-time RT-PCR and western blotting analyses. We concluded that an increase of integrin a6+p63+ cells after high-dose UVB may suggest that the putative progenitor or SC are resistant to UVB irradiation.

  20. Gene Expression Profiling of Human Epidermal Keratinocytes in Simulated Microgravity and Recovery Cultures

    Institute of Scientific and Technical Information of China (English)

    Jade Q. Clement; Shareen M. Lacy; Bobby L. Wilson

    2008-01-01

    Simulated microgravity (SMG) bioreactors and DNA microarray technology are powerful tools to identify "space genes" that play key roles in cellular response to microgravity. We applied these biotechnology tools to investigate SMG and post-SMG recovery effects on human epidermal keratinocytes by exposing cells to SMG for 3,4,9, and 10d using the high aspect ratio vessel bioreactor followed by recovery culturing for 15,50, and 60d in normal gravity. As a result, we identified 162 differentially expressed genes, 32 of which were "center genes" that were most consistently affected in the time course experiments. Eleven of the center genes were from the integrated stress response pathways and were coordinately down regulated. Another seven of the center genes, which are all metallothionein MT-Ⅰ and MT-Ⅱ isoforms, were coordinately up-regulated. In addition, HLA-G, a key gene in cellular immune response suppression, was found to be significantly upregulated during the recovery phase. Overall, more than 80% of the differentially expressed genes from the shorter exposures (≤4d) recovered in 15d; for longer (≥9d) exposures, more than 50d were needed to recover to the impact level of shorter exposures. The data indicated that shorter SMG exposure duration would lead to quicker and more complete recovery from the microgravity effect.

  1. Protective effect of trehalose-loaded liposomes against UVB-induced photodamage in human keratinocytes

    Science.gov (United States)

    EMANUELE, ENZO; BERTONA, MARCO; SANCHIS-GOMAR, FABIAN; PAREJA-GALEANO, HELIOS; LUCIA, ALEJANDRO

    2014-01-01

    Trehalose, a naturally occurring non-reducing disaccharide, is known to act as a major protein stabilizer that can reduce ultraviolet B (UVB)-induced corneal damage when topically applied to the eye. However, due to the low skin permeability of trehalose, which makes the development of topical formulations difficult, its use as a skin photoprotective agent has been limited. Previous findings demonstrated that liposomes may significantly improve the intracellular delivery of trehalose. Therefore, the present study aimed to assess the protective effects of trehalose-loaded liposomes against UVB-induced photodamage using the immortalized human keratinocyte cell line, HaCaT. The effects were also compared to those of the common skin photoprotective compounds, including L-carnosine, L-(+)-ergothioneine, L-ascorbic acid and DL-α-tocopherol. The levels of cyclobutane pyrimidine dimers, 8-hydroxy-2′-deoxyguanosine and protein carbonylation in HaCaT cells were used as biological markers of UVB-induced damage. Compared to other compounds, trehalose-loaded liposomes showed the highest efficacy in reducing the levels of the three markers following UVB irradiation of HaCaT cells (all P<0.001 when compared to each of the four other photoprotective compounds). Therefore, these findings indicate that there may be a clinical application for trehalose-loaded liposomes, and further studies should be performed to assess the potential usefulness in skin photoprotection and the prevention of non-melanoma skin cancer. PMID:25054023

  2. A mint purified extract protects human keratinocytes from short-term, chemically induced oxidative stress.

    Science.gov (United States)

    Berselli, Patrizia Valeria Rita; Zava, Stefania; Montorfano, Gigliola; Corsetto, Paola Antonia; Krzyzanowska, Justyna; Oleszek, Wieslaw; Berra, Bruno; Rizzo, Angela Maria

    2010-11-10

    Oxidative stress is strictly correlated to the pathogenesis of many diseases, and a diet rich in fruits and vegetables, or adequately integrated, is currently considered to be a protective and preventive factor. This study aimed to analyze the efficacy of a 1 h preincubation with the highest nontoxic dose of a characterized Mentha longifolia extract (80 μg/mL) in protecting human keratinocytes (NCTC2544) from chemically induced oxidative stress (500 μM H2O2 for 2, 16, and 24 h). As reference synthetic pure compounds rosmarinic acid (360.31 μg/mL), a major mint phenolic constituent, and resveratrol (31.95 mg/mL), a well-known antioxidant, were used. Cellular viability was significantly protected by mint, which limited protein and DNA damage, decreased lipid peroxidation, and preserved glutathione and superoxide dismutase activity in the shorter phases of oxidative stress induction, in extents comparable to or better than those of pure compounds. These data suggest that mint use as only a flavoring has to be revised, taking into consideration its enrichment in foodstuff and cosmetics.

  3. Gracilaria bursa-pastoris (Gmelin) Silva extract attenuates ultraviolet B radiation-induced oxidative stress in human keratinocytes.

    Science.gov (United States)

    Piao, M J; Kim, K C; Zheng, J; Yao, C W; Cha, J W; Kang, H K; Yoo, E S; Koh, Y S; Ko, M H; Lee, N H; Hyun, Jin Won

    2014-01-01

    The purpose of this study was to assess the protective effects of an ethanol extract derived from the red alga Gracilaria bursa-pastoris (Gmelin) Silva (GBE) on ultraviolet B (UVB)-irradiated human HaCaT keratinocytes. GBE exhibited scavenging activity against intracellular reactive oxygen species that were induced by either hydrogen peroxide or UVB radiation. In addition, both the superoxide anion and the hydroxyl radical were scavenged by GBE in cell-free systems. GBE absorbed light in the UVB range (280-320 nm) of the electromagnetic spectrum and lessened the extent of UVB-induced oxidative damage to cellular lipids, proteins, and DNA. Finally, GBE-treated keratinocytes showed a reduction in UVB-induced apoptosis, as exemplified by fewer apoptotic bodies. These results suggest that GBE exerts cytoprotective actions against UVB-stimulated oxidative stress by scavenging ROS and absorbing UVB rays, thereby attenuating injury to cellular constituents and preventing cell death.

  4. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Hanwen [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC 29208 (United States); Pirisi, Lucia [Department of Pathology, Microbiology and Immunology, University of South Carolina School of Medicine, University of South Carolina, Columbia, SC 29208 (United States); Creek, Kim E., E-mail: creekk@sccp.sc.edu [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC 29208 (United States)

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling.

  5. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yi; Pirisi, Lucia [Department of Pathology, Microbiology and Immunology, School of Medicine, University of South Carolina, Columbia, SC (United States); Creek, Kim E., E-mail: creekk@sccp.sc.edu [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC (United States)

    2013-09-15

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski.

  6. Incorporation and distribution of dihomo-gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1986-02-01

    Human keratinocytes in culture were labelled with /sup 14/C-dihomo-gamma-linolenic acid, /sup 14/C-arachidonic acid or /sup 14/C-eicosapentaenoic acid. All three eicosanoid precursor fatty acids were effectively incorporated into the cells. In phospholipids most of the radioactivity was recovered, in neutral lipids a substantial amount, and as free unesterified fatty acids only a minor amount. Most of the radioactivity was found in phosphatidylethanolamine which was also the major phospholipid as measured by phosphorous assay. The incorporation of dihomo-gamma-linolenic acid and arachidonic acid into lipid subfractions was essentially similar. Eicosapentaenoic acid was, however, much less effectively incorporated into phosphatidylinositol + phosphatidylserine and, correspondingly, more effectively into triacylglycerols as compared to the two other precursor fatty acids. Once incorporated, the distribution of all three precursor fatty acids was relatively stable, and only minor amounts of fatty acids were released into the culture medium during short term culture (two days). Our study demonstrates that eicosanoid precursor fatty acids are avidly taken up by human keratinocytes and esterified into membrane lipids. The clinical implication of this finding is that dietary manipulations might be employed to cause changes in the fatty acid composition of keratinocytes.

  7. Role of VEGF receptors in normal and psoriatic human keratinocytes: evidence from irradiation with different UV sources.

    Directory of Open Access Journals (Sweden)

    Jian-Wei Zhu

    Full Text Available Vascular endothelial growth factor (VEGF promotes angiogenesis and plays important roles both in physiological and pathological conditions. VEGF receptors (VEGFRs are high-affinity receptors for VEGF and are originally considered specific to endothelial cells. We previously reported that VEGFRs were also constitutively expressed in normal human keratinocytes and overexpressed in psoriatic epidermis. In addition, UVB can activate VEGFRs in normal keratinocytes, and the activated VEGFR-2 signaling is involved in the pro-survival mechanism. Here, we show that VEGFRs were also upregulated and activated by UVA in normal human keratinocytes via PKC, and interestingly, both the activated VEGFR-1 and VEGFR-2 protected against UVA-induced cell death. As VEGFRs were over-expressed in psoriatic epidermis, we further investigated whether narrowband UVB (NB-UVB phototherapy or topical halomethasone monohydrate 0.05% cream could affect their expression. Surprisingly, the over-expressed VEGFRs in psoriatic epidermis were significantly attenuated by both treatments. During NB-UVB therapy, VEGFRs declined first in the basal, and then gradually in the upper psoriatic epidermis. VEGFRs were activated in psoriatic epidermis, their activation was enhanced by NB-UVB, but turned undetectable after whole therapy. This process was quite different from that by halomethasone, in which VEGFRs and phospho-VEGFRs decreased in a gradual, homogeneous manner. Our findings further suggest that UV-induced activation of VEGFRs serves as a pro-survival signal for keratinocytes. In addition, VEGFRs may be involved in the pathological process of psoriasis, and UV phototherapy is effective for psoriasis by directly modulating the expression of VEGFRs.

  8. Ubiquitin/proteasome pathway regulates levels of retinoic acid receptor gamma and retinoid X receptor alpha in human keratinocytes.

    Science.gov (United States)

    Boudjelal, M; Wang, Z; Voorhees, J J; Fisher, G J

    2000-04-15

    Repeated exposure of human skin to solar UV radiation leads to premature aging (photoaging) and skin cancer. UV-induced skin damage can be ameliorated by all-trans retinoic acid treatment. The actions of retinoic acid in skin keratinocytes are mediated primarily by nuclear retinoic acid receptor gamma (RARgamma) and retinoid X receptor alpha (RXRalpha). We found that exposure of cultured primary human keratinocytes to UV irradiation (30 mJ/cm2) substantially reduced (50-90%) RARgamma and RXRalpha mRNA and protein within 8 h. The rates of disappearance of RARgamma and RXRalpha proteins after UV exposure or treatment with the protein synthesis inhibitor cycloheximide were similar. UV irradiation did not increase the rate of breakdown of RARgamma or RXRalpha but rather reduced their rate of synthesis. The addition of proteasome inhibitors MG132 and LLvL, but not the lysosomal inhibitor E64, prevented loss of RARgamma and RXRalpha proteins after exposure of keratinocytes to either UV radiation or cycloheximide. Soluble extracts from nonirradiated or UV-irradiated keratinocytes possessed similar levels of proteasome activity that degraded RARgamma and RXRalpha proteins in vitro. Furthermore, RARgamma and RXRalpha were polyubiquitinated in intact cells. RXRalpha was found to contain two proline, glutamate/aspartate, serine, and threonine (PEST) motifs, which confer rapid turnover of many short-lived regulatory proteins that are degraded by the ubiquitin/proteasome pathway. However, the PEST motifs in RXRalpha did not function to regulate its stability, because deletion of the PEST motifs individually or together did not alter ubiquitination or proteasome-mediated degradation of RXRalpha. These results demonstrate that loss of RARgamma and RXRalpha proteins after UV irradiation results from degradation via the ubiquitin/proteasome pathway. Taken together, the data here indicate that ubiquitin/proteasome-mediated breakdown is an important mechanism regulating the levels of

  9. Regulation of migratory activity of human keratinocytes by topography of multiscale collagen-containing nanofibrous matrices.

    Science.gov (United States)

    Fu, Xiaoling; Xu, Meng; Liu, Jie; Qi, Yanmei; Li, Shaohua; Wang, Hongjun

    2014-02-01

    Nanofibrous matrices hold great promise in skin wound repair partially due to their capability of recapturing the essential attributes of native extracellular matrix (ECM). With regard to limited studies on the effect of nanofibrous matrices on keratinocytes, the present study was aimed to understand how the topographical feature of nanofibrous matrices regulates keratinocyte motility by culturing keratinocytes on polycaprolactone (PCL)/collagen nanofibrous matrices (rough surface with fiber diameters of 331 ± 112 nm) or the matrices coated with a thin layer of collagen gel to form a secondary ultrafine fibrous network (smooth surface with ultrafine fiber diameters of 55 ± 26 nm). It was found that the PCL/collagen nanofibrous matrices alone did not stimulate cell migration, while collagen gel coating could significantly increase cell motility. Further studies demonstrated that the ultrafine fibrous network of collagen gel coating significantly activated integrin β1, Rac1 and Cdc42, facilitated the deposition of laminin-332 (formerly called laminin-5), and promoted the expression of active matrix metalloproteinases (MMPs) (i.e., MMP-2 and 9). Neutralization of integrin β1 activity abrogated the gel coating-induced keratinocyte migration. These findings provide important evidence on the role of topographical features of nanofibrous matrices in regulating the phenotypic alteration of keratinocytes and suggest the possible utility of collagen-containing nanofibrous matrices for skin regeneration especially in re-epithelialization.

  10. A Novel Controllable Hydrogen Sulfide-Releasing Molecule Protects Human Skin Keratinocytes Against Methylglyoxal-Induced Injury and Dysfunction

    Directory of Open Access Journals (Sweden)

    Chun-tao Yang

    2014-09-01

    Full Text Available Background/Aim: Delayed wound healing is a common skin complication of diabetes, which is associated with keratinocyte injury and dysfunction. Levels of methylglyoxal (MGO, an α-dicarbonyl compound, are elevated in diabetic skin tissue and plasma, while levels of hydrogen sulfide (H2S, a critical gaseous signaling molecule, are reduced. Interestingly, the gas has shown dermal protection in our previous study. To date, there is no evidence demonstrating whether MGO affects keratinocyte viability and function or H2S donation abolishes these effects and improves MGO-related impairment of wound healing. The current study was conducted to examine the effects of MGO on the injury and function in human skin keratinocytes and then to evaluate the protective action of a novel H2S-releasing molecule. Methods: An N-mercapto-based H2S donor (NSHD-1 was synthesized and its ability to release H2S was observed in cell medium and cells, respectively. HaCaT cells, a cell line of human skin keratinocyte, were exposed to MGO to establish an in vitro diabetic wound healing model. NSHD-1 was added to the cells before MGO exposure and the improvement of cell function was observed in respect of cellular viability, apoptosis, oxidative stress, mitochondrial membrane potential (MMP and behavioral function. Results: Treatment with MGO decreased cell viability, induced cellular apoptosis, increased intracellular reactive oxygen species (ROS content and depressed MMP in HaCaT cells. The treatment also damaged cell behavioral function, characterized by decreased cellular adhesion and migration. The synthesized H2S-releasing molecule, NSHD-1, was able to increase H2S levels in both cell medium and cells. Importantly, pretreatment with NSHD-1 inhibited MGO-induced decreases in cell viability and MMP, increases in apoptosis and ROS accumulation in HaCaT cells. The pretreatment was also able to improve adhesion and migration function. Conclusion: These results demonstrate that

  11. Differential cytotoxicity of long-chain bases for human oral gingival epithelial keratinocytes, oral fibroblasts, and dendritic cells

    Directory of Open Access Journals (Sweden)

    Leslie A. Mehalick

    2015-12-01

    Full Text Available Long-chain bases, found in the oral cavity, have potent antimicrobial activity against oral pathogens. In an article associated with this dataset, Poulson and colleagues determined the cytotoxicities of long-chain bases (sphingosine, dihydrosphingosine, and phytosphingosine for human oral gingival epithelial (GE keratinocytes, oral gingival fibroblasts (GF, dendritic cells (DC, and squamous cell carcinoma (SCC cell lines [1]. Poulson and colleagues found that GE keratinocytes were more resistant to long-chain bases as compared to GF, DC, and SCC cell lines [1]. In this study, we assess the susceptibility of DC to lower concentrations of long chain bases. 0.2–10.0 µM long-chain bases and GML were not cytotoxic to DC; 40.0–80.0 µM long-chain bases, but not GML, were cytotoxic for DC; and 80.0 µM long-chain bases were cytotoxic to DC and induced cellular damage and death in less than 20 mins. Overall, the LD50 of long-chain bases for GE keratinocytes, GF, and DC were considerably higher than their minimal inhibitory concentrations for oral pathogens, a finding important to pursuing their future potential in treating periodontal and oral infections.

  12. Cytotoxicity and chromosome aberrations in normal human oral keratinocytes induced by chemical carcinogens: Comparison of inter-individual variations.

    Science.gov (United States)

    Tsutsui, T; Kawamoto, Y; Suzuki, N; Gladen, B C; Barrett, J C

    1991-01-01

    Normal human keratinocytes from the oral cavity were cultured in vitro in serum-free medium. Cultures from different individuals were established, and the responses of the cells to different chemicals were compared. The cells, grown at clonal densities, were treated separately with an alkylating agent (N-methyl-N'-nitro-N-nitrosoguanidine; MNNG), two arsenical salts (sodium arsenate or sodium arsenite), sodium fluoride or two polyaromatic hydrocarbons (benzo[a]pyrene or 7,12-dimethylbenz[a]-anthracene). There were no significant differences in the colony-forming efficiencies (22.8 +/- 4.2%) of control (untreated) cells from five different individuals. At selected doses, each of the chemicals reduced the colony-forming efficiencies of the treated cells. The cytotoxicity of most of the chemicals did not differ significantly among cells derived from different individuals, with the exception of sodium arsenate at two doses and sodium fluoride at the highest dose tested. Induction of chromosome aberrations by MNNG, sodium arsenite, sodium arsenate and sodium flouride was analysed with cells derived from up to nine individuals. There was little difference in the inducibilities of chromosome aberrations among cultured keratinocytes from different donors. Treatment of cells from nine donors with one dose of sodium fluoride revealed a statistically significant inter-individual variation. These findings provide a model system to study the effects of carcinogens on the target cells for oral cancers. The results can be compared with findings for cells from other epithelial tissues, since the culture conditions support the growth of keratinocytes regardless of origin. Little inter-individual variation was observed in the response of oral keratinocytes to the chemicals examined.

  13. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  14. Potential Wound Healing Activities of Galla Rhois in Human Fibroblasts and Keratinocytes.

    Science.gov (United States)

    Park, Hyo-Hyun; Park, Na-Young; Kim, Sun-Gun; Jeong, Kyu-Tae; Lee, Eu-Jin; Lee, Eunkyung

    2015-01-01

    Wound healing is a complex process orchestrated by the regeneration of the epithelium and the remodeling of the extracellular matrix through processes like collagen deposition. Galla Rhois has been widely used in traditional Korean medicine for its various pharmacological effects, including an anticoccidial effect, however, little is known about its healing activity. The purpose of this study was to determine the effects of Galla Rhois ethanol extract (GRE) on wound healing activities, including H2O2-induced oxidative stress, cell migration, and lactate dehydrogenase (LDH) release assays using human keratinocyte (HaCaT) and dermal fibroblasts (CCD-986SK). In addition, total soluble collagen deposition and collagen gene expression for Type I and III collagen were evaluated in CCD-986SK. Total tannin and flavonoid contents for GRE were measured. GRE induced a significant increase in the number and migration of cells, along with a decrease in cell death and LDH release. In addition, it also induced the over-expression of collagen Type I and III mRNA and caused increased synthesis of total soluble collagen. The contents of total tannin and flavonoid for GRE were 55.7% ([Formula: see text][Formula: see text]mg/g) and 62.9% ([Formula: see text][Formula: see text]mg/g), respectively. The results suggest that GRE can cause accelerated wound healing by increasing cell survival, proliferation, migration, and collagen synthesis along with a potential anti-oxidant property. This evidence provides novel insight into natural therapy for tissue injury.

  15. Human papillomavirus type 59 immortalized keratinocytes express late viral proteins and infectious virus after calcium stimulation.

    Science.gov (United States)

    Lehr, Elizabeth E; Qadadri, Brahim; Brown, Calla R; Brown, Darron R

    2003-09-30

    Human papillomavirus type 59 (HPV 59) is an oncogenic type related to HPV 18. HPV 59 was recently propagated in the athymic mouse xenograft system. A continuous keratinocyte cell line infected with HPV 59 was created from a foreskin xenograft grown in an athymic mouse. Cells were cultured beyond passage 50. The cells were highly pleomorphic, containing numerous abnormally shaped nuclei and mitotic figures. HPV 59 sequences were detected in the cells by DNA in situ hybridization in a diffuse nuclear distribution. Southern blots were consistent with an episomal state of HPV 59 DNA at approximately 50 copies per cell. Analysis of the cells using a PCR/reverse blot strip assay, which amplifies a portion of the L1 open reading frame, was strongly positive. Differentiation of cells in monolayers was induced by growth in F medium containing 2 mM calcium chloride for 10 days. Cells were harvested as a single tissue-like sheet, and histologic analysis revealed a four-to-six cell-thick layer. Transcripts encoding involucrin, a cornified envelope protein, and the E1/E4 and E1/E4/L1 viral transcripts were detected after several days of growth in F medium containing 2 mM calcium chloride. The E1/E4 and L1 proteins were detected by immunohistochemical analysis, and virus particles were seen in electron micrographs in a subset of differentiated cells. An extract of differentiated cells was prepared by vigorous sonication and was used to infect foreskin fragments. These fragments were implanted into athymic mice. HPV 59 was detected in the foreskin xenografts removed 4 months later by DNA in situ hybridization and PCR/reverse blot assay. Thus, the complete viral growth cycle, including production on infectious virus, was demonstrated in the HPV 59 immortalized cells grown in a simple culture system.

  16. Nicotinamide attenuates aquaporin 3 overexpression induced by retinoic acid through inhibition of EGFR/ERK in cultured human skin keratinocytes.

    Science.gov (United States)

    Song, Xiuzu; Xu, Aie; Pan, Wei; Wallin, Brittany; Kivlin, Rebecca; Lu, Shan; Cao, Cong; Bi, Zhigang; Wan, Yinsheng

    2008-08-01

    The most common adverse effects that are related to all-trans retinoic acid (atRA) treatment are irritation and dryness of the skin. atRA therapy is reported to impair barrier function as achieved by trans-epidermal water loss (TEWL). Treatment with nicotinamide prior to initiation of atRA therapy provides additional barrier protection and thus reduces susceptibility of retinoic acid. Our previous studies showed that atRA upregulates aquaporin 3 (AQP3) in cultured human skin keratinocytes and fibroblasts. Others have demonstrated that in atopic dermatitis, overexpression of AQP3 is linked to elevated TEWL and that nicotinamide treatment reduces skin TEWL. In this study, we observed that while atRA upregulates AQP3 expression in cultured human skin keratinocytes (HaCaT cells), nicotinamide attenuates the effect of atRA in a concentration-dependent manner. atRA treatment induces EGFR and ERK activation. PD153035, an EGFR inhibitor, and U0126, an ERK inhibitor, inhibit atRA-induced upregulation of AQP3. Nicotinamide also inhibits atRA-induced activation of EGFR/ERK signal transduction and decreases water permeability by downregulating AQP3 expression. Collectively, our results indicate that the effect of atRA on AQP3 expression is at least partly mediated by EGFR/ERK signaling in cultured human skin keratinocytes. Nicotinamide attenuates atRA-induced AQP3 expression through inhibition of EGFR/ERK signal transduction and eventually decreases water permeability and water loss. Our study provides insights into the molecular mechanism through which nicotinamide reverses the side effects of dryness in human skin after treatment with atRA.

  17. Activated protein C: A regulator of human skin epidermal keratinocyte function

    Institute of Scientific and Technical Information of China (English)

    Kelly; McKelvey; Christopher; John; Jackson; Meilang; Xue

    2014-01-01

    Activated protein C(APC) is a physiological anticoagulant, derived from its precursor protein C(PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor(EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC’s function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  18. Activated protein C: A regulator of human skin epidermal keratinocyte function.

    Science.gov (United States)

    McKelvey, Kelly; Jackson, Christopher John; Xue, Meilang

    2014-05-26

    Activated protein C (APC) is a physiological anticoagulant, derived from its precursor protein C (PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor (EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC's function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  19. The Parkinsonism-associated protein DJ-1/Park7 prevents glycation damage in human keratinocyte.

    Science.gov (United States)

    Advedissian, Tamara; Deshayes, Frédérique; Poirier, Françoise; Viguier, Mireille; Richarme, Gilbert

    2016-04-22

    Reducing sugars and dicarbonyls form covalent adducts with proteins through a nonenzymatic process known as glycation, which inactivates proteins, is increased in diabetic patients and is associated with diabetic complications, including retinopathy, cataracts, nephropathy, neuropathy, cardiomyopathy and skin defects. We recently characterized DJ-1/Park7 as a protein deglycase that repairs proteins from glycation by glyoxal and methylglyoxal, two major glycating agents which are responsible for up to 65% of glycation events. In this study, we investigated the ability of DJ-1 to prevent protein glycation in keratinocytes. Glycation of collagen and keratinocyte proteins was tested by measuring ultraviolet absorption and fluorescence emission. Protein glycation in HaCaT keratinocytes was investigated by immunodetection with anti-advanced glycation endproduct antibodies, after DJ-1 depletion or overexpression. In vitro, DJ-1 prevented glycation of collagen and keratinocyte protein extracts. In cell culture, DJ-1 depletion by small interfering RNAs resulted in a 3-fold increase in protein glycation levels. Moreover, protein glycation levels were decreased several-fold in cells overexpressing DJ-1 after addition of the Nrf2 inducer sulforaphane or after transfection with a DJ-1 plasmid. Thus, the DJ-1 deglycase plays a major role in preventing protein glycation in eukaryotic cells and might be important for preventing skin glycation.

  20. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.

  1. Human keratinocyte caspase-14 expression is altered in human epidermal 3D models by dexamethasone and by natural products used in cosmetics.

    Science.gov (United States)

    Kataoka, Saori; Hattori, Kenji; Date, Akira; Tamura, Hiroomi

    2013-10-01

    Caspase-14 is a cysteinyl-aspartate-specific proteinase that is specifically expressed in epidermal keratinocytes. Dysregulation of caspase-14 expression is implicated in impaired skin barrier formation. To elucidate the regulation of caspase-14 in differentiated keratinocytes, we characterized the expression of caspase-14 in normal human epidermal keratinocytes (NHEKs) and two types of three-dimensional (3D) human epidermis culture models, EPI-200 and EPI-201, via RT-PCR and immunoblot analyses. Caspase-14 expression was absent in subconfluent NHEKs, but was present in confluent NHEKs as well as those induced to differentiate by calcium. Caspase-14 expression levels in the 3D epidermis models were almost equal to that in the Ca(2+)-treated differentiated NHEKs. Despite the presence of caspase-14 expression in these models, caspase-14 activity was found only in the mature 3D skin model, EPI-200. This was confirmed by detection of a 17 kDa cleaved fragment of caspase-14 present only in the EPI-200 model. Since glucocorticoid (GC) receptor is required for skin barrier competence, we investigated whether the GC dexamethasone (Dex) and various natural components of common skin moisturizers affect caspase-14 expression in keratinocytes. Dex decreased caspase-14 expression in undifferentiated, but not differentiated, NHEKs. Conversely, Dex increased caspase-14 expression in both 3D skin models, although it did not alter caspase protease activity. Similar to treatment with Dex, treatment of the premature 3D skin mode, EPI-201 with a Galactomyces ferment filtrate markedly increased expression of caspase-14. Further, these results suggest that the effect of Dex, or lack thereof, on caspase-14 expression is dependent on the stage of keratinocyte differentiation.

  2. Flavonoid myricetin inhibits TNF-α-stimulated production of inflammatory mediators by suppressing the Akt, mTOR and NF-κB pathways in human keratinocytes.

    Science.gov (United States)

    Lee, Da Hee; Lee, Chung Soo

    2016-08-05

    Flavonoid myricetin has been shown to exhibit anti-inflammatory and anti-oxidant effects. Nevertheless, the effect of myricetin on the TNF-α-stimulated production of inflammatory mediators in keratinocytes has not been studied. Using human keratinocytes, we examined the effect of myricetin on the TNF-α-stimulated production of inflammatory mediators in relation to the Akt, mTOR and NF-κB pathways, which regulate the transcription genes involved in immune and inflammatory responses. TNF-α stimulated production of the inflammatory mediators and reactive oxygen species in keratinocytes, and activation of the Akt, mTOR and NF-κB pathways in HaCaT cells and primary keratinocytes. Myricetin, Akt inhibitor, Bay 11-7085 (an inhibitor of NF-κB activation), rapamycin (mTOR inhibitor) and N-acetylcysteine attenuated TNF-α-induced activation of Akt, mTOR and NF-κB. Myricetin and N-acetylcysteine attenuated the TNF-α-stimulated production of cytokines and chemokines, and production of reactive oxygen species in keratinocytes. The results show that myricetin may reduce TNF-α-stimulated inflammatory mediator production in keratinocytes by suppressing the activation of the Akt, mTOR and NF-κB pathways. The effect of myricetin appears to be associated with inhibition of the production of reactive oxygen species. Further, myricetin appears to attenuate the proinflammatory mediator-induced inflammatory skin diseases.

  3. Propolis Inhibits UVA-Induced Apoptosis of Human Keratinocyte HaCaT Cells by Scavenging ROS

    OpenAIRE

    2016-01-01

    Propolis is a resinous material collected by honeybees from several plant sources. This research aimed at showing its protective effect against UVA-induced apoptosis of human keratinocyte HaCaT cells. Using Hoechst staining, it was demonstrated that propolis (5 and 10 μg/mL) significantly inhibited the apoptosis of HaCaT cells induced by UVA-irradiation. Propolis also showed the protective effect against loss of mitochondrial membrane potential induced by UVA-irradiaiton in HaCaT cells. Propo...

  4. A p38(MAPK)/HIF-1 pathway initiated by UVB irradiation is required to induce Noxa and apoptosis of human keratinocytes.

    Science.gov (United States)

    Nys, Kris; Van Laethem, An; Michiels, Carine; Rubio, Noemi; Piette, Jacques G; Garmyn, Maria; Agostinis, Patrizia

    2010-09-01

    The signal transduction pathways leading to apoptosis of human keratinocytes responding to UVB irradiation are complex and not completely understood. Previously, we reported that in UVB-irradiated keratinocytes, p38(MAPK) instigates Bcl-2-associated X protein (Bax) activation and mitochondrial apoptosis. However, the molecular mechanism underlying the pro-apoptotic function of p38(MAPK) remained unclear. Here, we show that in UVB-treated human primary keratinocytes the activation of p38(MAPK) is necessary to upregulate Noxa, a BH3-only pro-apoptotic dominantly induced by UVB and required for apoptosis. Whereas p53-silencing was marginally cytoprotective and poorly affected Noxa expression, p38(MAPK) inhibition in p53-silenced keratinocytes or in p53(-/-) cells could still efficiently prevent Noxa induction and intrinsic apoptosis after UVB, indicating that p38(MAPK) signals mainly through p53-independent mechanisms. Furthermore, p38(MAPK) was required for the induction and activation of hypoxia-inducible factor 1 (HIF-1) in response to UVB, and HIF-1 knockdown reduced Noxa expression and apoptosis. In UVB-irradiated keratinocytes, Noxa targeted the anti-apoptotic myeloid cell leukemia sequence 1 (Mcl-1) for degradation, and small-interfering RNA (siRNA)-mediated knockdown of Noxa or p38(MAPK) inhibition restored levels of Mcl-1 and abolished apoptosis. Thus, the pro-apoptotic mechanisms orchestrated by p38(MAPK) in human keratinocytes in response to UVB involve an HIF-1/Noxa axis, which prompts the downregulation of anti-apoptotic Mcl-1, thereby favoring Bax-mediated mitochondrial apoptosis of UVB-damaged keratinocytes.

  5. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in human keratinocytes and ex vivo skin.

    Science.gov (United States)

    Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2013-05-01

    Nicotinamide (vitamin B3) protects from ultraviolet (UV) radiation-induced carcinogenesis in mice and from UV-induced immunosuppression in mice and humans. Recent double-blinded randomized controlled Phase 2 studies in heavily sun-damaged individuals have shown that oral nicotinamide significantly reduces premalignant actinic keratoses, and may reduce new non-melanoma skin cancers. Nicotinamide is a precursor of nicotinamide adenine dinucleotide (NAD(+)), an essential coenzyme in adenosine triphosphate (ATP) production. Previously, we showed that nicotinamide prevents UV-induced ATP decline in HaCaT keratinocytes. Energy-dependent DNA repair is a key determinant of cellular survival after exposure to DNA-damaging agents such as UV radiation. Hence, in this study we investigated whether nicotinamide protection from cellular energy loss influences DNA repair. We treated HaCaT keratinocytes with nicotinamide and exposed them to low-dose solar-simulated UV (ssUV). Excision repair was quantified using an assay of unscheduled DNA synthesis. Nicotinamide increased both the proportion of cells undergoing excision repair and the repair rate in each cell. We then investigated ssUV-induced cyclobutane pyrimidine dimers (CPDs) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8oxoG) formation and repair by comet assay in keratinocytes and with immunohistochemistry in human skin. Nicotinamide reduced CPDs and 8oxoG in both models and the reduction appeared to be due to enhancement of DNA repair. These results show that nicotinamide enhances two different pathways for repair of UV-induced photolesions, supporting nicotinamide's potential as an inexpensive, convenient and non-toxic agent for skin cancer chemoprevention.

  6. Subcellular Raman Microspectroscopy Imaging of Nucleic Acids and Tryptophan for Distinction of Normal Human Skin Cells and Tumorigenic Keratinocytes.

    Science.gov (United States)

    Piredda, Paola; Berning, Manuel; Boukamp, Petra; Volkmer, Andreas

    2015-07-07

    At present, tumor diagnostic imaging is commonly based on hematoxylin and eosin or immunohistochemical staining of biopsies, which requires tissue excision, fixation, and staining with exogenous marker molecules. Here, we report on label-free tumor imaging using confocal spontaneous Raman scattering microspectroscopy, which exploits the intrinsic vibrational contrast of endogenous biomolecular species. We present a chemically specific and quantitative approach to monitoring normal human skin cells (keratinocytes and fibroblasts) as well as the human HaCaT in vitro skin carcinogenesis model and the tumor-derived MET in vivo skin cancer progression model. Mapping the amplitudes of two spectrally well isolated Raman bands at 752 and 785 cm(-1) allowed for direct visualization of the distributions representative of tryptophan-rich proteins and nucleic acids, respectively, with subcellular spatial resolution. Using these Raman markers, it was feasible to discriminate between normal human epidermal keratinocytes (NHEK) and dermal fibroblasts (NHDF) and to confine all tumorigenic cells from both the NHEK and NHDF. First evidence for the successful application of the proposed intracellular nucleic acid and tryptophan Raman signatures for skin cancer diagnosis was further demonstrated in an organotypic cutaneous squamous cell carcinomas model, allowing for the identification of tumor cells and their surrounding stroma in the tissue context.

  7. Amygdalin analogues inhibit IFN-γ signalling and reduce the inflammatory response in human epidermal keratinocytes.

    Science.gov (United States)

    Paoletti, Iole; De Gregorio, Vincenza; Baroni, Adone; Tufano, Maria Antonietta; Donnarumma, Giovanna; Perez, Juan Jesus

    2013-12-01

    Peptide T (PT), an octapeptide fragment located in the V2 region of the HIV-1 gp120-coating protein, appears to be beneficial in the treatment of psoriasis. Our previous investigations suggest that keratinocytes play a key role in conditioning the therapeutic effects of PT in psoriasis. The aim of this study was to explore the effects of PT and the peptidomimetic natural products, Dhurrin and Prunasin, on the expression of the IL-6, IL-8, IL-23, HSP70 and ICAM-1 on IFN-γ and TNF-α-NHEK activated cells. Moreover, we analysed the interference of PT and its analogues through STAT-3 activation. Our results show that the analogues tested exhibit the beneficial biological effects of PT, suggesting the primary role of keratinocytes upon which PT and the peptidomimetics act directly, by reducing proinflammatory responses. Its reduction appears to be important for therapeutic approach in psoriasis pathogenesis.

  8. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer.

    Science.gov (United States)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E

    2013-09-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer.

  9. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer.

  10. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  11. The human adult cardiomyocyte phenotype

    NARCIS (Netherlands)

    Bird, SD; Doevendans, PA; van Rooijen, MA; de la Riviere, AB; Hassink, RJ; Passier, R; Mummery, CL

    2003-01-01

    Aim: Determination of the phenotype of adult human atrial and ventricular myocytes based on gene expression and morphology. Methods: Atrial and ventricular cardiomyocytes were obtained from patients undergoing cardiac surgery using a modified isolation procedure. Myocytes were isolated and cultured

  12. Phospholipase C-gamma1 is required for subculture-induced terminal differentiation of normal human oral keratinocytes.

    Science.gov (United States)

    Oh, Ju-Eun; Kook, Joong-Ki; Park, Kyung-Hee; Lee, Gene; Seo, Byoung-Moo; Min, Byung-Moo

    2003-04-01

    Serial subculture of primary normal human oral keratinocytes (NHOKs) to the post-mitotic stage induces terminal differentiation, which is in part linked to elevated levels of phospholipase C (PLC)-gamma1. Therefore, PLC-gamma1 may be involved in the signal transduction system that leads to the calcium regulation of subculture-induced keratinocyte differentiation. To test this hypothesis, the expression of PLC-gamma1 in primary NHOKs was blocked by transfecting cells with the antisense PLC-gamma1 cDNA construct. These cells demonstrated dramatic reductions in PLC-gamma1 protein and in the differentiation markers involucrin and transglutaminase following calcium exposure and an increase (15-20%) in in vitro life span versus empty vector-transfected cells. In addition, we established the ability of antisense PLC-gamma1 to block the serial subculture-induced rise in intracellular calcium. Similar observations were made following treatment with the specific PLC inhibitor U73122. These results indicate that the terminal differentiation of NHOKs by serial subculture is associated with PLC-gamma1, which mediates calcium regulation by mobilizing intracellular calcium.

  13. Regulation of haptoglobin expression in a human keratinocyte cell line HaCaT by inflammatory cytokines and dexamethasone

    Institute of Scientific and Technical Information of China (English)

    XIA Li-xin; XIAO Ting; CHEN Hong-duo; LI Ping; WANG Ya-kun; WANG He

    2008-01-01

    Background Haptoglobin(Hp)is one of the acute-phase proteins. Recent studies have demonstrated that Hp exerts immunoregulatory and anti-inflammatory actions and may be one of the inhibitory factors of immune reactions in the skin. In this study we investigated the regulation of Hp expression in a human keratinocyte cell line HaCaT by various cytokines and glucocorticod. Methods HaCaT cells were cultured with IL-6(50 ng/ml), TNF-α(20 ng/ml), IFN-Y(20 ng/ml)or IL-4(20 ng/ml)with or without 1 μmol/L dexamethasone in 6-well plates for 12, 24 and 48 hours. Both the cells and the supernatants were collected to detect the changes of Hp expression by reverse-transcription PCR, ELISA and immunohistochemistry. Results The results showed that Hp expression were elevated at both the mRNA and protein level by the combination of IL-6, TNF-α or IL-4 with dexamethasone, whereas the three cytokines alone did not upregulate the Hp expression. IFN-Y showed no effect on the Hp expression in HaCaT cells. Conclusions These findings suggest that different inflammatory cytokines as well as glucocorticoid may be involved in the regulation of Hp expression in keratinocytes, and this may be one of the negative feedback mechanisms in inflammatory skin diseases.

  14. Silver nanoparticles exert a long-lasting antiproliferative effect on human keratinocyte HaCaT cell line.

    Science.gov (United States)

    Zanette, Caterina; Pelin, Marco; Crosera, Matteo; Adami, Gianpiero; Bovenzi, Massimo; Larese, Francesca Filon; Florio, Chiara

    2011-08-01

    For their antibacterial activity, silver nanoparticles (Ag NPs) are largely used in various commercially available products designed to come in direct contact with the skin. In this study we investigated the effects of Ag NPs on skin using the human-derived keratinocyte HaCaT cell line model. Ag NPs caused a concentration- and time-dependent decrease of cell viability, with IC(50) values of 6.8 ± 1.3 μM (MTT assay) and 12 ± 1.2 μM (SRB assay) after 7 days of contact. A 24h treatment, followed by a 6 day recovery period in Ag NPs-free medium, reduced cell viability with almost the same potency (IC(50)s of 15.3 ± 4.6 and 35 ± 20 μM, MTT and SRB assays, respectively). Under these conditions, no evidence of induction of necrotic events (propidium iodide assay) was found. Apocynin, NADPH-oxidase inhibitor, or N(G)-monomethyl-L-argynine, nitric oxide synthase inhibitor, did not prevent NPs-induced reduction of cell viability. TEM analysis of cells exposed to NPs for 24h revealed alteration of nuclear morphology but only a marginal presence of individual NPs inside the cells. These results demonstrate that on HaCaT keratinocytes a relatively short time of contact with Ag NPs causes a long-lasting inhibition of cell growth, not associated with consistent Ag NPs internalization.

  15. Suppression of Ultraviolet B Exposure-Mediated Activation of NF-κB in Normal Human Keratinocytes by Resveratrol

    Directory of Open Access Journals (Sweden)

    Vaqar Mustafa Adhami

    2003-01-01

    Full Text Available Chemoprevention by naturally occurring agents is a newer dimension in the management of neoplasia, including skin cancer. Solar ultraviolet (UV radiation is the major cause of skin cancer. We recently demonstrated that resveratrol (3,5,4'-trihydroxystilbene, a polyphenolic antioxidant found in grapes and red wine, imparts protection from UVB-mediated cutaneous damages in SKH-1 hairless mice. The mechanism of action of resveratrol is not clearly understood. Here, we investigated the involvement of nuclear factor kappa B (NF-κB, which is known to play a critical role in skin biology and the development of skin cancer, as the mechanism of chemoprevention of UV damage by resveratrol. In the normal human epidermal keratinocytes, resveratrol blocked UVB-mediated (40 mJ/cm2 activation of NF-κB in a dose-dependent (5, 10, and 25μM resveratrol for 24 hours as well as time-dependent (5μ/M resveratrol for 12, 24, and 48 hours fashion. Resveratrol treatment of keratinocytes also inhibited UVB-mediated 1 phosphorylation and degradation of IκBα, and 2 activation of IKKα. We suggest that NF-κB pathway plays a critical role in the chemopreventive effects of resveratrol against the adverse effects of UV radiation including photocarcinogenesis.

  16. Zinc oxide nanoparticles-induced epigenetic change and G2/M arrest are associated with apoptosis in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Gao F

    2016-08-01

    Full Text Available Fei Gao, Ningjie Ma, Hong Zhou, Qing Wang, Hao Zhang, Pu Wang, Haoli Hou, Huan Wen, Lijia Li State Key Laboratory of Hybrid Rice, College of Life Sciences, Wuhan University, Wuhan, People’s Republic of China Abstract: As an engineered nanomaterial, zinc oxide nanoparticles (ZnO NPs are used frequently in biological applications and can make contact with human skin. Here, we systematically investigated the effects of ZnO NPs on non-tumorigenic human epidermal keratinocytes, which were used as a test model for this in vitro study, at the epigenetic and molecular levels. Our results showed that ZnO NPs induced cell cycle arrest at the G2/M checkpoint before the viability of human epidermal keratinocytes was reduced, which was associated with the chromatin changes at the epigenetic level, including increased methylation of histone H3K9 and decreased acetylation of histone H4K5 accompanied by chromatin condensation at 24 hours. The mRNA expression of the methyltransferase genes G9a and GLP was also increased upon treatment with ZnO NPs, and the acetyltransferase genes GCN5, P300, and CBP were downregulated. Reactive oxygen species were found to be more abundant after treatment with ZnO NPs for 6 hours, and DNA damage was observed at 24 hours. Transmission electron microscopy and flow cytometry confirmed that ZnO NPs were absorbed into the cell when they were added to the medium. Apoptotic human epidermal keratinocytes were detected, and the expression of the proapoptotic genes Bax, Noxa, and Puma increased significantly, while the expression of the antiapoptotic gene Bcl-xl decreased 24 hours after exposure to ZnO NPs. These findings suggest that the ZnO NPs induced cell cycle arrest at G2/M, which was associated with epigenetic changes and accompanied by p53-Bax mitochondrial pathway-mediated apoptosis. Keywords: ZnO nanoparticle, cell cycle G2/M arrest, histone modification, p53-Bax mitochondrial apoptosis pathway, reactive oxygen species

  17. In vitro cytotoxicity of CdSe/ZnS quantum dots with different surface coatings to human keratinocytes HaCaT cells

    Institute of Scientific and Technical Information of China (English)

    Kavitha Pathakoti; Huey-Min Hwang; Hong Xu; Zoraida P.Aguilar; Andrew Wang

    2013-01-01

    Quantum dots (QD) nanoparticles have been widely used in biomedical and electronics fields,because of their novel optical properties.Consequently it confers enormous potential for human exposure and environmental release.To increase the biocompatibility of QDs,a variety of surface coatings or functional groups are added to increase their bioactivity and water solubility.Human adult low calcium high temperature (HaCaT) cells are the epithelial cells derived from adult human skin that exhibits normal differentiation capacity and a DNA fingerprint pattern that is unaffected by long-term cultivation,transformation,or the presence of muldple chromosomal alternations.Human keratinocytes,HaCaT cells were used to systematically evaluate the cytotoxicity of biocompatible QD made of CdSe metal core and ZnS shell with three different coatings and at three different wavelengths (530,580 and 620 nm).In terms of halfmaximal inhibitory concentration,QSA-QDs with amine-polyethyleneglycol coating and QSH-QDs with amphiphilic polymer coating were not cytotoxic,while QEI-QDs with polyethylenimine coating were highly toxic to the HaCaT cells in comparison to a reference CuInS2/ZnS.QEI-QDs led to significant increase in reactive oxygen species,decrease in mitochondrial membrane potential and DNA damage in HaCaT cells.The mechanisms of toxicity of QEI-530 and QEI-580 can be attributed to the combination of intracellular reactive oxygen species production and loss of MMP.The QDs toxicity can be attributed to the polyethylemimine surface coating which was highly toxic to cells in comparison with amine-polyethyleneglycol,but not due to the release of cadmium ions.

  18. The Alteration of the Epidermal Basement Membrane Complex of Human Nevus Tissue and Keratinocyte Attachment after High Hydrostatic Pressurization

    Directory of Open Access Journals (Sweden)

    Naoki Morimoto

    2016-01-01

    Full Text Available We previously reported that human nevus tissue was inactivated after high hydrostatic pressure (HHP higher than 200 MPa and that human cultured epidermis (hCE engrafted on the pressurized nevus at 200 MPa but not at 1000 MPa. In this study, we explore the changes to the epidermal basement membrane in detail and elucidate the cause of the difference in hCE engraftment. Nevus specimens of 8 mm in diameter were divided into five groups (control and 100, 200, 500, and 1000 MPa. Immediately after HHP, immunohistochemical staining was performed to detect the presence of laminin-332 and type VII collagen, and the specimens were observed by transmission electron microscopy (TEM. hCE was placed on the pressurized nevus specimens in the 200, 500, and 1000 MPa groups and implanted into the subcutis of nude mice; the specimens were harvested at 14 days after implantation. Then, human keratinocytes were seeded on the pressurized nevus and the attachment was evaluated. The immunohistochemical staining results revealed that the control and 100 MPa, 200 MPa, and 500 MPa groups were positive for type VII collagen and laminin-332 immediately after HHP. TEM showed that, in all of the groups, the lamina densa existed; however, anchoring fibrils were not clearly observed in the 500 or 1000 MPa groups. Although the hCE took in the 200 and 500 MPa groups, keratinocyte attachment was only confirmed in the 200 MPa group. This result indicates that HHP at 200 MPa is preferable for inactivating nevus tissue to allow its reuse for skin reconstruction in the clinical setting.

  19. Induction of interleukin-6 production by ultraviolet radiation in normal human epidermal keratinocytes and in a human keratinocyte cell line is mediated by DNA damage

    NARCIS (Netherlands)

    Petit-Frère, C.; Clingen, P.H.; Grewe, M.; Krutmann, J.; Roza, L.; Arlett, C.F.; Green, M.H.L.

    1998-01-01

    The sunburn reaction is the most common consequence of human exposure to ultraviolet radiation (UVR), and is mediated at least in part by interleukin- 6 (IL-6). The aim of this study was to determine if DNA is a major chromophore involved in the induction of IL-6 following UV irradiation of a human

  20. Protective Effect of Garlic on Cellular Senescence in UVB-Exposed HaCaT Human Keratinocytes.

    Science.gov (United States)

    Kim, Hye Kyung

    2016-07-29

    Ultraviolet (UV) irradiation generates reactive oxygen species (ROS) in the cells, which induces the cellular senescence and photoaging. The present study investigated the protective effects of garlic on photo-damage and cellular senescence in UVB-exposed human keratinocytes, HaCaT cells. An in vitro cell free system was used to examine the scavenging activity of 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radicals and nitric oxide (NO). The effect of garlic extract on ROS formation, MMP-1 protein and mRNA expressions, cytokines such as interleukin (IL)-1β and IL-6, senescence associated-β-galactosidase (SA-β-gal) activity, and silent information regulator T1 (SIRT1) activity were determined in UVB-irradiated HaCaT cells. Garlic exhibited strong DPPH radical and NO scavenging activity in cell free system exhibiting IC50 values of 2.50 mg/mL and 4.38 mg/mL, respectively. Garlic pretreatment attenuated the production of UVB-induced intracellular ROS. MMP-1 level, which has been known to be induced by ROS, was dramatically elevated by UVB irradiation, and UVB-induced MMP-1 mRNA and protein expressions were significantly reduced by garlic treatment (50 µg/mL) comparable to those of UV-unexposed control cells. UV-induced pro-inflammatory cytokine productions (IL-6 and IL-1β) were significantly inhibited by pretreatment with garlic in a dose-dependent manner. SA-β-gal activity, a classical biomarker of cellular senescence, and SIRT1 activity, which has attracted attention as an anti-aging factor in recent years, were ameliorated by garlic treatment in UV-irradiated HaCaT cells. The present study provides the first evidence of garlic inhibiting UVB-induced photoaging as a result of augmentation of cellular senescence in HaCaT human keratinocytes.

  1. Arabinogalactan Proteins from Baobab and Acacia Seeds Influence Innate Immunity of Human Keratinocytes in vitro.

    Science.gov (United States)

    Zahid, Abderrakib; Despres, Julie; Benard, Magalie; Nguema-Ona, Eric; Leprince, Jerome; Vaudry, David; Rihouey, Christophe; Vicré-Gibouin, Maité; Driouich, Azeddine; Follet-Gueye, Marie-Laure

    2016-10-13

    Plant derived arabinogalactan proteins (AGP) were repeatedly confirmed as immunologically as well as dermatologically active compounds. However little is currently known regarding their potential activity towards skin innate immunity. Here, we extracted and purified AGP from acacia (Acacia senegal) and baobab (Adansonia digitata) seeds to investigate their biological effects on the HaCaT keratinocyte cell line in an in vitro system. While AGP from both sources did not exhibit any cytotoxic effect, AGP from acacia seeds enhanced cell viability Moreover, real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis showed that AGP extracted from both species induced a substantial overexpression of hBD-2, TLR-5, and IL1-α genes. These data suggest that plant AGP, already known to control plant defensive processes, could also modulate skin innate immune responses. This article is protected by copyright. All rights reserved.

  2. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  3. Integrin-blocking antibodies delay keratinocyte re-epithelialization in a human three-dimensional wound healing model.

    Directory of Open Access Journals (Sweden)

    Christophe Egles

    Full Text Available The alpha6beta4 integrin plays a significant role in tumor growth, angiogenesis and metastasis through modulation of growth factor signaling, and is a potentially important therapeutic target. However, alpha6beta4-mediated cell-matrix adhesion is critical in normal keratinocyte attachment, signaling and anchorage to the basement membrane through its interaction with laminin-5, raising potential risks for targeted therapy. Bioengineered Human Skin Equivalent (HSE, which have been shown to mimic their normal and wounded counterparts, have been used here to investigate the consequences of targeting beta4 to establish toxic effects on normal tissue homeostasis and epithelial wound repair. We tested two antibodies directed to different beta4 epitopes, one adhesion-blocking (ASC-8 and one non-adhesion blocking (ASC-3, and determined that these antibodies were appropriately localized to the basal surface of keratinocytes at the basement membrane interface where beta4 is expressed. While normal tissue architecture was not altered, ASC-8 induced a sub-basal split at the basement membrane in non-wounded tissue. In addition, wound closure was significantly inhibited by ASC-8, but not by ASC-3, as the epithelial tongue only covered 40 percent of the wound area at 120 hours post-wounding. These results demonstrate beta4 adhesion-blocking antibodies may have adverse effects on normal tissue, whereas antibodies directed to other epitopes may provide safer alternatives for therapy. Taken together, we conclude that these three-dimensional tissue models provide a biologically relevant platform to identify toxic effects induced by candidate therapeutics, which will allow generation of findings that are more predictive of in vivo responses early in the drug development process.

  4. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  5. T Helper 1 and T Helper 2 Cytokines Differentially Modulate Expression of Filaggrin and its Processing Proteases in Human Keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Zheng-Hong Di; Lei Ma; Rui-Qun Qi; Xiao-Dong Sun; Wei Huo; Li Zhang; Ya-Ni Lyu

    2016-01-01

    Background: Atopic dermatitis (AD) is characterized by defective skin barrier and imbalance in T helper 1/T helper 2 (Th 1/Th2) cytokine expression.Filaggrin (FLG) is the key protein to maintaining skin barrier function.Recent studies indicated that Th1/Th2 cytokines influence FLG expression in keratinocytes.However, the role ofThl/Th2 cytokines on FLG processing is not substantially documented.Our aim was to investigate the impact ofThl/Th2 cytokines on FLG processing.Methods: HaCaT cells and normal human keratinocytes were cultured in low and high calcium media and stimulated by either interleukin (IL)-4, 13 or interferon-γ(IFN-γ).FLG, its major processing proteases and key protease inhibitor lymphoepithelial Kazal-type-related inhibitor (LEKTI) were measured by both real-time quantitative polymerase chain reaction and Western blotting.Their expression was also evaluated in acute and chronic AD lesions by immunohistochemistry.Results: IL-4/13 significantly reduced, while IFN-γsignificantly up-regulated FLG expression.IL-4/13 significantly increased, whereas IFN-γsignificantly decreased the expression ofkallikreins 5 and 7, matriptase and channel-activating serine protease 1.On the contrary, IL-4/13 significantly decreased, while IFN-γincreased the expression of LEKTI and caspase-14.Similar trends were observed in AD lesions.Conclusions: Our results suggested that Th1/Th2 cytokines differentially regulated the expression of major FLG processing enzymes.The imbalance between Th1 and Th2 polarized immune response seems to extend to FLG homeostasis, through the network of FLG processing enzymes.

  6. Broad-spectrum sunscreens prevent the secretion of proinflammatory cytokines in human keratinocytes exposed to ultraviolet A and phototoxic lomefloxacin

    Energy Technology Data Exchange (ETDEWEB)

    Reinhardt, P.; Cybulski, M. [Lasers and Electro-Optics Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada)], E-mail: pascale_reinhardt@hc-sc.gc.ca; Miller, S.M.; Ferrarotto, C.; Wilkins, R. [Radiobiology Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada); Deslauriers, Y. [Lasers and Electro-Optics Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada)

    2006-02-15

    The combination of phototoxic drugs and ultraviolet (UV) radiation can trigger the release of proinflammatory cytokines. The present study measured the ability of sunscreens to prevent cytokine secretion in human keratinocytes following cotreatment of these cells with a known photoreactive drug and UVA. Keratinocytes were treated for 1 h with increasing concentrations of lomefloxacin (LOM) or norfloxacin (NOR), exposed to 15 J/cm{sup 2} UVA, and incubated for 24 h. NOR, owing to the absence of a fluorine atom in position 8, was non-phototoxic and used as a negative control. Cell viability and the release of 3 cytokines were assessed, namely interleukin-1{alpha} (IL-1{alpha}), interleukin-6 (IL-6), and tumour necrosis factor-{alpha} (TNF-{alpha}). The measurement of these cytokines may be a useful tool for detecting photoreactive compounds. To measure their ability to prevent cytokine secretion, various sunscreens were inserted between the UVA source and the cells. Treatment with NOR, NOR plus UVA, or LOM had no effect on the cells. LOM plus UVA, however, had an effect on cell viability and on cytokine secretion. IL-1{alpha} levels increased with LOM concentration. The release of TNF-{alpha} and IL-6 followed the same pattern at lower concentrations of LOM but peaked at 15 {mu}mol/L and decreased at higher concentrations. Sunscreens protected the cells from the effects of LOM plus UVA, as cell viability and levels of cytokines remained the same as in the control cells. In conclusion, the application of broad-spectrum sunscreen by individuals exposed to UVA radiation may prevent phototoxic reactions initiated by drugs such as LOM. (author)

  7. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  8. Human papillomavirus E6E7-mediated adenovirus cell killing: selectivity of mutant adenovirus replication in organotypic cultures of human keratinocytes.

    Science.gov (United States)

    Balagué, C; Noya, F; Alemany, R; Chow, L T; Curiel, D T

    2001-08-01

    Replication-competent adenoviruses are being investigated as potential anticancer agents. Exclusive virus replication in cancer cells has been proposed as a safety trait to be considered in the design of oncolytic adenoviruses. From this perspective, we have investigated several adenovirus mutants for their potential to conditionally replicate and promote the killing of cells expressing human papillomavirus (HPV) E6 and E7 oncoproteins, which are present in a high percentage of anogenital cancers. For this purpose, we have employed an organotypic model of human stratified squamous epithelium derived from primary keratinocytes that have been engineered to express HPV-18 oncoproteins stably. We show that, whereas wild-type adenovirus promotes a widespread cytopathic effect in all infected cells, E1A- and E1A/E1B-deleted adenoviruses cause no deleterious effect regardless of the coexpression of HPV18 E6E7. An adenovirus deleted in the CR2 domain of E1A, necessary for binding to the pRB family of pocket proteins, shows no selectivity of replication as it efficiently kills all normal and E6E7-expressing keratinocytes. Finally, an adenovirus mutant deleted in the CR1 and CR2 domains of E1A exhibits preferential replication and cell killing in HPV E6E7-expressing cultures. We conclude that the organotypic keratinocyte culture represents a distinct model to evaluate adenovirus selectivity and that, based on this model, further modifications of the adenovirus genome are required to restrict adenovirus replication to tumor cells.

  9. FOXM1 allows human keratinocytes to bypass the oncogene-induced differentiation checkpoint in response to gain of MYC or loss of p53

    Science.gov (United States)

    Molinuevo, R; Freije, A; de Pedro, I; Stoll, S W; Elder, J T; Gandarillas, A

    2017-01-01

    Tumour suppressor p53 or proto-oncogene MYC is frequently altered in squamous carcinomas, but this is insufficient to drive carcinogenesis. We have shown that overactivation of MYC or loss of p53 via DNA damage triggers an anti-oncogenic differentiation-mitosis checkpoint in human epidermal keratinocytes, resulting in impaired cell division and squamous differentiation. Forkhead box M1 (FOXM1) is a transcription factor recently proposed to govern the expression of a set of mitotic genes. Deregulation of FOXM1 occurs in a wide variety of epithelial malignancies. We have ectopically expressed FOXM1 in keratinocytes of the skin after overexpression of MYC or inactivation of endogenous p53. Ectopic FOXM1 rescues the proliferative capacity of MYC- or p53-mutant cells in spite of higher genetic damage and a larger cell size typical of differentiation. As a consequence, differentiation induced by loss of p53 or MYC is converted into increased proliferation and keratinocytes displaying genomic instability are maintained within the proliferative compartment. The results demonstrate that keratinocyte oncogene-induced differentiation is caused by mitosis control and provide new insight into the mechanisms driving malignant progression in squamous cancer. PMID:27452522

  10. Suppressive effects of antimycotics on tumor necrosis factor-alpha-induced CCL27, CCL2, and CCL5 production in human keratinocytes.

    Science.gov (United States)

    Kanda, Naoko; Watanabe, Shinichi

    2006-08-14

    Antimycotic agents are reported to improve cutaneous symptoms of atopic dermatitis or psoriasis vulgaris. Keratinocytes in these lesions excessively produce chemokines, CCL27, CCL2, or CCL5 which trigger inflammatory infiltrates. Tumor necrosis factor-alpha (TNF-alpha) induces production of these chemokines via activating nuclear factor-kappaB (NF-kappaB). We examined in vitro effects of antimycotics on TNF-alpha-induced CCL27, CCL2, and CCL5 production in human keratinocytes. Antimycotics ketoconazole and terbinafine hydrochloride suppressed TNF-alpha-induced CCL27, CCL2, and CCL5 secretion and mRNA expression in keratinocytes in parallel to the inhibition of NF-kappaB activity while fluconazole was ineffective. Anti-prostaglandin E2 (PGE2) antiserum or antisense oligonucleotides against PGE2 receptor EP2 or EP3 abrogated inhibitory effects of ketoconazole and terbinafine hydrochloride on TNF-alpha-induced NF-kappaB activity and CCL27, CCL2, and CCL5 production, indicating the involvement of endogenous PGE2 in the inhibitory effects. Prostaglandin H2, a precursor of PGE2 can be converted to thromboxane A2. Ketoconazole, terbinafine hydrochloride and thromboxane A2 synthase (EC 5.3.99.5) inhibitor, carboxyheptyl imidazole increased PGE2 release from keratinocytes and reduced that of thromboxane B2, a stable metabolite of thromboxane A2. Carboxyheptyl imidazole also suppressed TNF-alpha-induced NF-kappaB activity and CCL27, CCL2, and CCL5 production. These results suggest that ketoconazole and terbinafine hydrochloride may suppress TNF-alpha-induced NF-kappaB activity and CCL27, CCL2, and CCL5 production by increasing PGE2 release from keratinocytes. These antimycotics may suppress thromboxane A2 synthesis and redirect the conversion of PGH2 toward PGE2. These antimycotics may alleviate inflammatory infiltration in atopic dermatitis or psoriasis vulgaris by suppressing chemokine production.

  11. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd.

  12. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar.

  13. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E

    1994-01-01

    The master two-dimensional (2-D) gel database of human keratinocytes currently lists 3087 cellular proteins (2168 isoelectric focusing, IEF; and 919 none-quilibrium pH gradient electrophoresis, NEPHGE), many of which correspond to posttranslational modifications, 890 polypeptides have been...... identified (protein name, organelle components, etc.) using one or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry and (v...... in the database. We also report a database of proteins recovered from the medium of noncultured, unfractionated keratinocytes. This database lists 398 polypeptides (309 IEF; 89 NEPHGE) of which 76 have been identified. The aim of the comprehensive databases is to gather, through a systematic study...

  14. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  15. Protective effect of cyanidin-3-O-glucoside against ultraviolet B radiation-induced cell damage in human HaCaT keratinocytes

    Directory of Open Access Journals (Sweden)

    Yunfeng Hu

    2016-09-01

    Full Text Available Ultraviolet radiation is the major environmental harmful factor that has emotional impact on human skin. The aim of the present study was to determine the mechanism of protection of cyanidin-3-O-glucoside against ultraviolet B (UVB -induced damage to human HaCaT keratinocytes. Our results show that cyanidin-3-O-glucoside decreased the levels of intracellular reactive oxygen species generated by UVB treatment. cyanidin-3-O-glucoside also decreased the UVB-augmented levels of the DNA damage indicators phospho-p53 and phospho-ATM/ATR. In addition, cyanidin-3-O-glucoside protected keratinocytes from UVB-induced injury by overturning the disruption of mitochondrial membrane potential and reversing apoptosis. The expression of anti-apoptotic protein B-cell lymphoma 2 (Bcl-2 was attenuated in UVB-exposed cells but restored in UVB/cyanidin-3-O-glucoside-treated cells. Furthermore, expression of the proapoptotic proteins Bcl-2-associated X (Bax and the key apoptosis executer cleaved caspase-3 were increased in UVB-irradiated cells and decreased in UVB/cyanidin-3-O-glucoside-treated cells. For these reasons, the results demonstrate that cyanidin-3-O-glucoside protects human keratinocytes against UVB-induced oxidative stress and apoptosis. Our study provides a theoretical basis for the use of cyanidin-3-O-glucoside in the fight against light damage .

  16. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  17. Protective Effect of Cyanidin-3-O-Glucoside against Ultraviolet B Radiation-Induced Cell Damage in Human HaCaT Keratinocytes.

    Science.gov (United States)

    Hu, Yunfeng; Ma, Yuetang; Wu, Shi; Chen, Tianfeng; He, Yong; Sun, Jianxia; Jiao, Rui; Jiang, Xinwei; Huang, Yadong; Deng, Liehua; Bai, Weibin

    2016-01-01

    Ultraviolet radiation is the major environmental harmful factor that has emotional impact on human skin. The aim of the present study was to determine the mechanism of protection of cyanidin-3-O-glucoside against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. Our results show that cyanidin-3-O-glucoside decreased the levels of intracellular reactive oxygen species generated by UVB treatment. Cyanidin-3-O-glucoside also decreased the UVB-augmented levels of the DNA damage indicators phospho-p53 and phospho-ATM/ATR. In addition, cyanidin-3-O-glucoside protected keratinocytes from UVB-induced injury by overturning the disruption of mitochondrial membrane potential and reversing apoptosis. The expression of anti-apoptotic protein B-cell lymphoma 2 (Bcl-2) was attenuated in UVB-exposed cells but restored in UVB/cyanidin-3-O-glucoside-treated cells. Furthermore, expression of the proapoptotic proteins Bcl-2-associated X (Bax) and the key apoptosis executer cleaved caspase-3 were increased in UVB-irradiated cells and decreased in UVB/cyanidin-3-O-glucoside-treated cells. For these reasons, the results demonstrate that cyanidin-3-O-glucoside protects human keratinocytes against UVB-induced oxidative stress and apoptosis. Our study provides a theoretical basis for the use of cyanidin-3-O-glucoside in the fight against light damage.

  18. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  19. Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-{beta} signaling

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Reuben H., E-mail: rkim@dentistry.ucla.edu [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Lieberman, Mark B.; Lee, Rachel [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Shin, Ki-Hyuk [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Mehrazarin, Shebli; Oh, Ju-Eun [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Park, No-Hee [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Kang, Mo K., E-mail: mkang@dentistry.ucla.edu [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States)

    2010-10-01

    We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-{beta} signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-{beta} signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-{beta}1 levels, phosphorylation of Smad2/3, and increased expression of p15{sup INK4B} and p57{sup KIP2}. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-{beta}1 induced dephosphorylation of Smad2/3, and diminished the level of p15{sup INK4B} and p57{sup KIP2}. Moreover, Bmi-1 expression led to the inhibition of TGF-{beta}-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15{sup INK4B}, and p57{sup KIP2}. In addition, an exposure of senescent NHOK to TGF-{beta} receptor I kinase inhibitor or anti-TGF-{beta} antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-{beta} signaling pathway in NHOK.

  20. Cytogenotoxicity of selected organophosphate insecticides on HaCaT keratinocytes and NL-20 human bronchial cells.

    Science.gov (United States)

    Arteaga-Gómez, Eduardo; Rodríguez-Levis, Alejandra; Cortés-Eslava, Josefina; Arenas-Huertero, Francisco; Valencia-Quintana, Rafael; Gómez-Arroyo, Sandra

    2016-02-01

    Organophosphate insecticides (OI) are widely used. To humans the main routes of exposure are skin and inhalation. For this, keratinocytes (HaCaT) and bronchial cells (NL-20) were used as cell culture models to evaluate the effects of OI. The aim of this study was to evaluate the effect of four OI on HaCaT and NL-20 cells: azinphos-methyl, (AM); parathion-methyl (PM); omethoate (OM); and methamidophos (MET). Cells were exposed to 0.1, 1 and 10 μg/μL of each. Results showed a decrease in cell viability in both cell lines. Viability of the NL-20 cell line decreased with the three concentrations of OM. All differences were significant (p insecticides except MET, induced cell death. MET caused DNA damage in HaCaT cells at all concentrations. Differences were significant (p insecticide. Quantitative real time-polymerase chain reaction (RT-qPCR) showed an increase of BN1 gene in HaCaT by effect of AM and MET at 1 μg/μL. In conclusion, all the insecticides induced different levels of cyto and genotoxic effects in both cell lines.

  1. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  2. Metabolic effects of TiO2 nanoparticles, a common component of sunscreens and cosmetics, on human keratinocytes.

    Science.gov (United States)

    Tucci, P; Porta, G; Agostini, M; Dinsdale, D; Iavicoli, I; Cain, K; Finazzi-Agró, A; Melino, G; Willis, A

    2013-03-21

    The long-term health risks of nanoparticles remain poorly understood, which is a serious concern given their prevalence in the environment from increased industrial and domestic use. The extent to which such compounds contribute to cellular toxicity is unclear, and although it is known that induction of oxidative stress pathways is associated with this process, the proteins and the metabolic pathways involved with nanoparticle-mediated oxidative stress and toxicity are largely unknown. To investigate this problem further, the effect of TiO2 on the HaCaT human keratinocyte cell line was examined. The data show that although TiO2 does not affect cell cycle phase distribution, nor cell death, these nanoparticles have a considerable and rapid effect on mitochondrial function. Metabolic analysis was performed to identify 268 metabolites of the specific pathways involved and 85 biochemical metabolites were found to be significantly altered, many of which are known to be associated with the cellular stress response. Importantly, the uptake of nanoparticles into the cultured cells was restricted to phagosomes, TiO2 nanoparticles did not enter into the nucleus or any other cytoplasmic organelle. No other morphological changes were detected after 24-h exposure consistent with a specific role of mitochondria in this response.

  3. Loss of viability and induction of apoptosis in human keratinocytes exposed to Staphylococcus aureus biofilms in vitro.

    Science.gov (United States)

    Kirker, Kelly R; Secor, Patrick R; James, Garth A; Fleckman, Philip; Olerud, John E; Stewart, Philip S

    2009-01-01

    Bacteria colonizing chronic wounds are believed to exist as polymicrobial, biofilm communities; however, there are few studies demonstrating the role of biofilms in chronic wound pathogenesis. This study establishes a novel method for studying the effect of biofilms on the cell types involved in wound healing. Cocultures of Staphylococcus aureus biofilms and human keratinocytes (HK) were created by initially growing S. aureus biofilms on tissue culture inserts then transferring the inserts to existing HK cultures. Biofilm-conditioned medium (BCM) was prepared by culturing the insert-supported biofilm in cell culture medium. As a control planktonic-conditioned medium (PCM) was also prepared. Biofilm, BCM, and PCM were used in migration, cell viability, and apoptosis assays. Changes in HK morphology were followed by brightfield and confocal microscopy. After only 3 hours exposure to BCM, but not PCM, HK formed dendrite-like extensions and displayed reduced viability. After 9 hours, there was an increase in apoptosis (p< or =0.0004). At 24 hours, biofilm-, BCM-, and PCM-exposed HK all exhibited reduced scratch closure (p< or =0.0001). The results demonstrated that soluble products of both S. aureus planktonic cells and biofilms inhibit scratch closure. Furthermore, S. aureus biofilms significantly reduced HK viability and significantly increased HK apoptosis compared with planktonic S. aureus.

  4. Effect of extremely low-frequency electromagnetic fields on antioxidant activity in the human keratinocyte cell line NCTC 2544.

    Science.gov (United States)

    Calcabrini, Cinzia; Mancini, Umberto; De Bellis, Roberta; Diaz, Anna Rita; Martinelli, Maddalena; Cucchiarini, Luigi; Sestili, Piero; Stocchi, Vilberto; Potenza, Lucia

    2016-03-22

    Some epidemiological studies have suggested possible associations between exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) and various diseases. Recently, ELF-EMF has been considered as a therapeutic agent. To support ELF-EMF use in regenerative medicine, in particular in the treatment of skin injuries, we investigated whether significant cell damage occurs after ELF-EMF exposure. Reactive oxygen species (ROS) production was evaluated in the human keratinocyte exposed for 1 H to 50 Hz ELF-EMF in a range of field strengths from 0.25 to 2 G. Significant ROS increases resulted at 0.5 and 1 G and under these flux densities ROS production, glutathione content, antioxidant defense activity, and lipid peroxidation markers were assessed for different lengths of time. Analyzed parameters of antioxidant defense and membrane integrity showed a different trend at two selected magnetic fluxes, with a greater sensitivity of the cells exposed to 0.5 G, especially after 1 H. All significant alterations observed in the first 4 H of exposure reverted to controls 24 H after suggesting that under these conditions, ELF-EMF induces a slight oxidative stress that does not overwhelm the metabolic capacity of the cells or have a cytotoxic effect.

  5. Characterization of serum antibodies from women immunized with Gardasil: A study of HPV-18 infection of primary human keratinocytes.

    Science.gov (United States)

    Wang, Hsu-Kun; Wei, Qing; Moldoveanu, Zina; Huh, Warner K; Vu, Huong Lan; Broker, Thomas R; Mestecky, Jiri; Chow, Louise T

    2016-06-01

    The prevalent human papillomaviruses (HPVs) infect human epithelial tissues. Infections by the mucosotropic HPV genotypes cause hyperproliferative ano-genital lesions. Persistent infections by high-risk (HR) HPVs such as HPV-16, HPV-18 and related types can progress to high grade intraepithelial neoplasias and cancers. Prophylactic HPV vaccines are based on DNA-free virus-like particles (VLPs) composed of the major capsid protein L1 of HPV-16, -18, -6 and -11 (Gardasil) or HPV-16 and -18 (Cervarix). Sera from vaccinated animals effectively prevent HPV pseudovirions to infect cell lines and mouse cervical epithelia. Both vaccines have proven to be highly protective in people. HPV pseudovirions are assembled in HEK293TT cells from matched L1 and L2 capsid proteins to encapsidate a reporter gene. Pseudovirions and genuine virions have structural differences and they infect cell lines or primary human keratinocytes (PHKs) with different efficiencies. In this study, we show that sera and isolated IgG from women immunized with Gardasil prevent authentic HPV-18 virions from infecting PHKs, whereas non-immune sera and purified IgG thereof are uniformly ineffective. Using early passage PHKs, neutralization is achieved only if immune sera are added within 2-4h of infection. We attribute the timing effect to a conformational change in HPV virions, thought to occur upon initial binding to heparan sulfate proteoglycans (HSPG) on the cell surface. This interpretation is consistent with the inability of immune IgG bound to or taken up by PHKs to neutralize the virus. Interestingly, the window of neutralization increases to 12-16h in slow growing, late passage PHKs, suggestive of altered cell surface molecules. In vivo, this window might be further lengthened by the time required to activate the normally quiescent basal cells to become susceptible to infection. Our observations help explain the high efficacy of HPV vaccines.

  6. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone

    2004-01-01

    Caspases, members of the cysteine protease family, execute UVB-induced apoptosis in several cell lines and keratinocytes. Several researchers investigating UVB-induced apoptosis have demonstrated a dose-dependent protective effect of the synthetic peptide caspase inhibitor zVAD-fmk. However, z......VAD-fmk displays a dose-dependent protective effect against UVB-induced apoptosis, even at doses higher than those required to block all known proapoptotic caspases. In addition, it is known that zVAD-fmk also inhibits other cysteine proteases including cathepsins and calpains, and these proteases have recently....... This was done by investigating the effect of the irreversible cysteine protease inhibitor zFA-fmk, the cathepsin B inhibitor CA-074-Me and the calpain inhibitor ALLN on the viability of UVB-irradiated human keratinocytes and HeLa cells. At concentrations of 10 microM and above zVAD-fmk conferred partial dose...

  7. Microarray-Based Comparisons of Ion Channel Expression Patterns: Human Keratinocytes to Reprogrammed hiPSCs to Differentiated Neuronal and Cardiac Progeny

    Directory of Open Access Journals (Sweden)

    Leonhard Linta

    2013-01-01

    Full Text Available Ion channels are involved in a large variety of cellular processes including stem cell differentiation. Numerous families of ion channels are present in the organism which can be distinguished by means of, for example, ion selectivity, gating mechanism, composition, or cell biological function. To characterize the distinct expression of this group of ion channels we have compared the mRNA expression levels of ion channel genes between human keratinocyte-derived induced pluripotent stem cells (hiPSCs and their somatic cell source, keratinocytes from plucked human hair. This comparison revealed that 26% of the analyzed probes showed an upregulation of ion channels in hiPSCs while just 6% were downregulated. Additionally, iPSCs express a much higher number of ion channels compared to keratinocytes. Further, to narrow down specificity of ion channel expression in iPS cells we compared their expression patterns with differentiated progeny, namely, neurons and cardiomyocytes derived from iPS cells. To conclude, hiPSCs exhibit a very considerable and diverse ion channel expression pattern. Their detailed analysis could give an insight into their contribution to many cellular processes and even disease mechanisms.

  8. Transforming growth factor-beta modulates plasminogen activator activity and plasminogen activator inhibitor type-1 expression in human keratinocytes in vitro.

    Science.gov (United States)

    Wikner, N E; Elder, J T; Persichitte, K A; Mink, P; Clark, R A

    1990-11-01

    Transforming growth factor beta (TGF-beta) is a multifunctional mediator with effects on cellular growth, differentiation, and extracellular matrix (ECM) metabolism. Because TGF-beta stimulates fibronectin expression in cultured human keratinocytes, we wished to determine whether it might also affect ECM degradation through the plasminogen activator (PA)-plasminogen activator inhibitor (PAI) system. Immunofluorescence of human keratinocytes using a monospecific antiserum to type 1 PAI (PAI-1) showed enhanced cellular and ECM staining when they were cultured in the presence of TGF-beta. The antiserum also identified an Mr 50,000 protein in conditioned media that was markedly enhanced by TGF-beta. A corresponding stimulation of PAI-1 mRNA was demonstrated by quantitative RNA blot analysis. Total plasminogen activating activity of conditioned medium was markedly decreased by TGF-beta. Zymography showed this to be at least partially due to decreased secreted urokinase activity. TGF-beta may play an important role in stabilizing the provisional matrix synthesized by keratinocytes in healing wounds.

  9. Baicalin downregulates Porphyromonas gingivalis lipopolysaccharide-upregulated IL-6 and IL-8 expression in human oral keratinocytes by negative regulation of TLR signaling.

    Directory of Open Access Journals (Sweden)

    Wei Luo

    Full Text Available Periodontal (gum disease is one of the main global oral health burdens and severe periodontal disease (periodontitis is a leading cause of tooth loss in adults globally. It also increases the risk of cardiovascular disease and diabetes mellitus. Porphyromonas gingivalis lipopolysaccharide (LPS is a key virulent attribute that significantly contributes to periodontal pathogenesis. Baicalin is a flavonoid from Scutellaria radix, an herb commonly used in traditional Chinese medicine for treating inflammatory diseases. The present study examined the modulatory effect of baicalin on P. gingivalis LPS-induced expression of IL-6 and IL-8 in human oral keratinocytes (HOKs. Cells were pre-treated with baicalin (0-80 µM for 24 h, and subsequently treated with P. gingivalis LPS at 10 µg/ml with or without baicalin for 3 h. IL-6 and IL-8 transcripts and proteins were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of nuclear factor-κB (NF-κB, p38 mitogen-activated protein kinase (MAPK and c-Jun N-terminal kinase (JNK proteins was analyzed by western blot. A panel of genes related to toll-like receptor (TLR signaling was examined by PCR array. We found that baicalin significantly downregulated P. gingivalis LPS-stimulated expression of IL-6 and IL-8, and inhibited P. gingivalis LPS-activated NF-κB, p38 MAPK and JNK. Furthermore, baicalin markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling. In conclusion, the present study shows that baicalin may significantly downregulate P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs via negative regulation of TLR signaling.

  10. UVB-irradiated human keratinocytes and interleukin-1αindirectly increase MAP kinase/AP-1 activation and MMP-1 production in UVA-irradiated dermal fibroblasts

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yong; BI Zhi-gang

    2006-01-01

    Background Solar ultraviolet (UV) irradiation induces the production of matrix metalloproteinases (MMPs) by activating cellular signalling transduction pathways. MMPs are responsible for the degradation and/or inhibition of synthesis of collagenous extracellular matrix in connective tissues. We mimicked the action of environmental ultraviolet on skin and investigated the effects of UVB-irradiated human keratinocytes HaCaT and IL-1α on mitogen activated protein (MAP) kinase activation, c-Jun and c-Fos (AP-1 is composed of Jun and Fos proteins)mRNA expression and MMP-1 production in UVA-irradiated dermal fibroblasts.Methods Following UVA irradiation, the culture medium of fibroblasts was replaced by culture medium from UVB-irradiated HaCaT, or replaced by the complete culture medium with interleukin (IL)-1α. MAP kinase activity expression in fibroblasts was detected by Western blot. c-Jun and c-Fos mRNA expressions were determined by reverse transcriptional polymerase chain reaction (RT-PCR); MMP-1 production in culture medium was detected by enzyme-linked immunosorbent assay (ELISA).Results Culture medium from UVB-irradiated keratinocytes increased MAP kinase activity and c-Jun mRNA expression in UVA-irradiated fibroblasts. IL-1α increased MAP kinase activity and c-Jun mRNA expression,IL-1 α also increased c-Fos mRNA expression. Both culture media from UVB-irradiated human keratinocytes and externally applied IL-1 α increased MMP-1 production in UVA-irradiated fibroblasts.Conclusions UVB-irradiated keratinocytes and IL-1α indirectly promote MMP-1 production in UVA-irradiated fibroblasts by increasing MAP kinase/AP-1 activity. IL-1 may play an important role in the paracrine activation and dermal collagen excessive degradation leading to skin photoaging.

  11. Inflammatory responses of a human keratinocyte cell line to 10 nm citrate- and PEG-coated silver nanoparticles

    Science.gov (United States)

    Bastos, V.; Brown, D.; Johnston, H.; Daniel-da-Silva, A. L.; Duarte, I. F.; Santos, C.; Oliveira, H.

    2016-07-01

    Silver nanoparticles (AgNPs) are among the most commonly used engineered NPs and various commercially available products are designed to come in direct contact with the skin (wound dressings, textiles, creams, among others). Currently, there is limited understanding of the influence of coatings on the toxicity of AgNPs and in particular their ability to impact on AgNP's mediated inflammatory responses. As AgNPs are often stabilized by different coatings, including citrate and polyethyleneglycol (PEG), in this study we investigate the influence of citrate (Cit10) or PEG (PEG10) coatings to 10 nm AgNP on skin, using human HaCaT keratinocytes. AgNPs cytotoxicity and inflammatory response (nuclear factor (NF)-κB induction and cytokine production) of HaCaT were assessed after in vitro exposure to 10 and 40 µg/mL after 4, 24, and 48 h. Results showed that although both types of coated AgNPs decreased cell proliferation and viability, Cit10 AgNPs were more toxic. NF-κB inhibition was observed for the highest concentration (40 µg/mL) of PEG10 AgNPs, and the putative link to early apoptotic pathways observed in these cells is discussed. No production of IL-1β, IL-6, IL-10, and TNFα was stimulated by AgNPs. Furthermore, Cit10 and PEG10 AgNPs decreased the release of MCP-1 by HaCaT cells after 48 h of exposure. As cytokines are vital for the immunologic regulation in the human body, and it is demonstrated that they may interfere with NPs, more research is needed to understand how different AgNPs affect the immune system.

  12. HPV16 E7 protein and hTERT proteins defective for telomere maintenance cooperate to immortalize human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Jonathan Miller

    Full Text Available Previous studies have shown that wild-type human telomerase reverse transcriptase (hTERT protein can functionally replace the human papillomavirus type 16 (HPV-16 E6 protein, which cooperates with the viral E7 protein in the immortalization of primary keratinocytes. In the current study, we made the surprising finding that catalytically inactive hTERT (hTERT-D868A, elongation-defective hTERT (hTERT-HA, and telomere recruitment-defective hTERT (hTERT N+T also cooperate with E7 in mediating bypass of the senescence blockade and effecting cell immortalization. This suggests that hTERT has activities independent of its telomere maintenance functions that mediate transit across this restriction point. Since hTERT has been shown to have a role in gene activation, we performed microarray studies and discovered that E6, hTERT and mutant hTERT proteins altered the expression of highly overlapping sets of cellular genes. Most important, the E6 and hTERT proteins induced mRNA and protein levels of Bmi1, the core subunit of the Polycomb Group (PcG complex 1. We show further that Bmi1 substitutes for E6 or hTERT in cell immortalization. Finally, tissue array studies demonstrated that expression of Bmi1 increased with the severity of cervical dysplasia, suggesting a potential role in the progression of cervical cancer. Together, these data demonstrate that hTERT has extra-telomeric activities that facilitate cell immortalization and that its induction of Bmi1 is one potential mechanism for mediating this activity.

  13. Acquisition of high-level chromosomal instability is associated with integration of human papillomavirus type 16 in cervical keratinocytes.

    Science.gov (United States)

    Pett, Mark R; Alazawi, William O F; Roberts, Ian; Dowen, Sally; Smith, David I; Stanley, Margaret A; Coleman, Nicholas

    2004-02-15

    Whereas two key steps in cervical carcinogenesis are integration of high-risk human papillomavirus (HR-HPV) and acquisition of an unstable host genome, the temporal association between these events is poorly understood. Chromosomal instability is induced when HR-HPV E7 oncoprotein is overexpressed from heterologous promoters in vitro. However, it is not known whether such events occur at the "physiologically" elevated levels of E7 produced by deregulation of the homologous HR-HPV promoter after integration. Indeed, an alternative possibility is that integration in vivo is favored in an already unstable host genome. We have addressed these issues using the unique human papillomavirus (HPV) 16-containing cervical keratinocyte cell line W12, which was derived from a low-grade squamous intraepithelial lesion and thus acquired HPV16 by "natural" infection. Whereas W12 at low passage contains HPV16 episomes only, long-term culture results in the emergence of cells containing integrated HPV16 only. We show that integration of HPV16 in W12 is associated with 3' deletion of the E2 transcriptional repressor, resulting in deregulation of the homologous promoter of the integrant and an increase in E7 protein levels. We further demonstrate that high-level chromosomal instability develops in W12 only after integration and that the forms of instability observed correlate with the physical state of HPV16 DNA and the level of E7 protein. Whereas intermediate E7 levels are associated with numerical chromosomal abnormalities, maximal levels are associated with both numerical and structural aberrations. HR-HPV integration is likely to be a critical event in cervical carcinogenesis, preceding the development of chromosomal abnormalities that drive malignant progression.

  14. Keratinocyte-specific stat3 heterozygosity impairs development of skin tumors in human papillomavirus 8 transgenic mice.

    Science.gov (United States)

    De Andrea, Marco; Rittà, Massimo; Landini, Manuela M; Borgogna, Cinzia; Mondini, Michele; Kern, Florian; Ehrenreiter, Karin; Baccarini, Manuela; Marcuzzi, Gian Paolo; Smola, Sigrun; Pfister, Herbert; Landolfo, Santo; Gariglio, Marisa

    2010-10-15

    Human papillomaviruses (HPV) of the genus β are thought to play a role in human skin cancers, but this has been difficult to establish using epidemiologic approaches. To gain insight into the transforming activities of β-HPV, transgenic mouse models have been generated that develop skin tumors. Recent evidence suggests a central role of signal transducer and activator of transcription 3 (Stat3) as a transcriptional node for cancer cell-autonomous initiation of a tumor-promoting gene signature associated with cell proliferation, cell survival, and angiogenesis. Moreover, high levels of phospho-Stat3 have been detected in tumors arising in HPV8-CER transgenic mice. In this study, we investigate the in vivo role of Stat3 in HPV8-induced skin carcinogenesis by combining our established experimental model of HPV8-induced skin cancer with epidermis-restricted Stat3 ablation. Stat3 heterozygous epidermis was less prone to tumorigenesis than wild-type epidermis. Three of the 23 (13%) Stat3(+/-):HPV8 animals developed tumors within 12 weeks of life, whereas 54.3% of Stat3(+/+):HPV8 mice already exhibited tumors in the same observation period (median age for tumor appearance, 10 weeks). The few tumors that arose in the Stat3(+/-):HPV8 mice were benign and never progressed to a more malignant phenotype. Collectively, these results offer direct evidence of a critical role for Stat3 in HPV8-driven epithelial carcinogenesis. Our findings imply that targeting Stat3 activity in keratinocytes may be a viable strategy to prevent and treat HPV-induced skin cancer.

  15. Effects of the novel compound DK223 ([1E,2E-1,2-Bis(6-methoxy-2H-chromen-3-yl)methylene]hydrazine) on migration and proliferation of human keratinocytes and primary dermal fibroblasts.

    Science.gov (United States)

    Ho, Manh Tin; Kang, Hyun Sik; Huh, Jung Sik; Kim, Young Mee; Lim, Yoongho; Cho, Moonjae

    2014-07-23

    Wound healing plays an important role in protecting the human body from external infection. Cell migration and proliferation of keratinocytes and dermal fibroblasts are essential for proper wound healing. Recently, several studies have demonstrated that secondary compounds produced in plants could affect skin cells migration and proliferation. In this study, we identified a novel compound DK223 ([1E,2E-1,2-bis(6-methoxy-2H-chromen-3-yl)methylene]hydrazine) that concomitantly induced human keratinocyte migration and dermal fibroblast proliferation. We evaluated the regulation of epithelial and mesenchymal protein markers, such as E-cadherin and Vimentin, in human keratinocytes, as well as extracellular matrix (ECM) secretion and metalloproteinase families in dermal fibroblasts. DK223 upregulated keratinocyte migration and significantly increased the epithelial marker E-cadherin in a time-dependent manner. We also found that reactive oxygen species (ROS) increased significantly in keratinocytes after 2 h of DK223 exposure, returning to normal levels after 24 h, which indicated that DK223 had an early shock effect on ROS production. DK223 also stimulated fibroblast proliferation, and induced significant secretion of ECM proteins, such as collagen I, III, and fibronectin. In dermal fibroblasts, DK223 treatment induced TGF-β1, which is involved in a signaling pathway that mediates proliferation. In conclusion, DK223 simultaneously induced both keratinocyte migration via ROS production and fibroblast proliferation via TGF-β1 induction.

  16. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  17. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith

    2008-01-01

    calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...... study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning......-hydroxyacid-phytosphingosine ceramides (NP) were absent. Also some alterations in fatty acid profiles of ROC ceramides were noted, e.g., esterified omega-hydroxyacid-sphingosine contained increased levels of oleic acid instead of linoleic acid. The fraction of lipids covalently bound to corneocyte proteins was distinctly lower in ROC...

  18. Protective effect of C. sativa leaf extract against UV mediated-DNA damage in a human keratinocyte cell line.

    Science.gov (United States)

    Almeida, I F; Pinto, A S; Monteiro, C; Monteiro, H; Belo, L; Fernandes, J; Bento, A R; Duarte, T L; Garrido, J; Bahia, M F; Sousa Lobo, J M; Costa, P C

    2015-03-01

    Toxic effects of ultraviolet (UV) radiation on skin include protein and lipid oxidation, and DNA damage. The latter is known to play a major role in photocarcinogenesis and photoaging. Many plant extracts and natural compounds are emerging as photoprotective agents. Castanea sativa leaf extract is able to scavenge several reactive species that have been associated to UV-induced oxidative stress. The aim of this work was to analyze the protective effect of C. sativa extract (ECS) at different concentrations (0.001, 0.01, 0.05 and 0.1 μg/mL) against the UV mediated-DNA damage in a human keratinocyte cell line (HaCaT). For this purpose, the cytokinesis-block micronucleus assay was used. Elucidation of the protective mechanism was undertaken regarding UV absorption, influence on (1)O₂ mediated effects or NRF2 activation. ECS presented a concentration-dependent protective effect against UV-mediated DNA damage in HaCaT cells. The maximum protection afforded (66.4%) was achieved with the concentration of 0.1 μg/mL. This effect was found to be related to a direct antioxidant effect (involving (1)O₂) rather than activation of the endogenous antioxidant response coordinated by NRF2. Electrochemical studies showed that the good antioxidant capacity of the ECS can be ascribed to the presence of a pool of different phenolic antioxidants. No genotoxic or phototoxic effects were observed after incubation of HaCaT cells with ECS (up to 0.1 μg/mL). Taken together these results reinforce the putative application of this plant extract in the prevention/minimization of UV deleterious effects on skin.

  19. MicroRNA-181b negatively regulates the proliferation of human epidermal keratinocytes in psoriasis through targeting TLR4.

    Science.gov (United States)

    Feng, Cheng; Bai, Ming; Yu, Nan-Ze; Wang, Xiao-Jun; Liu, Zeng

    2017-02-01

    Our study aims to explore the role of microRNA-181b (miR-181b) and TLR in the regulation of cell proliferation of human epidermal keratinocytes (HEKs) in psoriasis. Twenty-eight patients diagnosed with psoriasis vulgaris were selected as a case group with their lesional and non-lesional skin tissues collected. A control group consisted of 20 patients who underwent plastic surgery with their healthy skin tissues collected. Real-time quantitative fluorescence polymerase chain reaction (RT-qPCR), in situ hybridization and immunohistochemistry were used to detect the expressions of miR-181b and TLR4 in HEKs of healthy skin, psoriatic lesional skin and non-lesional skin respectively. The 3' untranslated region (3'UTR) of TLR4 combined with miR-181b was verified by a dual-luciferase reporter assay. Western blotting and bromodeoxyuridine were applied for corresponding detection of TLR4 expression and cell mitosis. The expression of miR-181b in HEKs of psoriatic lesional skin was less than healthy skin and psoriatic non-lesional skin. In psoriatic lesional and non-lesional skin, TLR4-positive cell rates and the number of positive cells per square millimetre were higher than healthy skin. The dual-luciferase reporter assay verified that miR-181b targets TLR4. HEKs transfected with miR-181b mimics had decreased expression of TLR4, along with the decrease of mitotic indexes and Brdu labelling indexes. However, HEKs transfected with miR-181b inhibitors showed increased TLR4 expression, mitotic indexes and Brdu labelling indexes. HEKs transfected with both miR-181b inhibitors and siTLR4 had decreased mitotic indexes and Brdu labelling indexes. These results indicate that miR-181b can negatively regulate the proliferation of HEKs in psoriasis by targeting TLR4.

  20. Deoxynivalenol induced mouse skin tumor initiation: Elucidation of molecular mechanisms in human HaCaT keratinocytes.

    Science.gov (United States)

    Mishra, Sakshi; Tewari, Prachi; Chaudhari, Bhushan P; Dwivedi, Premendra D; Pandey, Haushila P; Das, Mukul

    2016-11-01

    Among food contaminants, mycotoxins are toxic to both human and animal health. Our prior studies suggest that Deoxynivalenol (DON), a mycotoxin, behaves as a tumor promoter by inducing edema, hyperplasia, ODC activity and activation of MAPK's in mouse skin. In this study, topical application of DON, 336 and 672 nmol significantly enhanced ROS levels, DNA damage and apoptosis with concomitant downregulation of Ki-67, cyclin D, cyclin E, cyclin A and cyclin-dependent kinases (CDK4 and CDK2) thereby resulting in tumor initiation in mouse skin. Further, the elucidation of molecular mechanisms of tumor initiation by DON (0.42-3.37 nmol/ml) in HaCaT keratinocytes, revealed (i) enhanced ROS generation with cell cycle phase arrest in G0/G1 phase, (ii) increase in levels of 8-OxoG (6-24 hr) and γH2AX protein, (iii) significant enhancement in oxidative stress marker enzymes LPO, GSH, GR with concomitant decrease in antioxidant enzymes catalase, GPx, GST, SOD and mitochondrial membrane potential after DON (1.68 nmol) treatment, (iv) suppression of Nrf2 translocation to nucleus, enhanced phosphorylation with subsequent activation ERK1/2, p38 and JNK MAPK's following DON (1.68 nmol) treatment, (v) overexpression of c-jun, c-fos proteins, upregulation of Bax along with downregulation of Bcl-2 proteins, (vi) increase in cytochrome-c, caspase-9, caspase-3 and poly ADP ribose polymerase levels leads to apoptosis. Pretreatment of superoxide dismutase, mannitol and ethanol to HaCaT cells resulted in significant reduction in ROS levels and apoptosis indicating the role of superoxide and hydroxyl radicals in DON induced apoptosis as an early event and skin tumor initiation as a late event.

  1. Proteomic Analysis of Arsenic-Induced Oxidative Stress in Human Epidermal Keratinocytes

    Science.gov (United States)

    Chronic exposure to inorganic arsenic (IAs) has been associated with the development of several human cancers, including those found in the skin, lung, urinary bladder, liver, prostate and kidney. The precise mechanisms by which arsenic causes cancer are unknown. Defining the mod...

  2. DeltaNp63alpha repression of the Notch1 gene supports the proliferative capacity of normal human keratinocytes and cervical cancer cells.

    Science.gov (United States)

    Yugawa, Takashi; Narisawa-Saito, Mako; Yoshimatsu, Yuki; Haga, Kei; Ohno, Shin-ichi; Egawa, Nagayasu; Fujita, Masatoshi; Kiyono, Tohru

    2010-05-15

    The p53 family member p63 is a master regulator of epithelial development. One of its isoforms, DeltaNp63alpha, is predominantly expressed in the basal cells of stratified epithelia and plays a fundamental role in control of regenerative potential and epithelial integrity. In contrast to p53, p63 is rarely mutated in human cancers, but it is frequently overexpressed in squamous cell carcinomas (SCC). However, its functional relevance to tumorigenesis remains largely unclear. We previously identified the Notch1 gene as a novel transcriptional target of p53. Here, we show that DeltaNp63alpha functions as a transcriptional repressor of the Notch1 gene through the p53-responsive element. Knockdown of p63 caused upregulation of Notch1 expression and marked reduction in proliferation and clonogenicity of both normal human keratinocytes and cervical cancer cell lines overexpressing DeltaNp63alpha. Concomitant silencing of Notch1 significantly rescued this phenotype, indicating the growth defect induced by p63 deficiency to be, at least in part, attributable to Notch1 function. Conversely, overexpression of DeltaNp63alpha decreased basal levels of Notch1, increased proliferative potential of normal human keratinocytes, and inhibited both p53-dependent and p53-independent induction of Notch1 and differentiation markers upon genotoxic stress and serum exposure, respectively. These results suggest that DeltaNp63alpha maintains the self-renewing capacity of normal human keratinocytes and cervical cancer cells partly through transcriptional repression of the Notch1 gene and imply a novel pathogenetical significance of frequently observed overexpression of DeltaNp63alpha together with p53 inactivation in SCCs.

  3. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  4. Cigarette Smoke Affects ABCAl Expression via Liver X Receptor Nuclear Translocation in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Claudia Sticozzi

    2010-09-01

    Full Text Available Cutaneous tissue is the first barrier against outdoor insults. The outer most layer of the skin, the stratum corneum (SC, is formed by corneocytes embedded in a lipid matrix (cholesterol, ceramide and fatty acids. Therefore, the regulation of lipids and, in particular, of cholesterol homeostasis in the skin is of great importance. ABCA1 is a membrane transporter responsible for cholesterol efflux and plays a key role in maintaining cellular cholesterol levels. Among the many factors that have been associated with skin diseases, the environmental stressor cigarette smoke has been recently studied. In the present study, we demonstrate that ABCA1 expression in human cells (HaCaT was increased (both mRNA and protein levels after CS exposure. This effect was mediated by the inhibition of NFkB (aldehydes adducts formation that allows the translocation of liver X receptor (LXR. These findings suggest that passive smoking may play a role in skin cholesterol levels and thus affect cutaneous tissues functions.

  5. Single cell mechanics of keratinocyte cells.

    Science.gov (United States)

    Lulevich, Valentin; Yang, Hsin-ya; Isseroff, R Rivkah; Liu, Gang-yu

    2010-11-01

    Keratinocytes represent the major cell type of the uppermost layer of human skin, the epidermis. Using AFM-based single cell compression, the ability of individual keratinocytes to resist external pressure and global rupturing forces is investigated and compared with various cell types. Keratinocytes are found to be 6-70 times stiffer than other cell types, such as white blood, breast epithelial, fibroblast, or neuronal cells, and in contrast to other cell types they retain high mechanic strength even after the cell's death. The absence of membrane rupturing peaks in the force-deformation profiles of keratinocytes and their high stiffness during a second load cycle suggests that their unique mechanical resistance is dictated by the cytoskeleton. A simple analytical model enables the quantification of Young's modulus of keratinocyte cytoskeleton, as high as 120-340 Pa. Selective disruption of the two major cytoskeletal networks, actin filaments and microtubules, does not significantly affect keratinocyte mechanics. F-actin is found to impact cell deformation under pressure. During keratinocyte compression, the plasma membrane stretches to form peripheral blebs. Instead of blebbing, cells with depolymerized F-actin respond to pressure by detaching the plasma membrane from the cytoskeleton underneath. On the other hand, the compression force of keratinocytes expressing a mutated keratin (cell line, KEB-7) is 1.6-2.2 times less than that for the control cell line that has normal keratin networks. Therefore, we infer that the keratin intermediate filament network is responsible for the extremely high keratinocyte stiffness and resilience. This could manifest into the rugged protective nature of the human epidermis.

  6. CARMA2sh and ULK2 control pathogen-associated molecular patterns recognition in human keratinocytes: psoriasis-linked CARMA2sh mutants escape ULK2 censorship.

    Science.gov (United States)

    Scudiero, Ivan; Mazzone, Pellegrino; D'Andrea, Luca E; Ferravante, Angela; Zotti, Tiziana; Telesio, Gianluca; De Rubis, Gabriele; Reale, Carla; Pizzulo, Maddalena; Muralitharan, Shanmugakonar; Vito, Pasquale; Stilo, Romania

    2017-02-23

    The molecular complexes formed by specific members of the family of CARMA proteins, the CARD domain-containing adapter molecule BCL10 and MALT1 (CBM complex) represent a central hub in regulating activation of the pleiotropic transcription factor NF-κB. Recently, missense mutations in CARMA2sh have been shown to cause psoriasis in a dominant manner and with high penetrancy. Here, we demonstrate that in human keratinocytes CARMA2sh plays an essential role in the signal transduction pathway that connects pathogen-associated molecular patterns recognition to NF-κB activation. We also find that the serine/threonine kinase ULK2 binds to and phosphorylates CARMA2sh, thereby inhibiting its capacity to activate NF-κB by promoting lysosomal degradation of BCL10, which is essential for CARMA2sh-mediated NF-κB signaling. Remarkably, CARMA2sh mutants associated with psoriasis escape ULK2 inhibition. Finally, we show that a peptide blocking CARD-mediated BCL10 interactions reduces the capacity of psoriasis-linked CARMA2sh mutants to activate NF-κB. Our work elucidates a fundamental signaling mechanism operating in human keratinocytes and opens to novel potential tools for the therapeutical treatment of human skin disorders.

  7. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  8. Quercetin in combating H_2O_2 induced early cell apoptosis and mitochondrial damage to normal human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yan; HE Pei-ying; DU Juan; ZHANG Jian-zhong

    2010-01-01

    Background Oxidative stress plays an important role in the pathogenesis of epidermal diseases. This study aimed to investigate the effects of quercetin on the anti-oxidative response and on mitochondrial protection in cultured normal human keratinocytes. Methods Cultured HaCaT cells were treated with different concentrations of H_2O_2 (0, 50, 100, 250, 500 μmol/L) for different periods of time (0.5, 1,2,4 hours) to establish an oxidative stress model. The cultured HaCaT cells were randomly assigned to control, H_2O_2, and quercetin+H_2O_2 groups. For the quercetin groups, the cells were treated with different concentrations of quercetin (0,10, 25, 50 μmol/L) before exposure to H_2O_2. Morphological changes of the cells were observed under an inverted microscope and an electron microscope. The cell viability was detected by the MTT method. The cell apoptosis (AnnexinV/propidium iodide double stain) and mitochondrial membrane potential (△ψm) changes were detected by flow cytometry. Results An oxidative stress model of HaCaT cells was established under a suitable concentration (250 μmol/L) and treated time of H_2O_2 (2 hours). The cell viability and △ψm decreased in a concentration-dependent and time-dependent manner while the percentage of apoptotic cells significantly increased in the H_2O_2 groups compared with the control group (P<0.05). The cell viability and △ψm of the quercetin treated group increased (P<0.05) and the percentage of apoptotic cells decreased at concentrations of 1-50 μmol/L quercetin (P<0.01) compared with H_2O_2 treated group. Conclusion Quercetin can relieve the cell damage and apoptosis from H_2O_2 induced injury to HaCaT cells by anti-oxidation and mitochondrial protection.

  9. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes.

    Science.gov (United States)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-11-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis.

  10. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    Energy Technology Data Exchange (ETDEWEB)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A. (Univ. of Colorado School of Medicine, Denver (USA))

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs.

  11. Differentiation of Keratinocytes Modulates Skin HPA Analog.

    Science.gov (United States)

    Wierzbicka, Justyna M; Żmijewski, Michał A; Antoniewicz, Jakub; Sobjanek, Michal; Slominski, Andrzej T

    2017-01-01

    It is well established, that epidermal keratinocytes express functional equivalent of hypothalamus-pituitary-adrenal axis (HPA) in order to respond to changing environment and maintain internal homeostasis. We are presenting data indicating that differentiation of primary neonatal human keratinocytes (HPEKp), induced by prolonged incubation or calcium is accompanied by significant changes in the expression of the elements of skin analog of HPA (sHPA). Expression of CRF, UCN1-3, POMC, ACTH, CRFR1, CRFR2, MC1R, MC2R, and GR (coded by NR3C1 gene) were observed on gene/protein levels along differentiation of keratinocytes in culture with similar pattern seen by immunohistochemistry on full thickness skin biopsies. Expression of CRF was more pronounced in less differentiated keratinocytes, which corresponded to the detection of CRF immunoreactivity preferentially in the stratum basale. POMC expression was enhanced in more differentiated keratinocytes, which corresponded to detection of ACTH immunoreactivity, predominantly in the stratum spinosum and stratum granulosum. Expression of urocortins was also affected by induction of HPEKp differentiation. Immunohistochemical studies showed high prevalence of CRFR1 in well differentiated keratinocytes, while smaller keratinocytes showed predominantly CRFR2 immunoreactivity. MC2R mRNA levels were elevated from days 4 to 8 of in vitro incubation, while MC2R immunoreactivity was the highest in the upper layers of epidermis. Similar changes in mRNA/protein levels of sHPA elements were observed in HPEKp keratinocytes treated with calcium. Summarizing, preferential expression of CRF and POMC (ACTH) by populations of keratinocytes on different stage of differentiation resembles organization of central HPA axis suggesting their distinct role in physiology and pathology of the epidermis. J. Cell. Physiol. 232: 154-166, 2017. © 2016 Wiley Periodicals, Inc.

  12. Tissue engineering of composite grafts: Cocultivation of human oral keratinocytes and human osteoblast-like cells on laminin-coated polycarbonate membranes and equine collagen membranes under different culture conditions.

    Science.gov (United States)

    Glaum, R; Wiedmann-Al-Ahmad, M; Huebner, U; Schmelzeisen, R

    2010-05-01

    In complex craniomaxillofacial defects, the simultaneous reconstruction of hard and soft tissue is often necessary. Until now, oral keratinocytes and osteoblast-like cells have not been cocultivated on the same carrier. For the first time, the cocultivation of human oral keratinocytes and human osteoblast-like cells has been investigated in this study. Different carriers (laminin-coated polycarbonate and equine collagen membranes) and various culture conditions were examined. Human oral keratinocytes and human osteoblast-like cells from five patients were isolated from tissue samples, seeded on the opposite sides of the carriers and cultivated for 1 and 2 weeks under static conditions in an incubator and in a perfusion chamber. Proliferation and morphology of the cells were analyzed by EZ4U-tests, light microscopy, and scanning electron microscopy. Cocultivation of both cell-types seeded on one carrier was possible. Quantitative and qualitative growth was significantly better on collagen membranes when compared with laminin-coated polycarbonate membranes independent of the culture conditions. Using perfusion culture in comparison to static culture, the increase of cell proliferation after 2 weeks of cultivation when compared with the proliferation after 1 week was significantly lower, independent of the carriers used. In conclusion, the contemporaneous cultivation of human oral keratinocytes and human osteoblast-like cells on the same carrier is possible, a prerequisite for planned in vivo studies. As carrier collagen is superior to laminin-coated polycarbonate membranes. Regarding the development over time, the increase of proliferation rate is lower in perfusion culture. Examinations of cellular differentiation over time under various culture conditions will be subject of further investigations.

  13. Arsenic Induces p62 Expression to Form a Positive Feedback Loop with Nrf2 in Human Epidermal Keratinocytes: Implications for Preventing Arsenic-Induced Skin Cancer

    Science.gov (United States)

    Shah, Palak; Trinh, Elaine; Qiang, Lei; Xie, Lishi; Hu, Wen-Yang; Prins, Gail S.; Pi, Jingbo; He, Yu-Ying

    2017-01-01

    Exposure to inorganic arsenic in contaminated drinking water poses an environmental public health threat for hundreds of millions of people in the US and around the world. Arsenic is a known carcinogen for skin cancer. However, the mechanism by which arsenic induces skin cancer remains poorly understood. Here, we have shown that arsenic induces p62 expression in an autophagy-independent manner in human HaCaT keratinocytes. In mouse skin, chronic arsenic exposure through drinking water increases p62 protein levels in the epidermis. Nrf2 is required for basal and arsenic-induced p62 up-regulation. p62 knockdown reduces arsenic-induced Nrf2 activity, and induces sustained p21 up-regulation. p62 induction is associated with increased proliferation in mouse epidermis. p62 knockdown had little effect on arsenic-induced apoptosis, while it decreased cell proliferation following arsenic treatment. Our findings indicate that arsenic induces p62 expression to regulate the Nrf2 pathway in human keratinocytes and suggest that targeting p62 may help prevent arsenic-induced skin cancer. PMID:28125038

  14. An ethanol extract derived from Bonnemaisonia hamifera scavenges ultraviolet B (UVB) radiation-induced reactive oxygen species and attenuates UVB-induced cell damage in human keratinocytes.

    Science.gov (United States)

    Piao, Mei Jing; Hyun, Yu Jae; Cho, Suk Ju; Kang, Hee Kyoung; Yoo, Eun Sook; Koh, Young Sang; Lee, Nam Ho; Ko, Mi Hee; Hyun, Jin Won

    2012-12-14

    The present study investigated the photoprotective properties of an ethanol extract derived from the red alga Bonnemaisonia hamifera against ultraviolet B (UVB)-induced cell damage in human HaCaT keratinocytes. The Bonnemaisonia hamifera ethanol extract (BHE) scavenged the superoxide anion generated by the xanthine/xanthine oxidase system and the hydroxyl radical generated by the Fenton reaction (FeSO₄ + H₂O₂), both of which were detected by using electron spin resonance spectrometry. In addition, BHE exhibited scavenging activity against the 1,1-diphenyl-2-picrylhydrazyl radical and intracellular reactive oxygen species (ROS) that were induced by either hydrogen peroxide or UVB radiation. BHE reduced UVB-induced apoptosis, as shown by decreased apoptotic body formation and DNA fragmentation. BHE also attenuated DNA damage and the elevated levels of 8-isoprostane and protein carbonyls resulting from UVB-mediated oxidative stress. Furthermore, BHE absorbed electromagnetic radiation in the UVB range (280-320 nm). These results suggest that BHE protects human HaCaT keratinocytes against UVB-induced oxidative damage by scavenging ROS and absorbing UVB photons, thereby reducing injury to cellular components.

  15. An Ethanol Extract Derived from Bonnemaisonia hamifera Scavenges Ultraviolet B (UVB Radiation-Induced Reactive Oxygen Species and Attenuates UVB-Induced Cell Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nam Ho Lee

    2012-12-01

    Full Text Available The present study investigated the photoprotective properties of an ethanol extract derived from the red alga Bonnemaisonia hamifera against ultraviolet B (UVB-induced cell damage in human HaCaT keratinocytes. The Bonnemaisonia hamifera ethanol extract (BHE scavenged the superoxide anion generated by the xanthine/xanthine oxidase system and the hydroxyl radical generated by the Fenton reaction (FeSO4 + H2O2, both of which were detected by using electron spin resonance spectrometry. In addition, BHE exhibited scavenging activity against the 1,1-diphenyl-2-picrylhydrazyl radical and intracellular reactive oxygen species (ROS that were induced by either hydrogen peroxide or UVB radiation. BHE reduced UVB-induced apoptosis, as shown by decreased apoptotic body formation and DNA fragmentation. BHE also attenuated DNA damage and the elevated levels of 8-isoprostane and protein carbonyls resulting from UVB-mediated oxidative stress. Furthermore, BHE absorbed electromagnetic radiation in the UVB range (280–320 nm. These results suggest that BHE protects human HaCaT keratinocytes against UVB-induced oxidative damage by scavenging ROS and absorbing UVB photons, thereby reducing injury to cellular components.

  16. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  17. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Science.gov (United States)

    Thompson, Benjamin C; Halliday, Gary M; Damian, Diona L

    2015-01-01

    Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV) radiation and affects DNA damage and repair. Nicotinamide (vitamin B3) reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2) solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  18. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    proteins in alphabetical order), "basal cell markers", "differentiation markers", "proteins highly up-regulated in psoriatic skin", "microsequenced proteins" and "human autoantigens". For reference, we have also included 2-D gel (isoelectric focusing) patterns of cultured normal and psoriatic keratinocytes......A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  19. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  20. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    Energy Technology Data Exchange (ETDEWEB)

    Mera, Kentaro [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Kawahara, Ko-ichi [Department of Laboratory and Vascular Medicine Cardiovascular and Respiratory Disorders Advanced Therapeutics, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Tada, Ko-ichi; Kawai, Kazuhiro [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Hashiguchi, Teruto; Maruyama, Ikuro [Department of Laboratory and Vascular Medicine Cardiovascular and Respiratory Disorders Advanced Therapeutics, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Kanekura, Takuro, E-mail: takurok@m2.kufm.kagoshima-u.ac.jp [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan)

    2010-06-25

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-L{alpha}, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm{sup 2} irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm{sup 2} UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  1. Anti-Inflammatory Effects of Concentrated Ethanol Extracts of Edelweiss (Leontopodium alpinum Cass. Callus Cultures towards Human Keratinocytes and Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Lulli Daniela

    2012-01-01

    Full Text Available Edelweiss (Leontopodium alpinum Cass. is traditionally employed in folk medicine as an anti-inflammatory remedy. In nature, the plant is sparsely available and protected; therefore production of callus cultures was established. A concentrated ethanolic extract of culture homogenate, with leontopodic acid representing 55±2% of the total phenolic fraction (ECC55, was characterized for anti-inflammatory properties in primary human keratinocytes (PHKs and endotheliocytes (HUVECs. Inflammatory responses were induced by UVA+UVB, lipopolysaccharide (LPS, oxidized low-density lipoprotein (oxLDL, and a mixture of proinflammatory cytokines. Trichostatin A, a sirtuin inhibitor, was used to induce keratinocyte inflammatory senescence. ECC55 (10–50 μg/mL protected PHK from solar UV-driven damage, by enhancing early intracellular levels of nitric oxide, although not affecting UV-induced expression of inflammatory genes. Comparison of the dose-dependent inhibition of chemokine (IL-8, IP-10, MCP-1 and growth factor (GM-CSF release from PHK activated by TNFα + IFNγ showed that leontopodic acid was mainly responsible for the inhibitory effects of ECC55. Sirtuin-inhibited cell cycle, proliferation, and apoptosis markers were restored by ECC55. The extract inhibited LPS-induced IL-6 and VCAM1 genes in HUVEC, as well as oxLDL-induced selective VCAM1 overexpression. Conclusion. Edelweiss cell cultures could be a valuable source of anti-inflammatory substances potentially applicable for chronic inflammatory skin diseases and bacterial and atherogenic inflammation.

  2. The human keratinocyte two-dimensional gel protein database (update 1995): mapping components of signal transduction pathways

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Gromov, P

    1995-01-01

    )vaccinia virus expression of full length cDNAs, and (vi) in vitro transcription/translation of full-length cDNAs. This year, special emphasis has been given to the identification of signal transduction components by using 2-D gel immunoblotting of crude keratinocyte lysates in combination with enhanced......--through a systematic study of ekeratinocytes--qualitative and quantitative information on proteins and their genes that may allow us to identify abnormal patterns of gene expression and to pinpoint signaling pathways and components affected in various skin diseases, cancer included. Udgivelsesdato: 1995-Dec...

  3. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  4. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    Science.gov (United States)

    2005-01-01

    CCR5 , which is commonly used by HIV to gain entry into cells. Thus, HHV-8 inhibits the ability of HIV to infect cells already infected by HHV-8...can be recruited by cytokines and chemokines secreted by keratinocytes during inflammation. Macrophage inflammatory protein 3a (MIP-3a) functions as a...common 74 feature of E6 and E7 proteins from high- and low-risk HPV types 4.2.3 Transcription of MIP-3a requires NF-r.B signaling 76 4.3 Discussion

  5. Antimicrobial agent triclosan is a proton ionophore uncoupler of mitochondria in living rat and human mast cells and in primary human keratinocytes.

    Science.gov (United States)

    Weatherly, Lisa M; Shim, Juyoung; Hashmi, Hina N; Kennedy, Rachel H; Hess, Samuel T; Gosse, Julie A

    2016-06-01

    Triclosan (TCS) is an antimicrobial used widely in hospitals and personal care products, at ~10 mm. Human skin efficiently absorbs TCS. Mast cells are ubiquitous key players both in physiological processes and in disease, including asthma, cancer and autism. We previously showed that non-cytotoxic levels of TCS inhibit degranulation, the release of histamine and other mediators, from rat basophilic leukemia mast cells (RBL-2H3), and in this study, we replicate this finding in human mast cells (HMC-1.2). Our investigation into the molecular mechanisms underlying this effect led to the discovery that TCS disrupts adenosine triphosphate (ATP) production in RBL-2H3 cells in glucose-free, galactose-containing media (95% confidence interval EC50 = 7.5-9.7 µm), without causing cytotoxicity. Using these same glucose-free conditions, 15 µm TCS dampens RBL-2H3 degranulation by 40%. The same ATP disruption was found with human HMC-1.2 cells (EC50 4.2-13.7 µm), NIH-3 T3 mouse fibroblasts (EC50 4.8-7.4 µm) and primary human keratinocytes (EC50 3.0-4.1 µm) all with no cytotoxicity. TCS increases oxygen consumption rate in RBL-2H3 cells. Known mitochondrial uncouplers (e.g., carbonyl cyanide 3-chlorophenylhydrazone) previously were found to inhibit mast cell function. TCS-methyl, which has a methyl group in place of the TCS ionizable proton, affects neither degranulation nor ATP production at non-cytotoxic doses. Thus, the effects of TCS on mast cell function are due to its proton ionophore structure. In addition, 5 µm TCS inhibits thapsigargin-stimulated degranulation of RBL-2H3 cells: further evidence that TCS disrupts mast cell signaling. Our data indicate that TCS is a mitochondrial uncoupler, and TCS may affect numerous cell types and functions via this mechanism. Copyright © 2015 John Wiley & Sons, Ltd.

  6. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  7. Ectoine from halophilic microorganisms induces the expression of hsp70 and hsp70B' in human keratinocytes modulating the proinflammatory response.

    Science.gov (United States)

    Buommino, Elisabetta; Schiraldi, Chiara; Baroni, Adone; Paoletti, Iole; Lamberti, Monica; De Rosa, Mario; Tufano, Maria Antonietta

    2005-01-01

    The heat shock proteins (Hsps) have an important role in the cytoprotection and repair of cells and tissues. One potential mechanism of protection is the ability of Hsp to inhibit genetic expression of proinflammatory cytokines, the transcription of which is dependent on nuclear factor-kappa B (NF-kappaB) activation. In this study, we evaluated the ability of ectoine, a novel natural biomolecule produced by halophilic microorganisms, to activate the hsp70 and hsp70B'. By reverse transcriptase-polymerase chain reaction and Western blot analysis, we demonstrated increased hsp70B' gene expression in human keratinocytes treated with ectoine and heat stressed. In contrast, in the absence of heat shock, ectoine was unable to induce hsp70B' but had the ability to induce another member of the Hsp family, the hsp70. The latter is not only elevated in response to stress but is also present at basal level in unstressed cells. In addition, ectoine had no effect on proinflammatory cytokines interleukin (IL)-1alpha, IL-6, IL-8, and tumor necrosis factor-alpha and on NF-kappaB and IkappaB-alpha pathway, whereas it downregulated the expression of cited proinflammatory cytokines, in lipopolysaccharides-treated keratinocytes. These results highlighted the ability of ectoine to protect cells from stress conditions and to prevent cell damage by maintaining an elevated level of the Hsp70. Overall, these data might suggest the use of this compatible solute in cosmetic and even pharmaceutical preparations aiming to activate a cytoprotective heat shock response in human cells.

  8. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  9. The Inflammasome and the Epidermal Growth Factor Receptor (EGFR Are Involved in the Staphylococcus aureus-Mediated Induction of IL-1alpha and IL-1beta in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Maren Simanski

    Full Text Available Staphylococcus (S. aureus is an important pathogen causing various infections including those of the skin. Keratinocytes are able to sense invading S. aureus and to initiate a fast defense reaction by the rapid release of innate defense mediators such as antimicrobial peptides and cytokines. There is increasing evidence that the cytokines IL-1alpha and IL-1beta, which both signal through the IL-1 receptor, play an important role in cutaneous defense against S. aureus. The aim of this study was to gain more insight into the underlying mechanisms leading to the S. aureus-induced IL-1alpha and IL-1beta expression in keratinocytes. Infection of human primary keratinocytes with S. aureus led to the induction of gene expression and protein secretion of IL-1alpha and IL-1beta. Full S. aureus-induced IL-1 protein release required the inflammasome components caspase-1 and ASC (apoptosis-associated speck-like protein containing a CARD whereas gene induction of IL-1alpha and IL-beta by S. aureus was not dependent on caspase-1 and ASC. Since patients receiving anti-cancer therapy by inhibition of the epidermal growth factor receptor (EGFR often suffer from skin infections caused by S. aureus we additionally evaluated whether the EGFR pathway may be involved in the IL-1alpha and IL-1beta induction by S. aureus. Inactivation of the EGFR with a blocking antibody decreased the S. aureus-mediated IL-1alpha and IL-1beta induction in primary keratinocytes. Moreover, the use of siRNA experiments revealed that ADAM17 (A Disintegrin and A Metalloprotease 17, a metalloproteinase known to mediate the shedding and release of EGFR ligands, was required for full induction of IL-1alpha and IL-1beta in keratinocytes infected with S. aureus. A failure of keratinocytes to adequately upregulate IL-1alpha and IL-1beta may promote S. aureus skin infections.

  10. The key role of miR-21-regulated SOD2 in the medium-mediated bystander responses in human fibroblasts induced by α-irradiated keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Wenqian; Yin, Xiaoming; Wang, Longxiao; Wang, Jingdong; Zhu, Wei; Cao, Jianping [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Yang, Hongying, E-mail: yanghongying@suda.edu.cn [School of Radiation Medicine and Protection, Medical College of Soochow University/Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, 199 Renai Road, Suzhou Industrial Park, Suzhou, Jiangsu Province 215123 (China); Institute of Radiotherapy & Oncology, Soochow University (China)

    2015-10-15

    Highlights: • After co-culture with α-irradiated HaCaT cells, WS1 cells displayed oxidative stress and DNA damage. • Increased miR-21 expression in bystander cells was critical to the occurrence of RIBEs. • SOD2 of bystander cells played an important role in bystander responses. • miR-21 mediated bystander effects through its regulation on SOD2. - Abstract: Radiation-induced bystander effect (RIBE) is well accepted in the radiation research field by now, but the underlying molecular mechanisms for better understanding this phenomenon caused by intercellular communication and intracellular signal transduction are still incomplete. Although our previous study has demonstrated an important role of miR-21 of unirradiated bystander cells in RIBEs, the direct evidence for the hypothesis that RIBE is epigenetically regulated is still limited and how miR-21 mediates RIBEs is unknown. Reactive oxygen species (ROS) have been demonstrated to be involved in RIBEs, however, the roles of anti-oxidative stress system of cells in RIBEs are unclear. Using transwell insert co-culture system, we investigated medium-mediated bystander responses in WS1 human fibroblasts after co-culture with HaCaT keratinocytes traversed by α-particles. Results showed that the ROS levels in unirradiated bystander WS1 cells were significantly elevated after 30 min of co-culture, and 53BP1 foci, a surrogate marker of DNA damage, were obviously induced after 3 h of co-culture. This indicates the occurrence of oxidative stress and DNA damage in bystander WS1 cells after co-culture with irradiated keratinocytes. Furthermore, the expression of miR-21 was increased in bystander WS1 cells, downregulation of miR-21 eliminated the bystander responses, overexpression of miR-21 alone could induce bystander-like oxidative stress and DNA damage in WS1 cells. These data indicate an important mediating role of miR-21 in RIBEs. In addition, MnSOD or SOD2 in WS1 cells was involved in the bystander effects

  11. Concurrence of replicative senescence and elevated expression of p16(INK4A) with subculture-induced but not calcium-induced differentiation in normal human oral keratinocytes.

    Science.gov (United States)

    Lee, G; Park, B S; Han, S E; Oh, J E; You, Y O; Baek, J H; Kim, G S; Min, B M

    2000-10-01

    Primary normal human oral keratinocytes (NHOKs) undergo differentiation in the presence of calcium concentrations higher than 0.15 mM in vitro, which is useful in investigating the mechanisms involved in the differentiation of epithelial cells. Serial subculture of NHOKs to the postmitotic stage also induces terminal differentiation. However, the detailed mechanisms of both differentiation processes remain substantially unknown. To investigate the molecular differences in these processes, NHOKs were induced to differentiate by exposure to 1.2 mM of calcium and by serial subculture to the postmitotic stage. To study whether the cells were induced to differentiate and to undergo replicative senescence, the amount of cellular involucrin and the expression of senescence-associated beta-galactosidase (SA-beta-gal) were measured respectively. The expression of replicative senescence-associated genes and the activity of telomerase from the differentiated cells were also determined. Both calcium treatment and serial subculture to the postmitotic stage notably elevated the cellular involucrin. The percentage of SA-beta-gal-positive cells was significantly elevated by the continued subculture, but such changes were not observed in keratinocytes exposed to calcium. The concentration of cellular p16(INK4A) protein was progressively increased by the continued subculture but was not changed by calcium treatment. On the other hand, the concentrations of cellular p53 were similar in both differentiation processes. However, telomerase activity was lost in NHOKs that had undergone differentiation by both calcium treatment and serial subculture. The results indicate that calcium-induced differentiation of NHOKs has similar characteristics to their serial subculture-induced differentiation, but that the differentiation processes are not identical, because calcium-induced differentiation does not concur with either replicative senescence or the gradually increased concentration of p16

  12. TiO{sub 2} nanoparticles alleviate toxicity by reducing free Zn{sup 2+} ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kathawala, Mustafa Hussain; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)

    2015-06-15

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO{sub 2}) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO{sub 2}, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO{sub 2} was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml{sup −1} after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO{sub 2} nanoparticles which remained non-toxic until very high concentrations. It was found that TiO{sub 2} nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO{sub 2} nanoparticles caused an attenuation of free intracellular Zn{sup 2+} ions concentration, by adsorbing and immobilizing free Zn{sup 2+} ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  13. Characterization of fetal keratinocytes, showing enhanced stem cell-like properties: a potential source of cells for skin reconstruction.

    Science.gov (United States)

    Tan, Kenneth K B; Salgado, Giorgiana; Connolly, John E; Chan, Jerry K Y; Lane, E Birgitte

    2014-08-12

    Epidermal stem cells have been in clinical application as a source of culture-generated grafts. Although applications for such cells are increasing due to aging populations and the greater incidence of diabetes, current keratinocyte grafting technology is limited by immunological barriers and the time needed for culture amplification. We studied the feasibility of using human fetal skin cells for allogeneic transplantation and showed that fetal keratinocytes have faster expansion times, longer telomeres, lower immunogenicity indicators, and greater clonogenicity with more stem cell indicators than adult keratinocytes. The fetal cells did not induce proliferation of T cells in coculture and were able to suppress the proliferation of stimulated T cells. Nevertheless, fetal keratinocytes could stratify normally in vitro. Experimental transplantation of fetal keratinocytes in vivo seeded on an engineered plasma scaffold yielded a well-stratified epidermal architecture and showed stable skin regeneration. These results support the possibility of using fetal skin cells for cell-based therapeutic grafting.

  14. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    Treatment of proliferating and quiescent primary human keratinocytes with interferon-gamma (IFN-gamma) (100 U/ml, 23.5 h) followed by two-dimensional gel analysis revealed three proteins, IGUP I-3421 (M(r) = 48,200, pI = 6.06); IGUP I-3524 (M(r) = 56,900, pI = 5.92), a protein homologous to peptide......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially......-cultured, unfractionated psoriatic keratinocytes failed to reveal up-regulation of any of the three IFN-gamma-induced proteins suggesting that the effect of IFN-gamma in vivo may be modulated by the activity of other cytokine(s) or growth factor(s). Psoriatic keratinocytes were equally sensitive to IFN...

  15. Combination of low calcium with Y-27632 rock inhibitor increases the proliferative capacity, expansion potential and lifespan of primary human keratinocytes while retaining their capacity to differentiate into stratified epidermis in a 3D skin model.

    Directory of Open Access Journals (Sweden)

    Xanthe L Strudwick

    Full Text Available Human keratinocytes are difficult to isolate and have a limited lifespan. Traditionally, immortalised keratinocyte cell lines are used in vitro due to their ability to bypass senescence and survive indefinitely. However these cells do not fully retain their ability to differentiate in vitro and they are unable to form a normal stratum corneum in organotypic culture. Here we aimed to generate a pool of phenotypically similar keratinocytes from human donors that could be used in monolayer culture, without a fibroblast feeder layer, and in 3D human skin equivalent models. Primary human neonatal epidermal keratinocytes (HEKn were cultured in low calcium, (0.07 mM media, +/-10 μM Y-27632 ROCK inhibitor (HEKn-CaY. mRNA and protein was extracted and expression of differentiation markers Keratin 14 (K14, Keratin 10 (K10 and Involucrin (Inv assessed by qRT-PCR and Western blotting. The differentiation potential of the HEKn-CaY cultures was assessed by increasing calcium levels and removing the Y-27632 for 72 hrs prior to assessment of K14, K10 and Inv. The ability of the HEKn-CaY, to form a stratified epithelium was assessed using a human skin equivalent (HSE model in the absence of Y-27632. Increased proliferative capacity, expansion potential and lifespan of HEKn was observed with the combination of low calcium and 10 μM ROCK inhibitor Y-27632. The removal of Y-27632 and the addition of high calcium to induce differentiation allowed the cells to behave as primary keratinocytes even after extended serial passaging. Prolonged lifespan HEK-CaYs were capable of forming an organised stratified epidermis in 3D HSE cultures, demonstrating their ability to fully stratify and retain their original, primary characteristics. In conclusion, the use of 0.07 mM Calcium and 10 μM Y-27632 in HEKn monocultures provides the opportunity to culture primary human keratinocytes without a cell feeder layer for extended periods of culture whilst retaining their ability to

  16. Differential Influence of Components Resulting from Atmospheric-Pressure Plasma on Integrin Expression of Human HaCaT Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beate Haertel

    2013-01-01

    Full Text Available Adequate chronic wound healing is a major problem in medicine. A new solution might be non-thermal atmospheric-pressure plasma effectively inactivating microorganisms and influencing cells in wound healing. Plasma components as, for example, radicals can affect cells differently. HaCaT keratinocytes were treated with Dielectric Barrier Discharge plasma (DBD/air, DBD/argon, ozone or hydrogen peroxide to find the components responsible for changes in integrin expression, intracellular ROS formation or apoptosis induction. Dependent on plasma treatment time reduction of recovered cells was observed with no increase of apoptotic cells, but breakdown of mitochondrial membrane potential. DBD/air plasma increased integrins and intracellular ROS. DBD/argon caused minor changes. About 100 ppm ozone did not influence integrins. Hydrogen peroxide caused similar effects compared to DBD/air plasma. In conclusion, effects depended on working gas and exposure time to plasma. Short treatment cycles did neither change integrins nor induce apoptosis or ROS. Longer treatments changed integrins as important for influencing wound healing. Plasma effects on integrins are rather attributed to induction of other ROS than to generation of ozone. Changes of integrins by plasma may provide new solutions of improving wound healing, however, conditions are needed which allow initiating the relevant influence on integrins without being cytotoxic to cells.

  17. Differential influence of components resulting from atmospheric-pressure plasma on integrin expression of human HaCaT keratinocytes.

    Science.gov (United States)

    Haertel, Beate; Straßenburg, Susanne; Oehmigen, Katrin; Wende, Kristian; von Woedtke, Thomas; Lindequist, Ulrike

    2013-01-01

    Adequate chronic wound healing is a major problem in medicine. A new solution might be non-thermal atmospheric-pressure plasma effectively inactivating microorganisms and influencing cells in wound healing. Plasma components as, for example, radicals can affect cells differently. HaCaT keratinocytes were treated with Dielectric Barrier Discharge plasma (DBD/air, DBD/argon), ozone or hydrogen peroxide to find the components responsible for changes in integrin expression, intracellular ROS formation or apoptosis induction. Dependent on plasma treatment time reduction of recovered cells was observed with no increase of apoptotic cells, but breakdown of mitochondrial membrane potential. DBD/air plasma increased integrins and intracellular ROS. DBD/argon caused minor changes. About 100 ppm ozone did not influence integrins. Hydrogen peroxide caused similar effects compared to DBD/air plasma. In conclusion, effects depended on working gas and exposure time to plasma. Short treatment cycles did neither change integrins nor induce apoptosis or ROS. Longer treatments changed integrins as important for influencing wound healing. Plasma effects on integrins are rather attributed to induction of other ROS than to generation of ozone. Changes of integrins by plasma may provide new solutions of improving wound healing, however, conditions are needed which allow initiating the relevant influence on integrins without being cytotoxic to cells.

  18. Sphingomyelinase D from Loxosceles laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis.

    Science.gov (United States)

    Corrêa, Mara A; Okamoto, Cinthya K; Gonçalves-de-Andrade, Rute M; van den Berg, Carmen W; Tambourgi, Denise V

    2016-01-01

    Envenomation by Loxosceles spider is characterized by the development of dermonecrosis. In previous studies, we have demonstrated that increased expression/secretion of matrix metalloproteinases 2 and 9, induced by Loxosceles intermedia venom Class 2 SMases D (the main toxin in the spider venom), contribute to the development of cutaneous loxoscelism. In the present study we show that the more potent venom containing the Class 1 SMase D from Loxosceles laeta, in addition to increasing the expression/secretion of MMP2 and MMP9, also stimulates the expression of MMP7 (Matrilysin-1), which was associated with keratinocyte cell death. Tetracycline, a matrix metalloproteinase inhibitor, prevented cell death and reduced MMPs expression. Considering that L. laeta venom is more potent at inducing dermonecrosis than L. intermedia venom, our results suggest that MMP7 may play an important role in the severity of dermonecrosis induced by L. laeta spider venom SMase D. In addition, the inhibition of MMPs by e.g. tetracyclines may be considered for the treatment of the cutaneous loxoscelism.

  19. Sphingomyelinase D from Loxosceles laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis

    Science.gov (United States)

    Corrêa, Mara A.; Okamoto, Cinthya K.; Gonçalves-de-Andrade, Rute M.; van den Berg, Carmen W.; Tambourgi, Denise V.

    2016-01-01

    Envenomation by Loxosceles spider is characterized by the development of dermonecrosis. In previous studies, we have demonstrated that increased expression/secretion of matrix metalloproteinases 2 and 9, induced by Loxosceles intermedia venom Class 2 SMases D (the main toxin in the spider venom), contribute to the development of cutaneous loxoscelism. In the present study we show that the more potent venom containing the Class 1 SMase D from Loxosceles laeta, in addition to increasing the expression/secretion of MMP2 and MMP9, also stimulates the expression of MMP7 (Matrilysin-1), which was associated with keratinocyte cell death. Tetracycline, a matrix metalloproteinase inhibitor, prevented cell death and reduced MMPs expression. Considering that L. laeta venom is more potent at inducing dermonecrosis than L. intermedia venom, our results suggest that MMP7 may play an important role in the severity of dermonecrosis induced by L. laeta spider venom SMase D. In addition, the inhibition of MMPs by e.g. tetracyclines may be considered for the treatment of the cutaneous loxoscelism. PMID:27078876

  20. Ascorbic Acid, Ultraviolet C Rays, and Glucose but not Hyperthermia Are Elicitors of Human β-Defensin 1 mRNA in Normal Keratinocytes

    Directory of Open Access Journals (Sweden)

    Luis Antonio Cruz Díaz

    2015-01-01

    Full Text Available Hosts’ innate defense systems are upregulated by antimicrobial peptide elicitors (APEs. Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA, and ultraviolet C rays (UVC as well as glucose and ascorbic acid (AA on the regulation of human β-defensin 1 (DEFB1, cathelicidin (CAMP, and interferon-γ (IFNG genes in normal human keratinocytes (NHK. The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C and hyperthermia (39°C are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections.

  1. Ultraviolet B irradiation induces changes in the distribution and release of arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture

    Energy Technology Data Exchange (ETDEWEB)

    Punnonen, K.; Puustinen, T.; Jansen, C.T.

    1987-05-01

    There is increasing evidence that derivatives of 20-carbon polyunsaturated fatty acids, the eicosanoids, play an important role in the inflammatory responses of the human skin. To better understand the metabolic fate of fatty acids in the skin, the effect of ultraviolet B (UVB) irradiation (280-320 nm) on the distribution and release of /sup 14/C-labeled arachidonic acid, dihomo-gamma-linolenic acid, and eicosapentaenoic acid in human keratinocytes in culture was investigated. Ultraviolet B irradiation induced the release of all three /sup 14/C-labeled fatty acids from the phospholipids, especially from phosphatidylethanolamine, and this was accompanied by increased labeling of the nonphosphorus lipids. This finding suggests that UVB induces a significant liberation of eicosanoid precursor fatty acids from cellular phospholipids, but the liberated fatty acids are largely reincorporated into the nonphosphorus lipids. In conclusion, the present study suggests that not only arachidonic acid but also dihomo-gamma-linolenic acid, and eicosapentaenoic acid might be involved in the UVB irradiation-induced inflammatory reactions of human skin.

  2. Ascorbic Acid, Ultraviolet C Rays, and Glucose but not Hyperthermia Are Elicitors of Human β-Defensin 1 mRNA in Normal Keratinocytes

    Science.gov (United States)

    Cruz Díaz, Luis Antonio; Flores Miramontes, María Guadalupe; Allen, Kirk; Gonzalez Ávila, Marisela; Prado Montes de Oca, Ernesto

    2015-01-01

    Hosts' innate defense systems are upregulated by antimicrobial peptide elicitors (APEs). Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA), and ultraviolet C rays (UVC) as well as glucose and ascorbic acid (AA) on the regulation of human β-defensin 1 (DEFB1), cathelicidin (CAMP), and interferon-γ (IFNG) genes in normal human keratinocytes (NHK). The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C) and hyperthermia (39°C) are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections. PMID:25815330

  3. Chitin modulates innate immune responses of keratinocytes.

    Directory of Open Access Journals (Sweden)

    Barbara Koller

    Full Text Available BACKGROUND: Chitin, after cellulose the second most abundant polysaccharide in nature, is an essential component of exoskeletons of crabs, shrimps and insects and protects these organisms from harsh conditions in their environment. Unexpectedly, chitin has been found to activate innate immune cells and to elicit murine airway inflammation. The skin represents the outer barrier of the human host defense and is in frequent contact with chitin-bearing organisms, such as house-dust mites or flies. The effects of chitin on keratinocytes, however, are poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We hypothesized that chitin stimulates keratinocytes and thereby modulates the innate immune response of the skin. Here we show that chitin is bioactive on primary and immortalized keratinocytes by triggering production of pro-inflammatory cytokines and chemokines. Chitin stimulation further induced the expression of the Toll-like receptor (TLR TLR4 on keratinocytes at mRNA and protein level. Chitin-induced effects were mainly abrogated when TLR2 was blocked, suggesting that TLR2 senses chitin on keratinocytes. CONCLUSIONS/SIGNIFICANCE: We speculate that chitin-bearing organisms modulate the innate immune response towards pathogens by upregulating secretion of cytokines and chemokines and expression of MyD88-associated TLRs, two major components of innate immunity. The clinical relevance of this mechanism remains to be defined.

  4. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin: lipid composition and thermal phase behavior of the stratum corneum.

    Science.gov (United States)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith; Somerharju, Pentti; Wertz, Philip; Urtti, Arto; Suhonen, Marjukka

    2008-04-01

    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non-hydroxyacid-phytosphingosine ceramides (NP) were absent. Also some alterations in fatty acid profiles of ROC ceramides were noted, e.g., esterified omega-hydroxyacid-sphingosine contained increased levels of oleic acid instead of linoleic acid. The fraction of lipids covalently bound to corneocyte proteins was distinctly lower in ROC compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may explain the minor differences previously observed in drug permeation between ROC and human skin.

  5. Icariin inhibits TNF-α/IFN-γ induced inflammatory response via inhibition of the substance P and p38-MAPK signaling pathway in human keratinocytes.

    Science.gov (United States)

    Kong, Lingwen; Liu, Jiaqi; Wang, Jia; Luo, Qingli; Zhang, Hongying; Liu, Baojun; Xu, Fei; Pang, Qi; Liu, Yingchao; Dong, Jingcheng

    2015-12-01

    Pro-inflammatory cytokines play a crucial role in the etiology of atopic dermatitis. We demonstrated that Herba Epimedii has anti-inflammatory potential in an atopic dermatitis mouse model; however, limited research has been conducted on the anti-inflammatory effects and mechanism of icariin, the major active ingredient in Herba Epimedii, in human keratinocytes. In this study, we evaluated the anti-inflammatory potential and mechanisms of icariin in the tumor necrosis factor-α (TNF-α)/interferon-γ (IFN-γ)-induced inflammatory response in human keratinocytes (HaCaT cells) by observing these cells in the presence or absence of icariin. We measured IL-6, IL-8, IL-1β, MCP-1 and GRO-α production by ELISA; IL-6, IL-8, IL-1β, intercellular adhesion molecule-1 (ICAM-1) and tachykinin receptor 1 (TACR1) mRNA expression by real-time PCR; and P38-MAPK, P-ERK and P-JNK signaling expression by western blot in TNF-α/IFN-γ-stimulated HaCaT cells before and after icariin treatment. The expression of TNF-α-R1 and IFN-γ-R1 during the stimulation of the cell models was also evaluated before and after icariin treatment. We investigated the effect of icariin on these pro-inflammatory cytokines and detected whether this effect occurred via the mitogen-activated protein kinase (MAPK) signal transduction pathways. We further specifically inhibited the activity of two kinases with 20μM SB203580 (a p38 kinase inhibitor) and 50μM PD98059 (an ERK1/2 kinase inhibitor) to determine the roles of the two signal pathways involved in the inflammatory response. We found that icariin inhibited TNF-α/IFN-γ-induced IL-6, IL-8, IL-1β, and MCP-1 production in a dose-dependent manner; meanwhile, the icariin treatment inhibited the gene expression of IL-8, IL-1β, ICAM-1 and TACR1 in HaCaT cells in a time- and dose-dependent manner. Icariin treatment resulted in a reduced expression of p-P38 and p-ERK signal activation induced by TNF-α/IFN-γ; however, only SB203580, the p38 alpha

  6. Understanding chemical allergen potency: role of NLRP12 and Blimp-1 in the induction of IL-18 in human keratinocytes.

    Science.gov (United States)

    Papale, Angela; Kummer, Elena; Galbiati, Valentina; Marinovich, Marina; Galli, Corrado L; Corsini, Emanuela

    2016-09-01

    Keratinocytes (KCs) play a key role in all phases of skin sensitization. We recently identified interleukin-18 (IL-18) production as useful end point for determination of contact sensitization potential of low molecular weight chemicals. The aim of this study was to identify genes involved in skin sensitizer-induced inflammasome activation and to establish their role in IL-18 production. For gene expression analysis, cells were treated for 6 h with p-phenylenediamine (PPD) as reference contact allergen; total RNA was extracted and examined with a commercially available Inflammasome Polymerase Chain Reaction (PCR) array. Among genes induced, NLRP12 (Nod-like receptor P12) was selected for further investigation. NLRP12 promoter region contains Blimp-1 (B-lymphocyte-induced maturation protein-1)/PRDM1 binding site, and from the literature, it is reported that Blimp-1 reduces NLRP12 activity and expression in monocytes/macrophages. Their expression and role in KCs are currently unknown. To confirm NLRP12 expression and to investigate its relationship with Blimp-1, cells were exposed for different times (3, 6 and 24 h) to the extreme sensitizer 2,4-dinitrochlorobenzene (DNCB) and the strong sensitizer PPD. Allergens were able to induce both genes, however, with different kinetic, with DNCB more rapidly upregulating Blimp-1 and inducing IL-18 production, compared to PPD. NLRP12 and Blimp-1 expression appeared to be inversely correlated: Blimp-1 silencing resulted in increased NLRP12 expression and reduced contact allergen-induced IL-18 production. Overall results indicate that contact allergens of different potency differently modulate Blimp-1/NLRP12 expression, with strong allergen more rapidly downregulating NLRP12, thus more rapidly inducing IL-18 production. Data confirm that also in KCs, NLRP12 has an inhibitory effect on inflammasome activation assessed by IL-18 maturation.

  7. Role of gp91phox Homolog Nox1 in Induction of Premalignant Spindle Phenotypes of HPV 16 E6/E7—Immortalized Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Walee Chamulitrat

    2010-01-01

    Full Text Available The NADPH oxidase (Nox family of superoxide- and hydrogen peroxide—producing proteins has been recognized as important for signal transduction that regulates receptor-mediated functions, including cytoskeleton remodeling, cell proliferation, migration, differentiation, and cell death. Nox1 was the first of the Nox catalytic subunits to be cloned and shown to induce tumorigenic conversion of mouse fibroblasts. While Nox1 has been shown to be expressed in human colon and prostate cancers, however, limited studies have demonstrated the involvement of Nox1 in an early step of cell transformation. The aim of this review is to provide an overview on the role of Nox1 in cancer, as well as the contribution of our studies to demonstrate the involvement of Nox1 on neoplastic progression of human keratinocytes beyond the immortalization step. The generation of spindle phenotypes concomitant with anchorage-independent growth and invasiveness will be highlighted and discussed in relation to the possible role of Nox1 in epithelial-mesenchymal transition. Understanding these mechanisms may provide insight into Nox1 and redox signaling components as potential therapeutic targets to inhibit tumor progression.

  8. Angiogenic properties of adult human thymus fat.

    Science.gov (United States)

    Salas, Julián; Montiel, Mercedes; Jiménez, Eugenio; Valenzuela, Miguel; Valderrama, José Francisco; Castillo, Rafael; González, Sergio; El Bekay, Rajaa

    2009-11-01

    The endogenous proangiogenic properties of adipose tissue are well recognized. Although the adult human thymus has long been known to degenerate into fat tissue, it has never been considered as a potential source of angiogenic factors. We have investigated the expression of diverse angiogenic factors, including vascular endothelial growth factor A and B, angiopoietin 1, and tyrosine-protein kinase receptor-2 (an angiopoietin receptor), and then analyzed their physiological role on endothelial cell migration and proliferation, two relevant events in angiogenesis. The detection of the gene and protein expression of the various proteins has been performed by immunohistochemistry, Western blotting, and quantitative real-time polymerase chain reaction. We show, for the first time, that adult thymus fat produces a variety of angiogenic factors and induces the proliferation and migration of human umbilical cord endothelial cells. Based on these findings, we suggest that this fat has a potential angiogenic function that might affect thymic function and ongoing adipogenesis within the thymus.

  9. Cytotoxicity and Proliferation Studies with Arsenic in Established Human Cell Lines: Keratinocytes, Melanocytes, Dendritic Cells, Dermal Fibroblasts, Microvascular Endothelial Cells, Monocytes and T-Cells

    Directory of Open Access Journals (Sweden)

    Hari H. P. Cohly

    2003-01-01

    Full Text Available Abstract: Based on the hypothesis that arsenic exposure results in toxicity and mitogenecity, this study examined the dose-response of arsenic in established human cell lines of keratinocytes (HaCaT, melanocytes (1675, dendritic cells (THP-1/A23187, dermal fibroblasts (CRL1904, microvascular endothelial cells (HMEC, monocytes (THP-1, and T cells (Jurkat. Cytotoxicity was determined by incubating THP-1, THP-1+ A23187 and JKT cells in RPMI 1640, 1675 in Vitacell, HMEC in EBM, and dermal fibroblasts and HaCaT in DMEM with 10% fetal bovine serum, 1% streptomycin and penicillin for 72 hrs in 96-well microtiter plates, at 37oC in a 5% CO2 incubator with different concentrations of arsenic using fluorescein diacetate (FDA. Cell proliferation in 96-well plates was determined in cultured cells starved by prior incubation for 24 hrs in 1% FBS and exposed for 72 hours, using the 96 cell titer proliferation solution (Promega assay. Cytotoxicity assays yielded LD50s of 9 μg/mL for HaCaT, 1.5 μg/mL for CRL 1675, 1.5 μg/mL for dendritic cells, 37 μg/mL for dermal fibroblasts, 0.48 μg/mL for HMEC, 50 μg/mL for THP-1 cells and 50 μg/mL for JKT-T cells. The peak proliferation was observed at 6 μg/mL for HaCaT and THP-1 cells, 0.19 μg/mL for CRL 1675, dendritic cells, and HMEC, and 1.5 μg/mL for dermal fibroblasts and Jurkat T cells. These results show that arsenic is toxic at high doses to keratinocytes, fibroblasts, monocytes and T cells, and toxic at lower doses to melanocytes, microvascular endothelial cells and dendritic cells. Proliferation studies showed sub-lethal doses of arsenic to be mitogenic.

  10. Dermato-protective properties of ergothioneine through induction of Nrf2/ARE-mediated antioxidant genes in UVA-irradiated Human keratinocytes.

    Science.gov (United States)

    Hseu, You-Cheng; Lo, Heng-Wei; Korivi, Mallikarjuna; Tsai, Yu-Cheng; Tang, Meng-Ju; Yang, Hsin-Ling

    2015-09-01

    UVA irradiation-induced skin damage and redox imbalance have been shown to be ameliorated by ergothioneine (EGT), a naturally occurring sulfur-containing amino acid. However, the responsible molecular mechanism with nanomolar concentrations of EGT remains unclear. We investigated the dermato protective efficacies of EGT (125-500nM) against UVA irradiation (15J/cm(2)), and elucidated the underlying molecular mechanism in human keratinocyte-derived HaCaT cells. We found that EGT treatment prior to UVA exposure significantly increased the cell viability and prevented lactate dehydrogenase release into the medium. UVA-induced ROS and comet-like DNA formation were remarkably suppressed by EGT with a parallel inhibition of apoptosis, as evidenced by reduced DNA fragmentation (TUNEL), caspase-9/-3 activation, and Bcl-2/Bax dysregulation. Furthermore, EGT alleviated UVA-induced mitochondrial dysfunction. Dose-dependent increases of antioxidant genes, HO-1, NQO-1, and γ-GCLC and glutathione by EGT were associated with upregulated Nrf2 and downregulated Keap-1 expressions. This was confirmed by increased nuclear accumulation of Nrf2 and inhibition of Nrf2 degradation. Notably, augmented luciferase activity of ARE may explain Nrf2/ARE-mediated signaling pathways behind EGT dermato-protective properties. We further demonstrated that Nrf2 translocation was mediated by PI3K/AKT, PKC, or ROS signaling cascades. This phenomenon was confirmed with suppressed nuclear Nrf2 activation, and consequently diminished antioxidant genes in cells treated with respective pharmacological inhibitors (LY294002, GF109203X, and N-acetylcysteine). Besides, increased basal ROS by EGT appears to be crucial for triggering the Nrf2/ARE signaling pathways. Silencing of Nrf2 or OCTN1 (EGT carrier protein) signaling with siRNA showed no such protective effects of EGT against UVA-induced cell death, ROS, and apoptosis, which is evidence of the vitality of Nrf2 translocation and protective efficacy of EGT

  11. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  12. Pitavastatin, a new HMG-CoA reductase inhibitor, induces phototoxicity in human keratinocytes NCTC-2544 through the formation of benzophenanthridine-like photoproducts.

    Science.gov (United States)

    Viola, Giampietro; Grobelny, Pawel; Linardi, Maria Antonella; Salvador, Alessia; Dall'Acqua, Stefano; Sobotta, Łukasz; Mielcarek, Jadwiga; Dall'Acqua, Francesco; Vedaldi, Daniela; Basso, Giuseppe

    2012-03-01

    This study reports the results of an investigation of the phototoxicity mechanism induced by pitavastatin and its photoproducts, namely 6-cyclopropyl-10-fluoro-7,8-dihydrobenzo[k]phenanthridine (PP3) and 6-cyclopropyl-10-fluorobenzo[k]phenanthridine (PP4). The phototoxicity was tested in human keratinocytes cell lines NCTC-2544, and the results proved that under the same conditions, all three compounds exhibited phototoxic effects in the model tested. The reduction in cell viability was found to be both concentration- and UVA dose-dependent. A point of note is that both the photoproducts produced a dramatic decrease in cell viability with GI(50) values one order of magnitude lower compared to the parent compound. In particular, the fully aromatic derivative (PP4) showed the highest antiproliferative activity. Flow cytometric analysis indicated that pitavastatin and the photoproduct PP4 principally induced necrosis, as revealed by the large appearance of propidium iodide-positive cells and also confirmed by the rapid drop in cellular ATP levels. Further studies committed to better understanding of photoinduced cell death mechanism(s) revealed that neither pitavastatin nor PP4 induced mitochondrial depolarization or lysosomal damage, but, interestingly, extensive cell lipid membrane peroxidation along with a significant oxidation of model proteins occurred, suggesting that pitavastatin and PP4 exert their phototoxic effect mainly in the cellular membranes. The present results suggest that the phototoxicity of pitavastatin may be mediated by the formation of benzophenanthridine-like photoproducts that appear to have high potential as photosensitizers.

  13. Alginates induce differentiation and expression of CXCR7 and CXCL12/SDF-1 in human keratinocytes--the role of calcium.

    Science.gov (United States)

    Stenvik, Jørgen; Sletta, Håvard; Grimstad, Øystein; Pukstad, Brita; Ryan, Liv; Aune, Randi; Strand, Wenche; Tøndervik, Anne; Torp, Sverre Helge; Skjåk-Braek, Gudmund; Espevik, Terje

    2012-10-01

    Alginates from seaweed are used in chronic wound management, though the molecular and cellular effects of various alginate dressings are not well documented. We have developed ultrapure sodium-alginates from Pseudomonas fluorescens with different content and distribution of single guluronic acid (G) residues (0-45% G), and tested their biological activities on human primary keratinocytes (KCs). The alginates inhibited KC migration and induced expression of differentiation markers. The potency of the alginates correlated with the increasing percentage of single G residues. These findings were explained by different binding and release of ionic calcium (Ca++) from the alginates which subsequently triggered differentiation. Ca-free alginates had no effect on KC migration and differentiation, but the chemokine receptor CXCR7 was upregulated. Q-PCR revealed that also CXCL12/SDF-1, one of two known CXCR7-ligands, was induced by the alginates. Both CXCR7 and CXCL12-induction was dependent on the alginate G-content, and highest upregulation was induced by an alginate with 19% single G residues. In the epidermis, CXCR7 expression was restricted to the basal layer. This study defines two biological effects of ultrapure alginates on KCs, both being dependent on the alginate structure, and being either dependent or independent of Ca.

  14. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chalinee Ronpirin

    2016-01-01

    Full Text Available This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB, a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS, and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight, while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively. Ethanol and aqueous fractions of A. carambola (250 µg/mL significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL and aqueous (50, 100 and 250 µg/mL fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD. Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  15. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn; Tencomnao, Tewin

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  16. Remediation of textile azo dye acid red 114 by hairy roots of Ipomoea carnea Jacq. and assessment of degraded dye toxicity with human keratinocyte cell line.

    Science.gov (United States)

    Jha, Pamela; Jobby, Renitta; Desai, N S

    2016-07-05

    Bioremediation has proven to be the most desirable and cost effective method to counter textile dye pollution. Hairy roots (HRs) of Ipomoea carnea J. were tested for decolourization of 25 textile azo dyes, out of which >90% decolourization was observed in 15 dyes. A diazo dye, Acid Red 114 was decolourized to >98% and hence, was chosen as the model dye. A significant increase in the activities of oxidoreductive enzymes was observed during decolourization of AR114. The phytodegradation of AR114 was confirmed by HPLC, UV-vis and FTIR spectroscopy. The possible metabolites were identified by GCMS as 4- aminobenzene sulfonic acid 2-methylaniline and 4- aminophenyl 4-ethyl benzene sulfonate and a probable pathway for the biodegradation of AR114 has been proposed. The nontoxic nature of the metabolites and toxicity of AR114 was confirmed by cytotoxicity tests on human keratinocyte cell line (HaCaT). When HaCaT cells were treated separately with 150 μg mL(-1) of AR114 and metabolites, MTT assay showed 50% and ≈100% viability respectively. Furthermore, flow cytometry data showed that, as compared to control, the cells in G2-M and death phase increased by 2.4 and 3.6 folds respectively on treatment with AR114 but remained unaltered in cells treated with metabolites.

  17. Antioxidant and Anti-Inflammatory Effects of Selected Natural Compounds Contained in a Dietary Supplement on Two Human Immortalized Keratinocyte Lines

    Directory of Open Access Journals (Sweden)

    Elena Fasano

    2014-01-01

    Full Text Available Several advantages may derive from the use of dietary supplements containing multiple natural antioxidants and/or anti-inflammatory agents. At present, however, there is scarce information on the properties and potential of combined supplements. To fill the gap, the antioxidant and anti-inflammatory activities exerted by a combination of seven natural components (coenzyme Q10, krill oil, lipoic acid, resveratrol, grape seed oil, α-tocopherol, and selenium contained in a dietary supplement used for the prevention of skin disorders were investigated in vitro. Each component was administered, alone or in combination, to human keratinocytes, and the inhibition of Reactive Oxygen Species production and lipid peroxidation as well as the ability to reduce inflammatory cytokine secretion and to modulate Nuclear Factor-κB pathway was evaluated. The combination exhibited high antioxidant activity and in specific conditions the combination’s efficiency was higher than that of the most powerful components administered individually. Moreover, the combination showed remarkable anti-inflammatory properties. It reduced more efficiently than each component the secretion of Monocyte Chemoattractant Protein-1, a crucial cytokine for the development of chronic inflammation in skin, and inhibited Nuclear Factor-κB molecular pathway. Overall, our findings suggest that the combined formulation may have the potential to powerfully inhibit oxidative stress and inflammation at skin level.

  18. Gq protein mediates UVB-induced cyclooxygenase-2 expression by stimulating HB-EGF secretion from HaCaT human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Seo, MiRan [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2010-03-05

    Ultraviolet (UV) radiation induces cyclooxygenase-2 expression to produce cellular responses including aging and carcinogenesis in skin. We hypothesised that heterotrimeric G proteins mediate UV-induced COX-2 expression by stimulating secretion of soluble HB-EGF (sHB-EGF). In this study, we aimed to elucidate the role and underlying mechanism of the {alpha} subunit of Gq protein (G{alpha}q) in UVB-induced HB-EGF secretion and COX-2 induction. We found that expression of constitutively active G{alpha}q (G{alpha}qQL) augmented UVB-induced HB-EGF secretion, which was abolished by knockdown of G{alpha}q with shRNA in HaCaT human keratinocytes. G{alpha}q was found to mediate the UVB-induced HB-EGF secretion by sequential activation of phospholipase C (PLC), protein kinase C{delta} (PKC{delta}), and matrix metaloprotease-2 (MMP-2). Moreover, G{alpha}qQL mediated UVB-induced COX-2 expression in an HB-EGF-, EGFR-, and p38-dependent manner. From these results, we concluded that G{alpha}q mediates UV-induced COX-2 expression through activation of EGFR by HB-EGF, of which ectodomain shedding was stimulated through sequential activation of PLC, PKC{delta} and MMP-2 in HaCaT cells.

  19. Microarray assessment of fibronectin, collagen and integrin expression and the role of fibronectin-collagen coating in the growth of normal, SV40 T-antigen-immortalised and malignant human oral keratinocytes.

    Science.gov (United States)

    Sarang, Zsolt; Haig, Ylva; Hansson, Annette; Vondracek, Martin; Wärngård, Lars; Grafström, Roland

    2003-12-01

    Extracellular matrix proteins affect the growth and survival of epithelial tissues. Accordingly, surface coating with fibronectin and collagen is a common practice for promoting keratinocyte culture. In this study, the expression of fibronectin and collagen-related factors, including integrins, by normal (NOK), SV40 T-antigen-immortalised (SVpgC2a) and malignant (SqCC/Y1) human oral keratinocytes, under standardised, serum-free conditions, was investigated by using microarray analysis. Cell growth was also studied in the presence and absence of a matrix consisting of human fibronectin and bovine collagen type I (FN-COL). Fibronectin transcripts were abundant in all cells, whereas 16 of 29 collagen chains and 14 of 24 integrin subunits were variably detected. With regard to both the expression level and the number of transcripts, higher collagen and lower integrin expression was observed in SVpgC2a cells than in NOKs and SqCC/Y1 cells. The cell types differed with regard to colony-forming efficiency and the rate and kinetics of growth at high cell density. For all cell types, FN-COL coating consistently stimulated cell migration, without influencing growth in mass culture or clonal density. The results demonstrate the transcription of genes associated with the formation and function of fibronectin and collagen in oral epithelium, and variably altered expression patterns in transformed states, and show that keratinocyte lines can be successfully transferred without the stimulus from extracellular FN-COL.

  20. Tumourigenesis driven by the human papillomavirus type 16 Asian-American e6 variant in a three-dimensional keratinocyte model.

    Directory of Open Access Journals (Sweden)

    Robert Jackson

    Full Text Available Infection with a transforming human papillomavirus (HPV such as type 16 (of species Alphapapillomavirus 9 causes ano-genital and oral tumours via viral persistence in human squamous cell epithelia. Epidemiological studies showed that the naturally occurring HPV16 Asian-American (AA variant (sublineage D2/D3 is found more often than the European Prototype (EP (sublineage A1 in high-grade cervical neoplasia and tumours compared to non-cancer controls. Just three amino acid changes within the early gene, E6, of HPV16 AA have been linked to this augmented tumourigenicity. The AAE6 variant's greater immortalizing and transforming potential over EPE6 has recently been confirmed in retrovirally-transduced keratinocytes expressing the E6 gene only. However, the tumourigenic role of the full-length viral genome of HPV16 has not yet been addressed with regard to these E6 variants. To investigate this process in the context of these two HPV16 E6 genotypes, an organotypic tissue culture model was used to simulate the HPV infectious life cycle. The AAE6 variant demonstrated an enhanced ability over EPE6 to drive the viral life cycle toward tumourigenesis, as evidenced phenotypically-by a more severe grade of epithelial dysplasia with higher proliferation and deregulated differentiation, and molecularly-by high viral oncogene E6 and E7 expression, but lack of productive viral life cycle markers. In contrast, EPE6 had low E6 and E7 but high E1∧E4 expression, indicative of a productive life cycle. We suggest increased viral integration into the host genome for AAE6 as one possible mechanism for these observed differences from EPE6. Additionally, we found downstream effects on immortalization and host innate immune evasion. This study highlights how minor genomic variations in transforming viruses can have a significant affect on their tumourigenic ability.

  1. Establishment of coculture system of normal human epidermal keratinocytes and melanocytes in vitro%正常人角质形成细胞和黑素细胞体外共培养体系的建立

    Institute of Scientific and Technical Information of China (English)

    李海东; 王鹰

    2012-01-01

    目的 体外建立正常人表皮角质形成细胞和黑素细胞直接接触的共培养体系.方法 分别培养角质形成细胞和黑素细胞,体外建立角质形成细胞和黑素细胞直接接触的共培养模型,采用四甲基偶氮唑盐(MTT)比色法、紫外分光光度计检测、左旋多巴(L-Dopa)染色、免疫组织化学染色及透射电镜观察对共培养体系中的黑素细胞和角质形成细胞进行生物学鉴定.结果 单独培养时,角质形成细胞呈圆形、"铺路石样"生长,黑素细胞呈两极或多级树突状生长;角质形成细胞和黑素细胞按一定比例混合培养后,2种细胞均迅速增殖,黑素细胞树突多为3~5个,与数十个角质形成细胞呈团块状生长,形成类似黑素单元的结构.共培养体系中的黑素细胞和角质形成细胞具备正常的生物学功能.结论 角质形成细胞和黑素细胞直接接触的共培养体系为黑素细胞提供了更接近生理状态的体外研究模型.%Objective To establish coculture system of direct cell-to-cell contact between normal human epidermal keratinocytes and melanocytes in vitro. Methods Keratinocytes and melanocytes were cultured respectively,and then the coculture model of direct cell-to-cell contact between keratinocytes and melanocytes was established in vilro. Methyl thiazolyl tetrazolium(MTT) assay, UV spectrophotometry,levoDopa(L-Dopa) staining, immunohistochemical staining and transmission electron microscopy observation were employed to biologically identify the melanocytes and keratinocytes in the coculture system. Results Keratinocytes were round and grew in "cobblestone" pattern while melanocytes in bipolar or multi-level dendritic growth pattern when they were cultured separately. The 2 kinds of cells proliferated rapidly when they cocultured in a certain proportion. Melanocytes with 3 to 5 den-drites grew in crumb pattern with dozens of keratinocyte,similar to the structure of melanin unit. Melanocytes

  2. Stathmin regulates keratinocyte proliferation and migration during cutaneous regeneration.

    Science.gov (United States)

    Schmitt, Sabrina; Safferling, Kai; Westphal, Kathi; Hrabowski, Manuel; Müller, Ute; Angel, Peter; Wiechert, Lars; Ehemann, Volker; Müller, Benedikt; Holland-Cunz, Stefan; Stichel, Damian; Harder, Nathalie; Rohr, Karl; Germann, Günter; Matthäus, Franziska; Schirmacher, Peter; Grabe, Niels; Breuhahn, Kai

    2013-01-01

    Cutaneous regeneration utilizes paracrine feedback mechanisms to fine-tune the regulation of epidermal keratinocyte proliferation and migration. However, it is unknown how fibroblast-derived hepatocyte growth factor (HGF) affects these mutually exclusive processes in distinct cell populations. We here show that HGF stimulates the expression and phosphorylation of the microtubule-destabilizing factor stathmin in primary human keratinocytes. Quantitative single cell- and cell population-based analyses revealed that basal stathmin levels are important for the migratory ability of keratinocytes in vitro; however, its expression is moderately induced in the migration tongue of mouse skin or organotypic multi-layered keratinocyte 3D cultures after full-thickness wounding. In contrast, clearly elevated stathmin expression is detectable in hyperproliferative epidermal areas. In vitro, stathmin silencing significantly reduced keratinocyte proliferation. Automated quantitative and time-resolved analyses in organotypic cocultures demonstrated a high correlation between Stathmin/phospho-Stathmin and Ki67 positivity in epidermal regions with proliferative activity. Thus, activation of stathmin may stimulate keratinocyte proliferation, while basal stathmin levels are sufficient for keratinocyte migration during cutaneous regeneration.

  3. Stathmin regulates keratinocyte proliferation and migration during cutaneous regeneration.

    Directory of Open Access Journals (Sweden)

    Sabrina Schmitt

    Full Text Available Cutaneous regeneration utilizes paracrine feedback mechanisms to fine-tune the regulation of epidermal keratinocyte proliferation and migration. However, it is unknown how fibroblast-derived hepatocyte growth factor (HGF affects these mutually exclusive processes in distinct cell populations. We here show that HGF stimulates the expression and phosphorylation of the microtubule-destabilizing factor stathmin in primary human keratinocytes. Quantitative single cell- and cell population-based analyses revealed that basal stathmin levels are important for the migratory ability of keratinocytes in vitro; however, its expression is moderately induced in the migration tongue of mouse skin or organotypic multi-layered keratinocyte 3D cultures after full-thickness wounding. In contrast, clearly elevated stathmin expression is detectable in hyperproliferative epidermal areas. In vitro, stathmin silencing significantly reduced keratinocyte proliferation. Automated quantitative and time-resolved analyses in organotypic cocultures demonstrated a high correlation between Stathmin/phospho-Stathmin and Ki67 positivity in epidermal regions with proliferative activity. Thus, activation of stathmin may stimulate keratinocyte proliferation, while basal stathmin levels are sufficient for keratinocyte migration during cutaneous regeneration.

  4. Defensive effects of fullerene-C60 dissolved in squalane against the 2,4-nonadienal-induced cell injury in human skin keratinocytes HaCaT and wrinkle formation in 3D-human skin tissue model.

    Science.gov (United States)

    Kato, Shinya; Aoshima, Hisae; Saitoh, Yasukazu; Miwa, Nobuhiko

    2010-02-01

    We dissolved fullerene-C60 in squalane (LipoFullerene; LF-SQ, C60-eq.: 500 ppm) and examined its defensive effects against 2,4-nonadienal (NDA)-induced cell injury in HaCaT keratinocytes and wrinkle formation in three dimensional (3D)-human skin tissue model. NDA is an analog of 4-hydroxynonenal, one of major causes for human body odor indicative of aging and a lipophilic cell injury factor. Cell viability (% of the control) decreased to 31.6% on treatment with NDA (40 microM), but it increased to 66.0-97.5% when LF-SQ of 1-4% (C60-eq.: 5-20 ppm) was administered for 5 hr before NDA addition. The defensive effect by LF-SQ was superior to that of "squalane" alone at the same doses. NDA-induced DNA-fragmentation in HaCaT cells was suppressed by LF-SQ administered for 5 hr before NDA treatment, and LF-SQ protected HaCaT cells against apoptosis-like cell death. LF-SQ did not appreciably defend against hydrogen peroxide, though LF-SQ effectively defended against tert-butylhydroperoxide, a type of the intermediate hydrophilicity-lipophilicity degree out of other reactive oxygen species. The scanning electron microscopy demonstrated that NDA caused wrinkles and abnormal scales on keratinocytes of 3D-human skin tissue model, and structural homogeneity of the interstratum was broken, any of which were, however, markedly suppressed with LF-SQ. Squalane alone exhibited defensive effect against the skin tissue injury to some extent, but which was inferior to LF-SQ. LF-SQ might effectively capture and scavenge lipid radicals generated inside the cell membrane, because squalane acts as a lipophilic carrier of C60. C60 dissolved in squalane can be expected to serve as a cosmeceutical ingredient for anti-wrinkle formation.

  5. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jones, S.K. (Bristol Royal Infirmary (United Kingdom))

    1992-06-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author).

  6. Effect of arsenic on antioxidative ability of human keratinocytes%砷对人皮肤角质形成细胞抗氧化能力影响

    Institute of Scientific and Technical Information of China (English)

    孙鲜策; 王少鹏; 高娜; 刘爽; 杨光; 朴丰源

    2009-01-01

    目的 研究亚砷酸钠(NaAsO2)对人皮肤角质形成细胞(HaCaT)抗氧化能力的影响.方法 用流式细胞仪检测细胞内二氯荧光素(DCF)的荧光强度;用改良硫代巴比妥酸荧光法制定细胞内丙二醛(MDA)含量;用Ni-trite-kit法检测超氧化物歧化酶(SOD)活性;用紫外速率直接法测定过氧化氢酶(CAT)的活性.结果 各实验组(2.5,5,10和20 μmol/L NaAsO2)的DCF荧光强度均显著增高(P<0.05),分别是对照组的1.3,1.6,1.7和1.8倍;各实验组MDA含量显著增高(P<0.05),分别是对照组的1.1,1.4,1.5和2.2倍;10和20 μmol/L NaAsO2组SOD活性显著下降,分别为对照组的78%和61%;10和20μmol/L NaAsO2组SIOD和CAT活性显著下降,分别为对照组的50%和34%.结论 砷可以引起人皮肤细胞的氧化损伤,降低抗氧化能力.%Objective To explore the effect of sodium arsenite( NaAsO2) on antioxidative ability in human keratino-cytes (HaCaT). Methods The fluorescence intensity of dichlorofluorescein(DCF) was detected by flow cytometry. The malondialdehyde(MDA) content was detected by improved thio-barbituric acid fluorometric method. Superoxide dismutase (SOD) activity was determined by Nitrite-kit. The catalase(CAT) activity was determined by ultraviolet velocity direct method. Results The fluorescence intensity of DCF increased to 1.3,1.6,1.7, and 1. 8 times of the control' s in 2. 5,10, and 20 μmol/L NaAsO2 treated groups,respectively (P < 0. 05). The MDA content increased to 1.1,1.4,1.5, and 2.2 time of the control's in 2. 5,10, and 20 μmol/L NaAsO2 treated groups,respectively (P < 0. 05). While the activity of SOD de-creased to 78% and 61% of the control's in 10μmol/L and 20 μmol/L NaAsO2 groups. And CAT activity decreased to 50% and 34% of the control's in 10 μmol/L and 20 μmol/L NaAsO2 groups. Conclusion Arsenic can cause oxidative damage and decrease antioxidative ability in human keratinocytes.

  7. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  8. A novel solid-phase site-specific PEGylation enhances the in vitro and in vivo biostabilty of recombinant human keratinocyte growth factor 1.

    Directory of Open Access Journals (Sweden)

    Zhifeng Huang

    Full Text Available Keratinocyte growth factor 1 (KGF-1 has proven useful in the treatment of pathologies associated with dermal adnexae, liver, lung, and the gastrointestinal tract diseases. However, poor stability and short plasma half-life of the protein have restricted its therapeutic applications. While it is possible to improve the stability and extend the circulating half-life of recombinant human KGF-1 (rhKGF-1 using solution-phase PEGylation, such preparations have heterogeneous structures and often low specific activities due to multiple and/or uncontrolled PEGylation. In the present study, a novel solid-phase PEGylation strategy was employed to produce homogenous mono-PEGylated rhKGF-1. RhKGF-1 protein was immobilized on a Heparin-Sepharose column and then a site-selective PEGylation reaction was carried out by a reductive alkylation at the N-terminal amino acid of the protein. The mono-PEGylated rhKGF-1, which accounted for over 40% of the total rhKGF-1 used in the PEGylation reaction, was purified to homogeneity by SP Sepharose ion-exchange chromatography. Our biophysical and biochemical studies demonstrated that the solid-phase PEGylation significantly enhanced the in vitro and in vivo biostability without affecting the over all structure of the protein. Furthermore, pharmacokinetic analysis showed that modified rhKGF-1 had considerably longer plasma half-life than its intact counterpart. Our cell-based analysis showed that, similar to rhKGF-1, PEGylated rhKGF-1 induced proliferation in NIH 3T3 cells through the activation of MAPK/Erk pathway. Notably, PEGylated rhKGF-1 exhibited a greater hepatoprotection against CCl(4-induced injury in rats compared to rhKGF-1.

  9. Capsule expression in Streptococcus mitis modulates interaction with oral keratinocytes and alters susceptibility to human antimicrobial peptides.

    Science.gov (United States)

    Rukke, H V; Engen, S A; Schenck, K; Petersen, F C

    2016-08-01

    Streptococcus mitis is a colonizer of the oral cavity and the nasopharynx, and is closely related to Streptococcus pneumoniae. Both species occur in encapsulated and unencapsulated forms, but in S. mitis the role of the capsule in host interactions is mostly unknown. Therefore, the aim of this study was to examine how capsule expression in S. mitis can modulate interactions with the host with relevance for colonization. The S. mitis type strain, as well as two mutants of the type strain, an isogenic capsule deletion mutant, and a capsule switch mutant expressing the serotype 4 capsule of S. pneumoniae TIGR4, were used. Wild-type and capsule deletion strains of S. pneumoniae TIGR4 were included for comparison. We found that capsule production in S. mitis reduced adhesion to oral and lung epithelial cells. Further, exposure of oral epithelial cells to encapsulated S. mitis resulted in higher interleukin-6 and CXCL-8 transcription levels relative to the unencapsulated mutant. Capsule expression in S. mitis increased the sensitivity to human neutrophil peptide 1-3 but reduced the sensitivity to human β-defensin-3 and cathelicidin. This was in contrast with S. pneumoniae in which capsule expression has been generally associated with increased sensitivity to human antimicrobial peptides (AMPs). Collectively, these findings indicate that capsule expression in S. mitis is important in modulating interactions with epithelial cells, and is associated with increased or reduced susceptibility to AMPs depending on the nature of the AMP.

  10. Keratinocytes at the uppermost layer of epidermis might act as sensors of atmospheric pressure change.

    Science.gov (United States)

    Denda, Mitsuhiro

    2016-01-01

    It has long been suggested that climate, especially atmospheric pressure change, can cause health problems ranging from migraine to myocardial infarction. Here, I hypothesize that the sensory system of epidermal keratinocytes mediates the influence of atmospheric pressure change on the human physiological condition. We previously demonstrated that even subtle changes of atmospheric pressure (5-20 hPa) induce elevation of intracellular calcium level in cultured human keratinocytes (excitation of keratinocytes). It is also established that communication occurs between epidermal keratinocytes and peripheral nerve systems. Moreover, various neurotransmitters and hormones that influence multiple systems (nervous, cardiovascular, endocrine, and immune systems) are generated and released from epidermal keratinocytes in response to various external stimuli. Thus, I suggest that pathophysiological phenomena induced by atmospheric pressure changes might be triggered by epidermal keratinocytes.

  11. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  12. Cell pattern in adult human corneal endothelium.

    Directory of Open Access Journals (Sweden)

    Carlos H Wörner

    Full Text Available A review of the current data on the cell density of normal adult human endothelial cells was carried out in order to establish some common parameters appearing in the different considered populations. From the analysis of cell growth patterns, it is inferred that the cell aging rate is similar for each of the different considered populations. Also, the morphology, the cell distribution and the tendency to hexagonallity are studied. The results are consistent with the hypothesis that this phenomenon is analogous with cell behavior in other structures such as dry foams and grains in polycrystalline materials. Therefore, its driving force may be controlled by the surface tension and the mobility of the boundaries.

  13. Latent inhibition in human adults without masking.

    Science.gov (United States)

    Escobar, Martha; Arcediano, Francisco; Miller, Ralph R

    2003-09-01

    Latent inhibition refers to attenuated responding to Cue X observed when the X-outcome pairings are preceded by X-alone presentations. It has proven difficult to obtain in human adults unless the preexposure (X-alone) presentations are embedded within a masking (i.e., distracting) task. The authors hypothesized that the difficulty in obtaining latent inhibition with unmasked tasks is related to the usual training procedures, in which the preexposure and conditioning experiences are separated by a set of instructions. Experiment 1 reports latent inhibition without masking in a task in which preexposure and conditioning occur without interruption. Experiments 2 and 3 demonstrate that this attenuation in responding to target Cue X does not pass a summation test for conditioned inhibition and is context specific, thereby confirming that it is latent inhibition. Experiments 3 and 4 confirm that introducing instructions between preexposure and conditioning disrupts latent inhibition.

  14. Inactivation of p53 in Human Keratinocytes Leads to Squamous Differentiation and Shedding via Replication Stress and Mitotic Slippage.

    Science.gov (United States)

    Freije, Ana; Molinuevo, Rut; Ceballos, Laura; Cagigas, Marta; Alonso-Lecue, Pilar; Rodriguez, René; Menendez, Pablo; Aberdam, Daniel; De Diego, Ernesto; Gandarillas, Alberto

    2014-11-20

    Tumor suppressor p53 is a major cellular guardian of genome integrity, and its inactivation is the most frequent genetic alteration in cancer, rising up to 80% in squamous cell carcinoma (SCC). By adapting the small hairpin RNA (shRNA) technology, we inactivated endogenous p53 in primary epithelial cells from the epidermis of human skin. We show that either loss of endogenous p53 or overexpression of a temperature-sensitive dominant-negative conformation triggers a self-protective differentiation response, resulting in cell stratification and expulsion. These effects follow DNA damage and exit from mitosis without cell division. p53 preserves the proliferative potential of the stem cell compartment and limits the power of proto-oncogene MYC to drive cell cycle stress and differentiation. The results provide insight into the role of p53 in self-renewal homeostasis and help explain why p53 mutations do not initiate skin cancer but increase the likelihood that cancer cells will appear.

  15. Inactivation of p53 in Human Keratinocytes Leads to Squamous Differentiation and Shedding via Replication Stress and Mitotic Slippage

    Directory of Open Access Journals (Sweden)

    Ana Freije

    2014-11-01

    Full Text Available Tumor suppressor p53 is a major cellular guardian of genome integrity, and its inactivation is the most frequent genetic alteration in cancer, rising up to 80% in squamous cell carcinoma (SCC. By adapting the small hairpin RNA (shRNA technology, we inactivated endogenous p53 in primary epithelial cells from the epidermis of human skin. We show that either loss of endogenous p53 or overexpression of a temperature-sensitive dominant-negative conformation triggers a self-protective differentiation response, resulting in cell stratification and expulsion. These effects follow DNA damage and exit from mitosis without cell division. p53 preserves the proliferative potential of the stem cell compartment and limits the power of proto-oncogene MYC to drive cell cycle stress and differentiation. The results provide insight into the role of p53 in self-renewal homeostasis and help explain why p53 mutations do not initiate skin cancer but increase the likelihood that cancer cells will appear.

  16. Photodynamic activities of silicon phthalocyanines against achromic M6 melanoma cells and healthy human melanocytes and keratinocytes.

    Science.gov (United States)

    Decreau, R; Richard, M J; Verrando, P; Chanon, M; Julliard, M

    1999-01-01

    Dichlorosilicon phthalocyanine (Cl2SiPc) and bis(tri-n-hexylsiloxy) silicon phthalocyanine (HexSiPc) have been evaluated in vitro as potential photosensitizers for photodynamic therapy (PDT) against the human amelanotic melanoma cell line M6. Each photosensitizer is dissolved in a solvent-PBS mixture, or entrapped in egg-yolk lecithin liposomes or in Cremophor EL micelles. The cells are incubated for 1 h with the sensitizer and then irradiated for 20 min, 1 h or 2 h (lambda > 480 nm, 10 mW cm-2). The photocytotoxic effect is dependent on the photosensitizer concentration and the light dose. Higher phototoxicity is observed after an irradiation of 2 h: treatment with a solution of photosensitizer (2 x 10(-9) M) leads to 10% (HexSiPc in egg-yolk lecithin liposomes) or 20% (Cl2SiPc in DMF-PBS solution) cell viability. After 1 h incubation and 20 min of light exposure, the photodynamic effect is connected with the type of delivery system used. For HexSiPc, lower cell viability is found when this photosensitizer is entrapped in egg-yolk lecithin instead of solvent-PBS or for Cremophor EL micelles with Cl2SiPc. Liposome-delivered HexSiPc leads to lipid damage in M6 cells, illustrated by an increase of thiobarbituric acid-reacting substances (TBARs), but the change is not significant with Cremophor EL. The same is observed for the antioxidative defences after photodynamic stress. The cells irradiated with HexSiPc entrapped in liposomes display an increase of superoxide dismutase (SOD) activity and a decrease of glutathione (GSH) level, glutathione peroxidase (GSHPx) and catalase (Cat) activities.

  17. Co-cultivation of keratinocyte-human mesenchymal stem cell (hMSC) on sericin loaded electrospun nanofibrous composite scaffold (cationic gelatin/hyaluronan/chondroitin sulfate) stimulates epithelial differentiation in hMSCs: In vitro study.

    Science.gov (United States)

    Bhowmick, Sirsendu; Scharnweber, Dieter; Koul, Veena

    2016-05-01

    Fortifying the scaffold with bioactive molecules and glycosaminoglycans (GAGs), is an efficient way to design new generation tissue engineered biomaterials. In this study, we evaluated the synergistic effect of electrospun nanofibrous composite scaffold (cationic gelatin/hyaluronan/chondroitin sulfate) loaded with sericin and, contact co-culture of human mesenchymal stem cells (hMSCs)-keratinocytes on hMSCs' differentiation towards epithelial lineage. Cationic gelatin is prepared with one step novel synthesis process by grafting quaternary ammonium salts to the backbone of gelatin. Release kinetics studies showed that Fickian diffusion is the major release mechanism for both GAGs and sericin/gelatin. In vitro biocompatibility of the electrospun scaffold was evaluated in terms of LDH and DNA quantification assay on human foreskin fibroblast, human keratinocyte and hMSC. Significant proliferation (∼ 4-6 fold) was detected after culturing all three cell on the electrospun scaffold containing sericin. After 5 days of contact co-culture, results revealed that electrospun scaffold containing sericin promote epithelial differentiation of hMSC in terms of several protein markers (keratin 14, ΔNp63α and Pan-cytokeratin) and gene expression of some dermal proteins (keratin 14, ΔNp63α). Findings of this study will foster the progress of current skin tissue engineering scaffolds by understanding the skin regeneration and wound healing process.

  18. Isolation and cultivation of keratinocyte stem-like cells from human skin dermis%人皮肤真皮组织中角朊干细胞样细胞的分离与培养*☆

    Institute of Scientific and Technical Information of China (English)

    池光范; 李美英; 赵贵芳; 邓继鸿; 刘晋宇; 李玉林

    2013-01-01

      背景:皮肤真皮组织是皮肤损伤修复时除表皮基底层以外可形成表皮层结构的重要干细胞来源。目的:探索从人皮肤真皮组织中分离培养角朊干细胞样细胞的新方法。方法:将一定大小的成人腹部全层皮肤组织用 Dispase 过夜消化后去除表皮层结构,然后用0.1%Ⅰ型胶原酶过夜消化,离心分离以获取真皮来源总细胞。将分离的细胞用含有体积分数1% N2,2% B27,20μg/L表皮生长因子和40μg/L 碱性成纤维细胞生长因子的DMEM/F12(1∶1)无血清培养液悬浮后以低密度接种于培养皿进行培养。采用RT-PCR和免疫细胞荧光染色法对其进行分析。结果与结论:RT-PCR分析结果显示所分离的真皮细胞中含有表达Lgr5和Lirg1等特异基因的毛囊来源干细胞;免疫细胞荧光分析结果显示其表达细胞角蛋白8和细胞角蛋白14。在无血清条件下培养6 d时,可观察到表达细胞角蛋白14和整合素α6的“铺路石”样细胞克隆。进行传代培养后P1细胞表达角朊干细胞标志物CD29、细胞角蛋白14和P63。传代培养至P3,4时大部分细胞分化,不能继续传代。结果证实,以无血清培养液结合低密度培养法可直接从人真皮组织中有效地培养增殖活跃、细胞角蛋白14和P63阳性的角朊干细胞样细胞。%  BACKGROUND: Skin dermis is an essential stem cel source, except basal layer of epidermis, for forming epidermis structure during the process of skin wound healing. OBJECTIVE: To explore a new method for isolating and culturing keratinocyte-stem like cel s from human skin dermis. METHODS: Definitive sizes of ful skins from adult abdomen were digested with dispase overnight and the epidermal structure was discarded. The remaining dermis were digested with 0.1% type I col agenase overnight. Thereafter, the digested cel s were col ected by centrifugation, suspended in serum-free Dulbecco’s modified Eagle

  19. Have you got any cholesterol? Adults' views of human nutrition

    Science.gov (United States)

    Schibeci, Renato; Wong, Khoon Yoong

    1994-12-01

    The general aim of our human nutrition project is to develop a health education model grounded in ‘everyday’ or ‘situated’ cognition (Hennessey, 1993). In 1993, we began pilot work to document adult understanding of human nutrition. We used a HyperCard stack as the basis for a series of interviews with 50 adults (25 university students, and 25 adults from offcampus). The interviews were transcribed and analysed using the NUDIST computer program. A summary of the views of these 50 adults on selected aspects of human nutrition is presented in this paper.

  20. A Polyphenol-Enriched Fraction of Rose Oil Distillation Wastewater Inhibits Cell Proliferation, Migration and TNF-α-Induced VEGF Secretion in Human Immortalized Keratinocytes.

    Science.gov (United States)

    Wedler, Jonas; Rusanov, Krasimir; Atanassov, Ivan; Butterweck, Veronika

    2016-07-01

    Water steam distillation of rose flowers separates the essential oil from the polyphenol-containing rose oil distillation wastewater. Recently, a strategy was developed to separate rose oil distillation wastewater into a polyphenol depleted water fraction and a polyphenol-enriched fraction [RF20-(SP-207)]. The objective of the present study was to investigate RF20-(SP-207) and fraction F(IV), augmented in quercetin and ellagic acid, for possible antiproliferative effects in immortalized human keratinocytes (HaCaT) since rose petals are known to contain compounds with potential antiproliferative activity.RF20-(SP-207) revealed dose-dependent antiproliferative activity (IC50 of 9.78 µg/mL). In a nontoxic concentration of 10 µg/mL, this effect was stronger than that of the two positive controls LY294002 (10 µM, PI3 K-inhibitor, 30 % inhibition) and NVP-BEZ235 (100 nM, dual PI3 K/mTOR inhibitor, 30 % inhibition) and clearly exceeded the antiproliferative action of quercetin (50 µM, 25 % inhibition) and ellagic acid (1 µM, 15 % inhibition). Time-lapse microscopy detected a significant impairment of cell migration of RF20-(SP-207) and F(IV). At concentrations of 10 µg/mL of both, extract and fraction, cell migration was strongly suppressed (51 % and 28 % gap closure, respectively, compared to 95 % gap closure 24 hours after control treatment). The suppression of cell migration was comparable to the positive controls LY294002, NVP-BEZ235, and quercetin. Furthermore, basal and TNF-α-stimulated VEGF-secretion was significantly reduced by RF20-(SP-207) and F(IV) at 10 µg/mL (44 % vs. untreated control).In conclusion, RF20-(SP-207) showed promising antiproliferative and antimigratory effects and could be developed as a supportive, therapy against hyperproliferation-involved skin diseases.

  1. Adult neurogenesis in humans- common and unique traits in mammals.

    Directory of Open Access Journals (Sweden)

    Aurélie Ernst

    2015-01-01

    Full Text Available New neurons are continuously generated in specific regions in the adult brain. Studies in rodents have demonstrated that adult-born neurons have specific functional features and mediate neural plasticity. Data on the extent and dynamics of adult neurogenesis in adult humans are starting to emerge, and there are clear similarities and differences compared to other mammals. Why do these differences arise? And what do they mean?

  2. Adult Education & Human Resource Development: Overlapping and Disparate Fields

    Science.gov (United States)

    Watkins, Karen E.; Marsick, Victoria J.

    2014-01-01

    Adult education and human resource development as fields of practice and study share some roots in common but have grown in different directions in their histories. Adult education's roots focused initially on citizenship for a democratic society, whereas human resource development's roots are in performance at work. While they have…

  3. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  4. Transcriptional profiling of epidermal keratinocytes: comparison of genes expressed in skin, cultured keratinocytes, and reconstituted epidermis, using large DNA microarrays.

    Science.gov (United States)

    Gazel, Alix; Ramphal, Patricia; Rosdy, Martin; De Wever, Bart; Tornier, Carine; Hosein, Nadia; Lee, Brian; Tomic-Canic, Marjana; Blumenberg, Miroslav

    2003-12-01

    Epidermal keratinocytes are complex cells that create a unique three-dimensional (3-D) structure, differentiate through a multistage process, and respond to extracellular stimuli from nearby cells. Consequently, keratinocytes express many genes, i.e., have a relatively large "transcriptome." To determine which of the expressed genes are innate to keratinocytes, which are specific for the differentiation and 3-D architecture, and which are induced by other cell types, we compared the transcriptomes of skin from human subjects, differentiating 3-D reconstituted epidermis, cultured keratinocytes, and nonkeratinocyte cell types. Using large oligonucleotide microarrays, we analyzed five or more replicates of each, which yielded statistically consistent data and allowed identification of the differentially expressed genes. Epidermal keratinocytes, unlike other cells, express many proteases and protease inhibitors and genes that protect from UV light. Skin specifically expresses a higher number of receptors, secreted proteins, and transcription factors, perhaps influenced by the presence of nonkeratinocyte cell types. Surprisingly, mitochondrial proteins were significantly suppressed in skin, suggesting a low metabolic rate. Three-dimensional samples, skin and reconstituted epidermis, are similar to each other, expressing epidermal differentiation markers. Cultured keratinocytes express many cell-cycle and DNA replication genes, as well as integrins and extracellular matrix proteins. These results define innate, architecture-specific, and cell-type-regulated genes in epidermis.

  5. The dynamics of adult neurogenesis in human hippocampus.

    Science.gov (United States)

    Ihunwo, Amadi O; Tembo, Lackson H; Dzamalala, Charles

    2016-12-01

    The phenomenon of adult neurogenesis is now an accepted occurrence in mammals and also in humans. At least two discrete places house stem cells for generation of neurons in adult brain. These are olfactory system and the hippocampus. In animals, newly generated neurons have been directly or indirectly demonstrated to generate a significant amount of new neurons to have a functional role. However, the data in humans on the extent of this process is still scanty and such as difficult to comprehend its functional role in humans. This paper explores the available data on as extent of adult hippocampal neurogenesis in humans and makes comparison to animal data.

  6. Inhibition of Akt signaling by exclusion from lipid rafts in normal and transformed epidermal keratinocytes

    DEFF Research Database (Denmark)

    Calay, Damien; Vind-Kezunovic, Dina; Frankart, Aurelie;

    2010-01-01

    of the phosphatidylinositol-3 kinase (PI3K)/Akt pathway. Raft disruption was achieved in normal human keratinocytes and precancerous (HaCaT) or transformed (A431) keratinocytes by cholesterol extraction or inactivation with methyl-beta-cyclodextrin, filipin III, or 5-cholestene-5-beta-ol. Lipid raft disruption did not affect...

  7. Adult Human Neurogenesis: from Microscopy to Magnetic Resonance Imaging

    Directory of Open Access Journals (Sweden)

    Amanda eSierra

    2011-04-01

    Full Text Available Neural stem cells reside in well-defined areas of the adult human brain and are capable of gene-rating new neurons throughout the life span. In rodents, it is well established that the new born neurons are involved in olfaction as well as in certain forms of memory and learning. In humans, the functional relevance of adult human neurogenesis is being investigated, in particular its implication in the etiopathology of a variety of brain disorders. Adult neurogenesis in the human brain was discovered by utilizing methodologies directly imported from the rodent research, such as immunohistological detection of proliferation and cell-type specific biomarkers in postmortem or biopsy tissue. However, in the vast majority of cases, these methods do not support longitudinal studies; thus, the capacity of the putative stem cells to form new neurons under different disease conditions cannot be tested. More recently, new technologies have been specifically developed for the detection and quantification of neural stem cells in the living human brain. These technologies rely on the use of magnetic resonance imaging, available in hospitals worldwide. Although they require further validation in rodents and primates, these new methods hold the potential to test the contribution of adult human neurogenesis to brain function in both health and disease. This review reports on the current knowledge on adult human neurogenesis. We first review the different methods available to assess human neurogenesis, both ex vivo and in vivo and then appraise the changes of adult neurogenesis in human diseases.

  8. Attenuating properties of Agastache rugosa leaf extract against ultraviolet-B-induced photoaging via up-regulating glutathione and superoxide dismutase in a human keratinocyte cell line.

    Science.gov (United States)

    Oh, Yuri; Lim, Hye-Won; Huang, Yu-Hua; Kwon, Hee-Souk; Jin, Chang Duck; Kim, Kyunghoon; Lim, Chang-Jin

    2016-10-01

    Agastache rugosa Kuntze, known as a Korean mint, is an herbal medicine that has been used for the treatment of diverse kinds of symptoms in traditional medicine. This work was undertaken to assess the protective properties of A. rugosa leaves against UV-B-induced photoaging in HaCaT keratinocytes. They were evaluated via analyzing reactive oxygen species (ROS), promatrix metalloproteinase-2 (proMMP-2) and -9 (proMMP-9), total glutathione (GSH), total superoxide dismutase (SOD), cellular viability, flavonoid content and in vitro radical scavenging activity. Total flavonoid content of ARE, a hot water extract of A. rugosa leaves, was 22.8±7.6mg of naringin equivalent/g ARE. ARE exhibited ABTS(+) radical scavenging activity with an SC50 of 836.9μg/mL. ARE attenuated the UV-B-induced ROS generation. It diminished the UV-B-induced elevation of proMMP-2 and -9 at both activity and protein levels. On the contrary, ARE was able to enhance the UV-B-reduced total GSH and total SOD activity levels. ARE, at the used concentrations, was unable to interfere with the cellular viabilities of HaCaT keratinocytes under UV-B irradiation. Taken together, ARE possesses a protective potential against UV-B-induced photoaging in HaCaT keratinocytes, possibly based upon up-regulating antioxidant components, including total GSH and SOD. These findings reasonably suggest the use of A. rugosa leaves as a photoprotective resource in manufacturing functional cosmetics.

  9. Basic Red 51, a permitted semi-permanent hair dye, is cytotoxic to human skin cells: Studies in monolayer and 3D skin model using human keratinocytes (HaCaT).

    Science.gov (United States)

    Zanoni, Thalita B; Tiago, Manoela; Faião-Flores, Fernanda; de Moraes Barros, Silvia B; Bast, Aalt; Hageman, Geja; de Oliveira, Danielle Palma; Maria-Engler, Silvya S

    2014-06-01

    The use of hair dyes is closely associated with the increase of cancer, inflammation and other skin disorders. The recognition that human skin is not an impermeable barrier indicates that there is the possibility of human systemic exposure. The carcinogenic potential of hair dye ingredients has attracted the attention of toxicologists for many decades, mainly due to the fact that some ingredients belong to the large chemical family of aromatic amines. Herein, we investigated the cytotoxicity of Basic Red 51 (BR51) in immortalized human keratinocytes (HaCaT). BR51 is a temporary hair dye that belongs to the azo group (NN); the cleavage of this bond may result in the release of toxic aromatic amines. The half maximal effective concentration (EC50) in HaCaT cells is 13μg/mL. BR51 induced a significant decrease on expression of p21 in a dose dependent manner. p53 was not affected, whereas BR51 decreased procaspase 8 and cleaved procaspase 9. These results proved that caspase 3 is fully involved in BR51-induced apoptosis. The dye was also able to stop this cell cycle on G2 in sub-toxic doses. Moreover, we reconstructed a 3D artificial epidermis using HaCaT cells; using this model, we observed that BR51 induced cell injury and cells were undergoing apoptosis, considering the fragmented nuclei. Subsequently, BR51 induced reactive oxygen species (ROS) leading to an increase on the levels of 8-oxo-dG. In conclusion, we provide strong evidence that consumer and/or professional exposure to BR51 poses risk to human health.

  10. Gustofacial and olfactofacial responses in human adults.

    Science.gov (United States)

    Weiland, Romy; Ellgring, Heiner; Macht, Michael

    2010-11-01

    Adults' facial reactions in response to tastes and odors were investigated in order to determine whether differential facial displays observed in newborns remain stable in adults who exhibit a greater voluntary facial control. Twenty-eight healthy nonsmokers (14 females) tasted solutions of PROP (bitter), NaCl (salty), citric acid (sour), sucrose (sweet), and glutamate (umami) differing in concentration (low, medium, and high) and smelled different odors (banana, cinnamon, clove, coffee, fish, and garlic). Their facial reactions were video recorded and analyzed using the Facial Action Coding System. Adults' facial reactions discriminated between stimuli with opponent valences. Unpleasant tastes and odors elicited negative displays (brow lower, upper lip raise, and lip corner depress). The pleasant sweet taste elicited positive displays (lip suck), whereas the pleasant odors did not. Unlike newborns, adults smiled with higher concentrations of some unpleasant tastes that can be regarded as serving communicative functions. Moreover, adults expressed negative displays with higher sweetness. Except for the "social" smile in response to unpleasant tastes, adults' facial reactions elicited by tastes and odors mostly correspond to those found in newborns. In conclusion, adults' facial reactions to tastes and odors appear to remain stable in their basic displays; however, some additional reactions might reflect socialization influences.

  11. Distinct roles for ROCK1 and ROCK2 in the regulation of keratinocyte differentiation.

    Directory of Open Access Journals (Sweden)

    Frances E Lock

    Full Text Available BACKGROUND: The human epidermis is comprised of several layers of specialized epithelial cells called keratinocytes. Normal homoeostasis of the epidermis requires that the balance between keratinocyte proliferation and terminal differentiation be tightly regulated. The mammalian serine/threonine kinases (ROCK1 and ROCK2 are well-characterised downstream effectors of the small GTPase RhoA. We have previously demonstrated that the RhoA/ROCK signalling pathway plays an important role in regulation of human keratinocyte proliferation and terminal differentiation. In this paper we addressed the question of which ROCK isoform was involved in regulation of keratinocyte differentiation. METHODOLOGY AND PRINCIPAL FINDINGS: We used RNAi to specifically knockdown ROCK1 or ROCK2 expression in cultured human keratinocytes. ROCK1 depletion results in decreased keratinocyte adhesion to fibronectin and an increase in terminal differentiation. Conversely, ROCK2 depletion results in increased keratinocyte adhesion to fibronectin and inhibits terminal differentiation. CONCLUSION: These data suggest that ROCK1 and ROCK2 play distinct roles in regulating keratinocyte adhesion and terminal differentiation.

  12. The Asian-American variant of human papillomavirus type 16 exhibits higher activation of MAPK and PI3K/AKT signaling pathways, transformation, migration and invasion of primary human keratinocytes.

    Science.gov (United States)

    Hochmann, Jimena; Sobrinho, João S; Villa, Luisa L; Sichero, Laura

    2016-05-01

    Asian-American (AA) HPV-16 variants are associated with higher risk of cancer. Abnormal activation of intracellular signaling play a critical role in cancer development and progression. Our aim was to elucidate mechanisms underlying the higher oncogenic potential attributed to AA variant. We evaluated activation of MAPK and PI3K/AKT pathways in primary human keratinocytes (PHKs) transduced with E6/E7 of three HPV-16 variants: E-P, AA, E-350G. Phenotypes examined included migration, anchorage independent growth and invasion. AA PHKs presented the highest levels of active proteins involved in all cascades analyzed: MAPK-ERK, MAPK-p38 and PI3K-AKT. AA PHKs were more efficient in promoting anchorage independent growth, and in stimulating cell migration and invasion. MEK1 inhibition decreased migration. The mesenchymal phenotype marker vimentin was increased in AA PHKs. Our results suggest that MEK1, ERK2, AKT2 hyperactivation influence cellular behavior by means of GSK-3b inactivation and EMT induction prompting AA immortalized PHKs to more efficiently surpass carcinogenesis steps.

  13. Adult Literacy Education and Human Rights: A View from Afghanistan

    Science.gov (United States)

    Andersen, Susan M.; Kooij, Christina S.

    2007-01-01

    In this article, we argue that adult literacy as part of international development is an issue of both human rights and women's rights. We explore this by presenting a case study of the effects of one innovative adult literacy program in Afghanistan that places men and women, as well as various ethnicities, together in the same classroom as…

  14. Antioxidants protect keratinocytes against M. ulcerans mycolactone cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Alvar Grönberg

    Full Text Available BACKGROUND: Mycobacterium ulcerans is the causative agent of necrotizing skin ulcerations in distinctive geographical areas. M. ulcerans produces a macrolide toxin, mycolactone, which has been identified as an important virulence factor in ulcer formation. Mycolactone is cytotoxic to fibroblasts and adipocytes in vitro and has modulating activity on immune cell functions. The effect of mycolactone on keratinocytes has not been reported previously and the mechanism of mycolactone toxicity is presently unknown. Many other macrolide substances have cytotoxic and immunosuppressive activities and mediate some of their effects via production of reactive oxygen species (ROS. We have studied the effect of mycolactone in vitro on human keratinocytes--key cells in wound healing--and tested the hypothesis that the cytotoxic effect of mycolactone is mediated by ROS. METHODOLOGY/PRINCIPAL FINDINGS: The effect of mycolactone on primary skin keratinocyte growth and cell numbers was investigated in serum free growth medium in the presence of different antioxidants. A concentration and time dependent reduction in keratinocyte cell numbers was observed after exposure to mycolactone. Several different antioxidants inhibited this effect partly. The ROS inhibiting substance deferoxamine, which acts via chelation of Fe(2+, completely prevented mycolactone mediated cytotoxicity. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that mycolactone mediated cytotoxicity can be inhibited by deferoxamine, suggesting a role of iron and ROS in mycolactone induced cytotoxicity of keratinocytes. The data provide a basis for the understanding of Buruli ulcer pathology and the development of improved therapies for this disease.

  15. Effect of Oleanolic Acid on Adriamycin Induced Apoptosis of Cultured Human Skin Keratinocytes in Vitro%齐墩果酸对阿霉素诱导的培养人皮肤角质形成细胞凋亡的影响

    Institute of Scientific and Technical Information of China (English)

    张兴洪; 刘彦群; 魏志平; 田美华

    2011-01-01

    Objective To investigate the effect of oleanolic acid (OA) on adriamycin induced apoptosis of cultured human skin keratinocytes in vitro. Methods Human skin keratinocytes were cultured with different concentrations of oleanolic acid and adriamycin. Absorbance A was detected by colorimetric assay of MTT. The optical density (OD) values were showed on a scanning multiwell spectrophotometer. Apoptosis rate of human skin keratinocytes was detected by flow cytometry. Results We found that the proliferation of human skin keratinocytes was inhibited by adriamycin. If cells were pre-incubated with oleanolic acid, OD value was significantly higher and apoptosis induced by adriamycin was suppressed (P<0.05). Conclusion This study suggests that oleanolic acid could partially inhibit adriamycin induced apoptosis of cultured human skin keratinocytes.%目的 探讨齐墩果酸对阿霉素诱导的培养人皮肤角质形成细胞凋亡的影响.方法 用MTT法通过比色分析测定吸光度(A)值,检测不同剂量齐墩果酸和阿霉素给药对角质形成细胞增殖的影响,用流式细胞仪检测细胞凋亡.结果 阿霉素抑制体外培养的人皮肤角质形成细胞增殖,先给予齐墩果酸处理细胞,然后给予阿霉素,齐墩果酸升高A值(P<0.05),降低细胞凋亡率(P<0.05).结论 先行给予适当剂量齐墩果酸处理细胞,能一定程度减轻阿霉素对细胞的损伤,表现出对阿霉素致凋亡的保护作用.

  16. Keratinocyte-derived laminin-332 protein promotes melanin synthesis via regulation of tyrosine uptake.

    Science.gov (United States)

    Chung, Heesung; Jung, Hyejung; Lee, Jung-Hyun; Oh, Hye Yun; Kim, Ok Bin; Han, Inn-Oc; Oh, Eok-Soo

    2014-08-01

    Melanocytes, which produce the pigment melanin, are known to be closely regulated by neighboring keratinocytes. However, how keratinocytes regulate melanin production is unclear. Here we report that melanin production in melanoma cells (B16F10 and MNT-1) was increased markedly on a keratinocyte-derived extracellular matrix compared with a melanoma cell-derived extracellular matrix. siRNA-mediated reduction of keratinocyte-derived laminin-332 expression decreased melanin synthesis in melanoma cells, and laminin-332, but not fibronectin, enhanced melanin content and α-melanocyte-stimulating hormone-regulated melanin production in melanoma cells. Similar effects were observed in human melanocytes. Interestingly, however, laminin-332 did not affect the expression or activity of tyrosinase. Instead, laminin-332 promoted the uptake of extracellular tyrosine and, subsequently, increased intracellular levels of tyrosine in both melanocytes and melanoma cells. Taken together, these data strongly suggest that keratinocyte-derived laminin-332 contributes to melanin production by regulating tyrosine uptake.

  17. Transdifferentiation of adipose-derived stem cells into keratinocyte-like cells: engineering a stratified epidermis.

    Directory of Open Access Journals (Sweden)

    Claudia Chavez-Munoz

    Full Text Available Skin regeneration is an important area of research in the field of tissue-engineering, especially for cases involving loss of massive areas of skin, where current treatments are not capable of inducing permanent satisfying replacements. Human adipose-derived stem cells (ASC have been shown to differentiate in-vitro into both mesenchymal lineages and non-mesenchymal lineages, confirming their transdifferentiation ability. This versatile differentiation potential, coupled with their ease of harvest, places ASC at the advancing front of stem cell-based therapies. In this study, we hypothesized that ASC also have the capacity to transdifferentiate into keratinocyte-like cells and furthermore are able to engineer a stratified epidermis. ASC were successfully isolated from lipoaspirates and cell sorted (FACS. After sorting, ASC were either co-cultured with human keratinocytes or with keratinocyte conditioned media. After a 14-day incubation period, ASC developed a polygonal cobblestone shape characteristic of human keratinocytes. Western blot and q-PCR analysis showed the presence of specific keratinocyte markers including cytokeratin-5, involucrin, filaggrin and stratifin in these keratinocyte-like cells (KLC; these markers were absent in ASC. To further evaluate if KLC were capable of stratification akin to human keratinocytes, ASC were seeded on top of human decellularized dermis and cultured in the presence or absence of EGF and high Ca(2+ concentrations. Histological analysis demonstrated a stratified structure similar to that observed in normal skin when cultured in the presence of EGF and high Ca(2+. Furthermore, immunohistochemical analysis revealed the presence of keratinocyte markers such as involucrin, cytokeratin-5 and cytokeratin-10. In conclusion this study demonstrates for the first time that ASC have the capacity to transdifferentiate into KLC and engineer a stratified epidermis. This study suggests that adipose tissue is potentially a

  18. Differentiated human stem cells resemble fetal, not adult, β cells.

    Science.gov (United States)

    Hrvatin, Sinisa; O'Donnell, Charles W; Deng, Francis; Millman, Jeffrey R; Pagliuca, Felicia Walton; DiIorio, Philip; Rezania, Alireza; Gifford, David K; Melton, Douglas A

    2014-02-25

    Human pluripotent stem cells (hPSCs) have the potential to generate any human cell type, and one widely recognized goal is to make pancreatic β cells. To this end, comparisons between differentiated cell types produced in vitro and their in vivo counterparts are essential to validate hPSC-derived cells. Genome-wide transcriptional analysis of sorted insulin-expressing (INS(+)) cells derived from three independent hPSC lines, human fetal pancreata, and adult human islets points to two major conclusions: (i) Different hPSC lines produce highly similar INS(+) cells and (ii) hPSC-derived INS(+) (hPSC-INS(+)) cells more closely resemble human fetal β cells than adult β cells. This study provides a direct comparison of transcriptional programs between pure hPSC-INS(+) cells and true β cells and provides a catalog of genes whose manipulation may convert hPSC-INS(+) cells into functional β cells.

  19. Adult human metapneumonovirus (hMPV) pneumonia mimicking Legionnaire's disease.

    Science.gov (United States)

    Cunha, Burke A; Irshad, Nadia; Connolly, James J

    2016-01-01

    In adults hospitalized with viral pneumonias the main differential diagnostic consideration is influenza pneumonia. The respiratory viruses causing viral influenza like illnesses (ILIs), e.g., RSV may closely resemble influenza. Rarely, extrapulmonary findings of some ILIs may resemble Legionnaire's disease (LD), e.g., adenovirus, human parainfluenza virus (HPIV-3). We present a most unusual case of human metapneumonovirus pneumonia (hMPV) with some characteristic extrapulmonary findings characteristic of LD, e.g., relative bradycardia, as well as mildly elevated serum transaminases and hyphosphatemia. We believe this is the first reported case of hMPV pneumonia in a hospitalized adult that had some features of LD.

  20. Troxerutin induces protective effects against ultraviolet B radiation through the alteration of microRNA expression in human HaCaT keratinocyte cells.

    Science.gov (United States)

    Lee, Kwang Sik; Cha, Hwa Jun; Lee, Ghang Tai; Lee, Kun Kook; Hong, Jin Tae; Ahn, Kyu Joong; An, In-Sook; An, Sungkwan; Bae, Seunghee

    2014-04-01

    Ultraviolet light B (UVB), contained in sunlight, induces damaging effects on skin by impairing cells in the epidermis and dermis. In particular, keratinocytes in the epidermis are those cells which are mainly affected by UVB light. UVB radiation induces cell death, growth arrest, DNA damage and restricts cell migration. Various phytochemicals have been shown to alleviate UVB-induced cellular damage. Troxerutin is a natural flavonoid rutin mainly found in extracts of Sophora japonica, and is a well-known antioxidant and anti-inflammatory compound used in experimental mouse models. In this study, we examined the effects of troxerutin on UVB-induced damage in HaCaT cells. HaCaT cells were pre-treated with troxerutin (0-10 µM) and then exposed to UVB radiation (50 mJ/cm2). Cell viability, cell cycle and migration assays were performed to determine the protective effects of troxerutin on the cells. DNA repair activity was also measured. Troxerutin protected the cells against UVB-induced damage, such as cell death, growth arrest, restriction of cell migration and decreased DNA repair activity in HaCaT cells. Analyses of microRNA (miRNA) expression demonstrated that the protective effects of troxerutin correlated with alterations in miRNA expression, as indicated by Gene Ontology analyses of putative target genes. Overall, our data demonstrate that troxerutin exerts protective effects against UVB-induced damage by regulating miRNA expression.

  1. Yokukansan, a Traditional Japanese Medicine, Adjusts Glutamate Signaling in Cultured Keratinocytes

    Directory of Open Access Journals (Sweden)

    Maki Wakabayashi

    2014-01-01

    Full Text Available Glutamate plays an important role in skin barrier signaling. In our previous study, Yokukansan (YKS affected glutamate receptors in NC/Nga mice and was ameliorated in atopic dermatitis lesions. The aim of this study was to assess the effect of YKS on skin and cultured human keratinocytes. Glutamate concentrations in skin of YKS-treated and nontreated NC/Nga mice were measured. Then, glutamate release from cultured keratinocytes was measured, and extracellular glutamate concentrations in YKS-stimulated cultured human keratinocytes were determined. The mRNA expression levels of NMDA receptor 2D (NMDAR2D and glutamate aspartate transporter (GLAST were also determined in YKS-stimulated cultured keratinocytes. The glutamate concentrations and dermatitis scores increased in conventional mice, whereas they decreased in YKS-treated mice. Glutamate concentrations in cell supernatants of cultured keratinocytes increased proportionally to the cell density. However, they decreased dose-dependently with YKS. YKS stimulation increased NMDAR2D in a concentration-dependent manner. Conversely, GLAST decreased in response to YKS. Our findings indicate that YKS affects peripheral glutamate signaling in keratinocytes. Glutamine is essential as a transmitter, and dermatitis lesions might produce and release excess glutamate. This study suggests that, in keratinocytes, YKS controls extracellular glutamate concentrations, suppresses N-methyl-D-aspartate (NMDA receptors, and activates glutamate transport.

  2. 7-Chloro-5-(4-hydroxyphenyl)-1-methyl-3-(naphthalen-2-ylmethyl)-4,5-dihydro-1H-benzo[b][1,4]diazepin-2(3H)-one (Bz-423), a benzodiazepine, suppresses keratinocyte proliferation and has antipsoriatic activity in the human skin-severe, combined immunodeficient mouse transplant model.

    Science.gov (United States)

    Bhagavathula, Narasimharao; Nerusu, Kamalakar C; Hanosh, Andrew; Aslam, Muhammad N; Sundberg, Thomas B; Opipari, Anthony W; Johnson, Kent; Kang, Sewon; Glick, Gary D; Varani, James

    2008-03-01

    7-Chloro-5-(4-hydroxyphenyl)-1-methyl-3-(naphthalen-2-ylmethyl)-4,5-dihydro-1H-benzo[b][1,4]diazepin-2(3H)-one (Bz-423) is a benzodiazepine that has cytotoxic and cytostatic activity against a variety of cells in vivo and in vitro. In the present study, we demonstrate that Bz-423 (formulated for topical delivery) reduces epidermal hyperplasia in human psoriatic skin after transplantation to severe, combined immunodeficient (scid) mice. Bz-423 also suppresses the hyperplasia that develops in nonpsoriatic human skin as a consequence of transplantation to scid mice. Proliferation of human epidermal keratinocytes in monolayer culture was suppressed by Bz-423 at concentrations of 0.5 to 2.0 muM (noncytotoxic concentrations). Keratinocyte growth inhibition was accompanied by increased oxidant generation in Bz-423-treated cells, and treatment with vitamin E along with Bz-423 reversed the growth inhibition. Growth inhibition was accompanied by a redistribution of beta-catenin from a cytoplasmic pool to the cell membrane and by reduced levels of c-myc and cyclin D1 (two molecules associated with Wnt pathway signaling). Several analogs of Bz-423 were examined for antiproliferative activity against human epidermal keratinocytes and human dermal fibroblasts in monolayer culture. Each of the analogs tested suppressed growth of both cell types, but in all cases, keratinocytes were more sensitive than fibroblasts. Two of the compounds were found to suppress epidermal hyperplasia induced with all-trans retinoic acid in organ cultures of human skin. Taken together, these data show that Bz-423 and certain analogs produce biological responses in skin cells in vitro and in vivo that are consistent with therapeutic goals for treating psoriasis or epidermal hyperplasia resulting from other causes.

  3. Radiosensitivity of keratinocytes from tongue and skin; enhanced radioresistance following serial cultivation

    Energy Technology Data Exchange (ETDEWEB)

    Parkinson, E.K.; Hume, W.J.; Potten, C.S.

    1986-01-01

    A study has been carried out of the radiation response of keratinocytes from human skin, mouse skin and mouse tongue to 0-10 Gy of ..gamma..-radiation, carried out in suspension at 20/sup 0/C. The Dsub(o)values for primary cultures of keratinocytes was similar to those obtained in vivo for mice, suggesting that this in vitro assay could be used to measure the sensitivity of keratinocytes treated with various cytotoxic agents. Sensitivity appears to change on subculturing and hence subcultures may be less appropriate for determining in vivo cell sensitivities.

  4. Linking adult hippocampal neurogenesis with human physiology and disease.

    Science.gov (United States)

    Bowers, Megan; Jessberger, Sebastian

    2016-07-01

    We here review the existing evidence linking adult hippocampal neurogenesis and human brain function in physiology and disease. Furthermore, we aim to point out where evidence is missing, highlight current promising avenues of investigation, and suggest future tools and approaches to foster the link between life-long neurogenesis and human brain function. Developmental Dynamics 245:702-709, 2016. © 2016 Wiley Periodicals, Inc.

  5. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes; Mise en evidence de cassures double brin de l'ADN induites par irradiation de keratinocytes humains en microfaisceau alpha

    Energy Technology Data Exchange (ETDEWEB)

    Pouthier, Th

    2006-12-15

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  6. Rab11b mediates melanin transfer between donor melanocytes and acceptor keratinocytes via coupled exo/endocytosis.

    Science.gov (United States)

    Tarafder, Abul K; Bolasco, Giulia; Correia, Maria S; Pereira, Francisco J C; Iannone, Lucio; Hume, Alistair N; Kirkpatrick, Niall; Picardo, Mauro; Torrisi, Maria R; Rodrigues, Inês P; Ramalho, José S; Futter, Clare E; Barral, Duarte C; Seabra, Miguel C

    2014-04-01

    The transfer of melanin from melanocytes to keratinocytes is a crucial process underlying maintenance of skin pigmentation and photoprotection against UV damage. Here, we present evidence supporting coupled exocytosis of the melanin core, or melanocore, by melanocytes and subsequent endocytosis by keratinocytes as a predominant mechanism of melanin transfer. Electron microscopy analysis of human skin samples revealed three lines of evidence supporting this: (1) the presence of melanocores in the extracellular space; (2) within keratinocytes, melanin was surrounded by a single membrane; and (3) this membrane lacked the melanosomal membrane protein tyrosinase-related protein 1 (TYRP1). Moreover, co-culture of melanocytes and keratinocytes suggests that melanin exocytosis is specifically induced by keratinocytes. Furthermore, depletion of Rab11b, but not Rab27a, caused a marked decrease in both keratinocyte-stimulated melanin exocytosis and transfer to keratinocytes. Thus, we propose that the predominant mechanism of melanin transfer is keratinocyte-induced exocytosis, mediated by Rab11b through remodeling of the melanosome membrane, followed by subsequent endocytosis by keratinocytes.

  7. Sphingolipid metabolism in organotypic mouse keratinocyte cultures

    Energy Technology Data Exchange (ETDEWEB)

    Madison, K.C.; Swartzendruber, D.C.; Wertz, P.W.; Downing, D.T. (Univ. of Iowa College of Medicine, Iowa City (USA))

    1990-12-01

    Ceramides are the dominant component of the stratum corneum intercellular lipid lamellae, which constitute the epidermal permeability barrier. Only pig and human epidermal ceramides have been extensively characterized and the structures of the ceramides of cultured keratinocytes have not been previously investigated. In the present studies, we have characterized the ceramides synthesized by organotypic lifted mouse keratinocyte cultures for the first time and compared them to the ceramides of intact mouse epidermis. Both mouse epidermis and cultures contained five ceramides, ceramide 1 being the least polar and ceramide 5 the most polar. Ceramide 1 was a group of acylceramides, i.e., very-long-chain omega-hydroxyceramides with an ester-linked nonhydroxy fatty acid. Ceramide 2 contained medium-length saturated nonhydroxy fatty acids. (In culture, the ceramide 2 band was split into two parts with the slightly more polar ceramide 2' containing short-chain saturated nonhydroxy fatty acids.) Ceramide 5 contained short-chain alpha-hydroxy fatty acids. The structures of ceramides 1, 2, and 5 were analagous to those of pig and human epidermis. Mouse epidermal ceramide 3 was quite unusual, containing beta-hydroxy fatty acids, a structure not previously identified among mammalian ceramides. In contrast, culture ceramide 3 was composed of omega-hydroxy fatty acids with a chain-length distribution similar to that of ceramide 1. Mouse ceramide 4 was composed of fatty acids with chromatographic mobility similar to hydroxy fatty acids but with different chemical reactivity; it remains only partially characterized. Culture ceramide 4 was present in quantities too small for analysis. All ceramides in mouse epidermis and cultures contained only sphingosine bases, whereas pig and human ceramides also contain phytosphingosine.

  8. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration.

    Science.gov (United States)

    Mohammedsaeed, Walaa; Cruickshank, Sheena; McBain, Andrew J; O'Neill, Catherine A

    2015-11-05

    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobacillus (L) rhamnosus GG, L. reuteri, L. plantarum or L. fermentum. Re-epithelialization of treated monolayers was compared to that of untreated controls. Lysates of L. rhamnosus GG and L. reuteri significantly increased the rate of re-epithelialization, with L. rhamnosus GG being the most efficacious. L. reuteri increased keratinocyte proliferation while L. rhamnosus GG lysate significantly increased proliferation and migration. Microarray analysis of L. rhamnosus GG treated scratches showed increased expression of multiple genes including the chemokine CXCL2 and its receptor CXCR2. These are involved in normal wound healing where they stimulate keratinocyte proliferation and/or migration. Increased protein expression of both CXCL2 and CXCR2 were confirmed by ELISA and immunoblotting. These data demonstrate that L. rhamnosus GG lysate accelerates re-epithelialization of keratinocyte scratch assays, potentially via chemokine receptor pairs that induce keratinocyte migration.

  9. Oogenesis in adult mammals, including humans: a review.

    Science.gov (United States)

    Bukovsky, Antonin; Caudle, Michael R; Svetlikova, Marta; Wimalasena, Jay; Ayala, Maria E; Dominguez, Roberto

    2005-04-01

    The origin of oocytes and primary follicles in ovaries of adult mammalian females has been a matter of dispute for over 100 yr. The prevailing belief that all oocytes in adult mammalian females must persist from the fetal period of life seems to be a uniquely retrogressive reproductive mechanism requiring humans to preserve their gametes from the fetal period for several decades. The utilization of modern techniques during last 10 yr clearly demonstrates that mammalian primordial germ cells originate from somatic cell precursors. This indicates that if somatic cells are precursors of germ cells, then somatic mutations can be passed on to progeny. Mitotically active germline stem cells have been described earlier in ovaries of adult prosimian primates and recently have been reported to also be present in the ovaries of adult mice. We have earlier shown that in adult human females, mesenchymal cells in the ovarian tunica albuginea undergo a mesenchymal-epithelial transition into ovarian surface epithelium cells, which differentiate sequentially into primitive granulosa and germ cells. Recently, we have reported that these structures assemble in the deeper ovarian cortex and form new follicles to replace earlier primary follicles undergoing atresia (follicular renewal). Our current observations also indicate that follicular renewal exists in rat ovaries, and human oocytes can differentiate from ovarian surface epithelium in fetal ovaries in vivo and from adult ovaries in vitro. These reports challenge the established dogma regarding the fetal origin of eggs and primary follicles in adult mammalian ovaries. Our data indicate that the pool of primary follicles in adult human ovaries does not represent a static but a dynamic population of differentiating and regressing structures. Yet, the follicular renewal may cease at a certain age, and this may predetermine the onset of the natural menopause or premature ovarian failure. A lack of follicular renewal in aging ovaries

  10. Anti-wrinkle effects of Sargassum muticum ethyl acetate fraction on ultraviolet B-irradiated hairless mouse skin and mechanistic evaluation in the human HaCaT keratinocyte cell line.

    Science.gov (United States)

    Song, Jae Hyoung; Piao, Mei Jing; Han, Xia; Kang, Kyoung Ah; Kang, Hee Kyoung; Yoon, Weon Jong; Ko, Mi Hee; Lee, Nam Ho; Lee, Mi Young; Chae, Sungwook; Hyun, Jin Won

    2016-10-01

    The present study investigated the photoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME) against ultraviolet B (UVB)‑induced skin damage and photoaging in a mouse model. HR‑1 strain hairless male mice were divided into three groups: An untreated control group, a UVB‑irradiated vehicle group and a UVB‑irradiated SME group. The UVB‑irradiated mice in the SME group were orally administered with SME (100 mg/kg body weight in 0.1 ml water per day) and then exposed to radiation at a dose of 60‑120 mJ/cm2. Wrinkle formation and skin damage were evaluated by analysis of skin replicas, epidermal thickness and collagen fiber integrity in the dermal connective tissue. The mechanism underlying the action of SME was also investigated in the human HaCaT keratinocyte cell line following exposure of the cells to UVB at a dose of 30 mJ/cm2. The protein expression levels and activity of matrix metalloproteinase‑1 (MMP‑1), and the binding of activator protein‑1 (AP‑1) to the MMP‑1 promoter were assessed in the HaCaT cells using western blot analysis, an MMP‑1 fluorescent assay and a chromatin immune‑precipitation assay, respectively. The results showed that the mean length and depth of the wrinkles in the UVB‑exposed hairless mice were significantly improved by oral administration of SME, which also prevented the increase in epidermal thickness triggered by UVB irradiation. Furthermore, a marked increase in collagen bundle formation was observed in the UVB‑treated mice with SME administration. SME pretreatment also significantly inhibited the UVB‑induced upregulation in the expression and activity of MMP‑1 in the cultured HaCaT keratinocytes, and the UVB‑enhanced association of AP‑1 with the MMP‑1 promoter. These results suggested that SME may be useful as an anti-photoaging resource for the skin.

  11. Comparative Cytotoxicity of Glycyrrhiza glabra Roots from Different Geographical Origins Against Immortal Human Keratinocyte (HaCaT), Lung Adenocarcinoma (A549) and Liver Carcinoma (HepG2) Cells.

    Science.gov (United States)

    Basar, Norazah; Oridupa, Olayinka Ayotunde; Ritchie, Kenneth J; Nahar, Lutfun; Osman, Nashwa Mostafa M; Stafford, Angela; Kushiev, Habibjon; Kan, Asuman; Sarker, Satyajit D

    2015-06-01

    Glycyrrhiza glabra L. (Fabaceae), commonly known as 'liquorice', is a well-known medicinal plant. Roots of this plant have long been used as a sweetening and flavouring agent in food and pharmaceutical products, and also as a traditional remedy for cough, upper and lower respiratory ailments, kidney stones, hepatitis C, skin disorder, cardiovascular diseases, diabetes, gastrointestinal ulcers and stomach ache. Previous pharmacological and clinical studies have revealed its antitussive, antiinflammatory, antiviral, antimicrobial, antioxidant, immunomodulatory, hepatoprotective and cardioprotective properties. While glycyrrhizin, a sweet-tasting triterpene saponin, is the principal bioactive compound, several bioactive flavonoids and isoflavonoids are also present in the roots of this plant. In the present study, the cytotoxicity of the methanol extracts of nine samples of the roots of G. glabra, collected from various geographical origins, was assessed against immortal human keratinocyte (HaCaT), lung adenocarcinoma (A549) and liver carcinoma (HepG2) cell lines using the in vitro 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazoliumbromide cell toxicity/viability assay. Considerable variations in levels of cytotoxicity were observed among various samples of G. glabra.

  12. Papain Degrades Tight Junction Proteins of Human Keratinocytes In Vitro and Sensitizes C57BL/6 Mice via the Skin Independent of its Enzymatic Activity or TLR4 Activation.

    Science.gov (United States)

    Stremnitzer, Caroline; Manzano-Szalai, Krisztina; Willensdorfer, Anna; Starkl, Philipp; Pieper, Mario; König, Peter; Mildner, Michael; Tschachler, Erwin; Reichart, Ursula; Jensen-Jarolim, Erika

    2015-07-01

    Papain is commonly used in food, pharmaceutical, textile, and cosmetic industries and is known to induce occupational allergic asthma. We have previously shown that the papain-like cysteine protease Dermatophagoides pteronyssinus 1 from house dust mite exhibits percutaneous sensitization potential. We aimed here to investigate the potential of papain itself in epicutaneous sensitization. The effects of papain on tight junction (TJ) proteins were tested in vitro in human primary keratinocytes. Using C57BL/6 wild-type and Toll-like receptor 4 (TLR4)-deficient mice, we analyzed the sensitization potential of papain, its effects on the skin barrier, and immune cell recruitment. Our results show that papain affects the skin barrier by increasing transepidermal water loss, degrading TJ proteins and inducing vasodilation. When topically applied, papain exhibited a high epicutaneous inflammatory potential by recruiting neutrophils, mast cells, and CD3-positive cells and by induction of a TH2-biased antibody response. However, its high potency for specific sensitization via the skin was TLR4 independent and, in spite of its capacity to degrade epidermal TJ proteins, does not rely on its enzymatic function. From our data, we conclude that papain has all features to act as a strong allergen via the skin.

  13. Effect of ultraviolet on cytokine secretion in human keratinocyte cell line HaCaT%紫外线照射对皮肤细胞因子分泌功能的影响

    Institute of Scientific and Technical Information of China (English)

    周春蕾; 顾军

    2004-01-01

    AIM:To observe the effect of ultraviolet(UV) on cytokine secretion in human keratinocyte HaCaT cell line in both normal condition and after stimulation with PMA and LPS. METHODS:The expression of IL 1α ,IL 2,IL 6 and IL 8 was detected by enzyme linked immunosorbent assay(ELISA). RESULTS:Normal HaCaT cells secreted IL 1α ,IL 2,IL 6 and IL 8 spontaneously.Stimulation by PMA and LPS induced increase in IL 6 and IL 8 production(P0.05), IL 8分泌量升高( P< 0.05). PMA和 LPS刺激的 HaCaT细胞经 UV照射,其 IL 1α ,IL 6和 IL 8的分泌量明显增加( P< 0.01). 结论: UV对不同状态下 HaCaT细胞的作用是不同的.

  14. Editorial: Technology for higher education, adult learning and human performance

    Directory of Open Access Journals (Sweden)

    Minhong Wang

    2013-09-01

    Full Text Available This special issue is dedicated to technology-enabled approaches for improving higher education, adult learning, and human performance. Improvement of learning and human development for sustainable development has been recognized as a key strategy for individuals, institutions, and organizations to strengthen their competitive advantages. It becomes crucial to help adult learners and knowledge workers to improve their self-directed and life-long learning capabilities. Meanwhile, advances in technology have been increasingly enabling and facilitating learning and knowledge-related initiatives.. They have largely extended learning opportunities through the provision of resource-rich and learner-centered environment, computer-based learning support, and expanded social interactions and networks. Papers in this special issue are representative of ongoing research on integration of technology with learning for innovation and sustainable development in higher education institutions and organizational and community environments.

  15. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Katherine J Zappia

    Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.

  16. Keratinocyte Apoptosis is Decreased in Psoriatic Epidermis

    Directory of Open Access Journals (Sweden)

    Fatma Eskioğlu

    2009-12-01

    Full Text Available Background and Design: Abnormal differentiation and hyperproliferation of keratinocytes are the hallmarks of psoriasis vulgaris. Although psoriasis vulgaris is generally accepted as a disease of decreased keratinocyte apoptosis, the results are contradictory. The aim of the current study is to investigate whether decreased keratinocyte apoptosis contributes to the formation of a thickened epidermis as increased keratinocyte proliferation. Material and Method: Forty-three untreated psoriasis vulgaris patients and 20 healthy control subjects were included into the study. Biopsy specimens taken from the enrollee were evaluated by immunohistochemical staining for Ki-67 expressions to show the proliferation of keratinocytes and by the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling (TUNEL method to show the apoptotic keratinocytes. Results: Apoptotic index (percentage of the TUNEL positive cells was significantly lower in psoriatic epidermis (0.33±0.64 than in normal epidermis (0.75±0.85; whereas Ki-67 index (percentage of positively staining cells for Ki-67 was significantly higher in psoriatic epidermis (30.86±10.49 than in normal epidermis (11.65±2.98, (p=0.021 and p=0.00; respectively. Conclusion: Decreased keratinocyte apoptosis also contribute to increased epidermal thickness in psoriasis as well as increased keratinocyte proliferation.

  17. Effect of p53 Inhibitor-α on Adriamycin Induced Apoptosis of Cultured Human Skin Keratinocytes in Vitro%p53抑制剂PFT-α对阿霉素诱导的人皮肤角质形成细胞凋亡的影响

    Institute of Scientific and Technical Information of China (English)

    张兴洪; 刘彦群; 魏志平; 田美华

    2011-01-01

    Objective To investigate the effect of p53 inhibitor-α (PFT-α) on adriamycin induced apoptosis of cultured human skin keratinocytes in vitro.Methods Human skin keratinocytes were cultured with 0, 4, 8, 12 mg/L PFT-α and adriamycin.Cell proliferation was detected by colorimetric assay of MTT.The optical density (OD) values were read on a scanning multiwell spectrophotometer (ELISA reader).Apoptosis rate of human skin keratinocytes was detected by flow cytometry.Results The proliferation of human skin keratinocytes was inhibited by adriamycin.If cells were pre-incubated with 8, 12mg/L PFT-α, OD value was significant higher and apoptosis induced by adriamycin was suppressed compared with control group (P <0.05).Conclusion This study suggested that PFT-α could partially inhibit adriamycin induced apoptosis of cultured human skin keratinocytes.%目的 探讨p53抑制剂PFT-α对阿霉素诱导的人皮肤角质形成细胞凋亡的影响.方法 用MTT法通过比色分析测定吸光度(OD)值,检测0,4,8,12mg/L PFT-α和阿霉素给药对角质形成细胞增殖的影响,用流式细胞仪检测细胞凋亡.结果 阿霉素抑制体外培养的人皮肤角质形成细胞增殖,先给予8,12mg/L PFT-α处理细胞,然后给予阿霉素,与对照组比较,PFT-α升高OD值(P<0.05),降低细胞凋亡率(P<0.05).结论 先行给予适当剂量PFT-α处理人皮肤角质形成细胞,能一定程度减轻阿霉素对人皮肤角质形成细胞的损伤,表现出对阿霉素致凋亡的保护作用.

  18. Effect of Antisense p53 Oligodeoxynucleotides on Adriamycin Inducing Apoptosis of Cultured Human Skin Keratinocytes in Vitro%反义p53寡核苷酸对阿霉素诱导的培养人皮肤角质形成细胞凋亡的影响

    Institute of Scientific and Technical Information of China (English)

    张兴洪; 刘彦群; 田美华

    2011-01-01

    Objective To investigate the effect of antisense p53 oligodeoxynucleotides (ODN) on adriamycin inducing apoptosis of cultured human skin keratinocytes in vitro. Methods Human skin keratinocytes were cultured with 2mg/L adriamycin and transfected with 0.5mg/L antisense p53 ODN and different concentrations of liposome. Cell proliferation was detected by colorimetric assay of MTT. Then the optical density values were measured on a scanning multiwell spectrophotometer (ELISA reader). The mRNA of p53 was also observed by RT-PCR after transfection with antisense p53 ODN. Apoptosis rate of human skin keratinocytes was detected by flow cytometry. Results We found that the proliferation of human skin keratinocytes was inhibited by adriamycin. If cells were incubated with 0.5mg/L antisense p53 ODN and 5mg/L or 10mg/L liposome, p53 mRNA decreased. A value was significantly higher and apoptosis induced by adriamycin was suppressed (P<0.05). Conclusion This study suggests that antisense p53 ODN could partially inhibit adriamycin inducing apoptosis of cultured human skin keratinocytes.%目的 探讨反义p53寡核苷酸(ODN)对阿霉素诱导的培养人皮肤角质形成细胞凋亡的影响.方法 用MTT法检测不同浓度脂质体和0.5mg/L反义p53 ODN转染角质形成细胞后对2mg/L阿霉素抑制细胞增殖的影响;RT-PCR方法 测定p53 mRNA水平的变化;用流式细胞仪检测细胞凋亡.结果 阿霉素抑制体外培养的人皮肤角质形成细胞增殖,5mg/L、10mg/L的脂质体和0.5mg/L反义p53ODN转染细胞后,p53mRNA水平下降(P<0.05),细胞增殖能力增强(P<0.05),凋亡率降低(P<0.05).结论 给予适当剂量反义p53 ODN转染人皮肤角质形成细胞,能一定程度减轻阿霉素对细胞的损伤,表现出对阿霉素致凋亡的保护作用.

  19. The nutrition intervention improved adult human capital and economic productivity.

    Science.gov (United States)

    Martorell, Reynaldo; Melgar, Paul; Maluccio, John A; Stein, Aryeh D; Rivera, Juan A

    2010-02-01

    This article reviews key findings about the long-term impact of a nutrition intervention carried out by the Institute of Nutrition of Central America and Panama from 1969 to 1977. Results from follow-up studies in 1988-89 and 2002-04 show substantial impact on adult human capital and economic productivity. The 1988-89 study showed that adult body size and work capacity increased for those provided improved nutrition through age 3 y, whereas the 2002-04 follow-up showed that schooling was increased for women and reading comprehension and intelligence increased in both men and women. Participants were 26-42 y of age at the time of the 2002-04 follow-up, facilitating the assessment of economic productivity. Wages of men increased by 46% in those provided with improved nutrition through age 2 y. Findings for cardiovascular disease risk factors were heterogeneous; however, they suggest that improved nutrition in early life is unlikely to increase cardiovascular disease risk later in life and may indeed lower risk. In conclusion, the substantial improvement in adult human capital and economic productivity resulting from the nutrition intervention provides a powerful argument for promoting improvements in nutrition in pregnant women and young children.

  20. In vitro proliferation of adult human beta-cells.

    Directory of Open Access Journals (Sweden)

    Sabine Rutti

    Full Text Available A decrease in functional beta-cell mass is a key feature of type 2 diabetes. Glucagon-like peptide 1 (GLP-1 analogues induce proliferation of rodent beta-cells. However, the proliferative capacity of human beta-cells and its modulation by GLP-1 analogues remain to be fully investigated. We therefore sought to quantify adult human beta-cell proliferation in vitro and whether this is affected by the GLP-1 analogue liraglutide.Human islets from 7 adult cadaveric organ donors were dispersed into single cells. Beta-cells were purified by FACS. Non-sorted cells and the beta-cell enriched ("beta-cells" population were plated on extracellular matrix from rat (804G and human bladder carcinoma cells (HTB9 or bovine corneal endothelial ECM (BCEC. Cells were maintained in culture+/-liraglutide for 4 days in the presence of BrdU.Rare human beta-cell proliferation could be observed either in the purified beta-cell population (0.051±0.020%; 22 beta-cells proliferating out of 84'283 beta-cells counted or in the non-sorted cell population (0.055±0.011%; 104 proliferating beta-cells out of 232'826 beta-cells counted, independently of the matrix or the culture conditions. Liraglutide increased human beta-cell proliferation on BCEC in the non-sorted cell population (0.082±0.034% proliferating beta-cells vs. 0.017±0.008% in control, p<0.05.These results indicate that adult human beta-cell proliferation can occur in vitro but remains an extremely rare event with these donors and particular culture conditions. Liraglutide increases beta-cell proliferation only in the non-sorted cell population and only on BCEC. However, it cannot be excluded that human beta-cells may proliferate to a greater extent in situ in response to natural stimuli.

  1. EFFECTS OF ARSENITE IN TELOMERE AND TELOMERASE IN RELATION TO CELL PROLIFERATION AND APOPTOSIS IN HUMAN KERATINOCYTES AND LEUKEMIA CELLS IN VITRO

    Science.gov (United States)

    Telomeres are critical in maintaining chromosome and genomic stability. Arsenic, a human carcinogen as well as an anticancer agent, is known for its clastogenicity. To better understand molecular mechanisms of arsenic actions, we investigated arsenite effects on telomere and telo...

  2. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (γ-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK).

    Science.gov (United States)

    Kleszczyński, Konrad; Zillikens, Detlef; Fischer, Tobias W

    2016-09-01

    Melatonin is an ubiquitous molecule with a variety of functions including potent antioxidative properties. Due to its lipophilic character, it easily crosses cellular and intracellular membranes and reaches all subcellular organelles. Because of its ability to scavenge free radicals, melatonin protects against oxidative stress, for example, induced by ultraviolet radiation (UVR). Here, we investigated, in a dose-dependent (0, 10, 25, and 50 mJ/cm(2) ) and time-dependent (0, 4, 24, 48 hr post-UVR) manner, whether melatonin prevents the UVR-mediated alterations in ATP synthesis and the generation of reactive oxygen species (ROS) in normal human epidermal keratinocytes (NHEK). Additionally, we evaluated the molecular mechanism of action of melatonin with regard to activation of phase-2 antioxidative enzymes via nuclear erythroid 2-related factor (Nrf2). We found that (i) melatonin counteracted UVR-induced alterations in the ATP synthesis and reduced free radical formation; (ii) melatonin induced the translocation of Nrf2 transcription factor from the cytosol into the nucleus resulting in, (iii) melatonin enhanced gene expression of phase-2 antioxidative enzymes including γ-glutamylcysteine synthetase (γ-GCS), heme oxygenase-1 (HO-1), and NADPH: quinone dehydrogenase-1 (NQO1) representing an elevated antioxidative response of keratinocytes. These results suggest that melatonin not only directly scavenges ROS, but also significantly induces the activation of phase-2 antioxidative enzymes via the Nrf2 pathway uncovering a new action mechanism that supports the ability of keratinocytes to protect themselves from UVR-mediated oxidative stress.

  3. Specificity in stress response: epidermal keratinocytes exhibit specialized UV-responsive signal transduction pathways.

    Science.gov (United States)

    Adachi, Makoto; Gazel, Alix; Pintucci, Giuseppe; Shuck, Alyssa; Shifteh, Shiva; Ginsburg, Dov; Rao, Laxmi S; Kaneko, Takehiko; Freedberg, Irwin M; Tamaki, Kunihiko; Blumenberg, Miroslav

    2003-10-01

    UV light, a paradigmatic initiator of cell stress, invokes responses that include signal transduction, activation of transcription factors, and changes in gene expression. Consequently, in epidermal keratinocytes, its principal and frequent natural target, UV regulates transcription of a distinctive set of genes. Hypothesizing that UV activates distinctive epidermal signal transduction pathways, we compared the UV-responsive activation of the JNK and NFkappaB pathways in keratinocytes, with the activation of the same pathways by other agents and in other cell types. Using of inhibitors and antisense oligonucleotides, we found that in keratinocytes only UVB/UVC activate JNK, while in other cell types UVA, heat shock, and oxidative stress do as well. Keratinocytes express JNK-1 and JNK-3, which is unexpected because JNK-3 expression is considered brain-specific. In keratinocytes, ERK1, ERK2, and p38 are activated by growth factors, but not by UV. UVB/UVC in keratinocytes activates Elk1 and AP1 exclusively through the JNK pathway. JNKK1 is essential for UVB/UVC activation of JNK in keratinocytes in vitro and in human skin in vivo. In contrast, in HeLa cells, used as a control, crosstalk among signal transduction pathways allows considerable laxity. In parallel, UVB/UVC and TNFalpha activate the NFkappaB pathway via distinct mechanisms, as shown using antisense oligonucleotides targeted against IKKbeta, the active subunit of IKK. This implies a specific UVB/UVC responsive signal transduction pathway independent from other pathways. Our results suggest that in epidermal keratinocytes specific signal transduction pathways respond to UV light. Based on these findings, we propose that the UV light is not a genetic stress response inducer in these cells, but a specific agent to which epidermis developed highly specialized responses.

  4. Vitamin D signaling regulates oral keratinocyte proliferation in vitro and in vivo.

    Science.gov (United States)

    Yuan, Feng-Ning F; Valiyaparambil, Jayasanker; Woods, Michael C; Tran, Huy; Pant, Rima; Adams, John S; Mallya, Sanjay M

    2014-05-01

    The secosteroidal hormone 1,25-dihyroxyvitamin D [1,25(OH)(2)D(3)] and its receptor, the vitamin D receptor (VDR), are crucial regulators of epidermal proliferation and differentiation. However, the effects of 1,25(OH)(2)D(3)-directed signaling on oral keratinocyte pathophysiology have not been well studied. We examined the role of 1,25(OH)(2)D(3) in regulating proliferation and differentiation in cultured oral keratinocytes and on the oral epithelium in vivo. Using lentiviral-mediated shRNA to silence VDR, we generated an oral keratinocyte cell line with stable knockdown of VDR expression. VDR knockdown significantly enhanced proliferation and disrupted calcium- and 1,25(OH)(2)D(3)-induced oral keratinocyte differentiation, emphasizing the anti-proliferative and pro-differentiation effects of 1,25(OH)(2)D(3) in oral keratinocytes. Using vitamin D(3)-deficient diets, we induced chronic vitamin D deficiency in mice as evidenced by decreased serum 25-hydroxyvitamin D (25OHD) concentrations. The vitamin D-deficient mice manifested increased proliferation of the tongue epithelium, but did not develop any morphological or histological abnormalities in the oral epithelium, suggesting that vitamin D deficiency alone is insufficient to alter oral epithelial homeostasis and provoke carcinogenesis. Immunohistochemical analyses of human and murine oral squamous cell carcinomas showed increased VDR expression. Overall, our results provide strong support for a crucial role for vitamin D signaling in oral keratinocyte pathophysiology.

  5. CCM2 expression during prenatal development and adult human neocortex.

    Science.gov (United States)

    Tanriover, Gamze; Sozen, Berna; Gunel, Murat; Demir, Necdet

    2011-08-01

    Cerebral cavernous malformation (CCM) is one of the most common types of vascular malformations of the central nervous system, affecting nearly one in 200 people. CCM lesions are characterized by grossly dilated vascular channels lined by a single layer of endothelium. Genetic linkage analyses have mapped three CCM loci to CCM1, CCM2 and CCM3. All three causative genes have now been identified allowing new insights into CCM pathophysiology. We focused on the CCM2 protein that might take place in blood vessel formation; we report here the expression patterns of CCM2 in prenatal development and adult human neocortex by means of immunohistochemistry and Western blot analysis. CCM2 was obviously detected in vascular endothelium and neuroglial precursor cells during development and also observed in arterial endothelium, neurons, some of the glial cells in adult neocortex. The expression patterns suggest that it could be one of the arterial markers whether this is a cause or a consequence of an altered vascular identity. CCM2 might play a role during vasculogenesis and angiogenesis during human brain development. Furthermore, with this study, CCM2 have been described for the first time in developing human neocortex.

  6. Z-ligustilide ameliorated ultraviolet B-induced oxidative stress and inflammatory cytokine production in human keratinocytes through upregulation of Nrf2/HO-1 and suppression of NF-κB pathway.

    Science.gov (United States)

    Wu, Zhouwei; Uchi, Hiroshi; Morino-Koga, Saori; Shi, Weimin; Furue, Masutaka

    2015-09-01

    Ultraviolet B (UVB), a harmful environmental factor, is responsible for a variety of skin disorders including skin inflammation through reactive oxygen species (ROS) and inflammatory mediator production. Here, we investigated the effect of Z-ligustilide (Z-lig), an active ingredient isolated from the medicinal plants Cnidium officinale and Angelica acutiloba, on UVB-induced ROS generation and inflammatory mediator production in normal human epidermal keratinocytes (NHEKs) as well as its underlying mechanisms. Z-lig significantly rescued UVB-induced NHEKs damage in a dosage-dependent manner. Pretreatment of NHEKs with Z-lig inhibited UVB-induced ROS production in NHEKs. Both silencing the nuclear factor E2-related factor 2 (Nrf2) and the supplement of tin protoporphyrin IX (SnPP), a haeme oxygenase-1 (HO-1) inhibitor, cancelled the inhibitory effect of Z-lig on UVB-induced ROS upregulation in NHEKs. Moreover, pretreatment of NHEKs with Z-lig reduced UVB-induced nuclear factor kappa B (NF-κB)-dependent inflammatory mediators (IL-6, IL-8 and MCP-1) production at both mRNA and protein level. In the presence of Z-lig, UVB-induced NF-κB subunit p65 nuclear translocation was abolished, and the IκBα degradation was suppressed. Taken together, these findings suggest that Z-lig can suppress UVB-induced ROS generation through Nrf2/HO-1 upregulation and inflammation by suppressing the NF-κB pathway, suggesting that Z-lig may be beneficial in protecting skin from UVB exposure.

  7. Fisetin inhibits TNF-α-induced inflammatory action and hydrogen peroxide-induced oxidative damage in human keratinocyte HaCaT cells through PI3K/AKT/Nrf-2-mediated heme oxygenase-1 expression.

    Science.gov (United States)

    Seo, Seung-Hee; Jeong, Gil-Saeng

    2015-12-01

    Oxidative skin damage and skin inflammation play key roles in the pathogenesis of skin-related diseases. Fisetin is a naturally occurring flavonoid abundantly found in several vegetables and fruits. Fisetin has been shown to exert various positive biological effects, such as anti-cancer, anti-proliferative, neuroprotective and anti-oxidative effects. In this study, we investigate the skin protective effects and anti-inflammatory properties of fisetin in hydrogen peroxide- and TNF-α-challenged human keratinocyte HaCaT cells. When HaCaT cells were treated with non-cytotoxic concentrations of fisetin (1-20μM), heme oxygenase (HO)-1 mRNA and protein expression increased in a dose-dependent manner. Furthermore, fisetin dose-dependently increased cell viability and reduced ROS production in hydrogen peroxide-treated HaCaT cells. Fisetin also inhibited the production of NO, PGE2 IL-1β, IL-6, expression of iNOS and COX-2, and activation of NF-κB in HaCaT cells treated with TNF-α. Fisetin induced Nrf2 translocation to the nuclei. HO-1 siRNA transient transfection reversed the effects of fisetin on cytoprotection, ROS reduction, NO, PGE2, IL-1β, IL-6, and TNF-α production, and NF-κB DNA-binding activity. Moreover, fisetin increased Akt phosphorylation and a PI3K pathway inhibitor (LY294002) abolished fisetin-induced cytoprotection and NO inhibition. Taken together, these results provide evidence for a beneficial role of fisetin in skin therapy.

  8. Ontogeny of morningness-eveningness across the adult human lifespan

    Science.gov (United States)

    Randler, Christoph

    2016-02-01

    Sleep timing of humans can be classified alongside a continuum from early to late sleepers, with some people (larks) having an early activity, early bed, and rise times and others (owls) with a more nocturnally orientated activity. Only a few studies reported that morningness-eveningness changes significantly during the adult lifespan based on community samples. Here, I applied a different methodological approach to seek for evidence for the age-related changes in morningness-eveningness preferences by using a meta-data from all available studies. The new aspect of this cross-sectional approach is that only a few studies themselves address the age-related changes of the adult lifespan development, but that many studies are available that provide exactly the data needed. The studies came from 27 countries and included 36,939 participants. Age was highly significantly correlated with scores on the Composite Scale of Morningness ( r = 0.70). This relationship seems linear, because a linear regression explained nearly the same amount of variance compared to other models such as logarithmic, quadratic, or cubic models. The standard deviation of age correlated with the standard deviation of CSM scores ( r = 0.55), suggesting when there is much variance in age in a study; in turn, there is much variance in morningness. This meta-analytical approach shows that morningness-eveningness changes across the adult lifespan and that older age is related to higher morningness.

  9. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  10. Salivary trefoil factor 3 enhances migration of oral keratinocytes.

    Science.gov (United States)

    Storesund, Trond; Hayashi, Katsuhiko; Kolltveit, Kristin M; Bryne, Magne; Schenck, Karl

    2008-04-01

    Trefoil factor 3 (TFF3) is a member of the mammalian TFF family. Trefoil factors are secreted onto mucosal surfaces of the entire body and exert different effects according to tissue location. Trefoil factors may enhance mucosal healing by modulating motogenic activity, inhibiting apoptosis, and promoting angiogenesis. Trefoil factor 3 is secreted from the submandibular gland and is present in whole saliva. The aim of this study was to assess the migratory and proliferative effects of TFF3 on primary oral human keratinocytes and oral cancer cell lines. The addition of TFF3 increased the migration of both normal oral keratinocytes and the cancer cell line D12, as evaluated by a two-dimensional scratch assay. By contrast, no increase in proliferation or energy metabolism was observed after stimulation with TFF3. Trefoil factor 3-enhanced migration was found to be driven partly by the extracellular signal-related kinase (Erk1/2) pathway, as shown by addition of the mitogen-activated protein kinase (MAPK) inhibitor PD 98059. Previous functional studies on trefoil peptides have all been based on cells from monolayered epithelium like the intestinal mucosa; this is the first report to show that normal and cancerous keratinocytes from stratified epithelium respond to TFF stimuli. Taken together, salivary TFF3 is likely to contribute to oral wound healing.

  11. Inhibition of JNK promotes differentiation of epidermal keratinocytes.

    Science.gov (United States)

    Gazel, Alix; Banno, Tomohiro; Walsh, Rebecca; Blumenberg, Miroslav

    2006-07-21

    In inflamed tissue, normal signal transduction pathways are altered by extracellular signals. For example, the JNK pathway is activated in psoriatic skin, which makes it an attractive target for treatment. To define comprehensively the JNK-regulated genes in human epidermal keratinocytes, we compared the transcriptional profiles of control and JNK inhibitor-treated keratinocytes, using DNA microarrays. We identified the differentially expressed genes 1, 4, 24, and 48 h after the treatment with SP600125. Surprisingly, the inhibition of JNK in keratinocyte cultures in vitro induces virtually all aspects of epidermal differentiation in vivo: transcription of cornification markers, inhibition of motility, withdrawal from the cell cycle, stratification, and even production of cornified envelopes. The inhibition of JNK also induces the production of enzymes of lipid and steroid metabolism, proteins of the diacylglycerol and inositol phosphate pathways, mitochondrial proteins, histones, and DNA repair enzymes, which have not been associated with differentiation previously. Simultaneously, basal cell markers, including integrins, hemidesmosome and extracellular matrix components, are suppressed. Promoter analysis of regulated genes finds that the binding sites for the forkhead family of transcription factors are over-represented in the SP600125-induced genes and c-Fos sites in the suppressed genes. The JNK-induced proliferation appears to be secondary to inhibition of differentiation. The results indicate that the inhibition of JNK in epidermal keratinocytes is sufficient to initiate their differentiation program and suggest that augmenting JNK activity could be used to delay cornification and enhance wound healing, whereas attenuating it could be a differentiation therapy-based approach for treating psoriasis.

  12. A Model to Predict the Risk of Keratinocyte Carcinomas.

    Science.gov (United States)

    Whiteman, David C; Thompson, Bridie S; Thrift, Aaron P; Hughes, Maria-Celia; Muranushi, Chiho; Neale, Rachel E; Green, Adele C; Olsen, Catherine M

    2016-06-01

    Basal cell and squamous cell carcinomas of the skin are the commonest cancers in humans, yet no validated tools exist to estimate future risks of developing keratinocyte carcinomas. To develop a prediction tool, we used baseline data from a prospective cohort study (n = 38,726) in Queensland, Australia, and used data linkage to capture all surgically excised keratinocyte carcinomas arising within the cohort. Predictive factors were identified through stepwise logistic regression models. In secondary analyses, we derived separate models within strata of prior skin cancer history, age, and sex. The primary model included terms for 10 items. Factors with the strongest effects were >20 prior skin cancers excised (odds ratio 8.57, 95% confidence interval [95% CI] 6.73-10.91), >50 skin lesions destroyed (odds ratio 3.37, 95% CI 2.85-3.99), age ≥ 70 years (odds ratio 3.47, 95% CI 2.53-4.77), and fair skin color (odds ratio 1.75, 95% CI 1.42-2.15). Discrimination in the validation dataset was high (area under the receiver operator characteristic curve 0.80, 95% CI 0.79-0.81) and the model appeared well calibrated. Among those reporting no prior history of skin cancer, a similar model with 10 factors predicted keratinocyte carcinoma events with reasonable discrimination (area under the receiver operator characteristic curve 0.72, 95% CI 0.70-0.75). Algorithms using self-reported patient data have high accuracy for predicting risks of keratinocyte carcinomas.

  13. Pomegranate fruit extract modulates UV-B-mediated phosphorylation of mitogen-activated protein kinases and activation of nuclear factor kappa B in normal human epidermal keratinocytes paragraph sign.

    Science.gov (United States)

    Afaq, Farrukh; Malik, Arshi; Syed, Deeba; Maes, Daniel; Matsui, Mary S; Mukhtar, Hasan

    2005-01-01

    Excessive exposure of solar ultraviolet (UV) radiation, particularly its UV-B component, to humans causes many adverse effects that include erythema, hyperplasia, hyperpigmentation, immunosuppression, photoaging and skin cancer. In recent years, there is increasing use of botanical agents in skin care products. Pomegranate derived from the tree Punica granatum contains anthocyanins (such as delphinidin, cyanidin and pelargonidin) and hydrolyzable tannins (such as punicalin, pedunculagin, punicalagin, gallagic and ellagic acid esters of glucose) and possesses strong antioxidant and anti-inflammatory properties. Recently, we have shown that pomegranate fruit extract (PFE) possesses antitumor promoting effects in a mouse model of chemical carcinogenesis. To begin to establish the effect of PFE for humans in this study, we determined its effect on UV-B-induced adverse effects in normal human epidermal keratinocytes (NHEK). We first assessed the effect of PFE on UV-B-mediated phosphorylation of mitogen-activated protein kinases (MAPK) pathway in NHEK. Immunoblot analysis demonstrated that the treatment of NHEK with PFE (10-40 microg/mL) for 24 h before UV-B (40 mJ/cm(2)) exposure dose dependently inhibited UV-B-mediated phosphorylation of ERKl/2, JNK1/2 and p38 protein. We also observed that PFE (20 microg/mL) inhibited UV-B-mediated phosphorylation of MAPK in a time-dependent manner. Furthermore, in dose- and time-dependent studies, we evaluated the effect of PFE on UV-B-mediated activation of nuclear factor kappa B (NF-kappaB) pathway. Using Western blot analysis, we found that PFE treatment of NHEK resulted in a dose- and time-dependent inhibition of UV-B-mediated degradation and phosphorylation of IkappaBalpha and activation of IKKalpha. Using immunoblot analysis, enzyme-linked immunosorbent assay and electrophoretic mobility shift assay, we found that PFE treatment to NHEK resulted in a dose- and time-dependent inhibition of UV-B-mediated nuclear translocation and

  14. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults

    DEFF Research Database (Denmark)

    Larsen, Nadja; Vogensen, Finn Kvist; van der Berg, Franciscus Winfried J

    2010-01-01

    Background Recent evidence suggests that there is a link between metabolic diseases and bacterial populations in the gut. The aim of this study was to assess the differences between the composition of the intestinal microbiota in humans with type 2 diabetes and non-diabetic persons as control....... Methods and Findings The study included 36 male adults with a broad range of age and body-mass indices (BMIs), among which 18 subjects were diagnosed with diabetes type 2. The fecal bacterial composition was investigated by real-time quantitative PCR (qPCR) and in a subgroup of subjects (N = 20) by tag...... = 0.04). Conclusions The results of this study indicate that type 2 diabetes in humans is associated with compositional changes in intestinal microbiota. The level of glucose tolerance should be considered when linking microbiota with metabolic diseases such as obesity and developing strategies...

  15. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin......, to metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed...

  16. Lactobacillus rhamnosus GG inhibits the toxic effects of Staphylococcus aureus on epidermal keratinocytes.

    Science.gov (United States)

    Mohammedsaeed, Walaa; McBain, Andrew J; Cruickshank, Sheena M; O'Neill, Catherine A

    2014-09-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 10(8) CFU/ml of live L. rhamnosus GG, the viability of the infected keratinocytes increased to 57% (P = 0.01). L. rhamnosus GG lysates and spent culture fluid also provided significant protection to keratinocytes, with 65% (P = 0.006) and 57% (P = 0.01) of cells, respectively, being viable following 24 h of incubation. Keratinocyte survival was significantly enhanced regardless of whether the probiotic was applied in the viable form or as cell lysates 2 h before or simultaneously with (P = 0.005) or 12 h after (P = 0.01) S. aureus infection. However, spent culture fluid was protective only if added before or simultaneously with S. aureus. With respect to mechanism, both L. rhamnosus GG lysate and spent culture fluid apparently inhibited adherence of S. aureus to keratinocytes by competitive exclusion, but only viable bacteria or the lysate could displace S. aureus (P = 0.04 and 0.01, respectively). Furthermore, growth of S. aureus was inhibited by either live bacteria or lysate but not spent culture fluid. Together, these data suggest at least two separate activities involved in the protective effects of L. rhamnosus GG against S. aureus, growth inhibition and reduction of bacterial adhesion.

  17. Leptin-deficiency in mice counteracts imiquimod (IMQ)-induced psoriasis-like skin inflammation while leptin stimulation induces inflammation in human keratinocytes

    DEFF Research Database (Denmark)

    Stjernholm, T; Ommen, P; Langkilde, A;

    2016-01-01

    Leptin is an adipocyte-derived cytokine secreted mostly by adipose tissue. Serum leptin levels are elevated in obese individuals and correlate positively with body mass index (BMI). Interestingly, serum leptin levels are also elevated in psoriasis patients and correlate positively with disease...... severity. Psoriasis is associated with obesity; psoriasis patients have a higher incidence of obesity and obese individuals have a higher risk of developing psoriasis. Additionally, obese psoriasis patients experience a more severe degree of psoriasis. In this study, we hypothesised that leptin may link...... psoriasis and obesity and plays an aggravating role in psoriasis. To investigate leptin's role in psoriasis, we applied the widely accepted imiquimod (IMQ) induced psoriasis-like skin inflammation mouse model on leptin-deficient (ob/ob) mice and evaluated psoriasis severity. Moreover, we stimulated human...

  18. Induction of dental epithelial cell differentiation marker gene expression in non-odontogenic human keratinocytes by transfection with thymosin beta 4

    Directory of Open Access Journals (Sweden)

    Tamotsu Kiyoshima

    2014-01-01

    Full Text Available Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported that thymosin beta 4 (Tmsb4x is closely related to the initiation and development of the tooth germ. We herein attempted to establish odontogenic epithelial cells from non-odontogenic HaCaT cells by transfection with TMSB4X. TMSB4X-transfected cells formed nodules that were positive for Alizarin-red S (ALZ and von Kossa staining (calcium phosphate deposits when cultured in calcification-inducing medium. Three selected clones showing larger amounts of calcium deposits than the other clones, expressed PITX2, Cytokeratin 14, and Sonic Hedgehog. The upregulation of odontogenesis-related genes, such as runt-related transcription factor 2 (RUNX2, Amelogenin (AMELX, Ameloblastin (AMBN and Enamelin (ENAM was also detected. These proteins were immunohistochemically observed in nodules positive for the ALZ and von Kossa staining. RUNX2-positive selected TMSB4X-transfected cells implanted into the dorsal subcutaneous tissue of nude mice formed matrix deposits. Immunohistochemically, AMELX, AMBN and ENAM were observed in the matrix deposits. This study demonstrated the possibility of induction of dental epithelial cell differentiation marker gene expression in non-odontogenic HaCaT cells by TMSB4X.

  19. Neuropeptide Y in the Adult and Fetal Human Pineal Gland

    Directory of Open Access Journals (Sweden)

    Morten Møller

    2014-01-01

    Full Text Available Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passage and primarily located in a perifollicular position with some fibers entering the pineal parenchyma inside the follicle. The distance from the immunoreactive terminals to the pinealocytes indicates a modulatory function of neuropeptide Y for pineal physiology. Some of the immunoreactive fibers might originate from neurons located in the brain and be a part of the central innervation of the pineal gland. In a series of human fetuses, neuropeptide Y-containing nerve fibers was present and could be detected as early as in the pineal of four- to five-month-old fetuses. This early innervation of the human pineal is different from most rodents, where the innervation starts postnatally.

  20. Neuropeptide Y in the adult and fetal human pineal gland.

    Science.gov (United States)

    Møller, Morten; Phansuwan-Pujito, Pansiri; Badiu, Corin

    2014-01-01

    Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passage and primarily located in a perifollicular position with some fibers entering the pineal parenchyma inside the follicle. The distance from the immunoreactive terminals to the pinealocytes indicates a modulatory function of neuropeptide Y for pineal physiology. Some of the immunoreactive fibers might originate from neurons located in the brain and be a part of the central innervation of the pineal gland. In a series of human fetuses, neuropeptide Y-containing nerve fibers was present and could be detected as early as in the pineal of four- to five-month-old fetuses. This early innervation of the human pineal is different from most rodents, where the innervation starts postnatally.

  1. Early reversal cells in adult human bone remodeling

    DEFF Research Database (Denmark)

    Abdelgawad, Mohamed Essameldin; Delaissé, Jean-Marie; Hinge, Maja

    2016-01-01

    . Earlier preclinical studies indicate that reversal cells degrade the organic matrix left behind by the osteoclasts and that this degradation is crucial for the initiation of the subsequent bone formation. To our knowledge, this study is the first addressing these catabolic activities in adult human bone...... through electron microscopy and analysis of molecular markers. Periosteoclastic reversal cells show direct contacts with the osteoclasts and with the demineralized resorption debris. These early reversal cells show (1) ¾-collagen fragments typically generated by extracellular collagenases of the MMP...... family, (2) MMP-13 (collagenase-3) and (3) the endocytic collagen receptor uPARAP/Endo180. The prevalence of these markers was lower in the later reversal cells, which are located near the osteoid surfaces and morphologically resemble mature bone-forming osteoblasts. In conclusion, this study...

  2. Low oxygen tension stimulates redifferentiation of dedifferentiated adult human nasal chondrocytes

    NARCIS (Netherlands)

    Malda, J.; Blitterswijk, van C.A.; Geffen, van M.; Martens, D.E.; Tramper, J.; Riesle, J.

    2004-01-01

    Objective: To determine the effect of dissolved oxygen tension (DO) on the redifferentiation of dedifferentiated adult human nasal septum chondrocytes cultured as pellets. Design: After isolation, human nasal chondrocytes were expanded in monolayer culture, which resulted in their dedifferentiation.

  3. Low oxygen tension stimulates the redifferentiation of dedifferentiated adult human nasal chondrocytes

    NARCIS (Netherlands)

    Malda, J.; Blitterswijk, van C.A.; Geffen, van M.; Martens, D.E.; Tramper, J.; Riesle, J.

    2004-01-01

    Objective: To determine the effect of dissolved oxygen tension (DO) on the redifferentiation of dedifferentiated adult human nasal septum chondrocytes cultured as pellets. - Design: After isolation, human nasal chondrocytes were expanded in monolayer culture, which resulted in their dedifferentiati

  4. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  5. Comprehensive cellular-resolution atlas of the adult human brain.

    Science.gov (United States)

    Ding, Song-Lin; Royall, Joshua J; Sunkin, Susan M; Ng, Lydia; Facer, Benjamin A C; Lesnar, Phil; Guillozet-Bongaarts, Angie; McMurray, Bergen; Szafer, Aaron; Dolbeare, Tim A; Stevens, Allison; Tirrell, Lee; Benner, Thomas; Caldejon, Shiella; Dalley, Rachel A; Dee, Nick; Lau, Christopher; Nyhus, Julie; Reding, Melissa; Riley, Zackery L; Sandman, David; Shen, Elaine; van der Kouwe, Andre; Varjabedian, Ani; Write, Michelle; Zollei, Lilla; Dang, Chinh; Knowles, James A; Koch, Christof; Phillips, John W; Sestan, Nenad; Wohnoutka, Paul; Zielke, H Ronald; Hohmann, John G; Jones, Allan R; Bernard, Amy; Hawrylycz, Michael J; Hof, Patrick R; Fischl, Bruce; Lein, Ed S

    2016-11-01

    Detailed anatomical understanding of the human brain is essential for unraveling its functional architecture, yet current reference atlases have major limitations such as lack of whole-brain coverage, relatively low image resolution, and sparse structural annotation. We present the first digital human brain atlas to incorporate neuroimaging, high-resolution histology, and chemoarchitecture across a complete adult female brain, consisting of magnetic resonance imaging (MRI), diffusion-weighted imaging (DWI), and 1,356 large-format cellular resolution (1 µm/pixel) Nissl and immunohistochemistry anatomical plates. The atlas is comprehensively annotated for 862 structures, including 117 white matter tracts and several novel cyto- and chemoarchitecturally defined structures, and these annotations were transferred onto the matching MRI dataset. Neocortical delineations were done for sulci, gyri, and modified Brodmann areas to link macroscopic anatomical and microscopic cytoarchitectural parcellations. Correlated neuroimaging and histological structural delineation allowed fine feature identification in MRI data and subsequent structural identification in MRI data from other brains. This interactive online digital atlas is integrated with existing Allen Institute for Brain Science gene expression atlases and is publicly accessible as a resource for the neuroscience community. J. Comp. Neurol. 524:3127-3481, 2016. © 2016 The Authors The Journal of Comparative Neurology Published by Wiley Periodicals, Inc.

  6. Adult human liver mesenchymal progenitor cells express phenylalanine hydroxylase.

    Science.gov (United States)

    Baruteau, Julien; Nyabi, Omar; Najimi, Mustapha; Fauvart, Maarten; Sokal, Etienne

    2014-09-01

    Phenylketonuria (PKU) is one of the most prevalent inherited metabolic diseases and is accountable for a severe encephalopathy by progressive intoxication of the brain by phenylalanine. This results from an ineffective L-phenylalanine hydroxylase enzyme (PAH) due to a mutated phenylalanine hydroxylase (PAH) gene. Neonatal screening programs allow an early dietetic treatment with restrictive phenylalanine intake. This diet prevents most of the neuropsychological disabilities but remains challenging for lifelong compliance. Adult-derived human liver progenitor cells (ADHLPC) are a pool of precursors that can differentiate into hepatocytes. We aim to study PAH expression and PAH activity in a differenciated ADHLPC. ADHLPC were isolated from human hepatocyte primary culture of two different donors and differenciated under specific culture conditions. We demonstrated the high expression of PAH and a large increase of PAH activity in differenciated LPC. The age of the donor, the cellular viability after liver digestion and cryopreservation affects PAH activity. ADHLPC might therefore be considered as a suitable source for cell therapy in PKU.

  7. Keratinocyte gene therapy for systemic diseases. Circulating interleukin 10 released from gene-transferred keratinocytes inhibits contact hypersensitivity at distant areas of the skin.

    Science.gov (United States)

    Meng, X; Sawamura, D; Tamai, K; Hanada, K; Ishida, H; Hashimoto, I

    1998-01-01

    This study has examined the systemic effects of a circulating gene product, human interleukin 10 (IL-10), released from transduced keratinocytes. IL-10 is an anti-inflammatory cytokine which has an inhibitory effect on contact hypersensitivity (CHS). An expression vector (phIL-10) was constructed for human IL-10 and was injected into the dorsal skin of hairless rats. Local expression of IL-10 mRNA and protein was detected by reverse-transcriptase polymerase chain reaction and immunohistochemical staining, respectively. Enzyme-linked immunosorbent assay showed that the amount of IL-10 in the local keratinocytes and in the circulation increased with the dose of phIL-10 transferred. To determine whether circulating IL-10 could inhibit the effector phase of CHS at a distant area of the skin, various doses of phIL-10 were injected into the dorsal skin of sensitized rats before challenge on the ears. Our results showed that the degree of swelling of the ears of phIL-10- treated rats was significantly lower than that in the negative control animals. These results suggest that IL-10 released from transduced keratinocytes can enter the bloodstream and cause biological effects at distant areas of the skin. This study demonstrates that it may be possible to treat systemic disease using keratinocyte gene therapy. PMID:9502789

  8. Effective inhibition of melanosome transfer to keratinocytes by lectins and niacinamide is reversible.

    Science.gov (United States)

    Greatens, Amanda; Hakozaki, Tomohiro; Koshoffer, Amy; Epstein, Howard; Schwemberger, Sandy; Babcock, George; Bissett, Donald; Takiwaki, Hirotsugu; Arase, Seiji; Wickett, R Randall; Boissy, Raymond E

    2005-07-01

    Skin pigmentation results in part from the transfer of melanized melanosomes synthesized by melanocytes to neighboring keratinocytes. Plasma membrane lectins and their glycoconjugates expressed by these epidermal cells are critical molecules involved in this transfer process. In addition, the derivative of vitamin B(3), niacinamide, can inhibit melanosome transfer and induce skin lightening. We investigated the effects of these molecules on the viability of melanocytes and keratinocytes and on the reversibility of melanosome-transfer inhibition induced by these agents using an in vitro melanocyte-keratinocyte coculture model system. While lectins and neoglycoproteins could induce apoptosis in a dose-dependent manner to melanocytes or keratinocytes in monoculture, similar dosages of the lectins, as opposed to neoglycoproteins, did not induce apoptosis to either cell type when treated in coculture. The dosages of lectins and niacinamide not affecting cell viability produced an inhibitory effect on melanosome transfer, when used either alone or together in cocultures of melanocytes-keratinocytes. Cocultures treated with lectins or niacinamide resumed normal melanosome transfer in 3 days after removal of the inhibitor, while cocultures treated with a combination of lectins and niacinamide demonstrated a lag in this recovery. Subsequently, we assessed the effect of niacinamide on facial hyperpigmented spots using a vehicle-controlled, split-faced design human clinical trial. Topical application of niacinamide resulted in a dose-dependent and reversible reduction in hyperpigmented lesions. These results suggest that lectins and niacinamide at concentrations that do not affect cell viability are reversible inhibitors of melanosome transfer.

  9. Production of superoxide anions by keratinocytes initiates P. acnes-induced inflammation of the skin.

    Directory of Open Access Journals (Sweden)

    Philippe A Grange

    2009-07-01

    Full Text Available Acne vulgaris is a chronic inflammatory disorder of the sebaceous follicles. Propionibacterium acnes (P. acnes, a gram-positive anareobic bacterium, plays a critical role in the development of these inflammatory lesions. This study aimed at determining whether reactive oxygen species (ROS are produced by keratinocytes upon P. acnes infection, dissecting the mechanism of this production, and investigating how this phenomenon integrates in the general inflammatory response induced by P. acnes. In our hands, ROS, and especially superoxide anions (O2(*-, were rapidly produced by keratinocytes upon stimulation by P. acnes surface proteins. In P. acnes-stimulated keratinocytes, O2(*- was produced by NAD(PH oxidase through activation of the scavenger receptor CD36. O2(*- was dismuted by superoxide dismutase to form hydrogen peroxide which was further detoxified into water by the GSH/GPx system. In addition, P. acnes-induced O2(*- abrogated P. acnes growth and was involved in keratinocyte lysis through the combination of O2(*- with nitric oxide to form peroxynitrites. Finally, retinoic acid derivates, the most efficient anti-acneic drugs, prevent O2(*- production, IL-8 release and keratinocyte apoptosis, suggesting the relevance of this pathway in humans.

  10. Keratinocyte differentiation and upregulation of ceramide synthesis induced by an oat lipid extract via the activation of PPAR pathways.

    Science.gov (United States)

    Chon, Su-Hyoun; Tannahill, Ruth; Yao, Xiang; Southall, Michael D; Pappas, Apostolos

    2015-04-01

    Activation of peroxisome proliferator-activated receptors (PPARs) has been shown to have an important role in skin barrier function by regulating differentiation and lipid synthesis in keratinocytes. Oat (Avena sativa) has long been used as a soothing agent to relieve skin irritations, and the clinical benefits of topical oat formulations have been proven; however, the mechanistic understanding of oat's mode of action remains unknown. We investigated whether an oat lipid extract could activate PPARs and subsequently increase epidermal lipid synthesis and differentiation markers. Primary human epidermal keratinocytes and transformed cell lines were treated with PPAR agonists and oat lipid extracts to investigate the PPAR agonism. PPAR target genes and epidermal differentiation markers were analysed using quantitative real-time PCR and HPTLC analysis. Oat lipid extract demonstrated robust dual agonism for PPARα and PPARβ/δ, and increased direct PPAR target gene induction in primary human keratinocytes. In addition, oat oil treatment increased both receptor expression and, consistent with the literature on PPARs, oat oil treatment resulted in a significant upregulation of differentiation genes (involucrin, SPRRs and transglutaminase 1) and ceramide processing genes (β-glucocerebrosidase, sphingomyelinases 3 and ABCA12). Further, oat oil treatment in keratinocytes significantly increased ceramide levels (70%), suggesting a functional translation of PPAR activation by oat oil in keratinocytes. Taken together, these results demonstrate that oat lipids possess robust dual agonistic activities for PPARα and PPARβ/δ, increase their gene expression and induce differentiation and ceramide synthesis in keratinocytes, which can collectively improve skin barrier function.

  11. MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation

    Energy Technology Data Exchange (ETDEWEB)

    Lena, A.M.; Mancini, M.; Rivetti di Val Cervo, P. [University of ' Tor Vergata' , Department of Experimental Medicine and Biochemical Sciences, Via Montpellier 1, Rome 00133 (Italy); Istituto Dermopatico dell' Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS), Laboratory of Biochemistry c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); Saintigny, G.; Mahe, C. [CHANEL Parfums Beaute, 135 av. Charles de Gaulle, F 92521, Neuilly/Seine (France); Melino, G., E-mail: gerry.melino@uniroma2.it [University of ' Tor Vergata' , Department of Experimental Medicine and Biochemical Sciences, Via Montpellier 1, Rome 00133 (Italy); Istituto Dermopatico dell' Immacolata-Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS), Laboratory of Biochemistry c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); Association Cell Death and Differentiation c/o Department of Experimental Medicine and Biochemical Sciences, University of Rome ' Tor Vergata' , Rome 00133 (Italy); and others

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer miR-191 expression is upregulated in senescencent human epidermal keratinocytes. Black-Right-Pointing-Pointer miR-191 overexpression is sufficient per se to induce senescence in keratinocytes. Black-Right-Pointing-Pointer SATB1 and CDK6 are downregulated in senescence and are direct miR-191 targets. Black-Right-Pointing-Pointer SATB1 and CDK6 silencing by siRNA triggers senescence in HEKn cells. -- Abstract: Keratinocyte replicative senescence has an important role in time-dependent changes of the epidermis, a tissue with high turnover. Senescence encompasses growth arrest during which cells remain metabolically active but acquire a typical enlarged, vacuolar and flattened morphology. It is also accompanied by the expression of endogenous senescence-associated-{beta}-galactosidase and specific gene expression profiles. MicroRNAs levels have been shown to be modulated during keratinocytes senescence, playing key roles in inhibiting proliferation and in the acquisition of senescent markers. Here, we identify miR-191 as an anti-proliferative and replicative senescence-associated miRNA in primary human keratinocytes. Its overexpression is sufficient per se to induce senescence, as evaluated by induction of several senescence-associated markers. We show that SATB1 and CDK6 3 Prime UTRs are two miR-191 direct targets involved in this pathway. Cdk6 and Satb1 protein levels decrease during keratinocytes replicative senescence and their silencing by siRNA is able to induce a G1 block in cell cycle, accompanied by an increase in senescence-associated markers.

  12. Activation of TLR3 in keratinocytes increases expression of genes involved in formation of the epidermis, lipid accumulation and epidermal organelles

    Science.gov (United States)

    Borkowski, Andrew W.; Park, Kyungho; Uchida, Yoshikazu; Gallo, Richard L.

    2013-01-01

    Injury to the skin, and the subsequent release of non-coding double-stranded RNA from necrotic keratinocytes, has been identified as an endogenous activator of Toll-like receptor 3 (TLR3). Since changes in keratinocyte growth and differentiation follow injury, we hypothesized that TLR3 might trigger some elements of the barrier repair program in keratinocytes. Double-stranded RNA was observed to induce TLR3-dependent increases in human keratinocyte mRNA abundance for ABCA12 (ATP-binding cassette, sub-family A, member 12), glucocerebrosidase, acid sphingomyelinase, and transglutaminase 1. Additionally, treatment with double-stranded RNA resulted in increases in sphingomyelin and morphologic changes including increased epidermal lipid staining by oil-red O and TLR3-dependent increases in lamellar bodies and keratohyalin granules. These observations show that double-stranded RNA can stimulate some events in keratinocytes that are important for skin barrier repair and maintenance. PMID:23353987

  13. Effects triggered by platinum nanoparticles on primary keratinocytes.

    Science.gov (United States)

    Konieczny, Piotr; Goralczyk, Anna Grazyna; Szmyd, Radoslaw; Skalniak, Lukasz; Koziel, Joanna; Filon, Francesca Larese; Crosera, Matteo; Cierniak, Agnieszka; Zuba-Surma, Ewa K; Borowczyk, Julia; Laczna, Eliza; Drukala, Justyna; Pyza, Elzbieta; Semik, Danuta; Woznicka, Olga; Klein, Andrzej; Jura, Jolanta

    2013-01-01

    The platinum (Pt)-group elements (PGEs) represent a new kind of environmental pollutant and a new hazard for human health. Since their introduction as vehicle-exhaust catalysts, their emissions into the environment have grown considerably compared with their low natural concentration in the earth crust. PGE emissions from vehicle catalysts can be also in the form of nanometer-sized particles (Pt nanoparticles [PtNPs]). These elements, both in their metallic form or as ions solubilized in biological media, are now recognized as potent allergens and sensitizers. Human skin is always exposed to toxic particles; therefore, in the present study we addressed the question of whether polyvinylpyrrolidone-coated PtNPs may have any negative effects on skin cells, including predominantly epidermal keratinocytes. In this study, PtNPs of two sizes were used: 5.8 nm and 57 nm, in concentrations of 6.25, 12.5, and 25 μg/mL. Both types of NPs were protected with polyvinylpyrrolidone. Primary keratinocytes were treated for 24 and 48 hours, then cytotoxicity, genotoxicity, morphology, metabolic activity, and changes in the activation of signaling pathways were investigated in PtNP-treated cells. We found that PtNPs trigger toxic effects on primary keratinocytes, decreasing cell metabolism, but these changes have no effects on cell viability or migration. Moreover, smaller NPs exhibited more deleterious effect on DNA stability than the big ones. Analyzing activation of caspases, we found changes in activity of caspase 9 and caspase 3/7 triggered mainly by smaller NPs. Changes were not so significant in the case of larger nanoparticles. Importantly, we found that PtNPs have antibacterial properties, as is the case with silver NPs (AgNPs). In comparison to our previous study regarding the effects of AgNPs on cell biology, we found that PtNPs do not exhibit such deleterious effects on primary keratinocytes as AgNPs and that they also can be used as potential antibacterial agents

  14. Features of hand-foot crawling behavior in human adults.

    Science.gov (United States)

    Maclellan, M J; Ivanenko, Y P; Cappellini, G; Sylos Labini, F; Lacquaniti, F

    2012-01-01

    Interlimb coordination of crawling kinematics in humans shares features with other primates and nonprimate quadrupeds, and it has been suggested that this is due to a similar organization of the locomotor pattern generators (CPGs). To extend the previous findings and to further explore the neural control of bipedal vs. quadrupedal locomotion, we used a crawling paradigm in which healthy adults crawled on their hands and feet at different speeds and at different surface inclinations (13°, 27°, and 35°). Ground reaction forces, limb kinematics, and electromyographic (EMG) activity from 26 upper and lower limb muscles on the right side of the body were collected. The EMG activity was mapped onto the spinal cord in approximate rostrocaudal locations of the motoneuron pools to characterize the general features of cervical and lumbosacral spinal cord activation. The spatiotemporal pattern of spinal cord activity significantly differed between quadrupedal and bipedal gaits. In addition, participants exhibited a large range of kinematic coordination styles (diagonal vs. lateral patterns), which is in contrast to the stereotypical kinematics of upright bipedal walking, suggesting flexible coupling of cervical and lumbosacral pattern generators. Results showed strikingly dissimilar directional horizontal forces for the arms and legs, considerably retracted average leg orientation, and substantially smaller sacral vs. lumbar motoneuron activity compared with quadrupedal gait in animals. A gradual transition to a more vertical body orientation (increasing the inclination of the treadmill) led to the appearance of more prominent sacral activity (related to activation of ankle plantar flexors), typical of bipedal walking. The findings highlight the reorganization and adaptation of CPG networks involved in the control of quadrupedal human locomotion and a high specialization of the musculoskeletal apparatus to specific gaits.

  15. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  16. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults.

    Directory of Open Access Journals (Sweden)

    Nadja Larsen

    Full Text Available BACKGROUND: Recent evidence suggests that there is a link between metabolic diseases and bacterial populations in the gut. The aim of this study was to assess the differences between the composition of the intestinal microbiota in humans with type 2 diabetes and non-diabetic persons as control. METHODS AND FINDINGS: The study included 36 male adults with a broad range of age and body-mass indices (BMIs, among which 18 subjects were diagnosed with diabetes type 2. The fecal bacterial composition was investigated by real-time quantitative PCR (qPCR and in a subgroup of subjects (N = 20 by tag-encoded amplicon pyrosequencing of the V4 region of the 16S rRNA gene. The proportions of phylum Firmicutes and class Clostridia were significantly reduced in the diabetic group compared to the control group (P = 0.03. Furthermore, the ratios of Bacteroidetes to Firmicutes as well as the ratios of Bacteroides-Prevotella group to C. coccoides-E. rectale group correlated positively and significantly with plasma glucose concentration (P = 0.04 but not with BMIs. Similarly, class Betaproteobacteria was highly enriched in diabetic compared to non-diabetic persons (P = 0.02 and positively correlated with plasma glucose (P = 0.04. CONCLUSIONS: The results of this study indicate that type 2 diabetes in humans is associated with compositional changes in intestinal microbiota. The level of glucose tolerance should be considered when linking microbiota with metabolic diseases such as obesity and developing strategies to control metabolic diseases by modifying the gut microbiota.

  17. [Effect of trypsin on the rat keratinocyte separation and subculture].

    Science.gov (United States)

    Ouyang, An-Li; Zhou, Yan; Hua, Ping; Tan, Wen-Song

    2002-01-01

    The effect of trypsin on the separation an subculture of the keratinocytes was investigated in this work. It was found that when 0.25% trypsin was employed for 5 minutes to separate keratinocytes, the number of active keratinocytes and the cells capable of forming colony were higher than those of other experimental conditions. The maximum attached ratio of primary keratinocytes was obtained when skin tissues were treated at 0.05% concentration of trypsin. With the increase of the trypsin concentrations, the attached ratio, attachment rate constant, and colony forming efficiency were all increased. Thus, 0.25% concentration of trypsin was recommended for separating and subculturing the keratinocytes.

  18. Human herpesvirus 8 seropositivity among sexually active adults in Uganda.

    Directory of Open Access Journals (Sweden)

    Fatma M Shebl

    Full Text Available INTRODUCTION: Sexual transmission of human herpesvirus 8 (HHV8 has been implicated among homosexual men, but the evidence for sexual transmission among heterosexual individuals is controversial. We investigated the role of sexual transmission of HHV8 in a nationally representative sample in Uganda, where HHV8 infection is endemic and transmitted mostly during childhood. MATERIALS AND METHODS: The study population was a subset of participants (n = 2681 from a population-based HIV/AIDS serobehavioral survey of adults aged 15-59 years conducted in 2004/2005. High risk for sexual transmission was assessed by questionnaire and serological testing for HIV and herpes simplex virus 2. Anti-HHV8 antibodies were measured using two enzyme immunoassays targeting synthetic peptides from the K8.1 and orf65 viral genes. The current study was restricted to 2288 sexually active adults. ORs and 95% CIs for HHV8 seropositivity were estimated by fitting logistic regression models with a random intercept using MPLUS and SAS software. RESULTS: The weighted prevalence of HHV8 seropositivity was 56.2%, based on 1302 seropositive individuals, and it increased significantly with age (P(trend<0.0001. In analyses adjusting for age, sex, geography, education, and HIV status, HHV8 seropositivity was positively associated with reporting two versus one marital union (OR:1.52, 95% CI: 1.17-1.97 and each unit increase in the number of children born (OR: 1.04, 95% CI: 1.00-1.08, and was inversely associated with ever having used a condom (OR: 0.64, 95% CI: 0.45-0.89. HHV8 seropositivity was not associated with HIV (P = 0.660 or with herpes simplex virus 2 (P = 0.732 seropositivity. Other sexual variables, including lifetime number of sexual partners or having had at least one sexually transmitted disease, and socioeconomic variables were unrelated to HHV8 seropositivity. CONCLUSION: Our findings are compatible with the conclusion that sexual transmission of HHV8 in

  19. Effects of SHIKONIN on Cel Proliferation and Melanin Transfer of Co-Cultured Human Melanocytes and Keratinocytes%紫草素对黑素转运的影响

    Institute of Scientific and Technical Information of China (English)

    解士海; 潘武辉; 宗国勇; 黄小雄

    2014-01-01

    目的:探讨紫草素(Sh)在人表皮共培养体系中对黑素转运的影响。方法采用MTT法测定紫草素对人黑素细胞(MC)与角质形成细胞(KC)共培养体系增殖的影响,利用荧光标记技术以及流式细胞仪研究紫草素对于黑素转运的影响。结果0.25μmol/L、0.5μmol/L和1μmol/L紫草素对于人表皮共培养体系增殖无影响,0.25μmol/L、0.5μmol/L和1μmol/L紫草素对于共培养体系中黑素转运有剂量依赖地促进作用。结论紫草素对于共培养体系中黑素转运有剂量依赖的促进作用。%Objective: To study the Effects of SHIKONIN on cellProliferation and Melanin transfer of Co-Cultured of melanocytes and keratinocytes Methods: MTT method, Flow cytometry were employed to measure the cellviability, melanin transfer of co-cultured melanocytes and keratinocytes Results No influence was observed on co-cultured melanocytes and keratinocytes cellproliferation by 0.25μmol/L, 0.5μmol/L, or 1μmol/L of SHIKONIN . The melanin transfer were clearly enhanced by SHIKONIN in a dose-dependent manner at concentrations of 0.25μmol/L, 0.5μmol/L, and 1μmol/L Conclusion SHIKONIN exhibits a dose-dependent enhancing effects on melanin transfer in co-cultured melanocytes and keratinocytes.

  20. Cyclic stretch induces upregulation of endothelin-1 with keratinocytes in vitro: Possible role in mechanical stress-induced hyperpigmentation

    Energy Technology Data Exchange (ETDEWEB)

    Kurita, Masakazu, E-mail: masakazukurita@gmail.com [Department of Plastic Surgery, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi, Tokyo 181-8611 (Japan); Okazaki, Mutsumi [Department of Plastic and Reconstructive Surgery, Graduate School, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8510 (Japan); Fujino, Takashi [Department of Pathology, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi, Tokyo 181-8611 (Japan); Takushima, Akihiko; Harii, Kiyonori [Department of Plastic Surgery, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi, Tokyo 181-8611 (Japan)

    2011-05-27

    Highlights: {yields} Influence of cyclic stretch on melanogenetic paracrine cytokines was investigated. {yields} Keratinocyte-derived endothelin-1 was upregulated with cyclic stretch. {yields} Degree of upregulation increases dose-dependently. {yields} This upregulation possibly plays a role in the pathogenesis of pigmented disorders. -- Abstract: The aim of this study was to investigate the possible pathological relation between mechanical stress and hyperpigmentation. We did this by investigating the influence of cyclic stretch on the expression of keratinocyte- and fibroblast-derived melanogenetic paracrine cytokines in vitro. Using primary human keratinocytes and fibroblasts, alterations of mRNA expression of melanogenetic paracrine cytokines due to cyclic stretch were investigated using a real-time polymerase chain reaction (PCR). The cytokines included basic fibroblast growth factor (bFGF), stem cell factor (SCF), granulocyte/macrophage colony-stimulating factor, interleukin-1{alpha}, and endothelin-1 (ET-1) for keratinocytes and bFGF, SCF, and hepatocyte growth factor for fibroblasts. The dose dependence of keratinocyte-derived ET-1 upregulation was further investigated using real-time PCR and an enzyme-linked immunosorbent assay. We also investigated the effects of cyclic stretch on the proliferation and differentiation of keratinocytes. Among the melanogenetic paracrine cytokines investigated, keratinocyte-derived ET-1 was consistently upregulated in all four cell lines. The degree of upregulation increased with the degree of the length and frequency of the stretch; in contrast, cell number and differentiation markers showed no obvious alterations with cyclic stretch. Keratinocyte-derived ET-1 upregulation possibly plays a significant role in the pathogenesis of pigmented disorders, such as friction melanosis, caused by mechanical stress.

  1. Immunoreactivity of thymosin beta 4 in human foetal and adult genitourinary tract

    Science.gov (United States)

    Nemolato, S.; Cabras, T.; Fanari, M.U.; Cau, F.; Fanni, D.; Gerosa, C.; Manconi, B.; Messana, I.; Castagnola, M.; Faa, G.

    2010-01-01

    Thymosin beta 4 (Tβ4) is a member of the beta-thymosins family, a family of peptides playing essential roles in many cellular functions. Our recent studies suggested Tβ4 plays a key role in the development of human salivary glands and the gastrointestinal tract. The aim of this study was to analyse the presence of Tβ4 in the human adult and foetal genitourinary tract. Immunolocalization of Tβ4 was studied in autoptic samples of kidney, bladder, uterus, ovary, testicle and prostate obtained from four human foetuses and four adults. Presence of the peptide was observed in cells of different origin: in surface epithelium, in gland epithelial cells and in the interstitial cells. Tβ4 was mainly found in adult and foetal bladder in the transitional epithelial cells; in the adult endometrium, glands and stromal cells were immunoreactive for the peptide; Tβ4 was mainly localized in the glands of foetal prostate while, in the adults a weak Tβ4 reactivity was restricted to the stroma. In adult and foetal kidney, Tβ4 reactivity was restricted to ducts and tubules with completely spared glomeruli; a weak positivity was observed in adult and foetal oocytes; immunoreactivity was mainly localized in the interstitial cells of foetal and adult testis. In this study, we confirm that Tβ4 could play a relevant role during human development, even in the genitourinary tract, and reveal that immunoreactivity for this peptide may change during postnatal and adult life. PMID:21263742

  2. A century of trends in adult human height

    DEFF Research Database (Denmark)

    Sørensen, Thorkild Ingvor A; Zimmermann, Esther

    2016-01-01

    in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5-22.7) and 16.5 cm (13.3-19.7) taller, respectively. In contrast, there was little change in adult height in some sub-Saharan African countries and in South Asia over...

  3. Transcriptional profiling of adult neural stem-like cells from the human brain.

    Science.gov (United States)

    Sandberg, Cecilie Jonsgar; Vik-Mo, Einar O; Behnan, Jinan; Helseth, Eirik; Langmoen, Iver A

    2014-01-01

    There is a great potential for the development of new cell replacement strategies based on adult human neural stem-like cells. However, little is known about the hierarchy of cells and the unique molecular properties of stem- and progenitor cells of the nervous system. Stem cells from the adult human brain can be propagated and expanded in vitro as free floating neurospheres that are capable of self-renewal and differentiation into all three cell types of the central nervous system. Here we report the first global gene expression study of adult human neural stem-like cells originating from five human subventricular zone biopsies (mean age 42, range 33-60). Compared to adult human brain tissue, we identified 1,189 genes that were significantly up- and down-regulated in adult human neural stem-like cells (1% false discovery rate). We found that adult human neural stem-like cells express stem cell markers and have reduced levels of markers that are typical of the mature cells in the nervous system. We report that the genes being highly expressed in adult human neural stem-like cells are associated with developmental processes and the extracellular region of the cell. The calcium signaling pathway and neuroactive ligand-receptor interactions are enriched among the most differentially regulated genes between adult human neural stem-like cells and adult human brain tissue. We confirmed the expression of 10 of the most up-regulated genes in adult human neural stem-like cells in an additional sample set that included adult human neural stem-like cells (n = 6), foetal human neural stem cells (n = 1) and human brain tissues (n = 12). The NGFR, SLITRK6 and KCNS3 receptors were further investigated by immunofluorescence and shown to be heterogeneously expressed in spheres. These receptors could potentially serve as new markers for the identification and characterisation of neural stem- and progenitor cells or as targets for manipulation of cellular fate.

  4. HISTOLOGICAL SEXUAL DIFFERENCES IN ADULT HUMAN PARATHYROID GLANDS

    Directory of Open Access Journals (Sweden)

    Fating Anita

    2014-07-01

    Full Text Available CONTEXT (BACKGROUND: Increasing problems of calcium deficiency with physiological conditions like pregnancy, lactation etc. it becomes the need of time to focus attention towards these glands as one of the essential entity. Hence we have undertaken this study to have an idea about normal variation in the gland as per sex. AIMS: To reveal sexual differences in adult human parathyroid glands. METHODS AND MATERIAL: Parathyroid glands from 25 autopsied cases of 20 to 59 years were studied after staining with Hematoxylin & Eosin, Masson’s Trichrome & Reticulin stains. STATISTICAL ANALYSIS: Data is analyzed on statistical software intercooled STATA version 8.0. Data was presented in mean± standard deviation & categorical variables were expressed in percentages. Comparison of oxyphil scores in male & female was done by unpaired‘t’ test. P < 0.05 was taken as statistical significance. RESULTS: Stroma composed of short often branching reticular fibres along with blood vessels and fat cells. By statistical examination the amount of fat was more in case of females than in males of same age groups. Oxyphil cells being less numerous than chief cells were distinguished by their dark eosinophilic, granular cytoplasm and were arranged mostly in closely packed groups without interstitial fat in between the cells. Oxyphil cells also found as placed singly among chief cells. It was also observed as continuous masses or anastomosing columns. As compared with males oxyphil cells are more in females. CONCLUSIONS: By statistical analysis 1 Percentage of stromal fat in case of females was slightly greater than in males of same age group. 2 The score of oxyphil cells in females was double to more than triple as compared to male score of same age group. 3 This study is clinically important as hormonal changes occurs early in females than in males and it is in favor of providing supplementary calcium with D3 along with minimal dose of estrogen as age advances in

  5. Response to: Comment on "Human adult neurogenesis across the ages: An immunohistochemical study".

    Science.gov (United States)

    Dennis, C V; Suh, L S; Rodriguez, M L; Kril, J J; Sutherland, G T

    2017-02-20

    It is with great interest that we read the comment by Marucci [1] referring to our publication "Human adult neurogenesis across the ages: An immunohistochemical study" [2]. Since the seminal paper of Eriksson et al. in 1998, human adult neurogenesis has become a major area of research in neuroscience [3]. Although an age-related decline in human adult neurogenesis is not disputed, opinions differ on the functional significance of the residual neuroblasts. This article is protected by copyright. All rights reserved.

  6. Brain stem auditory evoked responses in human infants and adults

    Science.gov (United States)

    Hecox, K.; Galambos, R.

    1974-01-01

    Brain stem evoked potentials were recorded by conventional scalp electrodes in infants (3 weeks to 3 years of age) and adults. The latency of one of the major response components (wave V) is shown to be a function both of click intensity and the age of the subject; this latency at a given signal strength shortens postnatally to reach the adult value (about 6 msec) by 12 to 18 months of age. The demonstrated reliability and limited variability of these brain stem electrophysiological responses provide the basis for an optimistic estimate of their usefulness as an objective method for assessing hearing in infants and adults.

  7. Distinct epidermal keratinocytes respond to extremely low-frequency electromagnetic fields differently.

    Directory of Open Access Journals (Sweden)

    Chao-Ying Huang

    Full Text Available Following an increase in the use of electric appliances that can generate 50 or 60 Hz electromagnetic fields, concerns have intensified regarding the biological effects of extremely low-frequency electromagnetic fields (ELF-EMFs on human health. Previous epidemiological studies have suggested the carcinogenic potential of environmental exposure to ELF-EMFs, specifically at 50 or 60 Hz. However, the biological mechanism facilitating the effects of ELF-EMFs remains unclear. Cellular studies have yielded inconsistent results regarding the biological effects of ELF-EMFs. The inconsistent results might have been due to diverse cell types. In our previous study, we indicated that 1.5 mT, 60 Hz ELF-EMFs will cause G1 arrest through the activation of the ATM-Chk2-p21 pathway in human keratinocyte HaCaT cells. The aim of the current study was to investigate whether ELF-EMFs cause similar effects in a distinct epidermal keratinocyte, primary normal human epidermal keratinocytes (NHEK, by using the same ELF-EMF exposure system and experimental design. We observed that ELF-EMFs exerted no effects on cell growth, cell proliferation, cell cycle distribution, and the activation of ATM signaling pathway in NHEK cells. We demonstrated that the 2 epidermal keratinocytes responded to ELF-EMFs differently. To further validate this finding, we simultaneously exposed the NHEK and HaCaT cells to ELF-EMFs in the same incubator for 168 h and observed the cell growths. The simultaneous exposure of the two cell types results showed that the NHEK and HaCaT cells exhibited distinct responses to ELF-EMFs. Thus, we confirmed that the biological effects of ELF-EMFs in epidermal keratinocytes are cell type specific. Our findings may partially explain the inconsistent results of previous studies when comparing results across various experimental models.

  8. Distinct epidermal keratinocytes respond to extremely low-frequency electromagnetic fields differently.

    Science.gov (United States)

    Huang, Chao-Ying; Chuang, Chun-Yu; Shu, Wun-Yi; Chang, Cheng-Wei; Chen, Chaang-Ray; Fan, Tai-Ching; Hsu, Ian C

    2014-01-01

    Following an increase in the use of electric appliances that can generate 50 or 60 Hz electromagnetic fields, concerns have intensified regarding the biological effects of extremely low-frequency electromagnetic fields (ELF-EMFs) on human health. Previous epidemiological studies have suggested the carcinogenic potential of environmental exposure to ELF-EMFs, specifically at 50 or 60 Hz. However, the biological mechanism facilitating the effects of ELF-EMFs remains unclear. Cellular studies have yielded inconsistent results regarding the biological effects of ELF-EMFs. The inconsistent results might have been due to diverse cell types. In our previous study, we indicated that 1.5 mT, 60 Hz ELF-EMFs will cause G1 arrest through the activation of the ATM-Chk2-p21 pathway in human keratinocyte HaCaT cells. The aim of the current study was to investigate whether ELF-EMFs cause similar effects in a distinct epidermal keratinocyte, primary normal human epidermal keratinocytes (NHEK), by using the same ELF-EMF exposure system and experimental design. We observed that ELF-EMFs exerted no effects on cell growth, cell proliferation, cell cycle distribution, and the activation of ATM signaling pathway in NHEK cells. We demonstrated that the 2 epidermal keratinocytes responded to ELF-EMFs differently. To further validate this finding, we simultaneously exposed the NHEK and HaCaT cells to ELF-EMFs in the same incubator for 168 h and observed the cell growths. The simultaneous exposure of the two cell types results showed that the NHEK and HaCaT cells exhibited distinct responses to ELF-EMFs. Thus, we confirmed that the biological effects of ELF-EMFs in epidermal keratinocytes are cell type specific. Our findings may partially explain the inconsistent results of previous studies when comparing results across various experimental models.

  9. Morphological method for the diagnosis of human adult type hypolactasia.

    OpenAIRE

    Maiuri, L; M. Rossi; V. Raia; Paparo, F; Coletta, S; Mazzeo, F; Breglia, A; Auricchio, S

    1994-01-01

    The primary adult type hypolactasia is the most common form of genetically determined disaccharidase deficiency. This study examined a large and homogeneous population of the south of Italy: surgical biopsy specimens of proximal jejunum from 178 adult subjects have been assayed for disaccharidase activities; the expression of lactase protein and lactase activity has also been investigated on tissue sections by immunomorphological and enzymohistochemical techniques. Histograms of lactase to su...

  10. Effects triggered by platinum nanoparticles on primary keratinocytes

    Directory of Open Access Journals (Sweden)

    Konieczny P

    2013-10-01

    Full Text Available Piotr Konieczny,1,* Anna Grazyna Goralczyk,1,* Radoslaw Szmyd,1,* Lukasz Skalniak,1,* Joanna Koziel,2 Francesca Larese Filon,3 Matteo Crosera,4 Agnieszka Cierniak,1 Ewa K Zuba-Surma,5 Julia Borowczyk,5 Eliza Laczna,5 Justyna Drukala,5 Elzbieta Pyza,6 Danuta Semik,6 Olga Woznicka,6 Andrzej Klein,1 Jolanta Jura11Department of General Biochemistry, 2Department of Microbiology, Jagiellonian University, Kraków, Poland; 3Department of Public Health Sciences, 4Department of Chemical and Pharmaceutical Sciences, University of Trieste, Trieste, Italy; 5Department of Cell Biology, 6Department of Cell Biology and Imaging, Jagiellonian University, Kraków, Poland*These authors equally contributed to this workAbstract: The platinum (Pt-group elements (PGEs represent a new kind of environmental pollutant and a new hazard for human health. Since their introduction as vehicle-exhaust catalysts, their emissions into the environment have grown considerably compared with their low natural concentration in the earth crust. PGE emissions from vehicle catalysts can be also in the form of nanometer-sized particles (Pt nanoparticles [PtNPs]. These elements, both in their metallic form or as ions solubilized in biological media, are now recognized as potent allergens and sensitizers. Human skin is always exposed to toxic particles; therefore, in the present study we addressed the question of whether polyvinylpyrrolidone-coated PtNPs may have any negative effects on skin cells, including predominantly epidermal keratinocytes. In this study, PtNPs of two sizes were used: 5.8 nm and 57 nm, in concentrations of 6.25, 12.5, and 25 µg/mL. Both types of NPs were protected with polyvinylpyrrolidone. Primary keratinocytes were treated for 24 and 48 hours, then cytotoxicity, genotoxicity, morphology, metabolic activity, and changes in the activation of signaling pathways were investigated in PtNP-treated cells. We found that PtNPs trigger toxic effects on primary keratinocytes

  11. Death penalty for keratinocytes: apoptosis versus cornification.

    Science.gov (United States)

    Lippens, S; Denecker, G; Ovaere, P; Vandenabeele, P; Declercq, W

    2005-11-01

    Homeostasis implies a balance between cell growth and cell death. This balance is essential for the development and maintenance of multicellular organisms. Homeostasis is controlled by several mechanisms including apoptosis, a process by which cells condemned to death are completely eliminated. However, in some cases, total destruction and removal of dead cells is not desirable, as when they fulfil a specific function such as formation of the skin barrier provided by corneocytes, also known as terminally differentiated keratinocytes. In this case, programmed cell death results in accumulation of functional cell corpses. Previously, this process has been associated with apoptotic cell death. In this overview, we discuss differences and similarities in the molecular regulation of epidermal programmed cell death and apoptosis. We conclude that despite earlier confusion, apoptosis and cornification occur through distinct molecular pathways, and that possibly antiapoptotic mechanisms are implicated in the terminal differentiation of keratinocytes.

  12. 硫化氢抑制丙酮醛诱导的人皮肤角质形成细胞损伤%Hydrogen sulfide attenuates methylglyoxal-induced human skin keratinocytes injury

    Institute of Scientific and Technical Information of China (English)

    蔡典其; 杨春涛; 陈凤娟; 陈存特; 陈珏铭; 骆月妍; 江伟炽; 郑洁蓉; 张辉

    2014-01-01

    effects of hydrogen sulfide (H2S) on methylglyoxal (MGO)-induced human skin keratinocytes (HaCaT cells) injury.Methods HaCaT cells were assigned to control group,MGO group and MGO+NSHD(H2S donor) group.The MGO group was treated with 200,400 and 600 μmol/L MGO for 48 h to induce cell injury.Control group was treated with an aliquot of plain culture medium.In the MGO +NSHD group,before treatment with 400 μmol/L MGO for 48 h,the cells were preconditioned with 50,100 and 200 μmol/L NSHD for 1 h to examine the protective effects of H2S according to cell viability as measured by cell counting kit 8.After treatment with 100 μmol/L NSHD for 1 h,the levels of H2S in medium and cells of NSHD and control groups were assayed with 20 μmol/L WSP-1,the H2S fluorescent probe,for photofluorography.HaCaT cells were assigned to control group,MGO group,NSHD group and MGO+NSHD group.The MGO group was treated with 400 μmol/L MGO for 48 h to induce cell injury.Control group was treated with an aliquot of plain culture medium.In the MGO+NSHD group,before treatment with 400 μmol/L MGO for 48 h,the cells were preconditioned with 100 μmol/L NSHD,NSHD group was treated with only 100 μmol/L NSHD for 1 h.Cellular apoptosis and mitochondrial membrane potential (MMP) were observed by Hoechst 33258 and Rh123 staining followed by photofluorography respectively.Results Treatment with 200,400 and 600 μmol/L MGO for 48 h,were attenuated HaCaT cell viability 0.325±0.023,0.224±0.009 and 0.095±0.102 compared with control group 0.415±0.031 (F=37.866,P < 0.05).Both in medium and in cells of NSHD group,the content of H2S was enhanced after treatment with 100 μmol/L NSHD for 1 h compared with control group.The viability in 400 μmol/L MGO treatment for 48 h group was halved compared with control group,and therefore 400 μmol/L was deemed the optimal concentration for MGO treatment.Before treatment with 400 μtmol/L MGO for 48 h,the cells were preconditioned with 50,100 and 200 μmol/L NSHD for 1 h

  13. Adult human case of toxocariasis with pulmonary migratory infiltrate and eosinophilia

    Directory of Open Access Journals (Sweden)

    Považan Đorđe

    2011-01-01

    Full Text Available Introduction. Toxocariasis is a zoonosis which is in Serbia characterized with a very high infection rate of dogs and excessive contamination of the soil with the eggs of Toxocara canis, the agent of the disease. Toxocara-induced infections have in recent years been established in a few hundreds of children, but toxocariasis has rather rarely been diagnosed in adults. Case report. We reported toxocariasis (visceral larva migrans in an adult, manifested by migratory pulmonary infiltrates and positive serological test finding to Toxocara. Conclusion. Human toxocariasis is a rare disease in adults, therefore it should be considered in adult patients presented with eosinophilia and migratory pulmonary infiltrates.

  14. Anomalous features of EMT during keratinocyte transformation.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    Full Text Available During the evolution of epithelial cancers, cells often lose their characteristic features and acquire a mesenchymal phenotype, in a process known as epithelial-mesenchymal transition (EMT. In the present study we followed early stages of keratinocyte transformation by HPV16, and observed diverse cellular changes, associated with EMT. We compared primary keratinocytes with early and late passages of HF1 cells, a cell line of HPV16-transformed keratinocytes. We have previously shown that during the progression from the normal cells to early HF1 cells, immortalization is acquired, while in the progression to late HF1, cells become anchorage independent. We show here that during the transition from the normal state to late HF1 cells, there is a progressive reduction in cytokeratin expression, desmosome formation, adherens junctions and focal adhesions, ultimately leading to poorly adhesive phenotype, which is associated with anchorage-independence. Surprisingly, unlike "conventional EMT", these changes are associated with reduced Rac1-dependent cell migration. We monitored reduced Rac1-dependent migration also in the cervical cancer cell line SiHa. Therefore we can conclude that up to the stage of tumor formation migratory activity is eliminated.

  15. Monocular Visual Deprivation Suppresses Excitability in Adult Human Visual Cortex

    DEFF Research Database (Denmark)

    Lou, Astrid Rosenstand; Madsen, Kristoffer Hougaard; Paulson, Olaf Bjarne

    2011-01-01

    The adult visual cortex maintains a substantial potential for plasticity in response to a change in visual input. For instance, transcranial magnetic stimulation (TMS) studies have shown that binocular deprivation (BD) increases the cortical excitability for inducing phosphenes with TMS. Here, we...... employed TMS to trace plastic changes in adult visual cortex before, during, and after 48 h of monocular deprivation (MD) of the right dominant eye. In healthy adult volunteers, MD-induced changes in visual cortex excitability were probed with paired-pulse TMS applied to the left and right occipital cortex....... Stimulus–response curves were constructed by recording the intensity of the reported phosphenes evoked in the contralateral visual field at range of TMS intensities. Phosphene measurements revealed that MD produced a rapid and robust decrease in cortical excitability relative to a control condition without...

  16. Keratinocyte Antiviral Response to Poly(dA:dT) Stimulation and Papillomavirus Infection in a Canine Model of X-Linked Severe Combined Immunodeficiency

    Science.gov (United States)

    Luff, Jennifer A.; Yuan, Hang; Kennedy, Douglas; Schlegel, Richard; Felsburg, Peter; Moore, Peter F.

    2014-01-01

    X-linked severe combined immunodeficiency (XSCID) is caused by a genetic mutation within the common gamma chain (γc), an essential component of the cytokine receptors for interleukin (IL)-2, IL-4, IL-7, IL-9, IL-15, and IL-21. XSCID patients are most commonly treated with bone marrow transplants (BMT) to restore systemic immune function. However, BMT-XSCID humans and dogs remain at an increased risk for development of cutaneous papillomavirus (PV) infections and their associated neoplasms, most typically cutaneous papillomas. Since basal keratinocytes are the target cell for the initial PV infection, we wanted to determine if canine XSCID keratinocytes have a diminished antiviral cytokine response to poly(dA:dT) and canine papillomavirus-2 (CPV-2) upon initial infection. We performed quantitative RT-PCR for antiviral cytokines and downstream interferon stimulated genes (ISG) on poly(dA:dT) stimulated and CPV-2 infected monolayer keratinocyte cultures derived from XSCID and normal control dogs. We found that XSCID keratinocytes responded similarly to poly(dA:dT) as normal keratinocytes by upregulating antiviral cytokines and ISGs. CPV-2 infection of both XSCID and normal keratinocytes did not result in upregulation of antiviral cytokines or ISGs at 2, 4, or 6 days post infection. These data suggest that the antiviral response to initial PV infection of basal keratinocytes is similar between XSCID and normal patients, and is not the likely source for the remaining immunodeficiency in XSCID patients. PMID:25025687

  17. Keratinocyte antiviral response to Poly(dA:dT stimulation and papillomavirus infection in a canine model of X-linked severe combined immunodeficiency.

    Directory of Open Access Journals (Sweden)

    Jennifer A Luff

    Full Text Available X-linked severe combined immunodeficiency (XSCID is caused by a genetic mutation within the common gamma chain (γc, an essential component of the cytokine receptors for interleukin (IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. XSCID patients are most commonly treated with bone marrow transplants (BMT to restore systemic immune function. However, BMT-XSCID humans and dogs remain at an increased risk for development of cutaneous papillomavirus (PV infections and their associated neoplasms, most typically cutaneous papillomas. Since basal keratinocytes are the target cell for the initial PV infection, we wanted to determine if canine XSCID keratinocytes have a diminished antiviral cytokine response to poly(dA:dT and canine papillomavirus-2 (CPV-2 upon initial infection. We performed quantitative RT-PCR for antiviral cytokines and downstream interferon stimulated genes (ISG on poly(dA:dT stimulated and CPV-2 infected monolayer keratinocyte cultures derived from XSCID and normal control dogs. We found that XSCID keratinocytes responded similarly to poly(dA:dT as normal keratinocytes by upregulating antiviral cytokines and ISGs. CPV-2 infection of both XSCID and normal keratinocytes did not result in upregulation of antiviral cytokines or ISGs at 2, 4, or 6 days post infection. These data suggest that the antiviral response to initial PV infection of basal keratinocytes is similar between XSCID and normal patients, and is not the likely source for the remaining immunodeficiency in XSCID patients.

  18. 瘦素调节HaCaT细胞角蛋白17的表达%Leptin regulates keratin 17 expression in HaCaT human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    张敏; 苗叶; 薛柯; 李承新

    2014-01-01

    Objective To evaluate the effect of leptin on K17 expression in HaCaT human keratinocytes.Methods Some cultured HaCaT cells were treated with leptin (100 ng/ml) or remained untreated for 24 hours followed by the quantification of K17 mRNA expression by real-time PCR and detection of K17 protein expression by Western blot and immunofluorescence staining.To investigate the action mechanism of leptin,some cultured HaCaT cells were divided into several groups to be treated with leptin (100 ng/ml) alone,Piceatannol (an inhibitor of the STAT3 pathway) + leptin (100 ng/ml),PD-98059 (an inhibitor of the Erk1/2 pathway) + leptin (100 ng/ml),respectively for 24 hours,with the cells receiving no treatment as the negative control.Subsequently,the mRNA and protein expressions of K17 were measured by the above methods.Statistical analysis was done by the two-sample ttest.Results The mRNA expression of K17 was significantly higher in HaCaT cells treated with leptin alone than in those remaining untreated (3.086 7 ± 0.186 1 vs.1.000 0 ± 0.000 0,P < 0.01),but significantly downregulated in HaCaT cells treated with Piceatannol + leptin and those with PD-98059 + leptin compared with those treated leptin alone (0.674 1 ± 0.060 0 and 0.855 0 ± 0.390 3 vs.2.242 7 ± 0.188 7,both P < 0.01).The results of Western blot and immunofluorescence staining were in agreement with those of real-time PCR.Conclusions Leptin can induce K17 expression in HaCaT cells,likely by activating the STAT3 and Erk1/2 signaling pathways.%目的 探讨瘦素对HaCaT细胞角蛋白17(K17)表达的影响.方法 体外培养HaCaT细胞,给予100 ng/ml的瘦素作用24 h,应用实时PCR检测K17 mRNA表达水平、Western印迹及免疫荧光染色法检测K17蛋白表达水平变化.结果与阴性对照组(1.000 0±0.000 0)相比较,瘦素组(3.086 7±0.186 1)K17mRNA表达显著升高,差异有统计学意义(P<0.01).Western印迹结果表明,瘦素组K17蛋白较阴性对照组显著上调,细胞免疫

  19. Differential effects of detergents on keratinocyte gene expression.

    Science.gov (United States)

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  20. File list: Unc.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.20.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.20.AllAg.Keratinocytes.bed ...

  1. File list: Oth.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.20.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Epd.20.AllAg.Keratinocytes.bed ...

  2. File list: ALL.Epd.20.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.20.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.20.AllAg.Keratinocytes.bed ...

  3. File list: Unc.Epd.50.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.50.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.50.AllAg.Keratinocytes.bed ...

  4. File list: ALL.Epd.50.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.50.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.50.AllAg.Keratinocytes.bed ...

  5. File list: Oth.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.10.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Epd.10.AllAg.Keratinocytes.bed ...

  6. File list: Unc.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.05.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.05.AllAg.Keratinocytes.bed ...

  7. File list: Unc.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Epd.10.AllAg.Keratinocytes mm9 Unclassified Epidermis Keratinocytes SRX352044 h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.Epd.10.AllAg.Keratinocytes.bed ...

  8. File list: ALL.Epd.10.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.10.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.10.AllAg.Keratinocytes.bed ...

  9. File list: ALL.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Epd.05.AllAg.Keratinocytes hg19 All antigens Epidermis Keratinocytes SRX079858,...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Epd.05.AllAg.Keratinocytes.bed ...

  10. File list: Oth.Epd.05.AllAg.Keratinocytes [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Epd.05.AllAg.Keratinocytes mm9 TFs and others Epidermis Keratinocytes SRX352043... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Oth.Epd.05.AllAg.Keratinocytes.bed ...

  11. "Adult Education Is about Human Being in All Its Aspects"

    Science.gov (United States)

    Stanistreet, Paul

    2011-01-01

    Derek Legge, who celebrated his 95th birthday at the end of last month, is one of the most dedicated and influential of the largely unsung heroes of the adult education movement in Britain. As modesty is one of the many qualities with which his friends and colleagues credit him, he is certain to shrink from the description, but there is little…

  12. In Vitro Generation of Functional Liver Organoid-Like Structures Using Adult Human Cells

    NARCIS (Netherlands)

    Ramachandran, S.D.; Schirmer, K.; Munst, B.; Heinz, S.; Ghafoory, S.; Wolfl, S.; Simon-Keller, K.; Marx, A.; Oie, C.I.; Ebert, M.P.; Walles, H.; Braspenning, J.C.; Breitkopf-Heinlein, K.

    2015-01-01

    In this study we used differentiated adult human upcyte(R) cells for the in vitro generation of liver organoids. Upcyte(R) cells are genetically engineered cell strains derived from primary human cells by lenti-viral transduction of genes or gene combinations inducing transient proliferation capacit

  13. An Inventory of Skills and Attitudes Necessary for a Career in Human Services/Adult Care.

    Science.gov (United States)

    Broadbent, William

    This document is an inventory of skills identified as necessary by professionals in the human services field specializing in adult care. It is intended as a mechanism whereby educators can compare that which they teach against what the human services industry feels is relevant. Introductory material discusses the process of the occupational…

  14. Polymerized laminin-332 matrix supports rapid and tight adhesion of keratinocytes, suppressing cell migration.

    Directory of Open Access Journals (Sweden)

    Yoshinobu Kariya

    Full Text Available Laminin-332 (α3ß3γ2 (Lm332 supports the stable anchoring of basal keratinocytes to the epidermal basement membrane, while it functions as a motility factor for wound healing and cancer invasion. To understand these contrasting activities of Lm332, we investigated Lm332 matrices deposited by normal human keratinocytes and other Lm332-expressing cell lines. All types of the cells efficiently deposited Lm332 on the culture plates in specific patterns. On the contrary, laminins containing laminin ß1 and/or γ1 chains, such as Lm511 and Lm311, were not deposited on the culture plates even if secreted into culture medium. The Lm332 deposition was not inhibited by function-blocking antibodies to the α3 and α6 integrins but was inhibited by sodium selenate, suggesting that sulfated glycosaminoglycans on cell surface, e.g. heparan sulfate proteoglycans, might be involved in the process. HEK293 cells overexpressing exogenous Lm332 (Lm332-HEK almost exclusively deposited Lm332 on the plates. The deposited Lm332 matrix showed a mesh-like network structure as analyzed by electron microscopy, suggesting that Lm332 was highly polymerized. When biological activity was analyzed, the Lm332 matrix rather suppressed the migration of keratinocytes as compared with purified Lm332, which highly promoted the cell migration. The Lm332 matrix supported adhesion of keratinocytes much more strongly and stably than purified Lm332. Integrin α3ß1 bound to the Lm332 matrix at a three times higher level than purified Lm332. Normal keratinocytes prominently showed integrin α6ß4-containing, hemidesmosome-like structures on the Lm332 matrix but not on the purified one. These results indicate that the polymerized Lm332 matrix supports stable cell adhesion by interacting with both integrin α6ß4 and α3ß1, whereas unassembled soluble Lm332 supports cell migration.

  15. A century of trends in adult human height

    DEFF Research Database (Denmark)

    Damsgaard, Camilla T.; Michaelsen, Kim F.; Molbo, Drude

    2016-01-01

    in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5-22.7) and 16.5 cm (13.3-19.7) taller, respectively. In contrast, there was little change in adult height in some sub-Saharan African countries and in South Asia over...... the century of analysis. The tallest people over these 100 years are men born in the Netherlands in the last quarter of 20th century, whose average heights surpassed 182.5 cm, and the shortest were women born in Guatemala in 1896 (140.3 cm; 135.8-144.8). The height differential between the tallest...... and shortest populations was 19-20 cm a century ago, and has remained the same for women and increased for men a century later despite substantial changes in the ranking of countries....

  16. Binge Drinking Effects on EEG in Young Adult Humans

    Directory of Open Access Journals (Sweden)

    Kelly E. Courtney

    2010-05-01

    Full Text Available Young adult (N = 96 university students who varied in their binge drinking history were assessed by electroencephalography (EEG recording during passive viewing. Groups consisted of male and female non-binge drinkers (>1 to 5/4 drinks/ounces in under two hours, low-binge drinkers (5/4–7/6 drinks/ounces in under two hours, and high-binge drinkers (≥ 10 drinks/ounces in under two hours, who had been drinking alcohol at their respective levels for an average of 3 years. The non- and low-binge drinkers exhibited less spectral power than the high-binge drinkers in the delta (0–4 Hz and fast-beta (20–35 Hz bands. Binge drinking appears to be associated with a specific pattern of brain electrical activity in young adults that may reflect the future development of alcoholism.

  17. Spatial Distribution of Stem Cell-Like Keratinocytes in Dissected Compound Hair Follicles of the Dog.

    Directory of Open Access Journals (Sweden)

    Dominique J Wiener

    Full Text Available Hair cycle disturbances are common in dogs and comparable to some alopecic disorders in humans. A normal hair cycle is maintained by follicular stem cells which are predominately found in an area known as the bulge. Due to similar morphological characteristics of the bulge area in humans and dogs, the shared particularity of compound hair follicles as well as similarities in follicular biomarker expression, the dog is a promising model to study human hair cycle and stem cell disorders. To gain insight into the spatial distribution of follicular keratinocytes with stem cell potential in canine compound follicles, we microdissected hair follicles in anagen and telogen from skin samples of freshly euthanized dogs. The keratinocytes isolated from different locations were investigated for their colony forming efficiency, growth and differentiation potential as well as clonal growth. Our results indicate that i compound and single hair follicles exhibit a comparable spatial distribution pattern with respect to cells with high growth potential and stem cell-like characteristics, ii the lower isthmus (comprising the bulge harbors most cells with high growth potential in both, the anagen and the telogen hair cycle stage, iii unlike in other species, colonies with highest growth potential are rather small with an irregular perimeter and iv the keratinocytes derived from the bulbar region exhibit characteristics of actively dividing transit amplifying cells. Our results now provide the basis to conduct comparative studies of normal dogs and those with hair cycle disorders with the possibility to extend relevant findings to human patients.

  18. A method for the immortalization of newborn mouse skin keratinocytes

    Directory of Open Access Journals (Sweden)

    Brianna O Hammiller

    2015-07-01

    Full Text Available Isolation and culture of mouse primary epidermal keratinocytes is a common technique that allows for easy genetic and environmental manipulation. However, due to their limited lifespan in culture, experiments utilizing primary keratinocytes require large numbers of animals, and are time consuming and expensive. To avoid these issues, we developed a method for the immortalization of primary mouse epidermal keratinocytes. Upon isolation of newborn epidermal keratinocytes according to established methods, the cells were cultured long-term in keratinocyte growth factor-containing medium. The cells senesced within a few weeks and eventually, small, slowly growing colonies emerged. After they regained confluency, the cells were passaged and slowly refilled the dish. With several rounds of subculture, the cells adapted to culture conditions, were easily subcultured, maintained normal morphology, and were apparently immortal. The immortalized cells retained the ability to differentiate with increased calcium concentrations, and were maintained to high passage numbers, while maintaining a relatively stable karyotype. Analysis of multiple immortalized cell lines as well as primary keratinocyte cultures, revealed increased numbers of chromosomes, especially in the primary keratinocytes, and chromosomal aberrations in most of the immortalized cultures and in the primary keratinocytes. Orthotopic grafting of immortalized keratinocytes together with fibroblasts onto nude mouse hosts produced skin while v-rasHa infection of the immortalized keratinocytes prior to grafting produced squamous cell carcinoma. In summary, this method of cell line generation allows for decreased use of animals, reduces the expense and time involved in research, and provides a useful model for cutaneous keratinocyte experimentation.

  19. Hyaluronan-Phosphatidylethanolamine Polymers Form Pericellular Coats on Keratinocytes and Promote Basal Keratinocyte Proliferation

    Directory of Open Access Journals (Sweden)

    Caitlin J. Symonette

    2014-01-01

    Full Text Available Aged keratinocytes have diminished proliferative capacity and hyaluronan (HA cell coats, which are losses that contribute to atrophic skin characterized by reduced barrier and repair functions. We formulated HA-phospholipid (phosphatidylethanolamine, HA-PE polymers that form pericellular coats around cultured dermal fibroblasts independently of CD44 or RHAMM display. We investigated the ability of these HA-PE polymers to penetrate into aged mouse skin and restore epidermal function in vivo. Topically applied Alexa647-HA-PE penetrated into the epidermis and dermis, where it associated with both keratinocytes and fibroblasts. In contrast, Alexa647-HA was largely retained in the outer cornified layer of the epidermis and quantification of fluorescence confirmed that significantly more Alexa647-HA-PE penetrated into and was retained within the epidermis than Alexa647-HA. Multiple topical applications of HA-PE to shaved mouse skin significantly stimulated basal keratinocyte proliferation and epidermal thickness compared to HA or vehicle cream alone. HA-PE had no detectable effect on keratinocyte differentiation and did not promote local or systemic inflammation. These effects of HA-PE polymers are similar to those reported for endogenous epidermal HA in youthful skin and show that topical application of HA-PE polymers can restore some of the impaired functions of aged epidermis.

  20. Image enhancement of optical images for binary system of melanocytes and keratinocytes

    Science.gov (United States)

    Takanezawa, S.; Baba, A.; Sako, Y.; Ozaki, Y.; Date, A.; Toyama, K.; Morita, S.

    2013-05-01

    Automatic determination of the cell shapes of large numbers of melanocytes based on optical images of human skin models have been largely unsuccessful (the complexities introduced by dendrites and the melanin pigmentation over the keratinocytes to give unclear outlines). Here, we present an image enhancement procedure for enhancing the contrast of images with removing the non-uniformity of background. The brightness is normalized also for the non-uniform population density of melanocytes.

  1. CB1 cannabinoid receptor enrichment in the ependymal region of the adult human spinal cord

    OpenAIRE

    Beatriz Paniagua-Torija; Angel Arevalo-Martin; Isidro Ferrer; Eduardo Molina-Holgado; Daniel Garcia-Ovejero

    2015-01-01

    Cannabinoids are involved in the regulation of neural stem cell biology and their receptors are expressed in the neurogenic niches of adult rodents. In the spinal cord of rats and mice, neural stem cells can be found in the ependymal region, surrounding the central canal, but there is evidence that this region is largely different in adult humans: lacks a patent canal and presents perivascular pseudorosettes, typically found in low grade ependymomas. Using Laser Capture Microdissection, Taqma...

  2. Molecular Mechanism of Adult Neurogenesis and its Association with Human Brain Diseases

    Science.gov (United States)

    Liu, He; Song, Ni

    2016-01-01

    Recent advances in neuroscience challenge the old dogma that neurogenesis occurs only during embryonic development. Mounting evidence suggests that functional neurogenesis occurs throughout adulthood. This review article discusses molecular factors that affect adult neurogenesis, including morphogens, growth factors, neurotransmitters, transcription factors, and epigenetic factors. Furthermore, we summarize and compare current evidence of associations between adult neurogenesis and human brain diseases such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, and brain tumors. PMID:27375363

  3. A century of trends in adult human height

    OpenAIRE

    Bentham, J; Di Cesare, M; Stevens, G.A.; Zhou, B.; Bixby, H.; Cowan, M.; Fortunato, L.; Hajifathalian, K; Lu, Y.; Riley, L. M.; Kontis, V.; Paciorek, C. J.; Ezzati, M; Abdeen, Z. A. (Ziad A.); Hamid, Z. A.

    2016-01-01

    Being taller is associated with enhanced longevity, and higher education and earnings. We reanalysed 1472 population-based studies, with measurement of height on more than 18.6 million participants to estimate mean height for people born between 1896 and 1996 in 200 countries. The largest gain in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5–22.7) and 16.5 cm (13.3–19.7) taller, respectively. In contrast, ...

  4. Protein engineering,expression,and activity of a novel fusion protein possessing keratinocyte growth factor 2 and fibronectin

    Institute of Scientific and Technical Information of China (English)

    Wonmo Kang; Junhyeog Jang

    2009-01-01

    Growth factor-induced proliferation and differentiation often require adhesion of cells to the extracellular matrix proteins such as fibronectin(FN).In this study,we aimed to investigate the effect of protein engineering of the keratinocyte growth factor 2(KGF2)fused to the FN on the mitogenic activity of KGF2.The fusion protein(KGF2-FN10),which was expressed in Escherichia coli,showed significantly enhanced mitogenic activity of KGF2 on human keratinocytes.Moreover,KGF2-FN10 fusion protein showed significantly increased activity to differentiate keratinocytes from native KGF2.In conclusion,these results suggest that KGF2-FN10 fusion protein has certain advantages over native KGF2 and may offer a novel strategy to potentiate the therapeutic effect of KGF2.

  5. Photoprotection by Punica granatum seed oil nanoemulsion entrapping polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in human keratinocyte (HaCaT) cell line.

    Science.gov (United States)

    Baccarin, Thaisa; Mitjans, Montserrat; Ramos, David; Lemos-Senna, Elenara; Vinardell, Maria Pilar

    2015-12-01

    There has been an increase in the use of botanicals as skin photoprotective agents. Pomegranate (Punica granatum L.) is well known for its high concentration of polyphenolic compounds and for its antioxidant and anti-inflammatory properties. The aim of this study was to analyze the photoprotection provided by P. granatum seed oil nanoemulsion entrapping the polyphenol-rich ethyl acetate fraction against UVB-induced DNA damage in the keratinocyte HaCaT cell line. For this purpose, HaCaT cells were pretreated for 1h with nanoemulsions in a serum-free medium and then irradiated with UVB (90-200 mJ/cm(2)) rays. Fluorescence microscopy analysis provided information about the cellular internalization of the nanodroplets. We also determined the in vitro SPF of the nanoemulsions and evaluated their phototoxicity using the 3T3 Neutral Red Uptake Phototoxicity Test. The nanoemulsions were able to protect the cells' DNA against UVB-induced damage in a concentration dependent manner. Nanodroplets were internalized by the cells but a higher proportion was detected along the cell membrane. The SPF obtained (~25) depended on the concentration of the ethyl acetate fraction and pomegranate seed oil in the nanoemulsion. The photoprotective formulations were classified as non-phototoxic. In conclusion, nanoemulsions entrapping the polyphenol-rich ethyl acetate fraction show potential for use as a sunscreen product.

  6. Rate and adaptation effects on the auditory evoked brainstem response in human newborns and adults.

    Science.gov (United States)

    Lasky, R E

    1997-09-01

    Auditory evoked brainstem response (ABR) latencies increased and amplitudes decreased with increasing stimulus repetition rate for human newborns and adults. The wave V latency increases were larger for newborns than adults. The wave V amplitude decreases were smaller for newborns than adults. These differences could not be explained by developmental differences in frequency responsivity. The transition from the unadapted to the fully adapted response was less rapid in newborns than adults at short (= 10 ms) inter stimulus intervals (ISIs). At longer ISIs (= 20 ms) there were no developmental differences in the transition to the fully adapted response. The newborn transition occurred in a two stage process. The rapid initial stage observed in adults and newborns was complete by about 40 ms. A second slower stage was observed only in newborns although it has been observed in adults in other studies (Weatherby and Hecox, 1982; Lightfoot, 1991; Lasky et al., 1996). These effects were replicated at different stimulus intensities. After the termination of stimulation the return to the wave V unadapted response took nearly 500 ms in newborns. Neither the newborn nor the adult data can be explained by forward masking of one click on the next click. These results indicate human developmental differences in adaptation to repetitive auditory stimulation at the level of the brainstem.

  7. Ratite oils promote keratinocyte cell growth and inhibit leukocyte activation

    Science.gov (United States)

    Bennett, Darin C.; Leung, Gigi; Wang, Eddy; Ma, Sam; Lo, Blanche K. K.; McElwee, Kevin J.; Cheng, Kimberly M.

    2015-01-01

    Traditionally, native Australian aborigines have used emu oil for the treatment of inflammation and to accelerate wound healing. Studies on mice suggest that topically applied emu oil may have anti-inflammatory properties and may promote wound healing. We investigated the effects of ratite oils (6 emu, 3 ostrich, 1 rhea) on immortalized human keratinocytes (HaCaT cells) in vitro by culturing the cells in media with oil concentrations of 0%, 0.5%, and 1.0%. Peking duck, tea tree, and olive oils were used as comparative controls. The same oils at 0.5% concentration were evaluated for their influence on peripheral blood mononuclear cell (PBMC) survival over 48 hr and their ability to inhibit IFNγ production in PBMCs activated by phytohemagglutinin (PHA) in ELISpot assays. Compared to no oil control, significantly shorter population doubling time durations were observed for HaCaT cells cultured in emu oil (1.51 × faster), ostrich oil (1.46 × faster), and rhea oil (1.64 × faster). Tea tree oil demonstrated significant antiproliferative activity and olive oil significantly prolonged (1.35 × slower) cell population doubling time. In contrast, almost all oils, particularly tea tree oil, significantly reduced PBMC viability. Different oils had different levels of inhibitory effect on IFNγ production with individual emu, ostrich, rhea, and duck oil samples conferring full inhibition. This preliminary investigation suggests that emu oil might promote wound healing by accelerating the growth rate of keratinocytes. Combined with anti-inflammatory properties, ratite oil may serve as a useful component in bandages and ointments for the treatment of wounds and inflammatory skin conditions. PMID:26217022

  8. Ratite oils promote keratinocyte cell growth and inhibit leukocyte activation.

    Science.gov (United States)

    Bennett, Darin C; Leung, Gigi; Wang, Eddy; Ma, Sam; Lo, Blanche K K; McElwee, Kevin J; Cheng, Kimberly M

    2015-09-01

    Traditionally, native Australian aborigines have used emu oil for the treatment of inflammation and to accelerate wound healing. Studies on mice suggest that topically applied emu oil may have anti-inflammatory properties and may promote wound healing. We investigated the effects of ratite oils (6 emu, 3 ostrich, 1 rhea) on immortalized human keratinocytes (HaCaT cells) in vitro by culturing the cells in media with oil concentrations of 0%, 0.5%, and 1.0%. Peking duck, tea tree, and olive oils were used as comparative controls. The same oils at 0.5% concentration were evaluated for their influence on peripheral blood mononuclear cell (PBMC) survival over 48 hr and their ability to inhibit IFNγ production in PBMCs activated by phytohemagglutinin (PHA) in ELISpot assays. Compared to no oil control, significantly shorter population doubling time durations were observed for HaCaT cells cultured in emu oil (1.51×faster), ostrich oil (1.46×faster), and rhea oil (1.64×faster). Tea tree oil demonstrated significant antiproliferative activity and olive oil significantly prolonged (1.35×slower) cell population doubling time. In contrast, almost all oils, particularly tea tree oil, significantly reduced PBMC viability. Different oils had different levels of inhibitory effect on IFNγ production with individual emu, ostrich, rhea, and duck oil samples conferring full inhibition. This preliminary investigation suggests that emu oil might promote wound healing by accelerating the growth rate of keratinocytes. Combined with anti-inflammatory properties, ratite oil may serve as a useful component in bandages and ointments for the treatment of wounds and inflammatory skin conditions.

  9. A century of trends in adult human height.

    Science.gov (United States)

    2016-07-26

    Being taller is associated with enhanced longevity, and higher education and earnings. We reanalysed 1472 population-based studies, with measurement of height on more than 18.6 million participants to estimate mean height for people born between 1896 and 1996 in 200 countries. The largest gain in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5-22.7) and 16.5 cm (13.3-19.7) taller, respectively. In contrast, there was little change in adult height in some sub-Saharan African countries and in South Asia over the century of analysis. The tallest people over these 100 years are men born in the Netherlands in the last quarter of 20th century, whose average heights surpassed 182.5 cm, and the shortest were women born in Guatemala in 1896 (140.3 cm; 135.8-144.8). The height differential between the tallest and shortest populations was 19-20 cm a century ago, and has remained the same for women and increased for men a century later despite substantial changes in the ranking of countries.

  10. Lymphocytes in patients with psoriasis promote proliferation of keratinocytes

    Institute of Scientific and Technical Information of China (English)

    DENG An-mei; ZHONG Ren-qian; CHEN Sun-xiao; ZHOU Ye; KONG Xian-tao

    2002-01-01

    Objective: To analyze the effect of lymphocytes on proliferation of keratinocytes in patients with psoriasis. Methods: Lymphocytes in lesion and peripheral blood were isolated and amplified, then cultured together with normal keratinocytes. By MTT method, the living cells were quantified in the mixed culture.Results: Compared with normal controls, lymphocytes from lesion and peripheral blood of psoriasis both promote the proliferation of keratinocytes (P<0. 01 and P<0. 05 respectively). The concentrations of IL-2 and IFN-γ in the mixture of lesion lymphocytes and keratinocytes were significantly higher than that of controls.Tripterygium glycosides inhibited this promotion. Conclusion: Lymphocytes in patients with psoriasis (mainly Thl cell) play an important role in proliferation of keratinocytes. This psoriasis cell model is useful for studies on signal transduction in psoriasis.

  11. The human traffickers and exploitation of children and young adults.

    Directory of Open Access Journals (Sweden)

    Sara Scala

    2012-06-01

    Full Text Available The article focuses on the traffic of children, who are kidnapped, cheated and purchased by their families to be exploited in many ways. These victims have severe mental and physical traumas. Many of them, slaves of their exploiters, remain invisible and live their lifes without fundamental rights and without any kind of support or help. The traffic in human beings is a new kind of slavery, which acts in the dark, is criminal and involves different subjects of different ages, different nationalities and generations. The traffic in human beings is managed by transnational criminal organizations and is a disturbing and growing phenomena around the world.

  12. Resident aerobic microbiota of the adult human nasal cavity

    DEFF Research Database (Denmark)

    Rasmussen, TT; Kirkeby Nielsen, LP; Poulsen, Knud

    2000-01-01

    Recent evidence strongly suggests that the microbiota of the nasal cavity plays a crucial role in determining the reaction patterns of the mucosal and systemic immune system. However, little is known about the normal microbiota of the nasal cavity. The purpose of this study was to determine...... the microbiota in different parts of the nasal cavity and to develop and evaluate methods for this purpose. Samples were collected from 10 healthy adults by nasal washes and by swabbing of the mucosa through a sterile introduction device. Both methods gave results that were quantitatively and qualitatively...... reproducible, and revealed significant differences in the density of the nasal microbiota between individuals. The study revealed absence of gram-negative bacteria that are regular members of the commensal microbiota of the pharynx. Likewise, viridans type streptococci were sparsely represented. The nasal...

  13. The landscape of genomic imprinting across diverse adult human tissues

    Science.gov (United States)

    Baran, Yael; Subramaniam, Meena; Biton, Anne; Tukiainen, Taru; Tsang, Emily K.; Rivas, Manuel A.; Pirinen, Matti; Gutierrez-Arcelus, Maria; Smith, Kevin S.; Kukurba, Kim R.; Zhang, Rui; Eng, Celeste; Torgerson, Dara G.; Urbanek, Cydney; Li, Jin Billy; Rodriguez-Santana, Jose R.; Burchard, Esteban G.; Seibold, Max A.; MacArthur, Daniel G.; Montgomery, Stephen B.; Zaitlen, Noah A.; Lappalainen, Tuuli

    2015-01-01

    Genomic imprinting is an important regulatory mechanism that silences one of the parental copies of a gene. To systematically characterize this phenomenon, we analyze tissue specificity of imprinting from allelic expression data in 1582 primary tissue samples from 178 individuals from the Genotype-Tissue Expression (GTEx) project. We characterize imprinting in 42 genes, including both novel and previously identified genes. Tissue specificity of imprinting is widespread, and gender-specific effects are revealed in a small number of genes in muscle with stronger imprinting in males. IGF2 shows maternal expression in the brain instead of the canonical paternal expression elsewhere. Imprinting appears to have only a subtle impact on tissue-specific expression levels, with genes lacking a systematic expression difference between tissues with imprinted and biallelic expression. In summary, our systematic characterization of imprinting in adult tissues highlights variation in imprinting between genes, individuals, and tissues. PMID:25953952

  14. Hesperetin induces melanin production in adult human epidermal melanocytes.

    Science.gov (United States)

    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban

    2015-06-01

    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p melanocyte cultures could be reproduced on human skin.

  15. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults

    DEFF Research Database (Denmark)

    Larsen, Nadja; Vogensen, Finn Kvist; van der Berg, Franciscus Winfried J;

    2010-01-01

    Background Recent evidence suggests that there is a link between metabolic diseases and bacterial populations in the gut. The aim of this study was to assess the differences between the composition of the intestinal microbiota in humans with type 2 diabetes and non-diabetic persons as control...... to control metabolic diseases by modifying the gut microbiota....... = 0.04). Conclusions The results of this study indicate that type 2 diabetes in humans is associated with compositional changes in intestinal microbiota. The level of glucose tolerance should be considered when linking microbiota with metabolic diseases such as obesity and developing strategies...

  16. Combined treatment with sodium butyrate and PD153035 enhances keratinocyte differentiation

    Science.gov (United States)

    Carrion, Sandra Leon; Sutter, Carrie Hayes; Sutter, Thomas R.

    2014-01-01

    Epidermal growth factor (EGF) receptor (EGFR) signaling is a critical determinant of keratinocyte proliferation and differentiation in both normal and diseased skin. Here we explore the effects of combined treatment with the differentiation-promoting agent sodium butyrate (SB) and the EGFR inhibitor (EGFRI) PD153035 on terminal differentiation of normal human epidermal keratinocytes (NHEKs). Cells treated with SB showed increased expression of the levels of mRNA and protein of the differentiation markers filaggrin and transglutaminase 1. Co-treatment with EGF significantly blunted these effects of SB. Combined treatment with SB and PD153035 alleviated these inhibitory actions of EGF, resulting in improved effects of decreased cell growth and increased terminal differentiation, relative to the individual treatments. These results indicate that the combined use of a differentiation-promoting agent and an EGFR inhibitor may offer an additional approach to the management of hyperproliferative skin diseases. PMID:24451036

  17. The human traffickers and exploitation of children and young adults.

    OpenAIRE

    2012-01-01

    The article focuses on the traffic of children, who are kidnapped, cheated and purchased by their families to be exploited in many ways. These victims have severe mental and physical traumas. Many of them, slaves of their exploiters, remain invisible and live their lifes without fundamental rights and without any kind of support or help. The traffic in human beings is a new kind of slavery, which acts in the dark, is criminal and involves different subjects of different ages, different nation...

  18. Adult human neural stem cell therapeutics: Currentdevelopmental status and prospect

    Institute of Scientific and Technical Information of China (English)

    Hyun Nam; Kee-Hang Lee; Do-Hyun Nam; Kyeung Min Joo

    2015-01-01

    Over the past two decades, regenerative therapies usingstem cell technologies have been developed for variousneurological diseases. Although stem cell therapy is anattractive option to reverse neural tissue damage and torecover neurological deficits, it is still under developmentso as not to show significant treatment effects in clinicalsettings. In this review, we discuss the scientific andclinical basics of adult neural stem cells (aNSCs), andtheir current developmental status as cell therapeuticsfor neurological disease. Compared with other typesof stem cells, aNSCs have clinical advantages, suchas limited proliferation, inborn differentiation potentialinto functional neural cells, and no ethical issues. Inspite of the merits of aNSCs, difficulties in the isolationfrom the normal brain, and in the in vitro expansion,have blocked preclinical and clinical study using aNSCs.However, several groups have recently developed noveltechniques to isolate and expand aNSCs from normaladult brains, and showed successful applications ofaNSCs to neurological diseases. With new technologiesfor aNSCs and their clinical strengths, previous hurdlesin stem cell therapies for neurological diseases could beovercome, to realize clinically efficacious regenerativestem cell therapeutics.

  19. Keratinocyte-derived IL-24 plays a role in the positive feedback regulation of epidermal inflammation in response to environmental and endogenous toxic stressors

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Sun Hee [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of); Choi, Dalwoong [Department of Public Health Science, Korea University, Seoul 136-701 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2014-10-15

    Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) cells. To find a common gene expression signature of human keratinocytes in chronic skin diseases, we performed a whole genome microarray analysis on normal human epidermal keratinocytes (NHKs) treated with IFNγ, IL-4, IL-17A or IL-22, major cytokines from Th1, Th2, Th17 or Th22 cells, respectively. The microarray results showed that the four genes, IL-24, PDZK1IP1, H19 and filaggrin, had common expression profiles in NHKs exposed to Th cell cytokines. In addition, the acute phase pro-inflammatory cytokines, IL-1β, IL-6 and TNFα, also change the gene transcriptional profile of IL-24, PDZK1IP1, H19, and filaggrin in NHKs as those of Th cytokines. Therefore, the signature gene set, consisting of IL-24, PDZK1IP1, H19, and filaggrin, provides essential insights for understanding the process of cutaneous inflammation and toxic responses. We demonstrate that environmental toxic stressors, such as chemical irritants and ultraviolet irradiation stimulate the production of IL-24 in NHKs. IL-24 stimulates the JAK1-STAT3 and MAPK pathways in NHKs, and promotes the secretion of pro-inflammatory mediators IL-8, PGE2, and MMP-1. These results suggest that keratinocyte-derived IL-24 participates in the positive feedback regulation of epidermal inflammation in response to both endogenous and environmental toxic stressors. - Highlights: • Cutaneous inflammatory gene signature consists of PDZK1IP1, IL-24, H19 and filaggrin. • Pro-inflammatory cytokines increase IL-24 production in human keratinocytes. • Environmental toxic stressors increase IL-24 production in human keratinocytes. • IL-24 stimulates human keratinocytes to

  20. Production of TNF-a by primary cultures of human keratinocytes challenged with Loxosceles gaucho venom Produção de TNF-a por queratinócitos humanos em cultura primária após agressão com veneno de Loxosceles gaucho

    Directory of Open Access Journals (Sweden)

    Ceila M.S. MÁLAQUE

    1999-05-01

    Full Text Available Primary cultures of human keratinocytes were challenged with increasing doses from 10 ng/mL to 2 mg/mL of Loxosceles gaucho venom, responsible for dermonecrotic lesion in humans. TNF-a was investigated by bioassay and ELISA in the supernatant of the cultures challenged with 100 ng/mL, 500 ng/mL, 1 and 2 mg/mL of venom. TNF-a was detected by bioassay in the supernatant of cultures challenged with 100 ng/mL, after 6 h. The cytokine was detected by ELISA in the supernatant of the cells challenged with doses of l mg/mL, after 6 and 12 h. The results point out the capacity of this venom to activate the keratinocytes in primary cultures to produce TNF-a. The production of cytokines could contribute to the local inflammatory process in patients bitten by Loxosceles sp.Culturas primárias de queratinócitos humanos foram incubadas com veneno de aranha Loxosceles gaucho, que possui atividade esfingomielinase D, responsável por lesão dermo-necrótica nos acidentes humanos. As células das culturas primárias foram agredidas com o veneno em doses crescentes de 10 ng/mL a 2 µg/mL. No sobrenadante das culturas agredidas com 100 ng/mL, 500 ng/mL, 1 e 2 µg/mL da toxina, foi pesquisada a presença de TNF-a através de bioensaio e ELISA. Com 100 ng/mL, foi detectado TNF-a no sobrenadante após 6 h, no bioensaio; usando o teste de ELISA, detectou-se a citocina no sobrenadante de células agredidas com doses de 1 µg/mL, após 6 e 12 h. Os resultados apontam para a capacidade deste veneno em ativar os queratinócitos em cultura, levando-os a produzir TNF-a. É provável que a produção de citocinas ative as células endoteliais, auxiliando na localização do processo inflamatório.

  1. Concept Maps: Practice Applications in Adult Education and Human Resource Development

    Science.gov (United States)

    Daley, Barbara J.

    2010-01-01

    Concept maps can be used as both a cognitive and constructivist learning strategy in teaching and learning in adult education and human resource development. The maps can be used to understand course readings, analyze case studies, develop reflective thinking and enhance research skills. The creation of concept maps can also be supported by the…

  2. Bridging the Gap between Human Resource Development and Adult Education: Part Two, the Critical Turn

    Science.gov (United States)

    Hatcher, Tim; Bowles, Tuere

    2014-01-01

    Human resource development (HRD) as a scholarly endeavor and as a practice is often criticized in the adult education (AE) literature and by AE scholars as manipulative and oppressive and, through training and other interventions, controlling workers for strictly economic ends (Baptiste, 2001; Cunningham, 2004; Schied, 2001; Welton, 1995). The…

  3. Bridging the Gap between Human Resource Development and Adult Education: Part One, Assumptions, Definitions, and Critiques

    Science.gov (United States)

    Hatcher, Tim; Bowles, Tuere

    2013-01-01

    Human resource development (HRD) as a scholarly endeavor and as a practice is often criticized in the adult education (AE) literature and by AE scholars as manipulative and oppressive and, through training and other interventions, controlling workers for strictly economic ends (Baptiste, 2001; Cunningham, 2004; Schied, 2001; Welton, 1995).…

  4. Perspectives on Adult Education, Human Resource Development, and the Emergence of Workforce Development

    Science.gov (United States)

    Jacobs, Ronald L.

    2014-01-01

    This article presents a perspective on the relationship between adult education and human resource development of the past two decades and the subsequent emergence of workforce development. The lesson taken from the article should be more than simply a recounting of events related to these fields of study. Instead, the more general lesson may be…

  5. Plasticity of adult human pancreatic duct cells by neurogenin3-mediated reprogramming

    DEFF Research Database (Denmark)

    Swales, Nathalie; Martens, Geert A; Bonné, Stefan

    2012-01-01

    Duct cells isolated from adult human pancreas can be reprogrammed to express islet beta cell genes by adenoviral transduction of the developmental transcription factor neurogenin3 (Ngn3). In this study we aimed to fully characterize the extent of this reprogramming and intended to improve it....

  6. ABSORPTION-SPECTRA OF HUMAN FETAL AND ADULT OXYHEMOGLOBIN, DE-OXYHEMOGLOBIN, CARBOXYHEMOGLOBIN, AND METHEMOGLOBIN

    NARCIS (Netherlands)

    ZIJLSTRA, WG; MEEUWSENVANDERROEST, WP

    1991-01-01

    We determined the millimolar absorptivities of the four clinically relevant derivatives of fetal and adult human hemoglobin in the visible and near-infrared spectral range (450-1000 nm). As expected, spectral absorption curves of similar shape were found, but the small differences between fetal and

  7. Treatment of Human-Caused Trauma: Attrition in the Adult Outcomes Research

    Science.gov (United States)

    Matthieu, Monica; Ivanoff, Andre

    2006-01-01

    Attrition or dropout is the failure of a participant to complete, comply, or the prematurely discontinuation or discharge from treatment, resulting in lost data and affecting outcomes. This review of 10 years of adult posttraumatic stress disorder (PTSD) treatment outcome literature specific to Criterion A events of human origin examines how…

  8. Equality and Human Capital: Conflicting Concepts within State-Funded Adult Education in Ireland

    Science.gov (United States)

    Hurley, Kevin

    2015-01-01

    This article offers a critique of the concept of equality as it informs the White Paper on Adult Education: Learning for Life (2000). It also outlines the extent to which human capital theory can be seen to have effectively colonised lifelong learning from the outset of its adoption by the European Union with highly constraining implications for…

  9. Emotions and Human Concern: Adult Education and the Philosophical Thought of Martha Nussbaum

    Science.gov (United States)

    Plumb, Donovan

    2014-01-01

    This article argues that philosopher Martha Nussbaum's reflections on the role of the emotions in human flourishing can contribute in important ways to our understanding of the emotions in adult education contexts. The article summarises Nussbaum's exploration of the contributions of classical philosophers like Socrates, Aristotle, and…

  10. Mature astrocytes in the adult human neocortex express the early neuronal marker doublecortin.

    NARCIS (Netherlands)

    Verwer, R.W.H.; Sluiter, A.A.; Balesar, R.A.; Baayen, J.C.; Noske, D.P.; Dirven, C.M.; Wouda, J.; van Dam, A.M.; Lucassen, P.J.; Swaab, D.F.

    2007-01-01

    Doublecortin (DCX) is a microtubule-associated protein expressed by migrating neuroblasts and is considered to be a reliable marker of neurogenesis. DCX has been used to study the relation between neurogenesis in adult human brain and neurological and neurodegenerative disease processes in the searc

  11. Increased presence of capillaries next to remodeling sites in adult human cancellous bone

    DEFF Research Database (Denmark)

    Kristensen, Helene Bjoerg; Andersen, Thomas Levin; Marcussen, Niels;

    2013-01-01

    by pericytes. Furthermore, the BRC canopy cells were found to express SMA. These ordered distributions support the existence of an osteogenic-vascular interface in adult human cancellous bone. The organization of this interface fits the current knowledge on the mode of action of vasculature on osteogenesis...

  12. Canonical Genetic Signatures of the Adult Human Brain

    Science.gov (United States)

    Hawrylycz, Michael; Miller, Jeremy A.; Menon, Vilas; Feng, David; Dolbeare, Tim; Guillozet-Bongaarts, Angela L.; Jegga, Anil G.; Aronow, Bruce J.; Lee, Chang-Kyu; Bernard, Amy; Glasser, Matthew F.; Dierker, Donna L.; Menche, Jörge; Szafer, Aaron; Collman, Forrest; Grange, Pascal; Berman, Kenneth A.; Mihalas, Stefan; Yao, Zizhen; Stewart, Lance; Barabási, Albert-László; Schulkin, Jay; Phillips, John; Ng, Lydia; Dang, Chinh; Haynor, David R.; Jones, Allan; Van Essen, David C.; Koch, Christof; Lein, Ed

    2015-01-01

    The structure and function of the human brain are highly stereotyped, implying a conserved molecular program responsible for its development, cellular structure, and function. We applied a correlation-based metric of “differential stability” (DS) to assess reproducibility of gene expression patterning across 132 structures in six individual brains, revealing meso-scale genetic organization. The highest DS genes are highly biologically relevant, with enrichment for brain-related biological annotations, disease associations, drug targets, and literature citations. Using high DS genes we identified 32 anatomically diverse and reproducible gene expression signatures, which represent distinct cell types, intracellular components, and/or associations with neurodevelopmental and neurodegenerative disorders. Genes in neuron-associated compared to non-neuronal networks showed higher preservation between human and mouse; however, many diversely-patterned genes displayed dramatic shifts in regulation between species. Finally, highly consistent transcriptional architecture in neocortex is correlated with resting state functional connectivity, suggesting a link between conserved gene expression and functionally relevant circuitry. PMID:26571460

  13. 40 CFR 26.1704 - Prohibition of reliance on unethical human research with non-pregnant, non-nursing adults...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Prohibition of reliance on unethical human research with non-pregnant, non-nursing adults conducted before April 7, 2006. 26.1704 Section 26... Prohibition of reliance on unethical human research with non-pregnant, non-nursing adults conducted...

  14. 40 CFR 26.1705 - Prohibition of reliance on unethical human research with non-pregnant, non-nursing adults...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Prohibition of reliance on unethical human research with non-pregnant, non-nursing adults conducted after April 7, 2006. 26.1705 Section 26... Prohibition of reliance on unethical human research with non-pregnant, non-nursing adults conducted...

  15. Self-Control and Impulsiveness in Nondieting Adult Human Females: Effects of Visual Food Cues and Food Deprivation

    Science.gov (United States)

    Forzano, Lori-Ann B.; Chelonis, John J.; Casey, Caitlin; Forward, Marion; Stachowiak, Jacqueline A.; Wood, Jennifer

    2010-01-01

    Self-control can be defined as the choice of a larger, more delayed reinforcer over a smaller, less delayed reinforcer, and impulsiveness as the opposite. Previous research suggests that exposure to visual food cues affects adult humans' self-control. Previous research also suggests that food deprivation decreases adult<