WorldWideScience

Sample records for adult human keratinocytes

  1. Rho kinase inhibitor y-27632 prolongs the life span of adult human keratinocytes, enhances skin equivalent development, and facilitates lentiviral transduction.

    NARCIS (Netherlands)

    Bogaard, E.H.J. van den; Rodijk-Olthuis, D.; Jansen, P.A.M.; Vlijmen-Willems, I.M.J.J. van; Erp, P.E.J. van; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.

    2012-01-01

    The use of tissue-engineered human skin equivalents (HSE) for fundamental research and industrial application requires the expansion of keratinocytes from a limited number of skin biopsies donated by adult healthy volunteers or patients. A pharmacological inhibitor of Rho-associated protein kinases,

  2. Human keratinocytes are vanilloid resistant.

    Directory of Open Access Journals (Sweden)

    László Pecze

    Full Text Available BACKGROUND: Use of capsaicin or resiniferatoxin (RTX as analgesics is an attractive therapeutic option. RTX opens the cation channel inflammatory pain/vanilloid receptor type 1 (TRPV1 permanently and selectively removes nociceptive neurons by Ca(2+-cytotoxicity. Paradoxically, not only nociceptors, but non-neuronal cells, including keratinocytes express full length TRPV1 mRNA, while patient dogs and experimental animals that underwent topical treatment or anatomically targeted molecular surgery have shown neither obvious behavioral, nor pathological side effects. METHODS: To address this paradox, we assessed the vanilloid sensitivity of the HaCaT human keratinocyte cell line and primary keratinocytes from skin biopsies. RESULTS: Although both cell types express TRPV1 mRNA, neither responded to vanilloids with Ca(2+-cytotoxicity. Only ectopic overproduction of TRPV1 rendered HaCaT cells sensitive to low doses (1-50 nM of vanilloids. The TRPV1-mediated and non-receptor specific Ca(2+-cytotoxicity ([RTX]>15 microM could clearly be distinguished, thus keratinocytes were indeed resistant to vanilloid-induced, TRPV1-mediated Ca(2+-entry. Having a wider therapeutic window than capsaicin, RTX was effective in subnanomolar range, but even micromolar concentrations could not kill human keratinocytes. Keratinocytes showed orders of magnitudes lower TRPV1 mRNA level than sensory ganglions, the bona fide therapeutic targets in human pain management. In addition to TRPV1, TRPV1b, a dominant negative splice variant was also noted in keratinocytes. CONCLUSION: TRPV1B expression, together with low TRPV1 expression, may explain the vanilloid paradox: even genuinely TRPV1 mRNA positive cells can be spared with therapeutic (up to micromolar doses of RTX. This additional safety information might be useful for planning future human clinical trials.

  3. Peroxisome Proliferator-Activated Receptor-alpha Is a Functional Target of p63 in Adult Human Keratinocytes

    DEFF Research Database (Denmark)

    Pozzi, Silvia; Boergesen, Michael; Sinha, Satrajit;

    2009-01-01

    healing process, is a target of p63 in human keratinocytes. Silencing of p63 by RNA interference and transient transfections showed that p63 represses PPARalpha through a functional region of promoter B. Chromatin immunoprecipitation analyses indicate that p63 is bound to this region, in the absence......p63 is a master switch in the complex network of signaling pathways controlling the establishment and maintenance of stratified epithelia. We provide evidence that peroxisome proliferator-activated receptor-alpha (PPARalpha), a ligand-activated nuclear receptor that participates in the skin wound...

  4. Karyotypic analysis of gene transformed human keratinocyte line

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    @@ INTRODUCTION In order to solve the difficult problem of long term in vitro culture of human keratinocytes, the technique of gene transfer was utilized to transform human keratinocytes with simian virus 40 (SV40).

  5. N-acetyltransferase in human skin and keratinocytes

    NARCIS (Netherlands)

    Vogel, Tanja; Bonifas, Jutta; Wiegman, Marjon; Pas, Hendrikus; Blömeke, Brunhilde; Coenraads, Pieter Jan; Schuttelaar, Marie-Louise

    2014-01-01

    Background: N-acetyltransferase 1 (NAT1) mediated Nacetylation in human skin and keratinocytes is an important detoxification pathway for aromatic amines including the strong sensitizer para-phenylenediamine (PPD), an important component of oxidative hair dyes. Objectives: Human skin and keratinocyt

  6. Human keratinocytes are efficiently immortalized by a Rho kinase inhibitor

    OpenAIRE

    Chapman, Sandra; Liu, Xuefeng; Meyers, Craig; Schlegel, Richard; Alison A McBride

    2010-01-01

    Primary human keratinocytes are useful for studying the pathogenesis of many different diseases of the cutaneous and mucosal epithelia. In addition, they can form organotypic tissue equivalents in culture that can be used as epidermal autografts for wound repair as well as for the delivery of gene therapy. However, primary keratinocytes have a finite lifespan in culture that limits their proliferative capacity and clinical use. Here, we report that treatment of primary keratinocytes (originat...

  7. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  8. Cyclooxygenases in human and mouse skin and cultured human keratinocytes: association of COX-2 expression with human keratinocyte differentiation

    Science.gov (United States)

    Leong, J.; Hughes-Fulford, M.; Rakhlin, N.; Habib, A.; Maclouf, J.; Goldyne, M. E.

    1996-01-01

    Epidermal expression of the two isoforms of the prostaglandin H-generating cyclooxygenase (COX-1 and COX-2) was evaluated both by immunohistochemistry performed on human and mouse skin biopsy sections and by Western blotting of protein extracts from cultured human neonatal foreskin keratinocytes. In normal human skin, COX-1 immunostaining is observed throughout the epidermis whereas COX-2 immunostaining increases in the more differentiated, suprabasilar keratinocytes. Basal cell carcinomas express little if any COX-1 or COX-2 immunostaining whereas both isozymes are strongly expressed in squamous cell carcinomas deriving from a more differentiated layer of the epidermis. In human keratinocyte cultures, raising the extracellular calcium concentration, a recognized stimulus for keratinocyte differentiation, leads to an increased expression of both COX-2 protein and mRNA; expression of COX-1 protein, however, shows no significant alteration in response to calcium. Because of a recent report that failed to show COX-2 in normal mouse epidermis, we also looked for COX-1 and COX-2 immunostaining in sections of normal and acetone-treated mouse skin. In agreement with a previous report, some COX-1, but no COX-2, immunostaining is seen in normal murine epidermis. However, following acetone treatment, there is a marked increase in COX-1 expression as well as the appearance of significant COX-2 immunostaining in the basal layer. These data suggest that in human epidermis as well as in human keratinocyte cultures, the expression of COX-2 occurs as a part of normal keratinocyte differentiation whereas in murine epidermis, its constitutive expression is absent, but inducible as previously published.

  9. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  10. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. PMID:27371895

  11. Quantitative analysis of laminin 5 gene expression in human keratinocytes.

    Science.gov (United States)

    Akutsu, Nobuko; Amano, Satoshi; Nishiyama, Toshio

    2005-05-01

    To examine the expression of laminin 5 genes (LAMA3, LAMB3, and LAMC2) encoding the three polypeptide chains alpha3, beta3, and gamma2, respectively, in human keratinocytes, we developed novel quantitative polymerase chain reaction (PCR) methods utilizing Thermus aquaticus DNA polymerase, specific primers, and fluorescein-labeled probes with the ABI PRISM 7700 sequence detector system. Gene expression levels of LAMA3, LAMB3, and LAMC2 and glyceraldehyde-3-phosphate dehydrogenase were quantitated reproducibly and sensitively in the range from 1 x 10(2) to 1 x 10(8) gene copies. Basal gene expression level of LAMB3 was about one-tenth of that of LAMA3 or LAMC2 in human keratinocytes, although there was no clear difference among immunoprecipitated protein levels of alpha3, beta3, and gamma2 synthesized in radio-labeled keratinocytes. Human serum augmented gene expressions of LAMA3, LAMB3, and LAMC2 in human keratinocytes to almost the same extent, and this was associated with an increase of the laminin 5 protein content measured by a specific sandwich enzyme-linked immunosorbent assay. These results demonstrate that the absolute mRNA levels generated from the laminin 5 genes do not determine the translated protein levels of the laminin 5 chains in keratinocytes, and indicate that the expression of the laminin 5 genes may be controlled by common regulation mechanisms. PMID:15854126

  12. Effects of UVB irradiation on keratinocyte growth factor (KGF) and receptor (KGFR) expression in cultured human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Y.; Lee, H.S.T.; Kooshesh, F.; Fujisawa, H.; Sauder, D.N.; Kondo, S. [Univ. of Toronto, Sunnybrook Health Science Centre, Div. of Dermatology, Toronto (Canada)

    1996-06-01

    Keratinocyte growth factor (KGF) and its receptor (KGFR) are thought to play important roles in normal keratinocyte growth and differentiation. Since UVB radiation is known to influence keratinocyte growth, we sought to determine whether UVB would alter the expression of KGF and KGFR. Using a reverse-transcription coupled polymerase chain reaction (RT-PCR), the present study examined the expression of KGF and KGFR mRNA in cultured normal human keratinocytes exposed to UVB irradiation. Total cellular RNA was extracted from cultured keratinocytes at various time points after irradiation, reverse transcribed and used for PCR amplification using primers specific for KGF and KGFR. Constitutive expression of KGFR mRNA, but not KGF mRNA, was detected in normal cultured human keratinocytes. After UVB irradiation at 300 J/m{sup 2}, the KGF mRNA remained undetectable while the KGFR mRNA level was significantly decreased. The down-regulation of KGFR mRNA expression was also confirmed by Northern blot analysis. Immunohistochemical studies demonstrated a decreased positive signal of KGFR in human keratinocytes after UVB irradiation. Our results suggest a possible role for the KGF-KGFR signalling pathway in the skin after exposure to UVB, and that UVB-induced growth inhibition of keratinocytes in hyperproliferative skin disorders may be related to downregulation of KGFR. (au) 39 refs.

  13. Ultraviolet B light-induced apoptosis in human keratinocytes enriched with epidermal stem cells and normal keratinocytes

    Institute of Scientific and Technical Information of China (English)

    MEI Xue-ling; LIAN Shi

    2011-01-01

    Background The stem-cell compartment is the primary target for the accumulation of oncogenic mutations.Overexposure to solar ultraviolet radiation is responsible for the development and progression of >90% of skin cancers.Ultraviolet B (UVB) light-induced keratinocyte apoptosis is a strong preventive mechanism against carcinogenesis. The aim of this study was to isolate keratinocytes enriched with putative human epidermal stem cells and to investigate their apoptotic induction by UVB.Methods Keratinocytes enriched with putative human epidermal stem cells were isolated by adherence to collagen Ⅳ and the expressions of β1-integrin and p63 were investigated. Keratinocytes enriched with putative human epidermal stem cells and normal keratinocytes were irradiated with UVB at 0-80 mJ/cm2. The apoptotic response was investigated with phase-contrast microscopy, Hoechst 33342 staining, flow cytometry of annexin V/PI, and procaspase-3 Western blotting.Results Keratinocyte enriched with stem cells expressed high levels of p63 protein and β1-integrin and low level of pan-keratin (C11). In comparison to non-irradiated cells, significant apoptosis of keratinocyte enriched with stem cells was found with 40 and 80 mJ/cm2 UVB. However, significant apoptosis of normal keratinocytes was only found for 80 mJ/cm2 UVB.Conclusions Human epidermal stem cells can undergo apoptosis in response to UVB radiation and are more susceptible than other keratinocytes. The method could be used in vitro studies of human epidermal stem cells.

  14. Neoplastic transformation of immortalized human epidermal keratinocytes by ionizing radiation.

    OpenAIRE

    Thraves, P; Salehi, Z; Dritschilo, A; Rhim, J S

    1990-01-01

    Efforts to investigate the progression of events that cause human cells to become neoplastic in response to ionizing radiation have been aided by the development of tissue culture systems of epithelial cells. In the present study, nontumorigenic human epidermal keratinocytes immortalized by adenovirus type 12 and simian virus 40 have been transformed by exposure to x-ray irradiation. Such transformants showed morphological alterations, formed colonies in soft agar, and induced carcinomas when...

  15. Effect of silver nanoparticles on human primary keratinocytes.

    Science.gov (United States)

    Szmyd, Radoslaw; Goralczyk, Anna Grazyna; Skalniak, Lukasz; Cierniak, Agnieszka; Lipert, Barbara; Filon, Francesca Larese; Crosera, Matteo; Borowczyk, Julia; Laczna, Eliza; Drukala, Justyna; Klein, Andrzej; Jura, Jolanta

    2013-01-01

    Silver nanoparticles (AgNPs) have many biological applications in biomedicine, biotechnology and other life sciences. Depending on the size, shape and the type of carrier, AgNPs demonstrate different physical and chemical properties. AgNPs have strong antimicrobial, antiviral and antifungal activity, thus they are used extensively in a range of medical settings, particularly in wound dressings but also in cosmetics. This study was undertaken to examine the potential toxic effects of 15 nm polyvinylpyrrolidone-coated AgNPs on primary normal human epidermal keratinocytes (NHEK). Cells were treated with different concentrations of AgNPs and then cell viability, metabolic activity and other biological and biochemical aspects of keratinocytes functioning were studied. We observed that AgNPs decrease keratinocyte viability, metabolism and also proliferatory and migratory potential of these cells. Moreover, longer exposure resulted in activation of caspase 3/7 and DNA damage. Our studies show for the first time, that AgNPs may present possible danger for primary keratinocytes, concerning activation of genotoxic and cytotoxic processes depending on the concentration.

  16. Transcriptional network of p63 in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Silvia Pozzi

    Full Text Available p63 is a transcription factor required for the development and maintenance of ectodermal tissues in general, and skin keratinocytes in particular. The identification of its target genes is fundamental for understanding the complex network of gene regulation governing the development of epithelia. We report a list of almost 1000 targets derived from ChIP on chip analysis on two platforms; all genes analyzed changed in expression during differentiation of human keratinocytes. Functional annotation highlighted unexpected GO terms enrichments and confirmed that genes involved in transcriptional regulation are the most significant. A detailed analysis of these transcriptional regulators in condition of perturbed p63 levels confirmed the role of p63 in the regulatory network. Rather than a rigid master-slave hierarchical model, our data indicate that p63 connects different hubs involved in the multiple specific functions of the skin.

  17. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  18. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  19. Arsenite suppression of BMP signaling in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Marjorie A.; Qin, Qin [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States); Hu, Qin; Zhao, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Rice, Robert H., E-mail: rhrice@ucdavis.edu [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States)

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  20. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  1. Micronucleus formation in human keratinocytes is dependent on radiation quality and tissue architecture.

    Science.gov (United States)

    Snijders, Antoine M; Mannion, Brandon J; Leung, Stanley G; Moon, Sol C; Kronenberg, Amy; Wiese, Claudia

    2015-01-01

    The cytokinesis-block micronucleus (MN) assay was used to assess the genotoxicity of low doses of different types of space radiation. Normal human primary keratinocytes and immortalized keratinocytes grown in 2D monolayers each were exposed to graded doses of 0.3 or 1.0 GeV/n silicon ions or similar energies of iron ions. The frequencies of induced MN were determined and compared to γ-ray data. RBE(max) values ranged from 1.6 to 3.9 for primary keratinocytes and from 2.4 to 6.3 for immortalized keratinocytes. At low radiation doses ≤ 0.4 Gy, 0.3 GeV/n iron ions were the most effective at inducing MN in normal keratinocytes. An "over-kill effect" was observed for 0.3 GeV/n iron ions at higher doses, wherein 1.0 GeV/n iron ions were most efficient in inducing MN. In immortalized keratinocytes, 0.3 GeV/n iron ions produced MN with greater frequency than 1.0 GeV/n iron ions, except at the highest dose tested. MN formation was higher in immortalized keratinocytes than in normal keratinocytes for all doses and radiation qualities investigated. MN induction was also assessed in human keratinocytes cultured in 3D to simulate the complex architecture of human skin. RBE values for MN formation in 3D were reduced for normal keratinocytes exposed to iron ions, but were elevated for immortalized keratinocytes. Overall, MN induction was significantly lower in keratinocytes cultured in 3D than in 2D. Together, the results suggest that tissue architecture and immortalization status modulate the genotoxic response to space radiation, perhaps via alterations in DNA repair fidelity. PMID:25041929

  2. Characterisation of human fibroblasts as keratinocyte feeder layer using p63 isoforms status.

    Science.gov (United States)

    Auxenfans, Céline; Thépot, Amélie; Justin, Virginie; Hautefeuille, Agnès; Shahabeddin, Lili; Damour, Odile; Hainaut, Pierre

    2009-01-01

    Large-scale culture of primary keratinocytes allows the production of large epidermal sheet surfaces for the treatment of extensive skin burns. This method is dependent upon the capacity to establish cultures of proliferating keratinocytes in conditions compatible with their clonal expansion while maintaining their capacity to differentiate into the typical squamous pattern of human epidermis. Feeder layers are critical in this process because the fibroblasts that compose this layer serve as a source of adhesion, growth and differentiation factors. In this report, we have characterise the expression patterns of p63 isoforms in primary keratinocytes cultured on two different feeder layer systems, murine 3T3 and human fibroblasts. We show that with the latter, keratinocytes express a higher ratio of Delta N to TAp63 isoform, in relation with higher clonogenic potential. These results indicate that human fibroblasts represent an adequate feeder layer system to support the culture of primary human keratinocytes. PMID:20042803

  3. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  4. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/106 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/106 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn+2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  5. Biologic mechanisms for the regulation of normal human keratinocyte proliferation and differentiation.

    OpenAIRE

    Wilke, M. S.; Hsu, B. M.; Wille, J J; Pittelkow, M R; Scott, R. E.

    1988-01-01

    Normal human keratinocytes can be grown in serum-free medium, and the integrated control of their proliferation and differentiation can be modulated experimentally. The growth of cultured human keratinocytes can also be specifically arrested at either reversible or irreversible growth arrest states. Reversible growth arrest is induced by culture in medium containing TGF-beta or ethionine or in medium deficient of isoleucine. Irreversible growth arrest is induced by culture in razoxane-contain...

  6. Human epidermal keratinocyte cell response on integrin-specific artificial extracellular matrix proteins.

    Science.gov (United States)

    Tjin, Monica Suryana; Chua, Alvin Wen Choong; Ma, Dong Rui; Lee, Seng Teik; Fong, Eileen

    2014-08-01

    Cell-matrix interactions play critical roles in regulating cellular behavior in wound repair and regeneration of the human skin. In particular, human skin keratinocytes express several key integrins such as alpha5beta1, alpha3beta1, and alpha2beta1 for binding to the extracellular matrix (ECM) present in the basement membrane in uninjured skin. To mimic these key integrin-ECM interactions, artificial ECM (aECM) proteins containing functional domains derived from laminin 5, type IV collagen, fibronectin, and elastin are prepared. Human skin keratinocyte cell responses on the aECM proteins are specific to the cell-binding domain present in each construct. Keratinocyte attachment to the aECM protein substrates is also mediated by specific integrin-material interactions. In addition, the aECM proteins are able to support the proliferation of keratinocyte stem cells, demonstrating their promise for use in skin tissue engineering.

  7. Genome-wide analysis of high risk human papillomavirus E2 proteins in human primary keratinocytes

    OpenAIRE

    Sunthamala, Nuchsupha; Pang, Chai Ling; Thierry, Francoise; Teissier, Sebastien; Pientong, Chamsai; Ekalaksananan, Tipaya

    2014-01-01

    The E2 protein is expressed in the early stage of human papillomavirus (HPV) infection that is associated with cervical lesions. This protein plays important roles in regulation of viral replication and transcription. To characterize the role of E2 protein in modulation of cellular gene expression in HPV infected cells, genome-wide expression profiling of human primary keratinocytes (HPK) harboring HPV16 E2 and HPV18 E2 was investigated using microarray. The Principle Components Analysis (PCA...

  8. Involucrin and envelope competence in human keratinocytes: Modulation by hydrocortisone, retinyl acetate and growth arrest

    OpenAIRE

    Rice, Rh; Cline, PR

    1983-01-01

    Involucrin accumulation and ionophore-assisted envelope for mation, markers of keratinocyte differentiation, were found to be highly dependent on culture conditions in the malignant epidermal keratinocyte line, SCC-13, derived from a human squamous cell carcinoma. In confluent cultures, approximately one-half of the cells were competent to form envelopes when grown in medium without hydrocortisone or retinyl acetate supplementation. Ad dition of hydrocortisone to the medi...

  9. Protective Effects of Triphala on Dermal Fibroblasts and Human Keratinocytes.

    Science.gov (United States)

    Varma, Sandeep R; Sivaprakasam, Thiyagarajan O; Mishra, Abheepsa; Kumar, L M Sharath; Prakash, N S; Prabhu, Sunil; Ramakrishnan, Shyam

    2016-01-01

    Human skin is body's vital organ constantly exposed to abiotic oxidative stress. This can have deleterious effects on skin such as darkening, skin damage, and aging. Plant-derived products having skin-protective effects are well-known traditionally. Triphala, a formulation of three fruit products, is one of the most important rasayana drugs used in Ayurveda. Several skin care products based on Triphala are available that claim its protective effects on facial skin. However, the skin protective effects of Triphala extract (TE) and its mechanistic action on skin cells have not been elucidated in vitro. Gallic acid, ellagic acid, and chebulinic acid were deduced by LC-MS as the major constituents of TE. The identified key compounds were docked with skin-related proteins to predict their binding affinity. The IC50 values for TE on human dermal fibroblasts (HDF) and human keratinocytes (HaCaT) were 204.90 ± 7.6 and 239.13 ± 4.3 μg/mL respectively. The antioxidant capacity of TE was 481.33 ± 1.5 mM Trolox equivalents in HaCaT cells. Triphala extract inhibited hydrogen peroxide (H2O2) induced RBC haemolysis (IC50 64.95 μg/mL), nitric oxide production by 48.62 ± 2.2%, and showed high reducing power activity. TE also rescued HDF from H2O2-induced damage; inhibited H2O2 induced cellular senescence and protected HDF from DNA damage. TE increased collagen-I, involucrin and filaggrin synthesis by 70.72 ± 2.3%, 67.61 ± 2.1% and 51.91 ± 3.5% in HDF or HaCaT cells respectively. TE also exhibited anti-tyrosinase and melanin inhibition properties in a dose-dependent manner. TE increased the mRNA expression of collagen-I, elastin, superoxide dismutase (SOD-2), aquaporin-3 (AQP-3), filaggrin, involucrin, transglutaminase in HDF or HaCaT cells, and decreased the mRNA levels of tyrosinase in B16F10 cells. Thus, Triphala exhibits protective benefits on skin cells in vitro and can be used as a potential ingredient in skin care formulations. PMID:26731545

  10. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  11. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  12. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  13. H(+)/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport.

    Science.gov (United States)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko; Akagawa, Mitsugu; Tsuji-Naito, Kentaro

    2016-07-01

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H(+) gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. PMID:27216463

  14. Basal and stress-inducible expression of HSPA6 in human keratinocytes is regulated by negative and positive promoter regions

    OpenAIRE

    Ramirez, Vincent P.; Stamatis, Michael; Shmukler, Anastasia; Aneskievich, Brian J.

    2014-01-01

    Epidermal keratinocytes serve as the primary barrier between the body and environmental stressors. They are subjected to numerous stress events and are likely to respond with a repertoire of heat shock proteins (HSPs). HSPA6 (HSP70B′) is described in other cell types with characteristically low to undetectable basal expression, but is highly stress induced. Despite this response in other cells, little is known about its control in keratinocytes. We examined endogenous human keratinocyte HSPA6...

  15. Human keratinocyte ATP2C1 localizes to the Golgi and controls Golgi Ca2+ stores

    OpenAIRE

    Behne, M J; Tu, Chia-Ling L; Aronchik, I; Epstein, E; Bench, G.; Bikle, D D; Pozzan, T; Mauro, T.M.

    2003-01-01

    Hailey-Hailey disease (MIM16960) is a blistering skin disease caused by mutations in the Ca2+ ATPase ATP2C1. We found that the abnormal Ca2+ signaling seen in Hailey-Hailey disease keratinocytes correlates with decreased protein levels of ATP2C1. Human ATP2C1 protein approximated 115 kDa in size. The ATP2C1 is localized to the Golgi apparatus in human keratinocytes, similar to its localization in yeast and Caenorhabditis elegans. To test whether the ATP2C1 controls Golgi Ca2+ stores, we measu...

  16. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Ramos-Jerz, Maria Del R; Villanueva, Socorro; Jerz, Gerold; Winterhalter, Peter; Deters, Alexandra M

    2013-01-01

    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  17. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts

    Directory of Open Access Journals (Sweden)

    Maria del R. Ramos-Jerz

    2013-01-01

    Full Text Available Methanolic avocado (Persea americana Mill., Lauraceae seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK and normal human dermal fibroblasts (NHDF. The methanol-water partition (M from avocado seeds and HSCCC fraction 3 (M.3 were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes.

  18. Human Keratinocyte Growth and Differentiation on Acellular Porcine Dermal Matrix in relation to Wound Healing Potential

    Directory of Open Access Journals (Sweden)

    Robert Zajicek

    2012-01-01

    Full Text Available A number of implantable biomaterials derived from animal tissues are now used in modern surgery. Xe-Derma is a dry, sterile, acellular porcine dermis. It has a remarkable healing effect on burns and other wounds. Our hypothesis was that the natural biological structure of Xe-Derma plays an important role in keratinocyte proliferation and formation of epidermal architecture in vitro as well as in vivo. The bioactivity of Xe-Derma was studied by a cell culture assay. We analyzed growth and differentiation of human keratinocytes cultured in vitro on Xe-Derma, and we compared the results with formation of neoepidermis in the deep dermal wounds treated with Xe-Derma. Keratinocytes cultured on Xe-Derma submerged in the culture medium achieved confluence in 7–10 days. After lifting the cultures to the air-liquid interface, the keratinocytes were stratified and differentiated within one week, forming an epidermis with basal, spinous, granular, and stratum corneum layers. Immunohistochemical detection of high-molecular weight cytokeratins (HMW CKs, CD29, p63, and involucrin confirmed the similarity of organization and differentiation of the cultured epidermal cells to the normal epidermis. The results suggest that the firm natural structure of Xe-Derma stimulates proliferation and differentiation of human primary keratinocytes and by this way improves wound healing.

  19. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Ramos-Jerz, Maria Del R; Villanueva, Socorro; Jerz, Gerold; Winterhalter, Peter; Deters, Alexandra M

    2013-01-01

    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes. PMID:24371457

  20. Isorhamnetin Protects Human Keratinocytes against Ultraviolet B-Induced Cell Damage

    Science.gov (United States)

    Han, Xia; Piao, Mei Jing; Kim, Ki Cheon; Madduma Hewage, Susara Ruwan Kumara; Yoo, Eun Sook; Koh, Young Sang; Kang, Hee Kyoung; Shin, Jennifer H; Park, Yeunsoo; Yoo, Suk Jae; Chae, Sungwook; Hyun, Jin Won

    2015-01-01

    Isorhamnetin (3-methylquercetin) is a flavonoid derived from the fruits of certain medicinal plants. This study investigated the photoprotective properties of isorhamnetin against cell damage and apoptosis resulting from excessive ultraviolet (UV) B exposure in human HaCaT keratinocytes. Isorhamnetin eliminated UVB-induced intracellular reactive oxygen species (ROS) and attenuated the oxidative modification of DNA, lipids, and proteins in response to UVB radiation. Moreover, isorhamnetin repressed UVB-facilitated programmed cell death in the keratinocytes, as evidenced by a reduction in apoptotic body formation, and nuclear fragmentation. Additionally, isorhamnetin suppressed the ability of UVB light to trigger mitochondrial dysfunction. Taken together, these results indicate that isorhamnetin has the potential to protect human keratinocytes against UVB-induced cell damage and death. PMID:26157553

  1. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  2. Sequential cultivation of human epidermal keratinocytes and dermal mesenchymal like stromal cells in vitro.

    Science.gov (United States)

    Mahabal, Shyam; Konala, Vijay Bhaskar Reddy; Mamidi, Murali Krishna; Kanafi, Mohammad Mahboob; Mishra, Suniti; Shankar, Krupa; Pal, Rajarshi; Bhonde, Ramesh

    2016-08-01

    Human skin has continuous self-renewal potential throughout adult life and serves as first line of defence. Its cellular components such as human epidermal keratinocytes (HEKs) and dermal mesenchymal stromal cells (DMSCs) are valuable resources for wound healing applications and cell based therapies. Here we show a simple, scalable and cost-effective method for sequential isolation and propagation of HEKs and DMSCs under defined culture conditions. Human skin biopsy samples obtained surgically were cut into fine pieces and cultured employing explant technique. Plated skin samples attached and showed outgrowth of HEKs. Gross microscopic examination displayed polygonal cells with a granular cytoplasm and H&E staining revealed archetypal HEK morphology. RT-PCR and immunocytochemistry authenticated the presence of key HEK markers including trans-membrane protein epithelial cadherin (E-cadherin), keratins and cytokeratin. After collection of HEKs by trypsin-EDTA treatment, mother explants were left intact and cultured further. Interestingly, we observed the appearance of another cell type with fibroblastic or stromal morphology which were able to grow up to 15 passages in vitro. Growth pattern, expression of cytoskeletal protein vimentin, surface proteins such as CD44, CD73, CD90, CD166 and mesodermal differentiation potential into osteocytes, adipocytes and chondrocytes confirmed their bonafide mesenchymal stem cell like status. These findings albeit preliminary may open up significant opportunities for novel applications in wound healing. PMID:25698160

  3. Establishment of a novel method for primary culture of normal human cervical keratinocytes

    Institute of Scientific and Technical Information of China (English)

    LIU Yu-zhen; L(U) Xiu-ping; PAN Zi-xuan; ZHANG Wei; CHEN Zhao-ri; WANG Hui; LIU Hua

    2013-01-01

    Background Cervical keratinocytes are recovered at a low numbers and frequently associated with contaminating human fibroblasts which rapidly overgrow the epithelial cells in culture with medium supplemented with 10% fetal bovine serum (FBS).However,it is difficult to initiate keratinocyte cultures with serum-free keratinocyte growth medium alone because cell attachment can be poor.Therefore,the culture of these cells is extremely difficult.In this study,we described a modified culture medium and coated culture plastics for growing normal human cervical epithelial cells in vitro.Methods Normal cervical epithelial tissue pieces were obtained and digested with type Ⅰ collagenase to dissociate the cells and a single cell suspension produced.The cells were cultured on plastic tissue culture substrate alone or substrate coated with collagen type Ⅰ from rat tail,with modified keratinocyte serum-free medium (K-SFM) supplemented with 5% FBS.After attachment,the medium were replaced with K-SFM without FBS.The expression of basal keratins of the ectocervical epithelium,K5,K14 and K19 were assayed by immunofiuorescence with monoclonal antibodies to identify the cell purity.Results Our results indicate that cells attached to the culture plastic more quickly in K-SFM supplemented with 5%FBS than in K-SFM alone,as well as to tissue culture plastic coated with collagen type Ⅰ than plastic alone.The modified medium composed of K-SFM and 5% FBS combined with a specific tissue culture plastic coated with collagen type Ⅰ from rat tail was the best method for culture of normal cervical epithelial cells.K5,K14 and K19 were assayed and keratinocyte purity was nearly 100%.Conclusion A novel,simple and effective method can be used to rapidly obtain highly purified keratinocytes from normal human cervical epithelium.

  4. Exogenous hydrogen sulfide promotes cell proliferation and differentiation by modulating autophagy in human keratinocytes.

    Science.gov (United States)

    Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen

    2016-04-01

    The effects and the underlying mechanisms of hydrogen sulfide (H2S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H2S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H2S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H2S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation.

  5. Improvement of human keratinocyte migration by a redox active bioelectric dressing.

    Directory of Open Access Journals (Sweden)

    Jaideep Banerjee

    Full Text Available Exogenous application of an electric field can direct cell migration and improve wound healing; however clinical application of the therapy remains elusive due to lack of a suitable device and hence, limitations in understanding the molecular mechanisms. Here we report on a novel FDA approved redox-active Ag/Zn bioelectric dressing (BED which generates electric fields. To develop a mechanistic understanding of how the BED may potentially influence wound re-epithelialization, we direct emphasis on understanding the influence of BED on human keratinocyte cell migration. Mapping of the electrical field generated by BED led to the observation that BED increases keratinocyte migration by three mechanisms: (i generating hydrogen peroxide, known to be a potent driver of redox signaling, (ii phosphorylation of redox-sensitive IGF1R directly implicated in cell migration, and (iii reduction of protein thiols and increase in integrinαv expression, both of which are known to be drivers of cell migration. BED also increased keratinocyte mitochondrial membrane potential consistent with its ability to fuel an energy demanding migration process. Electric fields generated by a Ag/Zn BED can cross-talk with keratinocytes via redox-dependent processes improving keratinocyte migration, a critical event in wound re-epithelialization.

  6. Improvement of human keratinocyte migration by a redox active bioelectric dressing.

    Science.gov (United States)

    Banerjee, Jaideep; Das Ghatak, Piya; Roy, Sashwati; Khanna, Savita; Sequin, Emily K; Bellman, Karen; Dickinson, Bryan C; Suri, Prerna; Subramaniam, Vish V; Chang, Christopher J; Sen, Chandan K

    2014-01-01

    Exogenous application of an electric field can direct cell migration and improve wound healing; however clinical application of the therapy remains elusive due to lack of a suitable device and hence, limitations in understanding the molecular mechanisms. Here we report on a novel FDA approved redox-active Ag/Zn bioelectric dressing (BED) which generates electric fields. To develop a mechanistic understanding of how the BED may potentially influence wound re-epithelialization, we direct emphasis on understanding the influence of BED on human keratinocyte cell migration. Mapping of the electrical field generated by BED led to the observation that BED increases keratinocyte migration by three mechanisms: (i) generating hydrogen peroxide, known to be a potent driver of redox signaling, (ii) phosphorylation of redox-sensitive IGF1R directly implicated in cell migration, and (iii) reduction of protein thiols and increase in integrinαv expression, both of which are known to be drivers of cell migration. BED also increased keratinocyte mitochondrial membrane potential consistent with its ability to fuel an energy demanding migration process. Electric fields generated by a Ag/Zn BED can cross-talk with keratinocytes via redox-dependent processes improving keratinocyte migration, a critical event in wound re-epithelialization.

  7. KGF-transfected cells can stimulate growth and proliferation of human cultured keratinocytes in vitro

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    Objective: To establish two stably KGF-transfected, immortalized cell lines. Methods: HaCaT-keratinocytes and KMST-6-fibroblasts were transfected by liposome mediated gene transfer. Transfection effectivity, gene integration and configuration of the transgenic protein were investigated by ELISA, DANN-PCR and β-Gal-staining. Results: Most effective GF producing clones were tested by a colorimetric XTT-test. Conclusion: This is a significant acceleration of cell proliferation and mitosis of human keratinocytes in an Air Liquid Interface (ALI) test system.

  8. Growth of human keratinocytes on hydrophilic film support and application to bioreactor culture

    Energy Technology Data Exchange (ETDEWEB)

    Knooka, M. (Osaka Univ., Suita (Japan)) Prenosil, J. (Swizerland Univ., Zurich (Switzerland))

    1998-10-01

    Human keratinocytes were cultured on an inert polymeric film support in serum-free medium to produce subconfluent autologous skin grafts for healing of burn wounds and chronic leg ulcers. The growth of keratinocytes in Petriperm with such a hydrophilic film bottom as a culture support was superior to that in T-flask owing to better cell adhesion. Based on this principle, an autonomous modular bioreactor, KERATOR for large scale production of skin grafts up to 5280 cm[sup 2] in size was constructed. It is computer controlled, and operations such as cell seeding and medium change are automated. The cell growth rate profiles in the bioreactor and Petriperm are similar, evincing the significance of KERATOR. The harvested skin grafts consist of the polymeric film covered by subconfluent sheets of non-differentiated keratinocyte cells. Such grafts may be applied to wounds in 'upside-down' fashion. 16 refs., 3 figs.

  9. Development of a full-thickness human gingiva equivalent constructed from immortalized keratinocytes and fibroblasts

    NARCIS (Netherlands)

    J.K. Buskermolen; C.M.A. Reijnders; S.W. Spiekstra; T. Steinberg; C.J. Kleverlaan; A.J. Feilzer; A.D. Bakker; S. Gibbs

    2016-01-01

    Organotypic models make it possible to investigate the unique properties of oral mucosa in vitro. For gingiva, the use of human primary keratinocytes (KC) and fibroblasts (Fib) is limited due to the availability and size of donor biopsies. The use of physiologically relevant immortalized cell lines

  10. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  11. Investigation on etretin effects on expression of Fas/FasL ligand and apoptosis in cultured human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Ping Liu; Shunsheng Tan; Yanping Xi; Zhenping Cao

    2005-01-01

    Objective: To further illuminate a possibme mechanism of Fas/FasL in the treatment of psoriasis, the expression of it and apoptosis of KC were investigated. Methods: With cell culture,immunocytochemistry, the expression of Fas/FasL protein after the treatment with etretin was observed in cultured human normal keratinocytes. Then, the state of apoptosis in cultured keratinocyte after stimuwasn't involved in apoptosis in cultured normol human keratinocytes. But during limited period, the apoptosis of KC could be induced by etretin, thus it can antagonize benign proliferate of keratinocytes. Our data showed up-regulation of the expression of Fas/FasL and apoptosis in cultured human keratinocytes stimulated by etretin, and its function may be involved in the therapeutic machanism of psoriasis.

  12. Transcriptional profiling of ectoderm specification to keratinocyte fate in human embryonic stem cells.

    Science.gov (United States)

    Tadeu, Ana Mafalda Baptista; Lin, Samantha; Hou, Lin; Chung, Lisa; Zhong, Mei; Zhao, Hongyu; Horsley, Valerie

    2015-01-01

    In recent years, several studies have shed light into the processes that regulate epidermal specification and homeostasis. We previously showed that a broad-spectrum γ-secretase inhibitor DAPT promoted early keratinocyte specification in human embryonic stem cells triggered to undergo ectoderm specification. Here, we show that DAPT accelerates human embryonic stem cell differentiation and induces expression of the ectoderm protein AP2. Furthermore, we utilize RNA sequencing to identify several candidate regulators of ectoderm specification including those involved in epithelial and epidermal development in human embryonic stem cells. Genes associated with transcriptional regulation and growth factor activity are significantly enriched upon DAPT treatment during specification of human embryonic stem cells to the ectoderm lineage. The human ectoderm cell signature identified in this study contains several genes expressed in ectodermal and epithelial tissues. Importantly, these genes are also associated with skin disorders and ectodermal defects, providing a platform for understanding the biology of human epidermal keratinocyte development under diseased and homeostatic conditions.

  13. Oligo- and polysaccharides exhibit a structure-dependent bioactivity on human keratinocytes in vitro.

    Science.gov (United States)

    Deters, Alexandra M; Lengsfeld, Christian; Hensel, Andreas

    2005-12-01

    In traditional medicine, a variety of plants with high carbohydrate contents were used for dermatological therapies. Contemporary investigations confirmed exogenous carbohydrates as biologically active. The recent study describes the characterization of oligo- and polysaccharides from medicinal herbs and evaluation of composite-dependent physiological activity of carbohydrates on human keratinocytes in vitro. Polysaccharide isolation was followed by size- and charge fractionation. Identification of monosaccharide components was performed by GLC/MS. Primary human keratinocytes (NHK) and cells of the cell line HaCaT were used for investigation of carbohydrate action on cellular proliferation (BrdU-uptake), differentiation specific enzymes (involucrin), cell viability (MTT-reduction) and cytotoxicity. Incubation of keratinocytes with a purified beta-glucan from Reed mace seeds resulted in an improved proliferation followed by an increased differentiation after contact inhibition. Fucosylated oligo- and polysaccharides of human milk and Sea weed induced involucrin expression as maker for early differentiation without an increase in proliferation. Cell viability and proliferation of keratinocytes were enhanced by an arabinogalactan of Kaki fruits. Okra fruit rhamnogalacturonans increased cell proliferation. Heart sease pectin-like polysaccharides reduced the proliferation significantly but improved the cell viability. These results led assume that the carbohydrates of traditional used herbs play a part in their efficacy. PMID:16111846

  14. Stress protein synthesis in human keratinocytes treated with sodium arsenite, phenyldichloroarsine, and nitrogen mustard

    International Nuclear Information System (INIS)

    Cells from bacteria to man respond to sublethal thermal and certain chemical stresses by synthesis of heat shock, or stress, proteins. The human epidermal keratinocyte is a target for a variety of cytotoxic substances. One response of cells exposed to such agents may be the synthesis of stress proteins. Human epidermal keratinocytes were treated thermally (43 degrees C) or chemically with sodium arsenite and the skin irritants phenyldichloroarsine and mechlorethamine. Proteins synthesized by keratinocytes were radiolabeled with [35S]methionine, separated on polyacrylamide gels under denaturing conditions, and visualized by fluorography. Quantitation by computer-assisted densitometry of fluorograms revealed different patterns of synthesis of two heat shock proteins (hsp's) with apparent molecular weights of 70 and 90 kDa after treatment with heat, sodium arsenite, phenyl-dichloroarsine, or mechlorethamine. Sodium arsenite induced the highest levels of synthesis of these two proteins, approximately 10-fold and 3-fold increases in hsp-70 and hsp-90, respectively. Phenyldichloroarsine at 0.5 microM produced a 2-fold increase in hsp-70 but no significant increase in hsp-90. Mechlorethamine, in contrast, had an apparent inhibitory effect on hsp-70 synthesis. These results suggest that some but not all skin irritants induce the synthesis of heat shock proteins in human keratinocytes

  15. Antimycotics suppress the Malassezia extract-induced production of CXC chemokine ligand 10 in human keratinocytes.

    Science.gov (United States)

    Hau, Carren S; Kanda, Naoko; Makimura, Koichi; Watanabe, Shinichi

    2014-02-01

    Malassezia, a lipophilic yeast, exacerbates atopic dermatitis. Malassezia products can penetrate the disintegrated stratum corneum and encounter subcorneal keratinocytes in the skin of atopic dermatitis patients. Type 1 helper T (Th1) cells infiltrate chronic lesions with atopic dermatitis, and antimycotic agents improve its symptoms. We aimed to identify Malassezia-induced chemokines in keratinocytes and examine whether antimycotics suppressed this induction. Normal human keratinocytes were incubated with a Malassezia restricta extract and antimycotics. Chemokine expression was analyzed by enzyme-linked immunosorbent assays and real-time polymerase chain reaction. Signal transducer and activator of transcription (STAT)1 activity was examined by luciferase assays. The tyrosine-phosphorylation of STAT1 was analyzed by western blotting. The M. restricta extract increased the mRNA and protein expression of Th1-attracting CXC chemokine ligand (CXCL)10 and STAT1 activity and phosphorylation in keratinocytes, which was suppressed by a Janus kinase inhibitor. The antimycotics itraconazole, ketoconazole, luliconazole, terbinafine, butenafine and amorolfine suppressed M. restricta extract-induced CXCL10 mRNA and protein expression and STAT1 activity and phosphorylation. These effects were similarly induced by 15-deoxy-Δ-(12,14) -prostaglandin J2 (15d-PGJ2 ), a prostaglandin D2 metabolite. Antimycotics increased the release of 15d-PGJ2 from keratinocytes. The antimycotic-induced suppression of CXCL10 production and STAT1 activity was counteracted by a lipocalin-type prostaglandin D synthase inhibitor. The antimycotics itraconazole, ketoconazole, luliconazole, terbinafine, butenafine and amorolfine may suppress the M. restricta-induced production of CXCL10 by inhibiting STAT1 through an increase in 15d-PGJ2 production in keratinocytes. These antimycotics may block the Th1-mediated inflammation triggered by Malassezia in the chronic phase of atopic dermatitis. PMID

  16. Keratinocytes as depository of ammonium-inducible glutamine synthetase: age- and anatomy-dependent distribution in human and rat skin.

    Directory of Open Access Journals (Sweden)

    Lusine Danielyan

    Full Text Available In inner organs, glutamine contributes to proliferation, detoxification and establishment of a mechanical barrier, i.e., functions essential for skin, as well. However, the age-dependent and regional peculiarities of distribution of glutamine synthetase (GS, an enzyme responsible for generation of glutamine, and factors regulating its enzymatic activity in mammalian skin remain undisclosed. To explore this, GS localization was investigated using immunohistochemistry and double-labeling of young and adult human and rat skin sections as well as skin cells in culture. In human and rat skin GS was almost completely co-localized with astrocyte-specific proteins (e.g. GFAP. While GS staining was pronounced in all layers of the epidermis of young human skin, staining was reduced and more differentiated among different layers with age. In stratum basale and in stratum spinosum GS was co-localized with the adherens junction component beta-catenin. Inhibition of, glycogen synthase kinase 3beta in cultured keratinocytes and HaCaT cells, however, did not support a direct role of beta-catenin in regulation of GS. Enzymatic and reverse transcriptase polymerase chain reaction studies revealed an unusual mode of regulation of this enzyme in keratinocytes, i.e., GS activity, but not expression, was enhanced about 8-10 fold when the cells were exposed to ammonium ions. Prominent posttranscriptional up-regulation of GS activity in keratinocytes by ammonium ions in conjunction with widespread distribution of GS immunoreactivity throughout the epidermis allows considering the skin as a large reservoir of latent GS. Such a depository of glutamine-generating enzyme seems essential for continuous renewal of epidermal permeability barrier and during pathological processes accompanied by hyperammonemia.

  17. Analysis of the response of human keratinocytes to Malassezia globosa and restricta strains.

    Science.gov (United States)

    Donnarumma, Giovanna; Perfetto, Brunella; Paoletti, Iole; Oliviero, Giovanni; Clavaud, Cécile; Del Bufalo, Aurelia; Guéniche, Audrey; Jourdain, Roland; Tufano, Maria Antonietta; Breton, Lionel

    2014-10-01

    Malassezia spp. are saprophyte yeasts involved in skin diseases with different degrees of severity. The aim of our study was to analyze the response of human epidermal keratinocytes to Malassezia globosa and restricta strains evaluating the host defence mechanisms induced by Malassezia spp. colonization. Our results showed a different modulation of the inflammatory and immunomodulatory cytokine pathways obtained with the different strains of Malassezia tested. In addition, this expression is altered by blocking the TLR2 receptor. In comparison with M. furfur, M. globosa and restricta displayed an unexpected and striking cytotoxicity on keratinocytes. The differences observed could be related to the different modalities of interaction between keratinocytes and Malassezia strains, but also to their growth condition. Taken together, these results indicate that M. globosa or M. restricta colonization exert a different control on the cytokine inflammatory response activated in the human keratinocyte in which TLR2 might be involved. M. globosa and M. restricta may play a synergistic role in the exacerbation of skin diseases in which both are found. PMID:25038621

  18. Enhancing effect of tazarotene on the HLA-DR expression of cultured human keratinocytes induced by interferon-gamma

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian-gan; TAN Sheng-shun

    2005-01-01

    Objective: To investigate the effect of tazarotene on the expression of HLA-DR induced by IFN-γ. Methods: (1) Keratinocytes from normal human skin were cultured in vitro;(2) Tazarotene, IFN-γ and the combination of the two compounds were incubated with the keratinocytes in medium, respectively. The expression of HLA-DR in keratinocytes was determined using immunocytochemistry techniques at 24h after incubation. Results: (1) There was rare expression of HLA-DR in normal human keratinocytes; (2) 10-6mol/L tazarotene failed to induce the expression of HLA-DR in keratinocytes at 24h after incubation; (3) 500 U/ml IFN-γ obviously induced the HLA-DR expression in keratinocytes at 24h after treatment; (4) After 24h, 10-7-10-5 mol/L tazarotene had a significantly enhancing effect on the expression of HLA-DR induced by IFN-γ (P<0.005). Conclusion: Tazarotene up-regulates the expression of HLA-DR in keratinocytes cultured in vitro when combined with IFN-γ . Therefore, the reduction of HLA-DR positive keratinocytes in psoriatic lesions may be attributed to not direct interaction of tazarotene in combination with IFN-γ but other pathways.

  19. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  20. Transcriptional Profiling of Ectoderm Specification to Keratinocyte Fate in Human Embryonic Stem Cells

    OpenAIRE

    Ana Mafalda Baptista Tadeu; Samantha Lin; Lin Hou; Lisa Chung; Mei Zhong; Hongyu Zhao; Valerie Horsley

    2015-01-01

    In recent years, several studies have shed light into the processes that regulate epidermal specification and homeostasis. We previously showed that a broad-spectrum γ-secretase inhibitor DAPT promoted early keratinocyte specification in human embryonic stem cells triggered to undergo ectoderm specification. Here, we show that DAPT accelerates human embryonic stem cell differentiation and induces expression of the ectoderm protein AP2. Furthermore, we utilize RNA sequencing to identify severa...

  1. Treatment of Hypertrophic Scar in Human with Autologous Transplantation of Cultured Keratinocytes and Fibroblasts along with Fibrin Glue

    Directory of Open Access Journals (Sweden)

    Ehsan Taghiabadi

    2015-04-01

    Full Text Available Objective: Hypertrophic scar involves excessive amounts of collagen in dermal layer and may be painful. Nowadays, we can’t be sure about effectiveness of procedure for hypertrophic scar management. The application of stem cells with natural scaffold has been the best option for treatment of burn wounds and skin defect, in recent decades. Fibrin glue (FG was among the first of the natural biomaterials applied to enhance skin deformity in burn patients. This study aimed to identify an efficient, minimally invasive and economical transplantation procedure using novel FG from human cord blood for treatment of hypertrophic scar and regulation collagen synthesis. Materials and Methods: In this case series study, eight patients were selected with hypertrophic scar due to full-thickness burns. Human keratinocytes and fibroblasts derived from adult skin donors were isolated and cultured. They were tested for the expression of cytokeratin 14 and vimentin using immunocytochemistry. FG was prepared from pooled cord blood. Hypertrophic scars were extensively excised then grafted by simply placing the sheet of FG containing autologous fibroblast and keratinocytes. Histological analyses were performed using Hematoxylin and eosin (H&E and Masson’s Trichrome (MT staining of the biopsies after 8 weeks. Results: Cultured keratinocytes showed a high level of cytokeratin 14 expression and also fibroblasts showed a high level of vimentin. Histological analyses of skin biopsies after 8 weeks of transplantation revealed re-epithelialization with reduction of hypertrophic scars in 2 patients. Conclusion: These results suggest may be the use of FG from cord blood, which is not more efficient than previous biological transporters and increasing hypertrophic scar relapse, but could lead to decrease pain rate.

  2. Self-Antigen Presentation by Keratinocytes in the Inflamed Adult Skin Modulates T-Cell Auto-Reactivity.

    Science.gov (United States)

    Meister, Michael; Tounsi, Amel; Gaffal, Evelyn; Bald, Tobias; Papatriantafyllou, Maria; Ludwig, Julia; Pougialis, Georg; Bestvater, Felix; Klotz, Luisa; Moldenhauer, Gerhard; Tüting, Thomas; Hämmerling, Günter J; Arnold, Bernd; Oelert, Thilo

    2015-08-01

    Keratinocytes have a pivotal role in the regulation of immune responses, but the impact of antigen presentation by these cells is still poorly understood, particularly in a situation where the antigen will be presented only in adult life. Here, we generated a transgenic mouse model in which keratinocytes exclusively present a myelin basic protein (MBP) peptide covalently linked to the major histocompatibility complex class II β-chain, solely under inflammatory conditions. In these mice, inflammation caused by epicutaneous contact sensitizer treatment resulted in keratinocyte-mediated expansion of MBP-specific CD4(+) T cells in the skin. Moreover, repeated contact sensitizer application preceding a systemic MBP immunization reduced the reactivity of the respective CD4(+) T cells and lowered the symptoms of the resulting experimental autoimmune encephalomyelitis. This downregulation was CD4(+) T-cell-mediated and dependent on the presence of the immune modulator Dickkopf-3. Thus, presentation of a neo self-antigen by keratinocytes in the inflamed, adult skin can modulate CD4(+) T-cell auto-aggression at a distal organ. PMID:25835957

  3. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation. PMID:24184596

  4. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation.

  5. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  6. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    International Nuclear Information System (INIS)

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  7. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  8. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  9. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  10. Induced multipotency in adult keratinocytes through down-regulation of ΔNp63 or DGCR8

    Science.gov (United States)

    Chakravarti, Deepavali; Su, Xiaohua; Cho, Min Soon; Bui, Ngoc Hoang Bao; Coarfa, Cristian; Venkatanarayan, Avinashnarayan; Benham, Ashley L.; Flores González, Ramón E.; Alana, Jennifer; Xiao, Weimin; Leung, Marco L.; Vin, Harina; Chan, Io Long; Aquino, Arianexys; Müller, Nicole; Wang, Hongran; Cooney, Austin J.; Parker-Thornburg, Jan; Tsai, Kenneth Y.; Gunaratne, Preethi H.; Flores, Elsa R.

    2014-01-01

    The roles of microRNAs (miRNAs) and the miRNA processing machinery in the regulation of stem cell biology are not well understood. Here, we show that the p53 family member and p63 isoform, ΔNp63, is a transcriptional activator of a cofactor critical for miRNA processing (DGCR8). This regulation gives rise to a unique miRNA signature resulting in reprogramming cells to multipotency. Strikingly, ΔNp63−/− epidermal cells display profound defects in terminal differentiation and express a subset of markers and miRNAs present in embryonic stem cells and fibroblasts induced to pluripotency using Yamanaka factors. Moreover, ΔNp63−/− epidermal cells transduced with an inducible DGCR8 plasmid can differentiate into multiple cell fates in vitro and in vivo. We found that human primary keratinocytes depleted of ΔNp63 or DGCR8 can be reprogrammed in 6 d and express a unique miRNA and gene expression signature that is similar but not identical to human induced pluripotent stem cells. Our data reveal a role for ΔNp63 in the transcriptional regulation of DGCR8 to reprogram adult somatic cells into multipotent stem cells. PMID:24449888

  11. Infection of human keratinocytes by Streptococcus dysgalactiae subspecies dysgalactiae isolated from milk of the bovine udder.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Alves-Barroco, Cynthia; Raposo, Luís R; Costa, Mafalda N; Fortunato, Elvira; Baptista, Pedro Viana; Fernandes, Alexandra R; Santos-Sanches, Ilda

    2016-04-01

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) are considered exclusive animal pathogens; however, a putative zoonotic upper limb cellulitis, a prosthetic joint infection and an infective endocarditis were described in humans. To unravel if bovine SDSD isolates are able to infect human cells, the adherence and internalization to human primary keratinocytes of two bovine SDSD strains isolated from milk collected from udder were analyzed. Bacterial adhesion assays and confocal microscopy indicate a high adherence and internalization of SDSD isolates to human cells, suggesting for the first time the ability of bovine isolates to infect human cells. PMID:26655883

  12. Effects of growth factors on the proliferation of human keratinocytes and fibroblasts in vitro.

    Science.gov (United States)

    Kim, D S; Korting, H C; Schäfer-Korting, M

    1998-01-01

    Growth/differentiation factor-5 (GDF-5) is a new member of the transforming growth factor-beta (TGF-beta) superfamily of multifunctional peptide growth factors that appear to mediate many key events in cell growth and development. The effects of GDF-5 and other growth factors (epidermal growth factor, EGF; TGF-beta 1) on the proliferation of human keratinocytes and fibroblasts compared with desoximetasone and calcipotriol have been investigated. The proliferation rate was determined by a hemocytometer, MTT assay and the incorporation of [3H]-thymidine. Moreover, cell cycle analyses were performed and the influence on interleukin-1 alpha (IL-1 alpha) production in keratinocytes was measured by enzyme-linked immunosorbent assay (ELISA) because of its pronounced proinflammatory effect. In keratinocytes, GDF-5 stimulated cell proliferation to a minor extent. The drug already proved to be effective at very low concentrations (0.1 ng/ml). Growth stimulatory effects with EGF have been observed only in keratinocyte basal medium (KBM), but not in keratinocyte growth medium (KGM). TGF-beta 1 markedly inhibited the proliferation of keratinocytes at concentrations > 1 ng/ml. Calcipotriol and desoximetasone also showed a dose-dependent cell growth inhibition in epidermal cell cultures. IL-1 alpha synthesis was greatly suppressed by calcipotriol 10(-8)-10(-6) M. EGF at 10 ng/ml, in contrast, strongly stimulated IL-1 alpha production. Neither GDF-5 nor TGF-beta 1 had a significant effect on IL-1 alpha production in keratinocyte monolayer cultures. In fibroblasts, GDF-5 induced very weak antiproliferative effects. Calcipotriol and desoximetasone also inhibited cell growth in fibroblast cultures whereas proliferation and DNA synthesis were strongly stimulated by 1 ng/ml EGF. There was, however, a contradiction between TGF-beta 1 results on fibroblasts. Whereas TGF-beta 1 increased proliferation in cell number determination and in the thymidine incorporation assay, MTT assays showed

  13. Human papillomavirus (HPV upregulates the cellular deubiquitinase UCHL1 to suppress the keratinocyte's innate immune response.

    Directory of Open Access Journals (Sweden)

    Rezaul Karim

    Full Text Available Persistent infection of basal keratinocytes with high-risk human papillomavirus (hrHPV may cause cancer. Keratinocytes are equipped with different pattern recognition receptors (PRRs but hrHPV has developed ways to dampen their signals resulting in minimal inflammation and evasion of host immunity for sustained periods of time. To understand the mechanisms underlying hrHPV's capacity to evade immunity, we studied PRR signaling in non, newly, and persistently hrHPV-infected keratinocytes. We found that active infection with hrHPV hampered the relay of signals downstream of the PRRs to the nucleus, thereby affecting the production of type-I interferon and pro-inflammatory cytokines and chemokines. This suppression was shown to depend on hrHPV-induced expression of the cellular protein ubiquitin carboxyl-terminal hydrolase L1 (UCHL1 in keratinocytes. UCHL1 accomplished this by inhibiting tumor necrosis factor receptor-associated factor 3 (TRAF3 K63 poly-ubiquitination which lead to lower levels of TRAF3 bound to TANK-binding kinase 1 and a reduced phosphorylation of interferon regulatory factor 3. Furthermore, UCHL1 mediated the degradation of the NF-kappa-B essential modulator with as result the suppression of p65 phosphorylation and canonical NF-κB signaling. We conclude that hrHPV exploits the cellular protein UCHL1 to evade host innate immunity by suppressing PRR-induced keratinocyte-mediated production of interferons, cytokines and chemokines, which normally results in the attraction and activation of an adaptive immune response. This identifies UCHL1 as a negative regulator of PRR-induced immune responses and consequently its virus-increased expression as a strategy for hrHPV to persist.

  14. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  15. COP1 contributes to UVB-induced signaling in human keratinocytes.

    Science.gov (United States)

    Kinyó, Agnes; Kiss-László, Zsuzsanna; Hambalkó, Szabolcs; Bebes, Attila; Kiss, Mária; Széll, Márta; Bata-Csörgo, Zsuzsanna; Nagy, Ferenc; Kemény, Lajos

    2010-02-01

    UVB irradiation has been shown to trigger a broad range of changes in gene expression in human skin; however, factors governing these events are still not well understood. In this study, we show that human constitutive photomorphogenic protein-1 (huCOP1), an E3 ligase, contributes to the orchestration of UVB response of keratinocytes. Accordingly, our data show that (i) huCOP1 protein is expressed both in the nucleus and in the cytoplasm of cultured keratinocytes, (ii) UVB reduces the levels of the huCOP1 mRNA and protein, and (iii) induces changes in the subcellular localization of huCOP1. Finally, we show that gene-specific silencing of huCOP1 induces the accumulation of the tumor suppressor p53 protein, which is further increased after UVB irradiation.

  16. Isorhamnetin Protects Human Keratinocytes against Ultraviolet B-Induced Cell Damage

    OpenAIRE

    Han, Xia; Piao, Mei Jing; Kim, Ki Cheon; Madduma Hewage, Susara Ruwan Kumara; Yoo, Eun Sook; Koh, Young Sang; Kang, Hee Kyoung; Shin, Jennifer H.; PARK, YEUNSOO; Yoo, Suk Jae; Chae, Sungwook; Hyun, Jin Won

    2015-01-01

    Isorhamnetin (3-methylquercetin) is a flavonoid derived from the fruits of certain medicinal plants. This study investigated the photoprotective properties of isorhamnetin against cell damage and apoptosis resulting from excessive ultraviolet (UV) B exposure in human HaCaT keratinocytes. Isorhamnetin eliminated UVB-induced intracellular reactive oxygen species (ROS) and attenuated the oxidative modification of DNA, lipids, and proteins in response to UVB radiation. Moreover, isorhamnetin repr...

  17. Metabolism of the Antibacterial Triclocarban by Human Epidermal Keratinocytes to Yield Protein Adducts

    OpenAIRE

    Schebb, Nils Helge; Buchholz, Bruce A.; Hammock, Bruce D.; Rice, Robert H.

    2012-01-01

    Previous studies of triclocarban suggest that its biotransformation could yield reactive metabolites that form protein adducts. Since the skin is the major route of triclocarban exposure, present work examined this possibility in cultured human keratinocytes. The results provide evidence for considerable biotransformation and protein adduct formation when cytochrome P450 activity is induced in the cells by TCDD, a model Ah receptor ligand. Since detecting low adduct levels in cells and tissue...

  18. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  19. Biological properties of differently-aged human keratinocytes:population doubling time growth curve and cell cycle analysis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective To explore the biological properties of keratinocytes from differently-aged healthy human beings. Methods Keratinocytes from fetus,teenager and middle-aged groups were separated and cultured. The population doubling time (PDT) and cell growth curve in different cells were compared,and the cell cycles were analyzed by flow cytometry. Results ① In primary culture of keratinocytes,the adherence time in middle-aged group was longer than that in fetus and teenager groups. However,all cell morphology sh...

  20. Primary cell culture from human oral tissue: gingival keratinocytes,gingival fibroblasts and periodontal ligament fibroblasts

    Directory of Open Access Journals (Sweden)

    Supreya Wanichpakorn

    2010-08-01

    Full Text Available Primary cell culture of human oral tissue has many applications for oral biology research. There are two techniques in primary culture, which includes the enzymatic and direct explant technique. The objectives of this study were (1 to isolate and investigate the difference in percentage the success in culturing three cell types from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts by using the direct explant technique; (2 to compare the effect of sex and age on the success of tissue culturing. Twenty seven tissue samples were obtained from healthy human gingival tissue, 19 female and 8 male patients aged 14-67 years (37.7±17.5. The tissue was cut into 1x1 mm pieces and placed on plastic culture plates containing Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin and 1% amphotericin B. For the keratinocytes culture, after the epithelial cells started to multiply around the gingival origin and the diameter was 2-5 mm., the fibroblasts were liminated by mechanical removal under inverted microscope to prevent fibroblast overgrowth and the medium was changed to keratinocyte-SFM (Gibco, BRL supplemented with 5 µg/ml gentamycin. The results revealed that gingival fibroblast gave the highest success rate in culture (96.3%, followed by gingival keratinocytes (88.9% and periodontal ligament fibroblasts (81.5%. There was no significant difference in the success rate of cultivation between younger and older individuals, as between sex of the subjects (p>0.05. The risk of failure in culture techniques is mainly caused by microbiological contamination from the tissue samples.

  1. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  2. Impact of AQP3 inducer treatment on cultured human keratinocytes, ex vivo human skin and volunteers.

    Science.gov (United States)

    Garcia, N; Gondran, C; Menon, G; Mur, L; Oberto, G; Guerif, Y; Dal Farra, C; Domloge, N

    2011-10-01

    One of the main functions of the skin is to protect the organism against environmental threats, such as thermal stress. Aquaporin-3 (AQP3) facilitates water and glycerol transport across cell membranes and therefore regulates osmotic balance in different situations of stress. This mechanism seems to be particularly important for the resistance of different organisms to cold stress. Consequently, we were interested in investigating the effect of cold and osmotic stress on AQP3 expression in normal human keratinocytes. We developed a new active ingredient to stimulate aquaporins in skin and demonstrated the partial restoration of AQP3 expression in keratinocytes transfected with AQP3 siRNA. Moreover, we examined the effect of cold stress on cell morphology and the impact of a pre-treatment with the active ingredient. Our results indicated that induction of AQP3 helped maintain a correct organization of the actin cytoskeleton, preserving cell morphology and preventing cells from rounding. Immunofluorescent staining revealed cytoplasmic localization of AQP3 and its translocation to the cell membrane following osmotic stress. Histological ex vivo studies of skin under different conditions, such as cold environment and tape-stripping, indicated that increase in AQP3 expression appears to be involved in skin protection and showed that the pattern of AQP3 expression was more enhanced in the active ingredient-treated samples. In vivo confocal microscopy by Vivascope showed a generally healthier appearance of the skin in the treated areas. These results attest to the potential value of the active ingredient in optimizing environmental stress resistance and protecting the skin from stratum corneum damage.

  3. Impact of AQP3 inducer treatment on cultured human keratinocytes, ex vivo human skin and volunteers.

    Science.gov (United States)

    Garcia, N; Gondran, C; Menon, G; Mur, L; Oberto, G; Guerif, Y; Dal Farra, C; Domloge, N

    2011-10-01

    One of the main functions of the skin is to protect the organism against environmental threats, such as thermal stress. Aquaporin-3 (AQP3) facilitates water and glycerol transport across cell membranes and therefore regulates osmotic balance in different situations of stress. This mechanism seems to be particularly important for the resistance of different organisms to cold stress. Consequently, we were interested in investigating the effect of cold and osmotic stress on AQP3 expression in normal human keratinocytes. We developed a new active ingredient to stimulate aquaporins in skin and demonstrated the partial restoration of AQP3 expression in keratinocytes transfected with AQP3 siRNA. Moreover, we examined the effect of cold stress on cell morphology and the impact of a pre-treatment with the active ingredient. Our results indicated that induction of AQP3 helped maintain a correct organization of the actin cytoskeleton, preserving cell morphology and preventing cells from rounding. Immunofluorescent staining revealed cytoplasmic localization of AQP3 and its translocation to the cell membrane following osmotic stress. Histological ex vivo studies of skin under different conditions, such as cold environment and tape-stripping, indicated that increase in AQP3 expression appears to be involved in skin protection and showed that the pattern of AQP3 expression was more enhanced in the active ingredient-treated samples. In vivo confocal microscopy by Vivascope showed a generally healthier appearance of the skin in the treated areas. These results attest to the potential value of the active ingredient in optimizing environmental stress resistance and protecting the skin from stratum corneum damage. PMID:21401652

  4. Long-term subculture of human keratinocytes under an anoxic condition.

    Science.gov (United States)

    Kino-oka, Masahiro; Agatahama, Yuka; Haga, Yuki; Inoie, Masukazu; Taya, Masahito

    2005-07-01

    The serial subculturing of human keratinocyte cells under the anoxic and normoxic conditions was examined. The cumulative number of population doublings in the subcultures under the former condition increased 2.1-fold while maintaining an appreciable growth rate of cells, as compared with that under the latter condition. Moreover, the migration ability, which was estimated by the rotation rate of paired cells, was maintained accompanied by fully developed filopodia of F-actin filaments under the anoxic condition, despite of the poor development of stress fibers at the center of the cellular body. The cells passaged under the anoxic condition possessed the sufficient clonogenic potential to form epithelial sheets, supporting the view that the long-term subculture of keratinocytes under the anoxic condition can be applied for cell expansion in the practical production of epithelial sheets.

  5. In vitro human keratinocyte migration rates are associated with SNPs in the KRT1 interval.

    Directory of Open Access Journals (Sweden)

    Heng Tao

    Full Text Available Efforts to develop effective therapeutic treatments for promoting fast wound healing after injury to the epidermis are hindered by a lack of understanding of the factors involved. Re-epithelialization is an essential step of wound healing involving the migration of epidermal keratinocytes over the wound site. Here, we examine genetic variants in the keratin-1 (KRT1 locus for association with migration rates of human epidermal keratinocytes (HEK isolated from different individuals. Although the role of intermediate filament genes, including KRT1, in wound activated keratinocytes is well established, this is the first study to examine if genetic variants in humans contribute to differences in the migration rates of these cells. Using an in vitro scratch wound assay we observe quantifiable variation in HEK migration rates in two independent sets of samples; 24 samples in the first set and 17 samples in the second set. We analyze genetic variants in the KRT1 interval and identify SNPs significantly associated with HEK migration rates in both samples sets. Additionally, we show in the first set of samples that the average migration rate of HEK cells homozygous for one common haplotype pattern in the KRT1 interval is significantly faster than that of HEK cells homozygous for a second common haplotype pattern. Our study demonstrates that genetic variants in the KRT1 interval contribute to quantifiable differences in the migration rates of keratinocytes isolated from different individuals. Furthermore we show that in vitro cell assays can successfully be used to deconstruct complex traits into simple biological model systems for genetic association studies.

  6. Sodium Dodecyl Sulfate and C31G as Microbicidal Alternatives to Nonoxynol 9: Comparative Sensitivity of Primary Human Vaginal Keratinocytes

    OpenAIRE

    Krebs, Fred C.; Miller, Shendra R.; Catalone, Bradley J.; Welsh, Patricia A.; Malamud, Daniel; Howett, Mary K; Wigdahl, Brian

    2000-01-01

    A broad-spectrum vaginal microbicide must be effective against a variety of sexually transmitted disease pathogens and be minimally toxic to the cell types found within the vaginal epithelium, including vaginal keratinocytes. We assessed the sensitivity of primary human vaginal keratinocytes to potential topical vaginal microbicides nonoxynol-9 (N-9), C31G, and sodium dodecyl sulfate (SDS). Direct immunofluorescence and fluorescence-activated cell sorting analyses demonstrated that primary va...

  7. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    Energy Technology Data Exchange (ETDEWEB)

    Senthilkumar, P.K. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Robertson, L.W. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States); Ludewig, G., E-mail: Gabriele-ludewig@uiowa.edu [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States)

    2012-02-15

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  8. Alcohol metabolism by oral streptococci and interaction with human papillomavirus leads to malignant transformation of oral keratinocytes.

    Science.gov (United States)

    Tao, Lin; Pavlova, Sylvia I; Gasparovich, Stephen R; Jin, Ling; Schwartz, Joel

    2015-01-01

    Poor oral hygiene, ethanol consumption, and human papillomavirus (HPV) are associated with oral and esophageal cancers. However, the mechanism is not fully known. This study examines alcohol metabolism in Streptococcus and its interaction with HPV-16 in the malignant transformation of oral keratinocytes. The acetaldehyde-producing strain Streptococcus gordonii V2016 was analyzed for adh genes and activities of alcohol and aldehyde dehydrogenases. Streptococcus attachment to immortalized HPV-16 infected human oral keratinocytes, HOK (HPV/HOK-16B), human oral buccal keratinocytes, and foreskin keratinocytes was studied. Acetaldehyde, malondialdehyde, DNA damage, and abnormal proliferation among keratinocytes were also quantified. We found that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB, and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol, and ethanol, respectively. S. gordonii V2016 did not show a detectable aldehyde dehydrogenase. AdhE is the major alcohol dehydrogenase in S. gordonii. Acetaldehyde and malondialdehyde production from permissible Streptococcus species significantly increased the bacterial attachment to keratinocytes, which was associated with an enhanced expression of furin to facilitate HPV infection and several malignant phenotypes including acetaldehyde adduct formation, abnormal proliferation, and enhanced migration through integrin-coated basement membrane by HPV-infected oral keratinocytes. Therefore, expression of multiple alcohol dehydrogenases with no functional aldehyde dehydrogenase contributes to excessive production of acetaldehyde from ethanol by oral streptococci. Oral Streptococcus species and HPV may cooperate to transform oral keratinocytes after ethanol exposure. These results suggest a significant clinical interaction, but further validation is warranted.

  9. Effects of Arsenic on Cell Proliferation and Its Related Gene Expression in Human Epidermal Keratinocyte

    Institute of Scientific and Technical Information of China (English)

    顾军; 毕新岭; 米庆胜; 文军慧

    2002-01-01

    Objective:To study the effects of low concentration of arsenic (As2O3) on DNA synthesisand related transcription factor gene E2F1 expression in keratinocyte. Methods: Human epidermal kerati-nocyte (cell line HaCaT) cultured in vitro was used. After treatment with various concentrations of arse-nic, DNA synthesis and E2F1 expression in HaCaT cells were detected by using 3 H-TdR method and RT-PCR. Results: Arsenic caused a modest increase of keratinocyte DNA synthesis when the concentrationreached the range within 0.5-16 nmol/L, but the amount of incorporated 3 H-TdR decreased and returnedto baseline level when the concentration of arsenic increased to over 16 nmol/L. RT-PCR analysis showedthe level of E2F1 mRNA was elevated in HaCaT cells with the increase of DNA synthesis. Conclusion:Ar-senic of a certain concentration could increase DNA synthesis and enhance E2F1 expression in HaCaT cellline, which might be one of the pathological mechanisms of skin disease related to arsenic.

  10. Biphasic effects of minoxidil on the proliferation and differentiation of normal human keratinocytes.

    Science.gov (United States)

    Boyera, N; Galey, I; Bernard, B A

    1997-01-01

    Minoxidil is the most used drug with proved effects in the treatment of androgenetic alopecia (AGA), but little is known about its pharmacological activity and target cells in hair follicles. As AGA is characterized by follicle atrophy, accelerated hair cycles and hair fiber thinning, we postulated that keratinocyte proliferation/differentiation is affected and we tested Minoxidil's effects on those parameters. Normal human keratinocytes (NHK) of follicular or epidermal origin were cultured in the presence of Minoxidil (0, 0.1, 1, 10, 100, 1,000 microM) during 5-8 days in various media (high-/low-calcium content, with or without serum). Proliferation was assessed by mitochondrial dehydrogenase activity (XTT), BrdU incorporation, lysosome numeration (neutral red incorporation) and total protein dosage. Drug-induced cytotoxicity was measured by lactate dehydrogenase release in culture supernatant, and pro-differentiating effects were evaluated by relative involucrin expression (ELISA dosage). On this basis, we showed that Minoxidil had biphasic effects on the proliferation and differentiation of NHK: Minoxidil stimulated NHK proliferation at micromolar doses, while antiproliferative, pro-differentiative and partially cytotoxic effects were observed with millimolar concentrations. We can hypothesize that Minoxidil hypertrichotic activity in vivo is possibly mediated by the maintenance of proliferative potential in follicular keratinocytes precociously committed to differentiation. PMID:9413895

  11. Multi-layered culture of human skin fibroblasts and keratinocytes through three-dimensional freeform fabrication.

    Science.gov (United States)

    Lee, Wonhye; Debasitis, Jason Cushing; Lee, Vivian Kim; Lee, Jong-Hwan; Fischer, Krisztina; Edminster, Karl; Park, Je-Kyun; Yoo, Seung-Schik

    2009-03-01

    We present a method to create multi-layered engineered tissue composites consisting of human skin fibroblasts and keratinocytes which mimic skin layers. Three-dimensional (3D) freeform fabrication (FF) technique, based on direct cell dispensing, was implemented using a robotic platform that prints collagen hydrogel precursor, fibroblasts and keratinocytes. A printed layer of cell-containing collagen was crosslinked by coating the layer with nebulized aqueous sodium bicarbonate. The process was repeated in layer-by-layer fashion on a planar tissue culture dish, resulting in two distinct cell layers of inner fibroblasts and outer keratinocytes. In order to demonstrate the ability to print and culture multi-layered cell-hydrogel composites on a non-planar surface for potential applications including skin wound repair, the technique was tested on a poly(dimethylsiloxane) (PDMS) mold with 3D surface contours as a target substrate. Highly viable proliferation of each cell layer was observed on both planar and non-planar surfaces. Our results suggest that organotypic skin tissue culture is feasible using on-demand cell printing technique with future potential application in creating skin grafts tailored for wound shape or artificial tissue assay for disease modeling and drug testing. PMID:19108884

  12. The effect of the plasma needle on the human keratinocytes related to the wound healing process

    Science.gov (United States)

    Korolov, Ihor; Fazekas, Barbara; Széll, Márta; Kemény, Lajos; Kutasi, Kinga

    2016-01-01

    In the present study we aim to verify the influence of a non-thermal atmospheric pressure plasma on the wound healing process. In this process the major contributors are the keratinocytes, which migrate to fill in the gap created by the wound. Therefore, we performed the direct treatment of HPV-immortalized human keratinocytes, protected by a layer of phosphate buffered saline (PBS) solution, with the glow discharge generated in flowing helium by a plasma needle. To mimick a wound, a 4 mm scratch was performed on the cell culture (scratch assay). We conducted two types of experiments: (i) cell proliferation and (ii) wound-healing model experiments. The plasma needle configuration, the plasma treatment conditions and the thickness of the protecting PBS layer were set based on viability experiments. The proliferation studies showed that short, 5-10 s, and low power treatments, such as 18 W and 20 W input power, could positively influence the cell proliferation when keratinocytes were protected by PBS. On the other hand, the plasma treatment of cell medium covered keratinocytes resulted in the decrease of proliferation. The wound-healing model (scratch assay) studies showed, that there was a maximum in the wound reduction as a function of the input power and treatment time, namely, at 18 W and 5 s. Furthermore, the wound reduction strongly depended on the treated cell—PBS interaction time. To mimic an infected wound, the scratch assay was covered with a 1× {{10}9} cfu ml-1 Propionibacterium acnes suspension. The plasma treatment of this infected assay resulted in closing of the scratch, while in the non-treated assay the wound did not close at all.

  13. The expressions of ABCC4 and ABCG2 xenobiotic transporters in human keratinocytes are proliferation-related.

    Science.gov (United States)

    Bebes, Attila; Kis, Kornélia; Nagy, Tünde; Kurunczi, Anita; Polyánka, Hilda; Bata-Csörgo, Zsuzsanna; Kemény, Lajos; Dobozy, Attila; Széll, Márta

    2012-01-01

    Xenobiotic transporters of the ATP-binding cassette (ABC) protein superfamily play important roles in maintaining the biochemical barrier of various tissues, but their precise functions in the skin are not yet known. Screening of the expressions of the known xenobiotic transporter genes in two in vitro keratinocyte differentiation models revealed that the ABCC4 and ABCG2 transporters are highly expressed in proliferating keratinocytes, their expressions decreasing along with differentiation. Abrogation of the ABCC4 and ABCG2 protein functions by siRNA-mediated silencing and chemical inhibition did not affect the proliferation of HaCaT cells. In contrast, disruption of the ABCG2 function had no effect on normal human epidermal keratinocyte proliferation, while the inhibition of ABCC-type transporters by probenecid resulted in a striking decrease in the proliferation of the cells. These results indicate that, besides their possible therapy-modulating effects, xenobiotic transporters may contribute significantly to other keratinocyte functions, such as cell proliferation.

  14. Mu-opiate receptor and Beta-endorphin expression in nerve endings and keratinocytes in human skin.

    Science.gov (United States)

    Bigliardi-Qi, M; Sumanovski, L T; Büchner, S; Rufli, T; Bigliardi, P L

    2004-01-01

    We have previously shown that human epidermal keratinocytes express a functionally active micro-opiate receptor, which adds a new dimension to the recently developed research in neuroimmunodermatology and neurogenic inflammation in skin diseases. Human keratinocytes specifically bind and also produce beta-endorphin, the endogenous micro-opiate receptor ligand. Using confocal imaging microscopy, we could now demonstrate that micro-opiate receptors are not only expressed in keratinocytes, but also on unmyelinated peripheral nerve fibers in the dermis and epidermis. Some of the peripheral nerve fibers also express the ligand beta-endorphin. The keratinocytes positive for beta-endorphin staining are clustered around the terminal ends of the unmyelinated nerve fibers. Therefore the opiate receptor system seems to be crucial in the direct communication between nerves and skin. The keratinocytes can influence the unmyelinated nerve fibers in the epidermis directly via secreting beta-endorphin. On the other hand, nerve fibers can also secrete beta-endorphin and influence the migration, differentiation and probably also the cytokine production pattern of keratinocytes.

  15. Genome-wide analysis of high risk human papillomavirus E2 proteins in human primary keratinocytes.

    Science.gov (United States)

    Sunthamala, Nuchsupha; Pang, Chai Ling; Thierry, Francoise; Teissier, Sebastien; Pientong, Chamsai; Ekalaksananan, Tipaya

    2014-12-01

    The E2 protein is expressed in the early stage of human papillomavirus (HPV) infection that is associated with cervical lesions. This protein plays important roles in regulation of viral replication and transcription. To characterize the role of E2 protein in modulation of cellular gene expression in HPV infected cells, genome-wide expression profiling of human primary keratinocytes (HPK) harboring HPV16 E2 and HPV18 E2 was investigated using microarray. The Principle Components Analysis (PCA) revealed that the expression data of HPV16 E2 and HPV18 E2-transduced HPKs were rather closely clustered. The Venn diagram of modulated genes showed an overlap of 10 common genes in HPV16 E2 expressing HPK and HPV18 E2 expressing HPK. These genes were expressed with significant difference by comparison with control cells. In addition, the distinct sets of modulated genes were detected 14 and 34 genes in HPV16 E2 and HPV18 E2 expressing HPKs, respectively. PMID:26484085

  16. Genome-wide analysis of high risk human papillomavirus E2 proteins in human primary keratinocytes

    Directory of Open Access Journals (Sweden)

    Nuchsupha Sunthamala

    2014-12-01

    Full Text Available The E2 protein is expressed in the early stage of human papillomavirus (HPV infection that is associated with cervical lesions. This protein plays important roles in regulation of viral replication and transcription. To characterize the role of E2 protein in modulation of cellular gene expression in HPV infected cells, genome-wide expression profiling of human primary keratinocytes (HPK harboring HPV16 E2 and HPV18 E2 was investigated using microarray. The Principle Components Analysis (PCA revealed that the expression data of HPV16 E2 and HPV18 E2-transduced HPKs were rather closely clustered. The Venn diagram of modulated genes showed an overlap of 10 common genes in HPV16 E2 expressing HPK and HPV18 E2 expressing HPK. These genes were expressed with significant difference by comparison with control cells. In addition, the distinct sets of modulated genes were detected 14 and 34 genes in HPV16 E2 and HPV18 E2 expressing HPKs, respectively.

  17. Transcriptional repression in normal human keratinocytes by wild-type and mutant p53.

    Science.gov (United States)

    Alvarez-Salas, L M; Velazquez, A; Lopez-Bayghen, E; Woodworth, C D; Garrido, E; Gariglio, P; DiPaolo, J A

    1995-05-01

    Wild-type p53 is a nuclear phosphoprotein that inhibits cell proliferation and represses transcriptionally most TATA box-containing promoters in transformed or tumor-derived cell lines. This study demonstrates that p53 alters transcription of the long control region (LCR) of human papillomavirus type 18 (HPV-18). Wild-type and mutant p53 143Val to Ala repressed the HPV-18 LCR promoter in normal human keratinocytes, the natural host cell for HPV infections. Repression by wild-type p53 was also observed in C-33A cells and in an HPV-16-immortalized cell line with an inducible wild-type p53. However, when C-33A cells were cotransfected with the HPV-18 LCR and mutant 143Val to Ala, repression did not occur. Mutant p53 135Cys to Ser did not induce repression in either normal human keratinocytes or in the C-33A line; although like 143Val to Ala, it is thought to affect the DNA binding activity of the wild-type protein. The ability of mutant p53 143Val to Ala to inactivate the HPV early promoter in normal cells (by approximately 60% reduction) suggests that this mutant may be able to associate with wild-type p53 and interact with TATA box-binding proteins. Therefore, these results demonstrate that the transcriptional activities of p53 mutants may be dependent upon the cell type assayed and the form of its endogenous p53. Furthermore, normal human keratinocytes represent an alternative model for determining the activities of p53 mutants.

  18. Gut bacteria producing phenols disturb keratinocyte differentiation in human skin

    OpenAIRE

    Iizuka, Ryoka; Kawakami, Koji; Chiba, Katsuyoshi

    2011-01-01

    Objective: Our previous study suggested that phenols (phenol and p-cresol) produced by gut bacteria affect the skin in hairless mice. In the present study we aimed to determine if the same phenomenon is applicable to humans. Methods: First, we analyzed the correlation between serum phenol levels and corneocyte size in 50 healthy female volunteers. Second, we administered a prebiotic beverage (containing galacto-oligosaccharides and polydextrose) to 19 healthy female volunteers and examined th...

  19. Ecto-nucleoside triphosphate diphosphohydrolase 2 modulates local ATP-induced calcium signaling in human HaCaT keratinocytes.

    Directory of Open Access Journals (Sweden)

    Chia-Lin Ho

    Full Text Available Keratinocytes are the major building blocks of the human epidermis. In many physiological and pathophysiological conditions, keratinocytes release adenosine triphosphate (ATP as an autocrine/paracrine mediator that regulates cell proliferation, differentiation, and migration. ATP receptors have been identified in various epidermal cell types; therefore, extracellular ATP homeostasis likely determines its long-term, trophic effects on skin health. We investigated the possibility that human keratinocytes express surface-located enzymes that modulate ATP concentration, as well as the corresponding receptor activation, in the pericellular microenvironment. We observed that the human keratinocyte cell line HaCaT released ATP and hydrolyzed extracellular ATP. Interestingly, ATP hydrolysis resulted in adenosine diphosphate (ADP accumulation in the extracellular space. Pharmacological inhibition by ARL 67156 or gene silencing of the endogenous ecto-nucleoside triphosphate diphosphohydrolase (NTPDase isoform 2 resulted in a 25% reduction in both ATP hydrolysis and ADP formation. Using intracellular calcium as a reporter, we found that although NTPDase2 hydrolyzed ATP and generated sustainable ADP levels, only ATP contributed to increased intracellular calcium via P2Y2 receptor activation. Furthermore, knocking down NTPDase2 potentiated the nanomolar ATP-induced intracellular calcium increase, suggesting that NTPDase2 globally attenuates nucleotide concentration in the pericellular microenvironment as well as locally shields receptors in the vicinity from being activated by extracellular ATP. Our findings reveal an important role of human keratinocyte NTPDase2 in modulating nucleotide signaling in the extracellular milieu of human epidermis.

  20. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  1. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  2. Biological properties of differently-aged human keratinocytes:population doubling time growth curve and cell cycle analysis

    Institute of Scientific and Technical Information of China (English)

    Hui-qun Ma; Jie Feng; Lech Chyczewski; Jacek Niklinski

    2009-01-01

    Objective To explore the biological properties of keratinocytes from differently-aged healthy human beings. Methods Keratinocytes from fetus, teenager and middle-aged groups were separated and cultured. The population doubling time (PDT) and cell growth curve in different cells were compared, and the cell cycles were analyzed by flow cytometry. Results ① In primary culture of keratinocytes, the adherence time in middle-aged group was longer than that in fetus and teenager groups. However, all cell morphology showed no obvioas differences. In subculture of kecatinocytes, with donator's age increasing, time of cell adherence prolonged, passage number decreused and differences in cell morphology were obrioas. ② The average PDT of keratinocytes was shorter in fetus group than in teenager and middle-aged groups. Bat difference in cell growth curve between different passages was not observed. ③ Keratinocytes showed G2/M period in fetus group but G0/G1 period in teenager and middle-aged groups mainly. Conclusion As age increases, the biological properties of keratinocytes change obviously.

  3. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.

    1989-01-01

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  4. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    International Nuclear Information System (INIS)

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma

  5. Phototoxicity of Phenylenediamine Hair Dye Chemicals in Salmonella typhimurium TA102 and Human Skin Keratinocytes

    OpenAIRE

    Yu, Hongtao; Mosley-Foreman; Choi, Jaehwa; Wang, Shuguang

    2008-01-01

    Phenylenediamines (PD) are dye precursors used to manufacture hair dyes. The three PDs, 1,2-, 1,3-, and 1,4-PD and three chlorinated PDs, 4-chloro-1,2-PD, 4-chloro-1,3- PD, and 4,5-dichloro-1,2-PD were studied for their mutagenic effect in Salmonella typhimurium TA 102, cytotoxicity in human skin keratinocyte cells, and for DNA cleavage. The results show that all six compounds are not toxic/mutagenic in TA 102 bacteria or skin cells, and do not cause DNA cleavage in ΦX 174 phage DNA. If the s...

  6. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays.Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation.  The most widespread, intense and uniform staining for PCNA

  7. Mammalian target of rapamycin (mTOR) regulates TLR3 induced cytokines in human oral keratinocytes

    OpenAIRE

    Zhao, Jiawei; Manjunatha R Benakanakere; Hosur, Kavita B.; Galicia, Johnah C.; Martin, Michael; Kinane, Denis F.

    2010-01-01

    Recent studies implicate the mammalian target of rapamycin (mTOR) pathway in the control of inflammatory responses following Toll-like receptor (TLR) stimulation in myeloid cells but its role in non-myeloid cells such as human keratinocytes is unknown. Here we show that TLR3 signaling can induce robust cytokine secretion including interleukin 1 beta (IL-1β), tumor necrosis factor alpha (TNFα), IL-12p70 and interferon beta (IFN-β), and our data reveal for the first time that inhibiting mTOR wi...

  8. A fully autologous co-culture system utilising non-irradiated autologous fibroblasts to support the expansion of human keratinocytes for clinical use.

    Science.gov (United States)

    Jubin, K; Martin, Y; Lawrence-Watt, D J; Sharpe, J R

    2011-12-01

    Autologous keratinocytes can be used to augment cutaneous repair, such as in the treatment of severe burns and recalcitrant ulcers. Such cells can be delivered to the wound bed either as a confluent sheet of cells or in single-cell suspension. The standard method for expanding primary human keratinocytes in culture uses lethally irradiated mouse 3T3 fibroblasts as feeder cells to support keratinocyte attachment and growth. In an effort to eliminate xenobiotic cells from clinical culture protocols where keratinocytes are applied to patients, we investigated whether human autologous primary fibroblasts could be used to expand keratinocytes in culture. At a defined ratio of a 6:1 excess of keratinocytes to fibroblasts, this co-culture method displayed a population doubling rate comparable to culture with lethally irradiated 3T3 cells. Furthermore, morphological and molecular analysis showed that human keratinocytes expanded in co-culture with autologous human fibroblasts were positive for proliferation markers and negative for differentiation markers. Keratinocytes expanded by this method thus retain their proliferative phenotype, an important feature in enhancing rapid wound closure. We suggest that this novel co-culture method is therefore suitable for clinical use as it dispenses with the need for lethally irradiated 3T3 cells in the rapid expansion of autologous human keratinocytes.

  9. Advanced oxidative protein products induced human keratinocyte apoptosis through the NOX-MAPK pathway.

    Science.gov (United States)

    Sun, Baihui; Ding, Ruoting; Yu, Wenlin; Wu, Yanhong; Wang, Bulin; Li, Qin

    2016-07-01

    Impaired wound healing is a major diabetes-related complication. Keratinocytes play an important role in wound healing. Multiple factors have been proposed that can induce dysfunction in keratinocytes. The focus of present research is at a more specific molecular level. We investigated the role of advanced oxidative protein products (AOPPs) in inducing human immortalized keratinocyte (HaCaT) cell apoptosis and the cellular mechanism underlying the proapoptotic effect of AOPPs. HaCaT cells were treated with increasing concentrations of AOPP-human serum albumin or for increasing time durations. The cell viability was measured using the thiazolyl blue tetrazolium bromide method, and flow cytometry was used to assess the rate of cell apoptosis. A loss of mitochondrial membrane potential (MMP) and an increase in intracellular reactive oxygen species (ROS) were observed through a confocal laser scanning microscope system, and the level of ROS generation was determined using a microplate reader. Nicotinamide adenine dinucleotide phosphate oxidase (NOX)4, extracellular signal-regulated kinase (ERK)1/2, p38 mitogen-activated protein kinase (MAPK), and apoptosis-related downstream protein interactions were investigated using the Western blot analysis. We found that AOPPs triggered HaCaT cell apoptosis and MMP loss. After AOPP treatment, intracellular ROS generation increased in a time- and dose-dependent manner. Proapoptotic proteins, such as Bax, caspase 9/caspase 3, and poly(ADP-ribose) polymerase (PARP)-1 were activated, whereas anti-apoptotic Bcl-2 protein was downregulated. AOPPs also increased NOX4, ERK1/2, and p38 MAPK expression. Taken together, these findings suggest that extracellular AOPP accumulation triggered NOX-dependent ROS production, which activated ERK1/2 and p38 MAPK, and induced HaCaT cell apoptosis by activating caspase 3 and PARP-1. PMID:27155970

  10. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith;

    2008-01-01

    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present...... study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...

  11. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Olerud John E

    2011-06-01

    Full Text Available Abstract Background Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. Results The impact of S. aureus soluble products in biofilm-conditioned medium (BCM or in planktonic-conditioned medium (PCM on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Conclusions Collectively the results indicate that S

  12. Development of a full-thickness human skin equivalent in vitro model derived from TERT-immortalized keratinocytes and fibroblasts

    NARCIS (Netherlands)

    C.M.A. Reijnders; A. van Lier; S. Roffel; D. Kramer; R.J. Scheper; S. Gibbs

    2015-01-01

    Currently, human skin equivalents (HSEs) used for in vitro assays (e.g., for wound healing) make use of primary human skin cells. Limitations of primary keratinocytes and fibroblasts include availability of donor skin and donor variation. The use of physiologically relevant cell lines could solve th

  13. Development of a Full-Thickness Human Skin Equivalent In Vitro Model Derived from TERT-Immortalized Keratinocytes and Fibroblasts

    NARCIS (Netherlands)

    Reijnders, Christianne M. A.; van Lier, Amanda; Roffel, Sanne; Kramer, Duco; Scheper, Rik J.; Gibbs, Susan

    2015-01-01

    Currently, human skin equivalents (HSEs) used for in vitro assays (e.g., for wound healing) make use of primary human skin cells. Limitations of primary keratinocytes and fibroblasts include availability of donor skin and donor variation. The use of physiologically relevant cell lines could solve th

  14. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert;

    2012-01-01

    Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by a......Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (Ha...

  15. Alkannin, HSP70 inducer, protects against UVB-induced apoptosis in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yoko Yoshihisa

    Full Text Available Alkannin is an active constituent from the root extract of Alkanna tinctoria of the Boraginaceae family and it may have utility as a heat shock protein 70 (HSP70 inducer in living organisms. Here, the effects of alkannin-induced HSP70 on ultraviolet (UV B (40 mJ/cm(2-induced apoptosis were investigated in human keratinocyte HaCaT cells. Pretreatment of cells with alkannin (1 µM caused significant inhibition of UVB-induced apoptosis and caspase-3 cleavage. On the other hand, the addition of KNK437 (HSP70 inhibitor reversed the action of alkannin increasing UVB-induced apoptosis in a dose-dependent manner. In addition, differences in gene expression associated with the suppression of UVB-induced apoptosis in the presence of alkannin were investigated using Gene Chip assay. Our results indicate that alkannin suppresses UVB-induced apoptosis through the induction of HSP70 in human keratinocytes, and therefore, we suggest the usefulness of using alkannin as an antiaging agent.

  16. Human Primary Keratinocytes as a Tool for the Analysis of Caspase-1-Dependent Unconventional Protein Secretion.

    Science.gov (United States)

    Strittmatter, Gerhard E; Garstkiewicz, Martha; Sand, Jennifer; Grossi, Serena; Beer, Hans-Dietmar

    2016-01-01

    Inflammasomes comprise a group of protein complexes, which activate the protease caspase-1 upon sensing a variety of stress factors. Active caspase-1 in turn cleaves and thereby activates the pro-inflammatory cytokines prointerleukin (IL)-1β and -18, and induces unconventional protein secretion (UPS) of mature IL-1β, IL-18, as well as of many other proteins involved in and required for induction of inflammation. Human primary keratinocytes (HPKs) represent epithelial cells able to activate caspase-1 in an inflammasome-dependent manner upon irradiation with a physiological dose of ultraviolet B (UVB) light. Here, we describe the isolation of keratinocytes from human skin, their cultivation, and induction of caspase-1-dependent UPS upon UVB irradiation as well as its siRNA- and chemical-mediated inhibition. In contrast to inflammasome activation of professional immune cells, UVB-irradiated HPKs represent a robust and physiological cell culture system for the analysis of UPS induced by active caspase-1. PMID:27665556

  17. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells. PMID:27529420

  18. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves; Habauzit, Denis

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells. PMID:27529420

  19. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  20. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-01

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. PMID:23142932

  1. Analyses of the Secondary Particle Radiation and the DNA Damage it Causes to Human Keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E. A.; Tafrov S.; Rusek, A.; Sivertz, M. B.; Yip, K.; Thompson, K. H.

    2011-11-01

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  2. Analyses of the secondary particle radiation and the DNA damage it causes to human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lebel E.; Rusek A.; Sivertz, M.; Yip, K.; Thompson, K.; Tafrov, S.

    2011-11-22

    High-energy protons, and high mass and energy ions, along with the secondary particles they produce, are the main contributors to the radiation hazard during space explorations. Skin, particularly the epidermis, consisting mainly of keratinocytes with potential for proliferation and malignant transformation, absorbs the majority of the radiation dose. Therefore, we used normal human keratinocytes to investigate and quantify the DNA damage caused by secondary radiation. Its manifestation depends on the presence of retinol in the serum-free media, and is regulated by phosphatidylinositol 3-kinases. We simulated the generation of secondary radiation after the impact of protons and iron ions on an aluminum shield. We also measured the intensity and the type of the resulting secondary particles at two sample locations; our findings agreed well with our predictions. We showed that secondary particles inflict DNA damage to different extents, depending on the type of primary radiation. Low-energy protons produce fewer secondary particles and cause less DNA damage than do high-energy protons. However, both generate fewer secondary particles and inflict less DNA damage than do high mass and energy ions. The majority of cells repaired the initial damage, as denoted by the presence of 53BPI foci, within the first 24 hours after exposure, but some cells maintained the 53BP1 foci longer.

  3. Lichen metabolites. 2. Antiproliferative and cytotoxic activity of gyrophoric, usnic, and diffractaic acid on human keratinocyte growth.

    Science.gov (United States)

    Kumar, K C; Müller, K

    1999-06-01

    The sensitivity of the human keratinocyte cell line HaCaT to several lichen metabolites isolated from Parmelia nepalensis and Parmelia tinctorum was evaluated. The tridepside gyrophoric acid (6), the dibenzofuran derivative (+)-usnic acid (1), and the didepside diffractaic acid (5) were potent antiproliferative agents and inhibited cell growth, with IC50 values of 1.7, 2.1, and 2.6 microM, respectively. Methyl beta-orcinolcarboxylate (2), ethyl hematommate (3), the didepside atranorin (4), and (+)-protolichesterinic acid (7) did not influence keratinocyte growth at concentrations of 5 microM. Keratinocytes were further tested for their susceptibility to the action of the potent antiproliferative agents on plasma membrane integrity. The release of lactate dehydrogenase activity into the culture medium was unchanged as compared to controls, documenting that the activity of gyrophoric acid (6), (+)-usnic acid (1), and diffractaic acid (5) was due to cytostatic rather than cytotoxic effects. PMID:10395495

  4. Development of a Full-Thickness Human Gingiva Equivalent Constructed from Immortalized Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Buskermolen, Jeroen K; Reijnders, Christianne M A; Spiekstra, Sander W; Steinberg, Thorsten; Kleverlaan, Cornelis J; Feilzer, Albert J; Bakker, Astrid D; Gibbs, Susan

    2016-08-01

    Organotypic models make it possible to investigate the unique properties of oral mucosa in vitro. For gingiva, the use of human primary keratinocytes (KC) and fibroblasts (Fib) is limited due to the availability and size of donor biopsies. The use of physiologically relevant immortalized cell lines would solve these problems. The aim of this study was to develop fully differentiated human gingiva equivalents (GE) constructed entirely from cell lines, to compare them with the primary cell counterpart (Prim), and to test relevance in an in vitro wound healing assay. Reconstructed gingiva epithelium on a gingiva fibroblast-populated collagen hydrogel was constructed from cell lines (keratinocytes: TERT or HPV immortalized; fibroblasts: TERT immortalized) and compared to GE-Prim and native gingiva. GE were characterized by immunohistochemical staining for proliferation (Ki67), epithelial differentiation (K10, K13), and basement membrane (collagen type IV and laminin 5). To test functionality of GE-TERT, full-thickness wounds were introduced. Reepithelialization, fibroblast repopulation of hydrogel, metabolic activity (MTT assay), and (pro-)inflammatory cytokine release (enzyme-linked immunosorbent assay) were assessed during wound closure over 7 days. Significant differences in basal KC cytokine secretion (IL-1α, IL-18, and CXCL8) were only observed between KC-Prim and KC-HPV. When Fib-Prim and Fib-TERT were stimulated with TNF-α, no differences were observed regarding cytokine secretion (IL-6, CXCL8, and CCL2). GE-TERT histology, keratin, and basement membrane protein expression very closely represented native gingiva and GE-Prim. In contrast, the epithelium of GE made with HPV-immortalized KC was disorganized, showing suprabasal proliferating cells, limited keratinocyte differentiation, and the absence of basement membrane proteins. When a wound was introduced into the more physiologically relevant GE-TERT model, an immediate inflammatory response (IL-6, CCL2, and

  5. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays. Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation. The most widespread, intense and uniform staining for PCNA and

  6. Keratinocyte-targeted expression of human laminin γ2 rescues skin blistering and early lethality of laminin γ2 deficient mice.

    Directory of Open Access Journals (Sweden)

    Tracy L Adair-Kirk

    Full Text Available Laminin-332 is a heterotrimeric basement membrane component comprised of the α3, ß3, and γ2 laminin chains. Laminin-332 modulates epithelial cell processes, such as adhesion, migration, and differentiation and is prominent in many embryonic and adult tissues. In skin, laminin-332 is secreted by keratinocytes and is a key component of hemidesmosomes connecting the keratinocytes to the underlying dermis. In mice, lack of expression of any of the three Laminin-332 chains result in impaired anchorage and detachment of the epidermis, similar to that seen in human junctional epidermolysis bullosa, and death occurs within a few days after birth. To bypass the early lethality of laminin-332 deficiency caused by the knockout of the mouse laminin γ2 chain, we expressed a dox-controllable human laminin γ2 transgene under a keratinocyte-specific promoter on the laminin γ2 (Lamc2 knockout background. These mice appear similar to their wild-type littermates, do not develop skin blisters, are fertile, and survive >1.5 years. Immunofluorescence analyses of the skin showed that human laminin γ2 colocalized with mouse laminin α3 and ß3 in the basement membrane zone underlying the epidermis. Furthermore, the presence of "humanized" laminin-332 in the epidermal basement membrane zone rescued the alterations in the deposition of hemidesmosomal components, such as plectin, collagen type XVII/BP180, and integrin α6 and ß4 chains, seen in conventional Lamc2 knockout mice, leading to restored formation of hemidesmosomes. These mice will be a valuable tool for studies of organs deficient in laminin-332 and the role of laminin-332 in skin, including wound healing.

  7. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  8. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity.

    Science.gov (United States)

    Mauro, Marcella; Crosera, Matteo; Pelin, Marco; Florio, Chiara; Bellomo, Francesca; Adami, Gianpiero; Apostoli, Piero; De Palma, Giuseppe; Bovenzi, Massimo; Campanini, Marco; Filon, Francesca Larese

    2015-07-01

    Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs) have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1) and needle-abraded human skin (experiment 2). Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled-Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm⁻²), while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm⁻²) and those with intact skin (1.08 ± 0.20 ng·cm⁻²). To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue and propidium iodide (PI) uptake assays. The results indicate that a long exposure time (i.e., seven days) was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10-4 M, 95% CL = 0.8-1.9 × 10⁻⁴ M, MTT essay; 3.7 × 10⁻⁵ M, 95% CI = 2.2-6.1 × 10⁻⁵ M, AlamarBlue assay) that seems to be associated to necrotic events (EC50 value: 1.3 × 10⁻⁴ M, 95% CL = 0.9-1.9 × 10⁻⁴ M, PI assay). This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  9. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  10. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle

    2005-10-01

    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  11. CD44v6 expression in human skin keratinocytes as a possible mechanism for carcinogenesis associated with chronic arsenic exposure

    OpenAIRE

    Huang, S.; Guo, S.; Guo, F; Yang, Q.; XIAO, X.; Murata, M.; Ohnishi, S.; Kawanishi, S; Ma, N

    2013-01-01

    Inorganic arsenic is a well-known human skin carcinogen. Chronic arsenic exposure results in various types of human skin lesions, including squamous cell carcinoma (SCC). To investigate whether mutant stem cells participate in arsenic-associated carcinogenesis, we repeatedly exposed the human spontaneously immortalized skin keratinocytes (HaCaT) cell line to an environmentally relevant level of arsenic (0.05 ppm) in vitrofor 18 weeks. Following sodium arsenite administration, cell cycle, colo...

  12. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  13. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO2. Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60Co gamma source at dose rate of 2 Gy min-1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  14. Ceramide stimulates ABCA12 expression via peroxisome proliferator-activated receptor {delta} in human keratinocytes.

    Science.gov (United States)

    Jiang, Yan J; Uchida, Yoshikazu; Lu, Biao; Kim, Peggy; Mao, Cungui; Akiyama, Masashi; Elias, Peter M; Holleran, Walter M; Grunfeld, Carl; Feingold, Kenneth R

    2009-07-10

    ABCA12 (ATP binding cassette transporter, family 12) is a cellular membrane transporter that facilitates the delivery of glucosylceramides to epidermal lamellar bodies in keratinocytes, a process that is critical for permeability barrier formation. Following secretion of lamellar bodies into the stratum corneum, glucosylceramides are metabolized to ceramides, which comprise approximately 50% of the lipid in stratum corneum. Gene mutations of ABCA12 underlie harlequin ichthyosis, a devastating skin disorder characterized by abnormal lamellar bodies and a severe barrier abnormality. Recently we reported that peroxisome proliferator-activated receptor (PPAR) and liver X receptor activators increase ABCA12 expression in human keratinocytes. Here we demonstrate that ceramide (C(2)-Cer and C(6)-Cer), but not C(8)-glucosylceramides, sphingosine, or ceramide 1-phosphate, increases ABCA12 mRNA expression in a dose- and time-dependent manner. Inhibitors of glucosylceramide synthase, sphingomyelin synthase, and ceramidase and small interfering RNA knockdown of human alkaline ceramidase, which all increase endogenous ceramide levels, also increased ABCA12 mRNA levels. Moreover, simultaneous treatment with C(6)-Cer and each of these same inhibitors additively increased ABCA12 expression, indicating that ceramide is an important inducer of ABCA12 expression and that the conversion of ceramide to other sphingolipids or metabolites is not required. Finally, both exogenous and endogenous ceramides preferentially stimulate PPARdelta expression (but not other PPARs or liver X receptors), whereas PPARdelta knockdown by siRNA transfection specifically diminished the ceramide-induced increase in ABCA12 mRNA levels, indicating that PPARdelta is a mediator of the ceramide effect. Together, these results show that ceramide, an important lipid component of epidermis, up-regulates ABCA12 expression via the PPARdelta-mediated signaling pathway, providing a substrate-driven, feed

  15. Intratracheal Administration of Recombinant Human Keratinocyte Growth Factor Promotes Alveolar Epithelial Cell Proliferation during Compensatory Lung Growth in Rat

    International Nuclear Information System (INIS)

    Keratinocyte growth factor (KGF) is considered to be one of the most important mitogens for lung epithelial cells. The objectives of this study were to confirm the effectiveness of intratracheal injection of recombinant human KGF (rhKGF) during compensatory lung growth and to optimize the instillation protocol. Here, trilobectomy in adult rat was performed, followed by intratracheal rhKGF instillation with low (0.4 mg/kg) and high (4 mg/kg) doses at various time-points. The proliferation of alveolar cells was assessed by the immunostaining for proliferating cell nuclear antigen (PCNA) in the residual lung. We also investigated other immunohistochemical parameters such as KGF, KGF receptor and surfactant protein A as well as terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling. Consequently, intratracheal single injection of rhKGF in high dose group significantly increased PCNA labeling index (LI) of alveolar cells in the remaining lung. Surprisingly, there was no difference in PCNA LI between low and high doses of rhKGF with daily injection, and PCNA LI reached a plateau level with 2 days-consecutive administration (about 60%). Our results indicate that even at low dose, daily intratracheal injection is effective to maintain high proliferative states during the early phase of compensatory lung growth

  16. Inhibition of inflammatory and proliferative responses of human keratinocytes exposed to the sesquiterpene lactones dehydrocostuslactone and costunolide.

    Directory of Open Access Journals (Sweden)

    Claudia Scarponi

    Full Text Available The imbalance of the intracellular redox state and, in particular, of the glutathione (GSH/GSH disulfide couple homeostasis, is involved in the pathogenesis of a number of diseases. In many skin diseases, including psoriasis, oxidative stress plays an important role, as demonstrated by the observation that treatments leading to increase of the local levels of oxidant species ameliorate the disease. Recently, dehydrocostuslactone (DCE and costunolide (CS, two terpenes naturally occurring in many plants, have been found to exert various anti-inflammatory and pro-apoptotic effects on different human cell types. These compounds decrease the level of the intracellular GSH by direct interaction with it, and, therefore, can alter cellular redox state. DCE and CS can trigger S-glutathionylation of various substrates, including the transcription factor STAT3 and JAK1/2 proteins. In the present study, we investigated on the potential role of DCE and CS in regulating inflammatory and proliferative responses of human keratinocytes to cytokines. We demonstrated that DCE and CS decreased intracellular GSH levels in human keratinocytes, as well as inhibited STAT3 and STAT1 phosphorylation and activation triggered by IL-22 or IFN-γ, respectively. Consequently, DCE and CS decreased the IL-22- and IFN-γ-induced expression of inflammatory and regulatory genes in keratinocytes, including CCL2, CXCL10, ICAM-1 and SOCS3. DCE and CS also inhibited proliferation and cell-cycle progression-related gene expression, as well as they promoted cell cycle arrest and apoptosis. In parallel, DCE and CS activated the anti-inflammatory EGFR and ERK1/2 molecules in keratinocytes, and, thus, wound healing in an in vitro injury model. In light of our findings, we can hypothesize that the employment of DCE and CS in psoriasis could efficiently counteract the pro-inflammatory effects of IFN-γ and IL-22 on keratinocytes, revert the apoptosis-resistant phenotype, as well as inhibit

  17. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes.

    Science.gov (United States)

    Zhang, Leshuai W; Yu, William W; Colvin, Vicki L; Monteiro-Riviere, Nancy A

    2008-04-15

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 microM, 2 microM and 10 microM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p<0.05) from 1.25 nM to 10 nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5 nM to 10 nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated. PMID:18261754

  18. Role of SP-1 in SDS-Induced Adipose Differentiation Related Protein Synthesis in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Emanuela Corsini

    2007-01-01

    Full Text Available Skin irritation is a complex phenomenon, and keratinocytes play an important role in it. We have recently characterized the expression and protective role of adipose differentiation related protein (ADRP in skin irritation. In particular, ADRP expression is induced to recover functional cell membrane following the cell damage caused by skin irritants. The purpose of this study was to characterize in a human keratinocyte cells line (NCTC 2544 the biochemical events that lead to ADRP expression following SDS treatment, and in particular, to investigate the role of transcription factor SP-1. Analysis of ADRP promoter region revealed the presence of a potential binding site for the transcription factor SP-1 close to the start site. Evaluated by measuring the DNA binding activity, we found that SDS induced a dose and time related SP-1 activation, which was correlated with SDS-induced ADRP mRNA expression. Furthermore, SDS-induced SP-1 activation, ADRP mRNA expression and lipid droplets accumulation could be modulated by mithramycin A, an antibiotic that selectively binds to the GC box preventing SP-1 binding and gene expression. This demonstrated that SDS-induced ADRP expression was mediated in part through the transcription factor SP-1. In addition, SDS-induced SP-1 activation and ADRP expression could be modulated by the calcium chelator BAPTA, indicating a role of calcium in ADRP-induction. Thus, every time an irritant perturbs the membrane barrier, it renders the membrane leaky and allows extracellular calcium to enter the cells, an event that provides the upstream mechanisms initiating the signaling cascade that triggers the activation of SP-1 and culminates in the enhancement of ADRP expression, which helps to restore the normal homeostasis and ultimately repairs the to membrane.

  19. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  20. Impairment of human keratinocyte mobility and proliferation by advanced glycation end products-modified BSA.

    Science.gov (United States)

    Zhu, Ping; Yang, Chuan; Chen, Li-Hong; Ren, Meng; Lao, Guo-Juan; Yan, Li

    2011-07-01

    The migration and proliferation of keratinocytes is critical to wound re-epithelialization and defects in this function are associated with the clinical phenomenon of chronic non-healing wounds. Advanced glycation end products (AGEs) occur through non-enzymatic glycation of long-lived proteins in diabetes and play important roles in diabetic complications. However, specific roles for AGEs in keratinocyte migration and proliferation, and the underlying molecular mechanisms, have not been fully established. The aim of the current study was to elucidate the interaction between AGE-modified bovine serum albumin (AGE-BSA) and keratinocytes. As a result, we found that AGE-BSA had no effect on the viability of keratinocytes for up to 48 h of incubation with 50 μg/ml of AGE-BSA. AGE-BSA (but not non-glycated BSA) exerted a concentration-dependent suppression of keratinocyte migration at a range of concentrations. The expression of matrix metalloproteinase-9 (MMP-9) was significantly up-regulated in keratinocytes incubated with increasing AGE-BSA, but tissue inhibitor of metalloproteinases-1 (TIMP-1) expression was down-regulated. AGE-BSA also profoundly depressed phospho-focal adhesion kinase-Tyr397 (p-FAK) and α2β1 integrin expression, while total-FAK expression levels remained constant, in keratinocytes. The proliferative capacity of keratinocytes was diminished after 72 h AGE-BSA incubation. Taken together, these findings suggested that in the presence of AGE-BSA, keratinocytes lose their migratory and proliferation abilities. These data also indicated that, in the context of the chronic hyperglycemia in diabetes, the effects of AGE-BSA on keratinocyte migration might be mediated through MMP-9/TIMP-1, p-FAK and α2β1 integrin.

  1. Expression of Hepatocyte Growth Factor-Like Protein in Human Wound Tissue and Its Biological Functionality in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    James C. Glasbey

    2015-02-01

    Full Text Available Hepatocyte growth factor-like protein (HGFl and its receptor, Recepteur d'Origine Nantais (RON, have been implicated in the development of wound chronicity. HGFl and RON expression was detected in acute wound tissue, chronic wound tissue and in normal skin using quantitative polymerase chain reaction (Q-PCR. HGFl and RON expression was also assessed in chronic healing and chronic non-healing wound tissues using Q-PCR and immunohistochemical staining. Expression was similarly detected in the HaCaT immortalized human keratinocyte cell line using reverse transcription polymerase chain reaction (RT-PCR. rhHGFl was used to assess the impact of this molecule on HaCaT cell functionality using in vitro growth assays and electric cell-substrate impendence sensing (ECIS migration assays. HGFl and RON transcript expression were significantly increased in acute wound tissue compared to chronic wound tissue and were also elevated, though non-significantly, in comparison to normal skin. Minimal expression was seen in both healing and non-healing chronic wounds. Treatment of HaCaT cells with rhHGFl had no effect on growth rates but did enhance cell migration. This effect was abolished by the addition of a phospholipase C gamma (PLCγ small molecule inhibitor. The increased expression of HGFl and RON in acute, healing wounds and the pro-migratory effect of HGFl in an in vitro human keratinocyte model, may indicate a role for HGFl in active wound healing.

  2. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  3. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  4. Protective effects of myricetin against ultraviolet-B-induced damage in human keratinocytes.

    Science.gov (United States)

    Huang, Jheng-Hua; Huang, Chieh-Chen; Fang, Jia-You; Yang, Cheng; Chan, Chi-Ming; Wu, Nan-Lin; Kang, Shung-Wen; Hung, Chi-Feng

    2010-02-01

    Myricetin is a flavonoid similar to quercetin, which is commonly found in natural foods such as berries, vegetables, teas, wine, and herbs. It is considered to be an antioxidant which is capable of quenching photoaging-causing free radicals within the skin. In this study, we investigated the mechanisms underlying protective effect of myricetin on ultraviolet-B (UVB)-induced damage to keratinocytes. We found that myricetin concentration-dependently attenuated UVB-induced keratinocyte death as determined by a cell viability assay. Pretreatment with myricetin also reduced the UVB-induced malondialdehyde level. Moreover, UVB-induced H(2)O(2) generation in keratinocytes was inhibited by myricetin according to flow cytometry, suggesting that myricetin can act as a free radical scavenger when keratinocytes experience photodamage. Furthermore, UVB-induced activation of c-jun-NH(2) terminal kinase (JNK) in keratinocytes was inhibited by myricetin. UVB-induced pre-G(1) phase arrest leading to apoptotic changes in keratinocytes was blocked by myricetin. Taken together, the protective mechanisms of keratinocyte by myricetin against UVB-induced photodamage occur by the inhibition of UVB-induced intracellular hydrogen peroxide production, lipid peroxidation and JNK activation. Therefore, myricetin is suitable for further development as an anti-aging agent for skin care. PMID:19778600

  5. Interleukin 6 is Expressed in High Levels in Psoriatic Skin and Stimulates Proliferation of Cultured Human Keratinocytes

    Science.gov (United States)

    Grossman, Rachel M.; Krueger, James; Yourish, Debra; Granelli-Piperno, Angela; Murphy, Daniel P.; May, Lester T.; Kupper, Thomas S.; Sehgal, Pravinkumar B.; Gottlieb, Alice B.

    1989-08-01

    Psoriasis is a common papulosquamous skin disease. The histopathology is characterized by epidermal hyperplasia and inflammation. Recent studies suggest that keratinocyte proliferation and inflammation in psoriasis are manifestations of the same underlying pathological process. Interleukin 6 (IL-6), a cytokine that is a major mediator of the host response to tissue injury and infection, is produced by both keratinocytes and leukocytes in culture. IL-6 expression was studied in psoriatic plaques by immunoperoxidase staining with two different polyclonal anti-recombinant IL-6 antisera and by in situ nucleic acid hybridization with IL-6 cRNA probes. Epidermal and dermal cells in active psoriatic plaques from 35 psoriasis patients stained heavily for IL-6 as compared with nonlesional skin and with plaques after treatment with antimetabolic and antiinflammatory agents. Absorption of the anti-recombinant IL-6 antisera with purified fibroblast-derived IL-6 or with recombinant IL-6, but not bovine serum albumin, removed the immunostaining. Increased levels of IL-6 were detected in the plasma of patients with active psoriasis (mean 3 ng/ml) by using two different bioassays. IL-6 production by proliferating keratinocytes was suggested by IL-6-specific immunostaining in cultured normal and psoriatic keratinocytes and by the detection of mRNA specific for IL-6 in psoriatic epidermis by in situ hybridization. IL-6 stimulated the proliferation of cultured, normal human keratinocytes as assessed by two different assays. Thus, IL-6 could directly contribute to the epidermal hyperplasia seen in psoriatic epithelium as well as affect the function of dermal inflammatory cells.

  6. Eckol inhibits ultraviolet B-induced cell damage in human keratinocytes via a decrease in oxidative stress

    International Nuclear Information System (INIS)

    In previous reports, the antioxidant effects of eckol were shown to protect cells against hydrogen peroxide- and gamma ray-induced oxidative stress. In this study, the role of eckol in protecting human skin keratinocytes (HaCaT) against UVB-induced oxidative cell damage was investigated. Also, triphlorethol-A, one of the chemical components in Ecklonia cava, and quercetin a well known antioxidant, were compared with eckol in terms of antioxidant activity based on chemical structure. Eckol decreased UVB-induced intracellular reactive oxygen species (ROS), decreased injury to cellular components resulting from UVB-induced oxidative stress, and restored cell viability. In addition, eckol reduced UVB-induced apoptosis by inhibiting the disruption of mitochondrial membranes. These results suggest that eckol protects human keratinocytes against UVB-induced oxidative stress by scavenging ROS, thereby lessening injury to cellular components. (author)

  7. Photoprotective Activity of Vulpinic and Gyrophoric Acids Toward Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Varol, Mehmet; Türk, Ayşen; Candan, Mehmet; Tay, Turgay; Koparal, Ayşe Tansu

    2016-01-01

    Vulpinic and gyrophoric acids are known as ultraviolet filters for natural lichen populations because of their chemical structures. However, to the best of our knowledge, there has been no reference to their cosmetic potential for skin protection against ultraviolet B (UVB)-induced damage and, consequently, we propose to highlight their photoprotective profiles in human keratinocytes (HaCaT). Therefore, vulpinic acid and gyrophoric acid were isolated from acetone extracts of Letharia vulpina and Xanthoparmelia pokornyi, respectively. Their photoprotective activities on irradiated HaCaT cells and destructive effects on non-irradiated HaCaT cells were compared through in vitro experimentation: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and lactate dehydrogenase assays, 4',6-diamino-2-phenylindole and tetramethylrhodamine B isothiocyanate-phalloidin staining protocols. Both of the lichen substances effectively prevented cytotoxic, apoptotic and cytoskeleton alterative activities of 2.5 J/cm(2) UVB in a dose-dependent manner. Moreover, vulpinic and gyrophoric acids showed no toxic, apoptotic or cytoskeleton alterative effects on non-irradiated HaCaT cells, except at high doses (≥400 μM) of gyrophoric acid. The findings suggest that vulpinic and gyrophoric acids can be promising cosmetic ingredients to photo-protect human skin cells and should therefore be further investigated by in vitro and in vivo multiple bioassays. PMID:26463741

  8. Effects of silver nanoparticles on human dermal fibroblasts and epidermal keratinocytes.

    Science.gov (United States)

    Galandáková, A; Franková, J; Ambrožová, N; Habartová, K; Pivodová, V; Zálešák, B; Šafářová, K; Smékalová, M; Ulrichová, J

    2016-09-01

    Biomedical application of silver nanoparticles (AgNPs) has been rapidly increasing. Owing to their strong antimicrobial activity, AgNPs are used in dermatology in the treatment of wounds and burns. However, recent evidence for their cytotoxicity gives rise to safety concerns. This study was undertaken as a part of an ongoing programme in our laboratory to develop a topical agent for wound healing. Here, we investigated the potential toxicity of AgNPs using normal human dermal fibroblasts (NHDF) and normal human epidermal keratinocytes (NHEK) with the aim of comparing the effects of AgNPs and ionic silver (Ag-I). Besides the effect of AgNPs and Ag-I on cell viability, the inflammatory response and DNA damage in AgNPs and Ag-I-treated cells were examined. The results showed that Ag-I were significantly more toxic than AgNPs both on NHDF and NHEK. Non-cytotoxic concentrations of AgNPs and Ag-I did not induce DNA strand breaks and did not affect inflammatory markers, except for a transient increase in interleukin 6 levels in Ag-I-treated NHDF. The results showed that AgNPs are more suitable for the intended application as a topical agent for wound healing up to the concentration 25 µg/mL. PMID:26500221

  9. Induction and inhibition of benzo(a)pyrene metabolism in human epidermal keratinocytes and dermal fibroblasts

    International Nuclear Information System (INIS)

    The effects of different growth conditions and various cytochrome P-450 inducers and inhibitors were examined on the benzo(a)pyrene (BP) metabolism of human skin cells in vitro. First, three different populations of neonatal foreskin fibroblasts were treated with 0.98 μM [G-3H]-BP at 9.6 Ci/mmole for 24 hours and the organic-extractable metabolites in the extracellular, the cytoplasmic, and the nuclear fractions were analyzed by high-pressure liquid chromatography (HPLC). Confluent cultures (contact-inhibited cells), which were nontransformable, metabolized BP to a much greater extent than the transformable populations, randomly-proliferating cultures (cells in logarithmic growth) and synchronized cultures (cells treated in S phase). The major extracellular BP metabolites detected were the 9,10-diol, the 7,8-diol, and the phenols, including all four tetrols observed only in the confluent cells. From this data, the state of confluency (i.e. the model for the in vivo state of skin cells) induced enzymes which catalyze primarily the detoxification pathways leading to the formation of metabolites which are readily excreted whereas cells which are actively dividing or synchronized induced the formation of metabolites from activation pathways that led to transformation. Next, the effects of four inducers (3-methylcholanthrene (3-MCA), phenobarbital (PB), isosafrole, and Arochlor 1254) and an inhibitor (butylated hydroxyanisole (BHA)) on the BP metabolism of human epidermal keratinocytes were evaluated

  10. Biocompatibility Evaluation of Dental Luting Cements Using Cytokine Released from Human Oral Fibroblasts and Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jae-Sung Kwon

    2015-10-01

    Full Text Available Dental luting cements are commonly used in dentistry for cementation of prosthetic restoration. Many previous studies focused on the measurement of the cell viability as the method of cytotoxicity evaluation during biocompatibility study for the material. In this study, the biocompatibility of various dental luting cements were evaluated using the new method of cytokine release measurement in order to better simulate inflammatory reactions in animal or clinical model using two different oral cells; immortalized human gingival fibroblast and immortalized human oral keratinocytes. Cells were exposed to extractions of various commercially available dental luting cements for different durations. Cytokines of IL-1α and IL-8 were measured from the supernatants of the cells and the results were then compared to the conventional MTT viability test. The result from the conventional cell viability study showed a relatively simple and straight forward indication that only one of the dental luting cements tested in this study was cytotoxic with increasing duration of exposure for both cells. Meanwhile, the result from the cytokine measurement study was much more complex at the time point they were measured, type of cells used for the study and the type of cytokines measured, all of which influenced the interpretation of the results. Hence, the better understanding of the cytokine release would be required for the application in biocompatibility evaluation.

  11. Effect of lead on IL-8 production and cell proliferation in human oral keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Thaweboon Srosiri; Poomsawat Sopee; Thaweboon Boonyanit

    2010-01-01

    Objective:To investigate the effect of lead on the production of IL-8 and cell proliferation in normal human oral keratinocytes (NHKs). Methods: NHKs were prepared as outgrowths from normal human buccal mucosa. The cells were treated with three concentrations of lead glutamate (4.5í10-5M, 4.5í10-6M and 4.5í10-7M). NHKs grown in glutamic acid were used as control. The amounts of IL-8 secreted in the culture supernatants were evaluated at 12 and 24 h using enzyme-linked immunospecific assay (ELISA). Cell proliferation was determined by the MTT colorimetric assay. Three cultures were used for each experiment, and three independent experiments were performed. Analysis of variance and Duncan’s multiple range tests were used for statistical analysis. Results:An elevation of IL-8 in culture supernatants of NHKs treated with lead at all concentrations at 12 and 24 h after exposure in a dose-dependent manner was revealed. A significant increase in cell numbers was observed only at 24 h exposed to 4.5í10-5M lead glutamate. Conclusions: The capacity of NHKs, to secrete IL-8, enhanced by lead glutamate, is demonstrated here. Induction of cell proliferation is revealed only after exposure to high lead concentration. The elevation of secreted IL-8 is a probable initial sign for the acute inflammatory response and may be involved in the pathogenesis of lead stomatitis.

  12. Increased expression of 70 kD heat shock protein in cultured primary human keratinocytes induced by human papillomavirus 16 E6/E7 gene

    Institute of Scientific and Technical Information of China (English)

    LIAO Wen-jun; FAN Ping-shen; FU Meng; FAN Xue-li; LIU Yu-feng

    2005-01-01

    Background Heat shock protein 70 (HSP70) is expressed highly in epithelial tumours associated closely with human papillomavirus 16 (HPV16) infections. However, evidence about the direct relationship between HSP70 expression and HPVs infections are still lacking. In the present study, we examined the expression of HSP70 in keratinocytes introduced with HPV16 E6/E7 oncogenes. Methods Stable transfected cells were established by transfection of the plasmids pLXSN16E6/E7 into cultured primary keratinocytes and subsequently selected by plasmid specific selection antibiotic (G418) at the required concentration. The expression of HSP70 in pLXSN16E6/E7 transfected keratinocytes was determined by Western blot. The correlation of HSP70 expression and E6/E7 transfection was further confirmed by doubly labelled immunofluorescent staining.Results Compared to non-transfected keratinocytes, there was a significant trend for higher levels of HSP70 in pLXSN16E6/E7 transfected keratinocytes. Doubly labelled immunofluorescent staining experiment showed that the co-localization of HPV16 E6/E7 and HSP70 in transfected keratinocytes was observed and increased expression of HSP70 was strongly associated with the transfection of HPV16 E6/E7.Conclusions Our studies demonstrated increased levels of HSP70 proteins in keratinocytes stably transfected by HPV16 E6/E7 oncogenes. It suggests that the expression of HSP70 is modulated by HPV16 E6/E7 proteins, which may be involved in HPV16 E6/E7 induced immortalization.

  13. Exploiting high-throughput screens to optimize Adeno-Associated Viral Vectors for gene transfer into primary human keratinocytes

    OpenAIRE

    Sallach, Jessica

    2014-01-01

    Chronic non-healing wounds such as diabetic ulcers or burns represent a devastating health problem with significant clinical, physical and social implications. The healing can be frustrating and painful for patients. The difficult healing process requires advanced therapeutic strategies such as the use of primary human keratinocytes (HK) as autologous transplants, which may be considered for clinical use. To improve engraftment or to introduce therapeutic genes into primary HK, efficient and ...

  14. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    OpenAIRE

    Marcella Mauro; Matteo Crosera; Marco Pelin; Chiara Florio; Francesca Bellomo; Gianpiero Adami; Piero Apostoli; Giuseppe Palma; Massimo Bovenzi; Marco Campanini; Francesca Larese Filon

    2015-01-01

    Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs) have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1) and needle-abraded huma...

  15. An ascorbic acid-enriched tomato genotype to fight UVA-induced oxidative stress in normal human keratinocytes.

    Science.gov (United States)

    Petruk, Ganna; Raiola, Assunta; Del Giudice, Rita; Barone, Amalia; Frusciante, Luigi; Rigano, Maria Manuela; Monti, Daria Maria

    2016-10-01

    UVA radiations contribute up to 95% of the total UV exposure and are known to induce cell damage, leading to apoptosis. Since the benefic effects of ascorbic acid on human health are well known, a new tomato genotype (named DHO4), highly rich in ascorbic acid, has been recently obtained. Here, we compared the effects of ascorbic acid and hydrophilic DHO4 extracts in protecting human keratinocytes exposed to UVA stress. Keratinocytes were pre-incubated with ascorbic acid or with extracts from the ascorbic acid enriched tomato genotype and irradiated with UVA light. Then, ROS production, intracellular GSH and lipid peroxidation levels were quantified. Western blots were carried out to evaluate mitogen-activated protein kinases cascade, activation of caspase-3 and inflammation levels. We demonstrated that ROS, GSH and lipid peroxidation levels were not altered in cell exposed to UVA stress when cells were pre-treated with ascorbic acid or with tomato extracts. In addition, no evidence of apoptosis and inflammation were observed in irradiated pre-treated cells. Altogether, we demonstrated the ability of an ascorbic acid enriched tomato genotype to counteract UVA-oxidative stress on human keratinocytes. This protective effect is due to the high concentration of vitamin C that acts as free radical scavenger. This novel tomato genotype may be used as genetic material in breeding schemes to produce improved varieties with higher antioxidant levels. PMID:27599115

  16. Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications

    OpenAIRE

    Jiang, Wen G; Sanders, Andrew J.; Ruge, Fiona; HARDING, KEITH G.

    2011-01-01

    Interleukin (IL)-8 is a pro-inflammatory cytokine that has a direct effect on immune cells, including polymorphonuclear cells. Keratinocytes are a rich source of IL-8. However, there is little knowledge on the role of IL-8 in clinical wound healing and the direct biological effect of IL-8 on keratinocytes. In this study, the effect of recombinant human IL-8 (rhIL-8) on migration and adhesion was tested using HaCaT keratinocytes as a cell model. The cell functions were evaluated using impedanc...

  17. Vitamin C Compound Mixtures Prevent Ozone-Induced Oxidative Damage in Human Keratinocytes as Initial Assessment of Pollution Protection.

    Directory of Open Access Journals (Sweden)

    Giuseppe Valacchi

    Full Text Available One of the main functions of cutaneous tissues is to protect our body from the outdoor insults. Ozone (O3 is among the most toxic stressors to which we are continuously exposed and because of its critical location, the skin is one of the most susceptible tissues to the oxidative damaging effect of O3. O3 is not able to penetrate the skin, and although it is not a radical per se, the damage is mainly a consequence of its ability to induce oxidative stress via the formation of lipid peroxidation products.In this study we investigated the protective effect of defined "antioxidant" mixtures against O3 induced oxidative stress damage in human keratinocytes and understand their underlying mechanism of action.Results showed that the mixtures tested were able to protect human keratinocytes from O3-induced cytotoxicity, inhibition of cellular proliferation, decrease the formation of HNE protein adducts, ROS, and carbonyls levels. Furthermore, we have observed the decreased activation of the redox sensitive transcription factor NF-kB, which is involved in transcribing pro-inflammatory cytokines and therefore constitutes one of the main players associated with O3 induced skin inflammation. Cells exposed to O3 demonstrated a dose dependent increase in p65 subunit nuclear expression as a marker of NF-kB activation, while pre-treatment with the mixtures abolished NF-kB nuclear translocation. In addition, a significant activation of Nrf2 in keratinocytes treated with the mixtures was also observed.Overall this study was able to demonstrate a protective effect of the tested compounds versus O3-induced cell damage in human keratinocytes. Pre-treatment with the tested compounds significantly reduced the oxidative damage induced by O3 exposure and this protective effect was correlated to the abolishment of NF-kB nuclear translocation, as well as activation of Nrf2 nuclear translocation activating the downstream defence enzymes involved in cellular detoxification

  18. Paeoniflorin attenuates ultraviolet B-induced apoptosis in human keratinocytes by inhibiting the ROS-p38-p53 pathway.

    Science.gov (United States)

    Kong, Lingwen; Wang, Shangshang; Wu, Xiao; Zuo, Fuguo; Qin, Haihong; Wu, Jinfeng

    2016-04-01

    Ultraviolet (UV) light is one of the most harmful environmental factors that contribute to skin damage. Exposure to UV induces extensive generation of reactive oxygen species (ROS), and results in photoaging and skin cancer development. One approach to protecting human skin against UV radiation is the use of antioxidants. In recent years, naturally occurring herbal compounds have gained considerable attention as protective agents for UV exposure. Paeoniflorin (PF) is a novel natural antioxidant, which is isolated from peony root (Radix Paeoniae Alba). The present study evaluated the protective effects of PF on UV‑induced skin damage in vitro, and demonstrated that the effects were mediated via the ROS‑p38‑p53 pathway. The results of the present study demonstrated that treatment with PF (25, 50, and 100 µM) significantly increased the percentage of viable keratinocytes after UV‑B exposure. In addition, cell death analysis indicated that PF treatment markedly reduced UV‑B‑radiation‑induced apoptosis in keratinocytes, which was accompanied by increased procaspase 3 expression and decreased cleaved caspase 3 expression. Treatment with PF markedly reduced the production of ROS, and inhibited the activation of p38 and p53 in human keratinocytes, thus suggesting that the ROS‑p38‑p53 pathway has a role in UV‑B‑induced skin damage. In conclusion, the present study reported that PF was able to attenuate UV‑B‑induced cell damage in human keratinocytes. Notably, these effects were shown to be mediated, at least in part, via inhibition of the ROS-p38-p53 pathway. PMID:26936104

  19. Immunochemistry of a keratinocyte-fibroblast co-culture model for reconstruction of human skin.

    Science.gov (United States)

    Fleischmajer, R; MacDonald, E D; Contard, P; Perlish, J S

    1993-09-01

    Our purpose was to determine differentiation markers of an in vitro co-culture model in which fibroblasts grown in a three-dimensional nylon mesh were recombined with human keratinocytes. The cultures were kept for 5 weeks and then processed for electron microscopy and immunochemistry. The specimens revealed an epidermis, a basal lamina, an anchoring zone, and a dermis. Epidermal differentiation was confirmed by the presence of K10-keratin, trichohyalin, and filaggrin. The basal lamina contained Type IV collagen, laminin, nidogen, and heparan sulfate. Type IV collagen, laminin, and nidogen were also noted in the extracellular matrix. Type VI collagen was present in the anchoring zone and also gave a reticulated pattern in the rest of the dermis. There was a heavy signal for tenascin and fibronectin throughout the dermis. Osteonectin was restricted to the epidermis and dermal fibroblasts. Fibrillin stained at the anchoring zone and dermis but elastin and vitronectin were negative, suggesting early formation of elastic fibrils. Collagen fibrils stained for Types I, III, and V, as well as the amino propeptide of Types I and III procollagen, suggesting newly synthesized collagen. Decorin was present throughout the dermis. The model described appears suitable for in vitro reconstruction of the skin and may be useful to study the development of various supramolecular skin structures.

  20. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress

    Science.gov (United States)

    KIM, KI CHEON; PIAO, MEI JING; HEWAGE, SUSARA RUWAN KUMARA MADDUMA; HAN, XIA; KANG, KYOUNG AH; JO, JIN OH; MOK, YOUNG SUN; SHIN, JENNIFER H.; PARK, YEUNSOO; YOO, SUK JAE; HYUN, JIN WON

    2016-01-01

    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The levels of intracellular reactive oxygen species (ROS) were determined using 2′,7′-dichlorodihydro-fluorescein diacetate and dihydroethidium was used to monitor superoxide anion production. Plasma induced the generation of ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals. N-acetyl cysteine, which is an antioxidant, prevented the decrease in cell viability caused by exposure to plasma. ROS generated by exposure to plasma resulted in damage to various cellular components, including lipid membrane peroxidation, DNA breaks and protein carbonylation, which was detected by measuring the levels of 8-isoprostane and diphenyl-1-pyrenylphosphine assay, comet assay and protein carbonyl formation. These results suggest that plasma exerts cytotoxic effects by causing oxidative stress-induced damage to cellular components. PMID:26573561

  1. Gene Expression Profiling of Human Epidermal Keratinocytes in Simulated Microgravity and Recovery Cultures

    Institute of Scientific and Technical Information of China (English)

    Jade Q. Clement; Shareen M. Lacy; Bobby L. Wilson

    2008-01-01

    Simulated microgravity (SMG) bioreactors and DNA microarray technology are powerful tools to identify "space genes" that play key roles in cellular response to microgravity. We applied these biotechnology tools to investigate SMG and post-SMG recovery effects on human epidermal keratinocytes by exposing cells to SMG for 3,4,9, and 10d using the high aspect ratio vessel bioreactor followed by recovery culturing for 15,50, and 60d in normal gravity. As a result, we identified 162 differentially expressed genes, 32 of which were "center genes" that were most consistently affected in the time course experiments. Eleven of the center genes were from the integrated stress response pathways and were coordinately down regulated. Another seven of the center genes, which are all metallothionein MT-Ⅰ and MT-Ⅱ isoforms, were coordinately up-regulated. In addition, HLA-G, a key gene in cellular immune response suppression, was found to be significantly upregulated during the recovery phase. Overall, more than 80% of the differentially expressed genes from the shorter exposures (≤4d) recovered in 15d; for longer (≥9d) exposures, more than 50d were needed to recover to the impact level of shorter exposures. The data indicated that shorter SMG exposure duration would lead to quicker and more complete recovery from the microgravity effect.

  2. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes

    International Nuclear Information System (INIS)

    The mechanism by which radiation-induced genomic instability is initiated, propagated and effected is currently under intense scrutiny. We have investigated the potential role of altered genomic methylation patterns in the cellular response to irradiation and have found evidence for widespread dysregulation of CpG methylation persisting up to 20 population doublings post-irradiation. Similar effects are seen with cells treated with medium from irradiated cells (the 'bystander effect') rather than subjected to direct irradiation. Using an arbitrarily primed methylation sensitive PCR screening method we have demonstrated that irradiation causes reproducible alterations in the methylation profile of a human keratinocyte cell line, HPV-G, and have further characterised one of these sequences as being a member of a retrotransposon element derived sequence family on chromosome 7; MLT1A. Multiple changes were also detected in the screen, which indicate that although the response of cells is predominantly hypermethylation, specific hypomethylation occurs as well. Sequence specific changes are also reported in the methylation of the pericentromeric SAT2 satellite sequence. This is the first demonstration that irradiation results in the induction of heritable methylation changes in mammalian cells, and provides a link between the various non-radiological instigators of genomic instability, the perpetuation of the unstable state and several of its manifestations

  3. Stages of Cell Cannibalism--Entosis--in Normal Human Keratinocyte Culture.

    Science.gov (United States)

    Garanina, A S; Khashba, L A; Onishchenko, G E

    2015-11-01

    Entosis is a type of cell cannibalism during which one cell penetrates into another cell and usually dies inside it. Researchers mainly pay attention to initial and final stages of entosis. Besides, tumor cells in suspension are the primary object of studies. In the present study, we investigated morphological changes of both cells-participants of entosis during this process. The substrate-dependent culture of human normal keratinocytes HaCaT was chosen for the work. A combination of light microscopy and scanning electron microscopy was used to prove that one cell was completely surrounded by the plasma membrane of another cell. We investigated such "cell-in-cell" structures and described the structural and functional changes of both cells during entosis. The outer cell nucleus localization and shape were changed. Gradual degradation of the inner cell nucleus and of the junctions between the inner and the outer cells was revealed. Moreover, repeated redistribution of the outer cell membrane organelles (Golgi apparatus, lysosomes, mitochondria, and autophagosomes), rearrangement of its cytoskeleton, and change in the lysosomal, autophagosomal, and mitochondrial state in both entotic cells were observed during entosis. On the basis of these data, we divided entosis into five stages that make it possible to systematize description of this type of cell death. PMID:26615438

  4. A mint purified extract protects human keratinocytes from short-term, chemically induced oxidative stress.

    Science.gov (United States)

    Berselli, Patrizia Valeria Rita; Zava, Stefania; Montorfano, Gigliola; Corsetto, Paola Antonia; Krzyzanowska, Justyna; Oleszek, Wieslaw; Berra, Bruno; Rizzo, Angela Maria

    2010-11-10

    Oxidative stress is strictly correlated to the pathogenesis of many diseases, and a diet rich in fruits and vegetables, or adequately integrated, is currently considered to be a protective and preventive factor. This study aimed to analyze the efficacy of a 1 h preincubation with the highest nontoxic dose of a characterized Mentha longifolia extract (80 μg/mL) in protecting human keratinocytes (NCTC2544) from chemically induced oxidative stress (500 μM H2O2 for 2, 16, and 24 h). As reference synthetic pure compounds rosmarinic acid (360.31 μg/mL), a major mint phenolic constituent, and resveratrol (31.95 mg/mL), a well-known antioxidant, were used. Cellular viability was significantly protected by mint, which limited protein and DNA damage, decreased lipid peroxidation, and preserved glutathione and superoxide dismutase activity in the shorter phases of oxidative stress induction, in extents comparable to or better than those of pure compounds. These data suggest that mint use as only a flavoring has to be revised, taking into consideration its enrichment in foodstuff and cosmetics.

  5. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  6. Gracilaria bursa-pastoris (Gmelin) Silva extract attenuates ultraviolet B radiation-induced oxidative stress in human keratinocytes.

    Science.gov (United States)

    Piao, M J; Kim, K C; Zheng, J; Yao, C W; Cha, J W; Kang, H K; Yoo, E S; Koh, Y S; Ko, M H; Lee, N H; Hyun, Jin Won

    2014-01-01

    The purpose of this study was to assess the protective effects of an ethanol extract derived from the red alga Gracilaria bursa-pastoris (Gmelin) Silva (GBE) on ultraviolet B (UVB)-irradiated human HaCaT keratinocytes. GBE exhibited scavenging activity against intracellular reactive oxygen species that were induced by either hydrogen peroxide or UVB radiation. In addition, both the superoxide anion and the hydroxyl radical were scavenged by GBE in cell-free systems. GBE absorbed light in the UVB range (280-320 nm) of the electromagnetic spectrum and lessened the extent of UVB-induced oxidative damage to cellular lipids, proteins, and DNA. Finally, GBE-treated keratinocytes showed a reduction in UVB-induced apoptosis, as exemplified by fewer apoptotic bodies. These results suggest that GBE exerts cytoprotective actions against UVB-stimulated oxidative stress by scavenging ROS and absorbing UVB rays, thereby attenuating injury to cellular constituents and preventing cell death.

  7. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Hanwen [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC 29208 (United States); Pirisi, Lucia [Department of Pathology, Microbiology and Immunology, University of South Carolina School of Medicine, University of South Carolina, Columbia, SC 29208 (United States); Creek, Kim E., E-mail: creekk@sccp.sc.edu [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC 29208 (United States)

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling.

  8. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yi; Pirisi, Lucia [Department of Pathology, Microbiology and Immunology, School of Medicine, University of South Carolina, Columbia, SC (United States); Creek, Kim E., E-mail: creekk@sccp.sc.edu [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC (United States)

    2013-09-15

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski.

  9. Ubiquitin/proteasome pathway regulates levels of retinoic acid receptor gamma and retinoid X receptor alpha in human keratinocytes.

    Science.gov (United States)

    Boudjelal, M; Wang, Z; Voorhees, J J; Fisher, G J

    2000-04-15

    Repeated exposure of human skin to solar UV radiation leads to premature aging (photoaging) and skin cancer. UV-induced skin damage can be ameliorated by all-trans retinoic acid treatment. The actions of retinoic acid in skin keratinocytes are mediated primarily by nuclear retinoic acid receptor gamma (RARgamma) and retinoid X receptor alpha (RXRalpha). We found that exposure of cultured primary human keratinocytes to UV irradiation (30 mJ/cm2) substantially reduced (50-90%) RARgamma and RXRalpha mRNA and protein within 8 h. The rates of disappearance of RARgamma and RXRalpha proteins after UV exposure or treatment with the protein synthesis inhibitor cycloheximide were similar. UV irradiation did not increase the rate of breakdown of RARgamma or RXRalpha but rather reduced their rate of synthesis. The addition of proteasome inhibitors MG132 and LLvL, but not the lysosomal inhibitor E64, prevented loss of RARgamma and RXRalpha proteins after exposure of keratinocytes to either UV radiation or cycloheximide. Soluble extracts from nonirradiated or UV-irradiated keratinocytes possessed similar levels of proteasome activity that degraded RARgamma and RXRalpha proteins in vitro. Furthermore, RARgamma and RXRalpha were polyubiquitinated in intact cells. RXRalpha was found to contain two proline, glutamate/aspartate, serine, and threonine (PEST) motifs, which confer rapid turnover of many short-lived regulatory proteins that are degraded by the ubiquitin/proteasome pathway. However, the PEST motifs in RXRalpha did not function to regulate its stability, because deletion of the PEST motifs individually or together did not alter ubiquitination or proteasome-mediated degradation of RXRalpha. These results demonstrate that loss of RARgamma and RXRalpha proteins after UV irradiation results from degradation via the ubiquitin/proteasome pathway. Taken together, the data here indicate that ubiquitin/proteasome-mediated breakdown is an important mechanism regulating the levels of

  10. Role of VEGF receptors in normal and psoriatic human keratinocytes: evidence from irradiation with different UV sources.

    Directory of Open Access Journals (Sweden)

    Jian-Wei Zhu

    Full Text Available Vascular endothelial growth factor (VEGF promotes angiogenesis and plays important roles both in physiological and pathological conditions. VEGF receptors (VEGFRs are high-affinity receptors for VEGF and are originally considered specific to endothelial cells. We previously reported that VEGFRs were also constitutively expressed in normal human keratinocytes and overexpressed in psoriatic epidermis. In addition, UVB can activate VEGFRs in normal keratinocytes, and the activated VEGFR-2 signaling is involved in the pro-survival mechanism. Here, we show that VEGFRs were also upregulated and activated by UVA in normal human keratinocytes via PKC, and interestingly, both the activated VEGFR-1 and VEGFR-2 protected against UVA-induced cell death. As VEGFRs were over-expressed in psoriatic epidermis, we further investigated whether narrowband UVB (NB-UVB phototherapy or topical halomethasone monohydrate 0.05% cream could affect their expression. Surprisingly, the over-expressed VEGFRs in psoriatic epidermis were significantly attenuated by both treatments. During NB-UVB therapy, VEGFRs declined first in the basal, and then gradually in the upper psoriatic epidermis. VEGFRs were activated in psoriatic epidermis, their activation was enhanced by NB-UVB, but turned undetectable after whole therapy. This process was quite different from that by halomethasone, in which VEGFRs and phospho-VEGFRs decreased in a gradual, homogeneous manner. Our findings further suggest that UV-induced activation of VEGFRs serves as a pro-survival signal for keratinocytes. In addition, VEGFRs may be involved in the pathological process of psoriasis, and UV phototherapy is effective for psoriasis by directly modulating the expression of VEGFRs.

  11. Expression and purification of recombinant truncated human keratinocyte growth factor-1

    International Nuclear Information System (INIS)

    Objective: To construct the genetic engineering bacteria highly expressing 23 amino acids human keratinocyte growth factor-1 (rhKGF1dest23) missing N terminal, and provide experimental data for development of new drug for treatment of oral mucositis after radiotherapy and chemotherapy. Methods: PCR was used to synthese 23 amino acids rhKGF1dest23 missing N terminal and sumo gene fragments, and construct four kinds of recombinant prokaryotic expression vectors: pET22b-rhKGF1dest23, pET22b-sumo-rhKGF1dest23, pET3c-rhKGF1dest23 and pET3c-sumo-rhKGF1dest23, then they were transformed into prokaryotic expression host bacteria: Rosetta (DE3) plysS, BL21 (DE3), BL21 (DE3) Star plysS, origima(DE3) and BL21AI, the best expression combination of plasmid and host strain of rhKGF1dest23 protein was screened and purified by CM ion-exchange and heparin affinity chromatography and identified with Western blotting. Results: pET22b-rhKGF1dest23 plasmid and the BL21AI host bacteria was the best combination of expression, after induced by IPTG and arabinose, the majority of recombinant protein was expressed in soluble form, accounting for about 12% of the total bacterial proteins. Its purity reached to more than 95% of the protein after two steps chromatography, then conformed with Western blotting. Conclusion: Human genetic engineering bacteria of KGF1dest23 is successfully constructed and induced by IPTG and arabinose, then after CM weak cation exchange and heparin affinity chromatography, the purified rhKGF1dest23 protein is obtained. (authors)

  12. Early Gene Expression in Wounded Human Keratinocytes Revealed by DNA Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Pascal Barbry

    2006-04-01

    Full Text Available Wound healing involves several steps: spreading of the cells, migration and proliferation. We have profiled gene expression during the early events of wound healing in normal human keratinocytes with a home-made DNA microarray containing about 1000 relevant human probes. An original wounding machine was used, that allows the wounding of up to 40% of the surface of a confluent monolayer of cultured cells grown on a Petri dish (compared with 5% with a classical ‘scratch’ method. The two aims of the present study were: (a to validate a limited number of genes by comparing the expression levels obtained with this technique with those found in the literature; (b to combine the use of the wounding machine with DNA microarray analysis for large-scale detection of the molecular events triggered during the early stages of the wound-healing process. The time-courses of RNA expression observed at 0.5, 1.5, 3, 6 and 15 h after wounding for genes such as c-Fos, c-Jun, Egr1, the plasminogen activator PLAU (uPA and the signal transducer and transcription activator STAT3, were consistent with previously published data. This suggests that our methodologies are able to perform quantitative measurement of gene expression. Transcripts encoding two zinc finger proteins, ZFP36 and ZNF161, and the tumour necrosis factor α-induced protein TNFAIP3, were also overexpressed after wounding. The role of the p38 mitogen-activated protein kinase (p38MAPK in wound healing was shown after the inhibition of p38 by SB203580, but our results also suggest the existence of surrogate activating pathways.

  13. Expression profiling of human keratinocyte response to ultraviolet A: implications in apoptosis.

    Science.gov (United States)

    He, Yu-Ying; Huang, Jian-Li; Sik, Robert H; Liu, Jie; Waalkes, Michael P; Chignell, Colin F

    2004-02-01

    Ultraviolet A radiation from sunlight is a major human health concern, as it is not absorbed by the ozone layer and can deeply penetrate into the skin causing skin damage. To study the molecular mechanism involved in the ultraviolet A effect, human HaCaT keratinocytes were exposed to ultraviolet A at doses of 10 J per cm2 and 30 J per cm2. Ultraviolet A irradiation caused dose- and time-dependent apoptotic cell death, as evidenced by DNA fragmentation, flow cytometry, and the activation of caspase-3. To study the genes altered by ultraviolet A at an apoptosis-inducing dose (30 J per cm2), cells were harvested immediately after ultraviolet A treatment (0 h), and 6 h and 24 h after ultraviolet A exposure. Total RNA was extracted for microarray and real-time RT-PCR analysis, and cellular proteins were extracted for western blot analysis. Of the selected critical genes/proteins, the induction of c-Jun, c-myc, and p33ING1, and the repression of epidermal growth factor receptor, inhibitor of apoptosis protein, and survivin pathways, could be involved in ultraviolet-A-induced apoptosis. On the other hand, the late induction of cyclin D1 and cyclin-dependent kinase 4 was indicative of possible cell cycle recovery in surviving cells. Real-time RT-PCR analysis confirmed these results and a majority of the protein levels paralleled their corresponding RNA levels. In addition, ultraviolet A treatment altered the expression of genes involved in signal transduction, RNA processing, structural proteins, and metabolism in a time-dependent manner. This initial microarray analysis could advance our understanding of cellular responses to ultraviolet A exposure, and provide a platform from which to further study ultraviolet-A-induced apoptosis and carcinogenesis. PMID:15009741

  14. Low-dose of ionizing radiation impairs DNA repair system in human primary keratinocytes and human skin 3D model

    International Nuclear Information System (INIS)

    The effects of low-doses of ionizing radiation in humans are of growing concern, especially in the context of current radiation techniques such as medical imaging. The biological response of healthy tissue to low dose of 1-10 cGy in vivo is largely unknown. In this project, we propose firstly to study the effects (long and short-term) of low-doses on cell proliferation, apoptosis, and capacity to obtain a cohesive and stratified epidermis after irradiation. Secondly, we will evaluate the carcinogenesis risk by measuring the modulation of the DNA repair/damage systems after low-dose exposure. For short-term radiosensitivity, cell viability was determined by MTT assay after 24, 48 and 72 h post irradiation, we also performed an in vivo colony-forming assay, which measures the radiation toxicity after 2 weeks. DNA repair system and damage was assessed by different techniques available in our laboratory (DNA repair chips, modified comet assay). Finally, organogenesis potential was determined by the capacity of normal exposed keratinocytes to form a pluri-stratified epithelium in 3D organo-typic cultures. We showed that low-dose of ionizing radiation increases 2 fold the oxidative DNA damage (p=0.01) without any activation of the base excision repair pathway, an important pathway to repair oxidative DNA damage. Moreover, we showed that low-dose affects the organogenesis potential of keratinocytes and impairs the proliferation-differentiation balance in the reconstructed skin. We postulate that when the dose or dose rate is very low the radiation damage sensors (ATM or ATR) are not activated, and the repair machinery is not induced. Hence damage could be accumulated in the genome of a cell until eventually it become malignant. (authors)

  15. A Novel Controllable Hydrogen Sulfide-Releasing Molecule Protects Human Skin Keratinocytes Against Methylglyoxal-Induced Injury and Dysfunction

    Directory of Open Access Journals (Sweden)

    Chun-tao Yang

    2014-09-01

    Full Text Available Background/Aim: Delayed wound healing is a common skin complication of diabetes, which is associated with keratinocyte injury and dysfunction. Levels of methylglyoxal (MGO, an α-dicarbonyl compound, are elevated in diabetic skin tissue and plasma, while levels of hydrogen sulfide (H2S, a critical gaseous signaling molecule, are reduced. Interestingly, the gas has shown dermal protection in our previous study. To date, there is no evidence demonstrating whether MGO affects keratinocyte viability and function or H2S donation abolishes these effects and improves MGO-related impairment of wound healing. The current study was conducted to examine the effects of MGO on the injury and function in human skin keratinocytes and then to evaluate the protective action of a novel H2S-releasing molecule. Methods: An N-mercapto-based H2S donor (NSHD-1 was synthesized and its ability to release H2S was observed in cell medium and cells, respectively. HaCaT cells, a cell line of human skin keratinocyte, were exposed to MGO to establish an in vitro diabetic wound healing model. NSHD-1 was added to the cells before MGO exposure and the improvement of cell function was observed in respect of cellular viability, apoptosis, oxidative stress, mitochondrial membrane potential (MMP and behavioral function. Results: Treatment with MGO decreased cell viability, induced cellular apoptosis, increased intracellular reactive oxygen species (ROS content and depressed MMP in HaCaT cells. The treatment also damaged cell behavioral function, characterized by decreased cellular adhesion and migration. The synthesized H2S-releasing molecule, NSHD-1, was able to increase H2S levels in both cell medium and cells. Importantly, pretreatment with NSHD-1 inhibited MGO-induced decreases in cell viability and MMP, increases in apoptosis and ROS accumulation in HaCaT cells. The pretreatment was also able to improve adhesion and migration function. Conclusion: These results demonstrate that

  16. Effect of various metals on intercellular adhesion molecule-1 expression and tumour necrosis factor alpha production by normal human keratinocytes.

    Science.gov (United States)

    Guéniche, A; Viac, J; Lizard, G; Charveron, M; Schmitt, D

    1994-01-01

    Nickel, cobalt and chromium are metals very often implicated in allergic contact dermatitis. In vivo, keratinocytes, which are the first target cells, can be directly activated to participate in the local reaction, especially through the expression of the membrane antigen ICAM-1, a ligand of the leucocyte antigen LFA-1, and the production of cytokines. Our aim was to assess the effects of sensitizing metal haptens (nickel, cobalt and chromium) compared with the toxic metal cadmium on the induction of ICAM-1 and the production of TNF alpha by epidermal cells. For this purpose, normal human keratinocytes obtained during plastic skin surgery were cultured in low-calcium defined medium (MCDB153) and the metals were used in non-toxic concentrations. Using FACS analysis, ICAM-1 expression was found to be induced only by nickel. This stimulation appeared as early as 24 h after stimulation. All the metals induced a low expression of TNF alpha detectable by immunocytochemistry correlating with the induction of the nuclear stress protein Hsp72 which is closely linked genetically with the TNF alpha locus. However, only Ni2+, Co2+ and Cr2+ induced a significant release of TNF alpha detectable by ELISA after 48 h stimulation. This secretion was lower than that observed with known stimulants such as lipopolysaccharide. These results indicate that the metals studied are able to induce an aggressive cellular effect, and that nickel, by its ICAM-1 induction, may play a major role in the keratinocyte activation state during allergic contact dermatitis. PMID:7864660

  17. Cytotoxicity and chromosome aberrations in normal human oral keratinocytes induced by chemical carcinogens: Comparison of inter-individual variations.

    Science.gov (United States)

    Tsutsui, T; Kawamoto, Y; Suzuki, N; Gladen, B C; Barrett, J C

    1991-01-01

    Normal human keratinocytes from the oral cavity were cultured in vitro in serum-free medium. Cultures from different individuals were established, and the responses of the cells to different chemicals were compared. The cells, grown at clonal densities, were treated separately with an alkylating agent (N-methyl-N'-nitro-N-nitrosoguanidine; MNNG), two arsenical salts (sodium arsenate or sodium arsenite), sodium fluoride or two polyaromatic hydrocarbons (benzo[a]pyrene or 7,12-dimethylbenz[a]-anthracene). There were no significant differences in the colony-forming efficiencies (22.8 +/- 4.2%) of control (untreated) cells from five different individuals. At selected doses, each of the chemicals reduced the colony-forming efficiencies of the treated cells. The cytotoxicity of most of the chemicals did not differ significantly among cells derived from different individuals, with the exception of sodium arsenate at two doses and sodium fluoride at the highest dose tested. Induction of chromosome aberrations by MNNG, sodium arsenite, sodium arsenate and sodium flouride was analysed with cells derived from up to nine individuals. There was little difference in the inducibilities of chromosome aberrations among cultured keratinocytes from different donors. Treatment of cells from nine donors with one dose of sodium fluoride revealed a statistically significant inter-individual variation. These findings provide a model system to study the effects of carcinogens on the target cells for oral cancers. The results can be compared with findings for cells from other epithelial tissues, since the culture conditions support the growth of keratinocytes regardless of origin. Little inter-individual variation was observed in the response of oral keratinocytes to the chemicals examined.

  18. The Effects of Antifungal Azoles on Inflammatory Cytokine Production in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    K Zomorodian

    2008-04-01

    Full Text Available ABSTRACT: Introduction & Objective: Azoles drugs are being used successfully in treatment of fungal infections. Recently, immunosuppressive effects of some of these agents have been reported. Keratinocytes, as the major cells of the skin, have an important role in innate immunity against pathogenic agents. Considering the scanty of information about the effects of azoles on immune responces, this study was conducted to assess the expression and secretion of inflammatory cytokines in keratinocytes following treatment with azole drugs. Materials & Methods: This is an exprimental study conducted in in molecular biology division in Tehran University of Medical Sciences and Immunodermatology Department in Vienna Medical University. Primery keratinocytes were cultured and treated with different concentrations of fluconazole, itraconazole, ketoconazole and griseofulvin. Secreted IL1, IL6 and TNF-α by keratinocytes in culture supernatant were measured by quantitative enzyme immunoassay technique. Moreover, expression of the genes encoding IL1 and IL8 was evaluated by Real Time-PCR. Results: Treatment of keratinocytes with different concentrations of fluconazole and low concentration of ketoconazole resulted in decrease in IL1 secretion, but Itraconazole and griseofulvin did not show such an effect at the same concentrations. In addition, none of the examined drugs had an effect on secretion level of IL6 and TNF-α. Quantitative analysis of IL1 and IL8 encoding genes revealed that transcription on these genes might be suppressed following treatment with fluconazole or ketoconazole. Conclusion: Fluconazole and ketoconazole might modulate the expression and secretion of IL1 and IL8 and affect the direction of immune responses induced by keratinocytes

  19. Effect of Storage Temperature on Structure and Function of Cultured Human Oral Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Rakibul Islam

    Full Text Available To assess the effect of storage temperature on the viability, phenotype, metabolism, and morphology of cultured human oral keratinocytes (HOK.Cultured HOK cells were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium (MEM at nine temperatures in approximately 4 °C increments from 4 °C to 37 °C for seven days. Cells were characterized for viability by calcein fluorescence, phenotype retention by immunocytochemistry, metabolic parameters (pH, glucose, lactate, and O2 within the storage medium by blood gas analysis, and morphology by scanning electron microscopy and light microscopy.Relative to the cultured, but non-stored control cells, a high percentage of viable cells were retained only in the 12 °C and 16 °C storage groups (85% ± 13% and 68% ± 10%, respectively. Expression of ABCG2, Bmi1, C/EBPδ, PCNA, cytokeratin 18, and caspase-3 were preserved after storage in the 5 groups between 4 °C and 20 °C, compared to the non-stored control. Glucose, pH and pO2 in the storage medium declined, whereas lactate increased with increasing storage temperature. Morphology was best preserved following storage of the three groups between 12 °C, 16 °C, and 20 °C.We conclude that storage temperatures of 12 °C and 16 °C were optimal for maintenance of cell viability, phenotype, and morphology of cultured HOK. The storage method described in the present study may be applicable for other cell types and tissues; thus its significance may extend beyond HOK and the field of ophthalmology.

  20. Bitter apricot essential oil induces apoptosis of human HaCaT keratinocytes.

    Science.gov (United States)

    Li, Keyou; Yang, Wenhua; Li, Zhe; Jia, Wangwang; Li, Jiazhou; Zhang, Pengfei; Xiao, Tiancun

    2016-05-01

    Psoriasis is a chronic skin disease that affects approximately 2% of the world's population. Conventional therapeutic approaches are not effective or necessarily safe for treating symptoms due to the serious side effects and resistance to currently prescribed drugs. Traditionally, in oriental medicine, apricot seed (Semen Armeniacae amarum) is used to treat skin diseases. However, the underlying mechanism of action has not been systematically elucidated. In the present study, the anti-proliferative effect of bitter apricot essential oil (BAEO) on cultured HaCaT cells was evaluated and the mechanism of action investigated. BAEO was isolated by hydrodistillation, and gas chromatography-mass spectrometry (GC-MS) analysis identified benzaldehyde (75.35%), benzoic acid (6.21%) and mandelonitrile (5.38%). HaCaT cell growth, measured by sulforhodamine B assay (SRB), was inhibited by BAEO with an IC50 value of 142.45 μg/ml. Apoptosis of HaCaT cells treated with BAEO was detected by cell cycle, flow cytometry, and western blot analyses. These measurements revealed G0/G1 cell cycle arrest, elevated numbers of early and late stage apoptotic cells, and caspases-3/8/9 and PARP activation. Z-VAD-FMK, a broad-spectrum caspase inhibitor, attenuated BAEO-induced apoptosis. Also, increased Bax and decreased Bcl-2 levels suggest that BAEO-induced apoptosis is mediated through both death receptor and mitochondrial pathways. Moreover, reduced Rel/NF-κB levels suggest that BAEO-mediated apoptosis is also associated with inhibition of the NF-κB pathway. These data suggest that BAEO is a naturally occurring material that functions as a potent pro-apoptotic factor for human keratinocytes. Thus, it is a promising candidate to treat psoriasis. PMID:26971222

  1. Nicotinamide attenuates aquaporin 3 overexpression induced by retinoic acid through inhibition of EGFR/ERK in cultured human skin keratinocytes.

    Science.gov (United States)

    Song, Xiuzu; Xu, Aie; Pan, Wei; Wallin, Brittany; Kivlin, Rebecca; Lu, Shan; Cao, Cong; Bi, Zhigang; Wan, Yinsheng

    2008-08-01

    The most common adverse effects that are related to all-trans retinoic acid (atRA) treatment are irritation and dryness of the skin. atRA therapy is reported to impair barrier function as achieved by trans-epidermal water loss (TEWL). Treatment with nicotinamide prior to initiation of atRA therapy provides additional barrier protection and thus reduces susceptibility of retinoic acid. Our previous studies showed that atRA upregulates aquaporin 3 (AQP3) in cultured human skin keratinocytes and fibroblasts. Others have demonstrated that in atopic dermatitis, overexpression of AQP3 is linked to elevated TEWL and that nicotinamide treatment reduces skin TEWL. In this study, we observed that while atRA upregulates AQP3 expression in cultured human skin keratinocytes (HaCaT cells), nicotinamide attenuates the effect of atRA in a concentration-dependent manner. atRA treatment induces EGFR and ERK activation. PD153035, an EGFR inhibitor, and U0126, an ERK inhibitor, inhibit atRA-induced upregulation of AQP3. Nicotinamide also inhibits atRA-induced activation of EGFR/ERK signal transduction and decreases water permeability by downregulating AQP3 expression. Collectively, our results indicate that the effect of atRA on AQP3 expression is at least partly mediated by EGFR/ERK signaling in cultured human skin keratinocytes. Nicotinamide attenuates atRA-induced AQP3 expression through inhibition of EGFR/ERK signal transduction and eventually decreases water permeability and water loss. Our study provides insights into the molecular mechanism through which nicotinamide reverses the side effects of dryness in human skin after treatment with atRA.

  2. Zinc oxide nanoparticles-induced epigenetic change and G2/M arrest are associated with apoptosis in human epidermal keratinocytes

    Science.gov (United States)

    Gao, Fei; Ma, Ningjie; Zhou, Hong; Wang, Qing; Zhang, Hao; Wang, Pu; Hou, Haoli; Wen, Huan; Li, Lijia

    2016-01-01

    As an engineered nanomaterial, zinc oxide nanoparticles (ZnO NPs) are used frequently in biological applications and can make contact with human skin. Here, we systematically investigated the effects of ZnO NPs on non-tumorigenic human epidermal keratinocytes, which were used as a test model for this in vitro study, at the epigenetic and molecular levels. Our results showed that ZnO NPs induced cell cycle arrest at the G2/M checkpoint before the viability of human epidermal keratinocytes was reduced, which was associated with the chromatin changes at the epigenetic level, including increased methylation of histone H3K9 and decreased acetylation of histone H4K5 accompanied by chromatin condensation at 24 hours. The mRNA expression of the methyltransferase genes G9a and GLP was also increased upon treatment with ZnO NPs, and the acetyltransferase genes GCN5, P300, and CBP were downregulated. Reactive oxygen species were found to be more abundant after treatment with ZnO NPs for 6 hours, and DNA damage was observed at 24 hours. Transmission electron microscopy and flow cytometry confirmed that ZnO NPs were absorbed into the cell when they were added to the medium. Apoptotic human epidermal keratinocytes were detected, and the expression of the proapoptotic genes Bax, Noxa, and Puma increased significantly, while the expression of the antiapoptotic gene Bcl-xl decreased 24 hours after exposure to ZnO NPs. These findings suggest that the ZnO NPs induced cell cycle arrest at G2/M, which was associated with epigenetic changes and accompanied by p53-Bax mitochondrial pathway-mediated apoptosis. PMID:27570453

  3. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available UNLABELLED: The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A. CONCLUSIONS/SIGNIFICANCE: Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  4. Activated protein C: A regulator of human skin epidermal keratinocyte function

    Institute of Scientific and Technical Information of China (English)

    Kelly; McKelvey; Christopher; John; Jackson; Meilang; Xue

    2014-01-01

    Activated protein C(APC) is a physiological anticoagulant, derived from its precursor protein C(PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor(EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC’s function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  5. Activated protein C: A regulator of human skin epidermal keratinocyte function.

    Science.gov (United States)

    McKelvey, Kelly; Jackson, Christopher John; Xue, Meilang

    2014-05-26

    Activated protein C (APC) is a physiological anticoagulant, derived from its precursor protein C (PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor (EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC's function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  6. Cytotoxic effects of sodium dodecyl benzene sulfonate on human keratinocytes are not associated with proinflammatory cytokines expression

    Institute of Scientific and Technical Information of China (English)

    Mu Zhanglei; Liu Xiaojing; Zhao Yan; Zhang Jianzhong

    2014-01-01

    Background Keratinocytes play a crucial role in the biological function of skin barrier.The relationship between sodium lauryl sulfate (SLS) and keratinocytes has been studied.However,the cytotoxicity and effects of sodium dodecyl benzene sulfonate (SDBS),a common detergent similar to SLS,on keratinocytes are still not known.This study aimed to investigate the effects of SDBS on cytotoxicity and expression of proinflammatory cytokines in cultured human keratinocytes.Methods This study was carried out using the keratinocytes cell line,HaCaT cells.The cytotoxicity of SDBS on HaCaT cells was evaluated with cell counting kit-8 (CCK-8) and phase-contrast microscopy.After exposure to different concentrations of SDBS,the total RNA of the HaCaT cells was extracted for evaluating the relative mRNA expression of IL-1α,IL-6,IL-8,and TNF-α by qPCR.The supernatants of cells were collected for measuring the levels of IL-6 and IL-8 by enzyme-linked immunosorbent assay (ELISA).Results SDBS at concentrations of 20 Jg/ml and over showed direct cytotoxicity and induced morphological changes of the HaCaT cells.The mRNA expressions of IL-1a,IL-6,IL-8,and TNF-α in different concentrations of SDBS at different time were comparable with that of controls.SDBS at concentrations of 5,10,and 15 μg/ml had no significant effects on IL-6 and IL-8 excretion from HaCaT cells after 24-hour exposure.Moreover,no significant effects on the IL-6 and IL-8 excretion were found after 10 and 15 μg/ml S DBS stimulations for 6,12,and 24 hours,respectively.Conclusion SDBS at higher concentrations had cytotoxicity on HaCaT cells but had no effects on the mRNA expression of IL-1α,IL-6,IL-8,and TNF-α,that was different from SLS.

  7. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.

  8. Characterization of the human papillomavirus E2 protein: evidence of trans-activation and trans-repression in cervical keratinocytes.

    OpenAIRE

    Bouvard, V.; A Storey; Pim, D; Banks, L.

    1994-01-01

    The major regulator of papillomavirus transcription is encoded by the viral E2 gene. The E2 gene has been well characterized in bovine papillomavirus (BPV) where it encodes at least three different polypeptides which differentially affect viral gene expression. In human papillomaviruses (HPVs) the E2 gene product is much less well characterized. In this study we have analysed the mechanism of action of the HPV-16, HPV-18 and BPV-1 E2 proteins in cervical keratinocytes. We show that the full l...

  9. Zinc deficiency or excess within the physiological range increases genome instability and cytotoxicity, respectively, in human oral keratinocyte cells

    OpenAIRE

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Fenech, Michael

    2011-01-01

    Zinc (Zn) is an essential component of Zn-finger proteins and acts as a cofactor for enzymes required for cellular metabolism and in the maintenance of DNA integrity. The study investigated the genotoxic and cytotoxic effects of Zn deficiency or excess in a primary human oral keratinocyte cell line and determined the optimal concentration of two Zn compounds (Zn Sulphate (ZnSO4) and Zn Carnosine (ZnC)) to minimise DNA damage. Zn-deficient medium (0 μM) was produced using Chelex treatment, and...

  10. Bifurcated converging pathways for high Ca2+- and TGFβ-induced inhibition of growth of normal human keratinocytes

    OpenAIRE

    Sakaguchi, Masakiyo; Sonegawa, Hiroyuki; Nukui, Takamasa; Sakaguchi, Yoshihiko; Miyazaki,Masahiro; Namba,Masayoshi; Huh, Nam-ho

    2005-01-01

    Growth suppression of normal human keratinocytes by high Ca2+ or TGFβ was shown to be mediated by p21WAF1/CIP1 and Sp1 [Pardali, K., et al. (2000) J. Biol. Chem. 275, 29244–29256; Santini, M. P., Talora, C., Seki, T., Bolgan, L. & Dotto, G. P. (2001) Proc. Nat. Acad. Sci. USA 98, 9575–9580; Al-Daraji, W. I., Grant, K. R., Ryan, K., Saxton, A., & Reynolds, N. J. (2002) J. Invest. Dermatol. 118, 779–788]. We previously demonstrated that S100C/A11 is a key mediator for growth inhibition of norma...

  11. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert;

    2012-01-01

    about 18% while other extract components were ineffective. A panel of biochemical and cell-based assays testing the antioxidative and cytoprotective activites of α-amyrin indicated no antioxidative activity of this compound. α-Amyrin did not protect HaCaT cells against the damage caused by UVB radiation.......Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by...

  12. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in human keratinocytes and ex vivo skin.

    Science.gov (United States)

    Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2013-05-01

    Nicotinamide (vitamin B3) protects from ultraviolet (UV) radiation-induced carcinogenesis in mice and from UV-induced immunosuppression in mice and humans. Recent double-blinded randomized controlled Phase 2 studies in heavily sun-damaged individuals have shown that oral nicotinamide significantly reduces premalignant actinic keratoses, and may reduce new non-melanoma skin cancers. Nicotinamide is a precursor of nicotinamide adenine dinucleotide (NAD(+)), an essential coenzyme in adenosine triphosphate (ATP) production. Previously, we showed that nicotinamide prevents UV-induced ATP decline in HaCaT keratinocytes. Energy-dependent DNA repair is a key determinant of cellular survival after exposure to DNA-damaging agents such as UV radiation. Hence, in this study we investigated whether nicotinamide protection from cellular energy loss influences DNA repair. We treated HaCaT keratinocytes with nicotinamide and exposed them to low-dose solar-simulated UV (ssUV). Excision repair was quantified using an assay of unscheduled DNA synthesis. Nicotinamide increased both the proportion of cells undergoing excision repair and the repair rate in each cell. We then investigated ssUV-induced cyclobutane pyrimidine dimers (CPDs) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8oxoG) formation and repair by comet assay in keratinocytes and with immunohistochemistry in human skin. Nicotinamide reduced CPDs and 8oxoG in both models and the reduction appeared to be due to enhancement of DNA repair. These results show that nicotinamide enhances two different pathways for repair of UV-induced photolesions, supporting nicotinamide's potential as an inexpensive, convenient and non-toxic agent for skin cancer chemoprevention.

  13. Ceramide Stimulates ABCA12 Expression via Peroxisome Proliferator-activated Receptor δ in Human Keratinocytes*

    OpenAIRE

    Jiang, Yan J.; Uchida, Yoshikazu; Lu, Biao; Kim, Peggy; Mao, Cungui; Akiyama, Masashi; Elias, Peter M.; Holleran, Walter M.; Grunfeld, Carl; Feingold, Kenneth R.

    2009-01-01

    ABCA12 (ATP binding cassette transporter, family 12) is a cellular membrane transporter that facilitates the delivery of glucosylceramides to epidermal lamellar bodies in keratinocytes, a process that is critical for permeability barrier formation. Following secretion of lamellar bodies into the stratum corneum, glucosylceramides are metabolized to ceramides, which comprise ∼50% of the lipid in stratum corneum. Gene mutations of ABCA12 underlie harlequin ichthyosis, a devastating skin disorde...

  14. The epithelial sodium channel mediates the directionality of galvanotaxis in human keratinocytes

    OpenAIRE

    Yang, Hsin-ya; Charles, Roch-Philippe; Hummler, Edith; Baines, Deborah L.; Isseroff, R. Rivkah

    2013-01-01

    Cellular directional migration in an electric field (galvanotaxis) is one of the mechanisms guiding cell movement in embryogenesis and in skin epidermal repair. The epithelial sodium channel (ENaC), in addition to its function of regulating sodium transport in kidney, has recently been found to modulate cell locomotory speed. Here we tested whether ENaC has an additional function of mediating the directional migration of galvanotaxis in keratinocytes. Genetic depletion of ENaC completely bloc...

  15. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  16. A synthetic isoflavone, DCMF, promotes human keratinocyte migration by activating Src/FAK signaling pathway.

    Science.gov (United States)

    Sophors, Phorl; Kim, Young Mee; Seo, Ga Young; Huh, Jung-Sik; Lim, Yoongho; Koh, Dong Soo; Cho, Moonjae

    2016-04-01

    Flavonoids are plant secondary compounds with various pharmacological properties. We previously showed that one flavonoid, trimethoxyisoflavone (TMF), could promote wound healing by inducing keratinocyte migration. Here, we screened TMF derivatives for enhanced activity and identified one compound, 2',6 Dichloro-7-methoxyisoflavone (DCMF), as most effective at promoting migration in a scratch wound assay. Using the HaCaT keratinocyte cell line, we found DCMF treatment induced phosphorylation of both FAK and Src, and increased keratinocyte migration. DCMF-induced Src kinase could promote activation of ERK, AKT, and p38 signaling pathways, and DCMF-induced secretion of matrix metalloproteinase (MMP)-2 and MMP-9 and partial epithelial-mesenchymal transition (EMT), whereas Src inhibition abolished DCMF-induced EMT. Using an in vivo excisional wound model, we observed improved wound closure and re-epithelialization in DCMF-treated mice, as compared to controls. Collectively, our data demonstrate that DCMF induces cell migration and promotes wound healing through activation of Src/FAK, ERK, AKT, and p38 MAPK signaling. PMID:26923073

  17. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer.

    Science.gov (United States)

    Chen, Yi; Pirisi, Lucia; Creek, Kim E

    2013-09-01

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer.

  18. Protective Effect of the Ethyl Acetate Fraction of Sargassum muticum against Ultraviolet B–Irradiated Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Jin Won Hyun

    2011-11-01

    Full Text Available The aim of this study was to investigate the cytoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME against ultraviolet B (UVB-induced cell damage in human keratinocytes (HaCaT cells. SME exhibited scavenging activity toward the 1,1-diphenyl-2-picrylhydrazyl radicals and hydrogen peroxide (H2O2 and UVB-induced intracellular reactive oxygen species (ROS. SME also scavenged the hydroxyl radicals generated by the Fenton reaction (FeSO4 + H2O2, which was detected using electron spin resonance spectrometry. In addition, SME decreased the level of lipid peroxidation that was increased by UVB radiation, and restored the level of protein expression and the activities of antioxidant enzymes that were decreased by UVB radiation. Furthermore, SME reduced UVB-induced apoptosis as shown by decreased DNA fragmentation and numbers of apoptotic bodies. These results suggest that SME protects human keratinocytes against UVB-induced oxidative stress by enhancing antioxidant activity in cells, thereby inhibiting apoptosis.

  19. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  20. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  1. Primary structure of keratinocyte transglutaminase

    International Nuclear Information System (INIS)

    The nucleotide and deduced amino acid sequences of the coding regions of human and rat keratinocyte transglutaminases (protein-glutamine: amine γ-glutamyltransferase; EC 2.3.2.13) have been determined. These yield proteins of ∼90 kDa that are 92% identical, indicative of the conservation of important structural features. Alignments of amino acid sequences show substantial similarity among the keratinocyte transglutaminase, human clotting factor XIII catalytic subunit, guinea pig liver tissue transglutaminase, and the human erythrocyte band-4.2 protein. The keratinocyte enzyme is most similar to factor XIII, whereas the band-4.2 protein is most similar to the tissue transglutaminase. A salient feature of the keratinocyte transglutaminase is its 105-residue extension beyond the N terminus of the tissue transglutaminase. This extension and the unreltaed activation peptide of factor XIII (a 37-residue extension) appear to be added for specialized functions after divergence of the tissue transglutaminase from their common lineage

  2. Uniform expression of alcohol dehydrogenase 3 in epithelia regenerated with cultured normal, immortalised and malignant human oral keratinocytes.

    Science.gov (United States)

    Hedberg, J J; Hansson, A; Nilsson, J A; Höög, J O; Grafström, R C

    2001-01-01

    The human oral epithelium is a target for damage from the inhalation of formaldehyde. However, most experimental studies on this chemical have relied on laboratory animals that are obligatory nose breathers, including rats and mice. Therefore, in vitro model systems that mimic the structure of the human oral epithelium and which retain normal tissue-specific metabolic competence are desirable. Based on the established role of alcohol dehydrogenase 3 (ADH3), also known as glutathione-dependent formaldehyde dehydrogenase, as the primary enzyme catalysing the detoxification of formaldehyde, the aim of this study was to investigate the expression of ADH3 in organotypic epithelia regenerated with normal (NOK), immortalised (SVpgC2a) and malignant (SqCC/Y1) human oral keratinocytes. Organotypic epithelia, usually consisting of 5-10 cell layers, were produced at the air-liquid interface of collagen gels containing human oral fibroblasts, after culture for 10 days in a standardised serum-free medium. Immunochemical staining demonstrated uniform expression of ADH3 in these organotypic epithelia, as well as in the epithelial cells of oral tissue. The specificity of the ADH3 antiserum was ascertained from the complete neutralisation of the immunochemical reaction with purified ADH3 protein. Assessment of the staining intensities indicated that the expression levels were similar among the regenerated epithelia. Furthermore, the regenerated epithelia showed similar ADH3 expression to the epithelium in oral tissue. Therefore, a tissue-like expression pattern for ADH3 can be generated from the culture of various oral keratinocyte lines in an organotypic state. Similar expression levels among the various cell lines indicate the preservation of ADH3 during malignant transformation, and therefore that NOK, SVpgC2a and SqCC/Y1 represent functional models for in vitro studies of formaldehyde metabolism in human oral mucosa.

  3. Suppression of Ultraviolet B Exposure-Mediated Activation of NF-κB in Normal Human Keratinocytes by Resveratrol

    Directory of Open Access Journals (Sweden)

    Vaqar Mustafa Adhami

    2003-01-01

    Full Text Available Chemoprevention by naturally occurring agents is a newer dimension in the management of neoplasia, including skin cancer. Solar ultraviolet (UV radiation is the major cause of skin cancer. We recently demonstrated that resveratrol (3,5,4'-trihydroxystilbene, a polyphenolic antioxidant found in grapes and red wine, imparts protection from UVB-mediated cutaneous damages in SKH-1 hairless mice. The mechanism of action of resveratrol is not clearly understood. Here, we investigated the involvement of nuclear factor kappa B (NF-κB, which is known to play a critical role in skin biology and the development of skin cancer, as the mechanism of chemoprevention of UV damage by resveratrol. In the normal human epidermal keratinocytes, resveratrol blocked UVB-mediated (40 mJ/cm2 activation of NF-κB in a dose-dependent (5, 10, and 25μM resveratrol for 24 hours as well as time-dependent (5μ/M resveratrol for 12, 24, and 48 hours fashion. Resveratrol treatment of keratinocytes also inhibited UVB-mediated 1 phosphorylation and degradation of IκBα, and 2 activation of IKKα. We suggest that NF-κB pathway plays a critical role in the chemopreventive effects of resveratrol against the adverse effects of UV radiation including photocarcinogenesis.

  4. Pyrimidine dimer induction and repair in cultured human skin keratinocytes or melanocytes after irradiation with monochromatic ultraviolet radiation

    International Nuclear Information System (INIS)

    We compared the susceptibilities of cultured melanocytes and keratinocytes to dimer induction in DNA by monochromatic ultraviolet (UV) radiation. Keratinocytes as well as melanocytes were derived from human foreskin, grown as a monolayer in petri dishes, covered with phosphate-buffered saline containing 0.1% glucose, and irradiated. UV irradiation was carried out at 254, 297, and 302 nm as well as with a light source emitting predominantly 312 nm. The induction of pyrmidine dimers was assessed by determination of the number of T4 endonuclease V-sensitive sites (ESS). We found a slightly higher response for dimer induction in melanocytes at 254, 297, and 302 nm; this difference was only significant at the 297-nm wavelength. Action spectra for pyrimidine dimer induction were derived from the exposure-response data obtained. The action spectra mimic to a large degree the action spectra for dimer induction in other cultured mammalian cells. The repair rate during a post-irradiation period lasting up to 24 h was substantially the same for the two cell types. The percentage of T4 endonuclease V-sensitive sites (ESS) remaining 9 and 24 h after irradiation was 45% and 30%, respectively

  5. Phospholipase C-gamma1 is required for subculture-induced terminal differentiation of normal human oral keratinocytes.

    Science.gov (United States)

    Oh, Ju-Eun; Kook, Joong-Ki; Park, Kyung-Hee; Lee, Gene; Seo, Byoung-Moo; Min, Byung-Moo

    2003-04-01

    Serial subculture of primary normal human oral keratinocytes (NHOKs) to the post-mitotic stage induces terminal differentiation, which is in part linked to elevated levels of phospholipase C (PLC)-gamma1. Therefore, PLC-gamma1 may be involved in the signal transduction system that leads to the calcium regulation of subculture-induced keratinocyte differentiation. To test this hypothesis, the expression of PLC-gamma1 in primary NHOKs was blocked by transfecting cells with the antisense PLC-gamma1 cDNA construct. These cells demonstrated dramatic reductions in PLC-gamma1 protein and in the differentiation markers involucrin and transglutaminase following calcium exposure and an increase (15-20%) in in vitro life span versus empty vector-transfected cells. In addition, we established the ability of antisense PLC-gamma1 to block the serial subculture-induced rise in intracellular calcium. Similar observations were made following treatment with the specific PLC inhibitor U73122. These results indicate that the terminal differentiation of NHOKs by serial subculture is associated with PLC-gamma1, which mediates calcium regulation by mobilizing intracellular calcium.

  6. Neutrophil extracellular trap formation is increased in psoriasis and induces human β-defensin-2 production in epidermal keratinocytes.

    Science.gov (United States)

    Hu, Stephen Chu-Sung; Yu, Hsin-Su; Yen, Feng-Lin; Lin, Chi-Ling; Chen, Gwo-Shing; Lan, Cheng-Che E

    2016-01-01

    Neutrophil extracellular traps (NETs) have been implicated in the development of certain immune-mediated diseases, but their role in psoriasis has not been clearly defined. Human β-defensin-2 (HBD-2) is an important antimicrobial peptide overexpressed in psoriasis epidermis. We evaluated whether the amount of NETs is increased in psoriasis and determined the effect of NETs on HBD-2 production in epidermal keratinocytes. Using fluorescent microscopy, we found that patients with psoriasis (n = 48) had higher amount of NETotic cells in their peripheral blood compared to healthy controls (n = 48) and patients with eczema (n = 35). Psoriasis sera showed increased ability to induce NET formation in control neutrophils but normal NET degradation ability. The amount of NETs in the peripheral blood correlated with psoriasis disease severity. NETosis was also observed in the majority (18 of 20) of psoriasis skin specimens. Furthermore, NETs induced HBD-2 mRNA and protein production in keratinocytes, and immunohistochemical analysis confirmed strong expression of HBD-2 in psoriasis lesional skin. In summary, NET formation is increased in peripheral blood and lesional skin of psoriasis patients and correlates with disease severity. Additionally, NET-induced HBD-2 production may provide a novel mechanism for the decreased susceptibility of psoriasis plaques to microbial infections. PMID:27493143

  7. Survival of human epidermal keratinocytes after short-duration high temperature: synthesis of HSP70 and IL-8.

    Science.gov (United States)

    Bowman, P D; Schuschereba, S T; Lawlor, D F; Gilligan, G R; Mata, J R; DeBaere, D R

    1997-06-01

    Thermal injury by short pulses (1-30 s) of relatively high temperature (50-68 degrees C) was investigated in normal human epidermal keratinocytes (NHEK). NHEK were cultured on plastic cover-slips and dipped in medium held at various temperatures. Survival assessed by methylthiazol tetrazolium reduction assay at 6 days postheating demonstrated an inverse time-temperature relationship that indicated that most cells could survive after a 1-s, 60 degrees C exposure or a 30-s, 55 degrees C exposure. Arrhenius plots of the data indicated major transition points for cell injury at 50 and 60 degrees C. Heat shock protein 70 (HSP70) and interleukin-8 (IL-8) were both induced by elevation of temperature between 50 and 60 degrees C for as short a time as 1 s. HSP70 synthesis stimulated by short, high pulses of heat appeared to induce thermotolerance. These results demonstrate that brief exposure to relatively high temperature can induce HSP70 and IL-8 synthesis in keratinocytes. PMID:9227428

  8. Silver nanoparticles exert a long-lasting antiproliferative effect on human keratinocyte HaCaT cell line.

    Science.gov (United States)

    Zanette, Caterina; Pelin, Marco; Crosera, Matteo; Adami, Gianpiero; Bovenzi, Massimo; Larese, Francesca Filon; Florio, Chiara

    2011-08-01

    For their antibacterial activity, silver nanoparticles (Ag NPs) are largely used in various commercially available products designed to come in direct contact with the skin. In this study we investigated the effects of Ag NPs on skin using the human-derived keratinocyte HaCaT cell line model. Ag NPs caused a concentration- and time-dependent decrease of cell viability, with IC(50) values of 6.8 ± 1.3 μM (MTT assay) and 12 ± 1.2 μM (SRB assay) after 7 days of contact. A 24h treatment, followed by a 6 day recovery period in Ag NPs-free medium, reduced cell viability with almost the same potency (IC(50)s of 15.3 ± 4.6 and 35 ± 20 μM, MTT and SRB assays, respectively). Under these conditions, no evidence of induction of necrotic events (propidium iodide assay) was found. Apocynin, NADPH-oxidase inhibitor, or N(G)-monomethyl-L-argynine, nitric oxide synthase inhibitor, did not prevent NPs-induced reduction of cell viability. TEM analysis of cells exposed to NPs for 24h revealed alteration of nuclear morphology but only a marginal presence of individual NPs inside the cells. These results demonstrate that on HaCaT keratinocytes a relatively short time of contact with Ag NPs causes a long-lasting inhibition of cell growth, not associated with consistent Ag NPs internalization.

  9. Regulation of haptoglobin expression in a human keratinocyte cell line HaCaT by inflammatory cytokines and dexamethasone

    Institute of Scientific and Technical Information of China (English)

    XIA Li-xin; XIAO Ting; CHEN Hong-duo; LI Ping; WANG Ya-kun; WANG He

    2008-01-01

    Background Haptoglobin(Hp)is one of the acute-phase proteins. Recent studies have demonstrated that Hp exerts immunoregulatory and anti-inflammatory actions and may be one of the inhibitory factors of immune reactions in the skin. In this study we investigated the regulation of Hp expression in a human keratinocyte cell line HaCaT by various cytokines and glucocorticod. Methods HaCaT cells were cultured with IL-6(50 ng/ml), TNF-α(20 ng/ml), IFN-Y(20 ng/ml)or IL-4(20 ng/ml)with or without 1 μmol/L dexamethasone in 6-well plates for 12, 24 and 48 hours. Both the cells and the supernatants were collected to detect the changes of Hp expression by reverse-transcription PCR, ELISA and immunohistochemistry. Results The results showed that Hp expression were elevated at both the mRNA and protein level by the combination of IL-6, TNF-α or IL-4 with dexamethasone, whereas the three cytokines alone did not upregulate the Hp expression. IFN-Y showed no effect on the Hp expression in HaCaT cells. Conclusions These findings suggest that different inflammatory cytokines as well as glucocorticoid may be involved in the regulation of Hp expression in keratinocytes, and this may be one of the negative feedback mechanisms in inflammatory skin diseases.

  10. In vitro cytotoxicity of CdSe/ZnS quantum dots with different surface coatings to human keratinocytes HaCaT cells

    Institute of Scientific and Technical Information of China (English)

    Kavitha Pathakoti; Huey-Min Hwang; Hong Xu; Zoraida P.Aguilar; Andrew Wang

    2013-01-01

    Quantum dots (QD) nanoparticles have been widely used in biomedical and electronics fields,because of their novel optical properties.Consequently it confers enormous potential for human exposure and environmental release.To increase the biocompatibility of QDs,a variety of surface coatings or functional groups are added to increase their bioactivity and water solubility.Human adult low calcium high temperature (HaCaT) cells are the epithelial cells derived from adult human skin that exhibits normal differentiation capacity and a DNA fingerprint pattern that is unaffected by long-term cultivation,transformation,or the presence of muldple chromosomal alternations.Human keratinocytes,HaCaT cells were used to systematically evaluate the cytotoxicity of biocompatible QD made of CdSe metal core and ZnS shell with three different coatings and at three different wavelengths (530,580 and 620 nm).In terms of halfmaximal inhibitory concentration,QSA-QDs with amine-polyethyleneglycol coating and QSH-QDs with amphiphilic polymer coating were not cytotoxic,while QEI-QDs with polyethylenimine coating were highly toxic to the HaCaT cells in comparison to a reference CuInS2/ZnS.QEI-QDs led to significant increase in reactive oxygen species,decrease in mitochondrial membrane potential and DNA damage in HaCaT cells.The mechanisms of toxicity of QEI-530 and QEI-580 can be attributed to the combination of intracellular reactive oxygen species production and loss of MMP.The QDs toxicity can be attributed to the polyethylemimine surface coating which was highly toxic to cells in comparison with amine-polyethyleneglycol,but not due to the release of cadmium ions.

  11. Inhibitory Activity of the Flower Buds of Lonicera japonica Thunb. against Histamine Production and L-Histidine Decarboxylase in Human Keratinocytes

    OpenAIRE

    Yoshihiro Inami; Yuko Matsui; Tomoko Hoshino; Chiaki Murayama; Hisayoshi Norimoto

    2014-01-01

    In previous studies we found that anionic surfactants such as sodium laurate (SL) and/or sodium dodecylsulfate (SDS) exert actions on epidermal keratinocytes rather than mast cells to give rise of histamine production and skin itching through increasing the expression of the 53-kDa active form of l-histidine decarboxylase (HDC). In addition, with treatment of SL in a three-dimensional human keratinocyte culture, increases in both the 53-kDa HDC and histamine production are detected and thus t...

  12. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  13. Protective Effect of Garlic on Cellular Senescence in UVB-Exposed HaCaT Human Keratinocytes.

    Science.gov (United States)

    Kim, Hye Kyung

    2016-01-01

    Ultraviolet (UV) irradiation generates reactive oxygen species (ROS) in the cells, which induces the cellular senescence and photoaging. The present study investigated the protective effects of garlic on photo-damage and cellular senescence in UVB-exposed human keratinocytes, HaCaT cells. An in vitro cell free system was used to examine the scavenging activity of 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radicals and nitric oxide (NO). The effect of garlic extract on ROS formation, MMP-1 protein and mRNA expressions, cytokines such as interleukin (IL)-1β and IL-6, senescence associated-β-galactosidase (SA-β-gal) activity, and silent information regulator T1 (SIRT1) activity were determined in UVB-irradiated HaCaT cells. Garlic exhibited strong DPPH radical and NO scavenging activity in cell free system exhibiting IC50 values of 2.50 mg/mL and 4.38 mg/mL, respectively. Garlic pretreatment attenuated the production of UVB-induced intracellular ROS. MMP-1 level, which has been known to be induced by ROS, was dramatically elevated by UVB irradiation, and UVB-induced MMP-1 mRNA and protein expressions were significantly reduced by garlic treatment (50 µg/mL) comparable to those of UV-unexposed control cells. UV-induced pro-inflammatory cytokine productions (IL-6 and IL-1β) were significantly inhibited by pretreatment with garlic in a dose-dependent manner. SA-β-gal activity, a classical biomarker of cellular senescence, and SIRT1 activity, which has attracted attention as an anti-aging factor in recent years, were ameliorated by garlic treatment in UV-irradiated HaCaT cells. The present study provides the first evidence of garlic inhibiting UVB-induced photoaging as a result of augmentation of cellular senescence in HaCaT human keratinocytes. PMID:27483310

  14. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  15. Protective Effects of Minor Components of Curcuminoids on Hydrogen Peroxide-Treated Human HaCaT Keratinocytes.

    Science.gov (United States)

    Liu, Yuh-Hwa; Lin, Yin-Shiou; Huang, Yu-Wei; Fang, Sheng-Uei; Lin, Shyr-Yi; Hou, Wen-Chi

    2016-05-11

    Hydrogen peroxide, one of the reactive oxygen species (ROS), can cause intracellular oxidative stress associated with skin aging and/or photoaging. Curcumin, a polyphenol in turmeric, has been reported to exhibit biological activity. In this study, five naturally occurring curcuminoids [curcumin, demethoxycurcumin (DMC), bisdemethoxycurcumin (BDMC), monohydroxy-DMC, and monohydroxy-BDMC] were used to investigate their protective roles against hydrogen peroxide-induced oxidative stress in the immortalized human keratinocyte cell lines (HaCaT cells). These five curcuminoids at 10 μM, but not at 5 μM, were shown to exhibit cytotoxicities toward HaCaT keratinocytes. Therefore, a 5 μM concentration of the five curcuminoids was selected for further investigations. Cells were pretreated with or without curcuminoids for 2.5 h before 24-h hydrogen peroxide (150 μM) treatments. Pretreatments with the minor components monohydroxy-DMC or monohydroxy-BDMC, but not curcumin, DMC, and BDMC, showed protective activity, elevating cell viability compared to cells with direct hydrogen peroxide treatments. Pretreatments with monohydroxy-DMC and monohydroxy-BDMC showed the best protective effects, reducing apoptotic cell populations and intracellular ROS, as demonstrated by flow cytometry, as well as reducing the changes of the mitochondrial membrane potential compared to cells with direct hydrogen peroxide treatments. The pretreatments with monohydroxy-DMC and monohydroxy-BDMC reduced c-jun and c-fos mRNA expression and p53 tumor suppressor protein expression and increased HO-1 protein expression and glutathione peroxidase (GPx) activity, respectively, compared to cells with direct hydrogen peroxide treatments. The five curcuminoids exhibited similar hydrogen peroxide-scavenging activity in vitro. It was proposed that monohydroxy-DMC and monohydroxy-BDMC could induce antioxidant defense systems better than curcumin, DMC, or BDMC could against hydrogen peroxide-induced oxidative

  16. Broad-spectrum sunscreens prevent the secretion of proinflammatory cytokines in human keratinocytes exposed to ultraviolet A and phototoxic lomefloxacin

    Energy Technology Data Exchange (ETDEWEB)

    Reinhardt, P.; Cybulski, M. [Lasers and Electro-Optics Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada)], E-mail: pascale_reinhardt@hc-sc.gc.ca; Miller, S.M.; Ferrarotto, C.; Wilkins, R. [Radiobiology Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada); Deslauriers, Y. [Lasers and Electro-Optics Div., Consumer and Clinical Radiation Protection Bureau, Product Safety Program, Healthy Environments and Consumer Safety Branch, Health Canada, Ottawa, Ontario (Canada)

    2006-02-15

    The combination of phototoxic drugs and ultraviolet (UV) radiation can trigger the release of proinflammatory cytokines. The present study measured the ability of sunscreens to prevent cytokine secretion in human keratinocytes following cotreatment of these cells with a known photoreactive drug and UVA. Keratinocytes were treated for 1 h with increasing concentrations of lomefloxacin (LOM) or norfloxacin (NOR), exposed to 15 J/cm{sup 2} UVA, and incubated for 24 h. NOR, owing to the absence of a fluorine atom in position 8, was non-phototoxic and used as a negative control. Cell viability and the release of 3 cytokines were assessed, namely interleukin-1{alpha} (IL-1{alpha}), interleukin-6 (IL-6), and tumour necrosis factor-{alpha} (TNF-{alpha}). The measurement of these cytokines may be a useful tool for detecting photoreactive compounds. To measure their ability to prevent cytokine secretion, various sunscreens were inserted between the UVA source and the cells. Treatment with NOR, NOR plus UVA, or LOM had no effect on the cells. LOM plus UVA, however, had an effect on cell viability and on cytokine secretion. IL-1{alpha} levels increased with LOM concentration. The release of TNF-{alpha} and IL-6 followed the same pattern at lower concentrations of LOM but peaked at 15 {mu}mol/L and decreased at higher concentrations. Sunscreens protected the cells from the effects of LOM plus UVA, as cell viability and levels of cytokines remained the same as in the control cells. In conclusion, the application of broad-spectrum sunscreen by individuals exposed to UVA radiation may prevent phototoxic reactions initiated by drugs such as LOM. (author)

  17. T Helper 1 and T Helper 2 Cytokines Differentially Modulate Expression of Filaggrin and its Processing Proteases in Human Keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Zheng-Hong Di; Lei Ma; Rui-Qun Qi; Xiao-Dong Sun; Wei Huo; Li Zhang; Ya-Ni Lyu

    2016-01-01

    Background: Atopic dermatitis (AD) is characterized by defective skin barrier and imbalance in T helper 1/T helper 2 (Th 1/Th2) cytokine expression.Filaggrin (FLG) is the key protein to maintaining skin barrier function.Recent studies indicated that Th1/Th2 cytokines influence FLG expression in keratinocytes.However, the role ofThl/Th2 cytokines on FLG processing is not substantially documented.Our aim was to investigate the impact ofThl/Th2 cytokines on FLG processing.Methods: HaCaT cells and normal human keratinocytes were cultured in low and high calcium media and stimulated by either interleukin (IL)-4, 13 or interferon-γ(IFN-γ).FLG, its major processing proteases and key protease inhibitor lymphoepithelial Kazal-type-related inhibitor (LEKTI) were measured by both real-time quantitative polymerase chain reaction and Western blotting.Their expression was also evaluated in acute and chronic AD lesions by immunohistochemistry.Results: IL-4/13 significantly reduced, while IFN-γsignificantly up-regulated FLG expression.IL-4/13 significantly increased, whereas IFN-γsignificantly decreased the expression ofkallikreins 5 and 7, matriptase and channel-activating serine protease 1.On the contrary, IL-4/13 significantly decreased, while IFN-γincreased the expression of LEKTI and caspase-14.Similar trends were observed in AD lesions.Conclusions: Our results suggested that Th1/Th2 cytokines differentially regulated the expression of major FLG processing enzymes.The imbalance between Th1 and Th2 polarized immune response seems to extend to FLG homeostasis, through the network of FLG processing enzymes.

  18. Integrin-blocking antibodies delay keratinocyte re-epithelialization in a human three-dimensional wound healing model.

    Directory of Open Access Journals (Sweden)

    Christophe Egles

    Full Text Available The alpha6beta4 integrin plays a significant role in tumor growth, angiogenesis and metastasis through modulation of growth factor signaling, and is a potentially important therapeutic target. However, alpha6beta4-mediated cell-matrix adhesion is critical in normal keratinocyte attachment, signaling and anchorage to the basement membrane through its interaction with laminin-5, raising potential risks for targeted therapy. Bioengineered Human Skin Equivalent (HSE, which have been shown to mimic their normal and wounded counterparts, have been used here to investigate the consequences of targeting beta4 to establish toxic effects on normal tissue homeostasis and epithelial wound repair. We tested two antibodies directed to different beta4 epitopes, one adhesion-blocking (ASC-8 and one non-adhesion blocking (ASC-3, and determined that these antibodies were appropriately localized to the basal surface of keratinocytes at the basement membrane interface where beta4 is expressed. While normal tissue architecture was not altered, ASC-8 induced a sub-basal split at the basement membrane in non-wounded tissue. In addition, wound closure was significantly inhibited by ASC-8, but not by ASC-3, as the epithelial tongue only covered 40 percent of the wound area at 120 hours post-wounding. These results demonstrate beta4 adhesion-blocking antibodies may have adverse effects on normal tissue, whereas antibodies directed to other epitopes may provide safer alternatives for therapy. Taken together, we conclude that these three-dimensional tissue models provide a biologically relevant platform to identify toxic effects induced by candidate therapeutics, which will allow generation of findings that are more predictive of in vivo responses early in the drug development process.

  19. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  20. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  1. Arsenic Transformation Predisposes Human Skin Keratinocytes To UV-induced DNA Damage Yet Enhances Their Survival Apparently by Diminishing Oxidant Response

    OpenAIRE

    Sun, Yang(Department of Physics, Shanghai Jiao Tong University, Shanghai 200240, China); Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark o...

  2. Photoprotective Effects of Hydroxychloroqine and TCMs on Human Keratinocytes Damaged from Ultraviolet Irradiation

    Institute of Scientific and Technical Information of China (English)

    LUODan; MINWei; LINXiang-fei; WUDi; MIAOXu

    2004-01-01

    Objective: To investigate damage effects of ultraviolet irradiation on eternal keratinocyte-HaCaT cells and to evaluate photo-protective efficiency of hydroxychloroqine and Traditional Chinese Medicines ( epigallocatechingallate[EGCG], baikal skullcap root and szechwan lovge rhizome) on HaCaT ceils damaged by middle wave ultraviolet(UVB) irradiation. Methods: Subconfluent HaCaT cells were sham or UVB irradiated and treated with above TCM agents. The damage degree of HaCaT cells was observed by a light microscop. Cell growth was recorded by cellcount and cellular activity was detected by MTT method. The secretion amount of IL-6 and TNF-α was measured by ELISA. Results: The irradiation damage of HaCaT cells was depended on the irradiated dosages and cellular activity was reduced by 36%-80%, with a maximum decrease over 90% after 72 h. The intervention of the above drugs may increase the cellular activity by 10%-72%. The photo-protective efficiency was more apparent in F_A~G (from 1.19+0.07 to 1.28 + 0.06, P < 0.01 ) than that in hydroxychloroqine ( from 0.43 + 0.04 to 0.96 + 0.04, P < 0.05). The other two tested drugs also showed photo-protective effect( from 0.44 + 0.07 to 1.21 -+ 0.02, P < 0.05). As to cytokine secretion, EGCG could decline the secretion amount of IL-6 and TNF.a apparently. Hydroxychloroqine and baikal skullcap root baikal skullcap root could only reduce the secretion of ID6. The secretion of IL-6 and TNF-α could not be inhibitedby szechwan lovge rhizome. Conclusion : The injury effect of UVB irradiation on cultured keratinocytes is dose-dependent and the tested drugs have photo-protective potency. Inhibition of cytokine secretion may be one of the mechanisms related to reducing the damage effect of UVB irradiation.

  3. Cis-urocanic acid synergizes with histamine for increased PGE2 production by human keratinocytes: link to indomethacin-inhibitable UVB-induced immunosuppression

    International Nuclear Information System (INIS)

    There is considerable evidence that suppression of the immune system by UVB (280-320 nm UV) irradiation is initiated by UVB-dependent isomerization of a specific skin photoreceptor, urocanic acid (UCA), from the trans to the cis form. Previous studies have confirmed that cis-UCA administration to mice 3-5 days prior to hapten sensitization at a distant site, suppresses the contact hypersensitivity (CHS) response upon challenge. This study demonstrates in mice that cis-UCA, like UVB, suppresses CHS to trinitrochlorobenzene by a mechanism partly dependent on prostanoid production. In vitro experimentation showed that human keratinocytes, isolated from neonatal foreskin, increased prostaglandin E2 (PGE2) production in response to histamine but not UCA alone. However, cis-UCA synergized with histamine for increased PGE2 production by keratinocytes. Cis-urocanic acid also increased the sensitivity of keratinocytes for PGE2 production in response to histamine. Prostaglandin E2 from keratinocytes exposed to cis-UCA and histamine may contribute directly, or indirectly, to the regulation of CHS responses by UVB irradiation. (Author)

  4. Sauchinone, a lignan from Saururus chinensis, protects human skin keratinocytes against ultraviolet B-induced photoaging by regulating the oxidative defense system

    International Nuclear Information System (INIS)

    Ultraviolet (UV) radiation from sunlight induces matrix metalloproteinase (MMP) expression, which are responsible for collagenous extracellular matrix proteins breakdown in skin, causing photoaging. Sauchinone is reported to have various bioactivity such as antioxidative, hepatoprotective, and anti-inflammatory effects. In the present study, we investigated the protective effect of sauchinone against UVB (50 mJ/cm2)-induced photoaging in HaCaT human epidermal keratinocytes. Sauchinone, at 5-40 μM, significantly protected keratinocytes against UVB-induced damage as assessed by cell viability and toxicity assay. Additionally, sauchinone, at 20-40 μM, prevented the upregulation of MMP-1 proteins and reduction of type 1 collagen induced by UVB. Other assays revealed that, in keratinocytes, sauchinone decreased reactive oxygen species (ROS) production and increased glutathione levels and heme oxygenase-1. Sauchinone also inhibited UVB-induced phosphorylation of mitogen-activated protein kinase (MAPK) signaling pathways. These results demonstrated that sauchinone protects skin keratinocytes through inhibition of extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38 MAPK signaling via upregulation of oxidative defense enzymes. (author)

  5. Leptin-deficiency in mice counteracts imiquimod (IMQ)-induced psoriasis-like skin inflammation while leptin stimulation induces inflammation in human keratinocytes

    DEFF Research Database (Denmark)

    Stjernholm, T; Ommen, P; Langkilde, A;

    2016-01-01

    psoriasis and obesity and plays an aggravating role in psoriasis. To investigate leptin's role in psoriasis, we applied the widely accepted imiquimod (IMQ) induced psoriasis-like skin inflammation mouse model on leptin-deficient (ob/ob) mice and evaluated psoriasis severity. Moreover, we stimulated human......A and IL-22 mRNA expression levels, as well as increased epidermal thickness were significantly less induced. In vitro, the effect of leptin stimulation on human keratinocytes demonstrated increased proliferation and induced secretion of several pro-inflammatory proteins; two hallmarks of psoriasis....... In conclusion, leptin-deficiency attenuated IMQ-induced psoriasis-like skin inflammation in a mouse model and leptin stimulation induced a pro-inflammatory phenotype in human keratinocytes, thus, supporting an aggravating role of leptin in psoriasis. This article is protected by copyright. All rights reserved....

  6. Biological activity of all-trans retinol requires metabolic conversion to all-trans retinoic acid and is mediated through activation of nuclear retinoid receptors in human keratinocytes.

    Science.gov (United States)

    Kurlandsky, S B; Xiao, J H; Duell, E A; Voorhees, J J; Fisher, G J

    1994-12-30

    The biological activity of all-trans retinol, in human keratinocytes, was investigated through metabolic and functional analyses that assessed the capacity for retinol uptake and metabolism and the mechanism of retinol-induced activation of gene transcription. Human keratinocytes converted all-trans retinol predominantly to retinyl esters, which accounted for 60 and 90% of cell-associated radiolabel after a 90-min pulse and a 48-h chase, respectively. Human keratinocytes also metabolized all-trans retinol to low levels of all-trans retinoic acid (11.47-131.3 ng/mg of protein) in a dose-dependent manner, between 0.3 and 10 microM added retinol. Small amounts of 13-cis retinoic acid (5.47-8.62 ng/mg of protein) were detected, but 9-cis retinoic acid was detected only when keratinocytes were incubated with radiolabeled retinol. There was no accumulation of the oxidized catabolic metabolites 4-hydroxy- or 4-oxoretinoic acid; however, 5,6-epoxy retinoic acid was detected at pharmacological levels (10 and 30 microM) of added retinol. Biological activity of retinol was assessed through analysis of two known retinoic acid-mediated responses: 1) reduction of type I epidermal transglutaminase and 2) activation of a retinoic acid receptor-dependent reporter gene, beta RARE3-tk-CAT. Both all-trans retinol and all-trans retinoic acid reduced type I epidermal transglutaminase in a dose-dependent manner; however, the ED50 for all-trans retinol (10 nM) was 10 times greater than for all-trans retinoic acid (1 nM). All-trans retinol also stimulated beta RARE3-tk-CAT reporter gene activity in a dose-dependent manner. Half-maximal induction was observed at 30 nM retinol, which was again 10-fold greater than observed with all-trans retinoic acid. Cotransfection of human keratinocytes with expression vectors for dominant negative mutant retinoic acid and retinoid X receptors reduced retinol-induced beta RARE3-tk-CAT reporter gene activation by 80%. Inhibition of conversion of all

  7. 乙酰胆碱对人表皮细胞冷存的影响%The Effect of Acetylcholine (Ach) on Preservation of Human Keratinocytes

    Institute of Scientific and Technical Information of China (English)

    张云涛; 霍孟华; 傅洪滨

    2001-01-01

    Objective: To investigate the effect of acetylcholine (Ach) on the preservation of human keratinocytes. Method: Use tissue engineering technology to separate and culture human keratinocyte in vitro and observe them using MTT method and histological and electron microscopic methods. Result: Different concentration of Ach can preserve more viability of human keratinocytes. The best concentration is 10- 8 to 10- 10 mol/L. Conclusion: Ach can preserve more viability of human kerationcytes during preservation.%目的:探讨乙酰胆碱(Ach)对人表皮细胞冷存活力的影响。方法:应用人表皮细胞的分离、培养技术,并进行MTT检测、病理切片以及电镜检测等手段进行观察。结果:不同浓度的Ach对冷存的表皮细胞均有一定的保存活力作用,其中以10-8~10-10mol/L的浓度为最佳。结论:认为Ach对冷存中的人表皮细胞有一定的保护作用,它可提高表皮细胞的保存活力。

  8. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  9. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. PMID:25855085

  10. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26691653

  11. Zinc deficiency or excess within the physiological range increases genome instability and cytotoxicity, respectively, in human oral keratinocyte cells.

    Science.gov (United States)

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Fenech, Michael

    2012-04-01

    Zinc (Zn) is an essential component of Zn-finger proteins and acts as a cofactor for enzymes required for cellular metabolism and in the maintenance of DNA integrity. The study investigated the genotoxic and cytotoxic effects of Zn deficiency or excess in a primary human oral keratinocyte cell line and determined the optimal concentration of two Zn compounds (Zn Sulphate (ZnSO(4)) and Zn Carnosine (ZnC)) to minimise DNA damage. Zn-deficient medium (0 μM) was produced using Chelex treatment, and the two Zn compounds ZnSO(4) and ZnC were tested at concentrations of 0.0, 0.4, 4.0, 16.0, 32.0 and 100.0 μM. Cell viability was decreased in Zn-depleted cells (0 μM) as well as at 32 μM and 100 μM for both Zn compounds (P < 0.0001) as measured via the MTT assay. DNA strand breaks, as measured by the comet assay, were found to be increased in Zn-depleted cells compared with the other treatment groups (P < 0.05). The Cytokinesis Block Micronucleus Cytome assay showed a significant increase in the frequency of both apoptotic and necrotic cells under Zn-deficient conditions (P < 0.05). Furthermore, elevated frequencies of micronuclei (MNi), nucleoplasmic bridges (NPBs) and nuclear buds (NBuds) were observed at 0 and 0.4 μM Zn, whereas these biomarkers were minimised for both Zn compounds at 4 and 16 μM Zn (P < 0.05), suggesting these concentrations are optimal to maintain genome stability. Expression of PARP, p53 and OGG1 measured by western blotting was increased in Zn-depleted cells indicating that DNA repair mechanisms are activated. These results suggest that maintaining Zn concentrations within the range of 4-16 μM is essential for DNA damage prevention in cultured human oral keratinocytes. PMID:21935692

  12. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    OpenAIRE

    Nattaporn Pattarachotanant; Varaporn Rakkhitawatthana; Tewin Tencomnao

    2014-01-01

    Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17), was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K1...

  13. A Novel Role of the NRF2 Transcription Factor in the Regulation of Arsenite-Mediated Keratin 16 Gene Expression in Human Keratinocytes

    OpenAIRE

    Endo, Hitoshi; Sugioka, Yoshihiko; Nakagi, Yoshihiko; Saijo, Yasuaki; Yoshida, Takahiko

    2008-01-01

    Background Inorganic sodium arsenite (iAs) is a ubiquitous environmental contaminant and is associated with an increased risk of skin hyperkeratosis and cancer. Objectives We investigated the molecular mechanisms underlying the regulation of the keratin 16 (K16) gene by iAs in the human keratinocyte cell line HaCaT. Methods We performed reverse transcriptase polymerase chain reaction, luciferase assays, Western blots, and electrophoretic mobility shift assays to determine the transcriptional ...

  14. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  15. Effects of an aqueous extract from the leaves of Chromolaena odorata (Eupolin) on the proliferation of human keratinocytes and on their migration in an in vitro model of reepithelialization.

    Science.gov (United States)

    Phan, T T; Hughes, M A; Cherry, G W

    2001-01-01

    Eupolin ointment, prepared from the leaves of Chromolaena odorata, has been shown to promote the healing of soft tissue wounds and burns in Vietnam. However, the mechanism by which this agent affects cells involved in the wound healing process is unknown. Cultured human keratinocytes were used in this study to investigate the effects of the Eupolin extract in vitro on processes involved in wound reepithelialization. Keratinocyte proliferation was monitored by a colorimetric assay and migration by the closure of a denuded area scratched in a confluent monolayer. Human keratinocyte proliferation was stimulated by low concentrations of the extract (from 0.1 to 5 microg/ml), cell differentiation by higher concentrations (50 to 300 microg/ml), and migration by intermediate concentrations (5 to 60 microg/ml). The increased proliferation and migration of human keratinocytes observed in vitro might explain, in part, the beneficial effects that have been observed in the clinic. PMID:11679139

  16. Role of taurine accumulation in keratinocyte hydration.

    Science.gov (United States)

    Janeke, Guido; Siefken, Wilfried; Carstensen, Stefanie; Springmann, Gunja; Bleck, Oliver; Steinhart, Hans; Höger, Peter; Wittern, Klaus-Peter; Wenck, Horst; Stäb, Franz; Sauermann, Gerhard; Schreiner, Volker; Doering, Thomas

    2003-08-01

    Epidermal keratinocytes are exposed to a low water concentration at the stratum corneum-stratum granulosum interface. When epithelial tissues are osmotically perturbed, cellular protection and cell volume regulation is mediated by accumulation of organic osmolytes such as taurine. Previous studies reported the presence of taurine in the epidermis of several animal species. Therefore, we analyzed human skin for the presence of the taurine transporter (TAUT) and studied the accumulation of taurine as one potential mechanism protecting epidermal keratinocytes from dehydration. According to our results, TAUT is expressed as a 69 kDa protein in human epidermis but not in the dermis. For the epidermis a gradient was evident with maximal levels of TAUT in the outermost granular keratinocyte layer and lower levels in the stratum spinosum. No TAUT was found in the basal layer or in the stratum corneum. Keratinocyte accumulation of taurine was induced by experimental induction of skin dryness via application of silica gel to human skin. Cultured human keratinocytes accumulated taurine in a concentration- and osmolarity-dependent manner. TAUT mRNA levels were increased after exposure of human keratinocytes to hyperosmotic culture medium, indicating osmosensitive TAUT mRNA expression as part of the adaptation of keratinocytes to hyperosmotic stress. Keratinocyte uptake of taurine was inhibited by beta-alanine but not by other osmolytes such as betaine, inositol, or sorbitol. Accumulation of taurine protected cultured human keratinocytes from both osmotically induced and ultraviolet-induced apoptosis. Our data indicate that taurine is an important epidermal osmolyte required to maintain keratinocyte hydration in a dry environment. PMID:12880428

  17. X-ray microanalysis of cultured keratinocytes: methodological aspects and effects of the irritant sodium lauryl sulphate on elemental composition.

    Science.gov (United States)

    Grängsjö, A; Pihl-Lundin, I; Lindberg, M; Roomans, G M

    2000-09-01

    Irritant substances have been shown to induce elemental changes in human and animal epidermal cells in situ. However, skin biopsies are a complicated experimental system and artefacts can be introduced by the anaesthesia necessary to take the biopsy. We therefore attempted to set up an experimental system for X-ray microanalysis (XRMA) consisting of cultured human keratinocytes. A number of methodological aspects were studied: different cell types, washing methods and different culture periods for the keratinocytes. It was also investigated whether the keratinocytes responded to exposure to sodium lauryl sulphate (SLS) with changes in their elemental composition. The concentrations of biologically important elements such as Na, Mg, P and K were different in HaCaT cells (a spontaneously immortalized non-tumorigenic cell line derived from adult human keratinocytes) compared to natural human epidermal keratinocytes. The washing procedure and time of culture influenced the intracellular elemental content, and rinsing with distilled water was preferred for further experiments. Changes in the elemental content in the HaCaT cells compatible with a pattern of cell injury followed by repair by cell proliferation were seen after treatment with 3.33 microM and 33 microM SLS. We conclude that XRMA is a useful tool for the study of functional changes in cultured keratinocytes, even though the preparation methods have to be strictly controlled. The method can conceivably be used for predicting effects of different chemicals on human skin. PMID:10971801

  18. Protective Effect of Cyanidin-3-O-Glucoside against Ultraviolet B Radiation-Induced Cell Damage in Human HaCaT Keratinocytes.

    Science.gov (United States)

    Hu, Yunfeng; Ma, Yuetang; Wu, Shi; Chen, Tianfeng; He, Yong; Sun, Jianxia; Jiao, Rui; Jiang, Xinwei; Huang, Yadong; Deng, Liehua; Bai, Weibin

    2016-01-01

    Ultraviolet radiation is the major environmental harmful factor that has emotional impact on human skin. The aim of the present study was to determine the mechanism of protection of cyanidin-3-O-glucoside against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. Our results show that cyanidin-3-O-glucoside decreased the levels of intracellular reactive oxygen species generated by UVB treatment. Cyanidin-3-O-glucoside also decreased the UVB-augmented levels of the DNA damage indicators phospho-p53 and phospho-ATM/ATR. In addition, cyanidin-3-O-glucoside protected keratinocytes from UVB-induced injury by overturning the disruption of mitochondrial membrane potential and reversing apoptosis. The expression of anti-apoptotic protein B-cell lymphoma 2 (Bcl-2) was attenuated in UVB-exposed cells but restored in UVB/cyanidin-3-O-glucoside-treated cells. Furthermore, expression of the proapoptotic proteins Bcl-2-associated X (Bax) and the key apoptosis executer cleaved caspase-3 were increased in UVB-irradiated cells and decreased in UVB/cyanidin-3-O-glucoside-treated cells. For these reasons, the results demonstrate that cyanidin-3-O-glucoside protects human keratinocytes against UVB-induced oxidative stress and apoptosis. Our study provides a theoretical basis for the use of cyanidin-3-O-glucoside in the fight against light damage.

  19. Protective Effect of Cyanidin-3-O-Glucoside against Ultraviolet B Radiation-Induced Cell Damage in Human HaCaT Keratinocytes.

    Science.gov (United States)

    Hu, Yunfeng; Ma, Yuetang; Wu, Shi; Chen, Tianfeng; He, Yong; Sun, Jianxia; Jiao, Rui; Jiang, Xinwei; Huang, Yadong; Deng, Liehua; Bai, Weibin

    2016-01-01

    Ultraviolet radiation is the major environmental harmful factor that has emotional impact on human skin. The aim of the present study was to determine the mechanism of protection of cyanidin-3-O-glucoside against ultraviolet B (UVB)-induced damage to human HaCaT keratinocytes. Our results show that cyanidin-3-O-glucoside decreased the levels of intracellular reactive oxygen species generated by UVB treatment. Cyanidin-3-O-glucoside also decreased the UVB-augmented levels of the DNA damage indicators phospho-p53 and phospho-ATM/ATR. In addition, cyanidin-3-O-glucoside protected keratinocytes from UVB-induced injury by overturning the disruption of mitochondrial membrane potential and reversing apoptosis. The expression of anti-apoptotic protein B-cell lymphoma 2 (Bcl-2) was attenuated in UVB-exposed cells but restored in UVB/cyanidin-3-O-glucoside-treated cells. Furthermore, expression of the proapoptotic proteins Bcl-2-associated X (Bax) and the key apoptosis executer cleaved caspase-3 were increased in UVB-irradiated cells and decreased in UVB/cyanidin-3-O-glucoside-treated cells. For these reasons, the results demonstrate that cyanidin-3-O-glucoside protects human keratinocytes against UVB-induced oxidative stress and apoptosis. Our study provides a theoretical basis for the use of cyanidin-3-O-glucoside in the fight against light damage. PMID:27656146

  20. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  1. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  2. Proteomic assessment of sulfur mustard-induced protein adducts and other protein modifications in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Although some toxicological mechanisms of sulfur mustard (HD) have been uncovered, new knowledge will allow for advanced insight in the pathways that lead towards epidermal-dermal separation in skin. In the present investigation, we aimed to survey events that occur at the protein level in human epidermal keratinocytes (HEK) during 24 h after exposure to HD. By using radiolabeled 14C-HD, it was found that proteins in cultured HEK are significant targets for alkylation by HD. HD-adducted proteins were visualized by two-dimensional gel electrophoresis and analyzed by mass spectrometry. Several type I and II cytokeratins, actin, stratifin (14-3-3σ) and galectin-7 were identified. These proteins are involved in the maintenance of the cellular cytoskeleton. Their alkylation may cause changes in the cellular architecture and, in direct line with that, be determinative for the onset of vesication. Furthermore, differential proteomic analysis was applied to search for novel features of the cellular response to HD. Partial breakdown of type I cytokeratins K14, K16 and K17 as well as the emergence of new charge variants of the proteins heat shock protein 27 and ribosomal protein P0 were observed. Studies with caspase inhibitors showed that caspase-6 is probably responsible for the breakdown of type I cytokeratins in HEK. The significance of the results is discussed in terms of toxicological relevance and possible clues for therapeutic intervention

  3. Metabolic effects of TiO2 nanoparticles, a common component of sunscreens and cosmetics, on human keratinocytes.

    Science.gov (United States)

    Tucci, P; Porta, G; Agostini, M; Dinsdale, D; Iavicoli, I; Cain, K; Finazzi-Agró, A; Melino, G; Willis, A

    2013-03-21

    The long-term health risks of nanoparticles remain poorly understood, which is a serious concern given their prevalence in the environment from increased industrial and domestic use. The extent to which such compounds contribute to cellular toxicity is unclear, and although it is known that induction of oxidative stress pathways is associated with this process, the proteins and the metabolic pathways involved with nanoparticle-mediated oxidative stress and toxicity are largely unknown. To investigate this problem further, the effect of TiO2 on the HaCaT human keratinocyte cell line was examined. The data show that although TiO2 does not affect cell cycle phase distribution, nor cell death, these nanoparticles have a considerable and rapid effect on mitochondrial function. Metabolic analysis was performed to identify 268 metabolites of the specific pathways involved and 85 biochemical metabolites were found to be significantly altered, many of which are known to be associated with the cellular stress response. Importantly, the uptake of nanoparticles into the cultured cells was restricted to phagosomes, TiO2 nanoparticles did not enter into the nucleus or any other cytoplasmic organelle. No other morphological changes were detected after 24-h exposure consistent with a specific role of mitochondria in this response.

  4. 1,4-Naphthoquinones as inducers of oxidative damage and stress signaling in HaCaT human keratinocytes.

    Science.gov (United States)

    Klaus, Viola; Hartmann, Tobias; Gambini, Juan; Graf, Peter; Stahl, Wilhelm; Hartwig, Andrea; Klotz, Lars-Oliver

    2010-04-15

    Selected biological effects of 1,4-naphthoquinone, menadione (2-methyl-1,4-naphthoquinone) and structurally related quinones from natural sources--the 5-hydroxy-naphthoquinones juglone, plumbagin and the 2-hydroxy-naphthoquinones lawsone and lapachol--were studied in human keratinocytes (HaCaT). 1,4-naphthoquinone and menadione as well as juglone and plumbagin were highly cytotoxic, strongly induced reactive oxygen species (ROS) formation and depleted cellular glutathione. Moreover, they induced oxidative DNA base damage and accumulation of DNA strand breaks, as demonstrated in an alkaline DNA unwinding assay. Neither lawsone nor lapachol (up to 100 microM) were active in any of these assays. Cytotoxic and oxidative action was paralleled by stimulation of stress signaling: all tested quinones except lawsone and lapachol strongly induced phosphorylation of the epidermal growth factor receptor (EGFR) and the related ErbB2 receptor tyrosine kinase. EGFR activation by plumbagin, juglone and menadione was attenuated by a superoxide dismutase mimetic, indicating that ROS-related mechanisms contribute to EGFR activation by these naphthoquinones. PMID:20153715

  5. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi

    2015-05-01

    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  6. Dissecting the Calcium-Induced Differentiation of Human Primary Keratinocytes Stem Cells by Integrative and Structural Network Analyses

    Science.gov (United States)

    Toufighi, Kiana; Yang, Jae-Seong; Luis, Nuno Miguel; Aznar Benitah, Salvador; Lehner, Ben; Serrano, Luis; Kiel, Christina

    2015-01-01

    The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55%) are composed of non-dynamic and dynamic gene products (‘di-chromatic’), 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation. PMID:25946651

  7. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an in vivo model.

    Science.gov (United States)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-12

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 microg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs. PMID:19850098

  8. Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-β signaling

    International Nuclear Information System (INIS)

    We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-β signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-β signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-β1 levels, phosphorylation of Smad2/3, and increased expression of p15INK4B and p57KIP2. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-β1 induced dephosphorylation of Smad2/3, and diminished the level of p15INK4B and p57KIP2. Moreover, Bmi-1 expression led to the inhibition of TGF-β-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15INK4B, and p57KIP2. In addition, an exposure of senescent NHOK to TGF-β receptor I kinase inhibitor or anti-TGF-β antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-β signaling pathway in NHOK.

  9. Mechanical response of a living human epidermal keratinocyte sheet as measured in a composite diaphragm inflation experiment.

    Science.gov (United States)

    Selby, John C; Shannon, Mark A

    2007-01-01

    Sheets of normal human epidermal keratinocytes (NHEKs) were reconstituted in vitro on tensed but highly compliant, freestanding polydimethylsiloxane (PDMS) membranes, 5.0 mm in diameter and 10 mum thick. NHEK-PDMS composite diaphragm (CD) specimens were then subjected to cyclical axisymmetric inflation tests to investigate epithelial sheet rheology under conditions of physiologically severe deformations (~50% nominal polar biaxial strains). Because the compliance of the specially formulated PDMS membrane was greater than that of the attached cell layer, the finite load-deformation behavior (mechanical response) of the living NHEK sheet was inferred from differences between the mechanical behavior of the CD specimen and the response of the underlying PDMS membrane measured prior to cell culture. In these composite diaphragm inflation (CDI) experiments, interconnected NHEKs exhibited rheological behaviors that were suggestive of a viscoelastic-plastic stress response. Remarkably, specimens returned to quiescent culture following a sequence of inflation tests recovered at least 80% of their original ability to store elastic strain energy, evidence of biological adaptation and recovery or restitutio ad integrum. Unlike methodologies that assay the morphological or biochemical response of cultured cells to an applied mechanostimulus, CDI experiments can be used to probe the load-bearing functions of desmosomes and adherens junctions within a living epithelial sheet, as well as to assess the rheological behaviors of the intermediate filament and microfilament networks that these cell-cell junctions serve to interconnect. PMID:18401074

  10. Cytogenotoxicity of selected organophosphate insecticides on HaCaT keratinocytes and NL-20 human bronchial cells.

    Science.gov (United States)

    Arteaga-Gómez, Eduardo; Rodríguez-Levis, Alejandra; Cortés-Eslava, Josefina; Arenas-Huertero, Francisco; Valencia-Quintana, Rafael; Gómez-Arroyo, Sandra

    2016-02-01

    Organophosphate insecticides (OI) are widely used. To humans the main routes of exposure are skin and inhalation. For this, keratinocytes (HaCaT) and bronchial cells (NL-20) were used as cell culture models to evaluate the effects of OI. The aim of this study was to evaluate the effect of four OI on HaCaT and NL-20 cells: azinphos-methyl, (AM); parathion-methyl (PM); omethoate (OM); and methamidophos (MET). Cells were exposed to 0.1, 1 and 10 μg/μL of each. Results showed a decrease in cell viability in both cell lines. Viability of the NL-20 cell line decreased with the three concentrations of OM. All differences were significant (p insecticides except MET, induced cell death. MET caused DNA damage in HaCaT cells at all concentrations. Differences were significant (p insecticide. Quantitative real time-polymerase chain reaction (RT-qPCR) showed an increase of BN1 gene in HaCaT by effect of AM and MET at 1 μg/μL. In conclusion, all the insecticides induced different levels of cyto and genotoxic effects in both cell lines.

  11. Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-{beta} signaling

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Reuben H., E-mail: rkim@dentistry.ucla.edu [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Lieberman, Mark B.; Lee, Rachel [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Shin, Ki-Hyuk [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Mehrazarin, Shebli; Oh, Ju-Eun [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Park, No-Hee [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Kang, Mo K., E-mail: mkang@dentistry.ucla.edu [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States)

    2010-10-01

    We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-{beta} signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-{beta} signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-{beta}1 levels, phosphorylation of Smad2/3, and increased expression of p15{sup INK4B} and p57{sup KIP2}. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-{beta}1 induced dephosphorylation of Smad2/3, and diminished the level of p15{sup INK4B} and p57{sup KIP2}. Moreover, Bmi-1 expression led to the inhibition of TGF-{beta}-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15{sup INK4B}, and p57{sup KIP2}. In addition, an exposure of senescent NHOK to TGF-{beta} receptor I kinase inhibitor or anti-TGF-{beta} antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-{beta} signaling pathway in NHOK.

  12. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  13. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  14. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  15. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing. PMID:11056422

  16. Characterization of serum antibodies from women immunized with Gardasil: A study of HPV-18 infection of primary human keratinocytes.

    Science.gov (United States)

    Wang, Hsu-Kun; Wei, Qing; Moldoveanu, Zina; Huh, Warner K; Vu, Huong Lan; Broker, Thomas R; Mestecky, Jiri; Chow, Louise T

    2016-06-01

    The prevalent human papillomaviruses (HPVs) infect human epithelial tissues. Infections by the mucosotropic HPV genotypes cause hyperproliferative ano-genital lesions. Persistent infections by high-risk (HR) HPVs such as HPV-16, HPV-18 and related types can progress to high grade intraepithelial neoplasias and cancers. Prophylactic HPV vaccines are based on DNA-free virus-like particles (VLPs) composed of the major capsid protein L1 of HPV-16, -18, -6 and -11 (Gardasil) or HPV-16 and -18 (Cervarix). Sera from vaccinated animals effectively prevent HPV pseudovirions to infect cell lines and mouse cervical epithelia. Both vaccines have proven to be highly protective in people. HPV pseudovirions are assembled in HEK293TT cells from matched L1 and L2 capsid proteins to encapsidate a reporter gene. Pseudovirions and genuine virions have structural differences and they infect cell lines or primary human keratinocytes (PHKs) with different efficiencies. In this study, we show that sera and isolated IgG from women immunized with Gardasil prevent authentic HPV-18 virions from infecting PHKs, whereas non-immune sera and purified IgG thereof are uniformly ineffective. Using early passage PHKs, neutralization is achieved only if immune sera are added within 2-4h of infection. We attribute the timing effect to a conformational change in HPV virions, thought to occur upon initial binding to heparan sulfate proteoglycans (HSPG) on the cell surface. This interpretation is consistent with the inability of immune IgG bound to or taken up by PHKs to neutralize the virus. Interestingly, the window of neutralization increases to 12-16h in slow growing, late passage PHKs, suggestive of altered cell surface molecules. In vivo, this window might be further lengthened by the time required to activate the normally quiescent basal cells to become susceptible to infection. Our observations help explain the high efficacy of HPV vaccines.

  17. Baicalin downregulates Porphyromonas gingivalis lipopolysaccharide-upregulated IL-6 and IL-8 expression in human oral keratinocytes by negative regulation of TLR signaling.

    Directory of Open Access Journals (Sweden)

    Wei Luo

    Full Text Available Periodontal (gum disease is one of the main global oral health burdens and severe periodontal disease (periodontitis is a leading cause of tooth loss in adults globally. It also increases the risk of cardiovascular disease and diabetes mellitus. Porphyromonas gingivalis lipopolysaccharide (LPS is a key virulent attribute that significantly contributes to periodontal pathogenesis. Baicalin is a flavonoid from Scutellaria radix, an herb commonly used in traditional Chinese medicine for treating inflammatory diseases. The present study examined the modulatory effect of baicalin on P. gingivalis LPS-induced expression of IL-6 and IL-8 in human oral keratinocytes (HOKs. Cells were pre-treated with baicalin (0-80 µM for 24 h, and subsequently treated with P. gingivalis LPS at 10 µg/ml with or without baicalin for 3 h. IL-6 and IL-8 transcripts and proteins were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of nuclear factor-κB (NF-κB, p38 mitogen-activated protein kinase (MAPK and c-Jun N-terminal kinase (JNK proteins was analyzed by western blot. A panel of genes related to toll-like receptor (TLR signaling was examined by PCR array. We found that baicalin significantly downregulated P. gingivalis LPS-stimulated expression of IL-6 and IL-8, and inhibited P. gingivalis LPS-activated NF-κB, p38 MAPK and JNK. Furthermore, baicalin markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling. In conclusion, the present study shows that baicalin may significantly downregulate P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs via negative regulation of TLR signaling.

  18. UVB-irradiated human keratinocytes and interleukin-1αindirectly increase MAP kinase/AP-1 activation and MMP-1 production in UVA-irradiated dermal fibroblasts

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yong; BI Zhi-gang

    2006-01-01

    Background Solar ultraviolet (UV) irradiation induces the production of matrix metalloproteinases (MMPs) by activating cellular signalling transduction pathways. MMPs are responsible for the degradation and/or inhibition of synthesis of collagenous extracellular matrix in connective tissues. We mimicked the action of environmental ultraviolet on skin and investigated the effects of UVB-irradiated human keratinocytes HaCaT and IL-1α on mitogen activated protein (MAP) kinase activation, c-Jun and c-Fos (AP-1 is composed of Jun and Fos proteins)mRNA expression and MMP-1 production in UVA-irradiated dermal fibroblasts.Methods Following UVA irradiation, the culture medium of fibroblasts was replaced by culture medium from UVB-irradiated HaCaT, or replaced by the complete culture medium with interleukin (IL)-1α. MAP kinase activity expression in fibroblasts was detected by Western blot. c-Jun and c-Fos mRNA expressions were determined by reverse transcriptional polymerase chain reaction (RT-PCR); MMP-1 production in culture medium was detected by enzyme-linked immunosorbent assay (ELISA).Results Culture medium from UVB-irradiated keratinocytes increased MAP kinase activity and c-Jun mRNA expression in UVA-irradiated fibroblasts. IL-1α increased MAP kinase activity and c-Jun mRNA expression,IL-1 α also increased c-Fos mRNA expression. Both culture media from UVB-irradiated human keratinocytes and externally applied IL-1 α increased MMP-1 production in UVA-irradiated fibroblasts.Conclusions UVB-irradiated keratinocytes and IL-1α indirectly promote MMP-1 production in UVA-irradiated fibroblasts by increasing MAP kinase/AP-1 activity. IL-1 may play an important role in the paracrine activation and dermal collagen excessive degradation leading to skin photoaging.

  19. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H;

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved......, melanocytes, fibroblasts, dermal microvascular endothelial cells, peripheral blood mononuclear cells and sweat duct cells. The keratinocyte 2-D gel protein database will be updated yearly in the November issue of Electrophoresis. Udgivelsesdato: 1991-Nov...

  20. E2 proteins of high risk human papillomaviruses down-modulate STING and IFN-κ transcription in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Nuchsupha Sunthamala

    Full Text Available In the early stages of human papillomavirus (HPV infection, the viral proteins elicit specific immune responses that can participate to regression of ano-genital lesions. HPV E6 protein for instance can reduce type I interferon (IFN including IFN-κ that is involved in immune evasion and HPV persistence. To evaluate the role of E2 protein in innate immunity in HPV16-associated cervical lesions, genome-wide expression profiling of human primary keratinocytes (HPK transduced by HPV16 E2 was investigated using microarrays and innate immunity associated genes were specifically analyzed. The analyses showed that the expression of 779 genes was modulated by HPV16E2 and 92 of them were genes associated with innate immunity. Notably IFN-κ and STING were suppressed in HPK expressing the E2 proteins of HPV16 or HPV18 and the trans-activation amino-terminal domain of E2 was involved in the suppressive effect. The relationship between STING, IFN-κ and interferon stimulated genes (ISGs in HPK was confirmed by gene silencing and real time PCR. The expression of STING and IFN-κ were further determined in clinical specimens by real time PCR. STING and IFN-κ were down-modulated in HPV positive low grade squamous intraepithelial lesions compared with HPV negative controls. This study demonstrates that E2 proteins of high risk HPV reduce STING and IFN-κ transcription and its downstream target genes that might be an immune evasion mechanism involved in HPV persistence and cervical cancer development.

  1. HPV16 E7 protein and hTERT proteins defective for telomere maintenance cooperate to immortalize human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Jonathan Miller

    Full Text Available Previous studies have shown that wild-type human telomerase reverse transcriptase (hTERT protein can functionally replace the human papillomavirus type 16 (HPV-16 E6 protein, which cooperates with the viral E7 protein in the immortalization of primary keratinocytes. In the current study, we made the surprising finding that catalytically inactive hTERT (hTERT-D868A, elongation-defective hTERT (hTERT-HA, and telomere recruitment-defective hTERT (hTERT N+T also cooperate with E7 in mediating bypass of the senescence blockade and effecting cell immortalization. This suggests that hTERT has activities independent of its telomere maintenance functions that mediate transit across this restriction point. Since hTERT has been shown to have a role in gene activation, we performed microarray studies and discovered that E6, hTERT and mutant hTERT proteins altered the expression of highly overlapping sets of cellular genes. Most important, the E6 and hTERT proteins induced mRNA and protein levels of Bmi1, the core subunit of the Polycomb Group (PcG complex 1. We show further that Bmi1 substitutes for E6 or hTERT in cell immortalization. Finally, tissue array studies demonstrated that expression of Bmi1 increased with the severity of cervical dysplasia, suggesting a potential role in the progression of cervical cancer. Together, these data demonstrate that hTERT has extra-telomeric activities that facilitate cell immortalization and that its induction of Bmi1 is one potential mechanism for mediating this activity.

  2. Acquisition of high-level chromosomal instability is associated with integration of human papillomavirus type 16 in cervical keratinocytes.

    Science.gov (United States)

    Pett, Mark R; Alazawi, William O F; Roberts, Ian; Dowen, Sally; Smith, David I; Stanley, Margaret A; Coleman, Nicholas

    2004-02-15

    Whereas two key steps in cervical carcinogenesis are integration of high-risk human papillomavirus (HR-HPV) and acquisition of an unstable host genome, the temporal association between these events is poorly understood. Chromosomal instability is induced when HR-HPV E7 oncoprotein is overexpressed from heterologous promoters in vitro. However, it is not known whether such events occur at the "physiologically" elevated levels of E7 produced by deregulation of the homologous HR-HPV promoter after integration. Indeed, an alternative possibility is that integration in vivo is favored in an already unstable host genome. We have addressed these issues using the unique human papillomavirus (HPV) 16-containing cervical keratinocyte cell line W12, which was derived from a low-grade squamous intraepithelial lesion and thus acquired HPV16 by "natural" infection. Whereas W12 at low passage contains HPV16 episomes only, long-term culture results in the emergence of cells containing integrated HPV16 only. We show that integration of HPV16 in W12 is associated with 3' deletion of the E2 transcriptional repressor, resulting in deregulation of the homologous promoter of the integrant and an increase in E7 protein levels. We further demonstrate that high-level chromosomal instability develops in W12 only after integration and that the forms of instability observed correlate with the physical state of HPV16 DNA and the level of E7 protein. Whereas intermediate E7 levels are associated with numerical chromosomal abnormalities, maximal levels are associated with both numerical and structural aberrations. HR-HPV integration is likely to be a critical event in cervical carcinogenesis, preceding the development of chromosomal abnormalities that drive malignant progression.

  3. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  4. Plant polyphenols differentially modulate inflammatory responses of human keratinocytes by interfering with activation of transcription factors NFκB and AhR and EGFR-ERK pathway

    International Nuclear Information System (INIS)

    Molecular mechanisms underlying modulation of inflammatory responses in primary human keratinocytes by plant polyphenols (PPs), namely the glycosylated phenylpropanoid verbascoside, the stilbenoid resveratrol and its glycoside polydatin, and the flavonoid quercetin and its glycoside rutin were evaluated. As non-lethal stimuli, the prototypic ligand for epidermal growth factor receptor (EGFR) transforming growth factor alpha (TGFalpha), the combination of tumor necrosis factor (TNFalpha) and interferon (IFNgamma) (T/I), UVA + UVB irradiation, and bacterial lipopolysaccharide (LPS) were used. We demonstrated differential modulation of inflammatory responses in keratinocytes at signal transduction, gene transcription, and protein synthesis levels as a function of PP chemical structure, the pro-inflammatory trigger used, and PP interaction with intracellular detoxifying systems. The PPs remarkably inhibited constitutive, LPS- and T/I-induced but not TGFalpha-induced ERK phosphorylation. They also suppressed NFkappaB activation by LPS and T/I. Verbascoside and quercetin invariably impaired EGFR phosphorylation and UV-associated aryl hydrocarbon receptor (AhR)-mediated signaling, while rutin, polydatin and resveratrol did not affect EGFR phosphorylation and further activated AhR machinery in UV-exposed keratinocytes. In general, PPs down-regulated gene expression of pro-inflammatory cytokines/enzymes, except significant up-regulation of IL-8 observed under stimulation with TGFalpha. Both spontaneous and T/I-induced release of IL-8 and IP-10 was suppressed, although 50 μM resveratrol and polydatin up-regulated IL-8. At this concentration, resveratrol activated both gene expression and de novo synthesis of IL-8 and AhR-mediated mechanisms were involved. We conclude that PPs differentially modulate the inflammatory response of human keratinocytes through distinct signal transduction pathways, including AhR and EGFR. - Graphical abstract: Display Omitted Highlights:

  5. Cultivating technique for human keratinocyte under laboratory condition%实验室条件下人角质形成细胞的培养技术

    Institute of Scientific and Technical Information of China (English)

    卢宁; 朱平; 刘玉峰; 王刚; 张海龙; 赵小东

    2006-01-01

    %,9 d左右细胞融合达90%,11d左右细胞完全融合形成细胞膜片.角质形成细胞可在体外稳定培养2~3个月,细胞形态和生长速度无明显改变. ②不同代的角质形成细胞冻存和复苏情况:将不同代的角质形成细胞分别冻存于液氮罐中,3个月后进行复苏,发现角质形成细胞的形态和生长速度无明显改变.③角质形成细胞形态学观察结果:显微镜下细胞呈典型上皮样特征,高核浆比例,细胞紧密排列,轮廓清楚折光性好.透射电镜下培养的表皮角质形成细胞胞浆内有大量束状张力丝和张力原纤维,可见线粒体和粗面内质网,胞质周边有短的突起,细胞间有桥粒相连等角化细胞所具有的特点.结论:培养的角质形成细胞在多次传代后仍能够保持正常的形态特征,提示改良的培养角质形成细胞的技术可为实验和临床提供可靠丰富的角质形成细胞来源.%BACKGROUND: Along with the establishment and development of in vitro culture technique for human keratinocyte, skin would no longer be considered only as the physiological barrier, it's of important significance in immunity and endocrinology and so on.OBJECTIVE: To explore the experimental cultivating technique for human keratinocytes to provide reliable cell resource forthe appliance of keratinocytes in many ways.DESIGN: An opening study with keratinocytes as the subjects of the experiment.SETTING: Department of Immunology and Department of Dermatology,Xijing Hospital, Fourth Military Medical University of Chinese PLA MATERIALS: This experiment was carried out in the clinical laboratory of Department of Immunology of Xijing Hospital of the Fourth Military Medical University of Chinese PLA between March 2003 and March 2005.Prepuce sample was postoperatively obtained from a 6-year-old boy who was admitted to the department of urology surgery of Xijing hospital in April 2003, prepuce was used as the source for keratinocytes.METHODS:

  6. Downregulation of TNIP1 Expression Leads to Increased Proliferation of Human Keratinocytes and Severer Psoriasis-Like Conditions in an Imiquimod-Induced Mouse Model of Dermatitis.

    Science.gov (United States)

    Chen, Yan; Yan, Heng; Song, Zhiqiang; Chen, Fangru; Wang, Huan; Niu, Jun; Shi, Xiaowei; Zhang, Dongmei; Zhang, Na; Zhai, Zhifang; Zhong, Baiyu; Cheng, Liangjin; Qian, Tian; Hao, Fei

    2015-01-01

    Psoriasis is a chronic, inflammatory skin disease involving both environmental and genetic factors. According to genome-wide association studies (GWAS), the TNIP1 gene, which encodes the TNF-α-induced protein 3-interacting protein 1 (TNIP1), is strongly linked to the susceptibility of psoriasis. TNIP1 is a widely expressed ubiquitin sensor that binds to the ubiquitin-editing protein A20 and restricts TNF- and TLR-induced signals. In our study, TNIP1 expression decreased in specimens of epidermis affected by psoriasis. Based on previous studies suggesting a role for TNIP1 in modulating cancer cell growth, we investigated its role in keratinocyte proliferation, which is clearly abnormal in psoriasis. To mimic the downregulation or upregulation of TNIP1 in HaCaT cells and primary human keratinocytes (PHKs), we used a TNIP1 specific small interfering hairpin RNA (TNIP1 shRNA) lentiviral vector or a recombinant TNIP1 (rTNIP1) lentiviral vector, respectively. Blocking TNIP1 expression increased keratinocyte proliferation, while overexpression of TNIP1 decreased keratinocyte proliferation. Furthermore, we showed that TNIP1 signaling might involve extracellular signal-regulated kinase1/2 (Erk1/2) and CCAAT/enhancer-binding protein β (C/EBPβ) activity. Intradermal injection of TNIP1 shRNA in BALB/c mice led to exaggerated psoriatic conditions in imiquimod (IMQ)-induced psoriasis-like dermatitis. These findings indicate that TNIP1 has a protective role in psoriasis and therefore could be a promising therapeutic target. PMID:26046540

  7. Downregulation of TNIP1 Expression Leads to Increased Proliferation of Human Keratinocytes and Severer Psoriasis-Like Conditions in an Imiquimod-Induced Mouse Model of Dermatitis.

    Directory of Open Access Journals (Sweden)

    Yan Chen

    Full Text Available Psoriasis is a chronic, inflammatory skin disease involving both environmental and genetic factors. According to genome-wide association studies (GWAS, the TNIP1 gene, which encodes the TNF-α-induced protein 3-interacting protein 1 (TNIP1, is strongly linked to the susceptibility of psoriasis. TNIP1 is a widely expressed ubiquitin sensor that binds to the ubiquitin-editing protein A20 and restricts TNF- and TLR-induced signals. In our study, TNIP1 expression decreased in specimens of epidermis affected by psoriasis. Based on previous studies suggesting a role for TNIP1 in modulating cancer cell growth, we investigated its role in keratinocyte proliferation, which is clearly abnormal in psoriasis. To mimic the downregulation or upregulation of TNIP1 in HaCaT cells and primary human keratinocytes (PHKs, we used a TNIP1 specific small interfering hairpin RNA (TNIP1 shRNA lentiviral vector or a recombinant TNIP1 (rTNIP1 lentiviral vector, respectively. Blocking TNIP1 expression increased keratinocyte proliferation, while overexpression of TNIP1 decreased keratinocyte proliferation. Furthermore, we showed that TNIP1 signaling might involve extracellular signal-regulated kinase1/2 (Erk1/2 and CCAAT/enhancer-binding protein β (C/EBPβ activity. Intradermal injection of TNIP1 shRNA in BALB/c mice led to exaggerated psoriatic conditions in imiquimod (IMQ-induced psoriasis-like dermatitis. These findings indicate that TNIP1 has a protective role in psoriasis and therefore could be a promising therapeutic target.

  8. APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

    Science.gov (United States)

    Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

  9. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    OpenAIRE

    Sharon Wong; Han Hor Chor; Sathiya Moorthy; Chee Tian Ong; Toan Thang Phan; Jaide Jay Lu

    2013-01-01

    Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in h...

  10. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    OpenAIRE

    SLOMINSKI, ANDRZEJ T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2013-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-...

  11. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes

    International Nuclear Information System (INIS)

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  12. Protective effect of C. sativa leaf extract against UV mediated-DNA damage in a human keratinocyte cell line.

    Science.gov (United States)

    Almeida, I F; Pinto, A S; Monteiro, C; Monteiro, H; Belo, L; Fernandes, J; Bento, A R; Duarte, T L; Garrido, J; Bahia, M F; Sousa Lobo, J M; Costa, P C

    2015-03-01

    Toxic effects of ultraviolet (UV) radiation on skin include protein and lipid oxidation, and DNA damage. The latter is known to play a major role in photocarcinogenesis and photoaging. Many plant extracts and natural compounds are emerging as photoprotective agents. Castanea sativa leaf extract is able to scavenge several reactive species that have been associated to UV-induced oxidative stress. The aim of this work was to analyze the protective effect of C. sativa extract (ECS) at different concentrations (0.001, 0.01, 0.05 and 0.1 μg/mL) against the UV mediated-DNA damage in a human keratinocyte cell line (HaCaT). For this purpose, the cytokinesis-block micronucleus assay was used. Elucidation of the protective mechanism was undertaken regarding UV absorption, influence on (1)O₂ mediated effects or NRF2 activation. ECS presented a concentration-dependent protective effect against UV-mediated DNA damage in HaCaT cells. The maximum protection afforded (66.4%) was achieved with the concentration of 0.1 μg/mL. This effect was found to be related to a direct antioxidant effect (involving (1)O₂) rather than activation of the endogenous antioxidant response coordinated by NRF2. Electrochemical studies showed that the good antioxidant capacity of the ECS can be ascribed to the presence of a pool of different phenolic antioxidants. No genotoxic or phototoxic effects were observed after incubation of HaCaT cells with ECS (up to 0.1 μg/mL). Taken together these results reinforce the putative application of this plant extract in the prevention/minimization of UV deleterious effects on skin.

  13. Regulation of transglutaminase type II by transforming growth factor-beta 1 in normal and transformed human epidermal keratinocytes.

    Science.gov (United States)

    George, M D; Vollberg, T M; Floyd, E E; Stein, J P; Jetten, A M

    1990-07-01

    This study examines the effect of transforming growth factor-beta 1 (TGF-beta 1) on the expression of Type I and II transglutaminase in normal human epidermal keratinocytes (NHEK cells). Treatment of undifferentiated NHEK cells with 100 pM TGF-beta 1 caused a 10- to 15-fold increase in the activity of a soluble transglutaminase. Based on its cellular distribution and immunoreactivity this transglutaminase was identified as Type II (tissue) transglutaminase. TGF-beta 1 did not enhance the levels of the membrane-bound Type I (epidermal) transglutaminase activity which is induced during squamous cell differentiation and did not increase Type II transglutaminase activity in differentiated NHEK cells. Several SV40 large T antigen-immortalized NHEK cell lines also exhibited a dramatic increase in transglutaminase Type II activity after TGF-beta 1 treatment; however, TGF-beta 1 did not induce any significant change in transglutaminase activity in the carcinoma-derived cell lines SCC-13, SCC-15, and SQCC/Y1. Half-maximal stimulation of transglutaminase Type II activity in NHEK cells occurred at a dose of 15 pM TGF-beta 1. TGF-beta 2 was about equally effective. This enhancement in transglutaminase activity was related to an increase in the amount of transglutaminase Type II protein as indicated by immunoblot analysis. Northern blot analyses using a specific cDNA probe for Type II transglutaminase showed that exposure of NHEK cells to TGF-beta 1 caused a marked increase in the mRNA levels of this enzyme which could be observed as early as 4 h after the addition of TGF-beta 1. Maximal induction of transglutaminase Type II mRNA occurred between 18 and 24 h. The increase in Type II transglutaminase mRNA levels was blocked by the presence of cycloheximide, suggesting that this increase in mRNA by TGF-beta 1 is dependent on protein synthesis. PMID:1972706

  14. Deoxynivalenol induced mouse skin tumor initiation: Elucidation of molecular mechanisms in human HaCaT keratinocytes.

    Science.gov (United States)

    Mishra, Sakshi; Tewari, Prachi; Chaudhari, Bhushan P; Dwivedi, Premendra D; Pandey, Haushila P; Das, Mukul

    2016-11-01

    Among food contaminants, mycotoxins are toxic to both human and animal health. Our prior studies suggest that Deoxynivalenol (DON), a mycotoxin, behaves as a tumor promoter by inducing edema, hyperplasia, ODC activity and activation of MAPK's in mouse skin. In this study, topical application of DON, 336 and 672 nmol significantly enhanced ROS levels, DNA damage and apoptosis with concomitant downregulation of Ki-67, cyclin D, cyclin E, cyclin A and cyclin-dependent kinases (CDK4 and CDK2) thereby resulting in tumor initiation in mouse skin. Further, the elucidation of molecular mechanisms of tumor initiation by DON (0.42-3.37 nmol/ml) in HaCaT keratinocytes, revealed (i) enhanced ROS generation with cell cycle phase arrest in G0/G1 phase, (ii) increase in levels of 8-OxoG (6-24 hr) and γH2AX protein, (iii) significant enhancement in oxidative stress marker enzymes LPO, GSH, GR with concomitant decrease in antioxidant enzymes catalase, GPx, GST, SOD and mitochondrial membrane potential after DON (1.68 nmol) treatment, (iv) suppression of Nrf2 translocation to nucleus, enhanced phosphorylation with subsequent activation ERK1/2, p38 and JNK MAPK's following DON (1.68 nmol) treatment, (v) overexpression of c-jun, c-fos proteins, upregulation of Bax along with downregulation of Bcl-2 proteins, (vi) increase in cytochrome-c, caspase-9, caspase-3 and poly ADP ribose polymerase levels leads to apoptosis. Pretreatment of superoxide dismutase, mannitol and ethanol to HaCaT cells resulted in significant reduction in ROS levels and apoptosis indicating the role of superoxide and hydroxyl radicals in DON induced apoptosis as an early event and skin tumor initiation as a late event. PMID:27389473

  15. Deoxynivalenol induced mouse skin tumor initiation: Elucidation of molecular mechanisms in human HaCaT keratinocytes.

    Science.gov (United States)

    Mishra, Sakshi; Tewari, Prachi; Chaudhari, Bhushan P; Dwivedi, Premendra D; Pandey, Haushila P; Das, Mukul

    2016-11-01

    Among food contaminants, mycotoxins are toxic to both human and animal health. Our prior studies suggest that Deoxynivalenol (DON), a mycotoxin, behaves as a tumor promoter by inducing edema, hyperplasia, ODC activity and activation of MAPK's in mouse skin. In this study, topical application of DON, 336 and 672 nmol significantly enhanced ROS levels, DNA damage and apoptosis with concomitant downregulation of Ki-67, cyclin D, cyclin E, cyclin A and cyclin-dependent kinases (CDK4 and CDK2) thereby resulting in tumor initiation in mouse skin. Further, the elucidation of molecular mechanisms of tumor initiation by DON (0.42-3.37 nmol/ml) in HaCaT keratinocytes, revealed (i) enhanced ROS generation with cell cycle phase arrest in G0/G1 phase, (ii) increase in levels of 8-OxoG (6-24 hr) and γH2AX protein, (iii) significant enhancement in oxidative stress marker enzymes LPO, GSH, GR with concomitant decrease in antioxidant enzymes catalase, GPx, GST, SOD and mitochondrial membrane potential after DON (1.68 nmol) treatment, (iv) suppression of Nrf2 translocation to nucleus, enhanced phosphorylation with subsequent activation ERK1/2, p38 and JNK MAPK's following DON (1.68 nmol) treatment, (v) overexpression of c-jun, c-fos proteins, upregulation of Bax along with downregulation of Bcl-2 proteins, (vi) increase in cytochrome-c, caspase-9, caspase-3 and poly ADP ribose polymerase levels leads to apoptosis. Pretreatment of superoxide dismutase, mannitol and ethanol to HaCaT cells resulted in significant reduction in ROS levels and apoptosis indicating the role of superoxide and hydroxyl radicals in DON induced apoptosis as an early event and skin tumor initiation as a late event.

  16. Proteomic Analysis of Arsenic-Induced Oxidative Stress in Human Epidermal Keratinocytes

    Science.gov (United States)

    Chronic exposure to inorganic arsenic (IAs) has been associated with the development of several human cancers, including those found in the skin, lung, urinary bladder, liver, prostate and kidney. The precise mechanisms by which arsenic causes cancer are unknown. Defining the mod...

  17. In Vivo Multiphoton NADH Fluorescence Reveals Depth-Dependent Keratinocyte Metabolism in Human Skin

    OpenAIRE

    Balu, Mihaela; Mazhar, Amaan; Hayakawa, Carole K.; Mittal, Richa; Krasieva, Tatiana B.; Konig, Karsten; Venugopalan, Vasan; Tromberg, Bruce J.

    2013-01-01

    We employ a clinical multiphoton microscope to monitor in vivo and noninvasively the changes in reduced nicotinamide adenine dinucleotide (NADH) fluorescence of human epidermal cells during arterial occlusion. We correlate these results with measurements of tissue oxy- and deoxyhemoglobin concentration during oxygen deprivation using spatial frequency domain imaging. During arterial occlusion, a decrease in oxyhemoglobin corresponds to an increase in NADH fluorescence in the basal epidermal c...

  18. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice;

    2015-01-01

    through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  19. The human keratinocyte two-dimensional gel protein database (update 1995): mapping components of signal transduction pathways

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Gromov, P;

    1995-01-01

    )vaccinia virus expression of full length cDNAs, and (vi) in vitro transcription/translation of full-length cDNAs. This year, special emphasis has been given to the identification of signal transduction components by using 2-D gel immunoblotting of crude keratinocyte lysates in combination with enhanced...

  20. The Expression and Regulation of Interleukin-33 in Human Epidermal Keratinocytes: A New Mediator of Atopic Dermatitis and Its Possible Signaling Pathway.

    Science.gov (United States)

    Du, Hong-Yang; Fu, Hai-Yan; Li, Dong-Ning; Qiao, Yuan; Wang, Qiao-Wei; Liu, Wei

    2016-09-01

    Interleukin (IL)-33 is a novel member of the IL-1 superfamily of cytokines that has recently become a focal point for research into the pathogenesis of atopic dermatitis (AD). However, the expression and regulation of IL-33 in human epidermal keratinocytes have not well been delineated. The aim of this study was to evaluate IL-33 and its receptor ST2L expression in skin lesions of AD patients and explored the signal transduction mechanisms leading to the IL-33 expression and of the IL-33's pharmacological action in keratinocytes from AD patients (ADKs) and those from healthy controls (NHEKs). We performed immunocytochemistry, reverse transcription-polymerase chain reaction, Western blotting, and enzyme-linked immunosorbent assay to investigate ADKs compared with NHEKs. We found that IL-33/ST2L were positively expressed in the skin lesions of AD patients and a high expression of IL-33 was induced in keratinocytes by IL-4 plus interferon [IFN]-γ or IFN-γ alone at the mRNA and protein levels. Meanwhile, IFN-γ induced IL-33 expression through extracellular signal-regulated kinase (ERK), p38 mitogen-activated protein kinase (MAPK), epidermal growth factor receptor (EGFR), and Janus kinase/signal transducer and activator of transcription. The expression of ST2L was increased in a time- and dose-dependent manner in both types of cells incubated with IL-33, and was especially increased in ADKs compared with NHEKs. We examined the cytokine IL-6 and the chemokines CXCL-8/IL-8, CCL-20, CCL-17, CCL-5, and CCL-2 in keratinocytes, which showed increased expression in a time- and dose-dependent manner in ADKs when induced by IL-33. Furthermore, 4 signaling pathways (ERK, p38 MAPK, c-Jun N-terminal kinase, and nuclear factor-κB) were involved in the IL-33-mediated induction in both cells. In conclusion, IL-33 is closely interlinked in AD skins and keratinocytes. IL-33 plays an important role in the pathogenesis of immune inflammatory responses in AD, which might be a possible

  1. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H{sup +}-dependent mitochondrial pathway

    Energy Technology Data Exchange (ETDEWEB)

    Pelin, Marco, E-mail: marco.pelin@phd.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Ponti, Cristina, E-mail: cponti@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Sosa, Silvio, E-mail: silvio.sosa@econ.units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Gibellini, Davide, E-mail: davide.gibellini@unibo.it [Department of Haematology and Oncological Sciences, University of Bologna, Via Massarenti 9, 40138 Bologna (Italy); Florio, Chiara, E-mail: florioc@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy); Tubaro, Aurelia, E-mail: tubaro@units.it [Department of Life Science, University of Trieste, Via L. Giorgieri 7/9, 34127 Trieste (Italy)

    2013-01-01

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na{sup +} influx due to the transformation of Na{sup +}/K{sup +} ATPase in a cationic channel. Recently, we have demonstrated that Na{sup +} overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na{sup +} intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O{sub 2}{sup −} production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na{sup +}-mediated H{sup +}-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O{sub 2}{sup −} production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O{sub 2}{sup −} production induced by PLTX-mediated ionic imbalance. Indeed, the H{sup +} intracellular overload that follows PLTX-induced intracellular Na{sup +} accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O{sub 2}{sup −} production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O{sub 2}{sup −}) production by reversing mitochondrial transport chain. ► The mechanism of

  2. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    OpenAIRE

    Hiroshi Ishida; Radharaman Ray; Jack Amnuaysirikul; Keiko Ishida; Prabhati Ray

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of N...

  3. Cigarette Smoke Affects ABCAl Expression via Liver X Receptor Nuclear Translocation in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Claudia Sticozzi

    2010-09-01

    Full Text Available Cutaneous tissue is the first barrier against outdoor insults. The outer most layer of the skin, the stratum corneum (SC, is formed by corneocytes embedded in a lipid matrix (cholesterol, ceramide and fatty acids. Therefore, the regulation of lipids and, in particular, of cholesterol homeostasis in the skin is of great importance. ABCA1 is a membrane transporter responsible for cholesterol efflux and plays a key role in maintaining cellular cholesterol levels. Among the many factors that have been associated with skin diseases, the environmental stressor cigarette smoke has been recently studied. In the present study, we demonstrate that ABCA1 expression in human cells (HaCaT was increased (both mRNA and protein levels after CS exposure. This effect was mediated by the inhibition of NFkB (aldehydes adducts formation that allows the translocation of liver X receptor (LXR. These findings suggest that passive smoking may play a role in skin cholesterol levels and thus affect cutaneous tissues functions.

  4. Nitric oxide produced by ultraviolet-irradiated keratinocytes stimulates melanogenesis.

    OpenAIRE

    Roméro-Graillet, C; Aberdam, E; Clément, M.; Ortonne, J P; Ballotti, R

    1997-01-01

    Ultraviolet (UV) radiation is the main physiological stimulus for human skin pigmentation. Within the epidermal-melanin unit, melanocytes synthesize and transfer melanin to the surrounding keratinocytes. Keratinocytes produce paracrine factors that affect melanocyte proliferation, dendricity, and melanin synthesis. In this report, we show that normal human keratinocytes secrete nitric oxide (NO) in response to UVA and UVB radiation, and we demonstrate that the constitutive isoform of keratino...

  5. Activation of the human keratinocyte B1 bradykinin receptor induces expression and secretion of metalloproteases 2 and 9 by transactivation of epidermal growth factor receptor.

    Science.gov (United States)

    Matus, Carola E; Ehrenfeld, Pamela; Pavicic, Francisca; González, Carlos B; Concha, Miguel; Bhoola, Kanti D; Burgos, Rafael A; Figueroa, Carlos D

    2016-09-01

    The B1 bradykinin receptor (BDKRB1) is a component of the kinin cascade localized in the human skin. Some of the effects produced by stimulation of BDKRB1 depend on transactivation of epidermal growth factor receptor (EGFR), but the mechanisms involved in this process have not been clarified yet. The primary purpose of this study was to determine the effect of a BDKRB1 agonist on wound healing in a mouse model and the migration and secretion of metalloproteases 2 and 9 from human HaCaT keratinocytes and delineate the signalling pathways that triggered their secretion. Although stimulation of BDKRB1 induces weak chemotactic migration of keratinocytes and wound closure in an in vitro scratch-wound assay, the BDKRB1 agonist improved wound closure in a mouse model. BDKRB1 stimulation triggers synthesis and secretion of both metalloproteases, effects that depend on the activity of EGFR and subsequent phosphorylation of ERK1/2 and p38 mitogen-activated protein kinases and PI3K/Akt. In the mouse model, immunoreactivity for both gelatinases was concentrated around wound borders. EGFR transactivation by BDKRB1 agonist involves Src kinases family and ADAM17. In addition to extracellular matrix degradation, metalloproteases 2 and 9 regulate cell migration and differentiation, cell functions that are associated with the role of BDKRB1 in keratinocyte differentiation. Considering that BDKRB1 is up-regulated by inflammation and/or by cytokines that are abundant in the inflammatory milieu, more stable BDKRB1 agonists may be of therapeutic value to modulate wound healing. PMID:27093919

  6. The Peroxisome Proliferator-Activated Receptor Gamma System Regulates Ultraviolet B-Induced Prostaglandin E2 Production in Human Epidermal Keratinocytes

    Directory of Open Access Journals (Sweden)

    Raymond L. Konger

    2010-01-01

    Full Text Available Studies using PPARγ agonists in mouse skin have suggested that peroxisome proliferator-activated receptor gamma (PPARγ is irrelevant to cutaneous photobiology. However, in several epithelial cell lines, ultraviolet B (UVB has been shown to induce the nonenzymatic production of oxidized phospholipids that act as PPARγ agonists. UVB is also a potent inducer of prostaglandin E2  (PGE2 production and COX-2 expression in keratinocytes and PPARγ is coupled to increased PGE2 production in other cell lines. In this current study, we demonstrate that PPARγ agonists, but not PPARα or PPARβ/δ agonists, induce PGE2 production and COX-2 expression in primary human keratinocytes (PHKs. Importantly, PPARγ agonist-induced COX-2 expression and PGE2 production were partially inhibited by the PPARγ antagonist, GW9662, indicating that both PPARγ-dependent and -independent pathways are likely involved. GW9662 also suppressed UVB and tert-butylhydroperoxide- (TBH- induced PGE2 production in PHKs and intact human epidermis and partially inhibited UVB-induced COX-2 expression in PHKs. These findings provide evidence that PPARγ is relevant to cutaneous photobiology in human epidermis.

  7. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  8. Exposure to heat-inactivated Trichophyton rubrum resulting in a limited immune response of human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    HUANG Xiao-qiang; YI Jin-ling; YIN Song-chao; CHEN Rong-zhang; LI Mei-rong; GONG Zi-jian; LAI Wei; CHEN Jian

    2013-01-01

    Background Trichophyton rubrum (T.rubrum) represents the most important agent of dermatophytosis in humans.T.rubrum infection causes slight inflammation,and tends to be chronic and recurrent.It is suggested that it may result from the failure of epithelial cells to recognize T.rubrum effectively and initiate effective immune responses.The C-type lectin receptors (CLR) and toll-like receptors (TLR) are the two major pattern recognition receptors (PRRs) that recognize fungal components.Therefore,the purpose of the study was to analyze the expression of those PRRs and the cytokines in HaCaT cells stimulated with heat-inactivated T.rubrum conidia and hyphae,respectively.Methods HaCaT cells were unstimulated or stimulated with heat-inactivated T.rubrum conidia and hyphae (1×106 and 1.5×10s colony-forming unit (CFU) in 2 ml medium,respectively) for 6,12 and 24 hours.The mRNA expression of PRRs involved in recognizing fungal pathogen-associated molecular patterns (PAMPs) and signaling molecules were measured by quantitative reverse transcription polymerase chain reaction (RT-PCR).Meanwhile,surface toll-like receptor (TLR) 2,TLR4 and Dectin-1 were analyzed by fluorescence-activated cell sorter (FACS) 24 hours after treatment.The cytokines were detected in cell culture supernatants of HaCaT cells in 12 and 24 hours after treatment.Results HaCaT cells constitutively expressed mRNA of membrane-bound TLR1,2,4 and 6,Dectin1 and DC-SIGN,but not Dectin-2 or Mincle.Heat-killed T.rubrum did not significantly upregulate gene transcriptions of the PRRs of HaCaT cells.Heat-inactivated T.rubrum conidia significantly reduced the surface expression of TLR2 and Dectin-1,and suppressed the secretions of interferon-inducible protein-10 (IP-10) and monocyte chemotactic protein-1 (MCP-1) of HaCaT cells,while heat-killed T.rubrum hyphae significantly induced the secretions of IP-10 and MCP-1.Conclusion The cell-wall antigens of T.rubrum fail to activate transcriptional expression of PRRs and

  9. The protective effect of recombinant human keratinocyte growth factor on radiation-induced pulmonary toxicity in rats

    International Nuclear Information System (INIS)

    Purpose: Radiation-induced lung toxicity is a significant dose-limiting side effect of radiotherapy for thoracic tumors. Recombinant human keratinocyte growth factor (rHuKGF) has been shown to be a mitogen for type II pneumocytes. The purpose of this study was to determine whether rHuKGF prevents or ameliorates the severity of late lung damage from fractionated irradiation in a rat model. Methods and materials: Female Fisher 344 rats were irradiated to the right hemithorax with a dose of 40 Gy/5 fractions/5 days. rHuKGF at dose of 5 mg/kg or 15 mg/kg was given via a single intravenous injection 10 min after the last fraction of irradiation. Animals were followed for 6 months after irradiation. Results: The breathing rate increased beginning at 6 weeks and reached a peak at 14 weeks after irradiation. The average breathing frequencies in the irradiated groups with rHuKGF (5 mg/kg and 15 mg/kg) treatment were significantly lower than that in the group receiving radiation without rHuKGF (116.5 ± 1.0 and 115.2 ± 0.8 vs 123.5 ± 1.2 breaths/min, p < 0.01). The severity of lung fibrosis and the level of immunoreactivity of integrin αvβ6, TGFβ1, type II TGFβ receptor, Smad3, and phosphorylated Smad2/3 were significantly decreased only in the group receiving irradiation plus high-dose rHuKGF treatment compared with irradiation plus vehicle group, suggesting a dose response for the effect of rHuKGF. Conclusions: This study is the first to demonstrate that rHuKGF treatment immediately after irradiation protects against late radiation-induced pulmonary toxicity. These results suggest that restoration of the integrity of the pulmonary epithelium via rHuKGF stimulation may downregulate the TGF-β-mediated fibrosis pathway. These data also support the use of rHuKGF in a clinical trial designed to prevent radiation-induced lung injury

  10. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    Energy Technology Data Exchange (ETDEWEB)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A. (Univ. of Colorado School of Medicine, Denver (USA))

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs.

  11. Differentiation of Keratinocytes Modulates Skin HPA Analog.

    Science.gov (United States)

    Wierzbicka, Justyna M; Żmijewski, Michał A; Antoniewicz, Jakub; Sobjanek, Michal; Slominski, Andrzej T

    2017-01-01

    It is well established, that epidermal keratinocytes express functional equivalent of hypothalamus-pituitary-adrenal axis (HPA) in order to respond to changing environment and maintain internal homeostasis. We are presenting data indicating that differentiation of primary neonatal human keratinocytes (HPEKp), induced by prolonged incubation or calcium is accompanied by significant changes in the expression of the elements of skin analog of HPA (sHPA). Expression of CRF, UCN1-3, POMC, ACTH, CRFR1, CRFR2, MC1R, MC2R, and GR (coded by NR3C1 gene) were observed on gene/protein levels along differentiation of keratinocytes in culture with similar pattern seen by immunohistochemistry on full thickness skin biopsies. Expression of CRF was more pronounced in less differentiated keratinocytes, which corresponded to the detection of CRF immunoreactivity preferentially in the stratum basale. POMC expression was enhanced in more differentiated keratinocytes, which corresponded to detection of ACTH immunoreactivity, predominantly in the stratum spinosum and stratum granulosum. Expression of urocortins was also affected by induction of HPEKp differentiation. Immunohistochemical studies showed high prevalence of CRFR1 in well differentiated keratinocytes, while smaller keratinocytes showed predominantly CRFR2 immunoreactivity. MC2R mRNA levels were elevated from days 4 to 8 of in vitro incubation, while MC2R immunoreactivity was the highest in the upper layers of epidermis. Similar changes in mRNA/protein levels of sHPA elements were observed in HPEKp keratinocytes treated with calcium. Summarizing, preferential expression of CRF and POMC (ACTH) by populations of keratinocytes on different stage of differentiation resembles organization of central HPA axis suggesting their distinct role in physiology and pathology of the epidermis. J. Cell. Physiol. 232: 154-166, 2017. © 2016 Wiley Periodicals, Inc.

  12. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  13. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Science.gov (United States)

    Thompson, Benjamin C; Halliday, Gary M; Damian, Diona L

    2015-01-01

    Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV) radiation and affects DNA damage and repair. Nicotinamide (vitamin B3) reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2) solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  14. Transfection of pseudouridine-modified mRNA encoding CPD-photolyase leads to repair of DNA damage in human keratinocytes: a new approach with future therapeutic potential

    Science.gov (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; Rózsa, Dávid; Nagy, Georgina; Juhász, Attila; Juhász, István; van der Horst, Gijsbertus; Horkay, Irén; Remenyik, Éva; Karikó, Katalin; Emri, Gabriella

    2013-01-01

    UVB irradiation induces harmful photochemical reactions, including formation of cyclobutane pyrimidine dimers (CPDs) in DNA. Accumulation of unrepaired CPD lesions causes inflammation, premature ageing and skin cancer. Photolyases are DNA repair enzymes that can rapidly restore DNA integrity in a light-dependent process called photoreactivation, but these enzymes are absent in humans. Here, we present a novel mRNA-based gene therapy method that directs synthesis of a marsupial, Potorous tridactylus, CPD-photolyase in cultured human keratinocytes. Pseudouridine was incorporated during in vitro transcription to make the mRNA non-immunogenic and highly translatable. Keratinocytes transfected with lipofectamine-complexed mRNA expressed photolyase in the nuclei for at least 2 days. Exposing photolyase mRNA-transfected cells to UVB irradiation resulted in significantly less CPD in those cells that were also treated with photoreactivating light, which is required for photolyase activity. The functional photolyase also diminished other UVB-mediated effects, including induction of IL-6 and inhibition of cell proliferation. These results demonstrate that pseudouridine-containing photolyase mRNA is a powerful tool to repair UVB-induced DNA lesions. The pseudouridine-modified mRNA approach has a strong potential to discern cellular effects of CPD in UV-related cell biological studies. The mRNA-based transient expression of proteins offers a number of opportunities for future application in medicine. PMID:24211294

  15. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Science.gov (United States)

    Thompson, Benjamin C; Halliday, Gary M; Damian, Diona L

    2015-01-01

    Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV) radiation and affects DNA damage and repair. Nicotinamide (vitamin B3) reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2) solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer. PMID:25658450

  16. An Ethanol Extract Derived from Bonnemaisonia hamifera Scavenges Ultraviolet B (UVB Radiation-Induced Reactive Oxygen Species and Attenuates UVB-Induced Cell Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nam Ho Lee

    2012-12-01

    Full Text Available The present study investigated the photoprotective properties of an ethanol extract derived from the red alga Bonnemaisonia hamifera against ultraviolet B (UVB-induced cell damage in human HaCaT keratinocytes. The Bonnemaisonia hamifera ethanol extract (BHE scavenged the superoxide anion generated by the xanthine/xanthine oxidase system and the hydroxyl radical generated by the Fenton reaction (FeSO4 + H2O2, both of which were detected by using electron spin resonance spectrometry. In addition, BHE exhibited scavenging activity against the 1,1-diphenyl-2-picrylhydrazyl radical and intracellular reactive oxygen species (ROS that were induced by either hydrogen peroxide or UVB radiation. BHE reduced UVB-induced apoptosis, as shown by decreased apoptotic body formation and DNA fragmentation. BHE also attenuated DNA damage and the elevated levels of 8-isoprostane and protein carbonyls resulting from UVB-mediated oxidative stress. Furthermore, BHE absorbed electromagnetic radiation in the UVB range (280–320 nm. These results suggest that BHE protects human HaCaT keratinocytes against UVB-induced oxidative damage by scavenging ROS and absorbing UVB photons, thereby reducing injury to cellular components.

  17. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  18. Comparison between human fetal and adult skin

    OpenAIRE

    Coolen, N.A.; Schouten, K.C.; Middelkoop, E.; Ulrich, M.

    2009-01-01

    Healing of early-gestation fetal wounds results in scarless healing. Since the capacity for regeneration is probably inherent to the fetal skin itself, knowledge of the fetal skin composition may contribute to the understanding of fetal wound healing. The aim of this study was to analyze the expression profiles of different epidermal and dermal components in the human fetal and adult skin. In the human fetal skin (ranging from 13 to 22 weeks’ gestation) and adult skin biopsies, the expression...

  19. The amine-containing cutaneous irritant heptylamine inhibits the volume-regulated anion channel and mobilizes intracellular calcium in normal human epidermal keratinocytes.

    Science.gov (United States)

    Raoux, Matthieu; Colomban, Cécile; Delmas, Patrick; Crest, Marcel

    2007-06-01

    Many amines are skin irritants and cause contact dermatitis. However, little is known about their mechanisms of action in keratinocytes except that they induce the release of the inflammatory mediators cytokines and ATP. Here, we tested whether volume-regulated anion channels (VRACs) in primary cultures of normal human epidermal keratinocytes are modulated by the referenced amine-containing cutaneous irritant heptylamine. Under isotonic conditions, we isolated the VRAC current (I(VRAC)) from other conductances using a high Ca(2+)-buffering internal solution. I(VRAC) ran up after patch rupturing and reached a plateau within 15 min. It was reversibly and dose-dependently inhibited by heptylamine with an IC(50) value of 260 microM. Cell-swelling caused by the application of a hypotonic solution increased 2.7-fold I(VRAC) and reduced the inhibition of VRAC by heptylamine with a dose-response curve shifted approximately 10-fold to the right. In addition, we showed, using cell-attached patch recordings, that adding heptylamine to the bath inhibited VRAC activity. This suggests that heptylamine diffuses into the membrane to inhibit VRAC. Finally, we demonstrated that heptylamine induced Ca(2+)-store depletion and that VRAC inhibition was not caused by the increase in cytosolic Ca(2+). Taken together, these results identify heptylamine as a blocker of VRAC and suggest that Ca(2+)-store depletion may be involved in mechanisms of irritant contact dermatitis caused by heptylamine. PMID:17384225

  20. Local Treatment of Hand-Foot Syndrome with Uridine/Thymidine: In Vitro Appraisal on a Human Keratinocyte Cell Line HaCaT

    Directory of Open Access Journals (Sweden)

    J. Hartinger

    2012-01-01

    Full Text Available 5-fluorouracil (5-FU is one of the most commonly used antineoplastic drugs in the anticancer therapy. The hand-foot (HF syndrome (palmar-plantar erythrodysesthesia is an adverse effect frequently related to long-term i.v. administration of 5-FU or its orally applicable prodrug capecitabine. Its severity can even lead to interruption of the otherwise effective anticancer therapy. Tentative practice in some clinics has shown that topical application of 10% uridine ointment is beneficial for calming down the HF syndrome. This study is focused on verifying the alleged protective activity of uridine in the in vitro model of cultured human keratinocyte cell line HaCaT. We also tested the protective effects of thymidine alone or uridine-thymidine combination. The cellular viability time progression was measured in order to evaluate the effect of protective agents by three different types of cytopathogenicity tests—NTCA test (non-destructive test of cellular activity, modified MTT test and RTCA (real-time cell analyser, Roche. All three methods proved the ability of uridine and uridine-thymidine combination to protect keratinocytes against 5-FU damage in vitro. While thymidine alone did not show any remarkable effect, the thymidine-uridine combination demonstrated enhanced protective activity compared to uridine alone. Our findings provided the supporting rationale for using uridine or uridine-thymidine ointments in the HF syndrome local therapy.

  1. Inhibitory Activity of the Flower Buds of Lonicera japonica Thunb. against Histamine Production and L-Histidine Decarboxylase in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshihiro Inami

    2014-06-01

    Full Text Available In previous studies we found that anionic surfactants such as sodium laurate (SL and/or sodium dodecylsulfate (SDS exert actions on epidermal keratinocytes rather than mast cells to give rise of histamine production and skin itching through increasing the expression of the 53-kDa active form of l-histidine decarboxylase (HDC. In addition, with treatment of SL in a three-dimensional human keratinocyte culture, increases in both the 53-kDa HDC and histamine production are detected and thus this culture assay is applied to screen anti-itching materials from natural resources. In this study, the inhibitory activity of “Kin-gin-ka” (flower buds of Lonicera japonica Thunb., FLJ against histamine production and expression of the active form of HDC were examined in this culture assay. FLJ is a well-known traditional Chinese medicine, being used to treat fevers, coughs and some infectious diseases. The result showed both FLJ and chlorogenic acid had inhibitory activities against the expression of 53-kDa HDC and histamine production. However, chlorogenic acid showed a weaker effect on histamine production than that of FLJ, suggesting that other chemical constituents besides chlorogenic acid could contribute to the inhibitory activities. Thus, a further chemical study of FLJ is now under investigation.

  2. Anti-Inflammatory Effects of Concentrated Ethanol Extracts of Edelweiss (Leontopodium alpinum Cass. Callus Cultures towards Human Keratinocytes and Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Lulli Daniela

    2012-01-01

    Full Text Available Edelweiss (Leontopodium alpinum Cass. is traditionally employed in folk medicine as an anti-inflammatory remedy. In nature, the plant is sparsely available and protected; therefore production of callus cultures was established. A concentrated ethanolic extract of culture homogenate, with leontopodic acid representing 55±2% of the total phenolic fraction (ECC55, was characterized for anti-inflammatory properties in primary human keratinocytes (PHKs and endotheliocytes (HUVECs. Inflammatory responses were induced by UVA+UVB, lipopolysaccharide (LPS, oxidized low-density lipoprotein (oxLDL, and a mixture of proinflammatory cytokines. Trichostatin A, a sirtuin inhibitor, was used to induce keratinocyte inflammatory senescence. ECC55 (10–50 μg/mL protected PHK from solar UV-driven damage, by enhancing early intracellular levels of nitric oxide, although not affecting UV-induced expression of inflammatory genes. Comparison of the dose-dependent inhibition of chemokine (IL-8, IP-10, MCP-1 and growth factor (GM-CSF release from PHK activated by TNFα + IFNγ showed that leontopodic acid was mainly responsible for the inhibitory effects of ECC55. Sirtuin-inhibited cell cycle, proliferation, and apoptosis markers were restored by ECC55. The extract inhibited LPS-induced IL-6 and VCAM1 genes in HUVEC, as well as oxLDL-induced selective VCAM1 overexpression. Conclusion. Edelweiss cell cultures could be a valuable source of anti-inflammatory substances potentially applicable for chronic inflammatory skin diseases and bacterial and atherogenic inflammation.

  3. Effects of in vitro UVA irradiation and PUVA treatment on membrane fatty acids and activities of antioxidant enzymes in human keratinocytes

    International Nuclear Information System (INIS)

    Human Keratinocytes (NCTC 2544) in culture were exposed to either plain ultraviolet A (UVA) irradiation or to 8-methoxypsoralen plus UVA (PUVA) treatment. Lipid peroxidation, activities of antioxidant enzymes, and percentage amounts of 14C-arachidonic acid in various cellular lipid subclasses and in the culture medium were measured. Both UVA irradiation and PUVA treatment induced significant changes in the distribution of arachidonic acid and increased the liberation of arachidonic acid from membrane phospholipids. At 24 h after either UVA irradiation or PUVA treatment the formation of thiobarbituric acid reactive material was significantly increased, whereas the amount of conjugated dienes was unaffected. The activities of the antioxidant enzymes, catalase and superoxide dismutase, were already significantly decreased at 0.5 h after UVA irradiation or PUVA treatment. The enzyme activities were partially restored during the following 24 h incubation. From the present study, we suggest that in keratinocytes both plain UVA irradiation and PUVA treatment induce changes in the distribution of membrane fatty acids and cause an impairment in the enzymic defense system against oxidative stress

  4. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    Energy Technology Data Exchange (ETDEWEB)

    Mera, Kentaro [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Kawahara, Ko-ichi [Department of Laboratory and Vascular Medicine Cardiovascular and Respiratory Disorders Advanced Therapeutics, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Tada, Ko-ichi; Kawai, Kazuhiro [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Hashiguchi, Teruto; Maruyama, Ikuro [Department of Laboratory and Vascular Medicine Cardiovascular and Respiratory Disorders Advanced Therapeutics, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Kanekura, Takuro, E-mail: takurok@m2.kufm.kagoshima-u.ac.jp [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan)

    2010-06-25

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-L{alpha}, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm{sup 2} irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm{sup 2} UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  5. Effect of the antipsoriatic drug metabolite etretin (Ro 10-1670) on UVB irradiation induced changes in the metabolism of arachidonic acid in human keratinocytes in culture

    Energy Technology Data Exchange (ETDEWEB)

    Punnonen, K.; Jansen, C.T.; Puustinen, T.

    1986-11-01

    (/sup 14/C)Arachidonic acid was avidly incorporated into human keratinocytes in culture and following exposure to UVB irradiation of 9 mJ/cm/sup 2/ (erythemally effective, EE) substantial amounts of /sup 14/C-radiolabel were released from the cells. The release of radiolabel was accompanied by a decrease in the labelling of phosphatidylethanolamine whereas the labelling of triacylglycerols and cholesteryl esters was increased. Keratinocytes produced significant amounts of prostaglandin E/sub 2/ (PGE/sub 2/) and following UVB irradiation of 9 mJ/cm/sup 2/ (EE) the formation of prostaglandin E/sub 2/ was increased. Etretin (Ro 10-1670), the active metabolite of the antipsoriatic drug etretinate (Ro 10-9359), affected significantly neither the total release of radiolabel induced by UVB nor the formation of prostaglandin E/sub 2/. However, in the presence of etretin the UVB irradiation induced transfer of (/sup 14/C)arachidonic acid into triacylglycerols and cholesteryl esters was not increased as much as in the corresponding experiments without etretin. On the basis of the present study it appears that etretin dose not interfere with the release of arachidonic acid in amounts which could be related to the therapeutic effects of the combination of retinoids with UVB irradiation (Re-UVB) in the treatment of psoriasis.

  6. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  7. AP-2α Inhibits c-MYC Induced Oxidative Stress and Apoptosis in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Lei Yu

    2009-01-01

    AP-2 may have a direct effect on the c-myc gene. Chromatin immunoprecipitation assays demonstrated that AP-2 proteins bound to a cluster of AP-2 binding sites located within a 2 kb upstream regulatory region of c-myc These results suggest that the negative regulation of AP-2 on c-MYC activity was achieved through binding of AP-2 protein to the c-myc gene. The effects of AP-2 on c-MYC induced ROS accumulation and apoptosis in epidermal keratinocytes are likely to play an important role in cell growth, differentiation and carcinogenesis of the skin.

  8. Xenobiotic metabolism capacities of human skin in comparison with a 3D epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: activating enzymes (Phase I).

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Blatz, Veronika; Jäckh, Christine; Freytag, Eva-Maria; Fabian, Eric; Landsiedel, Robert; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    Skin is important for the absorption and metabolism of exposed chemicals such as cosmetics or pharmaceuticals. The Seventh Amendment to the EU Cosmetics Directive prohibits the use of animals for cosmetic testing for certain endpoints, such as genotoxicity; therefore, there is an urgent need to understand the xenobiotic metabolizing capacities of human skin and to compare these activities with reconstructed 3D skin models developed to replace animal testing. We have measured Phase I enzyme activities of cytochrome P450 (CYP) and cyclooxygenase (COX) in ex vivo human skin, the 3D skin model EpiDerm™ (EPI-200), immortalized keratinocyte-based cell lines and primary normal human epidermal keratinocytes. Our data demonstrate that basal CYP enzyme activities are very low in whole human skin and EPI-200 as well as keratinocytes. In addition, activities in monolayer cells differed from organotypic tissues after induction. COX activity was similar in skin, EPI-200 and NHEK cells, but was significantly lower in immortalized keratinocytes. Hence, the 3D model EPI-200 might represent a more suitable model for dermatotoxicological studies. Altogether, these data help to better understand skin metabolism and expand the knowledge of in vitro alternatives used for dermatotoxicity testing. PMID:22509833

  9. Cultured keratinocyte grafting on various biologic matrices

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    Objective: To make attempts to use cell constructs from subconfluent keratinocyte cultures, which contain a much glue (TissucollR) and directly applied onto full thickness wounds in athymic mice or combined with allogenic split thickness overgrafts and compared with cultured sheet grafts. This keratinocyte fibrin glue suspension (KFGS) has also been used in burns up to 88% burned TBSA as well as in chronic wounds. Keratinocytes were also seeded onto various biomaterials (BiobraneR, HYAFF LaserskinR, IntegraTM, TissuFascieR) as carriers. Results: Human suspended keratinocytes were effective to reorganize to skin in vivo both in nude mice and in patients and superior if compared to sheet grafts. 3~ 5 d after seeding onto various biomaterials, cell reached subconfluence and were ready for grafting. These cell-membrane constructs were always tured on microspheres in spinner cultures could increase the cell yield, and the subconfluently covered microspheres were directly grafted onto" the wound. Conclusion: These experiments demonstrated that keratinocytes can grow on a variety of carrier materials in vitro and these cell constructs were able to spontaneously reform a multilayer neoepithelium in vivo. The current screening looks for the ideal carrier for keratinocytes that also would serve as a temporary wound cover and induce dermis formation by tissue conduction which further may be enhanced by gene therapy.

  10. Opposed arsenite-mediated regulation of p53-survivin is involved in neoplastic transformation, DNA damage, or apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: ► Different concentrations of arsenite cause biphasic effects in HaCaT cells. ► p53-survivin signal pathway plays a role in arsenite-induced biphasic effects. ► ERKs inactivate p53, but improve survivin expression by NF-κB/mot-2. ► JNKs block survivin expression by preventing p53 from mdm2-mediated degradation. ► ERKs and JNKs play roles in arsenite-induced biphasic effects. -- Abstract: Biphasic dose–response relationship induced by environmental agents is often characterized with the effect of low-dose stimulation and high dose inhibition. Some studies showed that arsenite may induce cell proliferation and apoptosis via biphasic dose–response relationship in human cells; however, mechanisms underlying this phenomenon are not well understood. Our present study shows that, for human keratinocytes (HaCaT) cells, a low concentration of arsenite activates extracellular signal-regulated kinases (ERKs), which leads to up-regulation of nuclear factor κB (NF-κB) binding to DNA and to elevated, NF-κB-dependent expression of mot-2 (a p53 inhibitor) and survivin (an inhibitor of apoptosis). Activation of p53 is blocked, and neoplastic transformation is enhanced. Inhibition of ERKs reduces cell proliferation and neoplastic transformation. In contrast, a high concentration of arsenite activates c-Jun N-terminal kinases (JNKs), positive regulators of p53, by binding to p53 and preventing its murine double minute 2 (mdm2)-mediated degradation. The elevated levels of p53 lead to repair of DNA damage and apoptosis. Inhibition of JNKs increases DNA damage but decreases apoptosis. By identifying a mechanism whereby ERKs and JNKs-mediated regulation of the p53-survivin signal pathway is involved in the biphasic effects of arsenite on human keratinocytes, our data expand understanding of arsenite-induced cell proliferation, neoplastic transformation, DNA damage, and apoptosis.

  11. Antimicrobial agent triclosan is a proton ionophore uncoupler of mitochondria in living rat and human mast cells and in primary human keratinocytes.

    Science.gov (United States)

    Weatherly, Lisa M; Shim, Juyoung; Hashmi, Hina N; Kennedy, Rachel H; Hess, Samuel T; Gosse, Julie A

    2016-06-01

    Triclosan (TCS) is an antimicrobial used widely in hospitals and personal care products, at ~10 mm. Human skin efficiently absorbs TCS. Mast cells are ubiquitous key players both in physiological processes and in disease, including asthma, cancer and autism. We previously showed that non-cytotoxic levels of TCS inhibit degranulation, the release of histamine and other mediators, from rat basophilic leukemia mast cells (RBL-2H3), and in this study, we replicate this finding in human mast cells (HMC-1.2). Our investigation into the molecular mechanisms underlying this effect led to the discovery that TCS disrupts adenosine triphosphate (ATP) production in RBL-2H3 cells in glucose-free, galactose-containing media (95% confidence interval EC50 = 7.5-9.7 µm), without causing cytotoxicity. Using these same glucose-free conditions, 15 µm TCS dampens RBL-2H3 degranulation by 40%. The same ATP disruption was found with human HMC-1.2 cells (EC50 4.2-13.7 µm), NIH-3 T3 mouse fibroblasts (EC50 4.8-7.4 µm) and primary human keratinocytes (EC50 3.0-4.1 µm) all with no cytotoxicity. TCS increases oxygen consumption rate in RBL-2H3 cells. Known mitochondrial uncouplers (e.g., carbonyl cyanide 3-chlorophenylhydrazone) previously were found to inhibit mast cell function. TCS-methyl, which has a methyl group in place of the TCS ionizable proton, affects neither degranulation nor ATP production at non-cytotoxic doses. Thus, the effects of TCS on mast cell function are due to its proton ionophore structure. In addition, 5 µm TCS inhibits thapsigargin-stimulated degranulation of RBL-2H3 cells: further evidence that TCS disrupts mast cell signaling. Our data indicate that TCS is a mitochondrial uncoupler, and TCS may affect numerous cell types and functions via this mechanism. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26204821

  12. Germacrane sesquiterpenes isolated from the rhizome of Curcuma xanthorrhiza Roxb. inhibit UVB-induced upregulation of MMP-1, -2, and -3 expression in human keratinocytes.

    Science.gov (United States)

    Park, Ji-Hae; Mohamed, Mohamed Antar Aziz; Jung, Ye-Jin; Shrestha, Sabina; Lee, Tae Hoon; Lee, Chang-Ho; Han, Daeseok; Kim, Jiyoung; Baek, Nam-In

    2015-10-01

    Four sesquiterpenes were isolated from the rhizome of Curcuma xanthorrhiza Roxb.: furanodiene (1), germacrone (2), furanodienone (3), and 13-hydroxygermacrone (4). Importantly, this was the first time compounds 1 and 4 were isolated from this plant. The chemical structures of these compounds were determined using 1D- and 2D-nuclear magnetic resonance, infrared spectroscopy, and electron ionization mass spectrometry analyses. Among the isolated compounds, compounds 2 and 4 inhibited UVB-induced upregulation of the mRNA and protein expression levels of MMP-1, MMP-2, and MMP-3 in human keratinocytes (HaCaT). Moreover, this upregulation occurred in a dose-dependent manner over the range of 1-10 μM for each compound.

  13. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  14. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes.

    Science.gov (United States)

    Pattarachotanant, Nattaporn; Rakkhitawatthana, Varaporn; Tencomnao, Tewin

    2014-01-01

    Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17), was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3). The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis. PMID:25435888

  15. The Inflammasome and the Epidermal Growth Factor Receptor (EGFR Are Involved in the Staphylococcus aureus-Mediated Induction of IL-1alpha and IL-1beta in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Maren Simanski

    Full Text Available Staphylococcus (S. aureus is an important pathogen causing various infections including those of the skin. Keratinocytes are able to sense invading S. aureus and to initiate a fast defense reaction by the rapid release of innate defense mediators such as antimicrobial peptides and cytokines. There is increasing evidence that the cytokines IL-1alpha and IL-1beta, which both signal through the IL-1 receptor, play an important role in cutaneous defense against S. aureus. The aim of this study was to gain more insight into the underlying mechanisms leading to the S. aureus-induced IL-1alpha and IL-1beta expression in keratinocytes. Infection of human primary keratinocytes with S. aureus led to the induction of gene expression and protein secretion of IL-1alpha and IL-1beta. Full S. aureus-induced IL-1 protein release required the inflammasome components caspase-1 and ASC (apoptosis-associated speck-like protein containing a CARD whereas gene induction of IL-1alpha and IL-beta by S. aureus was not dependent on caspase-1 and ASC. Since patients receiving anti-cancer therapy by inhibition of the epidermal growth factor receptor (EGFR often suffer from skin infections caused by S. aureus we additionally evaluated whether the EGFR pathway may be involved in the IL-1alpha and IL-1beta induction by S. aureus. Inactivation of the EGFR with a blocking antibody decreased the S. aureus-mediated IL-1alpha and IL-1beta induction in primary keratinocytes. Moreover, the use of siRNA experiments revealed that ADAM17 (A Disintegrin and A Metalloprotease 17, a metalloproteinase known to mediate the shedding and release of EGFR ligands, was required for full induction of IL-1alpha and IL-1beta in keratinocytes infected with S. aureus. A failure of keratinocytes to adequately upregulate IL-1alpha and IL-1beta may promote S. aureus skin infections.

  16. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    Science.gov (United States)

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  17. TiO{sub 2} nanoparticles alleviate toxicity by reducing free Zn{sup 2+} ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kathawala, Mustafa Hussain; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)

    2015-06-15

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO{sub 2}) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO{sub 2}, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO{sub 2} was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml{sup −1} after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO{sub 2} nanoparticles which remained non-toxic until very high concentrations. It was found that TiO{sub 2} nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO{sub 2} nanoparticles caused an attenuation of free intracellular Zn{sup 2+} ions concentration, by adsorbing and immobilizing free Zn{sup 2+} ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  18. Concurrence of replicative senescence and elevated expression of p16(INK4A) with subculture-induced but not calcium-induced differentiation in normal human oral keratinocytes.

    Science.gov (United States)

    Lee, G; Park, B S; Han, S E; Oh, J E; You, Y O; Baek, J H; Kim, G S; Min, B M

    2000-10-01

    Primary normal human oral keratinocytes (NHOKs) undergo differentiation in the presence of calcium concentrations higher than 0.15 mM in vitro, which is useful in investigating the mechanisms involved in the differentiation of epithelial cells. Serial subculture of NHOKs to the postmitotic stage also induces terminal differentiation. However, the detailed mechanisms of both differentiation processes remain substantially unknown. To investigate the molecular differences in these processes, NHOKs were induced to differentiate by exposure to 1.2 mM of calcium and by serial subculture to the postmitotic stage. To study whether the cells were induced to differentiate and to undergo replicative senescence, the amount of cellular involucrin and the expression of senescence-associated beta-galactosidase (SA-beta-gal) were measured respectively. The expression of replicative senescence-associated genes and the activity of telomerase from the differentiated cells were also determined. Both calcium treatment and serial subculture to the postmitotic stage notably elevated the cellular involucrin. The percentage of SA-beta-gal-positive cells was significantly elevated by the continued subculture, but such changes were not observed in keratinocytes exposed to calcium. The concentration of cellular p16(INK4A) protein was progressively increased by the continued subculture but was not changed by calcium treatment. On the other hand, the concentrations of cellular p53 were similar in both differentiation processes. However, telomerase activity was lost in NHOKs that had undergone differentiation by both calcium treatment and serial subculture. The results indicate that calcium-induced differentiation of NHOKs has similar characteristics to their serial subculture-induced differentiation, but that the differentiation processes are not identical, because calcium-induced differentiation does not concur with either replicative senescence or the gradually increased concentration of p16

  19. Combination of low calcium with Y-27632 rock inhibitor increases the proliferative capacity, expansion potential and lifespan of primary human keratinocytes while retaining their capacity to differentiate into stratified epidermis in a 3D skin model.

    Directory of Open Access Journals (Sweden)

    Xanthe L Strudwick

    Full Text Available Human keratinocytes are difficult to isolate and have a limited lifespan. Traditionally, immortalised keratinocyte cell lines are used in vitro due to their ability to bypass senescence and survive indefinitely. However these cells do not fully retain their ability to differentiate in vitro and they are unable to form a normal stratum corneum in organotypic culture. Here we aimed to generate a pool of phenotypically similar keratinocytes from human donors that could be used in monolayer culture, without a fibroblast feeder layer, and in 3D human skin equivalent models. Primary human neonatal epidermal keratinocytes (HEKn were cultured in low calcium, (0.07 mM media, +/-10 μM Y-27632 ROCK inhibitor (HEKn-CaY. mRNA and protein was extracted and expression of differentiation markers Keratin 14 (K14, Keratin 10 (K10 and Involucrin (Inv assessed by qRT-PCR and Western blotting. The differentiation potential of the HEKn-CaY cultures was assessed by increasing calcium levels and removing the Y-27632 for 72 hrs prior to assessment of K14, K10 and Inv. The ability of the HEKn-CaY, to form a stratified epithelium was assessed using a human skin equivalent (HSE model in the absence of Y-27632. Increased proliferative capacity, expansion potential and lifespan of HEKn was observed with the combination of low calcium and 10 μM ROCK inhibitor Y-27632. The removal of Y-27632 and the addition of high calcium to induce differentiation allowed the cells to behave as primary keratinocytes even after extended serial passaging. Prolonged lifespan HEK-CaYs were capable of forming an organised stratified epidermis in 3D HSE cultures, demonstrating their ability to fully stratify and retain their original, primary characteristics. In conclusion, the use of 0.07 mM Calcium and 10 μM Y-27632 in HEKn monocultures provides the opportunity to culture primary human keratinocytes without a cell feeder layer for extended periods of culture whilst retaining their ability to

  20. Differential Influence of Components Resulting from Atmospheric-Pressure Plasma on Integrin Expression of Human HaCaT Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beate Haertel

    2013-01-01

    Full Text Available Adequate chronic wound healing is a major problem in medicine. A new solution might be non-thermal atmospheric-pressure plasma effectively inactivating microorganisms and influencing cells in wound healing. Plasma components as, for example, radicals can affect cells differently. HaCaT keratinocytes were treated with Dielectric Barrier Discharge plasma (DBD/air, DBD/argon, ozone or hydrogen peroxide to find the components responsible for changes in integrin expression, intracellular ROS formation or apoptosis induction. Dependent on plasma treatment time reduction of recovered cells was observed with no increase of apoptotic cells, but breakdown of mitochondrial membrane potential. DBD/air plasma increased integrins and intracellular ROS. DBD/argon caused minor changes. About 100 ppm ozone did not influence integrins. Hydrogen peroxide caused similar effects compared to DBD/air plasma. In conclusion, effects depended on working gas and exposure time to plasma. Short treatment cycles did neither change integrins nor induce apoptosis or ROS. Longer treatments changed integrins as important for influencing wound healing. Plasma effects on integrins are rather attributed to induction of other ROS than to generation of ozone. Changes of integrins by plasma may provide new solutions of improving wound healing, however, conditions are needed which allow initiating the relevant influence on integrins without being cytotoxic to cells.

  1. Sphingomyelinase D from Loxosceles laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis.

    Science.gov (United States)

    Corrêa, Mara A; Okamoto, Cinthya K; Gonçalves-de-Andrade, Rute M; van den Berg, Carmen W; Tambourgi, Denise V

    2016-01-01

    Envenomation by Loxosceles spider is characterized by the development of dermonecrosis. In previous studies, we have demonstrated that increased expression/secretion of matrix metalloproteinases 2 and 9, induced by Loxosceles intermedia venom Class 2 SMases D (the main toxin in the spider venom), contribute to the development of cutaneous loxoscelism. In the present study we show that the more potent venom containing the Class 1 SMase D from Loxosceles laeta, in addition to increasing the expression/secretion of MMP2 and MMP9, also stimulates the expression of MMP7 (Matrilysin-1), which was associated with keratinocyte cell death. Tetracycline, a matrix metalloproteinase inhibitor, prevented cell death and reduced MMPs expression. Considering that L. laeta venom is more potent at inducing dermonecrosis than L. intermedia venom, our results suggest that MMP7 may play an important role in the severity of dermonecrosis induced by L. laeta spider venom SMase D. In addition, the inhibition of MMPs by e.g. tetracyclines may be considered for the treatment of the cutaneous loxoscelism.

  2. Sphingomyelinase D from Loxosceles laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis

    Science.gov (United States)

    Corrêa, Mara A.; Okamoto, Cinthya K.; Gonçalves-de-Andrade, Rute M.; van den Berg, Carmen W.; Tambourgi, Denise V.

    2016-01-01

    Envenomation by Loxosceles spider is characterized by the development of dermonecrosis. In previous studies, we have demonstrated that increased expression/secretion of matrix metalloproteinases 2 and 9, induced by Loxosceles intermedia venom Class 2 SMases D (the main toxin in the spider venom), contribute to the development of cutaneous loxoscelism. In the present study we show that the more potent venom containing the Class 1 SMase D from Loxosceles laeta, in addition to increasing the expression/secretion of MMP2 and MMP9, also stimulates the expression of MMP7 (Matrilysin-1), which was associated with keratinocyte cell death. Tetracycline, a matrix metalloproteinase inhibitor, prevented cell death and reduced MMPs expression. Considering that L. laeta venom is more potent at inducing dermonecrosis than L. intermedia venom, our results suggest that MMP7 may play an important role in the severity of dermonecrosis induced by L. laeta spider venom SMase D. In addition, the inhibition of MMPs by e.g. tetracyclines may be considered for the treatment of the cutaneous loxoscelism. PMID:27078876

  3. The transcriptional regulator gene E2 of the Human Papillomavirus (HPV) 16 influences the radiosensitivity of cervical keratinocytes

    International Nuclear Information System (INIS)

    Clinical studies have demonstrated that HPV induced tumors constitute a specific subclass of cancer with a better response to radiation treatment. The purpose of this study was to investigate meaning of viral E2-gene for radiosensitivity. W12 cells contain episomal HPV 16 genomes, whereas S12 cells, which derive from the W12 line, contain HPV DNA as integrated copies. Clonogenic survival was analyzed using 96-well in vitro test. Using flow cytometry cell cycle analyses were performed. Expression of pRb and p53 were analyzed using intracellular staining. W12 cells (intact E2 gene) showed a lower survival fraction than S12 cells. W12 cells developed a G2/M block 24 h after irradiation with 2 Gy whereas S12 showed no G2/M bloc. After irradiation S12 cells developed polyploidy and pRb-positive cells decreased. W12 cells showed no change of pRb-positive cells. Depending on E2 gene status differences in cell cycle regulation might cause radioresistance. The E2/E7/pRb pathway seems to influence HPV-induced radiosensitivity. Our experiments demonstrated an effect of HPV on radiosensitivity of cervical keratinocytes via viral transcription regulator E2 pathway

  4. Sphingomyelinase D from Loxosceles laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis.

    Science.gov (United States)

    Corrêa, Mara A; Okamoto, Cinthya K; Gonçalves-de-Andrade, Rute M; van den Berg, Carmen W; Tambourgi, Denise V

    2016-01-01

    Envenomation by Loxosceles spider is characterized by the development of dermonecrosis. In previous studies, we have demonstrated that increased expression/secretion of matrix metalloproteinases 2 and 9, induced by Loxosceles intermedia venom Class 2 SMases D (the main toxin in the spider venom), contribute to the development of cutaneous loxoscelism. In the present study we show that the more potent venom containing the Class 1 SMase D from Loxosceles laeta, in addition to increasing the expression/secretion of MMP2 and MMP9, also stimulates the expression of MMP7 (Matrilysin-1), which was associated with keratinocyte cell death. Tetracycline, a matrix metalloproteinase inhibitor, prevented cell death and reduced MMPs expression. Considering that L. laeta venom is more potent at inducing dermonecrosis than L. intermedia venom, our results suggest that MMP7 may play an important role in the severity of dermonecrosis induced by L. laeta spider venom SMase D. In addition, the inhibition of MMPs by e.g. tetracyclines may be considered for the treatment of the cutaneous loxoscelism. PMID:27078876

  5. Ascorbic Acid, Ultraviolet C Rays, and Glucose but not Hyperthermia Are Elicitors of Human β-Defensin 1 mRNA in Normal Keratinocytes

    Directory of Open Access Journals (Sweden)

    Luis Antonio Cruz Díaz

    2015-01-01

    Full Text Available Hosts’ innate defense systems are upregulated by antimicrobial peptide elicitors (APEs. Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA, and ultraviolet C rays (UVC as well as glucose and ascorbic acid (AA on the regulation of human β-defensin 1 (DEFB1, cathelicidin (CAMP, and interferon-γ (IFNG genes in normal human keratinocytes (NHK. The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C and hyperthermia (39°C are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections.

  6. Chitin modulates innate immune responses of keratinocytes.

    Directory of Open Access Journals (Sweden)

    Barbara Koller

    Full Text Available BACKGROUND: Chitin, after cellulose the second most abundant polysaccharide in nature, is an essential component of exoskeletons of crabs, shrimps and insects and protects these organisms from harsh conditions in their environment. Unexpectedly, chitin has been found to activate innate immune cells and to elicit murine airway inflammation. The skin represents the outer barrier of the human host defense and is in frequent contact with chitin-bearing organisms, such as house-dust mites or flies. The effects of chitin on keratinocytes, however, are poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We hypothesized that chitin stimulates keratinocytes and thereby modulates the innate immune response of the skin. Here we show that chitin is bioactive on primary and immortalized keratinocytes by triggering production of pro-inflammatory cytokines and chemokines. Chitin stimulation further induced the expression of the Toll-like receptor (TLR TLR4 on keratinocytes at mRNA and protein level. Chitin-induced effects were mainly abrogated when TLR2 was blocked, suggesting that TLR2 senses chitin on keratinocytes. CONCLUSIONS/SIGNIFICANCE: We speculate that chitin-bearing organisms modulate the innate immune response towards pathogens by upregulating secretion of cytokines and chemokines and expression of MyD88-associated TLRs, two major components of innate immunity. The clinical relevance of this mechanism remains to be defined.

  7. UV-B Radiation Induces Macrophage Migration Inhibitory Factor–Mediated Melanogenesis through Activation of Protease-Activated Receptor-2 and Stem Cell Factor in Keratinocytes

    OpenAIRE

    Enomoto, Akiko; Yoshihisa, Yoko; Yamakoshi, Takako; Ur Rehman, Mati; Norisugi, Osamu; HARA Hiroshi; Matsunaga, Kenji; Makino, Teruhiko; Nishihira, Jun; Shimizu, Tadamichi

    2011-01-01

    UV radiation indirectly regulates melanogenesis in melanocytes through a paracrine regulatory mechanism involving keratinocytes. Protease-activated receptor (PAR)-2 activation induces melanosome transfer by increasing phagocytosis of melanosomes by keratinocytes. This study demonstrated that macrophage migration inhibitory factor (MIF) stimulated PAR-2 expression in human keratinocytes. In addition, we showed that MIF stimulated stem cell factor (SCF) release in keratinocytes; however, MIF ha...

  8. APR-246/PRIMA-1MET rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations

    OpenAIRE

    Shen, Jinfeng; van den Bogaard, Ellen H.; Kouwenhoven, Evelyn N.; Vladimir J.N. Bykov; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S.; Gilissen, Christian; Van Heeringen, Simon J.; Schalkwijk, Joost; Van Bokhoven, Hans; Wiman, Klas G.; Zhou, Huiqing

    2013-01-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patien...

  9. Papain Degrades Tight Junction Proteins of Human Keratinocytes In Vitro and Sensitizes C57BL/6 Mice via the Skin Independent of its Enzymatic Activity or TLR4 Activation

    OpenAIRE

    Stremnitzer, Caroline; Manzano-Szalai, Krisztina; Willensdorfer, Anna; Starkl, Philipp(*); Pieper, Mario; König, Peter; Mildner, Michael; Tschachler, Erwin; Reichart, Ursula; Jensen-Jarolim, Erika

    2015-01-01

    Papain is commonly used in food, pharmaceutical, textile, and cosmetic industries and is known to induce occupational allergic asthma. We have previously shown that the papain-like cysteine protease Dermatophagoides pteronyssinus 1 from house dust mite exhibits percutaneous sensitization potential. We aimed here to investigate the potential of papain itself in epicutaneous sensitization. The effects of papain on tight junction (TJ) proteins were tested in vitro in human primary keratinocytes....

  10. Adipose derived mesenchymal stem cells express keratinocyte lineage markers in a co-culture model.

    Science.gov (United States)

    Irfan-Maqsood, M; Matin, M M; Heirani-Tabasi, A; Bahrami, M; Naderi-Meshkin, H; Mirahmadi, M; Hassanzadeh, H; Sanjar Moussavi, N; Raza-Shah, H; Raeesolmohaddeseen, M; Bidkhori, H; Bahrami, A R

    2016-01-01

    Cutaneous wound healing is a complex type of biological event involving proliferation, differentiation, reprograming, trans/de-differentiation, recruitment, migration, and apoptosis of a number of cells (keratinocytes, fibroblasts, endothelial cells, nerve cells and stem cells) to regenerate a multi-layered tissue that is damaged by either internal or external factors. The exact regeneration mechanism of damaged skin is still unknown but the epithelial and other kinds of stem cells located in skin play crucial roles in the healing process. In this work, a co-culture model composed of adipose derived mesenchymal stem cells and keratinocytes was developed to understand the cellular differentiation behaviour in wound healing. Human mesenchymal stem cells were isolated from waste lipoaspirates. Keratinocytes were isolated from neonatal rats skin as well from human adult skin. Both types of cells were cultured and their culturing behaviour was observed microscopically under regular intervals of time. The identity of both cells was confirmed by flow cytometry and qRT-PCR. Cells were co-cultured under the proposed co-culturing model and the model was observed for 7, 14 and 21 days. The cellular behaviour was studied based on change in morphology, colonization, stratification, migration and expression of molecular markers. Expression of molecular markers was studied at transcriptional level and change in cellular morphology and migration capabilities was observed under the invert microscope regularly. Successfully isolated and characterized mesenchymal stem cells were found to express keratinocyte lineage markers i.e. K5, K10, K14, K18, K19 and Involucrin when co-cultured with keratinocytes after 14 and 21 days. Their expression was found to increase by increasing the time span of cell culturing. The keratinocyte colonies started to disappear after 10 days of culturing which might be due to stratification process initiated by possibly transdifferentiated stem cells. It can

  11. The oxidation of p-phenylenediamine, an ingredient used for permanent hair dyeing purposes, leads to the formation of hydroxyl radicals: Oxidative stress and DNA damage in human immortalized keratinocytes.

    Science.gov (United States)

    Zanoni, Thalita B; Hudari, Felipe; Munnia, Armelle; Peluso, Marco; Godschalk, Roger W; Zanoni, Maria Valnice B; den Hartog, Gertjan J M; Bast, Aalt; Barros, Silvia B M; Maria-Engler, Silvya S; Hageman, Geja J; de Oliveira, Danielle Palma

    2015-12-15

    The hair-dyeing ingredient, p-phenylenediamine (PPD), was previously reported to be mutagenic, possibly by inducing oxidative stress. However, the exact mechanism of PPD in inducing oxidative stress upon skin exposure during hair-dyeing in human keratinocytes remains unknown. The aim of our studies was therefore to investigate the toxicity of PPD and its by-products in human immortalized keratinocytes (HaCaT) after auto-oxidation and after reaction with hydrogen peroxide (H2O2). We found that the PPD half maximal effective cytotoxic concentration (EC50) to HaCaT is 39.37 and 35.63 μg/mL after 24 and 48 h, respectively, without addition of H2O2 to induce oxidation. When PPD (10 or 100 μg/mL) is combined with 10.5 μg/mL of H2O2, intracellular ROS production by HaCaT after 1 h was significantly increased and enhanced levels of DNA damage were observed after 4 h of exposure. After 24 h incubations, 20 μg/mL of PPD increased the level of DNA oxidation in HaCaT. Also, we found that the in vitro reaction between PPD and H2O2, even below the maximum allowance by cosmetic industries, released hydroxyl radicals which can damage DNA. Taken together, we conclude that PPD alone and when combined with H2O2 increases the formation of reactive oxygen species in human keratinocytes, leading to oxidative stress and subsequent DNA damage. These alterations suggest that the mechanism by which PPD exposure, alone or combined with H2O2, damages keratinocytes by the formation of the high reactive HO∙ radicals. PMID:26456176

  12. Cytotoxicity and Proliferation Studies with Arsenic in Established Human Cell Lines: Keratinocytes, Melanocytes, Dendritic Cells, Dermal Fibroblasts, Microvascular Endothelial Cells, Monocytes and T-Cells

    Directory of Open Access Journals (Sweden)

    Hari H. P. Cohly

    2003-01-01

    Full Text Available Abstract: Based on the hypothesis that arsenic exposure results in toxicity and mitogenecity, this study examined the dose-response of arsenic in established human cell lines of keratinocytes (HaCaT, melanocytes (1675, dendritic cells (THP-1/A23187, dermal fibroblasts (CRL1904, microvascular endothelial cells (HMEC, monocytes (THP-1, and T cells (Jurkat. Cytotoxicity was determined by incubating THP-1, THP-1+ A23187 and JKT cells in RPMI 1640, 1675 in Vitacell, HMEC in EBM, and dermal fibroblasts and HaCaT in DMEM with 10% fetal bovine serum, 1% streptomycin and penicillin for 72 hrs in 96-well microtiter plates, at 37oC in a 5% CO2 incubator with different concentrations of arsenic using fluorescein diacetate (FDA. Cell proliferation in 96-well plates was determined in cultured cells starved by prior incubation for 24 hrs in 1% FBS and exposed for 72 hours, using the 96 cell titer proliferation solution (Promega assay. Cytotoxicity assays yielded LD50s of 9 μg/mL for HaCaT, 1.5 μg/mL for CRL 1675, 1.5 μg/mL for dendritic cells, 37 μg/mL for dermal fibroblasts, 0.48 μg/mL for HMEC, 50 μg/mL for THP-1 cells and 50 μg/mL for JKT-T cells. The peak proliferation was observed at 6 μg/mL for HaCaT and THP-1 cells, 0.19 μg/mL for CRL 1675, dendritic cells, and HMEC, and 1.5 μg/mL for dermal fibroblasts and Jurkat T cells. These results show that arsenic is toxic at high doses to keratinocytes, fibroblasts, monocytes and T cells, and toxic at lower doses to melanocytes, microvascular endothelial cells and dendritic cells. Proliferation studies showed sub-lethal doses of arsenic to be mitogenic.

  13. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  14. Antioxidant and Anti-Inflammatory Effects of Selected Natural Compounds Contained in a Dietary Supplement on Two Human Immortalized Keratinocyte Lines

    Directory of Open Access Journals (Sweden)

    Elena Fasano

    2014-01-01

    Full Text Available Several advantages may derive from the use of dietary supplements containing multiple natural antioxidants and/or anti-inflammatory agents. At present, however, there is scarce information on the properties and potential of combined supplements. To fill the gap, the antioxidant and anti-inflammatory activities exerted by a combination of seven natural components (coenzyme Q10, krill oil, lipoic acid, resveratrol, grape seed oil, α-tocopherol, and selenium contained in a dietary supplement used for the prevention of skin disorders were investigated in vitro. Each component was administered, alone or in combination, to human keratinocytes, and the inhibition of Reactive Oxygen Species production and lipid peroxidation as well as the ability to reduce inflammatory cytokine secretion and to modulate Nuclear Factor-κB pathway was evaluated. The combination exhibited high antioxidant activity and in specific conditions the combination’s efficiency was higher than that of the most powerful components administered individually. Moreover, the combination showed remarkable anti-inflammatory properties. It reduced more efficiently than each component the secretion of Monocyte Chemoattractant Protein-1, a crucial cytokine for the development of chronic inflammation in skin, and inhibited Nuclear Factor-κB molecular pathway. Overall, our findings suggest that the combined formulation may have the potential to powerfully inhibit oxidative stress and inflammation at skin level.

  15. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-01-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing. PMID:25866745

  16. Antioxidant and anti-inflammatory effects of selected natural compounds contained in a dietary supplement on two human immortalized keratinocyte lines.

    Science.gov (United States)

    Fasano, Elena; Serini, Simona; Mondella, Nadia; Trombino, Sonia; Celleno, Leonardo; Lanza, Paola; Cittadini, Achille; Calviello, Gabriella

    2014-01-01

    Several advantages may derive from the use of dietary supplements containing multiple natural antioxidants and/or anti-inflammatory agents. At present, however, there is scarce information on the properties and potential of combined supplements. To fill the gap, the antioxidant and anti-inflammatory activities exerted by a combination of seven natural components (coenzyme Q10, krill oil, lipoic acid, resveratrol, grape seed oil, α-tocopherol, and selenium) contained in a dietary supplement used for the prevention of skin disorders were investigated in vitro. Each component was administered, alone or in combination, to human keratinocytes, and the inhibition of Reactive Oxygen Species production and lipid peroxidation as well as the ability to reduce inflammatory cytokine secretion and to modulate Nuclear Factor-κB pathway was evaluated. The combination exhibited high antioxidant activity and in specific conditions the combination's efficiency was higher than that of the most powerful components administered individually. Moreover, the combination showed remarkable anti-inflammatory properties. It reduced more efficiently than each component the secretion of Monocyte Chemoattractant Protein-1, a crucial cytokine for the development of chronic inflammation in skin, and inhibited Nuclear Factor-κB molecular pathway. Overall, our findings suggest that the combined formulation may have the potential to powerfully inhibit oxidative stress and inflammation at skin level. PMID:25197638

  17. Chlorpyrifos induces NLRP3 inflammasome and pyroptosis/apoptosis via mitochondrial oxidative stress in human keratinocyte HaCaT cells.

    Science.gov (United States)

    Jang, Yoonjeong; Lee, Ah Young; Jeong, Sang-Hee; Park, Kyung-Hun; Paik, Min-Kyoung; Cho, Nam-Joon; Kim, Ji-Eun; Cho, Myung-Haing

    2015-12-01

    Chlorpyrifos (CPF) has been widely used around the world as a pesticide for both agricultural and residential application. Although various studies have reported toxicity and health-related effects from CPF exposure, the molecular mechanism of CPF toxicity to skin has not been well-characterized. The present study determined the potential mechanism involved in skin toxicity of CPF using the HaCaT human skin keratinocyte cell line. After treating to HaCaT cells, CPF triggered reactive oxygen species (ROS) generation and mitochondrial oxidative stress. We focused on NLRP3 inflammasome, known to induce innate immune response. We used mitochondrial ROS (mROS) scavenger mitoTEMPO to demonstrate a role for mROS in NLRP3 inflammasome and programmed cell death induced by CPF. Our results showed that CPF provoked NLRP3 inflammasome and pyroptosis/apoptosis via an increase of mROS in HaCaT cells. This study proposes that CPF induces innate immune response and skin inflammation through activating the NLRP3 inflammasome in skin epithelial cells. CPF may lead to cutaneous disease conditions and antioxidants could be proposed for therapy against skin exposure to CPF. PMID:26435000

  18. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn; Tencomnao, Tewin

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications. PMID:27057195

  19. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  20. Remediation of textile azo dye acid red 114 by hairy roots of Ipomoea carnea Jacq. and assessment of degraded dye toxicity with human keratinocyte cell line.

    Science.gov (United States)

    Jha, Pamela; Jobby, Renitta; Desai, N S

    2016-07-01

    Bioremediation has proven to be the most desirable and cost effective method to counter textile dye pollution. Hairy roots (HRs) of Ipomoea carnea J. were tested for decolourization of 25 textile azo dyes, out of which >90% decolourization was observed in 15 dyes. A diazo dye, Acid Red 114 was decolourized to >98% and hence, was chosen as the model dye. A significant increase in the activities of oxidoreductive enzymes was observed during decolourization of AR114. The phytodegradation of AR114 was confirmed by HPLC, UV-vis and FTIR spectroscopy. The possible metabolites were identified by GCMS as 4- aminobenzene sulfonic acid 2-methylaniline and 4- aminophenyl 4-ethyl benzene sulfonate and a probable pathway for the biodegradation of AR114 has been proposed. The nontoxic nature of the metabolites and toxicity of AR114 was confirmed by cytotoxicity tests on human keratinocyte cell line (HaCaT). When HaCaT cells were treated separately with 150 μg mL(-1) of AR114 and metabolites, MTT assay showed 50% and ≈100% viability respectively. Furthermore, flow cytometry data showed that, as compared to control, the cells in G2-M and death phase increased by 2.4 and 3.6 folds respectively on treatment with AR114 but remained unaltered in cells treated with metabolites.

  1. Gq protein mediates UVB-induced cyclooxygenase-2 expression by stimulating HB-EGF secretion from HaCaT human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Seo, MiRan [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Juhnn, Yong-Sung, E-mail: juhnn@snu.ac.kr [Department of Biochemistry and Molecular Biology and Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of)

    2010-03-05

    Ultraviolet (UV) radiation induces cyclooxygenase-2 expression to produce cellular responses including aging and carcinogenesis in skin. We hypothesised that heterotrimeric G proteins mediate UV-induced COX-2 expression by stimulating secretion of soluble HB-EGF (sHB-EGF). In this study, we aimed to elucidate the role and underlying mechanism of the {alpha} subunit of Gq protein (G{alpha}q) in UVB-induced HB-EGF secretion and COX-2 induction. We found that expression of constitutively active G{alpha}q (G{alpha}qQL) augmented UVB-induced HB-EGF secretion, which was abolished by knockdown of G{alpha}q with shRNA in HaCaT human keratinocytes. G{alpha}q was found to mediate the UVB-induced HB-EGF secretion by sequential activation of phospholipase C (PLC), protein kinase C{delta} (PKC{delta}), and matrix metaloprotease-2 (MMP-2). Moreover, G{alpha}qQL mediated UVB-induced COX-2 expression in an HB-EGF-, EGFR-, and p38-dependent manner. From these results, we concluded that G{alpha}q mediates UV-induced COX-2 expression through activation of EGFR by HB-EGF, of which ectodomain shedding was stimulated through sequential activation of PLC, PKC{delta} and MMP-2 in HaCaT cells.

  2. Differential cytokine modulation of the genes LAMA3, LAMB3, and LAMC2, encoding the constitutive polypeptides, alpha 3, beta 3, and gamma 2, of human laminin 5 in epidermal keratinocytes.

    Science.gov (United States)

    Korang, K; Christiano, A M; Uitto, J; Mauviel, A

    1995-07-24

    Laminin 5, an anchoring filament protein previously known as nicein/kalinin/epiligrin, consists of three polypeptide chains, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. The expression of laminin 5 was detected by Northern hybridization with specific cDNA probes in various epidermal keratinocyte cultures, whereas no expression of any of the three genes could be detected in foreskin fibroblast cultures. Transforming growth factor-beta (TGF-beta) enhanced LAMA3, LAMB3, and LAMC2 gene expression in human epidermal keratinocytes, as well as in HaCaT and Balb/K cells in culture, although the extent of enhancement was greater for LAMA3 and LAMC2 genes than for LAMB3. Interestingly, tumor necrosis factor-alpha, (TNF-alpha) alone did not alter the expression of LAMB3 and LAMC2 genes in human epidermal keratinocytes, whereas it inhibited the expression of LAMA3. These results suggest that the expression of the three genes encoding the laminin 5 subunits is not coordinately regulated by the cytokines tested. PMID:7635220

  3. Human papillomavirus type 8 interferes with a novel C/EBPβ-mediated mechanism of keratinocyte CCL20 chemokine expression and Langerhans cell migration.

    Directory of Open Access Journals (Sweden)

    Tanya Sperling

    Full Text Available Infection with genus beta human papillomaviruses (HPV is implicated in the development of non-melanoma skin cancer. This was first evidenced for HPV5 and 8 in patients with epidermodysplasia verruciformis (EV, a genetic skin disease. So far, it has been unknown how these viruses overcome cutaneous immune control allowing their persistence in lesional epidermis of these patients. Here we demonstrate that Langerhans cells, essential for skin immunosurveillance, are strongly reduced in HPV8-positive lesional epidermis from EV patients. Interestingly, the same lesions were largely devoid of the important Langerhans cells chemoattractant protein CCL20. Applying bioinformatic tools, chromatin immunoprecipitation assays and functional studies we identified the differentiation-associated transcription factor CCAAT/enhancer binding protein β (C/EBPβ as a critical regulator of CCL20 gene expression in normal human keratinocytes. The physiological relevance of this finding is supported by our in vivo studies showing that the expression patterns of CCL20 and nuclear C/EBPβ converge spatially in the most differentiated layers of human epidermis. Our analyses further identified C/EBPβ as a novel target of the HPV8 E7 oncoprotein, which co-localizes with C/EBPβ in the nucleus, co-precipitates with it and interferes with its binding to the CCL20 promoter in vivo. As a consequence, the HPV8 E7 but not E6 oncoprotein suppressed C/EBPβ-inducible and constitutive CCL20 gene expression as well as Langerhans cell migration. In conclusion, our study unraveled a novel molecular mechanism central to cutaneous host defense. Interference of the HPV8 E7 oncoprotein with this regulatory pathway allows the virus to disrupt the immune barrier, a major prerequisite for its epithelial persistence and procarcinogenic activity.

  4. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for Km and Vmax. In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  5. Anti-oxidant effects of the extracts from the leaves of Chromolaena odorata on human dermal fibroblasts and epidermal keratinocytes against hydrogen peroxide and hypoxanthine-xanthine oxidase induced damage.

    Science.gov (United States)

    Thang, P T; Patrick, S; Teik, L S; Yung, C S

    2001-06-01

    In cutaneous tissue repair, oxidants and antioxidants play very important roles. In local acute and chronic wounds, oxidants are known to have the ability to cause as cell damage and may function as inhibitory factors to wound healing. The administration of anti-oxidants or free radical scavengers is reportedly helpful, notably in order to limit the delayed sequelae of thermal trauma and to enhance the healing process. Extracts from the leaves of Chromolaena odorata have been shown to be beneficial for treatment of wounds. Studies in vitro of these extracts demonstrated enhanced proliferation of fibroblasts, endothelial cells and keratinocytes, stimulation of keratinocyte migration in an in vitro wound assay, up-regulation of production by keratinocytes of extracellular matrix proteins and basement membrane components, and inhibition of collagen lattice contraction by fibroblasts. In this study, the anti-oxidant effects of both total ethanol and polyphenolic extracts from the plant leaves on hydrogen peroxide and hypoxanthine-xanthine oxidase induced damage to human fibroblasts and keratinocytes were investigated. Cell viability was monitored by a colorimetric assay. The results showed that for fibroblasts, toxicity of hydrogen peroxide or hypoxanthine xanthine oxidase on cells was dose-dependent. Total ethanol extract (TEE) at 400 and 800 microg/ml showed maximum and consistent protective cellular effect on oxidant toxicity at low or high doses of oxidants. The 50 microg/ml concentration of TEE also had significant and slightly protective effects on fibroblasts against hydrogen peroxide and hypoxanthine-xanthine oxidase induced damage, respectively. For keratinocytes, a dose-dependent relationship of oxidant toxicity was only seen with hydrogen peroxide but the protective action of the extract correlated with oxidant dosage. TEE at 400 and 800 microg/ml showed dose-dependent effects with both low and high concentration of oxidants. TEE at 50 microg/ml had no

  6. Tumourigenesis driven by the human papillomavirus type 16 Asian-American e6 variant in a three-dimensional keratinocyte model.

    Directory of Open Access Journals (Sweden)

    Robert Jackson

    Full Text Available Infection with a transforming human papillomavirus (HPV such as type 16 (of species Alphapapillomavirus 9 causes ano-genital and oral tumours via viral persistence in human squamous cell epithelia. Epidemiological studies showed that the naturally occurring HPV16 Asian-American (AA variant (sublineage D2/D3 is found more often than the European Prototype (EP (sublineage A1 in high-grade cervical neoplasia and tumours compared to non-cancer controls. Just three amino acid changes within the early gene, E6, of HPV16 AA have been linked to this augmented tumourigenicity. The AAE6 variant's greater immortalizing and transforming potential over EPE6 has recently been confirmed in retrovirally-transduced keratinocytes expressing the E6 gene only. However, the tumourigenic role of the full-length viral genome of HPV16 has not yet been addressed with regard to these E6 variants. To investigate this process in the context of these two HPV16 E6 genotypes, an organotypic tissue culture model was used to simulate the HPV infectious life cycle. The AAE6 variant demonstrated an enhanced ability over EPE6 to drive the viral life cycle toward tumourigenesis, as evidenced phenotypically-by a more severe grade of epithelial dysplasia with higher proliferation and deregulated differentiation, and molecularly-by high viral oncogene E6 and E7 expression, but lack of productive viral life cycle markers. In contrast, EPE6 had low E6 and E7 but high E1∧E4 expression, indicative of a productive life cycle. We suggest increased viral integration into the host genome for AAE6 as one possible mechanism for these observed differences from EPE6. Additionally, we found downstream effects on immortalization and host innate immune evasion. This study highlights how minor genomic variations in transforming viruses can have a significant affect on their tumourigenic ability.

  7. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm2) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  8. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. PMID:22509834

  9. Defensive effects of fullerene-C60 dissolved in squalane against the 2,4-nonadienal-induced cell injury in human skin keratinocytes HaCaT and wrinkle formation in 3D-human skin tissue model.

    Science.gov (United States)

    Kato, Shinya; Aoshima, Hisae; Saitoh, Yasukazu; Miwa, Nobuhiko

    2010-02-01

    We dissolved fullerene-C60 in squalane (LipoFullerene; LF-SQ, C60-eq.: 500 ppm) and examined its defensive effects against 2,4-nonadienal (NDA)-induced cell injury in HaCaT keratinocytes and wrinkle formation in three dimensional (3D)-human skin tissue model. NDA is an analog of 4-hydroxynonenal, one of major causes for human body odor indicative of aging and a lipophilic cell injury factor. Cell viability (% of the control) decreased to 31.6% on treatment with NDA (40 microM), but it increased to 66.0-97.5% when LF-SQ of 1-4% (C60-eq.: 5-20 ppm) was administered for 5 hr before NDA addition. The defensive effect by LF-SQ was superior to that of "squalane" alone at the same doses. NDA-induced DNA-fragmentation in HaCaT cells was suppressed by LF-SQ administered for 5 hr before NDA treatment, and LF-SQ protected HaCaT cells against apoptosis-like cell death. LF-SQ did not appreciably defend against hydrogen peroxide, though LF-SQ effectively defended against tert-butylhydroperoxide, a type of the intermediate hydrophilicity-lipophilicity degree out of other reactive oxygen species. The scanning electron microscopy demonstrated that NDA caused wrinkles and abnormal scales on keratinocytes of 3D-human skin tissue model, and structural homogeneity of the interstratum was broken, any of which were, however, markedly suppressed with LF-SQ. Squalane alone exhibited defensive effect against the skin tissue injury to some extent, but which was inferior to LF-SQ. LF-SQ might effectively capture and scavenge lipid radicals generated inside the cell membrane, because squalane acts as a lipophilic carrier of C60. C60 dissolved in squalane can be expected to serve as a cosmeceutical ingredient for anti-wrinkle formation.

  10. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jones, S.K. (Bristol Royal Infirmary (United Kingdom))

    1992-06-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author).

  11. Effect of arsenic on antioxidative ability of human keratinocytes%砷对人皮肤角质形成细胞抗氧化能力影响

    Institute of Scientific and Technical Information of China (English)

    孙鲜策; 王少鹏; 高娜; 刘爽; 杨光; 朴丰源

    2009-01-01

    目的 研究亚砷酸钠(NaAsO2)对人皮肤角质形成细胞(HaCaT)抗氧化能力的影响.方法 用流式细胞仪检测细胞内二氯荧光素(DCF)的荧光强度;用改良硫代巴比妥酸荧光法制定细胞内丙二醛(MDA)含量;用Ni-trite-kit法检测超氧化物歧化酶(SOD)活性;用紫外速率直接法测定过氧化氢酶(CAT)的活性.结果 各实验组(2.5,5,10和20 μmol/L NaAsO2)的DCF荧光强度均显著增高(P<0.05),分别是对照组的1.3,1.6,1.7和1.8倍;各实验组MDA含量显著增高(P<0.05),分别是对照组的1.1,1.4,1.5和2.2倍;10和20 μmol/L NaAsO2组SOD活性显著下降,分别为对照组的78%和61%;10和20μmol/L NaAsO2组SIOD和CAT活性显著下降,分别为对照组的50%和34%.结论 砷可以引起人皮肤细胞的氧化损伤,降低抗氧化能力.%Objective To explore the effect of sodium arsenite( NaAsO2) on antioxidative ability in human keratino-cytes (HaCaT). Methods The fluorescence intensity of dichlorofluorescein(DCF) was detected by flow cytometry. The malondialdehyde(MDA) content was detected by improved thio-barbituric acid fluorometric method. Superoxide dismutase (SOD) activity was determined by Nitrite-kit. The catalase(CAT) activity was determined by ultraviolet velocity direct method. Results The fluorescence intensity of DCF increased to 1.3,1.6,1.7, and 1. 8 times of the control' s in 2. 5,10, and 20 μmol/L NaAsO2 treated groups,respectively (P < 0. 05). The MDA content increased to 1.1,1.4,1.5, and 2.2 time of the control's in 2. 5,10, and 20 μmol/L NaAsO2 treated groups,respectively (P < 0. 05). While the activity of SOD de-creased to 78% and 61% of the control's in 10μmol/L and 20 μmol/L NaAsO2 groups. And CAT activity decreased to 50% and 34% of the control's in 10 μmol/L and 20 μmol/L NaAsO2 groups. Conclusion Arsenic can cause oxidative damage and decrease antioxidative ability in human keratinocytes.

  12. APR-246/PRIMA-1(MET) rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations.

    Science.gov (United States)

    Shen, Jinfeng; van den Bogaard, Ellen H; Kouwenhoven, Evelyn N; Bykov, Vladimir J N; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S; Gilissen, Christian; van Heeringen, Simon J; Schalkwijk, Joost; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing

    2013-02-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patient keratinocytes cultured either in submerged 2D cultures or in 3D skin equivalents have impaired epidermal differentiation and stratification. Treatment of these patient keratinocytes with the mutant p53-targeting compound APR-246/PRIMA-1(MET) (p53 reactivation and induction of massive apoptosis) that has been successfully tested in a phase I/II clinical trial in cancer patients partially but consistently rescued morphological features and gene expression during epidermal stratification in both 2D and 3D models. This rescue coincides with restoration of p63 target-gene expression. Our data show that EEC patient keratinocytes with p63 mutations can be used for characterization of the abnormal molecular circuitry in patient skin and may open possibilities for the design of novel pharmacological treatment strategies for patients with mutant p63-associated developmental abnormalities. PMID:23355676

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. Cell pattern in adult human corneal endothelium.

    Directory of Open Access Journals (Sweden)

    Carlos H Wörner

    Full Text Available A review of the current data on the cell density of normal adult human endothelial cells was carried out in order to establish some common parameters appearing in the different considered populations. From the analysis of cell growth patterns, it is inferred that the cell aging rate is similar for each of the different considered populations. Also, the morphology, the cell distribution and the tendency to hexagonallity are studied. The results are consistent with the hypothesis that this phenomenon is analogous with cell behavior in other structures such as dry foams and grains in polycrystalline materials. Therefore, its driving force may be controlled by the surface tension and the mobility of the boundaries.

  15. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  16. Capsule expression in Streptococcus mitis modulates interaction with oral keratinocytes and alters susceptibility to human antimicrobial peptides.

    Science.gov (United States)

    Rukke, H V; Engen, S A; Schenck, K; Petersen, F C

    2016-08-01

    Streptococcus mitis is a colonizer of the oral cavity and the nasopharynx, and is closely related to Streptococcus pneumoniae. Both species occur in encapsulated and unencapsulated forms, but in S. mitis the role of the capsule in host interactions is mostly unknown. Therefore, the aim of this study was to examine how capsule expression in S. mitis can modulate interactions with the host with relevance for colonization. The S. mitis type strain, as well as two mutants of the type strain, an isogenic capsule deletion mutant, and a capsule switch mutant expressing the serotype 4 capsule of S. pneumoniae TIGR4, were used. Wild-type and capsule deletion strains of S. pneumoniae TIGR4 were included for comparison. We found that capsule production in S. mitis reduced adhesion to oral and lung epithelial cells. Further, exposure of oral epithelial cells to encapsulated S. mitis resulted in higher interleukin-6 and CXCL-8 transcription levels relative to the unencapsulated mutant. Capsule expression in S. mitis increased the sensitivity to human neutrophil peptide 1-3 but reduced the sensitivity to human β-defensin-3 and cathelicidin. This was in contrast with S. pneumoniae in which capsule expression has been generally associated with increased sensitivity to human antimicrobial peptides (AMPs). Collectively, these findings indicate that capsule expression in S. mitis is important in modulating interactions with epithelial cells, and is associated with increased or reduced susceptibility to AMPs depending on the nature of the AMP.

  17. CD44v6 expression in human skin keratinocytes as a possible mechanism for carcinogenesis associated with chronic arsenic exposure

    Directory of Open Access Journals (Sweden)

    S. Huang

    2013-01-01

    Full Text Available Inorganic arsenic is a well-known human skin carcinogen. Chronic arsenic exposure results in various types of human skin lesions, including squamous cell carcinoma (SCC. To investigate whether mutant stem cells participate in arsenic-associated carcinogenesis, we repeatedly exposed the HaCaT cells line to an environmentally relevant level of arsenic (0.05 ppm in vitro for 18 weeks. Following sodium arsenic arsenite administration, cell cycle, colony-forming efficiency (CFE, cell tumorigenicity, and expression of CD44v6, NF-κB and p53, were analyzed at different time points (0, 5, 10, 15, 20, 25 and 30 passages. We found that a chronic exposure of HaCaT cells to a low level of arsenic induced a cancer stem- like phenotype. Furthermore, arsenic-treated HaCaT cells also became tumorigenic in nude mice, their growth cycle was predominantly in G2/M and S phases. Relative to nontreated cells, they exhibited a higher growth rate and a significant increase in CFE. Western blot analysis found that arsenic was capable of increasing cell proliferation and sprouting of cancer stem-like phenotype. Additionally, immunohistochemical analysis demonstrated that CD44v6 expression was up-regulated in HaCaT cells exposed to a low level of arsenic during early stages of induction. The expression of CD44v6 in arsenic-treated cells was positively correlated with their cloning efficiency in soft agar (r=0.949, P=0.01. Likewise, the expressions of activating transcription factor NF-κB and p53 genes in the arsenic-treated HaCaT cells were significantly higher than that in non-treated cells. Higher expressions of CD44v6, NF-κB and p53 were also observed in tumor tissues isolated from Balb/c nude mice. The present results suggest that CD44v6 may be a biomarker of arsenic-induced neoplastic transformation in human skin cells, and that arsenic promotes malignant transformation in human skin lesions through a NF-κB signaling pathway-stimulated expression of CD44v6.

  18. 20-Hydroxycholecalciferol, product of vitamin D3 hydroxylation by P450scc, decreases NF-kappaB activity by increasing IkappaB alpha levels in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Zorica Janjetovic

    Full Text Available The side chain of vitamin D3 is hydroxylated in a sequential manner by cytochrome P450scc (CYP11A1 to form 20-hydroxycholecalciferol, which can induce growth arrest and differentiation of both primary and immortalized epidermal keratinocytes. Since nuclear factor-kappaB (NF-kappaB plays a pivotal role in the regulation of cell proliferation, differentiation and apoptosis, we examined the capability of 20-hydroxycholecalciferol to modulate the activity of NF-kappaB, using 1,25-dihydroxycholecalciferol (calcitriol as a positive control. 20-hydroxycholecalciferol inhibits the activation of NFkappaB DNA binding activity as well as NF-kappaB-driven reporter gene activity in keratinocytes. Also, 20-hydroxycholecalciferol induced significant increases in the mRNA and protein levels of the NF-kappaB inhibitor protein, IkappaB alpha, in a time dependent manner, while no changes in total NF-kappaB-p65 mRNA or protein levels were observed. Another measure of NF-kappaB activity, p65 translocation from the cytoplasm into the nucleus was also inhibited in extracts of 20-hydroxycholecalciferol treated keratinocytes. Increased IkappaB alpha was concomitantly observed in cytosolic extracts of 20-hydroxycholecalciferol treated keratinocytes, as determined by immunoblotting and immunofluorescent staining. In keratinocytes lacking vitamin D receptor (VDR, 20-hydroxycholecalciferol did not affect IkappaB alpha mRNA levels, indicating that it requires VDR for its action on NF-kappaB activity. Comparison of the effects of calcitrol, hormonally active form of vitamin D3, with 20-hydrocholecalciferol show that both agents have a similar potency in inhibiting NF-kappaB. Since NF-kappaB is a major transcription factor for the induction of inflammatory mediators, our findings indicate that 20-hydroxycholecalciferol may be an effective therapeutic agent for inflammatory and hyperproliferative skin diseases.

  19. High-Glucose Environment Enhanced Oxidative Stress and Increased Interleukin-8 Secretion From Keratinocytes

    OpenAIRE

    Lan, Cheng-Che E.; Wu, Ching-Shuang; Huang, Shu-Mei; Wu, I-Hui; Chen, Gwo-Shing

    2013-01-01

    Impaired wound healing frequently occurs in patients with diabetes. Interleukin (IL)-8 production by keratinocyte is responsible for recruiting neutrophils during healing. Intense inflammation is associated with diabetic wounds, while reduction of neutrophil infiltration is associated with enhanced healing. We hypothesized that increased neutrophil recruitment by keratinocytes may contribute to the delayed healing of diabetic wounds. Using cultured human keratinocytes and a diabetic rat model...

  20. Have you got any cholesterol? Adults' views of human nutrition

    Science.gov (United States)

    Schibeci, Renato; Wong, Khoon Yoong

    1994-12-01

    The general aim of our human nutrition project is to develop a health education model grounded in ‘everyday’ or ‘situated’ cognition (Hennessey, 1993). In 1993, we began pilot work to document adult understanding of human nutrition. We used a HyperCard stack as the basis for a series of interviews with 50 adults (25 university students, and 25 adults from offcampus). The interviews were transcribed and analysed using the NUDIST computer program. A summary of the views of these 50 adults on selected aspects of human nutrition is presented in this paper.

  1. Adult Education & Human Resource Development: Overlapping and Disparate Fields

    Science.gov (United States)

    Watkins, Karen E.; Marsick, Victoria J.

    2014-01-01

    Adult education and human resource development as fields of practice and study share some roots in common but have grown in different directions in their histories. Adult education's roots focused initially on citizenship for a democratic society, whereas human resource development's roots are in performance at work. While they have…

  2. Co-cultivation of keratinocyte-human mesenchymal stem cell (hMSC) on sericin loaded electrospun nanofibrous composite scaffold (cationic gelatin/hyaluronan/chondroitin sulfate) stimulates epithelial differentiation in hMSCs: In vitro study.

    Science.gov (United States)

    Bhowmick, Sirsendu; Scharnweber, Dieter; Koul, Veena

    2016-05-01

    Fortifying the scaffold with bioactive molecules and glycosaminoglycans (GAGs), is an efficient way to design new generation tissue engineered biomaterials. In this study, we evaluated the synergistic effect of electrospun nanofibrous composite scaffold (cationic gelatin/hyaluronan/chondroitin sulfate) loaded with sericin and, contact co-culture of human mesenchymal stem cells (hMSCs)-keratinocytes on hMSCs' differentiation towards epithelial lineage. Cationic gelatin is prepared with one step novel synthesis process by grafting quaternary ammonium salts to the backbone of gelatin. Release kinetics studies showed that Fickian diffusion is the major release mechanism for both GAGs and sericin/gelatin. In vitro biocompatibility of the electrospun scaffold was evaluated in terms of LDH and DNA quantification assay on human foreskin fibroblast, human keratinocyte and hMSC. Significant proliferation (∼ 4-6 fold) was detected after culturing all three cell on the electrospun scaffold containing sericin. After 5 days of contact co-culture, results revealed that electrospun scaffold containing sericin promote epithelial differentiation of hMSC in terms of several protein markers (keratin 14, ΔNp63α and Pan-cytokeratin) and gene expression of some dermal proteins (keratin 14, ΔNp63α). Findings of this study will foster the progress of current skin tissue engineering scaffolds by understanding the skin regeneration and wound healing process. PMID:26946262

  3. A Polyphenol-Enriched Fraction of Rose Oil Distillation Wastewater Inhibits Cell Proliferation, Migration and TNF-α-Induced VEGF Secretion in Human Immortalized Keratinocytes.

    Science.gov (United States)

    Wedler, Jonas; Rusanov, Krasimir; Atanassov, Ivan; Butterweck, Veronika

    2016-07-01

    Water steam distillation of rose flowers separates the essential oil from the polyphenol-containing rose oil distillation wastewater. Recently, a strategy was developed to separate rose oil distillation wastewater into a polyphenol depleted water fraction and a polyphenol-enriched fraction [RF20-(SP-207)]. The objective of the present study was to investigate RF20-(SP-207) and fraction F(IV), augmented in quercetin and ellagic acid, for possible antiproliferative effects in immortalized human keratinocytes (HaCaT) since rose petals are known to contain compounds with potential antiproliferative activity.RF20-(SP-207) revealed dose-dependent antiproliferative activity (IC50 of 9.78 µg/mL). In a nontoxic concentration of 10 µg/mL, this effect was stronger than that of the two positive controls LY294002 (10 µM, PI3 K-inhibitor, 30 % inhibition) and NVP-BEZ235 (100 nM, dual PI3 K/mTOR inhibitor, 30 % inhibition) and clearly exceeded the antiproliferative action of quercetin (50 µM, 25 % inhibition) and ellagic acid (1 µM, 15 % inhibition). Time-lapse microscopy detected a significant impairment of cell migration of RF20-(SP-207) and F(IV). At concentrations of 10 µg/mL of both, extract and fraction, cell migration was strongly suppressed (51 % and 28 % gap closure, respectively, compared to 95 % gap closure 24 hours after control treatment). The suppression of cell migration was comparable to the positive controls LY294002, NVP-BEZ235, and quercetin. Furthermore, basal and TNF-α-stimulated VEGF-secretion was significantly reduced by RF20-(SP-207) and F(IV) at 10 µg/mL (44 % vs. untreated control).In conclusion, RF20-(SP-207) showed promising antiproliferative and antimigratory effects and could be developed as a supportive, therapy against hyperproliferation-involved skin diseases. PMID:27093251

  4. Functional analysis of ZFP36 proteins in keratinocytes.

    Science.gov (United States)

    Prenzler, Frauke; Fragasso, Annunziata; Schmitt, Angelika; Munz, Barbara

    2016-08-01

    The ZFP36 family of zinc finger proteins, including ZFP36, ZFP36L1, and ZFP36L2, regulates the production of growth factors and cytokines via destabilization of the respective mRNAs. We could recently demonstrate that in cultured keratinocytes, expression of the ZFP36, ZFP36L1, and ZFP36L2 genes is induced by growth factors and cytokines and that ZFP36L1 is a potent regulator of keratinocyte VEGF production. We now further analyzed the localization and function of ZFP36 proteins in the skin, specifically in epidermal keratinocytes. We found that in human epidermis, the ZFP36 protein could be detected in basal and suprabasal keratinocytes, whereas ZFP36L1 and ZFP36L2 were expressed mainly in the basal layer, indicating different and non-redundant functions of the three proteins in the epidermis. Consistently, upon inhibition of ZFP36 or ZFP36L1 expression using specific siRNAs, there was no major effect on expression of the respective other gene. In addition, we demonstrate that both ZFP36 and ZFP36L1 influence keratinocyte cell cycle, differentiation, and apoptosis in a distinct manner. Finally, we show that similarly as ZFP36L1, ZFP36 is a potent regulator of keratinocyte VEGF production. Thus, it is likely that both proteins regulate angiogenesis via paracrine mechanisms. Taken together, our results suggest that ZFP36 proteins might control reepithelialization and angiogenesis in the skin in a multimodal manner. PMID:27182009

  5. Distinctive molecular responses to ultraviolet radiation between keratinocytes and melanocytes.

    Science.gov (United States)

    Sun, Xiaoyun; Kim, Arianna; Nakatani, Masashi; Shen, Yao; Liu, Liang

    2016-09-01

    Solar ultraviolet radiation (UVR) is the major risk factor for skin carcinogenesis. To gain new insights into the molecular pathways mediating UVR effects in the skin, we performed comprehensive transcriptomic analyses to identify shared and distinctive molecular responses to UVR between human keratinocytes and melanocytes. Keratinocytes and melanocytes were irradiated with varying doses of UVB (10, 20 and 30 mJ/cm(2) ) then analysed by RNA-Seq at different time points post-UVB radiation (4, 24 and 72 h). Under basal conditions, keratinocytes and melanocytes expressed similar number of genes, although they each expressed a distinctive subset of genes pertaining to their specific cellular identity. Upon UVB radiation, keratinocytes displayed a clear pattern of time- and dose-dependent changes in gene expression that was different from melanocytes. The early UVB-responsive gene set (4 h post-UVR) differed significantly from delayed UVB-responsive gene sets (24 and 72 h). We also identified multiple novel UVB signature genes including PRSS23, SERPINH1, LCE3D and CNFN, which were conserved between melanocyte and keratinocyte lines from different individuals. Taken together, our findings elucidated both common and distinctive molecular features between melanocytes and keratinocytes and uncovered novel UVB signature genes that might be utilized to predict UVB photobiological effects on the skin. PMID:27119462

  6. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone;

    2004-01-01

    Caspases, members of the cysteine protease family, execute UVB-induced apoptosis in several cell lines and keratinocytes. Several researchers investigating UVB-induced apoptosis have demonstrated a dose-dependent protective effect of the synthetic peptide caspase inhibitor zVAD-fmk. However, z......VAD-fmk displays a dose-dependent protective effect against UVB-induced apoptosis, even at doses higher than those required to block all known proapoptotic caspases. In addition, it is known that zVAD-fmk also inhibits other cysteine proteases including cathepsins and calpains, and these proteases have recently...... been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes...

  7. The Peroxisome Proliferator-Activated Receptor Gamma System Regulates Ultraviolet B-Induced Prostaglandin E2 Production in Human Epidermal Keratinocytes

    OpenAIRE

    Konger, Raymond L.; Kellie Clay Martel; Danielle Jernigan; Qiwei Zhang; Travers, Jeffrey B.

    2010-01-01

    Studies using PPARγ agonists in mouse skin have suggested that peroxisome proliferator-activated receptor gamma (PPARγ) is irrelevant to cutaneous photobiology. However, in several epithelial cell lines, ultraviolet B (UVB) has been shown to induce the nonenzymatic production of oxidized phospholipids that act as PPARγ agonists. UVB is also a potent inducer of prostaglandin E2  (PGE2) production and COX-2 expression in keratinocytes and PPARγ is coupled to increased PGE2 production in other...

  8. Effect of Spa Spring Water on Cytokine Expression in Human Keratinocyte HaCaT Cells and on Differentiation of CD4+ T Cells

    OpenAIRE

    Lee, Ho-Pyo; Choi, Yoon-Jung; Cho, Kyung-Ah; Woo, So-Youn; Yun, Seong-Taek; Lee, Jong Tae; Kim, Hong Jig; Lee, Kyung-Ho; Kim, Jin-Wou

    2012-01-01

    Background Skin acts as the first line of defense against any foreign materials outside of our body. In inflammatory skin disease, the pathogenesis is due to an immune reaction in the keratinocytes, immune cells and soluble mediators. Balneotherapy is widely used for the treatment of inflammatory skin disease, but the mechanisms are only partly understood by immune regulation. Balneotherapy in dermatologic disease can affect the secretion of pro-inflammatory cytokines, IL-1α and tumor necrosi...

  9. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  10. Adult Human Neurogenesis: from Microscopy to Magnetic Resonance Imaging

    Directory of Open Access Journals (Sweden)

    Amanda eSierra

    2011-04-01

    Full Text Available Neural stem cells reside in well-defined areas of the adult human brain and are capable of gene-rating new neurons throughout the life span. In rodents, it is well established that the new born neurons are involved in olfaction as well as in certain forms of memory and learning. In humans, the functional relevance of adult human neurogenesis is being investigated, in particular its implication in the etiopathology of a variety of brain disorders. Adult neurogenesis in the human brain was discovered by utilizing methodologies directly imported from the rodent research, such as immunohistological detection of proliferation and cell-type specific biomarkers in postmortem or biopsy tissue. However, in the vast majority of cases, these methods do not support longitudinal studies; thus, the capacity of the putative stem cells to form new neurons under different disease conditions cannot be tested. More recently, new technologies have been specifically developed for the detection and quantification of neural stem cells in the living human brain. These technologies rely on the use of magnetic resonance imaging, available in hospitals worldwide. Although they require further validation in rodents and primates, these new methods hold the potential to test the contribution of adult human neurogenesis to brain function in both health and disease. This review reports on the current knowledge on adult human neurogenesis. We first review the different methods available to assess human neurogenesis, both ex vivo and in vivo and then appraise the changes of adult neurogenesis in human diseases.

  11. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Science.gov (United States)

    Zappia, Katherine J; Garrison, Sheldon R; Palygin, Oleg; Weyer, Andy D; Barabas, Marie E; Lawlor, Michael W; Staruschenko, Alexander; Stucky, Cheryl L

    2016-01-01

    Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1) is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1. PMID:26978657

  12. Gustofacial and olfactofacial responses in human adults.

    Science.gov (United States)

    Weiland, Romy; Ellgring, Heiner; Macht, Michael

    2010-11-01

    Adults' facial reactions in response to tastes and odors were investigated in order to determine whether differential facial displays observed in newborns remain stable in adults who exhibit a greater voluntary facial control. Twenty-eight healthy nonsmokers (14 females) tasted solutions of PROP (bitter), NaCl (salty), citric acid (sour), sucrose (sweet), and glutamate (umami) differing in concentration (low, medium, and high) and smelled different odors (banana, cinnamon, clove, coffee, fish, and garlic). Their facial reactions were video recorded and analyzed using the Facial Action Coding System. Adults' facial reactions discriminated between stimuli with opponent valences. Unpleasant tastes and odors elicited negative displays (brow lower, upper lip raise, and lip corner depress). The pleasant sweet taste elicited positive displays (lip suck), whereas the pleasant odors did not. Unlike newborns, adults smiled with higher concentrations of some unpleasant tastes that can be regarded as serving communicative functions. Moreover, adults expressed negative displays with higher sweetness. Except for the "social" smile in response to unpleasant tastes, adults' facial reactions elicited by tastes and odors mostly correspond to those found in newborns. In conclusion, adults' facial reactions to tastes and odors appear to remain stable in their basic displays; however, some additional reactions might reflect socialization influences.

  13. Adult Literacy Education and Human Rights: A View from Afghanistan

    Science.gov (United States)

    Andersen, Susan M.; Kooij, Christina S.

    2007-01-01

    In this article, we argue that adult literacy as part of international development is an issue of both human rights and women's rights. We explore this by presenting a case study of the effects of one innovative adult literacy program in Afghanistan that places men and women, as well as various ethnicities, together in the same classroom as…

  14. Dopaminerge Differenzierung adulter humaner hippocampaler Stammzellen

    OpenAIRE

    Türk, Matthias

    2013-01-01

    Hintergrund und Ziele: Nachdem seit der ersten Hälfte des letzten Jahrhunderts durch mehrere Experimente adulte Neurogenese schließlich nachgewiesen und somit Cajals Dogma widerlegt werden konnte, erlebten die Neurowissenschaften durch die Möglichkeit zur Isolation adulter neuraler Stammzellen ein exponentielles Wachstum. Gleichzeitig mit der basiswissenschaftlichen Aufarbeitung der adulten Neurogenese sowohl im Tier, als auch im Menschen, kam die Idee der therapeutischen Verwendung dieser, v...

  15. Lactobacillus reuteri protects epidermal keratinocytes from Staphylococcus aureus-induced cell death by competitive exclusion.

    Science.gov (United States)

    Prince, Tessa; McBain, Andrew J; O'Neill, Catherine A

    2012-08-01

    Recent studies have suggested that the topical application of probiotic bacteria can improve skin health or combat disease. We have utilized a primary human keratinocyte culture model to investigate whether probiotic bacteria can inhibit Staphylococcus aureus infection. Evaluation of the candidate probiotics Lactobacillus reuteri ATCC 55730, Lactobacillus rhamnosus AC413, and Lactobacillus salivarius UCC118 demonstrated that both L. reuteri and L. rhamnosus, but not L. salivarius, reduced S. aureus-induced keratinocyte cell death in both undifferentiated and differentiated keratinocytes. Keratinocyte survival was significantly higher if the probiotic was applied prior to (P 0.05). The protective effect of L. reuteri was not dependent on the elaboration of inhibitory substances such as lactic acid. L. reuteri inhibited adherence of S. aureus to keratinocytes by competitive exclusion (P = 0.026). L. salivarius UCC118, however, did not inhibit S. aureus from adhering to keratinocytes (P > 0.05) and did not protect keratinocyte viability. S. aureus utilizes the α5β1 integrin to adhere to keratinocytes, and blocking of this integrin resulted in a protective effect similar to that observed with probiotics (P = 0.03). This suggests that the protective mechanism for L. reuteri-mediated protection of keratinocytes was by competitive exclusion of the pathogen from its binding sites on the cells. Our results suggest that use of a topical probiotic prophylactically could inhibit the colonization of skin by S. aureus and thus aid in the prevention of infection. PMID:22582077

  16. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder;

    1993-01-01

    transformation and because peptide sequences were available in the microsequence database. The cDNA was cloned from a fibroblast cDNA library using degenerate oligodeoxyribonucleotides and expressed in AMA cells using the vaccinia virus expression system. Database searches indicated that the predicted protein......Treatment of proliferating and quiescent primary human keratinocytes with interferon-gamma (IFN-gamma) (100 U/ml, 23.5 h) followed by two-dimensional gel analysis revealed three proteins, IGUP I-3421 (M(r) = 48,200, pI = 6.06); IGUP I-3524 (M(r) = 56,900, pI = 5.92), a protein homologous to peptide......-chain-release factor and tryptophanyl-tRNA synthetase; and IGUP I-5111 (M(r) = 30,400, pI = 5.76) recorded in the keratinocyte protein database (Celis et al., 1991, 1992) that are highly and specifically up-regulated by IFN-gamma among several agents tested including 14 other cytokines, second messengers [dibutyryl c...

  17. Bacteriology of moderate (chronic) periodontitis in mature adult humans.

    OpenAIRE

    Moore, W E; Holdeman, L V; Cato, E P; Smibert, R M; Burmeister, J A; Ranney, R R

    1983-01-01

    A total of 171 taxa was represented among 1,900 bacterial isolates from 60 samples of sites affected with moderate periodontitis in 22 mature adult humans. The composition of the subgingival sulcus flora was statistically significantly different from that of the adjacent supragingival flora and the subgingival flora of 14 people with healthy gingiva, but was not significantly different from that of sulci affected with severe periodontitis in 21 young human adults. The sulcus floras of moderat...

  18. Early reversal cells in adult human bone remodeling

    DEFF Research Database (Denmark)

    Abdelgawad, Mohamed Essameldin; Delaisse, Jean-Marie; Hinge, Maja;

    2016-01-01

    . Earlier preclinical studies indicate that reversal cells degrade the organic matrix left behind by the osteoclasts and that this degradation is crucial for the initiation of the subsequent bone formation. To our knowledge, this study is the first addressing these catabolic activities in adult human bone...... demonstrates that reversal cells colonizing bone surfaces right after resorption are osteoblast-lineage cells, and extends to adult human bone remodeling their role in rendering eroded surfaces osteogenic....

  19. Attenuating properties of Agastache rugosa leaf extract against ultraviolet-B-induced photoaging via up-regulating glutathione and superoxide dismutase in a human keratinocyte cell line.

    Science.gov (United States)

    Oh, Yuri; Lim, Hye-Won; Huang, Yu-Hua; Kwon, Hee-Souk; Jin, Chang Duck; Kim, Kyunghoon; Lim, Chang-Jin

    2016-10-01

    Agastache rugosa Kuntze, known as a Korean mint, is an herbal medicine that has been used for the treatment of diverse kinds of symptoms in traditional medicine. This work was undertaken to assess the protective properties of A. rugosa leaves against UV-B-induced photoaging in HaCaT keratinocytes. They were evaluated via analyzing reactive oxygen species (ROS), promatrix metalloproteinase-2 (proMMP-2) and -9 (proMMP-9), total glutathione (GSH), total superoxide dismutase (SOD), cellular viability, flavonoid content and in vitro radical scavenging activity. Total flavonoid content of ARE, a hot water extract of A. rugosa leaves, was 22.8±7.6mg of naringin equivalent/g ARE. ARE exhibited ABTS(+) radical scavenging activity with an SC50 of 836.9μg/mL. ARE attenuated the UV-B-induced ROS generation. It diminished the UV-B-induced elevation of proMMP-2 and -9 at both activity and protein levels. On the contrary, ARE was able to enhance the UV-B-reduced total GSH and total SOD activity levels. ARE, at the used concentrations, was unable to interfere with the cellular viabilities of HaCaT keratinocytes under UV-B irradiation. Taken together, ARE possesses a protective potential against UV-B-induced photoaging in HaCaT keratinocytes, possibly based upon up-regulating antioxidant components, including total GSH and SOD. These findings reasonably suggest the use of A. rugosa leaves as a photoprotective resource in manufacturing functional cosmetics.

  20. Basic Red 51, a permitted semi-permanent hair dye, is cytotoxic to human skin cells: Studies in monolayer and 3D skin model using human keratinocytes (HaCaT).

    Science.gov (United States)

    Zanoni, Thalita B; Tiago, Manoela; Faião-Flores, Fernanda; de Moraes Barros, Silvia B; Bast, Aalt; Hageman, Geja; de Oliveira, Danielle Palma; Maria-Engler, Silvya S

    2014-06-01

    The use of hair dyes is closely associated with the increase of cancer, inflammation and other skin disorders. The recognition that human skin is not an impermeable barrier indicates that there is the possibility of human systemic exposure. The carcinogenic potential of hair dye ingredients has attracted the attention of toxicologists for many decades, mainly due to the fact that some ingredients belong to the large chemical family of aromatic amines. Herein, we investigated the cytotoxicity of Basic Red 51 (BR51) in immortalized human keratinocytes (HaCaT). BR51 is a temporary hair dye that belongs to the azo group (NN); the cleavage of this bond may result in the release of toxic aromatic amines. The half maximal effective concentration (EC50) in HaCaT cells is 13μg/mL. BR51 induced a significant decrease on expression of p21 in a dose dependent manner. p53 was not affected, whereas BR51 decreased procaspase 8 and cleaved procaspase 9. These results proved that caspase 3 is fully involved in BR51-induced apoptosis. The dye was also able to stop this cell cycle on G2 in sub-toxic doses. Moreover, we reconstructed a 3D artificial epidermis using HaCaT cells; using this model, we observed that BR51 induced cell injury and cells were undergoing apoptosis, considering the fragmented nuclei. Subsequently, BR51 induced reactive oxygen species (ROS) leading to an increase on the levels of 8-oxo-dG. In conclusion, we provide strong evidence that consumer and/or professional exposure to BR51 poses risk to human health.

  1. The Asian-American variant of human papillomavirus type 16 exhibits higher activation of MAPK and PI3K/AKT signaling pathways, transformation, migration and invasion of primary human keratinocytes.

    Science.gov (United States)

    Hochmann, Jimena; Sobrinho, João S; Villa, Luisa L; Sichero, Laura

    2016-05-01

    Asian-American (AA) HPV-16 variants are associated with higher risk of cancer. Abnormal activation of intracellular signaling play a critical role in cancer development and progression. Our aim was to elucidate mechanisms underlying the higher oncogenic potential attributed to AA variant. We evaluated activation of MAPK and PI3K/AKT pathways in primary human keratinocytes (PHKs) transduced with E6/E7 of three HPV-16 variants: E-P, AA, E-350G. Phenotypes examined included migration, anchorage independent growth and invasion. AA PHKs presented the highest levels of active proteins involved in all cascades analyzed: MAPK-ERK, MAPK-p38 and PI3K-AKT. AA PHKs were more efficient in promoting anchorage independent growth, and in stimulating cell migration and invasion. MEK1 inhibition decreased migration. The mesenchymal phenotype marker vimentin was increased in AA PHKs. Our results suggest that MEK1, ERK2, AKT2 hyperactivation influence cellular behavior by means of GSK-3b inactivation and EMT induction prompting AA immortalized PHKs to more efficiently surpass carcinogenesis steps. PMID:26945151

  2. Ultrastructural evaluation of human keratinocyte growth and differentiation on a fibrin substrate Avaliação ultraestrutural do crescimento e da diferenciação de queratinócitos sobre um substrato de fibrina

    Directory of Open Access Journals (Sweden)

    Daniela Yukie Sakai Tanikawa

    2010-12-01

    Full Text Available PURPOSE: In order to circumvent several difficulties that have been met in the routine use of the in vitro keratinocyte cultures using the standard procedure described by Rheinwald and Green, and obtain a more resilient and the least possible immunogeneic skin substitute for a future clinical application, this work studied a new keratinocyte culture system, which envisages the utilization of a fibrin substrate in association with high densities of human keratinocytes. METHODS: Through light and transmission electron microscopy and immunohistochemical assays, long-term proliferative and differentiative characteristics of keratinocytes cultured onto a fibrin gel under immerse and air-liquid interface culture conditions were evaluated. RESULTS: Despite the absence of a dermal substitute, the results demonstrated that the proposed composite was constituted of a transparent and elastic fibrin film covered by a well-attached, multistratified epithelium with morphological characteristics that resemble human epidermis, including the neoformation, albeit incomplete, of the basement membrane. CONCLUSIONS: Increased mechanical resistance due to the presence of an easy handling substrate, the delivery of nonclonfluent keratinocytes as well as the removal of animal-derived cells from the culture system suggest its potential use for future transplantation purposes.OBJETIVO: Com o intuito de contornar diversas dificuldades encontradas no uso rotineiro de queratinócitos cultivados in vitro pela técnica descrita por Rheinwald e Green, e obter um substituto cutâneo mais resistente e o menos imunogênico possível para futuras aplicações clínicas, este trabalho avaliou um novo sistema de cultura de queratinócitos que prevê a utilização de um substrato de fibrina em associação com queratinócitos humanos em alta densidade. MÉTODOS: Através de microscopia óptica e eletrônica e análise imunohistoquímica, foram avaliadas as caracter

  3. Antioxidants protect keratinocytes against M. ulcerans mycolactone cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Alvar Grönberg

    Full Text Available BACKGROUND: Mycobacterium ulcerans is the causative agent of necrotizing skin ulcerations in distinctive geographical areas. M. ulcerans produces a macrolide toxin, mycolactone, which has been identified as an important virulence factor in ulcer formation. Mycolactone is cytotoxic to fibroblasts and adipocytes in vitro and has modulating activity on immune cell functions. The effect of mycolactone on keratinocytes has not been reported previously and the mechanism of mycolactone toxicity is presently unknown. Many other macrolide substances have cytotoxic and immunosuppressive activities and mediate some of their effects via production of reactive oxygen species (ROS. We have studied the effect of mycolactone in vitro on human keratinocytes--key cells in wound healing--and tested the hypothesis that the cytotoxic effect of mycolactone is mediated by ROS. METHODOLOGY/PRINCIPAL FINDINGS: The effect of mycolactone on primary skin keratinocyte growth and cell numbers was investigated in serum free growth medium in the presence of different antioxidants. A concentration and time dependent reduction in keratinocyte cell numbers was observed after exposure to mycolactone. Several different antioxidants inhibited this effect partly. The ROS inhibiting substance deferoxamine, which acts via chelation of Fe(2+, completely prevented mycolactone mediated cytotoxicity. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that mycolactone mediated cytotoxicity can be inhibited by deferoxamine, suggesting a role of iron and ROS in mycolactone induced cytotoxicity of keratinocytes. The data provide a basis for the understanding of Buruli ulcer pathology and the development of improved therapies for this disease.

  4. Keratinocyte dysfunction in vitiligo epidermis: cytokine microenvironment and correlation to keratinocyte apoptosis

    OpenAIRE

    Moretti, Silvia; Fabbri, Paolo; Baroni, Gianna; Berti, Samantha; Ban, Daniele; Berti, Emilio; Nassini, Romina; Lotti, Torello; Massi, Daniela

    2009-01-01

    Vitiligo is a skin disorder characterized by loss of functional melanocytes. Keratinocytes contribute to melanocyte homeostasis, and keratinocyte alteration may play a role in melanocyte dysfunction in vitiligo. In particular, the release of melanogenic mediators and the level of functioning keratinocytes may affect melanocyte dysfunction in vitiligo epidermis. Keratinocyte-derived mediators involved in pigmentation, analysed by in situ hybridization, and epidermal apo...

  5. Expression of the cystic fibrosis gene in adult human lung.

    OpenAIRE

    Engelhardt, J F; Zepeda, M; Cohn, J.A.; Yankaskas, J R; Wilson, J. M.

    1994-01-01

    Critical to an understanding of the pulmonary disease in cystic fibrosis (CF) and the development of effective gene therapies is a definition of the distribution and regulation of CF gene expression in adult human lung. Previous studies have detected the product of the CF gene, the CF transmembrane conductance regulator (CFTR), in submucosal glands of human bronchi. In this report, we have characterized the distribution of CFTR RNA and protein in the distal airway and alveoli of human lungs. ...

  6. Efficient keratinocyte differentiation strictly depends on JNK-induced soluble factors in fibroblasts.

    Science.gov (United States)

    Schumacher, Marion; Schuster, Christian; Rogon, Zbigniew M; Bauer, Tobias; Caushaj, Nevisa; Baars, Sebastian; Szabowski, Sibylle; Bauer, Christine; Schorpp-Kistner, Marina; Hess, Jochen; Holland-Cunz, Stefan; Wagner, Erwin F; Eils, Roland; Angel, Peter; Hartenstein, Bettina

    2014-05-01

    Previous studies demonstrated that fibroblast-derived and JUN-dependent soluble factors have a crucial role on keratinocyte proliferation and differentiation during cutaneous wound healing. Furthermore, mice with a deficiency in Jun N-terminal kinases (JNKs) , JNK1 or JNK2, showed impaired skin development and delayed wound closure. To decipher the role of dermal JNK in keratinocyte behavior during these processes, we used a heterologous coculture model combining primary human keratinocytes and murine fibroblasts. Although cocultured JNK1/JNK2-deficient fibroblasts did not affect keratinocyte proliferation, temporal monitoring of the transcriptome of differentiating keratinocytes revealed that efficient keratinocyte differentiation not only requires the support by fibroblast-derived soluble factors, but is also critically dependent on JNK1 and JNK2 signaling in these cells. Moreover, we showed that the repertoire of fibroblast transcripts encoding secreted proteins is severely disarranged upon loss of JNK under the coculture conditions applied. Finally, our data demonstrate that efficient keratinocyte terminal differentiation requires constant presence of JNK-dependent and fibroblast-derived soluble factors. Taken together, our results imply that mesenchymal JNK has a pivotal role in the paracrine cross talk between dermal fibroblasts and epidermal keratinocytes during wound healing. PMID:24335928

  7. Transdifferentiation of adipose-derived stem cells into keratinocyte-like cells: engineering a stratified epidermis.

    Directory of Open Access Journals (Sweden)

    Claudia Chavez-Munoz

    Full Text Available Skin regeneration is an important area of research in the field of tissue-engineering, especially for cases involving loss of massive areas of skin, where current treatments are not capable of inducing permanent satisfying replacements. Human adipose-derived stem cells (ASC have been shown to differentiate in-vitro into both mesenchymal lineages and non-mesenchymal lineages, confirming their transdifferentiation ability. This versatile differentiation potential, coupled with their ease of harvest, places ASC at the advancing front of stem cell-based therapies. In this study, we hypothesized that ASC also have the capacity to transdifferentiate into keratinocyte-like cells and furthermore are able to engineer a stratified epidermis. ASC were successfully isolated from lipoaspirates and cell sorted (FACS. After sorting, ASC were either co-cultured with human keratinocytes or with keratinocyte conditioned media. After a 14-day incubation period, ASC developed a polygonal cobblestone shape characteristic of human keratinocytes. Western blot and q-PCR analysis showed the presence of specific keratinocyte markers including cytokeratin-5, involucrin, filaggrin and stratifin in these keratinocyte-like cells (KLC; these markers were absent in ASC. To further evaluate if KLC were capable of stratification akin to human keratinocytes, ASC were seeded on top of human decellularized dermis and cultured in the presence or absence of EGF and high Ca(2+ concentrations. Histological analysis demonstrated a stratified structure similar to that observed in normal skin when cultured in the presence of EGF and high Ca(2+. Furthermore, immunohistochemical analysis revealed the presence of keratinocyte markers such as involucrin, cytokeratin-5 and cytokeratin-10. In conclusion this study demonstrates for the first time that ASC have the capacity to transdifferentiate into KLC and engineer a stratified epidermis. This study suggests that adipose tissue is potentially a

  8. Adult human metapneumonovirus (hMPV) pneumonia mimicking Legionnaire's disease.

    Science.gov (United States)

    Cunha, Burke A; Irshad, Nadia; Connolly, James J

    2016-01-01

    In adults hospitalized with viral pneumonias the main differential diagnostic consideration is influenza pneumonia. The respiratory viruses causing viral influenza like illnesses (ILIs), e.g., RSV may closely resemble influenza. Rarely, extrapulmonary findings of some ILIs may resemble Legionnaire's disease (LD), e.g., adenovirus, human parainfluenza virus (HPIV-3). We present a most unusual case of human metapneumonovirus pneumonia (hMPV) with some characteristic extrapulmonary findings characteristic of LD, e.g., relative bradycardia, as well as mildly elevated serum transaminases and hyphosphatemia. We believe this is the first reported case of hMPV pneumonia in a hospitalized adult that had some features of LD. PMID:26988110

  9. Modulation of keratinocyte gene expression and differentiation by PPAR-selective ligands and tetradecylthioacetic acid

    DEFF Research Database (Denmark)

    Westergaard, M; Henningsen, J; Svendsen, M L;

    2001-01-01

    Peroxisome proliferator-activated receptors (PPARs) are pleiotropic regulators of growth and differentiation of many cell types. We have performed a comprehensive analysis of the expression of PPARs, transcriptional cofactors, and marker genes during differentiation of normal human keratinocytes ...

  10. The weight of nations: an estimation of adult human biomass

    Directory of Open Access Journals (Sweden)

    Walpole Sarah

    2012-06-01

    Full Text Available Abstract Background The energy requirement of species at each trophic level in an ecological pyramid is a function of the number of organisms and their average mass. Regarding human populations, although considerable attention is given to estimating the number of people, much less is given to estimating average mass, despite evidence that average body mass is increasing. We estimate global human biomass, its distribution by region and the proportion of biomass due to overweight and obesity. Methods For each country we used data on body mass index (BMI and height distribution to estimate average adult body mass. We calculated total biomass as the product of population size and average body mass. We estimated the percentage of the population that is overweight (BMI > 25 and obese (BMI > 30 and the biomass due to overweight and obesity. Results In 2005, global adult human biomass was approximately 287 million tonnes, of which 15 million tonnes were due to overweight (BMI > 25, a mass equivalent to that of 242 million people of average body mass (5% of global human biomass. Biomass due to obesity was 3.5 million tonnes, the mass equivalent of 56 million people of average body mass (1.2% of human biomass. North America has 6% of the world population but 34% of biomass due to obesity. Asia has 61% of the world population but 13% of biomass due to obesity. One tonne of human biomass corresponds to approximately 12 adults in North America and 17 adults in Asia. If all countries had the BMI distribution of the USA, the increase in human biomass of 58 million tonnes would be equivalent in mass to an extra 935 million people of average body mass, and have energy requirements equivalent to that of 473 million adults. Conclusions Increasing population fatness could have the same implications for world food energy demands as an extra half a billion people living on the earth.

  11. An anatomically comprehensive atlas of the adult human brain transcriptome

    NARCIS (Netherlands)

    Hawrylycz, M.J.; Beckmann, C.F.; et al., et al.

    2012-01-01

    Neuroanatomically precise, genome-wide maps of transcript distributions are critical resources to complement genomic sequence data and to correlate functional and genetic brain architecture. Here we describe the generation and analysis of a transcriptional atlas of the adult human brain, comprising

  12. Yokukansan, a Traditional Japanese Medicine, Adjusts Glutamate Signaling in Cultured Keratinocytes

    Directory of Open Access Journals (Sweden)

    Maki Wakabayashi

    2014-01-01

    Full Text Available Glutamate plays an important role in skin barrier signaling. In our previous study, Yokukansan (YKS affected glutamate receptors in NC/Nga mice and was ameliorated in atopic dermatitis lesions. The aim of this study was to assess the effect of YKS on skin and cultured human keratinocytes. Glutamate concentrations in skin of YKS-treated and nontreated NC/Nga mice were measured. Then, glutamate release from cultured keratinocytes was measured, and extracellular glutamate concentrations in YKS-stimulated cultured human keratinocytes were determined. The mRNA expression levels of NMDA receptor 2D (NMDAR2D and glutamate aspartate transporter (GLAST were also determined in YKS-stimulated cultured keratinocytes. The glutamate concentrations and dermatitis scores increased in conventional mice, whereas they decreased in YKS-treated mice. Glutamate concentrations in cell supernatants of cultured keratinocytes increased proportionally to the cell density. However, they decreased dose-dependently with YKS. YKS stimulation increased NMDAR2D in a concentration-dependent manner. Conversely, GLAST decreased in response to YKS. Our findings indicate that YKS affects peripheral glutamate signaling in keratinocytes. Glutamine is essential as a transmitter, and dermatitis lesions might produce and release excess glutamate. This study suggests that, in keratinocytes, YKS controls extracellular glutamate concentrations, suppresses N-methyl-D-aspartate (NMDA receptors, and activates glutamate transport.

  13. Troxerutin induces protective effects against ultraviolet B radiation through the alteration of microRNA expression in human HaCaT keratinocyte cells.

    Science.gov (United States)

    Lee, Kwang Sik; Cha, Hwa Jun; Lee, Ghang Tai; Lee, Kun Kook; Hong, Jin Tae; Ahn, Kyu Joong; An, In-Sook; An, Sungkwan; Bae, Seunghee

    2014-04-01

    Ultraviolet light B (UVB), contained in sunlight, induces damaging effects on skin by impairing cells in the epidermis and dermis. In particular, keratinocytes in the epidermis are those cells which are mainly affected by UVB light. UVB radiation induces cell death, growth arrest, DNA damage and restricts cell migration. Various phytochemicals have been shown to alleviate UVB-induced cellular damage. Troxerutin is a natural flavonoid rutin mainly found in extracts of Sophora japonica, and is a well-known antioxidant and anti-inflammatory compound used in experimental mouse models. In this study, we examined the effects of troxerutin on UVB-induced damage in HaCaT cells. HaCaT cells were pre-treated with troxerutin (0-10 µM) and then exposed to UVB radiation (50 mJ/cm2). Cell viability, cell cycle and migration assays were performed to determine the protective effects of troxerutin on the cells. DNA repair activity was also measured. Troxerutin protected the cells against UVB-induced damage, such as cell death, growth arrest, restriction of cell migration and decreased DNA repair activity in HaCaT cells. Analyses of microRNA (miRNA) expression demonstrated that the protective effects of troxerutin correlated with alterations in miRNA expression, as indicated by Gene Ontology analyses of putative target genes. Overall, our data demonstrate that troxerutin exerts protective effects against UVB-induced damage by regulating miRNA expression.

  14. Identification of Cyclobutane Pyrimidine Dimer-Responsive Genes Using UVB-Irradiated Human Keratinocytes Transfected with In Vitro-Synthesized Photolyase mRNA

    Science.gov (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; van der Horst, Gijsbertus T. J.; Szegedi, Andrea; Horkay, Irén; Emri, Gabriella; Karikó, Katalin; Remenyik, Éva

    2015-01-01

    Major biological effects of UVB are attributed to cyclobutane pyrimidine dimers (CPDs), the most common photolesions formed on DNA. To investigate the contribution of CPDs to UVB-induced changes of gene expression, a model system was established by transfecting keratinocytes with pseudouridine-modified mRNA (Ψ-mRNA) encoding CPD-photolyase. Microarray analyses of this model system demonstrated that more than 50% of the gene expression altered by UVB was mediated by CPD photolesions. Functional classification of the gene targets revealed strong effects of CPDs on the regulation of the cell cycle and transcriptional machineries. To confirm the microarray data, cell cycle-regulatory genes, CCNE1 and CDKN2B that were induced exclusively by CPDs were selected for further investigation. Following UVB irradiation, expression of these genes increased significantly at both mRNA and protein levels, but not in cells transfected with CPD-photolyase Ψ-mRNA and exposed to photoreactivating light. Treatment of cells with inhibitors of c-Jun N-terminal kinase (JNK) blocked the UVB-dependent upregulation of both genes suggesting a role for JNK in relaying the signal of UVB-induced CPDs into transcriptional responses. Thus, photolyase mRNA-based experimental platform demonstrates CPD-dependent and -independent events of UVB-induced cellular responses, and, as such, has the potential to identify novel molecular targets for treatment of UVB-mediated skin diseases. PMID:26121660

  15. Identification of Cyclobutane Pyrimidine Dimer-Responsive Genes Using UVB-Irradiated Human Keratinocytes Transfected with In Vitro-Synthesized Photolyase mRNA.

    Directory of Open Access Journals (Sweden)

    Gábor Boros

    Full Text Available Major biological effects of UVB are attributed to cyclobutane pyrimidine dimers (CPDs, the most common photolesions formed on DNA. To investigate the contribution of CPDs to UVB-induced changes of gene expression, a model system was established by transfecting keratinocytes with pseudouridine-modified mRNA (Ψ-mRNA encoding CPD-photolyase. Microarray analyses of this model system demonstrated that more than 50% of the gene expression altered by UVB was mediated by CPD photolesions. Functional classification of the gene targets revealed strong effects of CPDs on the regulation of the cell cycle and transcriptional machineries. To confirm the microarray data, cell cycle-regulatory genes, CCNE1 and CDKN2B that were induced exclusively by CPDs were selected for further investigation. Following UVB irradiation, expression of these genes increased significantly at both mRNA and protein levels, but not in cells transfected with CPD-photolyase Ψ-mRNA and exposed to photoreactivating light. Treatment of cells with inhibitors of c-Jun N-terminal kinase (JNK blocked the UVB-dependent upregulation of both genes suggesting a role for JNK in relaying the signal of UVB-induced CPDs into transcriptional responses. Thus, photolyase mRNA-based experimental platform demonstrates CPD-dependent and -independent events of UVB-induced cellular responses, and, as such, has the potential to identify novel molecular targets for treatment of UVB-mediated skin diseases.

  16. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes; Mise en evidence de cassures double brin de l'ADN induites par irradiation de keratinocytes humains en microfaisceau alpha

    Energy Technology Data Exchange (ETDEWEB)

    Pouthier, Th

    2006-12-15

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  17. Targeting expression of keratinocyte growth factor to keratinocytes elicits striking changes in epithelial differentiation in transgenic mice.

    OpenAIRE

    Guo, L.; Yu, Q C; E. Fuchs

    1993-01-01

    Keratinocyte growth factor (KGF) is a member of the fibroblast growth factor (FGF) family. Synthesized by cells of the dermal component of skin, KGF's potent mitogenic activity is on the epidermal component, which harbors the receptors for this factor. To explore the possible role of KGF in mesenchymal-epithelial interactions in skin, we used a human keratin 14 promoter to target expression of human KGF cDNA to the stratified squamous epithelia of transgenic mice. Mice expressing KGF in their...

  18. Nitric Oxide Donors Suppress Chemokine Production by Keratinocytes in Vitro and in Vivo

    Science.gov (United States)

    Giustizieri, Maria Laura; Albanesi, Cristina; Scarponi, Claudia; De Pità, Ornella; Girolomoni, Giampiero

    2002-01-01

    Nitric oxide (NO) is involved in the modulation of inflammatory responses. In psoriatic skin, NO is highly produced by epidermal keratinocytes in response to interferon-γ and tumor necrosis factor-α. In this study, we investigated whether the NO donors, S-nitrosoglutathione (GS-NO) and NOR-1, could regulate chemokine production by human keratinocytes activated with interferon-γ and tumor necrosis factor-α. In addition, we studied the effects of the topical application of a GS-NO ointment on chemokine expression in lesional psoriatic skin. NO donors diminished in a dose-dependent manner and at both mRNA and protein levels the IP-10, RANTES, and MCP-1 expression in keratinocytes cultured from healthy patients and psoriatic patients. In contrast, constitutive and induced interleukin-8 production was unchanged. GS-NO-treated psoriatic skin showed reduction of IP-10, RANTES, and MCP-1, but not interleukin-8 expression by keratinocytes. Moreover, the number of CD14+ and CD3+ cells infiltrating the epidermis and papillary dermis diminished significantly. NO donors also down-regulated ICAM-1 protein expression without affecting mRNA accumulation in vitro, and suppressed keratinocyte ICAM-1 in vivo. Finally, NO donors inhibited nuclear factor-κB and STAT-1, but not AP-1 activities in transiently transfected keratinocytes. These results define NO donors as negative regulators of chemokine production by keratinocytes. PMID:12368213

  19. Pimecrolimus Enhances TLR2/6-Induced Expression of Antimicrobial Peptides in Keratinocytes

    OpenAIRE

    Büchau, Amanda S.; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Richard L Gallo

    2008-01-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrol...

  20. Microtubule Disruption in Keratinocytes Induces Cell-Cell Adhesion through Activation of Endogenous E-Cadherin

    OpenAIRE

    Kee, Sun-Ho; Steinert, Peter M.

    2001-01-01

    The association of the cytoskeleton with the cadherin–catenin complex is essential for strong cell-cell adhesion in epithelial cells. In this study, we have investigated the effect of microtubule organization on cell-cell adhesion in differentiating keratinocytes. When microtubules of normal human epidermal keratinocytes (NHEKs) grown in low calcium media (0.05 mM) were disrupted with nocodazole or colcemid, cell-cell adhesion was induced through relocalization of the ...

  1. Combined treatment with sodium butyrate and PD153035 enhances keratinocyte differentiation

    OpenAIRE

    Carrion, Sandra Leon; Sutter, Carrie Hayes; Sutter, Thomas R.

    2014-01-01

    Epidermal growth factor (EGF) receptor (EGFR) signaling is a critical determinant of keratinocyte proliferation and differentiation in both normal and diseased skin. Here we explore the effects of combined treatment with the differentiation-promoting agent sodium butyrate (SB) and the EGFR inhibitor (EGFRI) PD153035 on terminal differentiation of normal human epidermal keratinocytes (NHEKs). Cells treated with SB showed increased expression of the levels of mRNA and protein of the differentia...

  2. Editorial: Technology for higher education, adult learning and human performance

    Directory of Open Access Journals (Sweden)

    Minhong Wang

    2013-09-01

    Full Text Available This special issue is dedicated to technology-enabled approaches for improving higher education, adult learning, and human performance. Improvement of learning and human development for sustainable development has been recognized as a key strategy for individuals, institutions, and organizations to strengthen their competitive advantages. It becomes crucial to help adult learners and knowledge workers to improve their self-directed and life-long learning capabilities. Meanwhile, advances in technology have been increasingly enabling and facilitating learning and knowledge-related initiatives.. They have largely extended learning opportunities through the provision of resource-rich and learner-centered environment, computer-based learning support, and expanded social interactions and networks. Papers in this special issue are representative of ongoing research on integration of technology with learning for innovation and sustainable development in higher education institutions and organizational and community environments.

  3. Neuropeptide Y in the Adult and Fetal Human Pineal Gland

    OpenAIRE

    Morten Møller; Pansiri Phansuwan-Pujito; Corin Badiu

    2014-01-01

    Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passag...

  4. Anti-wrinkle effects of Sargassum muticum ethyl acetate fraction on ultraviolet B-irradiated hairless mouse skin and mechanistic evaluation in the human HaCaT keratinocyte cell line.

    Science.gov (United States)

    Song, Jae Hyoung; Piao, Mei Jing; Han, Xia; Kang, Kyoung Ah; Kang, Hee Kyoung; Yoon, Weon Jong; Ko, Mi Hee; Lee, Nam Ho; Lee, Mi Young; Chae, Sungwook; Hyun, Jin Won

    2016-10-01

    The present study investigated the photoprotective properties of the ethyl acetate fraction of Sargassum muticum (SME) against ultraviolet B (UVB)‑induced skin damage and photoaging in a mouse model. HR‑1 strain hairless male mice were divided into three groups: An untreated control group, a UVB‑irradiated vehicle group and a UVB‑irradiated SME group. The UVB‑irradiated mice in the SME group were orally administered with SME (100 mg/kg body weight in 0.1 ml water per day) and then exposed to radiation at a dose of 60‑120 mJ/cm2. Wrinkle formation and skin damage were evaluated by analysis of skin replicas, epidermal thickness and collagen fiber integrity in the dermal connective tissue. The mechanism underlying the action of SME was also investigated in the human HaCaT keratinocyte cell line following exposure of the cells to UVB at a dose of 30 mJ/cm2. The protein expression levels and activity of matrix metalloproteinase‑1 (MMP‑1), and the binding of activator protein‑1 (AP‑1) to the MMP‑1 promoter were assessed in the HaCaT cells using western blot analysis, an MMP‑1 fluorescent assay and a chromatin immune‑precipitation assay, respectively. The results showed that the mean length and depth of the wrinkles in the UVB‑exposed hairless mice were significantly improved by oral administration of SME, which also prevented the increase in epidermal thickness triggered by UVB irradiation. Furthermore, a marked increase in collagen bundle formation was observed in the UVB‑treated mice with SME administration. SME pretreatment also significantly inhibited the UVB‑induced upregulation in the expression and activity of MMP‑1 in the cultured HaCaT keratinocytes, and the UVB‑enhanced association of AP‑1 with the MMP‑1 promoter. These results suggested that SME may be useful as an anti-photoaging resource for the skin. PMID:27573915

  5. Comparative Cytotoxicity of Glycyrrhiza glabra Roots from Different Geographical Origins Against Immortal Human Keratinocyte (HaCaT), Lung Adenocarcinoma (A549) and Liver Carcinoma (HepG2) Cells.

    Science.gov (United States)

    Basar, Norazah; Oridupa, Olayinka Ayotunde; Ritchie, Kenneth J; Nahar, Lutfun; Osman, Nashwa Mostafa M; Stafford, Angela; Kushiev, Habibjon; Kan, Asuman; Sarker, Satyajit D

    2015-06-01

    Glycyrrhiza glabra L. (Fabaceae), commonly known as 'liquorice', is a well-known medicinal plant. Roots of this plant have long been used as a sweetening and flavouring agent in food and pharmaceutical products, and also as a traditional remedy for cough, upper and lower respiratory ailments, kidney stones, hepatitis C, skin disorder, cardiovascular diseases, diabetes, gastrointestinal ulcers and stomach ache. Previous pharmacological and clinical studies have revealed its antitussive, antiinflammatory, antiviral, antimicrobial, antioxidant, immunomodulatory, hepatoprotective and cardioprotective properties. While glycyrrhizin, a sweet-tasting triterpene saponin, is the principal bioactive compound, several bioactive flavonoids and isoflavonoids are also present in the roots of this plant. In the present study, the cytotoxicity of the methanol extracts of nine samples of the roots of G. glabra, collected from various geographical origins, was assessed against immortal human keratinocyte (HaCaT), lung adenocarcinoma (A549) and liver carcinoma (HepG2) cell lines using the in vitro 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazoliumbromide cell toxicity/viability assay. Considerable variations in levels of cytotoxicity were observed among various samples of G. glabra.

  6. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Katherine J Zappia

    Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.

  7. In vitro proliferation of adult human beta-cells.

    Directory of Open Access Journals (Sweden)

    Sabine Rutti

    Full Text Available A decrease in functional beta-cell mass is a key feature of type 2 diabetes. Glucagon-like peptide 1 (GLP-1 analogues induce proliferation of rodent beta-cells. However, the proliferative capacity of human beta-cells and its modulation by GLP-1 analogues remain to be fully investigated. We therefore sought to quantify adult human beta-cell proliferation in vitro and whether this is affected by the GLP-1 analogue liraglutide.Human islets from 7 adult cadaveric organ donors were dispersed into single cells. Beta-cells were purified by FACS. Non-sorted cells and the beta-cell enriched ("beta-cells" population were plated on extracellular matrix from rat (804G and human bladder carcinoma cells (HTB9 or bovine corneal endothelial ECM (BCEC. Cells were maintained in culture+/-liraglutide for 4 days in the presence of BrdU.Rare human beta-cell proliferation could be observed either in the purified beta-cell population (0.051±0.020%; 22 beta-cells proliferating out of 84'283 beta-cells counted or in the non-sorted cell population (0.055±0.011%; 104 proliferating beta-cells out of 232'826 beta-cells counted, independently of the matrix or the culture conditions. Liraglutide increased human beta-cell proliferation on BCEC in the non-sorted cell population (0.082±0.034% proliferating beta-cells vs. 0.017±0.008% in control, p<0.05.These results indicate that adult human beta-cell proliferation can occur in vitro but remains an extremely rare event with these donors and particular culture conditions. Liraglutide increases beta-cell proliferation only in the non-sorted cell population and only on BCEC. However, it cannot be excluded that human beta-cells may proliferate to a greater extent in situ in response to natural stimuli.

  8. Scanning Ion Conductance Microscopy of Live Keratinocytes

    Science.gov (United States)

    Hegde, V.; Mason, A.; Saliev, T.; Smith, F. J. D.; McLean, W. H. I.; Campbell, P. A.

    2012-07-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (

  9. Evaluation of the cytotoxic effects of humid lightweight coal ash derived from the disposal of waste on normal human keratinocyte and endothelial cell lines in 2-D and 3-D culture.

    Science.gov (United States)

    Scanarotti, Chiara; Vernazza, Stefania; Brignone, Massimiliano; Danailova, Jenia; Pronzato, Maria A; Bassi, Anna M

    2013-12-01

    The presence of waste in the environment has frequently been indicated as a significant risk to human health. Therefore, landfill sites and the disposal of urban solid and non-hazardous waste by incineration are subject to much environmental monitoring, in addition to the regulations already in place. However, little action has been taken, and consequently no specific legislation exists, in relation to the assessment of the real biological risk of various substances, including chemical mixtures and ashes, derived from the incineration processes. This study assessed the cytotoxic potential of humid lightweight coal ash (LA) derived from incineration processes and waste management, on two cell lines: NCTC 2544 normal human keratinocytes and HECV endothelial cells. To reach this goal and to assess more-realistic methods for animal replacement, we employed different in vitro experimental approaches: acute and longer exposure to LA, by direct and indirect contact (0-2mg/ml and 16mg, respectively), both in 2-D and 3-D cultures. In 2-D HECV cultures, we observed a decrease in the viability index, but only during direct contact with LA doses higher than 0.1mg/ml. Moreover, some striking differences in cytotoxicity were observed between the 2-D and 3-D models. Taken together, these observations indicate that, for studying pollutant toxicity during longer exposure times, 3-D cultures in direct contact with the pollutant seem to offer a more suitable approach - they mimic the in vivo behaviour of cells more realistically and under strictly controlled conditions. Thus, in readiness for possible forthcoming European regulations, we believe that the proposed study, even in its preliminary phase, can provide new advice on the assessment of the toxic and biological potential of particular chemical compounds derived from waste management processes. PMID:24512233

  10. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (γ-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK).

    Science.gov (United States)

    Kleszczyński, Konrad; Zillikens, Detlef; Fischer, Tobias W

    2016-09-01

    Melatonin is an ubiquitous molecule with a variety of functions including potent antioxidative properties. Due to its lipophilic character, it easily crosses cellular and intracellular membranes and reaches all subcellular organelles. Because of its ability to scavenge free radicals, melatonin protects against oxidative stress, for example, induced by ultraviolet radiation (UVR). Here, we investigated, in a dose-dependent (0, 10, 25, and 50 mJ/cm(2) ) and time-dependent (0, 4, 24, 48 hr post-UVR) manner, whether melatonin prevents the UVR-mediated alterations in ATP synthesis and the generation of reactive oxygen species (ROS) in normal human epidermal keratinocytes (NHEK). Additionally, we evaluated the molecular mechanism of action of melatonin with regard to activation of phase-2 antioxidative enzymes via nuclear erythroid 2-related factor (Nrf2). We found that (i) melatonin counteracted UVR-induced alterations in the ATP synthesis and reduced free radical formation; (ii) melatonin induced the translocation of Nrf2 transcription factor from the cytosol into the nucleus resulting in, (iii) melatonin enhanced gene expression of phase-2 antioxidative enzymes including γ-glutamylcysteine synthetase (γ-GCS), heme oxygenase-1 (HO-1), and NADPH: quinone dehydrogenase-1 (NQO1) representing an elevated antioxidative response of keratinocytes. These results suggest that melatonin not only directly scavenges ROS, but also significantly induces the activation of phase-2 antioxidative enzymes via the Nrf2 pathway uncovering a new action mechanism that supports the ability of keratinocytes to protect themselves from UVR-mediated oxidative stress. PMID:27117941

  11. Ontogeny of morningness-eveningness across the adult human lifespan

    Science.gov (United States)

    Randler, Christoph

    2016-02-01

    Sleep timing of humans can be classified alongside a continuum from early to late sleepers, with some people (larks) having an early activity, early bed, and rise times and others (owls) with a more nocturnally orientated activity. Only a few studies reported that morningness-eveningness changes significantly during the adult lifespan based on community samples. Here, I applied a different methodological approach to seek for evidence for the age-related changes in morningness-eveningness preferences by using a meta-data from all available studies. The new aspect of this cross-sectional approach is that only a few studies themselves address the age-related changes of the adult lifespan development, but that many studies are available that provide exactly the data needed. The studies came from 27 countries and included 36,939 participants. Age was highly significantly correlated with scores on the Composite Scale of Morningness ( r = 0.70). This relationship seems linear, because a linear regression explained nearly the same amount of variance compared to other models such as logarithmic, quadratic, or cubic models. The standard deviation of age correlated with the standard deviation of CSM scores ( r = 0.55), suggesting when there is much variance in age in a study; in turn, there is much variance in morningness. This meta-analytical approach shows that morningness-eveningness changes across the adult lifespan and that older age is related to higher morningness.

  12. EFFECTS OF ARSENITE IN TELOMERE AND TELOMERASE IN RELATION TO CELL PROLIFERATION AND APOPTOSIS IN HUMAN KERATINOCYTES AND LEUKEMIA CELLS IN VITRO

    Science.gov (United States)

    Telomeres are critical in maintaining chromosome and genomic stability. Arsenic, a human carcinogen as well as an anticancer agent, is known for its clastogenicity. To better understand molecular mechanisms of arsenic actions, we investigated arsenite effects on telomere and telo...

  13. Tumourigenesis Driven by the Human Papillomavirus Type 16 Asian-American E6 Variant in a Three-Dimensional Keratinocyte Model

    OpenAIRE

    Robert Jackson; Melissa Togtema; Lambert, Paul F.; Ingeborg Zehbe

    2014-01-01

    Infection with a transforming human papillomavirus (HPV) such as type 16 (of species Alphapapillomavirus 9) causes ano-genital and oral tumours via viral persistence in human squamous cell epithelia. Epidemiological studies showed that the naturally occurring HPV16 Asian-American (AA) variant (sublineage D2/D3) is found more often than the European Prototype (EP) (sublineage A1) in high-grade cervical neoplasia and tumours compared to non-cancer controls. Just three amino acid changes within ...

  14. Melatonin protects skin keratinocyte from hydrogen peroxide-mediated cell death via the SIRT1 pathway.

    Science.gov (United States)

    Lee, Ju-Hee; Moon, Ji-Hong; Nazim, Uddin Md; Lee, You-Jin; Seol, Jae-Won; Eo, Seong-Kug; Lee, John-Hwa; Park, Sang-Youel

    2016-03-15

    Melatonin (N-acetyl-5-methoxytryptamine), which is primarily synthesized in and secreted from the pineal gland, plays a pivotal role in cell proliferation as well as in the regulation of cell metastasis and cell survival in a diverse range of cells. The aim of this study is to investigate protection effect of melatonin on H2O2-induced cell damage and the mechanisms of melatonin in human keratinocytes. Hydrogen peroxide dose-dependently induced cell damages in human keratinocytes and co-treatment of melatonin protected the keratinocytes against H2O2-induced cell damage. Melatonin treatment activated the autophagy flux signals, which were identified by the decreased levels of p62 protein. Inhibition of autophagy flux via an autophagy inhibitor and ATG5 siRNA technique blocked the protective effects of melatonin against H2O2-induced cell death in human keratinocytes. And we found the inhibition of sirt1 using sirtinol and sirt1 siRNA reversed the protective effects of melatonin and induces the autophagy process in H2O2-treated cells. This is the first report demonstrating that autophagy flux activated by melatonin protects human keratinocytes through sirt1 pathway against hydrogen peroxide-induced damages. And this study also suggest that melatonin could potentially be utilized as a therapeutic agent in skin disease. PMID:26918354

  15. Melatonin protects skin keratinocyte from hydrogen peroxide-mediated cell death via the SIRT1 pathway

    Science.gov (United States)

    Lee, Ju-Hee; Moon, Ji-Hong; Nazim, Uddin MD.; Lee, You-Jin; Seol, Jae-Won; Eo, Seong-Kug; Lee, John-Hwa; Park, Sang-Youel

    2016-01-01

    Melatonin (N-acetyl-5-methoxytryptamine), which is primarily synthesized in and secreted from the pineal gland, plays a pivotal role in cell proliferation as well as in the regulation of cell metastasis and cell survival in a diverse range of cells. The aim of this study is to investigate protection effect of melatonin on H2O2-induced cell damage and the mechanisms of melatonin in human keratinocytes. Hydrogen peroxide dose-dependently induced cell damages in human keratinocytes and co-treatment of melatonin protected the keratinocytes against H2O2-induced cell damage. Melatonin treatment activated the autophagy flux signals, which were identified by the decreased levels of p62 protein. Inhibition of autophagy flux via an autophagy inhibitor and ATG5 siRNA technique blocked the protective effects of melatonin against H2O2-induced cell death in human keratinocytes. And we found the inhibition of sirt1 using sirtinol and sirt1 siRNA reversed the protective effects of melatonin and induces the autophagy process in H2O2-treated cells. This is the first report demonstrating that autophagy flux activated by melatonin protects human keratinocytes through sirt1 pathway against hydrogen peroxide-induced damages. And this study also suggest that melatonin could potentially be utilized as a therapeutic agent in skin disease. PMID:26918354

  16. Intrinsic differences between oral and skin keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anna Turabelidze

    Full Text Available Keratinocytes cover both the skin and some oral mucosa, but the morphology of each tissue and the behavior of the keratinocytes from these two sites are different. One significant dissimilarity between the two sites is the response to injury. Oral mucosal wounds heal faster and with less inflammation than equivalent cutaneous wounds. We hypothesized that oral and skin keratinocytes might have intrinsic differences at baseline as well as in the response to injury, and that such differences would be reflected in gene expression profiles.

  17. The human keratinocyte two-dimensional protein database (update 1994): towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Olsen, E;

    1994-01-01

    identified (protein name, organelle components, etc.) using one or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry and (v...

  18. Characterization of TNFα- and IL-17A-mediated synergistic induction of DEFB4 gene expression in human keratinocytes through IκBζ

    DEFF Research Database (Denmark)

    Johansen, Claus; Bertelsen, Trine; Ljungberg, Christine;

    2016-01-01

    Human β-defensin 2 (hBD2), encoded by the DEFB4 gene, is an antimicrobial peptide playing an essential role in inflammatory processes in the skin. hBD2 expression is regulated synergistically by TNFα and IL-17A, however, the underlying regulatory mechanisms behind are unknown. The purpose...

  19. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  20. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  1. Salivary trefoil factor 3 enhances migration of oral keratinocytes.

    Science.gov (United States)

    Storesund, Trond; Hayashi, Katsuhiko; Kolltveit, Kristin M; Bryne, Magne; Schenck, Karl

    2008-04-01

    Trefoil factor 3 (TFF3) is a member of the mammalian TFF family. Trefoil factors are secreted onto mucosal surfaces of the entire body and exert different effects according to tissue location. Trefoil factors may enhance mucosal healing by modulating motogenic activity, inhibiting apoptosis, and promoting angiogenesis. Trefoil factor 3 is secreted from the submandibular gland and is present in whole saliva. The aim of this study was to assess the migratory and proliferative effects of TFF3 on primary oral human keratinocytes and oral cancer cell lines. The addition of TFF3 increased the migration of both normal oral keratinocytes and the cancer cell line D12, as evaluated by a two-dimensional scratch assay. By contrast, no increase in proliferation or energy metabolism was observed after stimulation with TFF3. Trefoil factor 3-enhanced migration was found to be driven partly by the extracellular signal-related kinase (Erk1/2) pathway, as shown by addition of the mitogen-activated protein kinase (MAPK) inhibitor PD 98059. Previous functional studies on trefoil peptides have all been based on cells from monolayered epithelium like the intestinal mucosa; this is the first report to show that normal and cancerous keratinocytes from stratified epithelium respond to TFF stimuli. Taken together, salivary TFF3 is likely to contribute to oral wound healing.

  2. A Model to Predict the Risk of Keratinocyte Carcinomas.

    Science.gov (United States)

    Whiteman, David C; Thompson, Bridie S; Thrift, Aaron P; Hughes, Maria-Celia; Muranushi, Chiho; Neale, Rachel E; Green, Adele C; Olsen, Catherine M

    2016-06-01

    Basal cell and squamous cell carcinomas of the skin are the commonest cancers in humans, yet no validated tools exist to estimate future risks of developing keratinocyte carcinomas. To develop a prediction tool, we used baseline data from a prospective cohort study (n = 38,726) in Queensland, Australia, and used data linkage to capture all surgically excised keratinocyte carcinomas arising within the cohort. Predictive factors were identified through stepwise logistic regression models. In secondary analyses, we derived separate models within strata of prior skin cancer history, age, and sex. The primary model included terms for 10 items. Factors with the strongest effects were >20 prior skin cancers excised (odds ratio 8.57, 95% confidence interval [95% CI] 6.73-10.91), >50 skin lesions destroyed (odds ratio 3.37, 95% CI 2.85-3.99), age ≥ 70 years (odds ratio 3.47, 95% CI 2.53-4.77), and fair skin color (odds ratio 1.75, 95% CI 1.42-2.15). Discrimination in the validation dataset was high (area under the receiver operator characteristic curve 0.80, 95% CI 0.79-0.81) and the model appeared well calibrated. Among those reporting no prior history of skin cancer, a similar model with 10 factors predicted keratinocyte carcinoma events with reasonable discrimination (area under the receiver operator characteristic curve 0.72, 95% CI 0.70-0.75). Algorithms using self-reported patient data have high accuracy for predicting risks of keratinocyte carcinomas.

  3. Neuropeptide Y in the Adult and Fetal Human Pineal Gland

    Directory of Open Access Journals (Sweden)

    Morten Møller

    2014-01-01

    Full Text Available Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passage and primarily located in a perifollicular position with some fibers entering the pineal parenchyma inside the follicle. The distance from the immunoreactive terminals to the pinealocytes indicates a modulatory function of neuropeptide Y for pineal physiology. Some of the immunoreactive fibers might originate from neurons located in the brain and be a part of the central innervation of the pineal gland. In a series of human fetuses, neuropeptide Y-containing nerve fibers was present and could be detected as early as in the pineal of four- to five-month-old fetuses. This early innervation of the human pineal is different from most rodents, where the innervation starts postnatally.

  4. Neuropeptide Y in the adult and fetal human pineal gland

    DEFF Research Database (Denmark)

    Møller, Morten; Phansuwan-Pujito, Pansiri; Badiu, Corin

    2014-01-01

    Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we...... show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passage and primarily located in a perifollicular position with some fibers entering the pineal parenchyma...... inside the follicle. The distance from the immunoreactive terminals to the pinealocytes indicates a modulatory function of neuropeptide Y for pineal physiology. Some of the immunoreactive fibers might originate from neurons located in the brain and be a part of the central innervation of the pineal gland...

  5. Peptides from Tetraspanin CD9 Are Potent Inhibitors of Staphylococcus Aureus Adherence to Keratinocytes.

    Science.gov (United States)

    Ventress, Jennifer K; Partridge, Lynda J; Read, Robert C; Cozens, Daniel; MacNeil, Sheila; Monk, Peter N

    2016-01-01

    Staphylococcus aureus is one of the primary causative agents of skin and wound infections. As bacterial adherence is essential for infection, blocking this step can reduce invasion of host tissues by pathogens. An anti-adhesion therapy, based on a host membrane protein family, the tetraspanins, has been developed that can inhibit the adhesion of S. aureus to human cells. Synthetic peptides derived from a keratinocyte-expressed tetraspanin, CD9, were tested for anti-adhesive properties and at low nanomolar concentrations were shown to inhibit bacterial adhesion to cultured keratinocytes and to be effective in a tissue engineered model of human skin infection. These potential therapeutics had no effect on keratinocyte viability, migration or proliferation, indicating that they could be a valuable addition to current treatments for skin infection. PMID:27467693

  6. Human herpesvirus 7 is a constitutive inhabitant of adult human saliva.

    OpenAIRE

    Wyatt, L S; Frenkel, N

    1992-01-01

    We report the frequent isolation of human herpesvirus 7 from the saliva of healthy adults. Virus isolates recovered from different individuals exhibited minimal restriction enzyme polymorphism, which was mostly confined to heterogeneous (het) sequences in the genome. DNAs of isolates recovered from the same individual over a period of several months showed the same characteristic het fragments, indicating the stability of the het sequences upon virus replication and shedding in vivo. In contr...

  7. Induction of dental epithelial cell differentiation marker gene expression in non-odontogenic human keratinocytes by transfection with thymosin beta 4

    Directory of Open Access Journals (Sweden)

    Tamotsu Kiyoshima

    2014-01-01

    Full Text Available Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported that thymosin beta 4 (Tmsb4x is closely related to the initiation and development of the tooth germ. We herein attempted to establish odontogenic epithelial cells from non-odontogenic HaCaT cells by transfection with TMSB4X. TMSB4X-transfected cells formed nodules that were positive for Alizarin-red S (ALZ and von Kossa staining (calcium phosphate deposits when cultured in calcification-inducing medium. Three selected clones showing larger amounts of calcium deposits than the other clones, expressed PITX2, Cytokeratin 14, and Sonic Hedgehog. The upregulation of odontogenesis-related genes, such as runt-related transcription factor 2 (RUNX2, Amelogenin (AMELX, Ameloblastin (AMBN and Enamelin (ENAM was also detected. These proteins were immunohistochemically observed in nodules positive for the ALZ and von Kossa staining. RUNX2-positive selected TMSB4X-transfected cells implanted into the dorsal subcutaneous tissue of nude mice formed matrix deposits. Immunohistochemically, AMELX, AMBN and ENAM were observed in the matrix deposits. This study demonstrated the possibility of induction of dental epithelial cell differentiation marker gene expression in non-odontogenic HaCaT cells by TMSB4X.

  8. A biokinetic model for systemic technetium in adult humans

    International Nuclear Information System (INIS)

    The International Commission on Radiological Protection (ICRP) currently is updating its biokinetic and dosimetric models for internally deposited radionuclides. Technetium (Tc), the lightest element that exists only in radioactive form, has two important isotopes from the standpoint of potential risk to humans: the long-lived isotope99Tm(T1/2=2.1x105 y) is present in high concentration in nuclear waste, and the short-lived isotope 99mTc (T1/2=6.02 h) is the most commonly used radionuclide in diagnostic nuclear medicine. This paper reviews data on the biological behavior of technetium and proposes a biokinetic model for systemic technetium in the adult human body for use in radiation protection. Compared with the ICRP s current occupational model for systemic technetium, the proposed model provides a more realistic description of the paths of movement of technetium in the body; provides greater consistency with experimental and medical data; and, for most radiosensitive organs, yields substantially different estimates of cumulative activity (total radioactive decays within the organ) following uptake of 99Tm or 99mTc to blood

  9. Comprehensive cellular-resolution atlas of the adult human brain.

    Science.gov (United States)

    Ding, Song-Lin; Royall, Joshua J; Sunkin, Susan M; Ng, Lydia; Facer, Benjamin A C; Lesnar, Phil; Guillozet-Bongaarts, Angie; McMurray, Bergen; Szafer, Aaron; Dolbeare, Tim A; Stevens, Allison; Tirrell, Lee; Benner, Thomas; Caldejon, Shiella; Dalley, Rachel A; Dee, Nick; Lau, Christopher; Nyhus, Julie; Reding, Melissa; Riley, Zackery L; Sandman, David; Shen, Elaine; van der Kouwe, Andre; Varjabedian, Ani; Write, Michelle; Zollei, Lilla; Dang, Chinh; Knowles, James A; Koch, Christof; Phillips, John W; Sestan, Nenad; Wohnoutka, Paul; Zielke, H Ronald; Hohmann, John G; Jones, Allan R; Bernard, Amy; Hawrylycz, Michael J; Hof, Patrick R; Fischl, Bruce; Lein, Ed S

    2016-11-01

    Detailed anatomical understanding of the human brain is essential for unraveling its functional architecture, yet current reference atlases have major limitations such as lack of whole-brain coverage, relatively low image resolution, and sparse structural annotation. We present the first digital human brain atlas to incorporate neuroimaging, high-resolution histology, and chemoarchitecture across a complete adult female brain, consisting of magnetic resonance imaging (MRI), diffusion-weighted imaging (DWI), and 1,356 large-format cellular resolution (1 µm/pixel) Nissl and immunohistochemistry anatomical plates. The atlas is comprehensively annotated for 862 structures, including 117 white matter tracts and several novel cyto- and chemoarchitecturally defined structures, and these annotations were transferred onto the matching MRI dataset. Neocortical delineations were done for sulci, gyri, and modified Brodmann areas to link macroscopic anatomical and microscopic cytoarchitectural parcellations. Correlated neuroimaging and histological structural delineation allowed fine feature identification in MRI data and subsequent structural identification in MRI data from other brains. This interactive online digital atlas is integrated with existing Allen Institute for Brain Science gene expression atlases and is publicly accessible as a resource for the neuroscience community. J. Comp. Neurol. 524:3127-3481, 2016. © 2016 The Authors The Journal of Comparative Neurology Published by Wiley Periodicals, Inc.

  10. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Directory of Open Access Journals (Sweden)

    Xiuju Dai

    Full Text Available Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal.

  11. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Science.gov (United States)

    Dai, Xiuju; Okazaki, Hidenori; Hanakawa, Yasushi; Murakami, Masamoto; Tohyama, Mikiko; Shirakata, Yuji; Sayama, Koji

    2013-01-01

    Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal. PMID:23874436

  12. Professional Fulfillment and Satisfaction of US and Canadian Adult Education and Human Resource Development Faculty

    Science.gov (United States)

    Peterson, Shari L.; Wiesenberg, Faye

    2004-01-01

    This comparative study explored the professional fulfillment and job satisfaction of US and Canadian college and university faculty in the fields of Adult Education and Human Resource Development. In Autumn 2001, we disseminated electronically "The Adult Education and Human Resource Development Faculty Survey" to a selected sample of Canadian and…

  13. Sodium fluoride influences the expression of keratins in cultured keratinocytes

    OpenAIRE

    Prado, Euridice; Wurtz, Tilmann; Ferbus, Didier; Shabana, El-Hassan; FOREST, Nadine; Berdal, Ariane

    2010-01-01

    Epithelia in lung, skin, and kidney are often exposed to fluoride, and tissue damage in lung and kidney due to fluoride is well documented. Nevertheless, the biological effects of fluoride on epithelia are poorly investigated. In the present study, we report effects of sodium fluoride (NaF) on the differentiation of a human epithelial cell line, HaCaT. These cells may serve as a keratinocyte model, because they express a wide spectrum of keratins (Ks), and they associate into stratified tissu...

  14. Vaccinia virus induces rapid necrosis in keratinocytes by a STAT3-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Yong He

    Full Text Available Humans with a dominant negative mutation in STAT3 are susceptible to severe skin infections, suggesting an essential role for STAT3 signaling in defense against cutaneous pathogens.To focus on innate antiviral defenses in keratinocytes, we used a standard model of cutaneous infection of severe combined immunodeficient mice with the current smallpox vaccine, ACAM-2000. In parallel, early events post-infection with the smallpox vaccine ACAM-2000 were investigated in cultured keratinocytes of human and mouse origin.Mice treated topically with a STAT3 inhibitor (Stattic developed larger vaccinia lesions with higher virus titers and died more rapidly than untreated controls. Cultured human and murine keratinocytes infected with ACAM-2000 underwent rapid necrosis, but when treated with Stattic or with inhibitors of RIP1 kinase or caspase-1, they survived longer, produced higher titers of virus, and showed reduced activation of type I interferon responses and inflammatory cytokines release. Treatment with inhibitors of RIP1 kinase and STAT3, but not caspase-1, also reduced the inflammatory response of keratinocytes to TLR ligands. Vaccinia growth properties in Vero cells, which are known to be defective in some antiviral responses, were unaffected by inhibition of RIP1K, caspase-1, or STAT3.Our findings indicate that keratinocytes suppress the replication and spread of vaccinia virus by undergoing rapid programmed cell death, in a process requiring STAT3. These data offer a new framework for understanding susceptibility to skin infection in patients with STAT3 mutations. Interventions which promote prompt necroptosis/pyroptosis of infected keratinocytes may reduce risks associated with vaccination with live vaccinia virus.

  15. Effective inhibition of melanosome transfer to keratinocytes by lectins and niacinamide is reversible.

    Science.gov (United States)

    Greatens, Amanda; Hakozaki, Tomohiro; Koshoffer, Amy; Epstein, Howard; Schwemberger, Sandy; Babcock, George; Bissett, Donald; Takiwaki, Hirotsugu; Arase, Seiji; Wickett, R Randall; Boissy, Raymond E

    2005-07-01

    Skin pigmentation results in part from the transfer of melanized melanosomes synthesized by melanocytes to neighboring keratinocytes. Plasma membrane lectins and their glycoconjugates expressed by these epidermal cells are critical molecules involved in this transfer process. In addition, the derivative of vitamin B(3), niacinamide, can inhibit melanosome transfer and induce skin lightening. We investigated the effects of these molecules on the viability of melanocytes and keratinocytes and on the reversibility of melanosome-transfer inhibition induced by these agents using an in vitro melanocyte-keratinocyte coculture model system. While lectins and neoglycoproteins could induce apoptosis in a dose-dependent manner to melanocytes or keratinocytes in monoculture, similar dosages of the lectins, as opposed to neoglycoproteins, did not induce apoptosis to either cell type when treated in coculture. The dosages of lectins and niacinamide not affecting cell viability produced an inhibitory effect on melanosome transfer, when used either alone or together in cocultures of melanocytes-keratinocytes. Cocultures treated with lectins or niacinamide resumed normal melanosome transfer in 3 days after removal of the inhibitor, while cocultures treated with a combination of lectins and niacinamide demonstrated a lag in this recovery. Subsequently, we assessed the effect of niacinamide on facial hyperpigmented spots using a vehicle-controlled, split-faced design human clinical trial. Topical application of niacinamide resulted in a dose-dependent and reversible reduction in hyperpigmented lesions. These results suggest that lectins and niacinamide at concentrations that do not affect cell viability are reversible inhibitors of melanosome transfer.

  16. Production of superoxide anions by keratinocytes initiates P. acnes-induced inflammation of the skin.

    Directory of Open Access Journals (Sweden)

    Philippe A Grange

    2009-07-01

    Full Text Available Acne vulgaris is a chronic inflammatory disorder of the sebaceous follicles. Propionibacterium acnes (P. acnes, a gram-positive anareobic bacterium, plays a critical role in the development of these inflammatory lesions. This study aimed at determining whether reactive oxygen species (ROS are produced by keratinocytes upon P. acnes infection, dissecting the mechanism of this production, and investigating how this phenomenon integrates in the general inflammatory response induced by P. acnes. In our hands, ROS, and especially superoxide anions (O2(*-, were rapidly produced by keratinocytes upon stimulation by P. acnes surface proteins. In P. acnes-stimulated keratinocytes, O2(*- was produced by NAD(PH oxidase through activation of the scavenger receptor CD36. O2(*- was dismuted by superoxide dismutase to form hydrogen peroxide which was further detoxified into water by the GSH/GPx system. In addition, P. acnes-induced O2(*- abrogated P. acnes growth and was involved in keratinocyte lysis through the combination of O2(*- with nitric oxide to form peroxynitrites. Finally, retinoic acid derivates, the most efficient anti-acneic drugs, prevent O2(*- production, IL-8 release and keratinocyte apoptosis, suggesting the relevance of this pathway in humans.

  17. 亚砷酸钠对人永生化角质形成细胞株恶性转化的影响%Effect of sodium arsenite on malignant transformation of human immortalized keratinocyte cell lines

    Institute of Scientific and Technical Information of China (English)

    李艳玲; 胡玉贤; 张晓光; 王凌

    2016-01-01

    BACKGROUND:Studies have found that sodium arsenite can cause the malignant transformation and tumorigenicity of HaCaT cels, but whether low concentrations of sodium arsenite can cause the malignant transformation is rarely reported. OBJECTIVE:To study the effect of sodium arsenite on the malignant transformation of human immortalized keratinocyte cel lines. METHODS:HaCaT cels were treated with different concentrations of sodium arsenite. MTT assay was used to determine the effect of sodium arsenite on HaCaT cel morphology and proliferation, flow cytometry used to detect the effect of sodium arsenite on HaCaT cel cycle, and soft agar colony formation experiments assay used to determine the effect of sodium arsenite on HaCaT cel colony formation capacity. RESULTS AND CONCLUSION: HaCaT cels grew wel when the concentration of sodium arsenite was 5 mol/L, but the cel growth was inhibited under intervention with 10 and 50 mol/L sodium arsenite. HaCaT cels treated with 0.1 mol/L sodium arsenite were passaged to the 20th generation, and cel morphology had no notable changes; cels at passage 25 exhibited enlarged size and multiple nucleoli, which had a continued proliferation trend. Compared with the primarily cultured cels, 0.1 mol/L sodium arsenite-treated HaCaT cels at passages 15 and 25 had an increased proportion at S phase and G2/M phase, with strengthened proliferation ability and increased colony-forming efficiency, and moreover, the proliferation ability and colony-forming efficiency of passage 25 cels were higher than those of passage 15 cels. These experimental data show that high concentrations of sodium arsenite reduce HaCaT cel viability, and low concentrations of sodium sulfite have a certain influence on the morphology, cel cycle, proliferation ability and colony-forming efficiency of HaCaT cels, and moreover, the proliferation ability and colony-forming efficiency of human immortalized keratinocytes wil be strengthened with the increase of passage.%背景

  18. Functional Characterization of Cultured Keratinocytes after Acute Cutaneous Burn Injury

    OpenAIRE

    Gauglitz, Gerd G; Siegfried Zedler; Felix von Spiegel; Jasmin Fuhr; Guido Henkel von Donnersmarck; Eugen Faist

    2012-01-01

    BACKGROUND: In addition to forming the epithelial barrier against the outside environment keratinocytes are immunologically active cells. In the treatment of severely burned skin, cryoconserved keratinocyte allografts gain in importance. It has been proposed that these allografts accelerate wound healing also due to the expression of a favourable--keratinocyte-derived--cytokine and growth factor milieu. METHODS: In this study the morphology and cytokine expression profile of keratinocytes fro...

  19. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults.

    Directory of Open Access Journals (Sweden)

    Nadja Larsen

    Full Text Available BACKGROUND: Recent evidence suggests that there is a link between metabolic diseases and bacterial populations in the gut. The aim of this study was to assess the differences between the composition of the intestinal microbiota in humans with type 2 diabetes and non-diabetic persons as control. METHODS AND FINDINGS: The study included 36 male adults with a broad range of age and body-mass indices (BMIs, among which 18 subjects were diagnosed with diabetes type 2. The fecal bacterial composition was investigated by real-time quantitative PCR (qPCR and in a subgroup of subjects (N = 20 by tag-encoded amplicon pyrosequencing of the V4 region of the 16S rRNA gene. The proportions of phylum Firmicutes and class Clostridia were significantly reduced in the diabetic group compared to the control group (P = 0.03. Furthermore, the ratios of Bacteroidetes to Firmicutes as well as the ratios of Bacteroides-Prevotella group to C. coccoides-E. rectale group correlated positively and significantly with plasma glucose concentration (P = 0.04 but not with BMIs. Similarly, class Betaproteobacteria was highly enriched in diabetic compared to non-diabetic persons (P = 0.02 and positively correlated with plasma glucose (P = 0.04. CONCLUSIONS: The results of this study indicate that type 2 diabetes in humans is associated with compositional changes in intestinal microbiota. The level of glucose tolerance should be considered when linking microbiota with metabolic diseases such as obesity and developing strategies to control metabolic diseases by modifying the gut microbiota.

  20. Effects triggered by platinum nanoparticles on primary keratinocytes.

    Science.gov (United States)

    Konieczny, Piotr; Goralczyk, Anna Grazyna; Szmyd, Radoslaw; Skalniak, Lukasz; Koziel, Joanna; Filon, Francesca Larese; Crosera, Matteo; Cierniak, Agnieszka; Zuba-Surma, Ewa K; Borowczyk, Julia; Laczna, Eliza; Drukala, Justyna; Pyza, Elzbieta; Semik, Danuta; Woznicka, Olga; Klein, Andrzej; Jura, Jolanta

    2013-01-01

    The platinum (Pt)-group elements (PGEs) represent a new kind of environmental pollutant and a new hazard for human health. Since their introduction as vehicle-exhaust catalysts, their emissions into the environment have grown considerably compared with their low natural concentration in the earth crust. PGE emissions from vehicle catalysts can be also in the form of nanometer-sized particles (Pt nanoparticles [PtNPs]). These elements, both in their metallic form or as ions solubilized in biological media, are now recognized as potent allergens and sensitizers. Human skin is always exposed to toxic particles; therefore, in the present study we addressed the question of whether polyvinylpyrrolidone-coated PtNPs may have any negative effects on skin cells, including predominantly epidermal keratinocytes. In this study, PtNPs of two sizes were used: 5.8 nm and 57 nm, in concentrations of 6.25, 12.5, and 25 μg/mL. Both types of NPs were protected with polyvinylpyrrolidone. Primary keratinocytes were treated for 24 and 48 hours, then cytotoxicity, genotoxicity, morphology, metabolic activity, and changes in the activation of signaling pathways were investigated in PtNP-treated cells. We found that PtNPs trigger toxic effects on primary keratinocytes, decreasing cell metabolism, but these changes have no effects on cell viability or migration. Moreover, smaller NPs exhibited more deleterious effect on DNA stability than the big ones. Analyzing activation of caspases, we found changes in activity of caspase 9 and caspase 3/7 triggered mainly by smaller NPs. Changes were not so significant in the case of larger nanoparticles. Importantly, we found that PtNPs have antibacterial properties, as is the case with silver NPs (AgNPs). In comparison to our previous study regarding the effects of AgNPs on cell biology, we found that PtNPs do not exhibit such deleterious effects on primary keratinocytes as AgNPs and that they also can be used as potential antibacterial agents

  1. A century of trends in adult human height

    DEFF Research Database (Denmark)

    Sørensen, Thorkild Ingvor A; Zimmermann, Esther

    2016-01-01

    in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5-22.7) and 16.5 cm (13.3-19.7) taller, respectively. In contrast, there was little change in adult height in some sub-Saharan African countries and in South Asia over...

  2. Nanosized fibers' effect on adult human articular chondrocytes behavior

    International Nuclear Information System (INIS)

    Tissue engineering with chondrogenic cell based therapies is an expanding field with the intention of treating cartilage defects. It has been suggested that scaffolds used in cartilage tissue engineering influence cellular behavior and thus the long-term clinical outcome. The objective of this study was to assess whether chondrocyte attachment, proliferation and post-expansion re-differentiation could be influenced by the size of the fibers presented to the cells in a scaffold. Polylactic acid (PLA) scaffolds with different fiber morphologies were produced, i.e. microfiber (MS) scaffolds as well as nanofiber-coated microfiber scaffold (NMS). Adult human articular chondrocytes were cultured in the scaffolds in vitro up to 28 days, and the resulting constructs were assessed histologically, immunohistochemically, and biochemically. Attachment of cells and serum proteins to the scaffolds was affected by the architecture. The results point toward nano-patterning onto the microfibers influencing proliferation of the chondrocytes, and the overall 3D environment having a greater influence on the re-differentiation. In the efforts of finding the optimal scaffold for cartilage tissue engineering, studies as the current contribute to the knowledge of how to affect and control chondrocytes behavior. - Highlights: ► Chondrocyte behavior in nanofiber-coated microfiber versus microfiber scaffolds ► High porosity (> 90%) and large pore sizes (a few hundred μm) of nanofibrous scaffolds ► Proliferation enhanced by presence of nanofibers ► Differentiation not significantly affected ► Cell attachment improved in presence of both nanofibers and serum

  3. HISTOLOGICAL SEXUAL DIFFERENCES IN ADULT HUMAN PARATHYROID GLANDS

    Directory of Open Access Journals (Sweden)

    Fating Anita

    2014-07-01

    Full Text Available CONTEXT (BACKGROUND: Increasing problems of calcium deficiency with physiological conditions like pregnancy, lactation etc. it becomes the need of time to focus attention towards these glands as one of the essential entity. Hence we have undertaken this study to have an idea about normal variation in the gland as per sex. AIMS: To reveal sexual differences in adult human parathyroid glands. METHODS AND MATERIAL: Parathyroid glands from 25 autopsied cases of 20 to 59 years were studied after staining with Hematoxylin & Eosin, Masson’s Trichrome & Reticulin stains. STATISTICAL ANALYSIS: Data is analyzed on statistical software intercooled STATA version 8.0. Data was presented in mean± standard deviation & categorical variables were expressed in percentages. Comparison of oxyphil scores in male & female was done by unpaired‘t’ test. P < 0.05 was taken as statistical significance. RESULTS: Stroma composed of short often branching reticular fibres along with blood vessels and fat cells. By statistical examination the amount of fat was more in case of females than in males of same age groups. Oxyphil cells being less numerous than chief cells were distinguished by their dark eosinophilic, granular cytoplasm and were arranged mostly in closely packed groups without interstitial fat in between the cells. Oxyphil cells also found as placed singly among chief cells. It was also observed as continuous masses or anastomosing columns. As compared with males oxyphil cells are more in females. CONCLUSIONS: By statistical analysis 1 Percentage of stromal fat in case of females was slightly greater than in males of same age group. 2 The score of oxyphil cells in females was double to more than triple as compared to male score of same age group. 3 This study is clinically important as hormonal changes occurs early in females than in males and it is in favor of providing supplementary calcium with D3 along with minimal dose of estrogen as age advances in

  4. [Effect of trypsin on the rat keratinocyte separation and subculture].

    Science.gov (United States)

    Ouyang, An-Li; Zhou, Yan; Hua, Ping; Tan, Wen-Song

    2002-01-01

    The effect of trypsin on the separation an subculture of the keratinocytes was investigated in this work. It was found that when 0.25% trypsin was employed for 5 minutes to separate keratinocytes, the number of active keratinocytes and the cells capable of forming colony were higher than those of other experimental conditions. The maximum attached ratio of primary keratinocytes was obtained when skin tissues were treated at 0.05% concentration of trypsin. With the increase of the trypsin concentrations, the attached ratio, attachment rate constant, and colony forming efficiency were all increased. Thus, 0.25% concentration of trypsin was recommended for separating and subculturing the keratinocytes.

  5. Effects of SHIKONIN on Cel Proliferation and Melanin Transfer of Co-Cultured Human Melanocytes and Keratinocytes%紫草素对黑素转运的影响

    Institute of Scientific and Technical Information of China (English)

    解士海; 潘武辉; 宗国勇; 黄小雄

    2014-01-01

    目的:探讨紫草素(Sh)在人表皮共培养体系中对黑素转运的影响。方法采用MTT法测定紫草素对人黑素细胞(MC)与角质形成细胞(KC)共培养体系增殖的影响,利用荧光标记技术以及流式细胞仪研究紫草素对于黑素转运的影响。结果0.25μmol/L、0.5μmol/L和1μmol/L紫草素对于人表皮共培养体系增殖无影响,0.25μmol/L、0.5μmol/L和1μmol/L紫草素对于共培养体系中黑素转运有剂量依赖地促进作用。结论紫草素对于共培养体系中黑素转运有剂量依赖的促进作用。%Objective: To study the Effects of SHIKONIN on cellProliferation and Melanin transfer of Co-Cultured of melanocytes and keratinocytes Methods: MTT method, Flow cytometry were employed to measure the cellviability, melanin transfer of co-cultured melanocytes and keratinocytes Results No influence was observed on co-cultured melanocytes and keratinocytes cellproliferation by 0.25μmol/L, 0.5μmol/L, or 1μmol/L of SHIKONIN . The melanin transfer were clearly enhanced by SHIKONIN in a dose-dependent manner at concentrations of 0.25μmol/L, 0.5μmol/L, and 1μmol/L Conclusion SHIKONIN exhibits a dose-dependent enhancing effects on melanin transfer in co-cultured melanocytes and keratinocytes.

  6. Cyclic stretch induces upregulation of endothelin-1 with keratinocytes in vitro: Possible role in mechanical stress-induced hyperpigmentation

    International Nuclear Information System (INIS)

    Highlights: → Influence of cyclic stretch on melanogenetic paracrine cytokines was investigated. → Keratinocyte-derived endothelin-1 was upregulated with cyclic stretch. → Degree of upregulation increases dose-dependently. → This upregulation possibly plays a role in the pathogenesis of pigmented disorders. -- Abstract: The aim of this study was to investigate the possible pathological relation between mechanical stress and hyperpigmentation. We did this by investigating the influence of cyclic stretch on the expression of keratinocyte- and fibroblast-derived melanogenetic paracrine cytokines in vitro. Using primary human keratinocytes and fibroblasts, alterations of mRNA expression of melanogenetic paracrine cytokines due to cyclic stretch were investigated using a real-time polymerase chain reaction (PCR). The cytokines included basic fibroblast growth factor (bFGF), stem cell factor (SCF), granulocyte/macrophage colony-stimulating factor, interleukin-1α, and endothelin-1 (ET-1) for keratinocytes and bFGF, SCF, and hepatocyte growth factor for fibroblasts. The dose dependence of keratinocyte-derived ET-1 upregulation was further investigated using real-time PCR and an enzyme-linked immunosorbent assay. We also investigated the effects of cyclic stretch on the proliferation and differentiation of keratinocytes. Among the melanogenetic paracrine cytokines investigated, keratinocyte-derived ET-1 was consistently upregulated in all four cell lines. The degree of upregulation increased with the degree of the length and frequency of the stretch; in contrast, cell number and differentiation markers showed no obvious alterations with cyclic stretch. Keratinocyte-derived ET-1 upregulation possibly plays a significant role in the pathogenesis of pigmented disorders, such as friction melanosis, caused by mechanical stress.

  7. Propagation of Adult SSCs: From Mouse to Human

    OpenAIRE

    Martin, Laura A.; Marco Seandel

    2013-01-01

    Adult spermatogonial stem cells (SSCs) represent a distinctive source of stem cells in mammals for several reasons. First, by giving rise to spermatogenesis, SSCs are responsible for the propagation of a father’s genetic material. As such, autologous SSCs have been considered for treatment of infertility and other purposes, including correction of inherited disorders. Second, adult spermatogonia can spontaneously produce embryonic-like stem cells in vitro, which could be used a...

  8. Isolation of alveolar epithelial type II progenitor cells from adult human lungs

    OpenAIRE

    Fujino, Naoya; Kubo, Hiroshi; Suzuki, Takaya; Ota, Chiharu; Hegab, Ahmed E.; He, Mei; Suzuki, Satoshi; Suzuki, Takashi; Yamada, Mitsuhiro; Kondo, Takashi; Kato, Hidemasa; Yamaya, Mutsuo

    2010-01-01

    Resident stem/progenitor cells in the lung are important for tissue homeostasis and repair. However, a progenitor population for alveolar type II (ATII) cells in adult human lungs has not been identified. The aim of this study is to isolate progenitor cells from adult human lungs with the ability to differentiate into ATII cells. We isolated colony-forming cells that had the capability for self-renewal and the potential to generate ATII cells in vitro. These undifferentiated progenitor cells ...

  9. Adult human case of toxocariasis with pulmonary migratory infiltrate and eosinophilia

    Directory of Open Access Journals (Sweden)

    Považan Đorđe

    2011-01-01

    Full Text Available Introduction. Toxocariasis is a zoonosis which is in Serbia characterized with a very high infection rate of dogs and excessive contamination of the soil with the eggs of Toxocara canis, the agent of the disease. Toxocara-induced infections have in recent years been established in a few hundreds of children, but toxocariasis has rather rarely been diagnosed in adults. Case report. We reported toxocariasis (visceral larva migrans in an adult, manifested by migratory pulmonary infiltrates and positive serological test finding to Toxocara. Conclusion. Human toxocariasis is a rare disease in adults, therefore it should be considered in adult patients presented with eosinophilia and migratory pulmonary infiltrates.

  10. Distinct epidermal keratinocytes respond to extremely low-frequency electromagnetic fields differently.

    Science.gov (United States)

    Huang, Chao-Ying; Chuang, Chun-Yu; Shu, Wun-Yi; Chang, Cheng-Wei; Chen, Chaang-Ray; Fan, Tai-Ching; Hsu, Ian C

    2014-01-01

    Following an increase in the use of electric appliances that can generate 50 or 60 Hz electromagnetic fields, concerns have intensified regarding the biological effects of extremely low-frequency electromagnetic fields (ELF-EMFs) on human health. Previous epidemiological studies have suggested the carcinogenic potential of environmental exposure to ELF-EMFs, specifically at 50 or 60 Hz. However, the biological mechanism facilitating the effects of ELF-EMFs remains unclear. Cellular studies have yielded inconsistent results regarding the biological effects of ELF-EMFs. The inconsistent results might have been due to diverse cell types. In our previous study, we indicated that 1.5 mT, 60 Hz ELF-EMFs will cause G1 arrest through the activation of the ATM-Chk2-p21 pathway in human keratinocyte HaCaT cells. The aim of the current study was to investigate whether ELF-EMFs cause similar effects in a distinct epidermal keratinocyte, primary normal human epidermal keratinocytes (NHEK), by using the same ELF-EMF exposure system and experimental design. We observed that ELF-EMFs exerted no effects on cell growth, cell proliferation, cell cycle distribution, and the activation of ATM signaling pathway in NHEK cells. We demonstrated that the 2 epidermal keratinocytes responded to ELF-EMFs differently. To further validate this finding, we simultaneously exposed the NHEK and HaCaT cells to ELF-EMFs in the same incubator for 168 h and observed the cell growths. The simultaneous exposure of the two cell types results showed that the NHEK and HaCaT cells exhibited distinct responses to ELF-EMFs. Thus, we confirmed that the biological effects of ELF-EMFs in epidermal keratinocytes are cell type specific. Our findings may partially explain the inconsistent results of previous studies when comparing results across various experimental models.

  11. Distinct epidermal keratinocytes respond to extremely low-frequency electromagnetic fields differently.

    Directory of Open Access Journals (Sweden)

    Chao-Ying Huang

    Full Text Available Following an increase in the use of electric appliances that can generate 50 or 60 Hz electromagnetic fields, concerns have intensified regarding the biological effects of extremely low-frequency electromagnetic fields (ELF-EMFs on human health. Previous epidemiological studies have suggested the carcinogenic potential of environmental exposure to ELF-EMFs, specifically at 50 or 60 Hz. However, the biological mechanism facilitating the effects of ELF-EMFs remains unclear. Cellular studies have yielded inconsistent results regarding the biological effects of ELF-EMFs. The inconsistent results might have been due to diverse cell types. In our previous study, we indicated that 1.5 mT, 60 Hz ELF-EMFs will cause G1 arrest through the activation of the ATM-Chk2-p21 pathway in human keratinocyte HaCaT cells. The aim of the current study was to investigate whether ELF-EMFs cause similar effects in a distinct epidermal keratinocyte, primary normal human epidermal keratinocytes (NHEK, by using the same ELF-EMF exposure system and experimental design. We observed that ELF-EMFs exerted no effects on cell growth, cell proliferation, cell cycle distribution, and the activation of ATM signaling pathway in NHEK cells. We demonstrated that the 2 epidermal keratinocytes responded to ELF-EMFs differently. To further validate this finding, we simultaneously exposed the NHEK and HaCaT cells to ELF-EMFs in the same incubator for 168 h and observed the cell growths. The simultaneous exposure of the two cell types results showed that the NHEK and HaCaT cells exhibited distinct responses to ELF-EMFs. Thus, we confirmed that the biological effects of ELF-EMFs in epidermal keratinocytes are cell type specific. Our findings may partially explain the inconsistent results of previous studies when comparing results across various experimental models.

  12. Investigation of genes important in neurodevelopment disorders in adult human brain.

    Science.gov (United States)

    Maussion, Gilles; Diallo, Alpha B; Gigek, Carolina O; Chen, Elizabeth S; Crapper, Liam; Théroux, Jean-Francois; Chen, Gary G; Vasuta, Cristina; Ernst, Carl

    2015-10-01

    Several neurodevelopmental disorders (NDDs) are caused by mutations in genes expressed in fetal brain, but little is known about these same genes in adult human brain. Here, we test the hypothesis that genes associated with NDDs continue to have a role in adult human brain to explore the idea that NDD symptoms may be partially a result of their adult function rather than just their neurodevelopmental function. To demonstrate adult brain function, we performed expression analyses and ChIPseq in human neural stem cell(NSC) lines at different developmental stages and adult human brain, targeting two genes associated with NDDs, SATB2 and EHMT1, and the WNT signaling gene TCF7L2, which has not been associated with NDDs. Analysis of DNA interaction sites in neural stem cells reveals high (40-50 %) overlap between proliferating and differentiating cells for each gene in temporal space. Studies in adult brain demonstrate that consensus sites are similar to NSCs but occur at different genomic locations. We also performed expression analyses using BrainSpan data for NDD-associated genes SATB2, EHMT1, FMR1, MECP2, MBD5, CTNND2, RAI1, CHD8, GRIN2A, GRIN2B, TCF4, SCN2A, and DYRK1A and find high expression of these genes in adult brain, at least comparable to developing human brain, confirming that genes associated with NDDs likely have a role in adult tissue. Adult function of genes associated with NDDs might be important in clinical disease presentation and may be suitable targets for therapeutic intervention. PMID:26194112

  13. Effects triggered by platinum nanoparticles on primary keratinocytes

    Directory of Open Access Journals (Sweden)

    Konieczny P

    2013-10-01

    Full Text Available Piotr Konieczny,1,* Anna Grazyna Goralczyk,1,* Radoslaw Szmyd,1,* Lukasz Skalniak,1,* Joanna Koziel,2 Francesca Larese Filon,3 Matteo Crosera,4 Agnieszka Cierniak,1 Ewa K Zuba-Surma,5 Julia Borowczyk,5 Eliza Laczna,5 Justyna Drukala,5 Elzbieta Pyza,6 Danuta Semik,6 Olga Woznicka,6 Andrzej Klein,1 Jolanta Jura11Department of General Biochemistry, 2Department of Microbiology, Jagiellonian University, Kraków, Poland; 3Department of Public Health Sciences, 4Department of Chemical and Pharmaceutical Sciences, University of Trieste, Trieste, Italy; 5Department of Cell Biology, 6Department of Cell Biology and Imaging, Jagiellonian University, Kraków, Poland*These authors equally contributed to this workAbstract: The platinum (Pt-group elements (PGEs represent a new kind of environmental pollutant and a new hazard for human health. Since their introduction as vehicle-exhaust catalysts, their emissions into the environment have grown considerably compared with their low natural concentration in the earth crust. PGE emissions from vehicle catalysts can be also in the form of nanometer-sized particles (Pt nanoparticles [PtNPs]. These elements, both in their metallic form or as ions solubilized in biological media, are now recognized as potent allergens and sensitizers. Human skin is always exposed to toxic particles; therefore, in the present study we addressed the question of whether polyvinylpyrrolidone-coated PtNPs may have any negative effects on skin cells, including predominantly epidermal keratinocytes. In this study, PtNPs of two sizes were used: 5.8 nm and 57 nm, in concentrations of 6.25, 12.5, and 25 µg/mL. Both types of NPs were protected with polyvinylpyrrolidone. Primary keratinocytes were treated for 24 and 48 hours, then cytotoxicity, genotoxicity, morphology, metabolic activity, and changes in the activation of signaling pathways were investigated in PtNP-treated cells. We found that PtNPs trigger toxic effects on primary keratinocytes

  14. The Human Function Compunction: Teleological Explanation in Adults

    Science.gov (United States)

    Kelemen, Deborah; Rosset, Evelyn

    2009-01-01

    Research has found that children possess a broad bias in favor of teleological--or purpose-based--explanations of natural phenomena. The current two experiments explored whether adults implicitly possess a similar bias. In Study 1, undergraduates judged a series of statements as "good" (i.e., correct) or "bad" (i.e., incorrect) explanations for…

  15. Reorganization of the interchromosomal network during keratinocyte differentiation.

    Science.gov (United States)

    Sehgal, Nitasha; Seifert, Brandon; Ding, Hu; Chen, Zihe; Stojkovic, Branislav; Bhattacharya, Sambit; Xu, Jinhui; Berezney, Ronald

    2016-06-01

    The well-established human epidermal keratinocyte (HEK) differentiation model was investigated to determine possible alterations in chromosome territory (CT) association during differentiation. The seven human chromosomes (1, 4, 11, 12, 16, 17, and 18) selected for this analysis are representative of the chromosome size and gene density range of the overall human genome as well as including a majority of genes involved in epidermal development and differentiation (CT1, 12, and 17). Induction with calcium chloride (Ca(2+)) resulted in morphological changes characteristic of keratinocyte differentiation. Combined multi-fluorescence in situ hybridization (FISH) and computational image analysis on the undifferentiated (0 h) and differentiated (24 h after Ca(2+) treatment) HEK revealed that (a) increases in CT volumes correspond to overall nuclear volume increases, (b) radial positioning is gene density-dependent at 0 h but neither gene density- nor size-dependent at 24 h, (c) the average number of interchromosomal associations for each CT is gene density-dependent and similar at both time points, and (d) there are striking differences in the single and multiple pairwise interchromosomal association profiles. Probabilistic network models of the overall interchromosomal associations demonstrate major reorganization of the network during differentiation. Only ~40 % of the CT pairwise connections in the networks are common to both 0 and 24 h HEK. We propose that there is a probabilistic chromosome positional code which can be significantly altered during cell differentiation in coordination with reprogramming of gene expression. PMID:26490167

  16. Binge Drinking Effects on EEG in Young Adult Humans

    Directory of Open Access Journals (Sweden)

    Kelly E. Courtney

    2010-05-01

    Full Text Available Young adult (N = 96 university students who varied in their binge drinking history were assessed by electroencephalography (EEG recording during passive viewing. Groups consisted of male and female non-binge drinkers (>1 to 5/4 drinks/ounces in under two hours, low-binge drinkers (5/4–7/6 drinks/ounces in under two hours, and high-binge drinkers (≥ 10 drinks/ounces in under two hours, who had been drinking alcohol at their respective levels for an average of 3 years. The non- and low-binge drinkers exhibited less spectral power than the high-binge drinkers in the delta (0–4 Hz and fast-beta (20–35 Hz bands. Binge drinking appears to be associated with a specific pattern of brain electrical activity in young adults that may reflect the future development of alcoholism.

  17. Anomalous features of EMT during keratinocyte transformation.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    Full Text Available During the evolution of epithelial cancers, cells often lose their characteristic features and acquire a mesenchymal phenotype, in a process known as epithelial-mesenchymal transition (EMT. In the present study we followed early stages of keratinocyte transformation by HPV16, and observed diverse cellular changes, associated with EMT. We compared primary keratinocytes with early and late passages of HF1 cells, a cell line of HPV16-transformed keratinocytes. We have previously shown that during the progression from the normal cells to early HF1 cells, immortalization is acquired, while in the progression to late HF1, cells become anchorage independent. We show here that during the transition from the normal state to late HF1 cells, there is a progressive reduction in cytokeratin expression, desmosome formation, adherens junctions and focal adhesions, ultimately leading to poorly adhesive phenotype, which is associated with anchorage-independence. Surprisingly, unlike "conventional EMT", these changes are associated with reduced Rac1-dependent cell migration. We monitored reduced Rac1-dependent migration also in the cervical cancer cell line SiHa. Therefore we can conclude that up to the stage of tumor formation migratory activity is eliminated.

  18. Effects of dihydrotestosterone on the expression of SREBP-1c in human HaCaT keratinocytes%双氢睾酮对HaCaT细胞SREBP-1c表达的影响

    Institute of Scientific and Technical Information of China (English)

    黄秋红; 周炳荣; 王丹; 郭娴菲; 骆丹

    2012-01-01

    目的 探讨双氢睾酮( DHT)在HaCaT细胞固醇调控元件结合蛋白-1c(SREBP-1c)表达中的作用.方法 体外培养HaCaT细胞,分为4组,对照组不加任何刺激因素,DHT组分别加入3种不同浓度的DHT,LY294002+ DHT组在加入50 μmol/L PI3K抑制剂(LY294002)预处理40 min后加入100 nmol/LDHT,PD98059+DHT组即在加入50 μmol/L MEK抑制剂(PD98059)预处理40 min后加入100 nmol/LDHT.用实时定量PCR和Western印迹法检测DHT对HaCaT细胞SREBP 1 cmRNA和蛋白表达的影响.Western印迹法检测DHT作用于HaCaT细胞后蛋白激酶B(AKT)、胞外信号调控激酶(ERK)、p38丝裂原活化蛋白激酶(p38 MAPK)、c-Jun氨基末端激酶(JNK)的磷酸化情况.结果 DHT可呈浓度依赖性上调HaCaT细胞SREBP-1c mRNA和蛋白的表达,并诱导AKT、ERK的磷酸化,但对p38、JNK的磷酸化无明显激活作用.LY294002预处理后HaCaT细胞SREBP-1c mRNA的表达较单纯DHT组明显降低(t=9.406,P< 0.05);SREBP-1蛋白水平降为0.7113±0.0313,与单纯DHT组2.2577±0.0601比较,差异有统计学意义(t=39.498,P<0.05).而PD98059预处理后,SREBP-1c mRNA和蛋白的表达与单纯DHT组比较,差异均无统计学意义(P>0.05).结论 DHT可诱导HaCaT细胞SREBP-1 c mRNA和蛋白的表达.%Obective To evaluate the effects of dihydrotestosterone (DHT) on the expression of sterol regulatory element-binding protein-1c (SREBP-1c) in human HaCaT keratinocytes.Methods HaCaT cells were cultured in vitro and classified into 4 groups,i.e.,control group receiving no treatment,DIIT group treated with 3 different concentrations (10,100,1000 nmol/L) of DHT,LY294002 plus DHT group treated with DHT of 100 nmol/L after 40-minute pretreatment with the PI3K inhibitor LY294002 of 50 μmol/L,PD98059 plus DHT group treated with DHT of 100 nmol/L after 40-minute pretreatment with the MEK inhibitor PD98059 of 50 μmol/L.After another 24-hour culture,real time PCR and Western blot were carried out to detect the expression of SREBP-1c

  19. 瘦素调节HaCaT细胞角蛋白17的表达%Leptin regulates keratin 17 expression in HaCaT human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    张敏; 苗叶; 薛柯; 李承新

    2014-01-01

    Objective To evaluate the effect of leptin on K17 expression in HaCaT human keratinocytes.Methods Some cultured HaCaT cells were treated with leptin (100 ng/ml) or remained untreated for 24 hours followed by the quantification of K17 mRNA expression by real-time PCR and detection of K17 protein expression by Western blot and immunofluorescence staining.To investigate the action mechanism of leptin,some cultured HaCaT cells were divided into several groups to be treated with leptin (100 ng/ml) alone,Piceatannol (an inhibitor of the STAT3 pathway) + leptin (100 ng/ml),PD-98059 (an inhibitor of the Erk1/2 pathway) + leptin (100 ng/ml),respectively for 24 hours,with the cells receiving no treatment as the negative control.Subsequently,the mRNA and protein expressions of K17 were measured by the above methods.Statistical analysis was done by the two-sample ttest.Results The mRNA expression of K17 was significantly higher in HaCaT cells treated with leptin alone than in those remaining untreated (3.086 7 ± 0.186 1 vs.1.000 0 ± 0.000 0,P < 0.01),but significantly downregulated in HaCaT cells treated with Piceatannol + leptin and those with PD-98059 + leptin compared with those treated leptin alone (0.674 1 ± 0.060 0 and 0.855 0 ± 0.390 3 vs.2.242 7 ± 0.188 7,both P < 0.01).The results of Western blot and immunofluorescence staining were in agreement with those of real-time PCR.Conclusions Leptin can induce K17 expression in HaCaT cells,likely by activating the STAT3 and Erk1/2 signaling pathways.%目的 探讨瘦素对HaCaT细胞角蛋白17(K17)表达的影响.方法 体外培养HaCaT细胞,给予100 ng/ml的瘦素作用24 h,应用实时PCR检测K17 mRNA表达水平、Western印迹及免疫荧光染色法检测K17蛋白表达水平变化.结果与阴性对照组(1.000 0±0.000 0)相比较,瘦素组(3.086 7±0.186 1)K17mRNA表达显著升高,差异有统计学意义(P<0.01).Western印迹结果表明,瘦素组K17蛋白较阴性对照组显著上调,细胞免疫

  20. Molecular Mechanism of Adult Neurogenesis and its Association with Human Brain Diseases.

    Science.gov (United States)

    Liu, He; Song, Ni

    2016-01-01

    Recent advances in neuroscience challenge the old dogma that neurogenesis occurs only during embryonic development. Mounting evidence suggests that functional neurogenesis occurs throughout adulthood. This review article discusses molecular factors that affect adult neurogenesis, including morphogens, growth factors, neurotransmitters, transcription factors, and epigenetic factors. Furthermore, we summarize and compare current evidence of associations between adult neurogenesis and human brain diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and brain tumors. PMID:27375363

  1. Clinical characteristics analysis of adult human adenovirus type 7 infection

    Institute of Scientific and Technical Information of China (English)

    张乃春

    2014-01-01

    Objective To investigate the clinical characteristics of patients infected with human adenovirus type 7 and to provide guidance for early diagnosis and timely control of the outbreak.Methods A total of 301 patients infected with the human adenoviruses who were quarantined in hospital from December 2012 to February 2013 were observed.Epidemiological questionnaires were used to collect data of clinical features of the disease including

  2. Cold Preservation of Human Adult Hepatocytes for Liver Cell Therapy.

    Science.gov (United States)

    Duret, Cedric; Moreno, Daniel; Balasiddaiah, Anangi; Roux, Solene; Briolotti, Phillipe; Raulet, Edith; Herrero, Astrid; Ramet, Helene; Biron-Andreani, Christine; Gerbal-Chaloin, Sabine; Ramos, Jeanne; Navarro, Francis; Hardwigsen, Jean; Maurel, Patrick; Aldabe, Rafael; Daujat-Chavanieu, Martine

    2015-01-01

    Hepatocyte transplantation is a promising alternative therapy for the treatment of hepatic failure, hepatocellular deficiency, and genetic metabolic disorders. Hypothermic preservation of isolated human hepatocytes is potentially a simple and convenient strategy to provide on-demand hepatocytes in sufficient quantity and of the quality required for biotherapy. In this study, first we assessed how cold storage in three clinically safe preservative solutions (UW, HTS-FRS, and IGL-1) affects the viability and in vitro functionality of human hepatocytes. Then we evaluated whether such cold-preserved human hepatocytes could engraft and repopulate damaged livers in a mouse model of liver failure. Human hepatocytes showed comparable viabilities after cold preservation in the three solutions. The ability of fresh and cold-stored hepatocytes to attach to a collagen substratum and to synthesize and secrete albumin, coagulation factor VII, and urea in the medium after 3 days in culture was also equally preserved. Cold-stored hepatocytes were then transplanted in the spleen of immunodeficient mice previously infected with adenoviruses containing a thymidine kinase construct and treated with a single dose of ganciclovir to induce liver injury. Engraftment and liver repopulation were monitored over time by measuring the blood level of human albumin and by assessing the expression of specific human hepatic mRNAs and proteins in the recipient livers by RT-PCR and immunohistochemistry, respectively. Our findings show that cold-stored human hepatocytes in IGL-1 and HTS-FRS preservative solutions can survive, engraft, and proliferate in a damaged mouse liver. These results demonstrate the usefulness of human hepatocyte hypothermic preservation for cell transplantation. PMID:25622096

  3. Xenobiotics in vitro: the influence of L-cystine, pantothenat, and miliacin on metabolic and proliferative capacity of keratinocytes.

    Science.gov (United States)

    Obrigkeit, D Hoeller; Oepen, T; Jugert, F K; Merk, H F; Kubicki, J

    2006-01-01

    To investigate the effect of cell growth-stimulating agents on human epidermal keratinocytes, we exposed monolayers of normal human keratinocytes derived from foreskin to different concentrations of the amino acid L-cystine, the member of the vitamin B family D-pantothenat, the phytosterol miliacin, and a combination thereof in keratinocyte growth medium. As a test system for the metabolic capacity, we used the activity of mitochondrial deyhdrogenases as measured by XTT, and for the cell proliferation, we determined the BrdU-uptake. The additives, active ingredients of the hair growth drug PRIORIN, were added in the presence of fully supplemented keratinocyte growth medium or a deficient medium without L-cystine, L-methionine, L-histidin, D-pantothenat, epidermal growth factor, and bovine pituary gland extract. Deficient medium itself reduced the metabolic capacity of keratinocytes to 35% compared with keratinocytes in fully supplemented growth medium. In deficient medium cell, proliferation was not measurable. Increasing doses of L-cystine restored the reduced metabolic capacity from 46% (0.009 mg/L) to 54% (0.09 mg/L) and 92% (0.45 mg/L) in deficient medium. Addition of D-pantothenat (0.43 mg/L) enhanced the metabolic capacity to 150% only in fully supplemented growth medium, compared with untreated controls with growth medium. Miliacin (6 mg/mL) increased not only the metabolic capacity (162%) but also stimulated cell proliferation (215%) as measured by BrdU-uptake in growth medium. The combination of all three additives increased the metabolic capacity (245%) synergistically in growth medium. We were able to show effects of D-panthenol, L-lysine, and miliacin on proliferation and metabolic capacity of keratinocyte monocell culture, which was further increased by combination of the three substances. These basic results suggest a beneficial effect on keratinocyte growth and stimulation by products combining these substances (e.g., Priorin). Furthermore, this work

  4. A century of trends in adult human height

    Science.gov (United States)

    2016-01-01

    Being taller is associated with enhanced longevity, and higher education and earnings. We reanalysed 1472 population-based studies, with measurement of height on more than 18.6 million participants to estimate mean height for people born between 1896 and 1996 in 200 countries. The largest gain in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5–22.7) and 16.5 cm (13.3–19.7) taller, respectively. In contrast, there was little change in adult height in some sub-Saharan African countries and in South Asia over the century of analysis. The tallest people over these 100 years are men born in the Netherlands in the last quarter of 20th century, whose average heights surpassed 182.5 cm, and the shortest were women born in Guatemala in 1896 (140.3 cm; 135.8–144.8). The height differential between the tallest and shortest populations was 19-20 cm a century ago, and has remained the same for women and increased for men a century later despite substantial changes in the ranking of countries. DOI: http://dx.doi.org/10.7554/eLife.13410.001 PMID:27458798

  5. The effect of pantothenic acid deficiency on keratinocyte proliferation and the synthesis of keratinocyte growth factor and collagen in fibroblasts.

    Science.gov (United States)

    Kobayashi, Daisaku; Kusama, Miho; Onda, Masaaki; Nakahata, Norimichi

    2011-01-01

    It has been reported that pantothenic acid (vitamin B5) and panthenol, an alcohol derivative of pantothenic acid, have beneficial moisturizing effects on the skin. However, few studies have investigated the mechanism of action of pantothenic acid on skin tissues. We tried to clarify the role of pantothenic acid on skin function by using keratinocytes and fibroblasts. The depletion of pantothenic acid from the culture medium suppressed keratinocyte proliferation and promoted differentiation. Moreover, pantothenic acid depletion decreased the synthesis of keratinocyte growth factor and procollagen 4a2 in fibroblasts. These results suggest that pantothenic acid is essential for maintaining keratinocyte proliferation and differentiation. PMID:21258175

  6. Spatial Distribution of Stem Cell-Like Keratinocytes in Dissected Compound Hair Follicles of the Dog.

    Directory of Open Access Journals (Sweden)

    Dominique J Wiener

    Full Text Available Hair cycle disturbances are common in dogs and comparable to some alopecic disorders in humans. A normal hair cycle is maintained by follicular stem cells which are predominately found in an area known as the bulge. Due to similar morphological characteristics of the bulge area in humans and dogs, the shared particularity of compound hair follicles as well as similarities in follicular biomarker expression, the dog is a promising model to study human hair cycle and stem cell disorders. To gain insight into the spatial distribution of follicular keratinocytes with stem cell potential in canine compound follicles, we microdissected hair follicles in anagen and telogen from skin samples of freshly euthanized dogs. The keratinocytes isolated from different locations were investigated for their colony forming efficiency, growth and differentiation potential as well as clonal growth. Our results indicate that i compound and single hair follicles exhibit a comparable spatial distribution pattern with respect to cells with high growth potential and stem cell-like characteristics, ii the lower isthmus (comprising the bulge harbors most cells with high growth potential in both, the anagen and the telogen hair cycle stage, iii unlike in other species, colonies with highest growth potential are rather small with an irregular perimeter and iv the keratinocytes derived from the bulbar region exhibit characteristics of actively dividing transit amplifying cells. Our results now provide the basis to conduct comparative studies of normal dogs and those with hair cycle disorders with the possibility to extend relevant findings to human patients.

  7. Monocular Visual Deprivation Suppresses Excitability in Adult Human Visual Cortex

    DEFF Research Database (Denmark)

    Lou, Astrid Rosenstand; Madsen, Kristoffer Hougaard; Paulson, Olaf Bjarne;

    2011-01-01

    . Stimulus–response curves were constructed by recording the intensity of the reported phosphenes evoked in the contralateral visual field at range of TMS intensities. Phosphene measurements revealed that MD produced a rapid and robust decrease in cortical excitability relative to a control condition without......The adult visual cortex maintains a substantial potential for plasticity in response to a change in visual input. For instance, transcranial magnetic stimulation (TMS) studies have shown that binocular deprivation (BD) increases the cortical excitability for inducing phosphenes with TMS. Here, we...... MD. The cortical excitability returned to preinterventional baseline levels within 3 h after the end of MD. The results show that in contrast to the excitability increase in response to BD, MD acutely triggers a reversible decrease in visual cortical excitability. This shows that the pattern...

  8. The landscape of genomic imprinting across diverse adult human tissues

    Science.gov (United States)

    Baran, Yael; Subramaniam, Meena; Biton, Anne; Tukiainen, Taru; Tsang, Emily K.; Rivas, Manuel A.; Pirinen, Matti; Gutierrez-Arcelus, Maria; Smith, Kevin S.; Kukurba, Kim R.; Zhang, Rui; Eng, Celeste; Torgerson, Dara G.; Urbanek, Cydney; Li, Jin Billy; Rodriguez-Santana, Jose R.; Burchard, Esteban G.; Seibold, Max A.; MacArthur, Daniel G.; Montgomery, Stephen B.; Zaitlen, Noah A.; Lappalainen, Tuuli

    2015-01-01

    Genomic imprinting is an important regulatory mechanism that silences one of the parental copies of a gene. To systematically characterize this phenomenon, we analyze tissue specificity of imprinting from allelic expression data in 1582 primary tissue samples from 178 individuals from the Genotype-Tissue Expression (GTEx) project. We characterize imprinting in 42 genes, including both novel and previously identified genes. Tissue specificity of imprinting is widespread, and gender-specific effects are revealed in a small number of genes in muscle with stronger imprinting in males. IGF2 shows maternal expression in the brain instead of the canonical paternal expression elsewhere. Imprinting appears to have only a subtle impact on tissue-specific expression levels, with genes lacking a systematic expression difference between tissues with imprinted and biallelic expression. In summary, our systematic characterization of imprinting in adult tissues highlights variation in imprinting between genes, individuals, and tissues. PMID:25953952

  9. Induction of GLUT-1 protein in adult human skeletal muscle fibers

    DEFF Research Database (Denmark)

    Gaster, M; Franch, J; Staehr, P;

    2000-01-01

    Prompted by our recent observations that GLUT-1 is expressed in fetal muscles, but not in adult muscle fibers, we decided to investigate whether GLUT-1 expression could be reactivated. We studied different stimuli concerning their ability to induce GLUT-1 expression in mature human skeletal muscle...... GLUT-1. In contrast to GLUT-1, GLUT-4 was expressed in all investigated muscle fibers. Although the significance of GLUT-1 in adult human muscle fibers appears limited, GLUT-1 may be of importance for the glucose supplies in immature and regenerating muscle....

  10. D-type cyclins in adult human testis and testicular cancer

    DEFF Research Database (Denmark)

    Bartkova, J; Rajpert-de Meyts, E; Skakkebaek, N E;

    1999-01-01

    on immunohistochemical and immunochemical analysis of human adult testis and 32 testicular tumours to examine the differential expression and abundance of cyclins D1, D2, and D3 in relation to cell type, proliferation, differentiation, and malignancy. In normal testis, the cell type-restricted expression patterns were...... point to potential dual or multiple roles of the D-type cyclins, particularly of cyclin D3. These findings extend current concepts of the biology of the cyclin D subfamily, as well as of the biology and oncopathology of the human adult testis. Apart from practical implications for the assessment...

  11. Lactobacillus reuteri Protects Epidermal Keratinocytes from Staphylococcus aureus-Induced Cell Death by Competitive Exclusion

    OpenAIRE

    Prince, Tessa; McBain, Andrew J.; O'Neill, Catherine A.

    2012-01-01

    Recent studies have suggested that the topical application of probiotic bacteria can improve skin health or combat disease. We have utilized a primary human keratinocyte culture model to investigate whether probiotic bacteria can inhibit Staphylococcus aureus infection. Evaluation of the candidate probiotics Lactobacillus reuteri ATCC 55730, Lactobacillus rhamnosus AC413, and Lactobacillus salivarius UCC118 demonstrated that both L. reuteri and L. rhamnosus, but not L. salivarius, reduced S. ...

  12. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    Phenylketonuria (PKU) is caused by deficiency of phenylalanine hydroxylase (PAH) and increased levels of phenylalanine. PAH requires the cofactor BH(4) to function and the rate-limiting step in the synthesis of BH(4) is GTP cyclohydrolase I (GTP-CH). The skin is a potential target tissue for PKU...... gene therapy. We have previously shown that overexpression of PAH