WorldWideScience

Sample records for adult human keratinocytes

  1. Karyotypic analysis of gene transformed human keratinocyte line

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    @@ INTRODUCTION In order to solve the difficult problem of long term in vitro culture of human keratinocytes, the technique of gene transfer was utilized to transform human keratinocytes with simian virus 40 (SV40).

  2. Human Keratinocytes Are Vanilloid Resistant

    OpenAIRE

    Pecze, László; Szabó, Kornélia; Széll, Márta; Jósvay, Katalin; Kaszás, Krisztián; Kúsz, Erzsébet; Letoha, Tamás; Prorok, János; Koncz, István; Tóth, András; Kemény, Lajos; Vizler, Csaba; Oláh, Zoltán

    2008-01-01

    Background Use of capsaicin or resiniferatoxin (RTX) as analgesics is an attractive therapeutic option. RTX opens the cation channel inflammatory pain/vanilloid receptor type 1 (TRPV1) permanently and selectively removes nociceptive neurons by Ca2+-cytotoxicity. Paradoxically, not only nociceptors, but non-neuronal cells, including keratinocytes express full length TRPV1 mRNA, while patient dogs and experimental animals that underwent topical treatment or anatomically targeted molecular surge...

  3. Human keratinocyte culture from the peritonsillar mucosa.

    Science.gov (United States)

    Neugebauer, P; Bonnekoh, B; Wevers, A; Michel, O; Mahrle, G; Krieg, T; Stennert, E

    1996-01-01

    Tonsillectomy tissue can be used as a routine source for cultures of oropharyngeal keratinocytes. In so doing, a peritonsillar strip of unaltered mucosa was dissected in the upper submucosa. Subsequent trypsinization yielded 7.0 +/- 3.4 x 10(6) keratinocytes per bilateral tonsillectomy. Keratinocyte attachment and growth in primary culture were promoted by sublethally irradiated 3T3 murine fibroblasts. Three subcultures could be performed without a feeder layer and were characterized by a population doubling time of 4.5 days during log growth phase. Electrophoretic and immunoblot analysis of the third subculture revealed a strong expression of keratin pairs 5/14 and 6/16 as well as keratins 7 and 19, whereas keratins 8/18 were expressed less intensely. The lowest intensity, was found for keratin 13, which is known to be indicative of the differentiated mucosa. The culture technique thus provides an easily available in vitro model for morphological and functional studies on the epithelial compartment of human oropharyngeal mucosa. PMID:8737778

  4. N-acetyltransferase in human skin and keratinocytes

    NARCIS (Netherlands)

    Vogel, Tanja; Bonifas, Jutta; Wiegman, Marjon; Pas, Hendrikus; Blömeke, Brunhilde; Coenraads, Pieter Jan; Schuttelaar, Marie-Louise

    2014-01-01

    Background: N-acetyltransferase 1 (NAT1) mediated Nacetylation in human skin and keratinocytes is an important detoxification pathway for aromatic amines including the strong sensitizer para-phenylenediamine (PPD), an important component of oxidative hair dyes. Objectives: Human skin and keratinocyt

  5. Human keratinocytes are efficiently immortalized by a Rho kinase inhibitor

    OpenAIRE

    Chapman, Sandra; Liu, Xuefeng; Meyers, Craig; Schlegel, Richard; Alison A McBride

    2010-01-01

    Primary human keratinocytes are useful for studying the pathogenesis of many different diseases of the cutaneous and mucosal epithelia. In addition, they can form organotypic tissue equivalents in culture that can be used as epidermal autografts for wound repair as well as for the delivery of gene therapy. However, primary keratinocytes have a finite lifespan in culture that limits their proliferative capacity and clinical use. Here, we report that treatment of primary keratinocytes (originat...

  6. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  7. Cyclooxygenases in human and mouse skin and cultured human keratinocytes: association of COX-2 expression with human keratinocyte differentiation

    Science.gov (United States)

    Leong, J.; Hughes-Fulford, M.; Rakhlin, N.; Habib, A.; Maclouf, J.; Goldyne, M. E.

    1996-01-01

    Epidermal expression of the two isoforms of the prostaglandin H-generating cyclooxygenase (COX-1 and COX-2) was evaluated both by immunohistochemistry performed on human and mouse skin biopsy sections and by Western blotting of protein extracts from cultured human neonatal foreskin keratinocytes. In normal human skin, COX-1 immunostaining is observed throughout the epidermis whereas COX-2 immunostaining increases in the more differentiated, suprabasilar keratinocytes. Basal cell carcinomas express little if any COX-1 or COX-2 immunostaining whereas both isozymes are strongly expressed in squamous cell carcinomas deriving from a more differentiated layer of the epidermis. In human keratinocyte cultures, raising the extracellular calcium concentration, a recognized stimulus for keratinocyte differentiation, leads to an increased expression of both COX-2 protein and mRNA; expression of COX-1 protein, however, shows no significant alteration in response to calcium. Because of a recent report that failed to show COX-2 in normal mouse epidermis, we also looked for COX-1 and COX-2 immunostaining in sections of normal and acetone-treated mouse skin. In agreement with a previous report, some COX-1, but no COX-2, immunostaining is seen in normal murine epidermis. However, following acetone treatment, there is a marked increase in COX-1 expression as well as the appearance of significant COX-2 immunostaining in the basal layer. These data suggest that in human epidermis as well as in human keratinocyte cultures, the expression of COX-2 occurs as a part of normal keratinocyte differentiation whereas in murine epidermis, its constitutive expression is absent, but inducible as previously published.

  8. Human Keratinocytes Radioprotection with Mentha Longifolia

    Science.gov (United States)

    Rizzo, Angela Maria; Berselli, P.; Zava, S.; Negroni, M.; Corsetto, P.; Montorfano, G.; Bertolotti, A.; Ranza, E.; Ottolenghi, A.; Berra, B.

    Antioxidants are suggested to act as radioprotectors, and dietary supplements based on antiox-idants have been proposed for astronauts involved in long-term space missions. Plant extracts with antioxidant properties may be used in dietetic supplements for astronauts; in fact recent nutritional guidelines suggest that "fruits and vegetables may become as important on space-going vessels as limes were on the sea-going vessels of old". Mint presents a large variety of biological properties, such as antiallergenic, antibacterial, anti-inflammatory, antitumor, an-tiviral, gastrointestinal protective, hepatoprotective, chemopreventive activities, most of which are attributable to its antioxidant activity. The aim of the present study is to evaluate the antioxidant properties and protective bio-efficacy of a phenol enriched Mentha longifolia ex-tract on gamma rays stressed human keratinocytes (NCTC2544). We assessed first the in vitro antioxidant activity (ABTS and DPPH), and then evaluated different stress markers in order to investigate various oxidative stress targets: cell viability (MTT); retained proliferating ca-pability (CA); DNA damage (histone H2AX) and protein damage (HSP70 induction). Results indicate that this Mint extract has a higher antioxidant activity respect to fresh extracts, that could be responsible of its really interesting radio-protective effects.

  9. Polarized Integrin Mediates Human Keratinocyte Adhesion to Basal Lamina

    Science.gov (United States)

    de Luca, Michele; Tamura, Richard N.; Kajiji, Shama; Bondanza, Sergio; Rossino, Paola; Cancedda, Ranieri; Carlo Marchisio, Pier; Quaranta, Vito

    1990-09-01

    Epithelial cell interactions with matrices are critical to tissue organization. Indirect immunofluorescence and immunoprecipitations of cell lysates prepared from stratified cultures of human epidermal cells showed that the major integrins expressed by keratinocytes are α_Eβ_4 (also called α_6β_4) and α_2β_1/α_3β_1. The α_Eβ_4 integrin is localized at the surface of basal cells in contact with the basement membrane, whereas α_2β_1/ α_3β_1 integrins are absent from the basal surface and are localized only on the lateral surface of basal and spinous keratinocytes. Anti-β_4 antibodies potently inhibited keratinocyte adhesion to matrigel or purified laminin, whereas anti-β_1 antibodies were ineffective. Only anti-β_4 antibodies were able to detach established keratinocyte colonies. These data suggest that α_Eβ_4 mediates keratinocyte adhesion to basal lamina, whereas the β_1 subfamily is involved in cell-cell adhesion of keratinocytes.

  10. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. PMID:27371895

  11. Quantitative analysis of laminin 5 gene expression in human keratinocytes.

    Science.gov (United States)

    Akutsu, Nobuko; Amano, Satoshi; Nishiyama, Toshio

    2005-05-01

    To examine the expression of laminin 5 genes (LAMA3, LAMB3, and LAMC2) encoding the three polypeptide chains alpha3, beta3, and gamma2, respectively, in human keratinocytes, we developed novel quantitative polymerase chain reaction (PCR) methods utilizing Thermus aquaticus DNA polymerase, specific primers, and fluorescein-labeled probes with the ABI PRISM 7700 sequence detector system. Gene expression levels of LAMA3, LAMB3, and LAMC2 and glyceraldehyde-3-phosphate dehydrogenase were quantitated reproducibly and sensitively in the range from 1 x 10(2) to 1 x 10(8) gene copies. Basal gene expression level of LAMB3 was about one-tenth of that of LAMA3 or LAMC2 in human keratinocytes, although there was no clear difference among immunoprecipitated protein levels of alpha3, beta3, and gamma2 synthesized in radio-labeled keratinocytes. Human serum augmented gene expressions of LAMA3, LAMB3, and LAMC2 in human keratinocytes to almost the same extent, and this was associated with an increase of the laminin 5 protein content measured by a specific sandwich enzyme-linked immunosorbent assay. These results demonstrate that the absolute mRNA levels generated from the laminin 5 genes do not determine the translated protein levels of the laminin 5 chains in keratinocytes, and indicate that the expression of the laminin 5 genes may be controlled by common regulation mechanisms. PMID:15854126

  12. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.

    Science.gov (United States)

    Cavazza, Alessia; Miccio, Annarita; Romano, Oriana; Petiti, Luca; Malagoli Tagliazucchi, Guidantonio; Peano, Clelia; Severgnini, Marco; Rizzi, Ermanno; De Bellis, Gianluca; Bicciato, Silvio; Mavilio, Fulvio

    2016-04-12

    Human skin is maintained by the differentiation and maturation of interfollicular stem and progenitors cells. We used DeepCAGE, genome-wide profiling of histone modifications and retroviral integration analysis, to map transcripts, promoters, enhancers, and super-enhancers (SEs) in prospectively isolated keratinocytes and transit-amplifying progenitors, and retrospectively defined keratinocyte stem cells. We show that >95% of the active promoters are in common and differentially regulated in progenitors and differentiated keratinocytes, while approximately half of the enhancers and SEs are stage specific and account for most of the epigenetic changes occurring during differentiation. Transcription factor (TF) motif identification and correlation with TF binding site maps allowed the identification of TF circuitries acting on enhancers and SEs during differentiation. Overall, our study provides a broad, genome-wide description of chromatin dynamics and differential enhancer and promoter usage during epithelial differentiation, and describes a novel approach to identify active regulatory elements in rare stem cell populations. PMID:27050947

  13. Ultraviolet B light-induced apoptosis in human keratinocytes enriched with epidermal stem cells and normal keratinocytes

    Institute of Scientific and Technical Information of China (English)

    MEI Xue-ling; LIAN Shi

    2011-01-01

    Background The stem-cell compartment is the primary target for the accumulation of oncogenic mutations.Overexposure to solar ultraviolet radiation is responsible for the development and progression of >90% of skin cancers.Ultraviolet B (UVB) light-induced keratinocyte apoptosis is a strong preventive mechanism against carcinogenesis. The aim of this study was to isolate keratinocytes enriched with putative human epidermal stem cells and to investigate their apoptotic induction by UVB.Methods Keratinocytes enriched with putative human epidermal stem cells were isolated by adherence to collagen Ⅳ and the expressions of β1-integrin and p63 were investigated. Keratinocytes enriched with putative human epidermal stem cells and normal keratinocytes were irradiated with UVB at 0-80 mJ/cm2. The apoptotic response was investigated with phase-contrast microscopy, Hoechst 33342 staining, flow cytometry of annexin V/PI, and procaspase-3 Western blotting.Results Keratinocyte enriched with stem cells expressed high levels of p63 protein and β1-integrin and low level of pan-keratin (C11). In comparison to non-irradiated cells, significant apoptosis of keratinocyte enriched with stem cells was found with 40 and 80 mJ/cm2 UVB. However, significant apoptosis of normal keratinocytes was only found for 80 mJ/cm2 UVB.Conclusions Human epidermal stem cells can undergo apoptosis in response to UVB radiation and are more susceptible than other keratinocytes. The method could be used in vitro studies of human epidermal stem cells.

  14. Neoplastic transformation of immortalized human epidermal keratinocytes by ionizing radiation.

    OpenAIRE

    Thraves, P; Salehi, Z; Dritschilo, A; Rhim, J S

    1990-01-01

    Efforts to investigate the progression of events that cause human cells to become neoplastic in response to ionizing radiation have been aided by the development of tissue culture systems of epithelial cells. In the present study, nontumorigenic human epidermal keratinocytes immortalized by adenovirus type 12 and simian virus 40 have been transformed by exposure to x-ray irradiation. Such transformants showed morphological alterations, formed colonies in soft agar, and induced carcinomas when...

  15. Transcriptional network of p63 in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Silvia Pozzi

    Full Text Available p63 is a transcription factor required for the development and maintenance of ectodermal tissues in general, and skin keratinocytes in particular. The identification of its target genes is fundamental for understanding the complex network of gene regulation governing the development of epithelia. We report a list of almost 1000 targets derived from ChIP on chip analysis on two platforms; all genes analyzed changed in expression during differentiation of human keratinocytes. Functional annotation highlighted unexpected GO terms enrichments and confirmed that genes involved in transcriptional regulation are the most significant. A detailed analysis of these transcriptional regulators in condition of perturbed p63 levels confirmed the role of p63 in the regulatory network. Rather than a rigid master-slave hierarchical model, our data indicate that p63 connects different hubs involved in the multiple specific functions of the skin.

  16. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  17. Role of solar conditioning in DNA repair response and survival of human epidermal keratinocytes following UV irradiation

    International Nuclear Information System (INIS)

    The authors have investigated the cumulative effects of sunlight exposure upon the excision-repair of UV radiation damage to DNA in epidermal keratinocytes from human donors of different ages as well as the possible effect on DNA repair of periodic conditioning of the cultured keratinocytes with sublethal UV radiation exposures. The authors have also compared the growth properties of UV-irradiated keratinocytes derived from habitually sun-exposed and nonexposed areas from the bodies of young and aged donors. DNA repair replication in keratinocytes from habitually sun-exposed facial skin and the less sun-exposed abdominal skin of middle-aged adults was found to be similar, with respect to both the UV dose response and the time course of repair after 20 J/m2, 254 nm. Growth and survival (after exposure up to 50 J/m2, 254 nm) were greater for keratinocytes from protected areas of the upper arm of young donors (under 18 years) than for cells from their own sun-exposed areas. Growth and survival were markedly reduced for all keratinocyte cultures from aged donors, especially those cultures developed from sun-exposed areas. Nevertheless, the DNA repair response to UV radiation was similar in all cases. The evident uncoupling of UV sensitivity from DNA repair capacity remains to be understood. These studies confirm that the cumulative effect of sunlight exposure indeed contributes to some skin aging processes. However, the authors have found no indication that an overall reduction in capacity for excision-repair of UV photoproducts in keratinocyte DNA accompanies senescence in human skin

  18. Protective effect of silk lutein on ultraviolet B-irradiated human keratinocytes

    Directory of Open Access Journals (Sweden)

    Sutatip Pongcharoen

    2013-01-01

    Full Text Available Carotenoids are efficient antioxidants that are of great importance for human health. Lutein and zeaxanthin are carotinoids present in high concentrations in the human retina which are involved in the photoprotection of the human eye. Lutein may also protect the skin from ultraviolet (UV-induced damage. The present study investigated the protective effect of lutein extracted from yellow silk cocoons of Bombyx mori on human keratinocytes against UVB irradiation. A human keratinocyte cell line and primary human keratinocytes were used to investigate the UVB protection effects of silk lutein and plant lutein. Silk lutein showed no cytotoxicity to keratinocytes. Treatment with silk lutein prior to UVB irradiation enhanced cell viability and cell proliferation, and reduced cell apoptosis. The protective effects of silk lutein may be superior to those of plant lutein. Silk lutein may have a benefit for protection of keratinocytes against UVB-irradiation.

  19. Steroid synthesis by primary human keratinocytes; implications for skin disease

    International Nuclear Information System (INIS)

    Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-3H]-pregnenolone through each steroid intermediate to [7-3H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra

  20. Steroid synthesis by primary human keratinocytes; implications for skin disease

    Energy Technology Data Exchange (ETDEWEB)

    Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)

    2011-01-07

    Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data

  1. Vandetanib-induced phototoxicity in human keratinocytes NCTC-2544.

    Science.gov (United States)

    Salvador, Alessia; Vedaldi, Daniela; Brun, Paola; Dall'Acqua, Stefano

    2014-08-01

    The phototoxicity of the new anticancer drug vandetanib was evaluated using human keratinocyte cell line, NCTC-2544. This study was started since many clinical cases of vandetanib photosensitizing reactions were recently reported in literature. Vandetanib induces a clear drop in human keratinocytes viability after cell irradiation in concentration and UV-A dose dependent mode. Since vandetanib can photolyze with the formation of two main photoproducts after UV-A exposure, the contribution of these new species was also evaluated. These two photoproducts did not have a main role in the phototoxicity of their parent drug. In our opinion, the main hypothesis for the vandetanib phototoxic potential is the formation of a very reactive specie, such as an aryl radical, which can react promptly with different targets inside the cells. In fact, a massive DNA photodamage was detected both in the in vitro DNA photocleavage experiments, and in cells. Moreover, vandetanib was able to photoinduce lipid peroxidation and protein oxidations. Vandetanib photoinduced cell death by apoptosis with the involvement of mitochondria and lysosomes. PMID:24681205

  2. Stanniocalcin-1 regulates re-epithelialization in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Bonnie H Y Yeung

    Full Text Available Stanniocalcin-1 (STC1, a glycoprotein hormone, is believed to be involved in various biological processes such as inflammation, oxidative responses and cell migration. Riding on these emerging evidences, we hypothesized that STC1 may participate in the re-epithelialization during wound healing. Re-epithelialization is a critical step that involves keratinocyte lamellipodia (e-lam formation, followed by cell migration. In this study, staurosporine (STS treatment induced human keratinocyte (HaCaT e-lam formation on fibronectin matrix and migration via the activation of focal adhesion kinase (FAK, the surge of intracellular calcium level [Ca²⁺]i and the inactivation of Akt. In accompanied with these migratory features, a time- and dose-dependent increase in STC1 expression was detected. STC1 gene expression was found not the downstream target of FAK-signaling as illustrated by FAK inhibition using PF573228. The reduction of [Ca²⁺]i by BAPTA/AM blocked the STS-mediated keratinocyte migration and STC1 gene expression. Alternatively the increase of [Ca²⁺]i by ionomycin exerted promotional effect on STS-induced STC1 gene expression. The inhibition of Akt by SH6 and GSK3β by lithium chloride (LiCl could respectively induce and inhibit the STS-mediated e-lam formation, cell migration and STC1 gene expression. The STS-mediated e-lam formation and cell migration were notably hindered or induced respectively by STC1 knockdown or overexpression. This notion was further supported by the scratched wound assay. Collectively the findings provide the first evidence that STC1 promotes re-epithelialization in wound healing.

  3. Arsenite suppression of BMP signaling in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, Marjorie A.; Qin, Qin [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States); Hu, Qin; Zhao, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085 (China); Rice, Robert H., E-mail: rhrice@ucdavis.edu [Department of Environmental Toxicology, University of California, Davis, CA 95616-8588 (United States)

    2013-06-15

    Arsenic, a human skin carcinogen, suppresses differentiation of cultured keratinocytes. Exploring the mechanism of this suppression revealed that BMP-6 greatly increased levels of mRNA for keratins 1 and 10, two of the earliest differentiation markers expressed, a process prevented by co-treatment with arsenite. BMP also stimulated, and arsenite suppressed, mRNA for FOXN1, an important transcription factor driving early keratinocyte differentiation. Keratin mRNAs increased slowly after BMP-6 addition, suggesting they are indirect transcriptional targets. Inhibition of Notch1 activation blocked BMP induction of keratins 1 and 10, while FOXN1 induction was largely unaffected. Supporting a requirement for Notch1 signaling in keratin induction, BMP increased levels of activated Notch1, which was blocked by arsenite. BMP also greatly decreased active ERK, while co-treatment with arsenite maintained active ERK. Inhibition of ERK signaling mimicked BMP by inducing keratin and FOXN1 mRNAs and by increasing active Notch1, effects blocked by arsenite. Of 6 dual-specificity phosphatases (DUSPs) targeting ERK, two were induced by BMP unless prevented by simultaneous exposure to arsenite and EGF. Knockdown of DUSP2 or DUSP14 using shRNAs greatly reduced FOXN1 and keratins 1 and 10 mRNA levels and their induction by BMP. Knockdown also decreased activated Notch1, keratin 1 and keratin 10 protein levels, both in the presence and absence of BMP. Thus, one of the earliest effects of BMP is induction of DUSPs, which increases FOXN1 transcription factor and activates Notch1, both required for keratin gene expression. Arsenite prevents this cascade by maintaining ERK signaling, at least in part by suppressing DUSP expression. - Highlights: • BMP induces FOXN1 transcription. • BMP induces DUSP2 and DUSP14, suppressing ERK activation. • Arsenite suppresses levels of phosphorylated Smad1/5 and FOXN1 and DUSP mRNA. • These actions rationalize arsenite suppression of keratinocyte

  4. Micronucleus formation in human keratinocytes is dependent on radiation quality and tissue architecture.

    Science.gov (United States)

    Snijders, Antoine M; Mannion, Brandon J; Leung, Stanley G; Moon, Sol C; Kronenberg, Amy; Wiese, Claudia

    2015-01-01

    The cytokinesis-block micronucleus (MN) assay was used to assess the genotoxicity of low doses of different types of space radiation. Normal human primary keratinocytes and immortalized keratinocytes grown in 2D monolayers each were exposed to graded doses of 0.3 or 1.0 GeV/n silicon ions or similar energies of iron ions. The frequencies of induced MN were determined and compared to γ-ray data. RBE(max) values ranged from 1.6 to 3.9 for primary keratinocytes and from 2.4 to 6.3 for immortalized keratinocytes. At low radiation doses ≤ 0.4 Gy, 0.3 GeV/n iron ions were the most effective at inducing MN in normal keratinocytes. An "over-kill effect" was observed for 0.3 GeV/n iron ions at higher doses, wherein 1.0 GeV/n iron ions were most efficient in inducing MN. In immortalized keratinocytes, 0.3 GeV/n iron ions produced MN with greater frequency than 1.0 GeV/n iron ions, except at the highest dose tested. MN formation was higher in immortalized keratinocytes than in normal keratinocytes for all doses and radiation qualities investigated. MN induction was also assessed in human keratinocytes cultured in 3D to simulate the complex architecture of human skin. RBE values for MN formation in 3D were reduced for normal keratinocytes exposed to iron ions, but were elevated for immortalized keratinocytes. Overall, MN induction was significantly lower in keratinocytes cultured in 3D than in 2D. Together, the results suggest that tissue architecture and immortalization status modulate the genotoxic response to space radiation, perhaps via alterations in DNA repair fidelity. PMID:25041929

  5. Characterisation of human fibroblasts as keratinocyte feeder layer using p63 isoforms status.

    Science.gov (United States)

    Auxenfans, Céline; Thépot, Amélie; Justin, Virginie; Hautefeuille, Agnès; Shahabeddin, Lili; Damour, Odile; Hainaut, Pierre

    2009-01-01

    Large-scale culture of primary keratinocytes allows the production of large epidermal sheet surfaces for the treatment of extensive skin burns. This method is dependent upon the capacity to establish cultures of proliferating keratinocytes in conditions compatible with their clonal expansion while maintaining their capacity to differentiate into the typical squamous pattern of human epidermis. Feeder layers are critical in this process because the fibroblasts that compose this layer serve as a source of adhesion, growth and differentiation factors. In this report, we have characterise the expression patterns of p63 isoforms in primary keratinocytes cultured on two different feeder layer systems, murine 3T3 and human fibroblasts. We show that with the latter, keratinocytes express a higher ratio of Delta N to TAp63 isoform, in relation with higher clonogenic potential. These results indicate that human fibroblasts represent an adequate feeder layer system to support the culture of primary human keratinocytes. PMID:20042803

  6. Interleukin-8 and Tumor Necrosis Factor Alpha Production in Human Epidermal Keratinocytes Induced by Trichophyton mentagrophytes

    OpenAIRE

    Nakamura, Yuka; KANO, Rui; Hasegawa, Atsuhiko; Watanabe, Shinichi

    2002-01-01

    Production of interleukin-8 (IL-8) and tumor necrosis factor alpha (TNF-α) was confirmed by enzyme-linked immunosorbent assay in a medium where human epidermal keratinocytes were cocultured with Trichophyton mentagrophytes for 1 to 12 h. IL-8 and TNF-α mRNAs were also detected in the keratinocytes cocultured with T. mentagrophytes.

  7. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy

    International Nuclear Information System (INIS)

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/106 cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/106 cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 μM Zn+2 for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs

  8. Human keratinocyte sensitivity towards inflammatory cytokines varies with culture time

    Directory of Open Access Journals (Sweden)

    G. Elliott

    1992-01-01

    Full Text Available Proliferating keratinocyte cultures have been reported to synthesize higher concentrations of prostaglandin (PG E than confluent ones. As interleukin-1 (IL-1 stimulates keratinocyte PGE synthesis we investigated whether the degree of confluency of the keratinocyte culture modified the response of the cells to IL-1. It was found that IL-1α (100 U/ml stimulated PGE2 synthesis by proliferating (7 days in culture but not differentiating (14 days in culture keratinocytes. Similar effects were observed using tumour necrosis factor-α. Both arachidonic acid (AA and the calcium ionophore A23187 stimulated PGE2 synthesis by 7 and 14 day cultures although the increase was greatest when 7 day cultures were used. Our data indicate that there is a specific down-regulation of the mechanism(s by which some inflammatory cytokines stimulate keratinocyte eicosanoid synthesis as cultured keratinocytes begin to differentiate.

  9. Biologic mechanisms for the regulation of normal human keratinocyte proliferation and differentiation.

    OpenAIRE

    Wilke, M. S.; Hsu, B. M.; Wille, J J; Pittelkow, M R; Scott, R. E.

    1988-01-01

    Normal human keratinocytes can be grown in serum-free medium, and the integrated control of their proliferation and differentiation can be modulated experimentally. The growth of cultured human keratinocytes can also be specifically arrested at either reversible or irreversible growth arrest states. Reversible growth arrest is induced by culture in medium containing TGF-beta or ethionine or in medium deficient of isoleucine. Irreversible growth arrest is induced by culture in razoxane-contain...

  10. Antiproliferative potential of zidovudine in human keratinocyte cultures.

    Science.gov (United States)

    Bonnekoh, B; Wevers, A; Geisel, J; Rasokat, H; Mahrle, G

    1991-09-01

    Because the beneficial effects of zidovudine in human immunodeficiency virus infection-associated psoriasis have recently been observed, this study focused on the drug's action on the rapidly proliferating human HaCaT keratinocyte line as an in vitro model for epidermal hyperproliferation. Cultures in log growth phase were exposed to zidovudine for 2 days. Zidovudine slowed proliferation in a dose-dependent fashion as evidenced by 50% inhibition concentrations of 33 mumol/L (cell number), 30 mumol/L (protein content), 0.9 mumol/L (protein synthesis), and 0.7 mumol/L (DNA synthesis). Significant (p less than 0.01) reduction of cell viability to 94.6% and 87.2%, as well as morphologic manifestations of cytotoxicity, were first evident after 2 days' exposure to maximal drug concentrations of 10 and 100 mumol/L, respectively. Control viability, assayed by trypan blue exclusion, was 98.0%. Direct cytotoxic plasma membrane injury could be ruled out by the absence of any increase in cytoplasmic lactate dehydrogenase release into supernatants at least during the 1 day of maximal dosage exposure. The drug-induced inhibition of proliferation was reversible within 7 days after a 2-day exposure to 100 mumol/L zidovudine. Two days of treatment with a 10 mumol/L dose did not alter the pattern and synthesis of keratins in vitro. Thus the known antipsoriatic efficacy of zidovudine might be explained, at least partly, by the drug's cytostatic potency. PMID:1918488

  11. Genome-wide analysis of high risk human papillomavirus E2 proteins in human primary keratinocytes

    OpenAIRE

    Sunthamala, Nuchsupha; Pang, Chai Ling; Thierry, Francoise; Teissier, Sebastien; Pientong, Chamsai; Ekalaksananan, Tipaya

    2014-01-01

    The E2 protein is expressed in the early stage of human papillomavirus (HPV) infection that is associated with cervical lesions. This protein plays important roles in regulation of viral replication and transcription. To characterize the role of E2 protein in modulation of cellular gene expression in HPV infected cells, genome-wide expression profiling of human primary keratinocytes (HPK) harboring HPV16 E2 and HPV18 E2 was investigated using microarray. The Principle Components Analysis (PCA...

  12. Involucrin and envelope competence in human keratinocytes: Modulation by hydrocortisone, retinyl acetate and growth arrest

    OpenAIRE

    Rice, Rh; Cline, PR

    1983-01-01

    Involucrin accumulation and ionophore-assisted envelope for mation, markers of keratinocyte differentiation, were found to be highly dependent on culture conditions in the malignant epidermal keratinocyte line, SCC-13, derived from a human squamous cell carcinoma. In confluent cultures, approximately one-half of the cells were competent to form envelopes when grown in medium without hydrocortisone or retinyl acetate supplementation. Ad dition of hydrocortisone to the medi...

  13. Histamine suppresses epidermal keratinocyte differentiation and impairs skin barrier function in a human skin model

    OpenAIRE

    Gschwandtner, M; Mildner, M.; Mlitz, V; Gruber, F.; Eckhart, L; Werfel, T.; Gutzmer, R; Elias, P.M.; Tschachler, E.

    2012-01-01

    Background Defects in keratinocyte differentiation and skin barrier are important features of inflammatory skin diseases like atopic dermatitis. Mast cells and their main mediator histamine are abundant in inflamed skin and thus may contribute to disease pathogenesis. Methods Human primary keratinocytes were cultured under differentiation-promoting conditions in the presence and absence of histamine, histamine receptor agonists and antagonists. The expression of differentiation-associated gen...

  14. Protective Effects of Triphala on Dermal Fibroblasts and Human Keratinocytes.

    Science.gov (United States)

    Varma, Sandeep R; Sivaprakasam, Thiyagarajan O; Mishra, Abheepsa; Kumar, L M Sharath; Prakash, N S; Prabhu, Sunil; Ramakrishnan, Shyam

    2016-01-01

    Human skin is body's vital organ constantly exposed to abiotic oxidative stress. This can have deleterious effects on skin such as darkening, skin damage, and aging. Plant-derived products having skin-protective effects are well-known traditionally. Triphala, a formulation of three fruit products, is one of the most important rasayana drugs used in Ayurveda. Several skin care products based on Triphala are available that claim its protective effects on facial skin. However, the skin protective effects of Triphala extract (TE) and its mechanistic action on skin cells have not been elucidated in vitro. Gallic acid, ellagic acid, and chebulinic acid were deduced by LC-MS as the major constituents of TE. The identified key compounds were docked with skin-related proteins to predict their binding affinity. The IC50 values for TE on human dermal fibroblasts (HDF) and human keratinocytes (HaCaT) were 204.90 ± 7.6 and 239.13 ± 4.3 μg/mL respectively. The antioxidant capacity of TE was 481.33 ± 1.5 mM Trolox equivalents in HaCaT cells. Triphala extract inhibited hydrogen peroxide (H2O2) induced RBC haemolysis (IC50 64.95 μg/mL), nitric oxide production by 48.62 ± 2.2%, and showed high reducing power activity. TE also rescued HDF from H2O2-induced damage; inhibited H2O2 induced cellular senescence and protected HDF from DNA damage. TE increased collagen-I, involucrin and filaggrin synthesis by 70.72 ± 2.3%, 67.61 ± 2.1% and 51.91 ± 3.5% in HDF or HaCaT cells respectively. TE also exhibited anti-tyrosinase and melanin inhibition properties in a dose-dependent manner. TE increased the mRNA expression of collagen-I, elastin, superoxide dismutase (SOD-2), aquaporin-3 (AQP-3), filaggrin, involucrin, transglutaminase in HDF or HaCaT cells, and decreased the mRNA levels of tyrosinase in B16F10 cells. Thus, Triphala exhibits protective benefits on skin cells in vitro and can be used as a potential ingredient in skin care formulations. PMID:26731545

  15. Hyaluronan minimizes effects of UV irradiation on human keratinocytes

    Czech Academy of Sciences Publication Activity Database

    Hašová, M.; Crhák, Tomáš; Šafaříková, Barbora; Dvořáková, J.; Muthný, T.; Velebný, V.; Kubala, Lukáš

    2011-01-01

    Roč. 303, č. 4 (2011), s. 277-284. ISSN 0340-3696 R&D Projects: GA ČR(CZ) GA305/08/1704 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : hyaluronan * keratinocyte * ultraviolet light Subject RIV: BO - Biophysics Impact factor: 2.279, year: 2011

  16. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    Science.gov (United States)

    Laporta, Robert F.; Taichman, Lorne B.

    1982-06-01

    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  17. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    International Nuclear Information System (INIS)

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV

  18. Human keratinocytes restrict chikungunya virus replication at a post-fusion step

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, Eric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Hamel, Rodolphe [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Neyret, Aymeric [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Ekchariyawat, Peeraya [Laboratoire Maladies Infectieuses et Vecteurs: Ecologie, Génétique, Evolution, Contrôle, UMR 5290 CNRS/IRD/UM1, Montpellier (France); Molès, Jean-Pierre [INSERM U1058, UM1, CHU Montpellier (France); Simmons, Graham [Blood Systems Research Institute, San Francisco, CA 94118 (United States); Chazal, Nathalie [Centre d' étude d’agents Pathogènes et Biotechnologies pour la Santé, CPBS CNRS- UMR5236/UM1/UM2, Montpellier (France); Desprès, Philippe [Unité Interactions Moléculaires Flavivirus-Hôtes, Institut Pasteur, Paris (France); and others

    2015-02-15

    Transmission of chikungunya virus (CHIKV) to humans is initiated by puncture of the skin by a blood-feeding Aedes mosquito. Despite the growing knowledge accumulated on CHIKV, the interplay between skin cells and CHIKV following inoculation still remains unclear. In this study we questioned the behavior of human keratinocytes, the predominant cell population in the skin, following viral challenge. We report that CHIKV rapidly elicits an innate immune response in these cells leading to the enhanced transcription of type I/II and type III interferon genes. Concomitantly, we show that despite viral particles internalization into Rab5-positive endosomes and efficient fusion of virus and cell membranes, keratinocytes poorly replicate CHIKV as attested by absence of nonstructural proteins and genomic RNA synthesis. Accordingly, human keratinocytes behave as an antiviral defense against CHIKV infection rather than as a primary targets for initial replication. This picture significantly differs from that reported for Dengue and West Nile mosquito-borne viruses. - Highlights: • Human keratinocytes support endocytosis of CHIKV and fusion of viral membranes. • CHIKV replication is blocked at a post entry step in these cells. • Infection upregulates type-I, –II and –III IFN genes expression. • Keratinocytes behave as immune sentinels against CHIKV.

  19. H(+)/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport.

    Science.gov (United States)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko; Akagawa, Mitsugu; Tsuji-Naito, Kentaro

    2016-07-01

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H(+) gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. PMID:27216463

  20. Ultrastructural effects of recombinant gamma-interferon on cultured human keratinocytes.

    Science.gov (United States)

    Nickoloff, B J; Mahrle, G; Morhenn, V

    1986-01-01

    To extend our initial observations that recombinant gamma-interferon (r gamma IFN) influences the growth and differentiation of normal cultured human keratinocytes, we studied the electron microscopic changes induced by r gamma IFN. Treatment of cultured human keratinocytes with 10(3) units/ml (7.1 nM) of r gamma IFN produced a shift toward an increasing percentage of attached cells that had a mature-type, differentiated appearance rather than a basal type of proliferating cell, as observed in control, untreated cultures. This report extends the number of cell types that can be influenced by r gamma IFN at the ultrastructural level and supports the notion that r gamma IFN can influence both growth and maturation of normal cultured human keratinocytes. PMID:2421470

  1. Cortactin involvement in the keratinocyte growth factor and fibroblast growth factor 10 promotion of migration and cortical actin assembly in human keratinocytes

    International Nuclear Information System (INIS)

    Keratinocyte growth factor (KGF/FGF7) and fibroblast growth factor 10 (FGF10/KGF2) regulate keratinocyte proliferation and differentiation by binding to the tyrosine kinase KGF receptor (KGFR). KGF induces keratinocyte motility and cytoskeletal rearrangement, whereas a direct role of FGF10 on keratinocyte migration is not clearly established. Here we analyzed the motogenic activity of FGF10 and KGF on human keratinocytes. Migration assays and immunofluorescence of actin cytoskeleton revealed that FGF10 is less efficient than KGF in promoting migration and exerts a delayed effect in inducing lamellipodia and ruffles formation. Both growth factors promoted phosphorylation and subsequent membrane translocation of cortactin, an F-actin binding protein involved in cell migration; however, FGF10-induced cortactin phosphorylation was reduced, more transient and delayed with respect to that promoted by KGF. Cortactin phosphorylation induced by both growth factors was Src-dependent, while its membrane translocation and cell migration were blocked by either Src and PI3K inhibitors, suggesting that both pathways are involved in KGF- and FGF10-dependent motility. Furthermore, siRNA-mediated downregulation of cortactin inhibited KGF- and FGF10-induced migration. These results indicate that cortactin is involved in keratinocyte migration promoted by both KGF and FGF10

  2. Basal and stress-inducible expression of HSPA6 in human keratinocytes is regulated by negative and positive promoter regions

    OpenAIRE

    Ramirez, Vincent P.; Stamatis, Michael; Shmukler, Anastasia; Aneskievich, Brian J.

    2014-01-01

    Epidermal keratinocytes serve as the primary barrier between the body and environmental stressors. They are subjected to numerous stress events and are likely to respond with a repertoire of heat shock proteins (HSPs). HSPA6 (HSP70B′) is described in other cell types with characteristically low to undetectable basal expression, but is highly stress induced. Despite this response in other cells, little is known about its control in keratinocytes. We examined endogenous human keratinocyte HSPA6...

  3. Human keratinocyte ATP2C1 localizes to the Golgi and controls Golgi Ca2+ stores

    OpenAIRE

    Behne, M J; Tu, Chia-Ling L; Aronchik, I; Epstein, E; Bench, G.; Bikle, D D; Pozzan, T; Mauro, T.M.

    2003-01-01

    Hailey-Hailey disease (MIM16960) is a blistering skin disease caused by mutations in the Ca2+ ATPase ATP2C1. We found that the abnormal Ca2+ signaling seen in Hailey-Hailey disease keratinocytes correlates with decreased protein levels of ATP2C1. Human ATP2C1 protein approximated 115 kDa in size. The ATP2C1 is localized to the Golgi apparatus in human keratinocytes, similar to its localization in yeast and Caenorhabditis elegans. To test whether the ATP2C1 controls Golgi Ca2+ stores, we measu...

  4. Human Keratinocyte Growth and Differentiation on Acellular Porcine Dermal Matrix in relation to Wound Healing Potential

    Directory of Open Access Journals (Sweden)

    Robert Zajicek

    2012-01-01

    Full Text Available A number of implantable biomaterials derived from animal tissues are now used in modern surgery. Xe-Derma is a dry, sterile, acellular porcine dermis. It has a remarkable healing effect on burns and other wounds. Our hypothesis was that the natural biological structure of Xe-Derma plays an important role in keratinocyte proliferation and formation of epidermal architecture in vitro as well as in vivo. The bioactivity of Xe-Derma was studied by a cell culture assay. We analyzed growth and differentiation of human keratinocytes cultured in vitro on Xe-Derma, and we compared the results with formation of neoepidermis in the deep dermal wounds treated with Xe-Derma. Keratinocytes cultured on Xe-Derma submerged in the culture medium achieved confluence in 7–10 days. After lifting the cultures to the air-liquid interface, the keratinocytes were stratified and differentiated within one week, forming an epidermis with basal, spinous, granular, and stratum corneum layers. Immunohistochemical detection of high-molecular weight cytokeratins (HMW CKs, CD29, p63, and involucrin confirmed the similarity of organization and differentiation of the cultured epidermal cells to the normal epidermis. The results suggest that the firm natural structure of Xe-Derma stimulates proliferation and differentiation of human primary keratinocytes and by this way improves wound healing.

  5. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts.

    Science.gov (United States)

    Ramos-Jerz, Maria Del R; Villanueva, Socorro; Jerz, Gerold; Winterhalter, Peter; Deters, Alexandra M

    2013-01-01

    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly composed of chlorogenic acid and its isomers. Both reduced NHDF but enhanced HaCaT keratinocytes proliferation. HSCCC fraction M.2 composed of quinic acid among chlorogenic acid and its isomers inhibited proliferation and directly induced differentiation of keratinocytes as observed on gene and protein level. Furthermore, M.2 increased NHDF proliferation via upregulation of growth factor receptors. Salidrosides and ABA derivatives present in HSCCC fraction M.6 increased NHDF and keratinocyte proliferation that resulted in differentiation. The residual solvent fraction M.7 contained among low concentrations of ABA derivatives high amounts of proanthocyanidins B1 and B2 as well as an A-type trimer and stimulated proliferation of normal cells and inhibited the proliferation of immortalized HaCaT keratinocytes. PMID:24371457

  6. Insulin binding properties of normal and transformed human epidermal cultured keratinocytes

    International Nuclear Information System (INIS)

    Insulin binding to its receptors was studied in cultured normal and transformed (A431 line) human epidermal keratinocytes. The specific binding was a temperature-dependent, saturable process. Normal keratinocytes possess a mean value of about 80,000 receptors per cell. Fifteen hours exposure of the cells to insulin lowered their receptor number (about 65% loss in available sites); these reappeared when the hormone was removed from the culture medium. In the A431 epidermoid carcinoma cell line, there is a net decrease in insulin binding (84% of the initial bound/free hormone ratio in comparison with normal cells) essentially related to a loss in receptor affinity for insulin. Thus, cultured human keratinocytes which express insulin receptors may be a useful tool in understanding skin pathology related to insulin disorders

  7. Sequential cultivation of human epidermal keratinocytes and dermal mesenchymal like stromal cells in vitro.

    Science.gov (United States)

    Mahabal, Shyam; Konala, Vijay Bhaskar Reddy; Mamidi, Murali Krishna; Kanafi, Mohammad Mahboob; Mishra, Suniti; Shankar, Krupa; Pal, Rajarshi; Bhonde, Ramesh

    2016-08-01

    Human skin has continuous self-renewal potential throughout adult life and serves as first line of defence. Its cellular components such as human epidermal keratinocytes (HEKs) and dermal mesenchymal stromal cells (DMSCs) are valuable resources for wound healing applications and cell based therapies. Here we show a simple, scalable and cost-effective method for sequential isolation and propagation of HEKs and DMSCs under defined culture conditions. Human skin biopsy samples obtained surgically were cut into fine pieces and cultured employing explant technique. Plated skin samples attached and showed outgrowth of HEKs. Gross microscopic examination displayed polygonal cells with a granular cytoplasm and H&E staining revealed archetypal HEK morphology. RT-PCR and immunocytochemistry authenticated the presence of key HEK markers including trans-membrane protein epithelial cadherin (E-cadherin), keratins and cytokeratin. After collection of HEKs by trypsin-EDTA treatment, mother explants were left intact and cultured further. Interestingly, we observed the appearance of another cell type with fibroblastic or stromal morphology which were able to grow up to 15 passages in vitro. Growth pattern, expression of cytoskeletal protein vimentin, surface proteins such as CD44, CD73, CD90, CD166 and mesodermal differentiation potential into osteocytes, adipocytes and chondrocytes confirmed their bonafide mesenchymal stem cell like status. These findings albeit preliminary may open up significant opportunities for novel applications in wound healing. PMID:25698160

  8. The stress caused by nitrite with titanium dioxide nanoparticles under UVA irradiation in human keratinocyte cell

    International Nuclear Information System (INIS)

    Highlights: ► Nitrite increased photo-toxicity of nano-TiO2 on human keratinocyte cells in a dose-dependant manner. ► Morphological study suggested the cell death may be mediated by apoptosis inducing factor. ► Protein nitration was generated in the cells, and the most abundant nitrated protein was identified as cystatin-A. ► Tyr35 was the most likely site to be nitrated in cystatin-A. -- Abstract: Our previous work found that in the presence of nitrite, titanium dioxide nanoparticles can cause protein tyrosine nitration under UVA irradiation in vivo. In this paper, the human keratinocyte cells was used as a skin cell model to further study the photo-toxicity of titanium dioxide nanoparticles when nitrite was present. The results showed that nitrite increased the photo-toxicity of titanium dioxide in a dose-dependant manner, and generated protein tyrosine nitration in keratinocyte cells. Morphological study of keratinocyte cells suggested a specific apoptosis mediated by apoptosis inducing factor. It was also found the main target nitrated in cells was cystatin-A, which expressed abundantly in cytoplasm and functioned as a cysteine protease inhibitor. The stress induced by titanium dioxide with nitrite under UVA irradiation in human keratinocyte cells appeared to trigger the apoptosis inducing factor mediated cell death and lose the inhibition of active caspase by cystatin-A. We conclude that nitrite can bring new damage and stress to human keratinocyte cells with titanium dioxide nanoparticles under UVA irradiation.

  9. Calmodulin mediates sulfur mustard toxicity in human keratinocytes

    International Nuclear Information System (INIS)

    Sulfur mustard (SM) causes blisters in the skin through a series of cellular changes that we are beginning to identify. We earlier demonstrated that SM toxicity is the result of induction of both death receptor and mitochondrial pathways of apoptosis in human keratinocytes (KC). Because of its importance in apoptosis in the skin, we tested whether calmodulin (CaM) mediates the mitochondrial apoptotic pathway induced by SM. Of the three human CaM genes, the predominant form expressed in KC was CaM1. RT-PCR and immunoblot analysis revealed upregulation of CaM expression following SM treatment. To delineate the potential role of CaM1 in the regulation of SM-induced apoptosis, retroviral vectors expressing CaM1 RNA in the antisense (AS) orientation were used to transduce and derive stable CaM1 AS cells, which were then exposed to SM and subjected to immunoblot analysis for expression of apoptotic markers. Proteolytic activation of executioner caspases-3, -6, -7, and the upstream caspase-9, as well as caspase-mediated PARP cleavage were markedly inhibited by CaM1 AS expression. CaM1 AS depletion attenuated SM-induced, but not Fas-induced, proteolytic processing and activation of caspase-3. Whereas control KC exhibited a marked increase in apoptotic nuclear fragmentation after SM, CaM1 AS cells exhibited normal nuclear morphology up to 48 h after SM, indicating that suppression of apoptosis in CaM1 AS cells increases survival and does not shift to a necrotic death. CaM has been shown to activate the phosphatase calcineurin, which can induce apoptosis by Bad dephosphorylation. Interestingly, whereas SM-treated CaM1-depleted KC expressed the phosphorylated non-apoptotic sequestered form of Bad, Bad was present in the hypophosphorylated apoptotic form in SM-exposed control KC. To determine if pharmacological CaM inhibitors could attenuate SM-induced apoptosis via Bad dephosphorylation, KC were pretreated with the CaM-specific antagonist W-13 or its less active structural

  10. KGF-transfected cells can stimulate growth and proliferation of human cultured keratinocytes in vitro

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    Objective: To establish two stably KGF-transfected, immortalized cell lines. Methods: HaCaT-keratinocytes and KMST-6-fibroblasts were transfected by liposome mediated gene transfer. Transfection effectivity, gene integration and configuration of the transgenic protein were investigated by ELISA, DANN-PCR and β-Gal-staining. Results: Most effective GF producing clones were tested by a colorimetric XTT-test. Conclusion: This is a significant acceleration of cell proliferation and mitosis of human keratinocytes in an Air Liquid Interface (ALI) test system.

  11. Growth of human keratinocytes on hydrophilic film support and application to bioreactor culture

    Energy Technology Data Exchange (ETDEWEB)

    Knooka, M. (Osaka Univ., Suita (Japan)) Prenosil, J. (Swizerland Univ., Zurich (Switzerland))

    1998-10-01

    Human keratinocytes were cultured on an inert polymeric film support in serum-free medium to produce subconfluent autologous skin grafts for healing of burn wounds and chronic leg ulcers. The growth of keratinocytes in Petriperm with such a hydrophilic film bottom as a culture support was superior to that in T-flask owing to better cell adhesion. Based on this principle, an autonomous modular bioreactor, KERATOR for large scale production of skin grafts up to 5280 cm[sup 2] in size was constructed. It is computer controlled, and operations such as cell seeding and medium change are automated. The cell growth rate profiles in the bioreactor and Petriperm are similar, evincing the significance of KERATOR. The harvested skin grafts consist of the polymeric film covered by subconfluent sheets of non-differentiated keratinocyte cells. Such grafts may be applied to wounds in 'upside-down' fashion. 16 refs., 3 figs.

  12. Atomic force microscopy study on human keratinocytes treated with HgCl{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Lastella, M [Dipartimento di Scienze Biomediche, Universita di Foggia, Viale Pinto, 71100 Foggia (Italy); Lasalvia, M [Dipartimento di Scienze Mediche e del Lavoro, Universita di Foggia, Viale Pinto, 71100 Foggia (Italy); Perna, G [Dipartimento di Scienze Biomediche, Universita di Foggia, Viale Pinto, 71100 Foggia (Italy); Biagi, P F [Dipartimento Interateneo di Fisica, Universita di Bari, Via Amendola 173, 70126 Bari (Italy); Capozzi, V [Dipartimento di Scienze Biomediche, Universita di Foggia, Viale Pinto, 71100 Foggia (Italy)

    2007-04-15

    Morphological modifications of the cellular membrane of human keratinocytes treated with HgCl{sub 2} at different concentrations were investigated employing atomic force microscopy and Raman microspectroscopy techniques. Important changes in the surface structure of the keratinocytes membrane occur when this chemical treatment is performed. Mercury action gives rise to roughness and hole-like depressions, especially at cytotoxic concentration. Such surface features are mainly localized in peripheral zones of cells. Although the viability assay reveals that the exposure of keratinocytes to HgCl{sub 2} at a concentration of 10{sup -6} M has no cytotoxic effect, morphological modifications are also evident in cellular membrane at such concentration. Raman microspectroscopy measurements suggest that such morphological modifications are related to modifications occurring in the lipidic layer. Our findings show that atomic force microscopy can be a valid and useful tool in studying the changes in morphology of cells when exposed to chemical stress.

  13. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  14. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    Science.gov (United States)

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  15. Investigation on etretin effects on expression of Fas/FasL ligand and apoptosis in cultured human keratinocytes

    Institute of Scientific and Technical Information of China (English)

    Ping Liu; Shunsheng Tan; Yanping Xi; Zhenping Cao

    2005-01-01

    Objective: To further illuminate a possibme mechanism of Fas/FasL in the treatment of psoriasis, the expression of it and apoptosis of KC were investigated. Methods: With cell culture,immunocytochemistry, the expression of Fas/FasL protein after the treatment with etretin was observed in cultured human normal keratinocytes. Then, the state of apoptosis in cultured keratinocyte after stimuwasn't involved in apoptosis in cultured normol human keratinocytes. But during limited period, the apoptosis of KC could be induced by etretin, thus it can antagonize benign proliferate of keratinocytes. Our data showed up-regulation of the expression of Fas/FasL and apoptosis in cultured human keratinocytes stimulated by etretin, and its function may be involved in the therapeutic machanism of psoriasis.

  16. Stress protein synthesis in human keratinocytes treated with sodium arsenite, phenyldichloroarsine, and nitrogen mustard

    International Nuclear Information System (INIS)

    Cells from bacteria to man respond to sublethal thermal and certain chemical stresses by synthesis of heat shock, or stress, proteins. The human epidermal keratinocyte is a target for a variety of cytotoxic substances. One response of cells exposed to such agents may be the synthesis of stress proteins. Human epidermal keratinocytes were treated thermally (43 degrees C) or chemically with sodium arsenite and the skin irritants phenyldichloroarsine and mechlorethamine. Proteins synthesized by keratinocytes were radiolabeled with [35S]methionine, separated on polyacrylamide gels under denaturing conditions, and visualized by fluorography. Quantitation by computer-assisted densitometry of fluorograms revealed different patterns of synthesis of two heat shock proteins (hsp's) with apparent molecular weights of 70 and 90 kDa after treatment with heat, sodium arsenite, phenyl-dichloroarsine, or mechlorethamine. Sodium arsenite induced the highest levels of synthesis of these two proteins, approximately 10-fold and 3-fold increases in hsp-70 and hsp-90, respectively. Phenyldichloroarsine at 0.5 microM produced a 2-fold increase in hsp-70 but no significant increase in hsp-90. Mechlorethamine, in contrast, had an apparent inhibitory effect on hsp-70 synthesis. These results suggest that some but not all skin irritants induce the synthesis of heat shock proteins in human keratinocytes

  17. Analysis of the response of human keratinocytes to Malassezia globosa and restricta strains.

    Science.gov (United States)

    Donnarumma, Giovanna; Perfetto, Brunella; Paoletti, Iole; Oliviero, Giovanni; Clavaud, Cécile; Del Bufalo, Aurelia; Guéniche, Audrey; Jourdain, Roland; Tufano, Maria Antonietta; Breton, Lionel

    2014-10-01

    Malassezia spp. are saprophyte yeasts involved in skin diseases with different degrees of severity. The aim of our study was to analyze the response of human epidermal keratinocytes to Malassezia globosa and restricta strains evaluating the host defence mechanisms induced by Malassezia spp. colonization. Our results showed a different modulation of the inflammatory and immunomodulatory cytokine pathways obtained with the different strains of Malassezia tested. In addition, this expression is altered by blocking the TLR2 receptor. In comparison with M. furfur, M. globosa and restricta displayed an unexpected and striking cytotoxicity on keratinocytes. The differences observed could be related to the different modalities of interaction between keratinocytes and Malassezia strains, but also to their growth condition. Taken together, these results indicate that M. globosa or M. restricta colonization exert a different control on the cytokine inflammatory response activated in the human keratinocyte in which TLR2 might be involved. M. globosa and M. restricta may play a synergistic role in the exacerbation of skin diseases in which both are found. PMID:25038621

  18. Enhancing effect of tazarotene on the HLA-DR expression of cultured human keratinocytes induced by interferon-gamma

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jian-gan; TAN Sheng-shun

    2005-01-01

    Objective: To investigate the effect of tazarotene on the expression of HLA-DR induced by IFN-γ. Methods: (1) Keratinocytes from normal human skin were cultured in vitro;(2) Tazarotene, IFN-γ and the combination of the two compounds were incubated with the keratinocytes in medium, respectively. The expression of HLA-DR in keratinocytes was determined using immunocytochemistry techniques at 24h after incubation. Results: (1) There was rare expression of HLA-DR in normal human keratinocytes; (2) 10-6mol/L tazarotene failed to induce the expression of HLA-DR in keratinocytes at 24h after incubation; (3) 500 U/ml IFN-γ obviously induced the HLA-DR expression in keratinocytes at 24h after treatment; (4) After 24h, 10-7-10-5 mol/L tazarotene had a significantly enhancing effect on the expression of HLA-DR induced by IFN-γ (P<0.005). Conclusion: Tazarotene up-regulates the expression of HLA-DR in keratinocytes cultured in vitro when combined with IFN-γ . Therefore, the reduction of HLA-DR positive keratinocytes in psoriatic lesions may be attributed to not direct interaction of tazarotene in combination with IFN-γ but other pathways.

  19. Analysis of aquaporin 9 expression in human epidermis and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshinori Sugiyama

    2014-01-01

    Full Text Available Aquaporin 9 (AQP9 is a member of the aquaglyceroporin family that transports glycerol, urea and other small solutes as well as water. Compared to the expression and function in epidermal keratinocytes of AQP3, another aquaglyceroporin, our knowledge of epidermal AQP9 remains elusive. In this study, we investigated the expression of AQP9 in the human epidermis and cultured keratinocytes. Immunofluorescence studies revealed that AQP9 expression is highly restricted to the stratum granulosum of the human epidermis, where occludin is also expressed at the tight junctions. Interestingly, the AQP3 staining decreased sharply below the cell layers in which AQP9 is expressed. In cultured normal human epidermal keratinocytes (NHEK, knock-down of AQP9 expression in the differentiated cells induced by RNA interference reduced glycerol uptake, which was not as pronounced as was the case with AQP3 knock-down cells. In contrast, similar reduction of urea uptake was detected in AQP9 and AQP3 knock-down cells. These findings suggested that AQP9 expression in NHEK facilitates at least the transport of glycerol and urea. Finally, we analyzed the effect of retinoic acid (RA, a potent stimulator of keratinocyte proliferation, on AQP3 and AQP9 mRNA expression in differentiated NHEK. Stimulation with RA at 1 μM for 24 h augmented AQP3 expression and down-regulated AQP9 expression. Collectively, these results indicate that AQP9 expression in epidermal keratinocytes is regulated in a different manner from that of AQP3.

  20. Treatment of Hypertrophic Scar in Human with Autologous Transplantation of Cultured Keratinocytes and Fibroblasts along with Fibrin Glue

    Directory of Open Access Journals (Sweden)

    Ehsan Taghiabadi

    2015-04-01

    Full Text Available Objective: Hypertrophic scar involves excessive amounts of collagen in dermal layer and may be painful. Nowadays, we can’t be sure about effectiveness of procedure for hypertrophic scar management. The application of stem cells with natural scaffold has been the best option for treatment of burn wounds and skin defect, in recent decades. Fibrin glue (FG was among the first of the natural biomaterials applied to enhance skin deformity in burn patients. This study aimed to identify an efficient, minimally invasive and economical transplantation procedure using novel FG from human cord blood for treatment of hypertrophic scar and regulation collagen synthesis. Materials and Methods: In this case series study, eight patients were selected with hypertrophic scar due to full-thickness burns. Human keratinocytes and fibroblasts derived from adult skin donors were isolated and cultured. They were tested for the expression of cytokeratin 14 and vimentin using immunocytochemistry. FG was prepared from pooled cord blood. Hypertrophic scars were extensively excised then grafted by simply placing the sheet of FG containing autologous fibroblast and keratinocytes. Histological analyses were performed using Hematoxylin and eosin (H&E and Masson’s Trichrome (MT staining of the biopsies after 8 weeks. Results: Cultured keratinocytes showed a high level of cytokeratin 14 expression and also fibroblasts showed a high level of vimentin. Histological analyses of skin biopsies after 8 weeks of transplantation revealed re-epithelialization with reduction of hypertrophic scars in 2 patients. Conclusion: These results suggest may be the use of FG from cord blood, which is not more efficient than previous biological transporters and increasing hypertrophic scar relapse, but could lead to decrease pain rate.

  1. Photo-Oxidation Products of Skin Surface Squalene Mediate Metabolic and Inflammatory Responses to Solar UV in Human Keratinocytes

    OpenAIRE

    Kostyuk, Vladimir; Potapovich, Alla; Stancato, Andrea; De Luca, Chiara; Lulli, Daniela; Pastore, Saveria; Korkina, Liudmila

    2012-01-01

    The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL) or to primary cultures of normal human epidermal keratinocytes (NHEK). The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq), and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx) were ...

  2. Transcriptional Profiling of Ectoderm Specification to Keratinocyte Fate in Human Embryonic Stem Cells

    OpenAIRE

    Ana Mafalda Baptista Tadeu; Samantha Lin; Lin Hou; Lisa Chung; Mei Zhong; Hongyu Zhao; Valerie Horsley

    2015-01-01

    In recent years, several studies have shed light into the processes that regulate epidermal specification and homeostasis. We previously showed that a broad-spectrum γ-secretase inhibitor DAPT promoted early keratinocyte specification in human embryonic stem cells triggered to undergo ectoderm specification. Here, we show that DAPT accelerates human embryonic stem cell differentiation and induces expression of the ectoderm protein AP2. Furthermore, we utilize RNA sequencing to identify severa...

  3. Persea americana Mill. Seed: Fractionation, Characterization, and Effects on Human Keratinocytes and Fibroblasts

    OpenAIRE

    Ramos-Jerz, Maria del R.; Socorro Villanueva; Gerold Jerz; Peter Winterhalter; Deters, Alexandra M.

    2013-01-01

    Methanolic avocado (Persea americana Mill., Lauraceae) seed extracts were separated by preparative HSCCC. Partition and HSCCC fractions were principally characterized by LC-ESI-MS/MS analysis. Their in vitro influence was investigated on proliferation, differentiation, cell viability, and gene expression on HaCaT and normal human epidermal keratinocytes (NHEK) and normal human dermal fibroblasts (NHDF). The methanol-water partition (M) from avocado seeds and HSCCC fraction 3 (M.3) were mostly...

  4. Self-Antigen Presentation by Keratinocytes in the Inflamed Adult Skin Modulates T-Cell Auto-Reactivity.

    Science.gov (United States)

    Meister, Michael; Tounsi, Amel; Gaffal, Evelyn; Bald, Tobias; Papatriantafyllou, Maria; Ludwig, Julia; Pougialis, Georg; Bestvater, Felix; Klotz, Luisa; Moldenhauer, Gerhard; Tüting, Thomas; Hämmerling, Günter J; Arnold, Bernd; Oelert, Thilo

    2015-08-01

    Keratinocytes have a pivotal role in the regulation of immune responses, but the impact of antigen presentation by these cells is still poorly understood, particularly in a situation where the antigen will be presented only in adult life. Here, we generated a transgenic mouse model in which keratinocytes exclusively present a myelin basic protein (MBP) peptide covalently linked to the major histocompatibility complex class II β-chain, solely under inflammatory conditions. In these mice, inflammation caused by epicutaneous contact sensitizer treatment resulted in keratinocyte-mediated expansion of MBP-specific CD4(+) T cells in the skin. Moreover, repeated contact sensitizer application preceding a systemic MBP immunization reduced the reactivity of the respective CD4(+) T cells and lowered the symptoms of the resulting experimental autoimmune encephalomyelitis. This downregulation was CD4(+) T-cell-mediated and dependent on the presence of the immune modulator Dickkopf-3. Thus, presentation of a neo self-antigen by keratinocytes in the inflamed, adult skin can modulate CD4(+) T-cell auto-aggression at a distal organ. PMID:25835957

  5. Retinoic acid upregulates the plasminogen activator system in human epidermal keratinocytes.

    Science.gov (United States)

    Braungart, E; Magdolen, V; Degitz, K

    2001-05-01

    The activation of the proteolytic plasminogen activator system is important for the re-epithelialization of skin wounds. Keratinocytes synthesize and secrete the urokinase-type plasminogen activator, which binds to its specific receptor on keratinocytes. Receptor-bound urokinase-type plasminogen activator efficiently activates cell surface bound plasminogen. This results in pericellular proteolysis, which facilitates keratinocyte migration. Urokinase-type plasminogen activator activity is specifically controlled by plasminogen activator inhibitor-1 and -2. As retinoids have been reported to accelerate epithelialization of skin wounds in animal studies and clinical settings, we investigated the effects of all-trans retinoic acid on the plasminogen activator system in human epidermal keratinocytes. As tested in a chromogenic plasminogen activation assay, incubation with 10 microM all-trans retinoic acid caused a marked induction of cell-associated plasminogen activity after 24 h, and this induction was blocked by neutralizing anti-urokinase-type plasminogen activator antibodies, but not anti-tissue-type plasminogen activator antibodies. All-trans retinoic acid lead to a strong increase in urokinase-type plasminogen activator (enzyme-linked immunosorbent assay) and urokinase-type plasminogen activator receptor cell surface expression (flow cytometry) after 24 h. At this time-point, tissue-type plasminogen activator and plasminogen activator inhibitor-1 and -2 proteins were not or only slightly increased. Northern blot analyses revealed that all-trans retinoic acid caused an early and short-lived increase of plasminogen activator inhibitor-1, but a prolonged induction of urokinase-type plasminogen activator and urokinase-type plasminogen activator receptor mRNA levels. Collectively, these data suggest that all-trans retinoic acid activates the plasminogen activator system in human epidermal keratinocytes by differentially regulating activating and inhibiting components

  6. Anti-proliferative effects of protein kinase C inhibitors in human keratinocytes.

    Science.gov (United States)

    Hegemann, L; Bonnekoh, B; van Rooijen, L A; Mahrle, G

    1992-07-01

    Various lines of evidence indicate that protein kinase C, a key enzyme in transmembraneous signal transduction, is involved in the regulation of keratinocyte proliferation. In the present study we have investigated the effects of various structurally unrelated protein kinase C inhibitors on the proliferation of HaCa T cells, a non-tumorigenic human keratinocyte cell line. All protein kinase C inhibitors dose-dependently inhibited cell proliferation as assessed by the incorporation of radioactively labelled thymidine and amino acids as well as the increase in total protein content in keratinocytes. The potencies of the drugs to inhibit cell proliferation were strongly correlated to their inhibitory potency on purified protein kinase C, displaying a correlation coefficient of 0.97. Methotrexate, an anti-proliferative drug, was found not to inhibit protein kinase C. Therefore, our data provide evidence that protein kinase C is crucially involved in the regulation of keratinocyte proliferation but is not the only target of anti-proliferative drug action. PMID:1390454

  7. Replacement of murine fibroblasts by human fibroblasts irradiated in obtaining feeder layer for the culture of human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshito, Daniele; Sufi, Bianca S.; Santin, Stefany P.; Mathor, Monica B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Altran, Silvana C.; Isaac, Cesar [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Lab. de Microcirurgia Plastica; Esteves-Pedro, Natalia M. [Universidade Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Ciencias Farmaceuticas. Lab. de Controle Biologico; Herson, Marisa R. [DonorTissue Bank of Victoria (Australia)

    2011-07-01

    Human autologous epithelia cultivated in vitro, have been used successfully in treating damage to skin integrity. The methodology allowed the cultivation of these epithelia was described by Rheinwald and Green in 1975, this methodology consisted in seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate is controlled through the action of ionizing radiation. However, currently there is a growing concern about the possibility of transmitting prions and murine viruses to transplanted patients. Taking into account this concern, in this present work, we replaced the feeder layer originally composed of murine fibroblasts by human fibroblasts. To obtain this new feeder layer was necessary to standardize the enough irradiation dose to inhibit the replication of human fibroblasts and the verification of effectiveness of the development of keratinocytes culture on a feeder layer thus obtained. According to the obtained results we can verify that the human fibroblasts irradiated at various tested doses (60, 70, 100, 200, 250 and 300 Gy) had their mitotic activity inactivated by irradiation, allowing the use of any of these doses to confection of the feeder layer, since these fibroblasts irradiated still showed viable until fourteen days of cultivation. In the test of colony formation efficiency was observed that keratinocytes seeded on irradiated human fibroblasts were able to develop satisfactorily, preserving their clonogenic potential. Therefore it was possible the replacement of murine fibroblasts by human fibroblasts in confection of the feeder layer, in order to eliminate this xenobiotic component of the keratinocytes culture. (author)

  8. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    International Nuclear Information System (INIS)

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  9. TCDD induces dermal accumulation of keratinocyte-derived matrix metalloproteinase-10 in an organotypic model of human skin

    Energy Technology Data Exchange (ETDEWEB)

    De Abrew, K. Nadira [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Thomas-Virnig, Christina L.; Rasmussen, Cathy A. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Bolterstein, Elyse A. [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Schlosser, Sandy J. [Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States); Allen-Hoffmann, B. Lynn, E-mail: blallenh@wisc.edu [Molecular and Environmental Toxicology Center, University of Wisconsin—Madison, Madison, WI 53706 (United States); Department of Pathology, University of Wisconsin—Madison, Madison, WI 53706 (United States)

    2014-05-01

    The epidermis of skin is the first line of defense against the environment. A three dimensional model of human skin was used to investigate tissue-specific phenotypes induced by the environmental contaminant, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Continuous treatment of organotypic cultures of human keratinocytes with TCDD resulted in intracellular spaces between keratinocytes of the basal and immediately suprabasal layers as well as thinning of the basement membrane, in addition to the previously reported hyperkeratinization. These tissue remodeling events were preceded temporally by changes in expression of the extracellular matrix degrading enzyme, matrix metalloproteinase-10 (MMP-10). In organotypic cultures MMP-10 mRNA and protein were highly induced following TCDD treatment. Q-PCR and immunoblot results from TCDD-treated monolayer cultures, as well as indirect immunofluorescence and immunoblot analysis of TCDD-treated organotypic cultures, showed that MMP-10 was specifically contributed by the epidermal keratinocytes but not the dermal fibroblasts. Keratinocyte-derived MMP-10 protein accumulated over time in the dermal compartment of organotypic cultures. TCDD-induced epidermal phenotypes in organotypic cultures were attenuated by the keratinocyte-specific expression of tissue inhibitor of metalloproteinase-1, a known inhibitor of MMP-10. These studies suggest that MMP-10 and possibly other MMP-10-activated MMPs are responsible for the phenotypes exhibited in the basement membrane, the basal keratinocyte layer, and the cornified layer of TCDD-treated organotypic cultures. Our studies reveal a novel mechanism by which the epithelial–stromal microenvironment is altered in a tissue-specific manner thereby inducing structural and functional pathology in the interfollicular epidermis of human skin. - Highlights: • TCDD causes hyperkeratosis and basement membrane changes in a model of human skin. • TCDD induces MMP-10 expression in organotypic cultures

  10. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    International Nuclear Information System (INIS)

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  11. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Ok-Nam [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Eun-Sun [College of Pharmacy, Institute of Pharmaceutical Science and Technology, Hanyang University, Ansan 426-791 (Korea, Republic of); Jeong, Tae Cheon [College of Pharmacy, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Chun, Young-Jin [College of Pharmacy, Chung-Ang University, Seoul 156-756 (Korea, Republic of); Lee, Ai-Young, E-mail: leeay@duih.org [Department of Dermatology, Dongguk University Ilsan Hospital, Goyang 410-773 (Korea, Republic of); Noh, Minsoo, E-mail: minsoo@alum.mit.edu [College of Pharmacy, Natural Products Research Institute, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2015-03-01

    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  12. Vanillin protects human keratinocyte stem cells against ultraviolet B irradiation.

    Science.gov (United States)

    Lee, Jienny; Cho, Jae Youl; Lee, Sang Yeol; Lee, Kyung-Woo; Lee, Jongsung; Song, Jae-Young

    2014-01-01

    Ultraviolet-B (UVB) irradiation is one of major factors which induce cellular damages in the epidermis. We investigated protective effects and mechanisms of vanillin, a main constituent of vanilla beans, against UVB-induced cellular damages in keratinocyte stem cells (KSC). Here, vanillin significantly attenuated UVB irradiation-induced cytotoxicity. The vanillin effects were also demonstrated by the results of the senescence-associated β-galactosidase and alkaline comet assays. In addition, vanillin induced production of pro-inflammatory cytokines. Attempts to elucidate a possible mechanism underlying the vanillin-mediated effects revealed that vanillin significantly reduced UVB-induced phosphorylation of ataxia telangiectasia mutated (ATM), serine threonine kinase checkpoint kinase 2 (Chk2), tumor suppressor protein 53 (p53), p38/mitogen-activated protein kinase (p38), c-Jun N-terminal kinase/stress-activated protein kinase (JNK), S6 ribosomal protein (S6RP), and histone 2A family member X (H2A.X). UVB-induced activation of p53 luciferase reporter was also significantly inhibited by vanillin. In addition, while ATM inhibitor had no effect on the vanillin effects, mouse double minute 2 homolog (MDM2) inhibitor significantly attenuated suppressive effects of vanillin on UVB-induced activation of p53 reporter in KSC. Taken together, these findings suggest that vanillin protects KSC from UVB irradiation and its effects may occur through the suppression of downstream step of MDM2 in UVB irradiation-induced p53 activation. PMID:24184596

  13. Infection of human keratinocytes by Streptococcus dysgalactiae subspecies dysgalactiae isolated from milk of the bovine udder.

    Science.gov (United States)

    Roma-Rodrigues, Catarina; Alves-Barroco, Cynthia; Raposo, Luís R; Costa, Mafalda N; Fortunato, Elvira; Baptista, Pedro Viana; Fernandes, Alexandra R; Santos-Sanches, Ilda

    2016-04-01

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) are considered exclusive animal pathogens; however, a putative zoonotic upper limb cellulitis, a prosthetic joint infection and an infective endocarditis were described in humans. To unravel if bovine SDSD isolates are able to infect human cells, the adherence and internalization to human primary keratinocytes of two bovine SDSD strains isolated from milk collected from udder were analyzed. Bacterial adhesion assays and confocal microscopy indicate a high adherence and internalization of SDSD isolates to human cells, suggesting for the first time the ability of bovine isolates to infect human cells. PMID:26655883

  14. Effects of growth factors on the proliferation of human keratinocytes and fibroblasts in vitro.

    Science.gov (United States)

    Kim, D S; Korting, H C; Schäfer-Korting, M

    1998-01-01

    Growth/differentiation factor-5 (GDF-5) is a new member of the transforming growth factor-beta (TGF-beta) superfamily of multifunctional peptide growth factors that appear to mediate many key events in cell growth and development. The effects of GDF-5 and other growth factors (epidermal growth factor, EGF; TGF-beta 1) on the proliferation of human keratinocytes and fibroblasts compared with desoximetasone and calcipotriol have been investigated. The proliferation rate was determined by a hemocytometer, MTT assay and the incorporation of [3H]-thymidine. Moreover, cell cycle analyses were performed and the influence on interleukin-1 alpha (IL-1 alpha) production in keratinocytes was measured by enzyme-linked immunosorbent assay (ELISA) because of its pronounced proinflammatory effect. In keratinocytes, GDF-5 stimulated cell proliferation to a minor extent. The drug already proved to be effective at very low concentrations (0.1 ng/ml). Growth stimulatory effects with EGF have been observed only in keratinocyte basal medium (KBM), but not in keratinocyte growth medium (KGM). TGF-beta 1 markedly inhibited the proliferation of keratinocytes at concentrations > 1 ng/ml. Calcipotriol and desoximetasone also showed a dose-dependent cell growth inhibition in epidermal cell cultures. IL-1 alpha synthesis was greatly suppressed by calcipotriol 10(-8)-10(-6) M. EGF at 10 ng/ml, in contrast, strongly stimulated IL-1 alpha production. Neither GDF-5 nor TGF-beta 1 had a significant effect on IL-1 alpha production in keratinocyte monolayer cultures. In fibroblasts, GDF-5 induced very weak antiproliferative effects. Calcipotriol and desoximetasone also inhibited cell growth in fibroblast cultures whereas proliferation and DNA synthesis were strongly stimulated by 1 ng/ml EGF. There was, however, a contradiction between TGF-beta 1 results on fibroblasts. Whereas TGF-beta 1 increased proliferation in cell number determination and in the thymidine incorporation assay, MTT assays showed

  15. Effect of 1,24R-dihydroxyvitamin D3 on the growth of human keratinocytes.

    LENUS (Irish Health Repository)

    Matsumoto, K

    1990-02-01

    The effect of 1,24R-dihydroxyvitamin D3 (1,24R(OH)2D3), a synthetic analogue of a biologically active form of vitamin D3 (1,25-dihydroxyvitamin D3, 1,25(OH)2D3), on the growth of human keratinocytes cultured in serum-free medium was investigated. The growth of cultured normal human keratinocytes was inhibited by 65% by 10(-8)M 1,24R(OH)2D3 and by 90% by 10(-7)M 1,24(OH)2D3. It inhibited cell growth almost completely at 10(-6)M. The DNA synthesis of keratinocytes was also inhibited with 1,24R(OH)2D3 by 27% at 10(-8)M, 59% at 10(-7)M, and 92% at 10(-6)M. The inhibition of cell growth and DNA synthesis were more remarkable by 1,24R(OH)2D3 than by 1,25(OH)2D3. 1,24R(OH)2D3 also inhibited the growth of keratinocytes derived from patients with psoriasis vulgaris; the growth inhibitory effect was again more remarkable with 1,24R(OH)2D3 than with 1,25(OH)2D3. The viability and protein synthesis of keratinocytes were not affected by 1,24R(OH)2D3, suggesting that the growth inhibitory effect is due to its biological activity, not to cytotoxicity. The binding of [3H]-labeled 1,25(OH)2D3 to its receptor in the cytosolic fraction of cultured keratinocytes was competitively substituted by unlabeled 1,24R(OH)2D3 as well as 1,25(OH)2D3, suggesting that 1,24R(OH)2D3 binds to the 1,25(OH)2D3 receptor. It was found that the affinity of 1,24R(OH)2D3 for the receptor was slightly higher than that of 1,25(OH)2D3. These results demonstrate that 1,24R(OH)2D3 functions as a potent growth inhibitor in vitro in human keratinocytes from both normal and psoriatic epidermis, and it possesses a higher affinity for the 1,25(OH)2D3 receptor in cultured human keratinocytes. The difference in affinity of 1,24R(OH)2D3 for the 1,25(OH)2D3 receptor correlates with its greater inhibition of keratinocyte growth than 1,25(OH)2D3. 1,24R(OH)2D3 may be useful in the treatment of psoriasis.

  16. Long-wave ultraviolet radiation induces protein kinase C in normal human keratinocytes

    International Nuclear Information System (INIS)

    Skin tumor promotion by phorbol ester is believed to be mediated by the phospholipid-dependent ser/thr kinase, protein kinase C (PKC). Long-wave ultraviolet radiation (320-400 nm, UVA), which has also been shown to promote skin tumors, induces elevated levels of PKC in murine fibroblasts, suggesting that UVA may promote the development of basal and squamous cell skin cancers by a mechanism involving PKC. To examine UVA effects on PKC in a model relevant to skin, we maintained normal human epidermal keratinocytes (NHEK) in serum-free medium and exposed the cultured cells to various doses of UVA or to the phorbol ester, 12-O-tetradecanoylphorbol-13-acetate (TPA). The findings suggest that acute UVA exposure elevates PKC activity in human keratinocytes and may act through PKC to promote actinic skin cancer. The molecular mechanism is likely to differ from that of the phorbol esters, however. (author)

  17. In Vitro Cytotoxicity and Phototoxicity Assessment of Acylglutamate Surfactants Using a Human Keratinocyte Cell Line

    OpenAIRE

    Abhay Kyadarkunte; Milind Patole; Varsha Pokharkar

    2014-01-01

    In the current study, human keratinocyte cell line was used as in vitro cell culture model to elucidate the effects of the fatty acid chain length of acylglutamate (amino acid-based surfactant) namely, sodium cocoyl glutamate, sodium lauroyl glutamate, and sodium myristoyl glutamate on their cytotoxicity and the ultraviolet B induced phototoxicity. The endpoint used to assess toxicity was a tetrazolium-based assay whereas, the phototoxic potential of acylglutamate surfactants was predicted u...

  18. Metabolism of the Antibacterial Triclocarban by Human Epidermal Keratinocytes to Yield Protein Adducts

    OpenAIRE

    Schebb, Nils Helge; Buchholz, Bruce A.; Hammock, Bruce D.; Rice, Robert H.

    2012-01-01

    Previous studies of triclocarban suggest that its biotransformation could yield reactive metabolites that form protein adducts. Since the skin is the major route of triclocarban exposure, present work examined this possibility in cultured human keratinocytes. The results provide evidence for considerable biotransformation and protein adduct formation when cytochrome P450 activity is induced in the cells by TCDD, a model Ah receptor ligand. Since detecting low adduct levels in cells and tissue...

  19. Effect of Surface Coating on the Toxicity of Silver Nanomaterials on Human Skin Keratinocytes

    OpenAIRE

    Lu, Wentong; Senapati, Dulal; Wang, Shuguang; Tovmachenko, Oleg; Singh, Anant Kumar; Yu, Hongtao; Ray, Paresh Chandra

    2010-01-01

    As nanotechnology field continues to develop, assessing nanoparticle toxicity is very important for advancing nanoparticles for daily life application. In this Letter, we report the effect of surface coating on cyto, geno and photo-toxicity of silver nanomaterials of different shapes on human skin HaCaT keratinocytes. We found that the citrate coated colloidal silver nanoparticles at 100 µg/mL level are not geno-, cyto- and phtotoxic. On the other hand, citrate coated powder form of the silve...

  20. In Vitro Cytotoxicity and Phototoxicity Assessment of Acylglutamate Surfactants Using a Human Keratinocyte Cell Line

    Directory of Open Access Journals (Sweden)

    Abhay Kyadarkunte

    2014-07-01

    Full Text Available In the current study, human keratinocyte cell line was used as in vitro cell culture model to elucidate the effects of the fatty acid chain length of acylglutamate (amino acid-based surfactant namely, sodium cocoyl glutamate, sodium lauroyl glutamate, and sodium myristoyl glutamate on their cytotoxicity and the ultraviolet B induced phototoxicity. The endpoint used to assess toxicity was a tetrazolium-based assay whereas, the phototoxic potential of acylglutamate surfactants was predicted using two models namely, the Photo-Irritation Factor and Mean Photo Effect. The results of this study showed that the fatty acid chain length of acylglutamate greatly influences toxic effects on human keratinocyte cells. In addition, all the acylglutamate surfactants tested on human keratinocyte cells demonstrated significantly less cytotoxicity (when irradiated and non-irradiated with ultraviolet B light; p < 0.05 and no phototoxic potential was observed in any of the acylglutamate surfactants, when compared with the positive control chlorpromazine. In conclusion, the in vitro studies confirm the suitability of sodium lauroyl glutamate destined for the synthesis and stabilization of lipid nanoparticles.

  1. The comparison of two methods to obtain human oral keratinocytes in primary culture

    International Nuclear Information System (INIS)

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  2. Biological properties of differently-aged human keratinocytes:population doubling time growth curve and cell cycle analysis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective To explore the biological properties of keratinocytes from differently-aged healthy human beings. Methods Keratinocytes from fetus,teenager and middle-aged groups were separated and cultured. The population doubling time (PDT) and cell growth curve in different cells were compared,and the cell cycles were analyzed by flow cytometry. Results ① In primary culture of keratinocytes,the adherence time in middle-aged group was longer than that in fetus and teenager groups. However,all cell morphology sh...

  3. A Sensitive Sensor Cell Line for the Detection of Oxidative Stress Responses in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Ute Hofmann

    2014-06-01

    Full Text Available In the progress of allergic and irritant contact dermatitis, chemicals that cause the generation of reactive oxygen species trigger a heat shock response in keratinocytes. In this study, an optical sensor cell line based on cultured human keratinocytes (HaCaT cells expressing green fluorescent protein (GFP under the control of the stress-inducible HSP70B’ promoter were constructed. Exposure of HaCaT sensor cells to 25 µM cadmium, a model substance for oxidative stress induction, provoked a 1.7-fold increase in total glutathione and a ~300-fold induction of transcript level of the gene coding for heat shock protein HSP70B’. An extract of Arnica montana flowers resulted in a strong induction of the HSP70B’ gene and a pronounced decrease of total glutathione in keratinocytes. The HSP70B’ promoter-based sensor cells conveniently detected cadmium-induced stress using GFP fluorescence as read-out with a limit of detection of 6 µM cadmium. In addition the sensor cells responded to exposure of cells to A. montana extract with induction of GFP fluorescence. Thus, the HaCaT sensor cells provide a means for the automated detection of the compromised redox status of keratinocytes as an early indicator of the development of human skin disorders and could be applied for the prediction of skin irritation in more complex in vitro 3D human skin models and in the development of micro-total analysis systems (µTAS that may be utilized in dermatology, toxicology, pharmacology and drug screenings.

  4. Primary cell culture from human oral tissue: gingival keratinocytes,gingival fibroblasts and periodontal ligament fibroblasts

    Directory of Open Access Journals (Sweden)

    Supreya Wanichpakorn

    2010-08-01

    Full Text Available Primary cell culture of human oral tissue has many applications for oral biology research. There are two techniques in primary culture, which includes the enzymatic and direct explant technique. The objectives of this study were (1 to isolate and investigate the difference in percentage the success in culturing three cell types from human oral tissue: gingival keratinocytes, gingival fibroblasts and periodontal ligament fibroblasts by using the direct explant technique; (2 to compare the effect of sex and age on the success of tissue culturing. Twenty seven tissue samples were obtained from healthy human gingival tissue, 19 female and 8 male patients aged 14-67 years (37.7±17.5. The tissue was cut into 1x1 mm pieces and placed on plastic culture plates containing Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin and 1% amphotericin B. For the keratinocytes culture, after the epithelial cells started to multiply around the gingival origin and the diameter was 2-5 mm., the fibroblasts were liminated by mechanical removal under inverted microscope to prevent fibroblast overgrowth and the medium was changed to keratinocyte-SFM (Gibco, BRL supplemented with 5 µg/ml gentamycin. The results revealed that gingival fibroblast gave the highest success rate in culture (96.3%, followed by gingival keratinocytes (88.9% and periodontal ligament fibroblasts (81.5%. There was no significant difference in the success rate of cultivation between younger and older individuals, as between sex of the subjects (p>0.05. The risk of failure in culture techniques is mainly caused by microbiological contamination from the tissue samples.

  5. Impact of AQP3 inducer treatment on cultured human keratinocytes, ex vivo human skin and volunteers.

    Science.gov (United States)

    Garcia, N; Gondran, C; Menon, G; Mur, L; Oberto, G; Guerif, Y; Dal Farra, C; Domloge, N

    2011-10-01

    One of the main functions of the skin is to protect the organism against environmental threats, such as thermal stress. Aquaporin-3 (AQP3) facilitates water and glycerol transport across cell membranes and therefore regulates osmotic balance in different situations of stress. This mechanism seems to be particularly important for the resistance of different organisms to cold stress. Consequently, we were interested in investigating the effect of cold and osmotic stress on AQP3 expression in normal human keratinocytes. We developed a new active ingredient to stimulate aquaporins in skin and demonstrated the partial restoration of AQP3 expression in keratinocytes transfected with AQP3 siRNA. Moreover, we examined the effect of cold stress on cell morphology and the impact of a pre-treatment with the active ingredient. Our results indicated that induction of AQP3 helped maintain a correct organization of the actin cytoskeleton, preserving cell morphology and preventing cells from rounding. Immunofluorescent staining revealed cytoplasmic localization of AQP3 and its translocation to the cell membrane following osmotic stress. Histological ex vivo studies of skin under different conditions, such as cold environment and tape-stripping, indicated that increase in AQP3 expression appears to be involved in skin protection and showed that the pattern of AQP3 expression was more enhanced in the active ingredient-treated samples. In vivo confocal microscopy by Vivascope showed a generally healthier appearance of the skin in the treated areas. These results attest to the potential value of the active ingredient in optimizing environmental stress resistance and protecting the skin from stratum corneum damage. PMID:21401652

  6. Ultraviolet radiation B induces differentiation and protein kinase C in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Mid-wave ultraviolet radiation (UVB, 280-320 nm) is highly efficient at inducing erythema, pyrimidine dimers in DNA, oncogene expression and initiation of cutaneous tumors. These UVB-induced responses of epidermal cells have been correlated with the direct effects of UVB on DNA. However, UVB has also been shown to have biologic effects at the cellular level that appear to mimic some of the membrane-associated effects produced by phorbol ester tumor promoters such as 12-O-tetradecanoyl phorbol-13-acetate (TPA). For example, we have previously shown that both UVB irradiation and TPA treatment are followed by release of arachidonic acid and a rapid, dose-dependent inhibition of epidermal growth factor (EGF) binding. TPA generates cellular responses through activation of a phospholipid-dependent, calcium-sensitive protein kinase, protein kinase C (PKC). The primary goal of the studies described here was to compare the cellular effects of TPA with those of UVB with special regard to PKC and keratinocyte growth control, using normal human epidermal keratinocytes. The results obtained showed that both TPA and UVB radiation induced differentiation in normal human keratinocytes. UVB radiation, however, increased both cytosolic and membrane-associated levels of PKC, in contrast to TPA, which increased PKC primarily in the membrane fraction. PCK is probably not the initial chromophore or target molecule of UVB, but because activation of PKC has been shown to be essential for keratinocyte differentiation, differentiation induced by UVB may be caused by activation of PKC by UVB-induced release of diacylglycerol or arachidonic acid. (au) 25 refs

  7. Strain-Dependent Augmentation of Tight-Junction Barrier Function in Human Primary Epidermal Keratinocytes by Lactobacillus and Bifidobacterium Lysates

    OpenAIRE

    Sultana, Reshma; Andrew J. McBain; O'Neill, Catherine A.

    2013-01-01

    In this study, we investigated whether probiotic lysates can modify the tight-junction function of human primary keratinocytes. The keratinocytes were grown on cell culture inserts and treated with lysates from Bifidobacterium longum, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus fermentum, or Lactobacillus rhamnosus GG. With the exception of L. fermentum (which decreased cell viability), all strains markedly enhanced tight-junction barrier function within 24 h, as assessed by...

  8. Sodium Dodecyl Sulfate and C31G as Microbicidal Alternatives to Nonoxynol 9: Comparative Sensitivity of Primary Human Vaginal Keratinocytes

    OpenAIRE

    Krebs, Fred C.; Miller, Shendra R.; Catalone, Bradley J.; Welsh, Patricia A.; Malamud, Daniel; Howett, Mary K; Wigdahl, Brian

    2000-01-01

    A broad-spectrum vaginal microbicide must be effective against a variety of sexually transmitted disease pathogens and be minimally toxic to the cell types found within the vaginal epithelium, including vaginal keratinocytes. We assessed the sensitivity of primary human vaginal keratinocytes to potential topical vaginal microbicides nonoxynol-9 (N-9), C31G, and sodium dodecyl sulfate (SDS). Direct immunofluorescence and fluorescence-activated cell sorting analyses demonstrated that primary va...

  9. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    Energy Technology Data Exchange (ETDEWEB)

    Senthilkumar, P.K. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Robertson, L.W. [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States); Ludewig, G., E-mail: Gabriele-ludewig@uiowa.edu [Interdisciplinary Graduate Program in Human Toxicology, The University of Iowa, Iowa City, IA (United States); Department of Occupational and Environmental Health, The University of Iowa, Iowa City, IA (United States)

    2012-02-15

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  10. PCB153 reduces telomerase activity and telomere length in immortalized human skin keratinocytes (HaCaT) but not in human foreskin keratinocytes (NFK)

    International Nuclear Information System (INIS)

    Polychlorinated biphenyls (PCBs), ubiquitous environmental pollutants, are characterized by long term-persistence in the environment, bioaccumulation, and biomagnification in the food chain. Exposure to PCBs may cause various diseases, affecting many cellular processes. Deregulation of the telomerase and the telomere complex leads to several biological disorders. We investigated the hypothesis that PCB153 modulates telomerase activity, telomeres and reactive oxygen species resulting in the deregulation of cell growth. Exponentially growing immortal human skin keratinocytes (HaCaT) and normal human foreskin keratinocytes (NFK) were incubated with PCB153 for 48 and 24 days, respectively, and telomerase activity, telomere length, superoxide level, cell growth, and cell cycle distribution were determined. In HaCaT cells exposure to PCB153 significantly reduced telomerase activity, telomere length, cell growth and increased intracellular superoxide levels from day 6 to day 48, suggesting that superoxide may be one of the factors regulating telomerase activity, telomere length and cell growth compared to untreated control cells. Results with NFK cells showed no shortening of telomere length but reduced cell growth and increased superoxide levels in PCB153-treated cells compared to untreated controls. As expected, basal levels of telomerase activity were almost undetectable, which made a quantitative comparison of treated and control groups impossible. The significant down regulation of telomerase activity and reduction of telomere length by PCB153 in HaCaT cells suggest that any cell type with significant telomerase activity, like stem cells, may be at risk of premature telomere shortening with potential adverse health effects for the affected organism. -- Highlights: ► Human immortal (HaCaT) and primary (NFK) keratinocytes were exposed to PCB153. ► PCB153 significantly reduced telomerase activity and telomere length in HaCaT. ► No effect on telomere length and

  11. Multi-layered culture of human skin fibroblasts and keratinocytes through three-dimensional freeform fabrication.

    Science.gov (United States)

    Lee, Wonhye; Debasitis, Jason Cushing; Lee, Vivian Kim; Lee, Jong-Hwan; Fischer, Krisztina; Edminster, Karl; Park, Je-Kyun; Yoo, Seung-Schik

    2009-03-01

    We present a method to create multi-layered engineered tissue composites consisting of human skin fibroblasts and keratinocytes which mimic skin layers. Three-dimensional (3D) freeform fabrication (FF) technique, based on direct cell dispensing, was implemented using a robotic platform that prints collagen hydrogel precursor, fibroblasts and keratinocytes. A printed layer of cell-containing collagen was crosslinked by coating the layer with nebulized aqueous sodium bicarbonate. The process was repeated in layer-by-layer fashion on a planar tissue culture dish, resulting in two distinct cell layers of inner fibroblasts and outer keratinocytes. In order to demonstrate the ability to print and culture multi-layered cell-hydrogel composites on a non-planar surface for potential applications including skin wound repair, the technique was tested on a poly(dimethylsiloxane) (PDMS) mold with 3D surface contours as a target substrate. Highly viable proliferation of each cell layer was observed on both planar and non-planar surfaces. Our results suggest that organotypic skin tissue culture is feasible using on-demand cell printing technique with future potential application in creating skin grafts tailored for wound shape or artificial tissue assay for disease modeling and drug testing. PMID:19108884

  12. Lysophosphatidic acid regulates adhesion molecules and enhances migration of human oral keratinocytes.

    Science.gov (United States)

    Thorlakson, Hong H; Schreurs, Olav; Schenck, Karl; Blix, Inger J S

    2016-04-01

    Oral keratinocytes are connected via cell-to-cell adhesions to protect underlying tissues from physical and bacterial damage. Lysophosphatidic acids (LPAs) are a family of phospholipid mediators that have the ability to regulate gene expression, cytoskeletal rearrangement, and cytokine/chemokine secretion, which mediate proliferation, migration, and differentiation. Several forms of LPA are found in saliva and gingival crevicular fluid, but it is unknown how they affect human oral keratinocytes (HOK). The aim of the present study was therefore to examine how different LPA forms affect the expression of adhesion molecules and the migration and proliferation of HOK. Keratinocytes were isolated from gingival biopsies obtained from healthy donors and challenged with different forms of LPA. Quantitative real-time RT-PCR, immunocytochemistry, and flow cytometry were used to analyze the expression of adhesion molecules. Migration and proliferation assays were performed. Lysophosphatidic acids strongly promoted expression of E-cadherin and occludin mRNAs and translocation of E-cadherin protein from the cytoplasm to the membrane. Occludin and claudin-1 proteins were up-regulated by LPA. Migration of HOK in culture was increased, but proliferation was reduced, by the addition of LPA. This indicates that LPA can have a role in the regulation of the oral epithelial barrier by increasing the expression of adhesion molecules of HOK, by promotion of migration and by inhibition of proliferation. PMID:26913569

  13. The effect of the plasma needle on the human keratinocytes related to the wound healing process

    Science.gov (United States)

    Korolov, Ihor; Fazekas, Barbara; Széll, Márta; Kemény, Lajos; Kutasi, Kinga

    2016-01-01

    In the present study we aim to verify the influence of a non-thermal atmospheric pressure plasma on the wound healing process. In this process the major contributors are the keratinocytes, which migrate to fill in the gap created by the wound. Therefore, we performed the direct treatment of HPV-immortalized human keratinocytes, protected by a layer of phosphate buffered saline (PBS) solution, with the glow discharge generated in flowing helium by a plasma needle. To mimick a wound, a 4 mm scratch was performed on the cell culture (scratch assay). We conducted two types of experiments: (i) cell proliferation and (ii) wound-healing model experiments. The plasma needle configuration, the plasma treatment conditions and the thickness of the protecting PBS layer were set based on viability experiments. The proliferation studies showed that short, 5-10 s, and low power treatments, such as 18 W and 20 W input power, could positively influence the cell proliferation when keratinocytes were protected by PBS. On the other hand, the plasma treatment of cell medium covered keratinocytes resulted in the decrease of proliferation. The wound-healing model (scratch assay) studies showed, that there was a maximum in the wound reduction as a function of the input power and treatment time, namely, at 18 W and 5 s. Furthermore, the wound reduction strongly depended on the treated cell—PBS interaction time. To mimic an infected wound, the scratch assay was covered with a 1× {{10}9} cfu ml-1 Propionibacterium acnes suspension. The plasma treatment of this infected assay resulted in closing of the scratch, while in the non-treated assay the wound did not close at all.

  14. Effectiveness of octenidine and chlorhexidine in the artificially contaminated 3-D-culture of human keratinocytes

    Directory of Open Access Journals (Sweden)

    Kramer, Axel

    2009-12-01

    Full Text Available Epidermis-Equivalents (EpiDerm derived from human keratinocytes were obtained after 14 d air-lift-culture. These In-vitro-models were used for the demonstration of a possible postantiseptic effect against the test microorganisms Pseudomonas aeruginosa and Staphylococcus aureus after 5 min pre-incubation of the surface of the epidermis with equimolar concentrations of the antiseptic agents chlorhexidine digluconate (CHX and octenidine dihydrochloride (OCT of 1.6 mmol/l. Both antiseptics adhere to the surface of EpiDerm. Each active agent cannot be removed by washing with phosphate-buffered saline (PBS and remains microbiocidal active. EpiDerm-OCT was more effective after 30 min at room temperature against 106 cfu/ml Staphylococcus aureus resulting 3.2–4 log10 reduction, but not for EpiDerm-CHX producing only 2–2.4 log10 reduction. A maximum of 0.6–1.2 log10 reduction was found against Pseudomonas aeruginosa after 30 min exposure in EpiDerm-OCT, but there was no or a neglectable microbiocidal activity of 0–0.2 log10 reduction using EpiDerm-CHX. The postantiseptic effect of OCT is superior to EpiDerm-bound CHX comparing equimolar concentrations of active agent used for pre-incubation of EpiDerm. Treatment of EpiDerm with OCT alone or in combination with test organisms resulted in no cytotoxic effect in viable keratinocytes. In contrast to that the test organism Staphylococcus aureus, the active agent CHX alone or in combination with both test organisms demonstrated a cytotoxic activity reducing the viability of basal keratinocytes more than 10%. Therefore, OCT is more tolerated than CHX by basal keratinocytes of the presented In-vitro-model EpiDerm.

  15. Genome-wide analysis of high risk human papillomavirus E2 proteins in human primary keratinocytes.

    Science.gov (United States)

    Sunthamala, Nuchsupha; Pang, Chai Ling; Thierry, Francoise; Teissier, Sebastien; Pientong, Chamsai; Ekalaksananan, Tipaya

    2014-12-01

    The E2 protein is expressed in the early stage of human papillomavirus (HPV) infection that is associated with cervical lesions. This protein plays important roles in regulation of viral replication and transcription. To characterize the role of E2 protein in modulation of cellular gene expression in HPV infected cells, genome-wide expression profiling of human primary keratinocytes (HPK) harboring HPV16 E2 and HPV18 E2 was investigated using microarray. The Principle Components Analysis (PCA) revealed that the expression data of HPV16 E2 and HPV18 E2-transduced HPKs were rather closely clustered. The Venn diagram of modulated genes showed an overlap of 10 common genes in HPV16 E2 expressing HPK and HPV18 E2 expressing HPK. These genes were expressed with significant difference by comparison with control cells. In addition, the distinct sets of modulated genes were detected 14 and 34 genes in HPV16 E2 and HPV18 E2 expressing HPKs, respectively. PMID:26484085

  16. Genome-wide analysis of high risk human papillomavirus E2 proteins in human primary keratinocytes

    Directory of Open Access Journals (Sweden)

    Nuchsupha Sunthamala

    2014-12-01

    Full Text Available The E2 protein is expressed in the early stage of human papillomavirus (HPV infection that is associated with cervical lesions. This protein plays important roles in regulation of viral replication and transcription. To characterize the role of E2 protein in modulation of cellular gene expression in HPV infected cells, genome-wide expression profiling of human primary keratinocytes (HPK harboring HPV16 E2 and HPV18 E2 was investigated using microarray. The Principle Components Analysis (PCA revealed that the expression data of HPV16 E2 and HPV18 E2-transduced HPKs were rather closely clustered. The Venn diagram of modulated genes showed an overlap of 10 common genes in HPV16 E2 expressing HPK and HPV18 E2 expressing HPK. These genes were expressed with significant difference by comparison with control cells. In addition, the distinct sets of modulated genes were detected 14 and 34 genes in HPV16 E2 and HPV18 E2 expressing HPKs, respectively.

  17. Gut bacteria producing phenols disturb keratinocyte differentiation in human skin

    OpenAIRE

    Iizuka, Ryoka; Kawakami, Koji; Chiba, Katsuyoshi

    2011-01-01

    Objective: Our previous study suggested that phenols (phenol and p-cresol) produced by gut bacteria affect the skin in hairless mice. In the present study we aimed to determine if the same phenomenon is applicable to humans. Methods: First, we analyzed the correlation between serum phenol levels and corneocyte size in 50 healthy female volunteers. Second, we administered a prebiotic beverage (containing galacto-oligosaccharides and polydextrose) to 19 healthy female volunteers and examined th...

  18. Pseudomonas-derived ceramidase induces production of inflammatory mediators from human keratinocytes via sphingosine-1-phosphate.

    Directory of Open Access Journals (Sweden)

    Ami Oizumi

    Full Text Available Ceramide is important for water retention and permeability barrier functions in the stratum corneum, and plays a key role in the pathogenesis of atopic dermatitis (AD. A Pseudomonas aeruginosa-derived neutral ceramidase (PaCDase isolated from a patient with AD was shown to effectively degrade ceramide in the presence of Staphylococcus aureus-derived lipids or neutral detergents. However, the effect of ceramide metabolites on the functions of differentiating keratinocytes is poorly understood. We found that the ceramide metabolite sphingosine-1-phosphate (S1P stimulated the production of inflammatory mediators such as TNF-α and IL-8 from three-dimensionally cultured human primary keratinocytes (termed "3D keratinocytes", which form a stratum corneum. PaCDase alone did not affect TNF-α gene expression in 3D keratinocytes. In the presence of the detergent Triton X-100, which damages stratum corneum structure, PaCDase, but not heat-inactivated PaCDase or PaCDase-inactive mutant, induced the production of TNF-α, endothelin-1, and IL-8, indicating that this production was dependent on ceramidase activity. Among various ceramide metabolites, sphingosine and S1P enhanced the gene expression of TNF-α, endothelin-1, and IL-8. The PaCDase-enhanced expression of these genes was inhibited by a sphingosine kinase inhibitor and by an S1P receptor antagonist VPC 23019. The TNF-α-binding antibody infliximab suppressed the PaCDase-induced upregulation of IL-8, but not TNF-α, mRNA. PaCDase induced NF-κB p65 phosphorylation. The NF-κB inhibitor curcumin significantly inhibited PaCDase-induced expression of IL-8 and endothelin-1. VPC 23019 and infliximab inhibited PaCDase-induced NF-κB p65 phosphorylation and reduction in the protein level of the NF-κB inhibitor IκBα. Collectively, these findings suggest that (i 3D keratinocytes produce S1P from sphingosine, which is produced through the hydrolysis of ceramide by PaCDase, (ii S1P induces the production

  19. Novel non-calcemic secosteroids that are produced by human epidermal keratinocytes protect against solar radiation.

    Science.gov (United States)

    Slominski, Andrzej T; Janjetovic, Zorica; Kim, Tae-Kang; Wasilewski, Piotr; Rosas, Sofia; Hanna, Sherie; Sayre, Robert M; Dowdy, John C; Li, Wei; Tuckey, Robert C

    2015-04-01

    CYP11A1 hydroxylates the side chain of vitamin D3 (D3) in a sequential fashion [D3→20S(OH)D3→20,23(OH)2D3→17,20,23(OH)3D3], in an alternative to the classical pathway of activation [D3→25(OH)D3→1,25(OH)2D3]. The products/intermediates of the pathway can be further modified by the action of CYP27B1. The CYP11A1-derived products are biologically active with functions determined by the lineage of the target cells. This pathway can operate in epidermal keratinocytes. To further define the role of these novel secosteroids we tested them for protective effects against UVB-induced damage in human epidermal keratinocytes, melanocytes and HaCaT keratinocytes, cultured in vitro. The secosteroids attenuated ROS, H2O2 and NO production by UVB-irradiated keratinocytes and melanocytes, with an efficacy similar to 1,25(OH)2D3, while 25(OH)D3 had lower efficacy. These attenuations were also seen to some extent for the 20(OH)D3 precursor, 20S-hydroxy-7-dehydrocholesterol. These effects were accompanied by upregulation of genes encoding enzymes responsible for defense against oxidative stress. Using immunofluorescent staining we observed that the secosteroids reduced the generation cyclobutane pyrimidine dimers in response to UVB and enhanced expression of p53 phosphorylated at Ser-15, but not at Ser-46. Additional evidence for protection against DNA damage in cells exposed to UVB and treated with secosteroids was provided by the Comet assay where DNA fragmentation was markedly reduced by 20(OH)D3 and 20,23(OH)2D3. In conclusion, novel secosteroids that can be produced by the action of CYP11A1 in epidermal keratinocytes have protective effects against UVB radiation. This article is part of a special issue entitled '17th Vitamin D Workshop'. PMID:25617667

  20. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Woodworth, C.D.; Doniger, J.; DiPaolo, J.A.

    1989-01-01

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma.

  1. Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma

    International Nuclear Information System (INIS)

    Normal human foreskin keratinocytes cotransfected with the neomycin resistance gene and recombinant human papillomavirus (HPV) DNAs (types 16, 18, 31, and 33) that have a high or moderate association with cervical malignancy acquired immortality and contained integrated and transcriptionally active viral genomes. Only transcripts from the intact E6 and E7 genes were detected in at least one cell line, suggesting that one or both of these genes are responsible for immortalization. Recombinant HPV DNAs with low or no oncogenic potential for cervical cancer (HPV1a, -5, -6b, and -11) induced small G418-resistant colonies that senesced as did the nontransfected cells. These colonies contained only episomal virus DNA; therefore, integration of HPV sequences is important for immortalization of keratinocytes. This study suggests that the virus-encoded immortalization function contributes to the pathogenesis of cervical carcinoma

  2. Human Metapneumovirus in Adults

    OpenAIRE

    Haas, Lenneke E. M.; Steven F. T. Thijsen; Leontine van Elden; Heemstra, Karen A.

    2013-01-01

    Human metapneumovirus (HMPV) is a relative newly described virus. It was first isolated in 2001 and currently appears to be one of the most significant and common human viral infections. Retrospective serologic studies demonstrated the presence of HMPV antibodies in humans more than 50 years earlier. Although the virus was primarily known as causative agent of respiratory tract infections in children, HMPV is an important cause of respiratory infections in adults as well. Almost all children ...

  3. Biological properties of differently-aged human keratinocytes:population doubling time growth curve and cell cycle analysis

    Institute of Scientific and Technical Information of China (English)

    Hui-qun Ma; Jie Feng; Lech Chyczewski; Jacek Niklinski

    2009-01-01

    Objective To explore the biological properties of keratinocytes from differently-aged healthy human beings. Methods Keratinocytes from fetus, teenager and middle-aged groups were separated and cultured. The population doubling time (PDT) and cell growth curve in different cells were compared, and the cell cycles were analyzed by flow cytometry. Results ① In primary culture of keratinocytes, the adherence time in middle-aged group was longer than that in fetus and teenager groups. However, all cell morphology showed no obvioas differences. In subculture of kecatinocytes, with donator's age increasing, time of cell adherence prolonged, passage number decreused and differences in cell morphology were obrioas. ② The average PDT of keratinocytes was shorter in fetus group than in teenager and middle-aged groups. Bat difference in cell growth curve between different passages was not observed. ③ Keratinocytes showed G2/M period in fetus group but G0/G1 period in teenager and middle-aged groups mainly. Conclusion As age increases, the biological properties of keratinocytes change obviously.

  4. Mitochondrial and glycolytic activity of UV-irradiated human keratinocytes and its stimulation by a Saccharomyces cerevisiae autolysate.

    Science.gov (United States)

    Schütz, Rolf; Kuratli, Karin; Richard, Nathalie; Stoll, Clarissa; Schwager, Joseph

    2016-06-01

    Cutaneous aging is correlated with mitochondrial dysfunction and a concomitant decline in energy metabolism that can be accelerated by extrinsic factors such as UV radiation (UVR). In this study we compared cellular bioenergetics of normal and UV-irradiated primary human epidermal keratinocytes. Moreover, we investigated the influence of a Saccharomyces cerevisiae autolysate (SCA) on stressed keratinocytes to regain cellular homeostasis. Cellular metabolism was assessed by extracellular flux analysis which measures oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) as well as by ATP quantification. The expression level of ten mitochondria related genes in normal and UVR-stimulated (60mJ/cm(2) UVB) keratinocytes was quantified by real-time PCR and the impact of SCA addition was determined. Sublethal UV stress increased mitochondrial dysfunction in keratinocytes which resulted in reduced viability, uncoupled oxidative phosphorylation, and down-regulated mitochondrial gene expression. Particularly, gene expression of SHDA, UPC2, BID, and ATP5A1 was reduced about twofold within 4h. Treatment of keratinocytes with SCA shifted cellular metabolism towards a more energetic status by increasing the respiratory rate and glycolysis. SCA also stimulated cellular ATP production after short (4h) and prolonged (22h) incubations and induced the expression of genes related to mitochondrial function towards normal expression levels upon UV irradiation. The decreased respiratory capacity of UV-irradiated keratinocytes was partially compensated by the addition of SCA which enhanced glycolytic activity and thereby increased cellular resistance to environmental stress. PMID:27060217

  5. UVA and UVB irradiation differentially regulate microRNA expression in human primary keratinocytes.

    Directory of Open Access Journals (Sweden)

    Anne Kraemer

    Full Text Available MicroRNA (miRNA-mediated regulation of the cellular transcriptome is an important epigenetic mechanism for fine-tuning regulatory pathways. These include processes related to skin cancer development, progression and metastasis. However, little is known about the role of microRNA as an intermediary in the carcinogenic processes following exposure to UV-radiation. We now show that UV irradiation of human primary keratinocytes modulates the expression of several cellular miRNAs. A common set of miRNAs was influenced by exposure to both UVA and UVB. However, each wavelength band also activated a distinct subset of miRNAs. Common sets of UVA- and UVB-regulated miRNAs harbor the regulatory elements GLYCA-nTRE, GATA-1-undefined-site-13 or Hox-2.3-undefined-site-2 in their promoters. In silico analysis indicates that the differentially expressed miRNAs responding to UV have potential functions in the cellular pathways of cell growth and proliferation. Interestingly, the expression of miR-23b, which is a differentiation marker of human keratinocytes, is remarkably up-regulated after UVA irradiation. Studying the interaction between miR-23b and its putative skin-relevant targets using a Luciferase reporter assay revealed that RRAS2 (related RAS viral oncogene homolog 2, which is strongly expressed in highly aggressive malignant skin cancer, to be a direct target of miR-23b. This study demonstrates for the first time a differential miRNA response to UVA and UVB in human primary keratinocytes. This suggests that selective regulation of signaling pathways occurs in response to different UV energies. This may shed new light on miRNA-regulated carcinogenic processes involved in UV-induced skin carcinogenesis.

  6. Novel protein in human epidermal keratinocytes: regulation of expression during differentiation.

    OpenAIRE

    Kartasova, T; van Muijen, G. N.; Pelt-Heerschap, H. van; van de Putte, P

    1988-01-01

    Recently, two groups of cDNA clones have been isolated from human epidermal keratinocytes; the clones correspond to genes whose expression is stimulated by exposure of the cells to UV light or treatment with 4-nitroquinoline 1-oxide or 12-O-tetradecanoylphorbol 13-acetate (T. Kartasova and P. van de Putte, Mol. Cell. Biol. 8:2195-2203, 1988). The proteins predicted by the nucleotide sequence of both groups of cDNAs are small (8 to 10 kilodaltons), are exceptionally rich in proline, glutamine,...

  7. Phototoxicity of Phenylenediamine Hair Dye Chemicals in Salmonella typhimurium TA102 and Human Skin Keratinocytes

    OpenAIRE

    Yu, Hongtao; Mosley-Foreman; Choi, Jaehwa; Wang, Shuguang

    2008-01-01

    Phenylenediamines (PD) are dye precursors used to manufacture hair dyes. The three PDs, 1,2-, 1,3-, and 1,4-PD and three chlorinated PDs, 4-chloro-1,2-PD, 4-chloro-1,3- PD, and 4,5-dichloro-1,2-PD were studied for their mutagenic effect in Salmonella typhimurium TA 102, cytotoxicity in human skin keratinocyte cells, and for DNA cleavage. The results show that all six compounds are not toxic/mutagenic in TA 102 bacteria or skin cells, and do not cause DNA cleavage in ΦX 174 phage DNA. If the s...

  8. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays.Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation.  The most widespread, intense and uniform staining for PCNA

  9. Mammalian target of rapamycin (mTOR) regulates TLR3 induced cytokines in human oral keratinocytes

    OpenAIRE

    Zhao, Jiawei; Manjunatha R Benakanakere; Hosur, Kavita B.; Galicia, Johnah C.; Martin, Michael; Kinane, Denis F.

    2010-01-01

    Recent studies implicate the mammalian target of rapamycin (mTOR) pathway in the control of inflammatory responses following Toll-like receptor (TLR) stimulation in myeloid cells but its role in non-myeloid cells such as human keratinocytes is unknown. Here we show that TLR3 signaling can induce robust cytokine secretion including interleukin 1 beta (IL-1β), tumor necrosis factor alpha (TNFα), IL-12p70 and interferon beta (IFN-β), and our data reveal for the first time that inhibiting mTOR wi...

  10. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress

    OpenAIRE

    Kim, Ki Cheon; Piao, Mei Jing; Hewage, Susara Ruwan Kumara Madduma; Han, Xia; Kang, Kyoung Ah; JO, JIN OH; Mok, Young Sun; Shin, Jennifer H.; Park, Yeunsoo; Yoo, Suk Jae; Hyun, Jin Won

    2015-01-01

    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay....

  11. Advanced oxidative protein products induced human keratinocyte apoptosis through the NOX-MAPK pathway.

    Science.gov (United States)

    Sun, Baihui; Ding, Ruoting; Yu, Wenlin; Wu, Yanhong; Wang, Bulin; Li, Qin

    2016-07-01

    Impaired wound healing is a major diabetes-related complication. Keratinocytes play an important role in wound healing. Multiple factors have been proposed that can induce dysfunction in keratinocytes. The focus of present research is at a more specific molecular level. We investigated the role of advanced oxidative protein products (AOPPs) in inducing human immortalized keratinocyte (HaCaT) cell apoptosis and the cellular mechanism underlying the proapoptotic effect of AOPPs. HaCaT cells were treated with increasing concentrations of AOPP-human serum albumin or for increasing time durations. The cell viability was measured using the thiazolyl blue tetrazolium bromide method, and flow cytometry was used to assess the rate of cell apoptosis. A loss of mitochondrial membrane potential (MMP) and an increase in intracellular reactive oxygen species (ROS) were observed through a confocal laser scanning microscope system, and the level of ROS generation was determined using a microplate reader. Nicotinamide adenine dinucleotide phosphate oxidase (NOX)4, extracellular signal-regulated kinase (ERK)1/2, p38 mitogen-activated protein kinase (MAPK), and apoptosis-related downstream protein interactions were investigated using the Western blot analysis. We found that AOPPs triggered HaCaT cell apoptosis and MMP loss. After AOPP treatment, intracellular ROS generation increased in a time- and dose-dependent manner. Proapoptotic proteins, such as Bax, caspase 9/caspase 3, and poly(ADP-ribose) polymerase (PARP)-1 were activated, whereas anti-apoptotic Bcl-2 protein was downregulated. AOPPs also increased NOX4, ERK1/2, and p38 MAPK expression. Taken together, these findings suggest that extracellular AOPP accumulation triggered NOX-dependent ROS production, which activated ERK1/2 and p38 MAPK, and induced HaCaT cell apoptosis by activating caspase 3 and PARP-1. PMID:27155970

  12. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin

    DEFF Research Database (Denmark)

    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith;

    2008-01-01

    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present...... study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning...... calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non...

  13. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Olerud John E

    2011-06-01

    Full Text Available Abstract Background Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. Results The impact of S. aureus soluble products in biofilm-conditioned medium (BCM or in planktonic-conditioned medium (PCM on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Conclusions Collectively the results indicate that S

  14. Alkannin, HSP70 inducer, protects against UVB-induced apoptosis in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Yoko Yoshihisa

    Full Text Available Alkannin is an active constituent from the root extract of Alkanna tinctoria of the Boraginaceae family and it may have utility as a heat shock protein 70 (HSP70 inducer in living organisms. Here, the effects of alkannin-induced HSP70 on ultraviolet (UV B (40 mJ/cm(2-induced apoptosis were investigated in human keratinocyte HaCaT cells. Pretreatment of cells with alkannin (1 µM caused significant inhibition of UVB-induced apoptosis and caspase-3 cleavage. On the other hand, the addition of KNK437 (HSP70 inhibitor reversed the action of alkannin increasing UVB-induced apoptosis in a dose-dependent manner. In addition, differences in gene expression associated with the suppression of UVB-induced apoptosis in the presence of alkannin were investigated using Gene Chip assay. Our results indicate that alkannin suppresses UVB-induced apoptosis through the induction of HSP70 in human keratinocytes, and therefore, we suggest the usefulness of using alkannin as an antiaging agent.

  15. Structural Patterns of Rhamnogalacturonans Modulating Hsp-27 Expression in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yann Guerardel

    2008-05-01

    Full Text Available Polysaccharide extracts were obtained from chestnut bran (Castanea sativa, grape marc (Vitis vinifera and apple marc (Malus spp. and fractionated by size exclusion chromatography after endopolygalacturonase degradation. Compositional and linkage analyses by GC and GC-MS showed the characteristic rhamnogalacturonan structure with specific arabinan (apple marc and type II arabinogalactan (chestnut bran, grape marc side chains. Type II arabinogalactan rhamnogalacturonan from chestnut bran significantly stimulated the in vitro differentiation of human keratinocytes, giving evidence of a tight structure-function relationship. This molecule comprises short and ramified 3- and 3,6-β- D-galactan and 5- and 3,5-α-L-arabinan side chains, but also contains significant amounts of t-Xyl and 4-Xyl with a characteristic 2:1 ratio. Enzymatic hydrolysis of this polysaccharide produced fragments of lower molecular weight with unchanged xylose content which conserved the same ability to stimulate human keratinocyte differentiation. It could be then speculated that dimeric xylosyl-xylose and/or longer oligomeric xylose side chains attached to a galacturonan and closely associated to hairy rhamno-galacturonan domains are essential patterns that could determine the biological activity of pectins.

  16. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with [3H] arachidonic acid or [3H] choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of [3H] arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of [3H] choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase

  17. Additive Effects of Millimeter Waves and 2-Deoxyglucose Co-Exposure on the Human Keratinocyte Transcriptome.

    Science.gov (United States)

    Soubere Mahamoud, Yonis; Aite, Meziane; Martin, Catherine; Zhadobov, Maxim; Sauleau, Ronan; Le Dréan, Yves; Habauzit, Denis

    2016-01-01

    Millimeter Waves (MMW) will be used in the next-generation of high-speed wireless technologies, especially in future Ultra-Broadband small cells in 5G cellular networks. Therefore, their biocompatibilities must be evaluated prior to their massive deployment. Using a microarray-based approach, we analyzed modifications to the whole genome of a human keratinocyte model that was exposed at 60.4 GHz-MMW at an incident power density (IPD) of 20 mW/cm2 for 3 hours in athermic conditions. No keratinocyte transcriptome modifications were observed. We tested the effects of MMWs on cell metabolism by co-treating MMW-exposed cells with a glycolysis inhibitor, 2-deoxyglucose (2dG, 20 mM for 3 hours), and whole genome expression was evaluated along with the ATP content. We found that the 2dG treatment decreased the cellular ATP content and induced a high modification in the transcriptome (632 coding genes). The affected genes were associated with transcriptional repression, cellular communication and endoplasmic reticulum homeostasis. The MMW/2dG co-treatment did not alter the keratinocyte ATP content, but it did slightly alter the transcriptome, which reflected the capacity of MMW to interfere with the bioenergetic stress response. The RT-PCR-based validation confirmed 6 MMW-sensitive genes (SOCS3, SPRY2, TRIB1, FAM46A, CSRNP1 and PPP1R15A) during the 2dG treatment. These 6 genes encoded transcription factors or inhibitors of cytokine pathways, which raised questions regarding the potential impact of long-term or chronic MMW exposure on metabolically stressed cells. PMID:27529420

  18. Characterization of sciellin, a precursor to the cornified envelope of human keratinocytes.

    Science.gov (United States)

    Kvedar, J C; Manabe, M; Phillips, S B; Ross, B S; Baden, H P

    1992-04-01

    The cornified envelope, located beneath the plasma membrane of terminally differentiated keratinocytes, is formed as protein precursors are cross-linked by a membrane associated transglutaminase. This report characterizes a new precursor to the cornified envelope. A monoclonal antibody derived from mice immunized with cornified envelopes of human cultured keratinocytes stained the periphery of more differentiated cells in epidermis and other stratified squamous epithelia including hair and nails. The epitope was widely conserved among mammals as determined by immunohistochemical and Western analysis. Immunoelectron microscopy localized the epitope to the cell periphery in the upper stratum spinosum and granulosum of epidermis. In the hair follicle, the epitope was present in the internal root sheath and in the infundibulum, the innermost aspect of the external root sheath. The antibody recognized a protein of relative mobility (M(r)) 82,000, pI 7.8. The protein was a transglutaminase substrate as shown by a dansylcadaverine incorporation assay. Purified cornified envelopes absorbed the reactivity of the antibody to the partially purified protein and cleavage of envelopes by cyanogen bromide resulted in release of immunoreactive fragments. The protein was soluble only in denaturing buffers such as 8 M urea or 2% sodium dodecyl-sulfate (SDS). Partial solubility could be achieved in 50 mM TRIS pH 8.3 plus 0.3 M NaCl (high salt buffer); the presence of a reducing agent did not affect solubility. Extraction of cultured keratinocytes in 8 M urea and subsequent dialysis against 50 mM TRIS pH 8.3 buffer resulted in precipitation of the protein with the keratin filaments. Dialysis against high salt buffer prevented precipitation of the protein. The unique solubility properties of this protein suggest that it aggregates with itself and/or with keratin filaments. The possible role of the protein in cornified envelope assembly is discussed. We have named this protein Sciellin

  19. The Effect of Secretory Factors of Adipose-Derived Stem Cells on Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Soo-Wan Nam

    2012-01-01

    Full Text Available The beneficial effects of adipose-derived stem cell conditioned medium (ADSC-CM on skin regeneration have been reported. Although the mechanism of how ADSC-CM promotes skin regeneration is unclear, ADSC-CM contained various growth factors and it is an excellent raw material for skin treatment. ADSC-CM produced in a hypoxia condition of ADSC—in other words, Advanced Adipose-Derived Stem cell Protein Extract (AAPE—has great merits for skin regeneration. In this study, human primary keratinocytes (HKs, which play fundamental roles in skin tissue, was used to examine how AAPE affects HK. HK proliferation was significantly higher in the experimental group (1.22 μg/mL than in the control group. DNA gene chip demonstrated that AAPE in keratinocytes (p < 0.05 notably affected expression of 290 identified transcripts, which were associated with cell proliferation, cycle and migration. More keratinocyte wound healing and migration was shown in the experimental group (1.22 μg/mL. AAPE treatment significantly stimulated stress fiber formation, which was linked to the RhoA-ROCK pathway. We identified 48 protein spots in 2-D gel analysis and selected proteins were divided into 64% collagen components and 30% non-collagen components as shown by the MALDI-TOF analysis. Antibody array results contained growth factor/cytokine such as HGF, FGF-1, G-CSF, GM-CSF, IL-6, VEGF, and TGF-β3 differing from that shown by 2-D analysis. Conclusion: AAPE activates HK proliferation and migration. These results highlight the potential of the topical application of AAPE in the treatment of skin regeneration.

  20. Human β-Defensin-2 Induction in Human Foreskin Keratinocyte by Synergetic Stimulation with Foods and Escherichia Coli

    OpenAIRE

    Nishimura, Eisaku; Kato, Masatoshi; Hashizume, Shuichi

    2003-01-01

    We established a real-time quantitative RT-PCR assay that permits rapid and sensitive screening of foods that increase the human β-defensin-2 (hBD-2) mRNA level in human foreskin keratinocyte (HFK) cells. The range of hBD-2 mRNA concentrations suitable for the assay was between 8 × 10−11 M (39-cycle amplification) and 8 × 10−18 M (13-cycle amplification) as calibrated with standard hBD-2 cDNA. With this assay system, it was found that the stimulation of HFK cells by the addition of yeast powd...

  1. Saponins from Tribulus terrestris L. protect human keratinocytes from UVB-induced damage.

    Science.gov (United States)

    Sisto, Margherita; Lisi, Sabrina; D'Amore, Massimo; De Lucro, Raffaella; Carati, Davide; Castellana, Donatello; La Pesa, Velia; Zuccarello, Vincenzo; Lofrumento, Dario D

    2012-12-01

    Chronic exposure to solar UVB radiation damages skin, increasing the risk to develop cancer. Hence the identification of compounds with a photoprotective efficacy is essential. This study examined the role of saponins derived from Tribulus terrestris L. (TT) on the modulation of apoptosis in normal human keratinocytes (NHEK) exposed to physiological doses of UVB and to evaluate their antitumoral properties. In NHEK, TT saponins attenuate UVB-induced programmed cell death through inhibition of intrinsic apoptotic pathway. In squamous cell carcinomas (SCC) TT saponins do not make the malignant keratinocytes more resistant to UVB and determine an enhanced apoptotic response. The photoprotective effect of TT saponins is tightly correlated to the enhancement of NER genes expression and the block of UVB-mediated NF-κB activation. Collectively, our study shows experimental evidence that TT has a preventive efficacy against UVB-induced carcinogenesis and the molecular knowledge on the mechanisms through which TT saponins regulate cell death suggests great potential for TT to be developed into a new medicine for cancer patients. PMID:23142932

  2. The flavonoid apigenin suppresses vitamin D receptor expression and vitamin D responsiveness in normal human keratinocytes.

    Science.gov (United States)

    Segaert, S; Courtois, S; Garmyn, M; Degreef, H; Bouillon, R

    2000-02-01

    Apigenin, a flavonoid with chemopreventive properties, induces cellular growth arrest, with concomitant inhibition of intracellular signaling cascades and decreased proto-oncogene expression. We report that apigenin potently inhibited vitamin D receptor (VDR) mRNA and protein expression in human keratinocytes without changes in VDR mRNA half-life. Concurrently, downregulation of retinoid X receptor alpha, a dramatic loss of c-myc mRNA, and upregulation of p21(WAF1) took place. Furthermore, a nearly complete suppression of vitamin D responsiveness was observed as estimated by induction of 24-hydroxylase mRNA. The apigenin effect on VDR expression was shared by some other (quercetine and fisetine) but not all tested flavonoids. Interestingly, the apigenin-mediated VDR suppression was counteracted by the NFkappaB inhibitors sodium salicylate and caffeic acid phenethyl ester. The presented results propose suppression of nuclear receptor levels as a novel mechanism whereby flavonoids exert their pleiotropic effects. This study may also contribute to the understanding of the regulation of VDR expression in epidermal keratinocytes. PMID:10652242

  3. Cysteine Prevents the Reduction in Keratin Synthesis Induced by Iron Deficiency in Human Keratinocytes.

    Science.gov (United States)

    Miniaci, Maria Concetta; Irace, Carlo; Capuozzo, Antonella; Piccolo, Marialuisa; Di Pascale, Antonio; Russo, Annapina; Lippiello, Pellegrino; Lepre, Fabio; Russo, Giulia; Santamaria, Rita

    2016-02-01

    L-cysteine is currently recognized as a conditionally essential sulphur amino acid. Besides contributing to many biological pathways, cysteine is a key component of the keratin protein by its ability to form disulfide bridges that confer strength and rigidity to the protein. In addition to cysteine, iron represents another critical factor in regulating keratins expression in epidermal tissues, as well as in hair follicle growth and maturation. By focusing on human keratinocytes, the aim of this study was to evaluate the effect of cysteine supplementation as nutraceutical on keratin biosynthesis, as well as to get an insight on the interplay of cysteine availability and cellular iron status in regulating keratins expression in vitro. Herein we demonstrate that cysteine promotes a significant up-regulation of keratins expression as a result of de novo protein synthesis, while the lack of iron impairs keratin expression. Interestingly, cysteine supplementation counteracts the adverse effect of iron deficiency on cellular keratin expression. This effect was likely mediated by the up-regulation of transferrin receptor and ferritin, the main cellular proteins involved in iron homeostasis, at last affecting the labile iron pool. In this manner, cysteine may also enhance the metabolic iron availability for DNA synthesis without creating a detrimental condition of iron overload. To the best of our knowledge, this is one of the first study in an in vitro keratinocyte model providing evidence that cysteine and iron cooperate for keratins expression, indicative of their central role in maintaining healthy epithelia. PMID:26212225

  4. Hesperidin Attenuates Ultraviolet B-Induced Apoptosis by Mitigating Oxidative Stress in Human Keratinocytes

    Science.gov (United States)

    Hewage, Susara Ruwan Kumara Madduma; Piao, Mei Jing; Kang, Kyoung Ah; Ryu, Yea Seong; Han, Xia; Oh, Min Chang; Jung, Uhee; Kim, In Gyu; Hyun, Jin Won

    2016-01-01

    Human skin cells undergo pathophysiological processes via generation of reactive oxygen species (ROS) upon excessive exposure to ultraviolet B (UVB) radiation. This study investigated the ability of hesperidin (C28H34O15) to prevent apoptosis due to oxidative stress generated through UVB-induced ROS. Hesperidin significantly scavenged ROS generated by UVB radiation, attenuated the oxidation of cellular macromolecules, established mitochondrial membrane polarization, and prevented the release of cytochrome c into the cytosol. Hesperidin downregulated expression of caspase-9, caspase-3, and Bcl-2-associated X protein, and upregulated expression of B-cell lymphoma 2. Hesperidin absorbed wavelengths of light within the UVB range. In summary, hesperidin shielded human keratinocytes from UVB radiation-induced damage and apoptosis via its antioxidant and UVB absorption properties. PMID:26797112

  5. Keratinocyte-targeted expression of human laminin γ2 rescues skin blistering and early lethality of laminin γ2 deficient mice.

    Directory of Open Access Journals (Sweden)

    Tracy L Adair-Kirk

    Full Text Available Laminin-332 is a heterotrimeric basement membrane component comprised of the α3, ß3, and γ2 laminin chains. Laminin-332 modulates epithelial cell processes, such as adhesion, migration, and differentiation and is prominent in many embryonic and adult tissues. In skin, laminin-332 is secreted by keratinocytes and is a key component of hemidesmosomes connecting the keratinocytes to the underlying dermis. In mice, lack of expression of any of the three Laminin-332 chains result in impaired anchorage and detachment of the epidermis, similar to that seen in human junctional epidermolysis bullosa, and death occurs within a few days after birth. To bypass the early lethality of laminin-332 deficiency caused by the knockout of the mouse laminin γ2 chain, we expressed a dox-controllable human laminin γ2 transgene under a keratinocyte-specific promoter on the laminin γ2 (Lamc2 knockout background. These mice appear similar to their wild-type littermates, do not develop skin blisters, are fertile, and survive >1.5 years. Immunofluorescence analyses of the skin showed that human laminin γ2 colocalized with mouse laminin α3 and ß3 in the basement membrane zone underlying the epidermis. Furthermore, the presence of "humanized" laminin-332 in the epidermal basement membrane zone rescued the alterations in the deposition of hemidesmosomal components, such as plectin, collagen type XVII/BP180, and integrin α6 and ß4 chains, seen in conventional Lamc2 knockout mice, leading to restored formation of hemidesmosomes. These mice will be a valuable tool for studies of organs deficient in laminin-332 and the role of laminin-332 in skin, including wound healing.

  6. Chromium III histidinate exposure modulates antioxidant gene expression in HaCaT human keratinocytes exposed to oxidative stress

    Science.gov (United States)

    While the toxicity of hexavalent chromium is well established, trivalent Cr (Cr(III)) is an essential nutrient involved in insulin and glucose homeostasis. Recently, antioxidant effects of chromium (III) histidinate (Cr(III)His) were reported in HaCaT human keratinocytes exposed to oxidative stress...

  7. Direct evidence for uptake of intact liposomes encapsulating silver sulfadiazine by cultured human keratinocytes based on combined transmission electron microscopy and X-ray microanalysis.

    OpenAIRE

    Schaller, M.; Wurm, R; Korting, H. C.

    1997-01-01

    Cultured human keratinocytes were exposed to liposomally encapsulated silver sulfadiazine, free silver sulfadiazine, silver sulfadiazine cream, and a corresponding vehicle for 5 min to 24 h. Phagocytosis of intact liposomes by keratinocytes was demonstrated in vitro by combined X-ray microanalysis and electron microscopy. Silver as an active part of the antimicrobial served as an electron-dense marker.

  8. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    Directory of Open Access Journals (Sweden)

    Sharon Wong

    2013-12-01

    Full Text Available Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in human skin cells after fractionated radiation exposure and the expression of unique biomarkers that reflect cell death or biology using multiplexed immunoassays. Methods: Breast skin biopsies were obtained from a single individual and divided into small pieces. Each piece was irradiated under different radiotherapy treatment fractionation schedules to a total dose of 50Gy. The irradiated skin tissues were analysed using Tunnel, immunohistochemistry and Western blot assays for expression of apoptotic keratinocytes and biomarkers (p53, p21, and PCNA. Haematoxylin and eosin (H&E immunostaining was performed to study the morphological changes in the skin cells. Results: Radiation is mostly absorbed by the epidermal layers and observed to damage the epidermal keratinocytes leading to the activation of apoptotic proteins. Apoptotic proteins (p53, p21 and PCNA were confirmed to be up-regulated in radiation exposed skin cells as compared to normal skin cells with no radiation. There is strong correlation of apoptotic protein expressions with increased radiation dosage and dose fractionation. Statistical analysis with ANOVA revealed a significant increase of PCNA and p21 expression with increased radiation dosage and dose fractionation (p < 0.05. Immunohistochemically, 14 % (range 10.71% to 17.29% of the keratinocytes were positive for PCNA and 22.5% (range 18.28% to 27.2% for p21 after 2Gy of irradiation. The most widespread, intense and uniform staining for PCNA and

  9. A comparative in vitro study of the viability of human keratinocytes grown on irradiated human amnion membrane and fibrin glue scaffolds

    International Nuclear Information System (INIS)

    Full text: The dried irradiated human amnion membrane has been used as a biological dressing for various clinical conditions. Being another biological membrane its potential as a scaffold to grow human keratinocytes is not known yet. To compare the growth patterns and cell viability of keratinocytes using fibrin glue and air dried amnion membrane as a scaffold. Keratinocytes were obtained from skin samples of six patients undergoing elective surgery. Fibrin glue (Tisseel, Baxter ) was diluted and used to coat the wells. Human dried amnion membrane was obtained and placed into the 24 well plates. Keratinocytes were seeded into the fibrin and amnion scaffold. Cell viability assay (MTT) was performed after 24, 48 and 72 hours. Finally the measurements were done by the Enzyme-Linked Immunosorbent Assay (ELISA) reader at 570 nm. Six patients consented for the study. The cells growing on the amnion scaffold showed a decreasing trend (20.67%, 17.94% and 16.78% respectively for 24, 48 and 72 hours). The cells growing on the fibrin scaffold showed a steady increase in number at 24, 48 and 72 hours (73.03%, 74.12% and 79.66%). The percentage of growth of normal human keratinocytes were significantly greater in the fibrin scaffold group (Mann - Whitney p = 0.002) for 24, 48 and 72 hours. The air dried irradiated human amnion membrane can be used as a scaffold to grow keratinocytes but however the growth pattern does not sustain with time. Fibrin glue supports the growth of human keratinocytes and shows an increasing pattern of growth with time. (Author)

  10. CD44v6 expression in human skin keratinocytes as a possible mechanism for carcinogenesis associated with chronic arsenic exposure

    OpenAIRE

    Huang, S.; Guo, S.; Guo, F; Yang, Q.; XIAO, X.; Murata, M.; Ohnishi, S.; Kawanishi, S; Ma, N

    2013-01-01

    Inorganic arsenic is a well-known human skin carcinogen. Chronic arsenic exposure results in various types of human skin lesions, including squamous cell carcinoma (SCC). To investigate whether mutant stem cells participate in arsenic-associated carcinogenesis, we repeatedly exposed the human spontaneously immortalized skin keratinocytes (HaCaT) cell line to an environmentally relevant level of arsenic (0.05 ppm) in vitrofor 18 weeks. Following sodium arsenite administration, cell cycle, colo...

  11. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Holloway, Adele [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Cook, Anthony L. [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia); Chin, Suyin P. [Menzies Research Institute Tasmania, University of Tasmania, Hobart, TAS 7000 (Australia); Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au [School of Health Sciences, University of Tasmania, Launceston, TAS 7250 (Australia)

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  12. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    International Nuclear Information System (INIS)

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylation of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation

  13. Cobalt Oxide Nanoparticles: Behavior towards Intact and Impaired Human Skin and Keratinocytes Toxicity

    Directory of Open Access Journals (Sweden)

    Marcella Mauro

    2015-07-01

    Full Text Available Skin absorption and toxicity on keratinocytes of cobalt oxide nanoparticles (Co3O4NPs have been investigated. Co3O4NPs are commonly used in industrial products and biomedicine. There is evidence that these nanoparticles can cause membrane damage and genotoxicity in vitro, but no data are available on their skin absorption and cytotoxicity on keratinocytes. Two independent 24 h in vitro experiments were performed using Franz diffusion cells, using intact (experiment 1 and needle-abraded human skin (experiment 2. Co3O4NPs at a concentration of 1000 mg/L in physiological solution were used as donor phase. Cobalt content was evaluated by Inductively Coupled–Mass Spectroscopy. Co permeation through the skin was demonstrated after 24 h only when damaged skin protocol was used (57 ± 38 ng·cm−2, while no significant differences were shown between blank cells (0.92 ± 0.03 ng cm−2 and those with intact skin (1.08 ± 0.20 ng·cm−2. To further investigate Co3O4NPs toxicity, human-derived HaCaT keratinocytes were exposed to Co3O4NPs and cytotoxicity evaluated by MTT, Alamarblue® and propidium iodide (PI uptake assays. The results indicate that a long exposure time (i.e., seven days was necessary to induce a concentration-dependent cell viability reduction (EC50 values: 1.3 × 10−4 M, 95% CL = 0.8–1.9 × 10−4 M, MTT essay; 3.7 × 10−5 M, 95% CI = 2.2–6.1 × 10−5 M, AlamarBlue® assay that seems to be associated to necrotic events (EC50 value: 1.3 × 10−4 M, 95% CL = 0.9–1.9 × 10−4 M, PI assay. This study demonstrated that Co3O4NPs can penetrate only damaged skin and is cytotoxic for HaCat cells after long term exposure.

  14. Hepatocyte and keratinocyte growth factors and their receptors in human lung emphysema

    Directory of Open Access Journals (Sweden)

    Marchal Joëlle

    2005-10-01

    Full Text Available Abstract Background Hepatocyte and keratinocyte growth factors are key growth factors in the process of alveolar repair. We hypothesized that excessive alveolar destruction observed in lung emphysema involves impaired expression of hepatocyte and keratinocyte growth factors or their respective receptors, c-met and keratinocyte growth factor receptor. The aim of our study was to compare the expression of hepatocyte and keratinocyte growth factors and their receptors in lung samples from 3 groups of patients: emphysema; smokers without emphysema and non-smokers without emphysema. Methods Hepatocyte and keratinocyte growth factor proteins were analysed by immunoassay and western blot; mRNA expression was measured by real time quantitative polymerase chain reaction. Results Hepatocyte and keratinocyte growth factors, c-met and keratinocyte growth factor receptor mRNA levels were similar in emphysema and non-emphysema patients. Hepatocyte growth factor mRNA correlated negatively with FEV1 and the FEV1/FVC ratio both in emphysema patients and in smokers with or without emphysema. Hepatocyte and keratinocyte growth factor protein concentrations were similar in all patients' groups. Conclusion The expression of hepatocyte and keratinocyte growth factors and their receptors is preserved in patients with lung emphysema as compared to patients without emphysema. Hepatocyte growth factor mRNA correlates with the severity of airflow obstruction in smokers.

  15. Nifedipine prevents sodium caprate-induced barrier dysfunction in human epidermal keratinocyte cultures.

    Science.gov (United States)

    Uchino, Yoshihiro; Matsumoto, Junichi; Watanabe, Takuya; Hamabashiri, Masato; Tsuchiya, Takashi; Kimura, Ikuya; Yamauchi, Atsushi; Kataoka, Yasufumi

    2015-01-01

    Tight junctions (TJs) of the epidermis play an important role in maintaining the epidermal barrier. TJ breakdown is associated with skin problems, such as wrinkles and transepidermal water loss (TEWL). Clinical studies have reported that topical nifedipine is effective in reducing the depth of wrinkles and improving TEWL. However, it remains unknown whether nifedipine influences the TJ function in the epidermis. In the present study, we investigated the effect of nifedipine on epidermal barrier dysfunction in normal human epidermal keratinocytes (NHEKs) treated with sodium caprate (C10), a TJ inhibitor. Nifedipine reversed the C10-decreased transepithelial electrical resistance values as a measure of disruption of the epidermal barrier. Immunocytochemical observations revealed that nifedipine improved the C10-induced irregular arrangement of claudin-1, a key protein in TJs. Taken together, these findings suggest that nifedipine prevents epidermal barrier dysfunction, at least in part, by reconstituting the irregular claudin-1 localization at TJs in C10-treated NHEKs. PMID:26027835

  16. Exposure to Carbon Nanotube Material: Assessment of Nanotube Cytotoxicity Using Human Keratinocyte Cells

    Science.gov (United States)

    Shvedova, Anna A.; Castranova, Vincent; Kisin, Elena R.; Schwegler-Berry, Diane; Murray, Ashley R.; Gandelsman, Vadim Z.; Maynard, Andrew; Baron, Paul

    2003-01-01

    Carbon nanotubes are new members of carbon allotropes similar to fullerenes and graphite. Because of their unique electrical, mechanical, and thermal properties, carbon nanotubes are important for novel applications in the electronics, aerospace, and computer industries. Exposure to graphite and carbon materials has been associated with increased incidence of skin diseases, such as carbon fiber dermatitis, hyperkeratosis, and naevi. We investigated adverse effects of single-wall carbon nanotubes (SWCNT) using a cell culture of immortalized human epidermal keratinocytes (HaCaT). After 18 h of exposure of HaCaT to SWCNT, oxidative stress and cellular toxicity were indicated by formation of free radicals, accumulation of peroxidative products, antioxidant depletion, and loss of cell viability. Exposure to SWCNT also resulted in ultrastructural and morphological changes in cultured skin cells. These data indicate that dermal exposure to unrefined SWCNT may lead to dermal toxicity due to accelerated oxidative stress in the skin of exposed workers.

  17. Assessment of radiation induced cytogenetic damage in human keratinocytes by comet assay

    International Nuclear Information System (INIS)

    In the present study the effect of gamma radiation on normal human keratinocytes (HaCaT) cells has been analyzed using alkaline comet assay and a comparative study over the sensitivity of different comet parameters such as tail length (TL), olive tail moment (OTM) and percentage tail DNA (TDNA) has also been made. Human keratinocytes (HaCaT) cells were grown in Dulbecco's modified essential medium (DMEM) (10% FCS) at 37 °C in a humidified atmosphere containing 5% CO2. Cultured cells were harvested with 0.025 % trypsin EDTA. The sample (2 X 10 cells/ml) was exposed to gamma radiation of different dose using a 60Co gamma source at dose rate of 2 Gy min-1 and the dosimetry has been carried out using Fricke and FBX dosimeters. After irradiation, to quantify the DNA damage the comet assay (single cell gel electrophoresis) was carried out under alkaline conditions, by the methods outlined by Singh et al. The quantification of the DNA strand breaks in each cells were performed using CASP software. The DNA damage quantification can be accomplished by measuring those comet parameters which exhibit a linear dependence on the amount of DNA damage. In the present study, comet parameters such as OTM, TL and TDNA were recorded and the variation of these parameters and their correlation coefficients for different doses of gamma radiation is plotted. The OTM value is normalized with control value and control for TL and TDNA is adjusted to zero to avoid initial variations in different experiments

  18. Ceramide stimulates ABCA12 expression via peroxisome proliferator-activated receptor {delta} in human keratinocytes.

    Science.gov (United States)

    Jiang, Yan J; Uchida, Yoshikazu; Lu, Biao; Kim, Peggy; Mao, Cungui; Akiyama, Masashi; Elias, Peter M; Holleran, Walter M; Grunfeld, Carl; Feingold, Kenneth R

    2009-07-10

    ABCA12 (ATP binding cassette transporter, family 12) is a cellular membrane transporter that facilitates the delivery of glucosylceramides to epidermal lamellar bodies in keratinocytes, a process that is critical for permeability barrier formation. Following secretion of lamellar bodies into the stratum corneum, glucosylceramides are metabolized to ceramides, which comprise approximately 50% of the lipid in stratum corneum. Gene mutations of ABCA12 underlie harlequin ichthyosis, a devastating skin disorder characterized by abnormal lamellar bodies and a severe barrier abnormality. Recently we reported that peroxisome proliferator-activated receptor (PPAR) and liver X receptor activators increase ABCA12 expression in human keratinocytes. Here we demonstrate that ceramide (C(2)-Cer and C(6)-Cer), but not C(8)-glucosylceramides, sphingosine, or ceramide 1-phosphate, increases ABCA12 mRNA expression in a dose- and time-dependent manner. Inhibitors of glucosylceramide synthase, sphingomyelin synthase, and ceramidase and small interfering RNA knockdown of human alkaline ceramidase, which all increase endogenous ceramide levels, also increased ABCA12 mRNA levels. Moreover, simultaneous treatment with C(6)-Cer and each of these same inhibitors additively increased ABCA12 expression, indicating that ceramide is an important inducer of ABCA12 expression and that the conversion of ceramide to other sphingolipids or metabolites is not required. Finally, both exogenous and endogenous ceramides preferentially stimulate PPARdelta expression (but not other PPARs or liver X receptors), whereas PPARdelta knockdown by siRNA transfection specifically diminished the ceramide-induced increase in ABCA12 mRNA levels, indicating that PPARdelta is a mediator of the ceramide effect. Together, these results show that ceramide, an important lipid component of epidermis, up-regulates ABCA12 expression via the PPARdelta-mediated signaling pathway, providing a substrate-driven, feed

  19. Intratracheal Administration of Recombinant Human Keratinocyte Growth Factor Promotes Alveolar Epithelial Cell Proliferation during Compensatory Lung Growth in Rat

    International Nuclear Information System (INIS)

    Keratinocyte growth factor (KGF) is considered to be one of the most important mitogens for lung epithelial cells. The objectives of this study were to confirm the effectiveness of intratracheal injection of recombinant human KGF (rhKGF) during compensatory lung growth and to optimize the instillation protocol. Here, trilobectomy in adult rat was performed, followed by intratracheal rhKGF instillation with low (0.4 mg/kg) and high (4 mg/kg) doses at various time-points. The proliferation of alveolar cells was assessed by the immunostaining for proliferating cell nuclear antigen (PCNA) in the residual lung. We also investigated other immunohistochemical parameters such as KGF, KGF receptor and surfactant protein A as well as terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling. Consequently, intratracheal single injection of rhKGF in high dose group significantly increased PCNA labeling index (LI) of alveolar cells in the remaining lung. Surprisingly, there was no difference in PCNA LI between low and high doses of rhKGF with daily injection, and PCNA LI reached a plateau level with 2 days-consecutive administration (about 60%). Our results indicate that even at low dose, daily intratracheal injection is effective to maintain high proliferative states during the early phase of compensatory lung growth

  20. Human Metapneumovirus in Adults

    Directory of Open Access Journals (Sweden)

    Lenneke E. M. Haas

    2013-01-01

    Full Text Available Human metapneumovirus (HMPV is a relative newly described virus. It was first isolated in 2001 and currently appears to be one of the most significant and common human viral infections. Retrospective serologic studies demonstrated the presence of HMPV antibodies in humans more than 50 years earlier. Although the virus was primarily known as causative agent of respiratory tract infections in children, HMPV is an important cause of respiratory infections in adults as well. Almost all children are infected by HMPV below the age of five; the repeated infections throughout life indicate transient immunity. HMPV infections usually are mild and self-limiting, but in the frail elderly and the immunocompromised patients, the clinical course can be complicated. Since culturing the virus is relatively difficult, diagnosis is mostly based on a nucleic acid amplification test, such as reverse transcriptase polymerase chain reaction. To date, no vaccine is available and treatment is supportive. However, ongoing research shows encouraging results. The aim of this paper is to review the current literature concerning HMPV infections in adults, and discuss recent development in treatment and vaccination.

  1. Human metapneumovirus in adults.

    Science.gov (United States)

    Haas, Lenneke E M; Thijsen, Steven F T; van Elden, Leontine; Heemstra, Karen A

    2013-01-01

    Human metapneumovirus (HMPV) is a relative newly described virus. It was first isolated in 2001 and currently appears to be one of the most significant and common human viral infections. Retrospective serologic studies demonstrated the presence of HMPV antibodies in humans more than 50 years earlier. Although the virus was primarily known as causative agent of respiratory tract infections in children, HMPV is an important cause of respiratory infections in adults as well. Almost all children are infected by HMPV below the age of five; the repeated infections throughout life indicate transient immunity. HMPV infections usually are mild and self-limiting, but in the frail elderly and the immunocompromised patients, the clinical course can be complicated. Since culturing the virus is relatively difficult, diagnosis is mostly based on a nucleic acid amplification test, such as reverse transcriptase polymerase chain reaction. To date, no vaccine is available and treatment is supportive. However, ongoing research shows encouraging results. The aim of this paper is to review the current literature concerning HMPV infections in adults, and discuss recent development in treatment and vaccination. PMID:23299785

  2. Role of SP-1 in SDS-Induced Adipose Differentiation Related Protein Synthesis in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Emanuela Corsini

    2007-01-01

    Full Text Available Skin irritation is a complex phenomenon, and keratinocytes play an important role in it. We have recently characterized the expression and protective role of adipose differentiation related protein (ADRP in skin irritation. In particular, ADRP expression is induced to recover functional cell membrane following the cell damage caused by skin irritants. The purpose of this study was to characterize in a human keratinocyte cells line (NCTC 2544 the biochemical events that lead to ADRP expression following SDS treatment, and in particular, to investigate the role of transcription factor SP-1. Analysis of ADRP promoter region revealed the presence of a potential binding site for the transcription factor SP-1 close to the start site. Evaluated by measuring the DNA binding activity, we found that SDS induced a dose and time related SP-1 activation, which was correlated with SDS-induced ADRP mRNA expression. Furthermore, SDS-induced SP-1 activation, ADRP mRNA expression and lipid droplets accumulation could be modulated by mithramycin A, an antibiotic that selectively binds to the GC box preventing SP-1 binding and gene expression. This demonstrated that SDS-induced ADRP expression was mediated in part through the transcription factor SP-1. In addition, SDS-induced SP-1 activation and ADRP expression could be modulated by the calcium chelator BAPTA, indicating a role of calcium in ADRP-induction. Thus, every time an irritant perturbs the membrane barrier, it renders the membrane leaky and allows extracellular calcium to enter the cells, an event that provides the upstream mechanisms initiating the signaling cascade that triggers the activation of SP-1 and culminates in the enhancement of ADRP expression, which helps to restore the normal homeostasis and ultimately repairs the to membrane.

  3. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 μM, 2 μM and 10 μM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated

  4. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes.

    Science.gov (United States)

    Zhang, Leshuai W; Yu, William W; Colvin, Vicki L; Monteiro-Riviere, Nancy A

    2008-04-15

    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 microM, 2 microM and 10 microM for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p<0.05) from 1.25 nM to 10 nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5 nM to 10 nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated. PMID:18261754

  5. The Effect of Calcipotriol on the Expression of Human β Defensin-2 and LL-37 in Cultured Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Beom Joon Kim

    2009-01-01

    Full Text Available Background. Vitamin D has been reported to regulate innate immunity by controlling the expression of antimicrobial peptides (AMPs. Objective. We investigated the effect of calcipotriol on the expression of AMPs in human cultured keratinocytes. Methods. Keratinocytes were treated with lipopolysaccharide (LPS, TNF-α, Calcipotriol and irradiated with UVB, cultured, and harvested. To assess the expression of human beta defensin-2 and LL-37 in the control group, not exposed to any stimulants, the experimental group was treated with LPS, TNF-α, or UVB, and another group was treated again with calcipotriol; reverse transcriptase-polymerase chain reaction, Western blotting, and immunohistochemical staining were performed. Results. In the experimental group treated with LPS, UVB irradiation, and TNF-α, the expression of β-defensin and LL-37 was increased more than in the control group and then decreased in the experimental group treated with calcipotriol. Conclusions. Calcipotriol suppressed HBD-2 and LL-37, which were stimulated by UVB, LPS, and TNF-α.

  6. Expression of Hepatocyte Growth Factor-Like Protein in Human Wound Tissue and Its Biological Functionality in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    James C. Glasbey

    2015-02-01

    Full Text Available Hepatocyte growth factor-like protein (HGFl and its receptor, Recepteur d'Origine Nantais (RON, have been implicated in the development of wound chronicity. HGFl and RON expression was detected in acute wound tissue, chronic wound tissue and in normal skin using quantitative polymerase chain reaction (Q-PCR. HGFl and RON expression was also assessed in chronic healing and chronic non-healing wound tissues using Q-PCR and immunohistochemical staining. Expression was similarly detected in the HaCaT immortalized human keratinocyte cell line using reverse transcription polymerase chain reaction (RT-PCR. rhHGFl was used to assess the impact of this molecule on HaCaT cell functionality using in vitro growth assays and electric cell-substrate impendence sensing (ECIS migration assays. HGFl and RON transcript expression were significantly increased in acute wound tissue compared to chronic wound tissue and were also elevated, though non-significantly, in comparison to normal skin. Minimal expression was seen in both healing and non-healing chronic wounds. Treatment of HaCaT cells with rhHGFl had no effect on growth rates but did enhance cell migration. This effect was abolished by the addition of a phospholipase C gamma (PLCγ small molecule inhibitor. The increased expression of HGFl and RON in acute, healing wounds and the pro-migratory effect of HGFl in an in vitro human keratinocyte model, may indicate a role for HGFl in active wound healing.

  7. Effect of in vitro and in vivo UV irradiation on the production of ETAF activity by human and murine keratinocytes

    International Nuclear Information System (INIS)

    Cultured epidermal cells and keratinocytes produce a potent hormone-like factor called epidermal cell-derived thymocyte-activating factor (ETAF). ETAF appears to be similar if not identical to a monocyte-derived lymphokine, known as interleukin 1 (IL-1). These two cytokines are able to amplify a diverse number of proliferative and inflammatory processes. Several recent investigations have suggested that UV-induced immunosuppression may be due in part to the inhibition of IL-1/ETAF production by monocytes and keratinocytes, respectively. We therefore decided to directly study the effects of various doses of in vitro and in vivo UV radiation (UVR) on the production of ETAF by normal murine epidermal cells and a murine (Pam 212) and a human (SCC) keratinocyte cell line. Our results surprisingly demonstrated an increase in both the extracellular and the intracellular ETAF activity of the murine epidermal, Pam 212, and SCC after sublethal amounts of in vitro UVR. Likewise, increased ETAF activity of murine epidermal cells was detected after sublethal doses of in vivo UVR. The UV-induced ETAF activity was cycloheximide-sensitive, suggesting that de novo synthesis of ETAF rather than cell membrane leakage was responsible for the increased ETAF activity. The fact that UV irradiation can increase ETAF activity by keratinocytes could have important local and systemic consequences for the host and may provide an efficient, contaminant-free method for generating ETAF activity for further biochemical and immunologic studies

  8. Protective effects of myricetin against ultraviolet-B-induced damage in human keratinocytes.

    Science.gov (United States)

    Huang, Jheng-Hua; Huang, Chieh-Chen; Fang, Jia-You; Yang, Cheng; Chan, Chi-Ming; Wu, Nan-Lin; Kang, Shung-Wen; Hung, Chi-Feng

    2010-02-01

    Myricetin is a flavonoid similar to quercetin, which is commonly found in natural foods such as berries, vegetables, teas, wine, and herbs. It is considered to be an antioxidant which is capable of quenching photoaging-causing free radicals within the skin. In this study, we investigated the mechanisms underlying protective effect of myricetin on ultraviolet-B (UVB)-induced damage to keratinocytes. We found that myricetin concentration-dependently attenuated UVB-induced keratinocyte death as determined by a cell viability assay. Pretreatment with myricetin also reduced the UVB-induced malondialdehyde level. Moreover, UVB-induced H(2)O(2) generation in keratinocytes was inhibited by myricetin according to flow cytometry, suggesting that myricetin can act as a free radical scavenger when keratinocytes experience photodamage. Furthermore, UVB-induced activation of c-jun-NH(2) terminal kinase (JNK) in keratinocytes was inhibited by myricetin. UVB-induced pre-G(1) phase arrest leading to apoptotic changes in keratinocytes was blocked by myricetin. Taken together, the protective mechanisms of keratinocyte by myricetin against UVB-induced photodamage occur by the inhibition of UVB-induced intracellular hydrogen peroxide production, lipid peroxidation and JNK activation. Therefore, myricetin is suitable for further development as an anti-aging agent for skin care. PMID:19778600

  9. A modified method for the culture of naturally HPV-infected high-grade cervical intraepithelial neoplasia keratinocytes from human neoplastic cervical biopsies

    OpenAIRE

    Liu, Yu-Zhen; WANG, TIAN-TIAN; ZHANG, YOU-ZHONG

    2016-01-01

    Few studies on cervical intraepithelial neoplasia (CIN) keratinocyte cultures are available due to the numerous technical and methodological problems associated with the in vitro cultivation of these cells. The present study investigated an applicable and effective method for the in vitro cultivation of high-grade CIN keratinocytes from human neoplastic cervical biopsies. Human neoplastic cervical tissue sections were obtained and digested using type I collagen in order to dissociate the cell...

  10. Interleukin 6 is Expressed in High Levels in Psoriatic Skin and Stimulates Proliferation of Cultured Human Keratinocytes

    Science.gov (United States)

    Grossman, Rachel M.; Krueger, James; Yourish, Debra; Granelli-Piperno, Angela; Murphy, Daniel P.; May, Lester T.; Kupper, Thomas S.; Sehgal, Pravinkumar B.; Gottlieb, Alice B.

    1989-08-01

    Psoriasis is a common papulosquamous skin disease. The histopathology is characterized by epidermal hyperplasia and inflammation. Recent studies suggest that keratinocyte proliferation and inflammation in psoriasis are manifestations of the same underlying pathological process. Interleukin 6 (IL-6), a cytokine that is a major mediator of the host response to tissue injury and infection, is produced by both keratinocytes and leukocytes in culture. IL-6 expression was studied in psoriatic plaques by immunoperoxidase staining with two different polyclonal anti-recombinant IL-6 antisera and by in situ nucleic acid hybridization with IL-6 cRNA probes. Epidermal and dermal cells in active psoriatic plaques from 35 psoriasis patients stained heavily for IL-6 as compared with nonlesional skin and with plaques after treatment with antimetabolic and antiinflammatory agents. Absorption of the anti-recombinant IL-6 antisera with purified fibroblast-derived IL-6 or with recombinant IL-6, but not bovine serum albumin, removed the immunostaining. Increased levels of IL-6 were detected in the plasma of patients with active psoriasis (mean 3 ng/ml) by using two different bioassays. IL-6 production by proliferating keratinocytes was suggested by IL-6-specific immunostaining in cultured normal and psoriatic keratinocytes and by the detection of mRNA specific for IL-6 in psoriatic epidermis by in situ hybridization. IL-6 stimulated the proliferation of cultured, normal human keratinocytes as assessed by two different assays. Thus, IL-6 could directly contribute to the epidermal hyperplasia seen in psoriatic epithelium as well as affect the function of dermal inflammatory cells.

  11. Eckol inhibits ultraviolet B-induced cell damage in human keratinocytes via a decrease in oxidative stress

    International Nuclear Information System (INIS)

    In previous reports, the antioxidant effects of eckol were shown to protect cells against hydrogen peroxide- and gamma ray-induced oxidative stress. In this study, the role of eckol in protecting human skin keratinocytes (HaCaT) against UVB-induced oxidative cell damage was investigated. Also, triphlorethol-A, one of the chemical components in Ecklonia cava, and quercetin a well known antioxidant, were compared with eckol in terms of antioxidant activity based on chemical structure. Eckol decreased UVB-induced intracellular reactive oxygen species (ROS), decreased injury to cellular components resulting from UVB-induced oxidative stress, and restored cell viability. In addition, eckol reduced UVB-induced apoptosis by inhibiting the disruption of mitochondrial membranes. These results suggest that eckol protects human keratinocytes against UVB-induced oxidative stress by scavenging ROS, thereby lessening injury to cellular components. (author)

  12. Photoprotective Activity of Vulpinic and Gyrophoric Acids Toward Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Varol, Mehmet; Türk, Ayşen; Candan, Mehmet; Tay, Turgay; Koparal, Ayşe Tansu

    2016-01-01

    Vulpinic and gyrophoric acids are known as ultraviolet filters for natural lichen populations because of their chemical structures. However, to the best of our knowledge, there has been no reference to their cosmetic potential for skin protection against ultraviolet B (UVB)-induced damage and, consequently, we propose to highlight their photoprotective profiles in human keratinocytes (HaCaT). Therefore, vulpinic acid and gyrophoric acid were isolated from acetone extracts of Letharia vulpina and Xanthoparmelia pokornyi, respectively. Their photoprotective activities on irradiated HaCaT cells and destructive effects on non-irradiated HaCaT cells were compared through in vitro experimentation: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and lactate dehydrogenase assays, 4',6-diamino-2-phenylindole and tetramethylrhodamine B isothiocyanate-phalloidin staining protocols. Both of the lichen substances effectively prevented cytotoxic, apoptotic and cytoskeleton alterative activities of 2.5 J/cm(2) UVB in a dose-dependent manner. Moreover, vulpinic and gyrophoric acids showed no toxic, apoptotic or cytoskeleton alterative effects on non-irradiated HaCaT cells, except at high doses (≥400 μM) of gyrophoric acid. The findings suggest that vulpinic and gyrophoric acids can be promising cosmetic ingredients to photo-protect human skin cells and should therefore be further investigated by in vitro and in vivo multiple bioassays. PMID:26463741

  13. Effects of silver nanoparticles on human dermal fibroblasts and epidermal keratinocytes.

    Science.gov (United States)

    Galandáková, A; Franková, J; Ambrožová, N; Habartová, K; Pivodová, V; Zálešák, B; Šafářová, K; Smékalová, M; Ulrichová, J

    2016-09-01

    Biomedical application of silver nanoparticles (AgNPs) has been rapidly increasing. Owing to their strong antimicrobial activity, AgNPs are used in dermatology in the treatment of wounds and burns. However, recent evidence for their cytotoxicity gives rise to safety concerns. This study was undertaken as a part of an ongoing programme in our laboratory to develop a topical agent for wound healing. Here, we investigated the potential toxicity of AgNPs using normal human dermal fibroblasts (NHDF) and normal human epidermal keratinocytes (NHEK) with the aim of comparing the effects of AgNPs and ionic silver (Ag-I). Besides the effect of AgNPs and Ag-I on cell viability, the inflammatory response and DNA damage in AgNPs and Ag-I-treated cells were examined. The results showed that Ag-I were significantly more toxic than AgNPs both on NHDF and NHEK. Non-cytotoxic concentrations of AgNPs and Ag-I did not induce DNA strand breaks and did not affect inflammatory markers, except for a transient increase in interleukin 6 levels in Ag-I-treated NHDF. The results showed that AgNPs are more suitable for the intended application as a topical agent for wound healing up to the concentration 25 µg/mL. PMID:26500221

  14. Induction and inhibition of benzo(a)pyrene metabolism in human epidermal keratinocytes and dermal fibroblasts

    International Nuclear Information System (INIS)

    The effects of different growth conditions and various cytochrome P-450 inducers and inhibitors were examined on the benzo(a)pyrene (BP) metabolism of human skin cells in vitro. First, three different populations of neonatal foreskin fibroblasts were treated with 0.98 μM [G-3H]-BP at 9.6 Ci/mmole for 24 hours and the organic-extractable metabolites in the extracellular, the cytoplasmic, and the nuclear fractions were analyzed by high-pressure liquid chromatography (HPLC). Confluent cultures (contact-inhibited cells), which were nontransformable, metabolized BP to a much greater extent than the transformable populations, randomly-proliferating cultures (cells in logarithmic growth) and synchronized cultures (cells treated in S phase). The major extracellular BP metabolites detected were the 9,10-diol, the 7,8-diol, and the phenols, including all four tetrols observed only in the confluent cells. From this data, the state of confluency (i.e. the model for the in vivo state of skin cells) induced enzymes which catalyze primarily the detoxification pathways leading to the formation of metabolites which are readily excreted whereas cells which are actively dividing or synchronized induced the formation of metabolites from activation pathways that led to transformation. Next, the effects of four inducers (3-methylcholanthrene (3-MCA), phenobarbital (PB), isosafrole, and Arochlor 1254) and an inhibitor (butylated hydroxyanisole (BHA)) on the BP metabolism of human epidermal keratinocytes were evaluated

  15. Insights into the impact of silver nanoparticles on human keratinocytes metabolism through NMR metabolomics.

    Science.gov (United States)

    Carrola, Joana; Bastos, Verónica; Ferreira de Oliveira, José Miguel P; Oliveira, Helena; Santos, Conceição; Gil, Ana M; Duarte, Iola F

    2016-01-01

    Due to their antimicrobial properties, silver nanoparticles (AgNPs) are increasingly incorporated into consumer goods and medical products. Their potential toxicity to human cells is however a major concern, and there is a need for improved understanding of their effects on cell metabolism and function. Here, Nuclear Magnetic Resonance (NMR) metabolomics was used to investigate the metabolic profile of human epidermis keratinocytes (HaCaT cell line) exposed for 48 h to 30 nm citrate-stabilized spherical AgNPs (10 and 40 μg/mL). Intracellular aqueous extracts, organic extracts and extracellular culture medium were analysed to provide an integrated view of the cellular metabolic response. The specific metabolite variations, highlighted through multivariate analysis and confirmed by spectral integration, suggested that HaCaT cells exposed to AgNPs displayed upregulated glutathione-based antioxidant protection, increased glutaminolysis, downregulated tricarboxylic acid (TCA) cycle activity, energy depletion and cell membrane modification. Importantly, most metabolic changes were apparent in cells exposed to a concentration of AgNPs which did not affect cell viability at significant levels, thus underlying the sensitivity of NMR metabolomics to detect early biochemical events, even in the absence of a clear cytotoxic response. It can be concluded that NMR metabolomics is an important new tool in the field of in vitro nanotoxicology. PMID:26344855

  16. Temporal Gene Expression Kinetics for Human Keratinocytes Exposed to Hyperthermic Stress

    Directory of Open Access Journals (Sweden)

    Gerald J. Wilmink

    2013-04-01

    Full Text Available The gene expression kinetics for human cells exposed to hyperthermic stress are not well characterized. In this study, we identified and characterized the genes that are differentially expressed in human epidermal keratinocyte (HEK cells exposed to hyperthermic stress. In order to obtain temporal gene expression kinetics, we exposed HEK cells to a heat stress protocol (44 °C for 40 min and used messenger RNA (mRNA microarrays at 0 h, 4 h and 24 h post-exposure. Bioinformatics software was employed to characterize the chief biological processes and canonical pathways associated with these heat stress genes. The data shows that the genes encoding for heat shock proteins (HSPs that function to prevent further protein denaturation and aggregation, such as HSP40, HSP70 and HSP105, exhibit maximal expression immediately after exposure to hyperthermic stress. In contrast, the smaller HSPs, such as HSP10 and HSP27, which function in mitochondrial protein biogenesis and cellular adaptation, exhibit maximal expression during the “recovery phase”, roughly 24 h post-exposure. These data suggest that the temporal expression kinetics for each particular HSP appears to correlate with the cellular function that is required at each time point. In summary, these data provide additional insight regarding the expression kinetics of genes that are triggered in HEK cells exposed to hyperthermic stress.

  17. In vitro toxicity evaluation of low doses of pesticides in individual and mixed condition on human keratinocyte cell line

    OpenAIRE

    Abhishek, Amar; Ansari, Nasreen Ghazi; Shankhwar, Satya Narayan; Jain, Amita; Singh, Vishwajeet

    2014-01-01

    The induced toxicity of three pesticides (alpha-Hexachlorocyclohexane: α-HCH; Parathion methyl:PM; Carbofuran: CN) in single and four possible combination on human keratinocyte cell line have been investigated. There was no significant change in toxicity (cyto and genotoxicity) on cell line exposed by individual pesticides except α-HCH. But, a synergistic effect was observed when we tested mixture of pesticides. The intracellular ROS and cytotoxicity assay revealed maximum reduction in cell v...

  18. Exploiting high-throughput screens to optimize Adeno-Associated Viral Vectors for gene transfer into primary human keratinocytes

    OpenAIRE

    Sallach, Jessica

    2014-01-01

    Chronic non-healing wounds such as diabetic ulcers or burns represent a devastating health problem with significant clinical, physical and social implications. The healing can be frustrating and painful for patients. The difficult healing process requires advanced therapeutic strategies such as the use of primary human keratinocytes (HK) as autologous transplants, which may be considered for clinical use. To improve engraftment or to introduce therapeutic genes into primary HK, efficient and ...

  19. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    OpenAIRE

    Lamartine Jérôme; Martin Michèle T; Berthier-Vergnes Odile; Malet Claude; Ginestet Chantal; Molina Manuella; Bonin Florian

    2009-01-01

    Abstract Background The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1...

  20. Influence of interleukin-8 (IL-8) and IL-8 receptors on the migration of human keratinocytes, the role of PLC-γ and potential clinical implications

    OpenAIRE

    Jiang, Wen G; Sanders, Andrew J.; Ruge, Fiona; HARDING, KEITH G.

    2011-01-01

    Interleukin (IL)-8 is a pro-inflammatory cytokine that has a direct effect on immune cells, including polymorphonuclear cells. Keratinocytes are a rich source of IL-8. However, there is little knowledge on the role of IL-8 in clinical wound healing and the direct biological effect of IL-8 on keratinocytes. In this study, the effect of recombinant human IL-8 (rhIL-8) on migration and adhesion was tested using HaCaT keratinocytes as a cell model. The cell functions were evaluated using impedanc...

  1. Tumor necrosis factor beta and ultraviolet radiation are potent regulators of human keratinocyte ICAM-1 expression

    International Nuclear Information System (INIS)

    Intercellular adhesion molecule-1 (ICAM-1) functions as a ligand of leukocyte function-associated antigen-1 (LFA-1), as well as a receptor for human picorna virus, and its regulation thus affects various immunologic and inflammatory reactions. The weak, constitutive ICAM-1 expression on human keratinocytes (KC) can be up-regulated by cytokines such as interferon-gamma (IFN gamma) and tumor necrosis factor alpha (TNF alpha). In order to further examine the regulation of KC ICAM-1 expression, normal human KC or epidermoid carcinoma cells (KB) were incubated with different cytokines and/or exposed to ultraviolet (UV) radiation. Subsequently, ICAM-1 expression was monitored cytofluorometrically using a monoclonal anti-ICAM-1 antibody. Stimulation of cells with recombinant human (rh) interleukin (IL) 1 alpha, rhIL-4, rhIL-5, rhIL-6, rh granulocyte/macrophage colony-stimulating factor (GM-CSF), rh interferon alpha (rhIFN alpha), and rh transforming growth factor beta (TGF beta) did not increase ICAM-1 surface expression. In contrast, rhTNF beta significantly up-regulated ICAM-1 expression in a time- and dose-dependent manner. Moreover, the combination of rhTNF beta with rhIFN gamma increased the percentage of ICAM-1-positive KC synergistically. This stimulatory effect of rhTNF beta was further confirmed by the demonstration that rhTNF beta was capable of markedly enhancing ICAM-1 mRNA expression in KC. Finally, exposure of KC in vitro to sublethal doses of UV radiation (0-100 J/m2) prior to cytokine (rhIFN tau, rhTNF alpha, rhTNF beta) stimulation inhibited ICAM-1 up-regulation in a dose-dependent fashion. These studies identify TNF beta and UV light as potent regulators of KC ICAM-1 expression, which may influence both attachment and detachment of leukocytes and possibly viruses to KC

  2. Vitamin C Compound Mixtures Prevent Ozone-Induced Oxidative Damage in Human Keratinocytes as Initial Assessment of Pollution Protection.

    Directory of Open Access Journals (Sweden)

    Giuseppe Valacchi

    Full Text Available One of the main functions of cutaneous tissues is to protect our body from the outdoor insults. Ozone (O3 is among the most toxic stressors to which we are continuously exposed and because of its critical location, the skin is one of the most susceptible tissues to the oxidative damaging effect of O3. O3 is not able to penetrate the skin, and although it is not a radical per se, the damage is mainly a consequence of its ability to induce oxidative stress via the formation of lipid peroxidation products.In this study we investigated the protective effect of defined "antioxidant" mixtures against O3 induced oxidative stress damage in human keratinocytes and understand their underlying mechanism of action.Results showed that the mixtures tested were able to protect human keratinocytes from O3-induced cytotoxicity, inhibition of cellular proliferation, decrease the formation of HNE protein adducts, ROS, and carbonyls levels. Furthermore, we have observed the decreased activation of the redox sensitive transcription factor NF-kB, which is involved in transcribing pro-inflammatory cytokines and therefore constitutes one of the main players associated with O3 induced skin inflammation. Cells exposed to O3 demonstrated a dose dependent increase in p65 subunit nuclear expression as a marker of NF-kB activation, while pre-treatment with the mixtures abolished NF-kB nuclear translocation. In addition, a significant activation of Nrf2 in keratinocytes treated with the mixtures was also observed.Overall this study was able to demonstrate a protective effect of the tested compounds versus O3-induced cell damage in human keratinocytes. Pre-treatment with the tested compounds significantly reduced the oxidative damage induced by O3 exposure and this protective effect was correlated to the abolishment of NF-kB nuclear translocation, as well as activation of Nrf2 nuclear translocation activating the downstream defence enzymes involved in cellular detoxification

  3. Paeoniflorin attenuates ultraviolet B-induced apoptosis in human keratinocytes by inhibiting the ROS-p38-p53 pathway.

    Science.gov (United States)

    Kong, Lingwen; Wang, Shangshang; Wu, Xiao; Zuo, Fuguo; Qin, Haihong; Wu, Jinfeng

    2016-04-01

    Ultraviolet (UV) light is one of the most harmful environmental factors that contribute to skin damage. Exposure to UV induces extensive generation of reactive oxygen species (ROS), and results in photoaging and skin cancer development. One approach to protecting human skin against UV radiation is the use of antioxidants. In recent years, naturally occurring herbal compounds have gained considerable attention as protective agents for UV exposure. Paeoniflorin (PF) is a novel natural antioxidant, which is isolated from peony root (Radix Paeoniae Alba). The present study evaluated the protective effects of PF on UV‑induced skin damage in vitro, and demonstrated that the effects were mediated via the ROS‑p38‑p53 pathway. The results of the present study demonstrated that treatment with PF (25, 50, and 100 µM) significantly increased the percentage of viable keratinocytes after UV‑B exposure. In addition, cell death analysis indicated that PF treatment markedly reduced UV‑B‑radiation‑induced apoptosis in keratinocytes, which was accompanied by increased procaspase 3 expression and decreased cleaved caspase 3 expression. Treatment with PF markedly reduced the production of ROS, and inhibited the activation of p38 and p53 in human keratinocytes, thus suggesting that the ROS‑p38‑p53 pathway has a role in UV‑B‑induced skin damage. In conclusion, the present study reported that PF was able to attenuate UV‑B‑induced cell damage in human keratinocytes. Notably, these effects were shown to be mediated, at least in part, via inhibition of the ROS-p38-p53 pathway. PMID:26936104

  4. Gene Expression Profiling of Human Epidermal Keratinocytes in Simulated Microgravity and Recovery Cultures

    Institute of Scientific and Technical Information of China (English)

    Jade Q. Clement; Shareen M. Lacy; Bobby L. Wilson

    2008-01-01

    Simulated microgravity (SMG) bioreactors and DNA microarray technology are powerful tools to identify "space genes" that play key roles in cellular response to microgravity. We applied these biotechnology tools to investigate SMG and post-SMG recovery effects on human epidermal keratinocytes by exposing cells to SMG for 3,4,9, and 10d using the high aspect ratio vessel bioreactor followed by recovery culturing for 15,50, and 60d in normal gravity. As a result, we identified 162 differentially expressed genes, 32 of which were "center genes" that were most consistently affected in the time course experiments. Eleven of the center genes were from the integrated stress response pathways and were coordinately down regulated. Another seven of the center genes, which are all metallothionein MT-Ⅰ and MT-Ⅱ isoforms, were coordinately up-regulated. In addition, HLA-G, a key gene in cellular immune response suppression, was found to be significantly upregulated during the recovery phase. Overall, more than 80% of the differentially expressed genes from the shorter exposures (≤4d) recovered in 15d; for longer (≥9d) exposures, more than 50d were needed to recover to the impact level of shorter exposures. The data indicated that shorter SMG exposure duration would lead to quicker and more complete recovery from the microgravity effect.

  5. Stages of Cell Cannibalism--Entosis--in Normal Human Keratinocyte Culture.

    Science.gov (United States)

    Garanina, A S; Khashba, L A; Onishchenko, G E

    2015-11-01

    Entosis is a type of cell cannibalism during which one cell penetrates into another cell and usually dies inside it. Researchers mainly pay attention to initial and final stages of entosis. Besides, tumor cells in suspension are the primary object of studies. In the present study, we investigated morphological changes of both cells-participants of entosis during this process. The substrate-dependent culture of human normal keratinocytes HaCaT was chosen for the work. A combination of light microscopy and scanning electron microscopy was used to prove that one cell was completely surrounded by the plasma membrane of another cell. We investigated such "cell-in-cell" structures and described the structural and functional changes of both cells during entosis. The outer cell nucleus localization and shape were changed. Gradual degradation of the inner cell nucleus and of the junctions between the inner and the outer cells was revealed. Moreover, repeated redistribution of the outer cell membrane organelles (Golgi apparatus, lysosomes, mitochondria, and autophagosomes), rearrangement of its cytoskeleton, and change in the lysosomal, autophagosomal, and mitochondrial state in both entotic cells were observed during entosis. On the basis of these data, we divided entosis into five stages that make it possible to systematize description of this type of cell death. PMID:26615438

  6. Amorphous nanosilica induce endocytosis-dependent ROS generation and DNA damage in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Hirai Toshiro

    2011-01-01

    Full Text Available Abstract Background Clarifying the physicochemical properties of nanomaterials is crucial for hazard assessment and the safe application of these substances. With this in mind, we analyzed the relationship between particle size and the in vitro effect of amorphous nanosilica (nSP. Specifically, we evaluated the relationship between particle size of nSP and the in vitro biological effects using human keratinocyte cells (HaCaT. Results Our results indicate that exposure to nSP of 70 nm diameter (nSP70 induced an elevated level of reactive oxygen species (ROS, leading to DNA damage. A markedly reduced response was observed using submicron-sized silica particles of 300 and 1000 nm diameter. In addition, cytochalasin D-treatment reduced nSP70-mediated ROS generation and DNA damage, suggesting that endocytosis is involved in nSP70-mediated cellular effects. Conclusions Thus, particle size affects amorphous silica-induced ROS generation and DNA damage of HaCaT cells. We believe clarification of the endocytosis pathway of nSP will provide useful information for hazard assessment as well as the design of safer forms of nSPs.

  7. Radiation-induced genomic instability is associated with DNA methylation changes in cultured human keratinocytes

    International Nuclear Information System (INIS)

    The mechanism by which radiation-induced genomic instability is initiated, propagated and effected is currently under intense scrutiny. We have investigated the potential role of altered genomic methylation patterns in the cellular response to irradiation and have found evidence for widespread dysregulation of CpG methylation persisting up to 20 population doublings post-irradiation. Similar effects are seen with cells treated with medium from irradiated cells (the 'bystander effect') rather than subjected to direct irradiation. Using an arbitrarily primed methylation sensitive PCR screening method we have demonstrated that irradiation causes reproducible alterations in the methylation profile of a human keratinocyte cell line, HPV-G, and have further characterised one of these sequences as being a member of a retrotransposon element derived sequence family on chromosome 7; MLT1A. Multiple changes were also detected in the screen, which indicate that although the response of cells is predominantly hypermethylation, specific hypomethylation occurs as well. Sequence specific changes are also reported in the methylation of the pericentromeric SAT2 satellite sequence. This is the first demonstration that irradiation results in the induction of heritable methylation changes in mammalian cells, and provides a link between the various non-radiological instigators of genomic instability, the perpetuation of the unstable state and several of its manifestations

  8. Non-thermal dielectric-barrier discharge plasma damages human keratinocytes by inducing oxidative stress.

    Science.gov (United States)

    Kim, Ki Cheon; Piao, Mei Jing; Madduma Hewage, Susara Ruwan Kumara; Han, Xia; Kang, Kyoung Ah; Jo, Jin Oh; Mok, Young Sun; Shin, Jennifer H; Park, Yeunsoo; Yoo, Suk Jae; Hyun, Jin Won

    2016-01-01

    The aim of this study was to identify the mechanisms through which dielectric-barrier discharge plasma damages human keratinocytes (HaCaT cells) through the induction of oxidative stress. For this purpose, the cells were exposed to surface dielectric-barrier discharge plasma in 70% oxygen and 30% argon. We noted that cell viability was decreased following exposure of the cells to plasma in a time-dependent manner, as shown by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. The levels of intracellular reactive oxygen species (ROS) were determined using 2',7'-dichlorodihydrofluorescein diacetate and dihydroethidium was used to monitor superoxide anion production. Plasma induced the generation of ROS, including superoxide anions, hydrogen peroxide and hydroxyl radicals. N-acetyl cysteine, which is an antioxidant, prevented the decrease in cell viability caused by exposure to plasma. ROS generated by exposure to plasma resulted in damage to various cellular components, including lipid membrane peroxidation, DNA breaks and protein carbonylation, which was detected by measuring the levels of 8-isoprostane and diphenyl-1-pyrenylphosphine assay, comet assay and protein carbonyl formation. These results suggest that plasma exerts cytotoxic effects by causing oxidative stress-induced damage to cellular components. PMID:26573561

  9. Blockage of JNK pathway enhances arsenic trioxide-induced apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Arsenic is well known as a carcinogen predisposing humans to some severe diseases and also as an effective medicine for treating acute promyelocytic leukemia, syphilis, and psoriasis. Multiple active mechanisms, including cell cycle arrest and apoptosis, have been proposed in therapy; however, the opposing effects of arsenic remain controversial. Our previous study found that arsenic trioxide (ATO)-induced activation of p21WAF1/CIP1 (p21) led to A431 cell death through the antagonistic effects of the signaling of ERK1/2 and JNK1. In the current study, the inhibitory effects of JNK1 on ATO-induced p21 expression were explored. Over-expression of JNK1 in A431 cells could inhibit p21 expression, which was associated with HDAC1 and TGIF. Using the GST pull-down assay and fluorescence resonance energy transfer analysis, N-terminal domain (amino acids 1-108) of TGIF, critical to its binding with c-Jun, was found. Using reporter assays, requirement of the C-terminal domain (amino acids 138-272) of TGIF to suppress ATO-induced p21 expression was observed. Thus, the domains of TGIF that carried out its inhibitory effects on p21 were identified. Finally, treatment with JNK inhibitor SP600125 could enhance ATO-induced apoptosis of HaCaT keratinocytes by using flow cytometry.

  10. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    International Nuclear Information System (INIS)

    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides

  11. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yi; Pirisi, Lucia [Department of Pathology, Microbiology and Immunology, School of Medicine, University of South Carolina, Columbia, SC (United States); Creek, Kim E., E-mail: creekk@sccp.sc.edu [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC (United States)

    2013-09-15

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski.

  12. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    International Nuclear Information System (INIS)

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling

  13. Six1 overexpression at early stages of HPV16-mediated transformation of human keratinocytes promotes differentiation resistance and EMT

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Hanwen [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC 29208 (United States); Pirisi, Lucia [Department of Pathology, Microbiology and Immunology, University of South Carolina School of Medicine, University of South Carolina, Columbia, SC 29208 (United States); Creek, Kim E., E-mail: creekk@sccp.sc.edu [Department of Drug Discovery and Biomedical Sciences, South Carolina College of Pharmacy, University of South Carolina, Columbia, SC 29208 (United States)

    2015-01-01

    Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling.

  14. Ski protein levels increase during in vitro progression of HPV16-immortalized human keratinocytes and in cervical cancer

    International Nuclear Information System (INIS)

    We compared the levels of the Ski oncoprotein, an inhibitor of transforming growth factor-beta (TGF-β) signaling, in normal human keratinocytes (HKc), HPV16 immortalized HKc (HKc/HPV16), and differentiation resistant HKc/HPV16 (HKc/DR) in the absence and presence of TGF-β. Steady-state Ski protein levels increased in HKc/HPV16 and even further in HKc/DR, compared to HKc. TGF-β treatment of HKc, HKc/HPV16, and HKc/DR dramatically decreased Ski. TGF-β-induced Ski degradation was delayed in HKc/DR. Ski and phospho-Ski protein levels are cell cycle dependent with maximal Ski expression and localization to centrosomes and mitotic spindles during G2/M. ShRNA knock down of Ski in HKc/DR inhibited cell proliferation. More intense nuclear and cytoplasmic Ski staining and altered Ski localization were found in cervical cancer samples compared to adjacent normal tissue in a cervical cancer tissue array. Overall, these studies demonstrate altered Ski protein levels, degradation and localization in HPV16-transformed human keratinocytes and in cervical cancer. - Highlights: • Ski oncoprotein levels increase during progression of HPV16-transformed cells. • Ski and phospho-Ski protein levels are cell cycle dependent. • Ski knock-down in HPV16-transformed keratinocytes inhibited cell proliferation. • Cervical cancer samples overexpress Ski

  15. Comparative toxicities of bismuth oxybromide and titanium dioxide exposure on human skin keratinocyte cells.

    Science.gov (United States)

    Gao, Xiaoya; Wang, Yawen; Peng, Shiqi; Yue, Bin; Fan, Caimei; Chen, Weiyi; Li, Xiaona

    2015-09-01

    Nano-sized bismuth oxybromide (BiOBr) particles are being considered for applications within the semiconductor industry. However, little is known about their potential impact on human health. In this study, we comparatively investigated the cytotoxicity of BiOBr and titanium dioxide (TiO2) nanoparticles (NPs) using human skin keratinocyte cell line (HaCaT) as a research model. Results indicate that lamellar-shaped BiOBr (length: 200 nm, width: 150 nm, and an average thickness: around 15 nm) has less toxic effects on cell viability and intracellular organelles than TiO2 (P25) NPs. BiOBr mainly induced late cell apoptosis, while for TiO2, both early apoptosis and late apoptosis were involved. Cell cycle arrest was found in cells on both NPs exposure, and more prominent in TiO2-treated cells. More cellular uptake was achieved after TiO2 exposure, particularly at 10 μg mL(-1), presence of TiO2 resulted in more than 2-fold increase in cellular granularity compared with BiOBr. Furthermore, TiO2 had a high potential to generate intracellular reactive oxygen species (ROS) in cells, where a 2.7-fold increase in TiO2 group and 2.0-fold increase in BiOBr group at the same concentration of 25 μg mL(-1). Higher cellular uptake and ROS stimulation should contribute to the more hazards of TiO2 than BiOBr NPs. This knowledge is a crucial component in the environmental and human hazard assessment of BiOBr and TiO2 NPs. PMID:25917605

  16. Role of VEGF receptors in normal and psoriatic human keratinocytes: evidence from irradiation with different UV sources.

    Directory of Open Access Journals (Sweden)

    Jian-Wei Zhu

    Full Text Available Vascular endothelial growth factor (VEGF promotes angiogenesis and plays important roles both in physiological and pathological conditions. VEGF receptors (VEGFRs are high-affinity receptors for VEGF and are originally considered specific to endothelial cells. We previously reported that VEGFRs were also constitutively expressed in normal human keratinocytes and overexpressed in psoriatic epidermis. In addition, UVB can activate VEGFRs in normal keratinocytes, and the activated VEGFR-2 signaling is involved in the pro-survival mechanism. Here, we show that VEGFRs were also upregulated and activated by UVA in normal human keratinocytes via PKC, and interestingly, both the activated VEGFR-1 and VEGFR-2 protected against UVA-induced cell death. As VEGFRs were over-expressed in psoriatic epidermis, we further investigated whether narrowband UVB (NB-UVB phototherapy or topical halomethasone monohydrate 0.05% cream could affect their expression. Surprisingly, the over-expressed VEGFRs in psoriatic epidermis were significantly attenuated by both treatments. During NB-UVB therapy, VEGFRs declined first in the basal, and then gradually in the upper psoriatic epidermis. VEGFRs were activated in psoriatic epidermis, their activation was enhanced by NB-UVB, but turned undetectable after whole therapy. This process was quite different from that by halomethasone, in which VEGFRs and phospho-VEGFRs decreased in a gradual, homogeneous manner. Our findings further suggest that UV-induced activation of VEGFRs serves as a pro-survival signal for keratinocytes. In addition, VEGFRs may be involved in the pathological process of psoriasis, and UV phototherapy is effective for psoriasis by directly modulating the expression of VEGFRs.

  17. Expression and purification of recombinant truncated human keratinocyte growth factor-1

    International Nuclear Information System (INIS)

    Objective: To construct the genetic engineering bacteria highly expressing 23 amino acids human keratinocyte growth factor-1 (rhKGF1dest23) missing N terminal, and provide experimental data for development of new drug for treatment of oral mucositis after radiotherapy and chemotherapy. Methods: PCR was used to synthese 23 amino acids rhKGF1dest23 missing N terminal and sumo gene fragments, and construct four kinds of recombinant prokaryotic expression vectors: pET22b-rhKGF1dest23, pET22b-sumo-rhKGF1dest23, pET3c-rhKGF1dest23 and pET3c-sumo-rhKGF1dest23, then they were transformed into prokaryotic expression host bacteria: Rosetta (DE3) plysS, BL21 (DE3), BL21 (DE3) Star plysS, origima(DE3) and BL21AI, the best expression combination of plasmid and host strain of rhKGF1dest23 protein was screened and purified by CM ion-exchange and heparin affinity chromatography and identified with Western blotting. Results: pET22b-rhKGF1dest23 plasmid and the BL21AI host bacteria was the best combination of expression, after induced by IPTG and arabinose, the majority of recombinant protein was expressed in soluble form, accounting for about 12% of the total bacterial proteins. Its purity reached to more than 95% of the protein after two steps chromatography, then conformed with Western blotting. Conclusion: Human genetic engineering bacteria of KGF1dest23 is successfully constructed and induced by IPTG and arabinose, then after CM weak cation exchange and heparin affinity chromatography, the purified rhKGF1dest23 protein is obtained. (authors)

  18. Expression profiling of human keratinocyte response to ultraviolet A: implications in apoptosis.

    Science.gov (United States)

    He, Yu-Ying; Huang, Jian-Li; Sik, Robert H; Liu, Jie; Waalkes, Michael P; Chignell, Colin F

    2004-02-01

    Ultraviolet A radiation from sunlight is a major human health concern, as it is not absorbed by the ozone layer and can deeply penetrate into the skin causing skin damage. To study the molecular mechanism involved in the ultraviolet A effect, human HaCaT keratinocytes were exposed to ultraviolet A at doses of 10 J per cm2 and 30 J per cm2. Ultraviolet A irradiation caused dose- and time-dependent apoptotic cell death, as evidenced by DNA fragmentation, flow cytometry, and the activation of caspase-3. To study the genes altered by ultraviolet A at an apoptosis-inducing dose (30 J per cm2), cells were harvested immediately after ultraviolet A treatment (0 h), and 6 h and 24 h after ultraviolet A exposure. Total RNA was extracted for microarray and real-time RT-PCR analysis, and cellular proteins were extracted for western blot analysis. Of the selected critical genes/proteins, the induction of c-Jun, c-myc, and p33ING1, and the repression of epidermal growth factor receptor, inhibitor of apoptosis protein, and survivin pathways, could be involved in ultraviolet-A-induced apoptosis. On the other hand, the late induction of cyclin D1 and cyclin-dependent kinase 4 was indicative of possible cell cycle recovery in surviving cells. Real-time RT-PCR analysis confirmed these results and a majority of the protein levels paralleled their corresponding RNA levels. In addition, ultraviolet A treatment altered the expression of genes involved in signal transduction, RNA processing, structural proteins, and metabolism in a time-dependent manner. This initial microarray analysis could advance our understanding of cellular responses to ultraviolet A exposure, and provide a platform from which to further study ultraviolet-A-induced apoptosis and carcinogenesis. PMID:15009741

  19. Phorbol ester binding and protein kinase C activity in normal and transformed human keratinocytes

    International Nuclear Information System (INIS)

    Normal keratinocytes, SV40-transformed keratinocytes (SVK14), and various squamous carcinoma cell (SCC) lines have been used as an in vitro model system to study the properties of phorbol ester receptor and protein kinase C expression during keratinocyte differentiation. The cell lines used exhibit a decreasing capacity to differentiate; moreover, all cell lines respond to a low external Ca2+ concentration by a decreased capacity to differentiate. Normal keratinocytes exhibited the highest number of phorbol ester receptors as compared to the other cell lines, while each individual cell line exhibited a higher number of phorbol ester receptors during growth under normal Ca2+ conditions as compared to cells grown under low Ca2+ conditions. The apparent dissociation constant (Kd) demonstrated only small variations in the various cell lines. These studies revealed differences between protein kinase C properties from the two cell lines grown under normal and low Ca2+ conditions. The differences included the effect of phorbol 12-myristate 13-acetate (PMA) on the redistribution pattern of protein kinase C between the cytoplasmic and particulate fractions as well as the activating effect of diolein in vitro on protein kinase C activity. These observations demonstrate that the functional protein kinase C activity of keratinocytes is determined by various endogenous and exogenous activators and that these activators are modulated differently in various cell lines, under various growth conditions (low Ca2+ versus normal Ca2+)

  20. Low-dose of ionizing radiation impairs DNA repair system in human primary keratinocytes and human skin 3D model

    International Nuclear Information System (INIS)

    The effects of low-doses of ionizing radiation in humans are of growing concern, especially in the context of current radiation techniques such as medical imaging. The biological response of healthy tissue to low dose of 1-10 cGy in vivo is largely unknown. In this project, we propose firstly to study the effects (long and short-term) of low-doses on cell proliferation, apoptosis, and capacity to obtain a cohesive and stratified epidermis after irradiation. Secondly, we will evaluate the carcinogenesis risk by measuring the modulation of the DNA repair/damage systems after low-dose exposure. For short-term radiosensitivity, cell viability was determined by MTT assay after 24, 48 and 72 h post irradiation, we also performed an in vivo colony-forming assay, which measures the radiation toxicity after 2 weeks. DNA repair system and damage was assessed by different techniques available in our laboratory (DNA repair chips, modified comet assay). Finally, organogenesis potential was determined by the capacity of normal exposed keratinocytes to form a pluri-stratified epithelium in 3D organo-typic cultures. We showed that low-dose of ionizing radiation increases 2 fold the oxidative DNA damage (p=0.01) without any activation of the base excision repair pathway, an important pathway to repair oxidative DNA damage. Moreover, we showed that low-dose affects the organogenesis potential of keratinocytes and impairs the proliferation-differentiation balance in the reconstructed skin. We postulate that when the dose or dose rate is very low the radiation damage sensors (ATM or ATR) are not activated, and the repair machinery is not induced. Hence damage could be accumulated in the genome of a cell until eventually it become malignant. (authors)

  1. Effect of Storage Temperature on Structure and Function of Cultured Human Oral Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Rakibul Islam

    Full Text Available To assess the effect of storage temperature on the viability, phenotype, metabolism, and morphology of cultured human oral keratinocytes (HOK.Cultured HOK cells were stored in HEPES- and sodium bicarbonate-buffered Minimum Essential Medium (MEM at nine temperatures in approximately 4 °C increments from 4 °C to 37 °C for seven days. Cells were characterized for viability by calcein fluorescence, phenotype retention by immunocytochemistry, metabolic parameters (pH, glucose, lactate, and O2 within the storage medium by blood gas analysis, and morphology by scanning electron microscopy and light microscopy.Relative to the cultured, but non-stored control cells, a high percentage of viable cells were retained only in the 12 °C and 16 °C storage groups (85% ± 13% and 68% ± 10%, respectively. Expression of ABCG2, Bmi1, C/EBPδ, PCNA, cytokeratin 18, and caspase-3 were preserved after storage in the 5 groups between 4 °C and 20 °C, compared to the non-stored control. Glucose, pH and pO2 in the storage medium declined, whereas lactate increased with increasing storage temperature. Morphology was best preserved following storage of the three groups between 12 °C, 16 °C, and 20 °C.We conclude that storage temperatures of 12 °C and 16 °C were optimal for maintenance of cell viability, phenotype, and morphology of cultured HOK. The storage method described in the present study may be applicable for other cell types and tissues; thus its significance may extend beyond HOK and the field of ophthalmology.

  2. Bitter apricot essential oil induces apoptosis of human HaCaT keratinocytes.

    Science.gov (United States)

    Li, Keyou; Yang, Wenhua; Li, Zhe; Jia, Wangwang; Li, Jiazhou; Zhang, Pengfei; Xiao, Tiancun

    2016-05-01

    Psoriasis is a chronic skin disease that affects approximately 2% of the world's population. Conventional therapeutic approaches are not effective or necessarily safe for treating symptoms due to the serious side effects and resistance to currently prescribed drugs. Traditionally, in oriental medicine, apricot seed (Semen Armeniacae amarum) is used to treat skin diseases. However, the underlying mechanism of action has not been systematically elucidated. In the present study, the anti-proliferative effect of bitter apricot essential oil (BAEO) on cultured HaCaT cells was evaluated and the mechanism of action investigated. BAEO was isolated by hydrodistillation, and gas chromatography-mass spectrometry (GC-MS) analysis identified benzaldehyde (75.35%), benzoic acid (6.21%) and mandelonitrile (5.38%). HaCaT cell growth, measured by sulforhodamine B assay (SRB), was inhibited by BAEO with an IC50 value of 142.45 μg/ml. Apoptosis of HaCaT cells treated with BAEO was detected by cell cycle, flow cytometry, and western blot analyses. These measurements revealed G0/G1 cell cycle arrest, elevated numbers of early and late stage apoptotic cells, and caspases-3/8/9 and PARP activation. Z-VAD-FMK, a broad-spectrum caspase inhibitor, attenuated BAEO-induced apoptosis. Also, increased Bax and decreased Bcl-2 levels suggest that BAEO-induced apoptosis is mediated through both death receptor and mitochondrial pathways. Moreover, reduced Rel/NF-κB levels suggest that BAEO-mediated apoptosis is also associated with inhibition of the NF-κB pathway. These data suggest that BAEO is a naturally occurring material that functions as a potent pro-apoptotic factor for human keratinocytes. Thus, it is a promising candidate to treat psoriasis. PMID:26971222

  3. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available UNLABELLED: The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A. CONCLUSIONS/SIGNIFICANCE: Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  4. Activated protein C: A regulator of human skin epidermal keratinocyte function

    Institute of Scientific and Technical Information of China (English)

    Kelly; McKelvey; Christopher; John; Jackson; Meilang; Xue

    2014-01-01

    Activated protein C(APC) is a physiological anticoagulant, derived from its precursor protein C(PC). Independent of its anticoagulation, APC possesses strong anti-inflammatory, anti-apoptotic and barrier protective properties which appear to be protective in a number of disorders including chronic wound healing. The epidermis is the outermost skin layer and provides the first line of defence against the external environment. Keratinocytes are the most predominant cells in the epidermis and play a critical role in maintaining epidermal barrier function. PC/APC and its receptor, endothelial protein C receptor(EPCR), once thought to be restricted to the endothelium, are abundantly expressed by skin epidermal keratinocytes. These cells respond to APC by upregulating proliferation, migration and matrix metalloproteinase-2 activity and inhibiting apoptosis/inflammation leading to a wound healing phenotype. APC also increases barrier function of keratinocyte monolayers by promoting the expression of tight junction proteins and re-distributing them to cell-cell contacts. These cytoprotective properties of APC are mediated through EPCR, protease-activated receptors, epidermal growth factor receptor or Tie2. Future preventive and therapeutic uses of APC in skin disorders associated with disruption of barrier function and inflammation look promising. This review will focus on APC’s function in skin epidermis/keratinocytes and its therapeutical potential in skin inflammatory conditions.

  5. Cytotoxic effects of sodium dodecyl benzene sulfonate on human keratinocytes are not associated with proinflammatory cytokines expression

    Institute of Scientific and Technical Information of China (English)

    Mu Zhanglei; Liu Xiaojing; Zhao Yan; Zhang Jianzhong

    2014-01-01

    Background Keratinocytes play a crucial role in the biological function of skin barrier.The relationship between sodium lauryl sulfate (SLS) and keratinocytes has been studied.However,the cytotoxicity and effects of sodium dodecyl benzene sulfonate (SDBS),a common detergent similar to SLS,on keratinocytes are still not known.This study aimed to investigate the effects of SDBS on cytotoxicity and expression of proinflammatory cytokines in cultured human keratinocytes.Methods This study was carried out using the keratinocytes cell line,HaCaT cells.The cytotoxicity of SDBS on HaCaT cells was evaluated with cell counting kit-8 (CCK-8) and phase-contrast microscopy.After exposure to different concentrations of SDBS,the total RNA of the HaCaT cells was extracted for evaluating the relative mRNA expression of IL-1α,IL-6,IL-8,and TNF-α by qPCR.The supernatants of cells were collected for measuring the levels of IL-6 and IL-8 by enzyme-linked immunosorbent assay (ELISA).Results SDBS at concentrations of 20 Jg/ml and over showed direct cytotoxicity and induced morphological changes of the HaCaT cells.The mRNA expressions of IL-1a,IL-6,IL-8,and TNF-α in different concentrations of SDBS at different time were comparable with that of controls.SDBS at concentrations of 5,10,and 15 μg/ml had no significant effects on IL-6 and IL-8 excretion from HaCaT cells after 24-hour exposure.Moreover,no significant effects on the IL-6 and IL-8 excretion were found after 10 and 15 μg/ml S DBS stimulations for 6,12,and 24 hours,respectively.Conclusion SDBS at higher concentrations had cytotoxicity on HaCaT cells but had no effects on the mRNA expression of IL-1α,IL-6,IL-8,and TNF-α,that was different from SLS.

  6. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Herbert, Katharine J.; Cook, Anthony L., E-mail: Anthony.Cook@utas.edu.au; Snow, Elizabeth T., E-mail: elizabeth.snow@utas.edu.au

    2014-06-15

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis.

  7. SIRT1 inhibition restores apoptotic sensitivity in p53-mutated human keratinocytes

    International Nuclear Information System (INIS)

    Mutations to the p53 gene are common in UV-exposed keratinocytes and contribute to apoptotic resistance in skin cancer. P53-dependent activity is modulated, in part, by a complex, self-limiting feedback loop imposed by miR-34a-mediated regulation of the lysine deacetylase, SIRT1. Expression of numerous microRNAs is dysregulated in squamous and basal cell carcinomas; however the contribution of specific microRNAs to the pathogenesis of skin cancer remains untested. Through use of RNAi, miRNA target site blocking oligonucleotides and small molecule inhibitors, this study explored the influence of p53 mutational status, SIRT1 activity and miR-34a levels on apoptotic sensitivity in primary (NHEK) and p53-mutated (HaCaT) keratinocyte cell lines. SIRT1 and p53 are overexpressed in p53-mutated keratinocytes, whilst miR-34a levels are 90% less in HaCaT cells. HaCaTs have impaired responses to p53/SIRT1/miR-34a axis manipulation which enhanced survival during exposure to the chemotherapeutic agent, camptothecin. Inhibition of SIRT1 activity in this cell line increased p53 acetylation and doubled camptothecin-induced cell death. Our results demonstrate that p53 mutations increase apoptotic resistance in keratinocytes by interfering with miR-34a-mediated regulation of SIRT1 expression. Thus, SIRT1 inhibitors may have a therapeutic potential for overcoming apoptotic resistance during skin cancer treatment. - Highlights: • Impaired microRNA biogenesis promotes apoptotic resistance in HaCaT keratinocytes. • TP53 mutations suppress miR-34a-mediated regulation of SIRT1 expression. • SIRT1 inhibition increases p53 acetylation in HaCaTs, restoring apoptosis

  8. Zinc deficiency or excess within the physiological range increases genome instability and cytotoxicity, respectively, in human oral keratinocyte cells

    OpenAIRE

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Fenech, Michael

    2011-01-01

    Zinc (Zn) is an essential component of Zn-finger proteins and acts as a cofactor for enzymes required for cellular metabolism and in the maintenance of DNA integrity. The study investigated the genotoxic and cytotoxic effects of Zn deficiency or excess in a primary human oral keratinocyte cell line and determined the optimal concentration of two Zn compounds (Zn Sulphate (ZnSO4) and Zn Carnosine (ZnC)) to minimise DNA damage. Zn-deficient medium (0 μM) was produced using Chelex treatment, and...

  9. Bifurcated converging pathways for high Ca2+- and TGFβ-induced inhibition of growth of normal human keratinocytes

    OpenAIRE

    Sakaguchi, Masakiyo; Sonegawa, Hiroyuki; Nukui, Takamasa; Sakaguchi, Yoshihiko; Miyazaki,Masahiro; Namba,Masayoshi; Huh, Nam-ho

    2005-01-01

    Growth suppression of normal human keratinocytes by high Ca2+ or TGFβ was shown to be mediated by p21WAF1/CIP1 and Sp1 [Pardali, K., et al. (2000) J. Biol. Chem. 275, 29244–29256; Santini, M. P., Talora, C., Seki, T., Bolgan, L. & Dotto, G. P. (2001) Proc. Nat. Acad. Sci. USA 98, 9575–9580; Al-Daraji, W. I., Grant, K. R., Ryan, K., Saxton, A., & Reynolds, N. J. (2002) J. Invest. Dermatol. 118, 779–788]. We previously demonstrated that S100C/A11 is a key mediator for growth inhibition of norma...

  10. Characterization of the human papillomavirus E2 protein: evidence of trans-activation and trans-repression in cervical keratinocytes.

    OpenAIRE

    Bouvard, V.; A Storey; Pim, D; Banks, L.

    1994-01-01

    The major regulator of papillomavirus transcription is encoded by the viral E2 gene. The E2 gene has been well characterized in bovine papillomavirus (BPV) where it encodes at least three different polypeptides which differentially affect viral gene expression. In human papillomaviruses (HPVs) the E2 gene product is much less well characterized. In this study we have analysed the mechanism of action of the HPV-16, HPV-18 and BPV-1 E2 proteins in cervical keratinocytes. We show that the full l...

  11. Triterpenoid α-amyrin stimulates proliferation of human keratinocytes but does not protect them against UVB damage

    DEFF Research Database (Denmark)

    Biskup, Edyta; Gołębiowski, Marek; Gniadecki, Robert;

    2012-01-01

    about 18% while other extract components were ineffective. A panel of biochemical and cell-based assays testing the antioxidative and cytoprotective activites of α-amyrin indicated no antioxidative activity of this compound. α-Amyrin did not protect HaCaT cells against the damage caused by UVB radiation.......Rhaponticum carthamoides plants ("maral root") are widely used in Siberian folk medicine. The present study reports for the first time the presence of pentacyclic terpenoid, α-amyrin, in methanol extract from leaves of this plant. α-Amyrin induced proliferation of human keratinocytes (HaCaT) by...

  12. Partial loss of Smad signaling during in vitro progression of HPV16-immortalized human keratinocytes

    International Nuclear Information System (INIS)

    Disruption of the transforming growth factor-beta (TGF-β) signaling pathway is observed in many cancers, including cervical cancer, resulting in TGF-β resistance. While normal human keratinocytes (HKc) and human papillomavirus type 16-immortalized HKc (HKc/HPV16) are sensitive to the growth inhibitory effects of TGF-β, HKc/HPV16 develop resistance to TGF-β1 as they progress in vitro to a differentiation resistant phenotype (HKc/DR). The loss of sensitivity to the antiproliferative effects of TGF-β1 in HKc/DR is due, at least partially, to decreased expression of the TGF-β receptor type I. In the present study, we explored in detail whether alterations in Smad protein levels, Smad phosphorylation, or nuclear localization of Smads in response to TGF-β could contribute to the development of TGF-β resistance during in vitro progression of HKc/HPV16, and whether TGF-β induction of a Smad-responsive reporter gene was altered in HKc/DR. Western blot analysis was used to assess Smad protein levels. In order to study Smad nuclear localization we performed indirect immunofluorescence. In addition, we determined Smad-mediated TGF-β signaling using a luciferase reporter construct. We did not find a decrease in protein levels of Smad2, Smad3 or Smad4, or an increase in the inhibitory Smad7 that paralleled the loss of sensitivity to the growth inhibitory effects of TGF-β1 observed in HKc/DR. However, we found diminished Smad2 phosphorylation, and delayed nuclear Smad3 localization in response to TGF-β1 in HKc/DR, compared to normal HKc and TGF-β sensitive HKc/HPV16. In addition, we determined that TGF-β1 induction of a Smad responsive promoter is reduced by about 50% in HKc/DR, compared to HKc/HPV16. These results demonstrate that alterations in Smad protein levels are not associated with the loss of response to the antiproliferative effects of TGF-β in HKc/DR, but that diminished and delayed Smad phosphorylation and nuclear localization, and decreased Smad

  13. Ispaghula (Plantago ovata) seed husk polysaccharides promote proliferation of human epithelial cells (skin keratinocytes and fibroblasts) via enhanced growth factor receptors and energy production.

    Science.gov (United States)

    Deters, A M; Schröder, K R; Smiatek, T; Hensel, Andreas

    2005-01-01

    Endogenous carbohydrates, especially oligo- and polysaccharides, participate in the regulation of a broad range of biological activities, e. g., signal transduction, inflammation, fertilisation, cell-cell-adhesion and act as in vivo markers for the determination of cell types. In the present study, water-soluble (WS) and gel-forming polysaccharides (GF) of ispaghula seed husk (Plantago ovata Forsskal, Plantaginaceae) were characterised as neutral and acidic arabinoxylans and tested under in vitro conditions for regulating activities on cell physiology of human keratinocytes and human primary fibroblasts. Only water-soluble polysaccharides exhibited strong and significant effects on cell physiology of keratinocytes and fibroblasts. Proliferation of cells of the spontaneously immortalised keratinocyte cell line HaCaT was significantly up-regulated in a dose-independent manner. Analysis of activated signal pathways by RNA analysis proved an effect of the acidic arabinoxylan on the expression of keratinocyte growth factor (KGF) in HaCaT cells. Differentiation behaviour of normal human keratinocytes (NHK) determined by involucrin was slightly influenced, due to the enhanced cell proliferation, leading to a cell-cell-mediated indirect induction of early differentiation. WS did not influence late differentiation, as determined by keratin K1 and K10 titres. PMID:15678371

  14. The effect of 648 nm diode laser irradiation on second messengers in senescent human keratinocytes

    Science.gov (United States)

    Hawkins Evans, D.; Abrahamse, H.

    2009-02-01

    Background/purpose: Stress induced premature senescence (SIPS) is defined as the long-term effect of subcytotoxic stress on proliferative cell types. Cells in SIPS display differences at the level of protein expression which affect energy metabolism, defense systems, redox potential, cell morphology and transduction pathways. This study aimed to determine the effect of laser irradiation on second messengers in senescent cells and to establish if that effect can be directly linked to changes in cellular function such as cell viability or proliferation. Materials and Methods: Human keratinocyte cell cultures were modified to induce premature senescence using repeated sub-lethal stresses of 200 uM H2O2 or 5% OH every day for four days with two days recovery. SIPS was confirmed by senescence-associated β-galactosidase staining. Control conditions included normal, repeated stress of 500 uM H2O2 to induce apoptosis and 200 uM PBN as an anti-oxidant or free radical scavenger. Cells were irradiated with 1.5 J/cm2 on day 1 and 4 using a 648 nm diode laser (3.3 mW/cm2) and cellular responses were measured 1 h post irradiation. The affect on second messengers was assessed by measuring cAMP, cGMP, nitric oxide and intracellular calcium (Ca2+) while functional changes were assessed using cell morphology, ATP cell viability, LDH membrane integrity and WST-1 cell proliferation. Results: Results indicate an increase in NO and a decrease in cGMP and Ca2+ in 200 uM H2O2 irradiated cells while PBN irradiated cells showed a decrease in cAMP and an increase in ATP viability and cell proliferation. Conclusion: Laser irradiation influences cell signaling which ultimately changes the biological function of senescent cells. If laser therapy can stimulate the biological function of senescent cells it may be beneficial to conditions such as immune senescence, skin ageing, muscle atrophy, premature ageing of arteries in patients with advanced heart disease, neurodegenerative disorders and

  15. Cell kinetic effects of a single treatment with PUVA on cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    The present study investigated the effects of a single treatment with 8-methoxypsoralen (8-MOP)+long wavelength ultraviolet light (PUVA) on cultured human epidermal keratinocytes. Flow cytometry was used to determine the proportions of cells in S and G2+M phase. The simultaneous measurement of Ki-67 antigen and DNA content was used to estimate proportion of Ki-67-positive cells in S and G2+M compartments following PUVA. The sorting analysis was used to estimate the proportion of M-phase cells in the G2+M compartment. For simultaneous measurement of RNA and DNA content of individual cells by flow cytometry, cells were stained with acridine orange. The growth curve from PUVA-treated cultures was significantly lower than that of the untreated control cultures until 120 hr after treatment. After PUVA treatment, a slight decrease at 2 hr, followed by a marked increase with a peak at 12 hr, was observed in the number of S-phase cells. PUVA caused a slight decrease from 2 to 6 hr in the number of cells in the G2+M phase, together with a decrease in the proportion of M-phase cells in the G2+M compartment. Thereafter, an increasing number of cells was observed in the G2+M phase from 24 to 120 hr, accompanied by a marked decrease in the proportion of M-phase cells in the G2+M compartment. A decrease in the number of Ki-67-positive cells in the G2+M compartment was observed in PUVA-treated cultures from 48 to 120 hr. A considerable number of cells with lower RNA content were observed in the S and G2+M compartment from 72 to 120 hr. The evidence strongly suggests that PUVA causes an initial blocking of cells in the G1 phase, and that when the partial G1 block is released, a large number of cells pass through the S phase in partial synchrony. It is also suggested that PUVA induces an accumulation of cells in the G2 phase, and that many of the cells accumulating in the G2 phase may be G2Q cells. (author)

  16. Ceramide Stimulates ABCA12 Expression via Peroxisome Proliferator-activated Receptor δ in Human Keratinocytes*

    OpenAIRE

    Jiang, Yan J.; Uchida, Yoshikazu; Lu, Biao; Kim, Peggy; Mao, Cungui; Akiyama, Masashi; Elias, Peter M.; Holleran, Walter M.; Grunfeld, Carl; Feingold, Kenneth R.

    2009-01-01

    ABCA12 (ATP binding cassette transporter, family 12) is a cellular membrane transporter that facilitates the delivery of glucosylceramides to epidermal lamellar bodies in keratinocytes, a process that is critical for permeability barrier formation. Following secretion of lamellar bodies into the stratum corneum, glucosylceramides are metabolized to ceramides, which comprise ∼50% of the lipid in stratum corneum. Gene mutations of ABCA12 underlie harlequin ichthyosis, a devastating skin disorde...

  17. The epithelial sodium channel mediates the directionality of galvanotaxis in human keratinocytes

    OpenAIRE

    Yang, Hsin-ya; Charles, Roch-Philippe; Hummler, Edith; Baines, Deborah L.; Isseroff, R. Rivkah

    2013-01-01

    Cellular directional migration in an electric field (galvanotaxis) is one of the mechanisms guiding cell movement in embryogenesis and in skin epidermal repair. The epithelial sodium channel (ENaC), in addition to its function of regulating sodium transport in kidney, has recently been found to modulate cell locomotory speed. Here we tested whether ENaC has an additional function of mediating the directional migration of galvanotaxis in keratinocytes. Genetic depletion of ENaC completely bloc...

  18. Keratinocytes in tissue engineering of human skin: invitro and in vivo studies

    OpenAIRE

    Fredriksson, Camilla

    2008-01-01

    Full thickness wounds, such as deep burns, need restoration of both the dermal and epidermal layers of the skin. In normal wound healing, re-epithelialization occurs by migration and proliferation of keratinocytes from the wound edges and by differentiation of stem cells from remaining hair follicles. Restoration of dermis occurs by influx of growth factors secreted by macrophages, platelets, and fibroblasts; by fibroblast proliferation and subsequent synthesis and remodeling of collagenous d...

  19. Mannosides as crucial part of bioactive supports for cultivation of human epidermal keratinocytes without feeder cells

    Czech Academy of Sciences Publication Activity Database

    Labský, Jiří; Dvořánková, B.; Smetana, Karel; Holíková, Z.; Brož, L.; Gabius, H.J.

    2003-01-01

    Roč. 24, č. 5 (2003), s. 863-872. ISSN 0142-9612 R&D Projects: GA ČR GA203/00/1310; GA MŠk LN00A065; GA MZd ND6340 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy * keratinocyte * mannose Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.903, year: 2003

  20. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  1. Anti-inflammatory effects of astaxanthin in the human gingival keratinocyte line NDUSD-1

    OpenAIRE

    Miyachi, Masashiro; Matsuno, Tomonori; Asano, Kazunari; Mataga, Izumi

    2015-01-01

    Oral lichen planus is a chronic inflammatory disease that affects the mucous membrane of the oral cavity and can contribute to the development of other diseases. Inflammation in oral lichen planus is a T-cell-mediated autoimmune disease that acts through cytotoxic CD8+ T cells to trigger apoptosis of keratinocytes. However, the specific cause of oral lichen planus remains unknown and no effective medical treatment has yet been established. Astaxanthin is a carotenoid pigment with capacity for...

  2. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  3. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  4. A synthetic isoflavone, DCMF, promotes human keratinocyte migration by activating Src/FAK signaling pathway.

    Science.gov (United States)

    Sophors, Phorl; Kim, Young Mee; Seo, Ga Young; Huh, Jung-Sik; Lim, Yoongho; Koh, Dong Soo; Cho, Moonjae

    2016-04-01

    Flavonoids are plant secondary compounds with various pharmacological properties. We previously showed that one flavonoid, trimethoxyisoflavone (TMF), could promote wound healing by inducing keratinocyte migration. Here, we screened TMF derivatives for enhanced activity and identified one compound, 2',6 Dichloro-7-methoxyisoflavone (DCMF), as most effective at promoting migration in a scratch wound assay. Using the HaCaT keratinocyte cell line, we found DCMF treatment induced phosphorylation of both FAK and Src, and increased keratinocyte migration. DCMF-induced Src kinase could promote activation of ERK, AKT, and p38 signaling pathways, and DCMF-induced secretion of matrix metalloproteinase (MMP)-2 and MMP-9 and partial epithelial-mesenchymal transition (EMT), whereas Src inhibition abolished DCMF-induced EMT. Using an in vivo excisional wound model, we observed improved wound closure and re-epithelialization in DCMF-treated mice, as compared to controls. Collectively, our data demonstrate that DCMF induces cell migration and promotes wound healing through activation of Src/FAK, ERK, AKT, and p38 MAPK signaling. PMID:26923073

  5. Metabolic activation of pyrrolizidine alkaloids leading to phototoxicity and photogenotoxicity in human HaCaT keratinocytes.

    Science.gov (United States)

    Wang, Chia-Chi; Xia, Qingsu; Li, Meng; Wang, Shuguang; Zhao, Yuewei; Tolleson, William H; Yin, Jun-Jie; Fu, Peter P

    2014-01-01

    Pyrrolizidine alkaloids, produced by a large number of poisonous plants with wide global distribution, are associated with genotoxicity, tumorigenicity, and hepatotoxicity in animals and humans. Mammalian metabolism converts pyrrolizidine alkaloids to reactive pyrrolic metabolites (dehydropyrrolizidine alkaloids) that form covalent protein and DNA adducts. Although a mechanistic understanding is currently unclear, pyrrolizidine alkaloids can cause secondary (hepatogenous) photosensitization and induce skin cancer. In this study, the phototoxicity of monocrotaline, riddelliine, dehydromonocrotaline, dehydroriddelliine, and dehydroretronecine (DHR) in human HaCaT keratinocytes under ultraviolet A (UVA) irradiation was determined. UVA irradiation of HaCaT cells treated with dehydromonocrotaline, dehydroriddelline, and DHR resulted in increased release of lactate dehydrogenase and enhanced photocytotoxicity proportional to the UVA doses. UVA-induced photochemical DNA damage also increased proportionally with dehydromonocrotaline and dehydroriddelline. UVA treatment potentiated the formation of 8-hydroxy-2'-deoxyguanosine DNA adducts induced by dehydromonocrotaline in HaCaT skin keratinocytes. Using electron spin resistance trapping, we found that UVA irradiation of dehydromonocrotaline and dehydroriddelliine generates reactive oxygen species (ROS), including hydroxyl radical, singlet oxygen, and superoxide, and electron transfer reactions, indicating that cytotoxicity and genotoxicity of these compounds could be mediated by ROS. Our results suggest that dehydropyrrolizidine alkaloids formed or delivered to the skin cause pyrrolizidine alkaloid-induced secondary photosensitization and possible skin cancer. PMID:25436474

  6. Release by ultraviolet B (u.v.B) radiation of nitric oxide (NO) from human keratinocytes: a potential role for nitric oxide in erythema production

    International Nuclear Information System (INIS)

    The mechanism of human sunburn is poorly understood but its characteristic features include the development of erythema. In this study we attempted to determine whether human keratinocytes possess a nitric oxide (NO) synthase (NOS), if this enzyme could be activated to release NO following exposure to ultraviolet B (u.v.B) and to define whether this photo-induced response could be involved in the pathogenesis of sunburn erythema. The present results indicate that u.v.B radiation acts as a potent stimulator of NOS in keratinocytes. NO is lipophilic and may diffuse out of the keratinocytes, activating sGC in endothelial cells and neighbouring smooth muscle cells. This may be a major part of the integrated response of the skin leading to vasodilatation and erythema. (author)

  7. Alterations of nitric-oxide synthase and xanthine-oxidase activities of human keratinocytes by ultraviolet-B radiation -potential role for peroxynitrite in skin inflammation

    International Nuclear Information System (INIS)

    In the present study, we demonstrated that NO synthase (cNOS) and xanthine oxidase (XO) of human keratinocytes can be activated to release NO, superoxide (O-2(-)) and peroxynitrite (ONOO-) following exposure to ultraviolet B (UVB) radiation. We defined that this photo induced response may be involved in the pathogenesis of sunburn erythema and inflammation. Treatment of human keratinocytes with UVB (290-320 nm) radiation (up to 200 mJ/cm(2)) resulted in a dose-dependent increase in NO and ONOO-release that was inhibited by N-monomethyl-L-arginine (L-NMMA). NO and ONOO- release from keratinocytes was accompanied by an increase in intracellular cGMP levels. Treatment of human keratinocyte cytosol with various doses of UVB (up to 100 mJ/cm(2)) resulted in an increase in XO activity that was inhibited by oxypurinol. In in vivo experiments, when experimental animals were subjected to UVB radiation, a protection factor (PF) of 6.5 ± 1.8 was calculated when an emulsified cream formulation containing nitro-L-arginine (L-NA) (2%) and L-NMMA (2%) was applied to their skin. The present study indicates that UVB radiation acts as a potent stimulator of cNOS and XO activities in human keratinocytes. NO and ONOO- may exert cytotoxic effects in keratinocytes themselves, as well as in their neighbouring endothelial and smooth muscle cells. This may be a major part of the integrated response leading to erythema production and the inflammation process. (UK)

  8. Primary structure of keratinocyte transglutaminase

    International Nuclear Information System (INIS)

    The nucleotide and deduced amino acid sequences of the coding regions of human and rat keratinocyte transglutaminases (protein-glutamine: amine γ-glutamyltransferase; EC 2.3.2.13) have been determined. These yield proteins of ∼90 kDa that are 92% identical, indicative of the conservation of important structural features. Alignments of amino acid sequences show substantial similarity among the keratinocyte transglutaminase, human clotting factor XIII catalytic subunit, guinea pig liver tissue transglutaminase, and the human erythrocyte band-4.2 protein. The keratinocyte enzyme is most similar to factor XIII, whereas the band-4.2 protein is most similar to the tissue transglutaminase. A salient feature of the keratinocyte transglutaminase is its 105-residue extension beyond the N terminus of the tissue transglutaminase. This extension and the unreltaed activation peptide of factor XIII (a 37-residue extension) appear to be added for specialized functions after divergence of the tissue transglutaminase from their common lineage

  9. Survival of human epidermal keratinocytes after short-duration high temperature: synthesis of HSP70 and IL-8.

    Science.gov (United States)

    Bowman, P D; Schuschereba, S T; Lawlor, D F; Gilligan, G R; Mata, J R; DeBaere, D R

    1997-06-01

    Thermal injury by short pulses (1-30 s) of relatively high temperature (50-68 degrees C) was investigated in normal human epidermal keratinocytes (NHEK). NHEK were cultured on plastic cover-slips and dipped in medium held at various temperatures. Survival assessed by methylthiazol tetrazolium reduction assay at 6 days postheating demonstrated an inverse time-temperature relationship that indicated that most cells could survive after a 1-s, 60 degrees C exposure or a 30-s, 55 degrees C exposure. Arrhenius plots of the data indicated major transition points for cell injury at 50 and 60 degrees C. Heat shock protein 70 (HSP70) and interleukin-8 (IL-8) were both induced by elevation of temperature between 50 and 60 degrees C for as short a time as 1 s. HSP70 synthesis stimulated by short, high pulses of heat appeared to induce thermotolerance. These results demonstrate that brief exposure to relatively high temperature can induce HSP70 and IL-8 synthesis in keratinocytes. PMID:9227428

  10. Hydrolyzed Methylhesperidin Induces Antioxidant Enzyme Expression via the Nrf2-ARE Pathway in Normal Human Epidermal Keratinocytes.

    Science.gov (United States)

    Kuwano, Tetsuya; Watanabe, Manabu; Kagawa, Daiji; Murase, Takatoshi

    2015-09-16

    Methylhesperidin (MHES) is a mixture of methylated derivatives of the citrus flavonoid hesperidin and is used as a food or pharmaceutical additive. Dietary MHES could be hydrolyzed by gut microflora to give aglycons. Therefore, we prepared hydrolyzed methylhesperidin (h-MHES) and assessed its pharmacological activity in human epidermal keratinocytes. h-MHES promoted nuclear factor erythroid 2-related factor 2 (Nrf2) nuclear translocation and the expression of cytoprotective genes (e.g., heme oxygenase-1 (HO-1) and glutamate cysteine ligase catalytic subunit (GCLC)). h-MHES also increased intracellular glutathione levels and reduced UVB-induced reactive oxygen species. Moreover, h-MHES increased phosphorylation of p38 mitogen-activated protein kinase (MAPK), and a p38 MAPK inhibitor significantly attenuated h-MHES-induced HO-1 and GCLC expression. Furthermore, when we purified the components of h-MHES, we identified two methoxy-chalcones as novel Nrf2 activators. Our study demonstrates that h-MHES can induce cytoprotective gene expression and reduce oxidative stress via the Nrf2-ARE pathway in keratinocytes, suggesting that MHES may contribute to the suppression of UVB-induced skin damage in vivo. PMID:26313892

  11. Regulation of haptoglobin expression in a human keratinocyte cell line HaCaT by inflammatory cytokines and dexamethasone

    Institute of Scientific and Technical Information of China (English)

    XIA Li-xin; XIAO Ting; CHEN Hong-duo; LI Ping; WANG Ya-kun; WANG He

    2008-01-01

    Background Haptoglobin(Hp)is one of the acute-phase proteins. Recent studies have demonstrated that Hp exerts immunoregulatory and anti-inflammatory actions and may be one of the inhibitory factors of immune reactions in the skin. In this study we investigated the regulation of Hp expression in a human keratinocyte cell line HaCaT by various cytokines and glucocorticod. Methods HaCaT cells were cultured with IL-6(50 ng/ml), TNF-α(20 ng/ml), IFN-Y(20 ng/ml)or IL-4(20 ng/ml)with or without 1 μmol/L dexamethasone in 6-well plates for 12, 24 and 48 hours. Both the cells and the supernatants were collected to detect the changes of Hp expression by reverse-transcription PCR, ELISA and immunohistochemistry. Results The results showed that Hp expression were elevated at both the mRNA and protein level by the combination of IL-6, TNF-α or IL-4 with dexamethasone, whereas the three cytokines alone did not upregulate the Hp expression. IFN-Y showed no effect on the Hp expression in HaCaT cells. Conclusions These findings suggest that different inflammatory cytokines as well as glucocorticoid may be involved in the regulation of Hp expression in keratinocytes, and this may be one of the negative feedback mechanisms in inflammatory skin diseases.

  12. Pyrimidine dimer induction and repair in cultured human skin keratinocytes or melanocytes after irradiation with monochromatic ultraviolet radiation

    International Nuclear Information System (INIS)

    We compared the susceptibilities of cultured melanocytes and keratinocytes to dimer induction in DNA by monochromatic ultraviolet (UV) radiation. Keratinocytes as well as melanocytes were derived from human foreskin, grown as a monolayer in petri dishes, covered with phosphate-buffered saline containing 0.1% glucose, and irradiated. UV irradiation was carried out at 254, 297, and 302 nm as well as with a light source emitting predominantly 312 nm. The induction of pyrmidine dimers was assessed by determination of the number of T4 endonuclease V-sensitive sites (ESS). We found a slightly higher response for dimer induction in melanocytes at 254, 297, and 302 nm; this difference was only significant at the 297-nm wavelength. Action spectra for pyrimidine dimer induction were derived from the exposure-response data obtained. The action spectra mimic to a large degree the action spectra for dimer induction in other cultured mammalian cells. The repair rate during a post-irradiation period lasting up to 24 h was substantially the same for the two cell types. The percentage of T4 endonuclease V-sensitive sites (ESS) remaining 9 and 24 h after irradiation was 45% and 30%, respectively

  13. Evaluation of the effect of radiation levels and dose rates in irradiation of murine fibroblasts used as a feeder layer in the culture of human keratinocytes

    International Nuclear Information System (INIS)

    In 1975, Rheinwald and Green published an effective methodology for obtaining and cultivating human keratinocytes. This methodology consisted of seeding keratinocytes onto a feeder layer composed of lineage 3T3 murine fibroblasts, the proliferation rate of which is then controlled through the action of ionizing radiation. The presence of the feeder layer encourages the development of keratinocyte colonies and their propagation in similar cultures, becoming possible several clinical applications as skin substitutes or wound dressings in situations such as post burn extensive skin loss and other skin disorders. However, good development of these keratinocytes depends on a high quality feeder layer among other factors. In the present work, we evaluated the relationship between radiation levels and dose rates applied to fibroblasts used in construction of feeder layers and the radiation effect on keratinocytes colonies forming efficiency. Results indicate 3T3 lineage murine fibroblasts irradiated with doses varying between 60 and 100 Gy can be used as a feeder layer immediately after irradiation or storage of the irradiated cells in suspension at 4 g C for 24 hours with similar results. The exception is when the irradiation dose rate is 2.75 Gyh-1; in this case, results suggested that the fibroblasts should be used immediately after irradiation. (author)

  14. Inhibitory Activity of the Flower Buds of Lonicera japonica Thunb. against Histamine Production and L-Histidine Decarboxylase in Human Keratinocytes

    OpenAIRE

    Yoshihiro Inami; Yuko Matsui; Tomoko Hoshino; Chiaki Murayama; Hisayoshi Norimoto

    2014-01-01

    In previous studies we found that anionic surfactants such as sodium laurate (SL) and/or sodium dodecylsulfate (SDS) exert actions on epidermal keratinocytes rather than mast cells to give rise of histamine production and skin itching through increasing the expression of the 53-kDa active form of l-histidine decarboxylase (HDC). In addition, with treatment of SL in a three-dimensional human keratinocyte culture, increases in both the 53-kDa HDC and histamine production are detected and thus t...

  15. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  16. A murine monoclonal antibody (VM-1) against human basal cells inhibits the growth of human keratinocytes in culture.

    Science.gov (United States)

    Oseroff, A R; Pfendt, E A; DiCicco, L; Morhenn, V B

    1985-04-01

    Using epidermal cells from psoriatic plaques as the immunogen, an IgG1 murine monoclonal antibody, VM-1, has been produced which stains basal keratinocytes on frozen sections of skin obtained from normal individuals and from psoriatic plaques. In some areas of both normal and psoriatic epidermis, the cell layer immediately above the basal cells is also stained. Cells in the external root sheath of the hair follicles also bind VM-1. The antibody binding site is trypsin-resistant, and is not blocked by bullous pemphigoid serum. If dispersed epidermal cells are preincubated with VM-1 for 1 h or more before plating, the majority of the cells do not attach and spread out on a collagen-coated Petri dish surface or on a fibroblast feeder layer. When added to attached, preconfluent cultures of keratinocytes, VM-1 inhibits growth and alters cell morphology. The growth inhibition is specific for keratinocytes, and viability studies show that it is not due to an immediate toxic effect of the antibody. The VM-1-induced inhibition of keratinocyte growth is not reversed by soy bean or lima bean trypsin inhibitors added at the time of cell plating or at the time of addition of antibody. PMID:3981036

  17. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yu-Ping Hsiao

    2015-01-01

    Full Text Available Malic acid (MA has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT. The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs. Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR was significantly decreased whereas extracellular acidification rate (ECAR was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways.

  18. Comparative metabolism of benzo[a]pyrene by human keratinocytes infected with high-risk human papillomavirus types 16 and 18 as episomal or integrated genomes

    Directory of Open Access Journals (Sweden)

    Neil Trushin

    2012-01-01

    Full Text Available Background: Infection with human papillomavirus (HPV is a critical factor in the development of cervical cancer. Smoking is an additional risk factor. Tobacco smoke carcinogens, such as benzo[a]pyrene (B[a]P, and their cytochrome P450-related metabolites are present in significantly higher levels in the cervical mucus of women smokers than in nonsmokers. We determined the metabolism and P450 expression of B[a]P-treated human keratinocytes infected with HPV-16 or -18. Materials and Methods: Monolayer cultures of uninfected primary human foreskin keratinocytes, human vaginal and cervical keratinocytes carrying episomal genomes of HPV-16 and -18, respectively, and invasive cervical carcinoma cell lines carrying either HPV-16 or -18 genomes integrated into the host DNA, were incubated with 0.1 μM [3H]B[a]P. The resulting oxidative metabolites were analyzed and quantified by radioflow high-performance liquid chromatography. Additionally, all cell lines were incubated with unlabeled 0.1 μM B[a]P for Western blot analysis of cytochrome P450 1A1 and 1B1. Results: Significant enhancement in levels of both detoxification and activation metabolites was found in incubations with all types of HPV-infected cells compared with control incubations (P < 0.05. The highest capacity to metabolize B[a]P was observed with cells containing integrated HPV-18 genomes. Induction of cytochrome 1B1 was observed in HPV-16 and -18 integrated, and in HPV-16 episomal cell types. Conclusions: Both viral genotype and genomic status in the host cell affect B[a]P metabolism and cytochrome P450 1B1 expression. An increase of DNA-damaging metabolites might result from exposure of HPV-infected women to cigarette smoke carcinogens.

  19. Protective Effect of Garlic on Cellular Senescence in UVB-Exposed HaCaT Human Keratinocytes.

    Science.gov (United States)

    Kim, Hye Kyung

    2016-01-01

    Ultraviolet (UV) irradiation generates reactive oxygen species (ROS) in the cells, which induces the cellular senescence and photoaging. The present study investigated the protective effects of garlic on photo-damage and cellular senescence in UVB-exposed human keratinocytes, HaCaT cells. An in vitro cell free system was used to examine the scavenging activity of 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radicals and nitric oxide (NO). The effect of garlic extract on ROS formation, MMP-1 protein and mRNA expressions, cytokines such as interleukin (IL)-1β and IL-6, senescence associated-β-galactosidase (SA-β-gal) activity, and silent information regulator T1 (SIRT1) activity were determined in UVB-irradiated HaCaT cells. Garlic exhibited strong DPPH radical and NO scavenging activity in cell free system exhibiting IC50 values of 2.50 mg/mL and 4.38 mg/mL, respectively. Garlic pretreatment attenuated the production of UVB-induced intracellular ROS. MMP-1 level, which has been known to be induced by ROS, was dramatically elevated by UVB irradiation, and UVB-induced MMP-1 mRNA and protein expressions were significantly reduced by garlic treatment (50 µg/mL) comparable to those of UV-unexposed control cells. UV-induced pro-inflammatory cytokine productions (IL-6 and IL-1β) were significantly inhibited by pretreatment with garlic in a dose-dependent manner. SA-β-gal activity, a classical biomarker of cellular senescence, and SIRT1 activity, which has attracted attention as an anti-aging factor in recent years, were ameliorated by garlic treatment in UV-irradiated HaCaT cells. The present study provides the first evidence of garlic inhibiting UVB-induced photoaging as a result of augmentation of cellular senescence in HaCaT human keratinocytes. PMID:27483310

  20. NOVEL NON-CALCEMIC SECOSTEROIDS THAT ARE PRODUCED BY HUMAN EPIDERMAL KERATINOCYTES PROTECT AGAINST SOLAR RADIATION

    OpenAIRE

    Slominski, Andrzej T.; Janjetovic, Zorica; Kim, Tae-Kang; Wasilewski, Piotr; Rosas, Sofia; Hanna, Sherie; Sayre, Robert M.; Dowdy, John C.; Li, Wei; Tuckey, Robert C.

    2015-01-01

    CYP11A1 hydroxylates the side chain of vitamin D3 (D3) in a sequential fashion [D3→20S(OH)D3→20,23(OH)2D3→ 17,20,23(OH)3D3], in an alternative to the classical pathway of activation [D3→25(OH)D3→1,25(OH)2D3]. The products/intermediates of the pathway can be further modified by the action of CYP27B1. The CYP11A1-derived products are biologically active with functions determined by the lineage of the target cells. This pathway can operate in epidermal keratinocytes. To further define the role o...

  1. Human T-Lymphotropic virus (HTLV type I in vivo integration in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Martha C Domínguez

    2011-03-01

    Full Text Available Although the infection of HTLV-1 to cell components of the mouth have been previously reported, there was not until this report, a detailed study to show the characteristics of such infection. From 14 Tropical Spastic Paraparesis/ HTLV-1-Associated Myelopathy (HAM/TSP patients and 11 asymptomatic carrier individuals (AC coming from HTLV-1 endemic areas of southwest Pacific of Colombia, infected oral mucosa cells were primary cultured during five days. These cell cultures were immunophenotyped by dual color fluorescence cell assortment using different lymphocyte CD markers and also were immunohistochemically processed using a polyclonal anti-keratin antibody. Five days old primary cultures were characterized as oral keratinocytes, whose phenotype was CD3- /CD4-/CD8-/CD19-/CD14-/CD45-/A575-keratin+. From DNA extracted of primary cultures LTR, pol, env and tax HTLV-1 proviral DNA regions were differentially amplified by PCR showing proviral integration. Using poly A+ RNA obtained of these primary cultures, we amplify by RT-PCR cDNA of tax and pol in 57.14% (8/14 HAM/TSP patients and 27.28% (3/11 AC. Tax and pol poly A+ RNA were expressed only in those sIgA positive subjects. Our results showed that proviral integration and viral gene expression in oral keratinocytes are associated with a HTLV-1 specific local mucosal immune response only in those HTLV-1 infected individuals with detectable levels of sIgA in their oral fluids. Altogether the results gave strong evidence that oral mucosa infection would be parte of the systemic spreading of HTLV-1 infection.

  2. Protective Effects of Minor Components of Curcuminoids on Hydrogen Peroxide-Treated Human HaCaT Keratinocytes.

    Science.gov (United States)

    Liu, Yuh-Hwa; Lin, Yin-Shiou; Huang, Yu-Wei; Fang, Sheng-Uei; Lin, Shyr-Yi; Hou, Wen-Chi

    2016-05-11

    Hydrogen peroxide, one of the reactive oxygen species (ROS), can cause intracellular oxidative stress associated with skin aging and/or photoaging. Curcumin, a polyphenol in turmeric, has been reported to exhibit biological activity. In this study, five naturally occurring curcuminoids [curcumin, demethoxycurcumin (DMC), bisdemethoxycurcumin (BDMC), monohydroxy-DMC, and monohydroxy-BDMC] were used to investigate their protective roles against hydrogen peroxide-induced oxidative stress in the immortalized human keratinocyte cell lines (HaCaT cells). These five curcuminoids at 10 μM, but not at 5 μM, were shown to exhibit cytotoxicities toward HaCaT keratinocytes. Therefore, a 5 μM concentration of the five curcuminoids was selected for further investigations. Cells were pretreated with or without curcuminoids for 2.5 h before 24-h hydrogen peroxide (150 μM) treatments. Pretreatments with the minor components monohydroxy-DMC or monohydroxy-BDMC, but not curcumin, DMC, and BDMC, showed protective activity, elevating cell viability compared to cells with direct hydrogen peroxide treatments. Pretreatments with monohydroxy-DMC and monohydroxy-BDMC showed the best protective effects, reducing apoptotic cell populations and intracellular ROS, as demonstrated by flow cytometry, as well as reducing the changes of the mitochondrial membrane potential compared to cells with direct hydrogen peroxide treatments. The pretreatments with monohydroxy-DMC and monohydroxy-BDMC reduced c-jun and c-fos mRNA expression and p53 tumor suppressor protein expression and increased HO-1 protein expression and glutathione peroxidase (GPx) activity, respectively, compared to cells with direct hydrogen peroxide treatments. The five curcuminoids exhibited similar hydrogen peroxide-scavenging activity in vitro. It was proposed that monohydroxy-DMC and monohydroxy-BDMC could induce antioxidant defense systems better than curcumin, DMC, or BDMC could against hydrogen peroxide-induced oxidative

  3. Increase of lipid fluidity and suppression of proliferation resulting from liposome uptake by human keratinocytes in vitro.

    Science.gov (United States)

    Bonnekoh, B; Röding, J; Krueger, G R; Ghyczy, M; Mahrle, G

    1991-04-01

    The in vitro effects of liposomes on HaCaT human keratinocytes were studied with regard to their uptake, lipid fluidity and proliferation of the cells. Oligolamellar liposomes, prepared from soya bean phospholipids, had a mean size of 150 mm and consisted predominantly of phosphatidylcholine (83%) and phosphatidylethanolamine (10%) and the fatty acids comprised mainly linoleic acid (66%) or other unsaturated fatty acids. After 6 and 24 h of incubation with 1 and 0.1% w/v of liposomal lipids, phase-contrast microscopy revealed marked cytoplasmic vacuolization of the cells. Keratinocytes treated with the liposomes contained aggregations of multilaminated lipid material without delimiting cell membranes. The cellular lipid fluidity (reciprocal of diphenylhexatriene fluorescence polarization P-value) correlated with liposomal concentration and incubation time. A significant elevation of lipid fluidity (P less than 0.05) was observed with 1 and 0.1% liposomes after 1 h of incubation (81.8 +/- 4.7 and 95.7 +/- 1.2% of control P value) and for 0.01% liposomes after 3 h (96.2 +/- 1.5%). Maximum fluidity occurred after 48 h of exposure to 1% liposomes (42.1 +/- 3.1%). Exposure to liposomal lipids for 24 and 48 h resulted in suppressed cell proliferation with 50% inhibition concentrations (IC50), being 0.06% for incorporation of [3H]-thymidine. 0.08% for [14C]-amino-acid incorporation and greater than 1% for protein content per well after 24 h of exposure. The cells were able to proliferate and lipid fluidity returned to normal within 7 days following discontinuation of incubation with liposomal lipids. PMID:2025554

  4. Cox2 and β-Catenin/T-cell Factor Signaling Intestinalize Human Esophageal Keratinocytes When Cultured under Organotypic Conditions

    Directory of Open Access Journals (Sweden)

    Jianping Kong

    2011-09-01

    Full Text Available The incidence of esophageal adenocarcinoma (EAC is rising in the United States. An important risk factor for EAC is the presence of Barrett esophagus (BE. BE is the replacement of normal squamous esophageal epithelium with a specialized columnar epithelium in response to chronic acid and bile reflux. However, the emergence of BE from squamous keratinocytes has not yet been demonstrated. Our research has focused on this. Wnt and cyclooxygenase 2 (Cox2 are two pathways whose activation has been associated with BE and progression to EAC, but their role has not been tested experimentally. To explore their contribution, we engineered a human esophageal keratinocyte cell line to express either a dominant-active Wnt effector CatCLef or a Cox2 complementary DNA. In a two-dimensional culture environment, Cox2 expression increases cell proliferation and migration, but neither transgene induces known BE markers. In contrast, when these cells were placed into three-dimensional organotypic culture conditions, we observed more profound effects. CatCLef-expressing cells were more proliferative, developed a thicker epithelium, and upregulated Notch signaling and several BE markers including NHE2. Cox2 expression also increased cell proliferation and induced a thicker epithelium. More importantly, we observed cysts form within the epithelium, filled with intestinal mucins including Muc5B and Muc17. This suggests that Cox2 expression in a three-dimensional culture environment induces a lineage of mucin-secreting cells and supports an important causal role for Cox2 in BE pathogenesis. We conclude that in vitro modeling of BE pathogenesis can be improved by enhancing Wnt signaling and Cox2 activity and using three-dimensional organotypic culture conditions.

  5. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Lamartine Jérôme

    2009-09-01

    Full Text Available Abstract Background The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knock-down was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test, associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide microarrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation.

  6. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    International Nuclear Information System (INIS)

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGFβ signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  7. GATA3 is a master regulator of the transcriptional response to low-dose ionizing radiation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Bonin, F.; Molina, M.; Berthier-Vergnes, O.; Lamartine, J. [Universite de Lyon, Lyon, F-69003 (France); Universite Lyon 1, Lyon, F-69003 (France); CNRS, UMR5534, Centre de Genetique Moleculaire et Cellulaire, Villeurbanne, F-69622 (France); Malet, C.; Ginestet, C. [Centre Leon Berard, Service de Radiotherapie, Lyon F-69008 (France); Martin, M.T. [Laboratoire de Genomique et Radiobiologie de la Keratinopoiese, CEA, IRCM, Evry F-91000 (France)

    2009-07-01

    Background: The general population is constantly exposed to low levels of radiation through natural, occupational or medical irradiation. Even if the biological effects of low-level radiation have been intensely debated and investigated, the molecular mechanisms underlying the cellular response to low doses remain largely unknown. Results: The present study investigated the role of GATA3 protein in the control of the cellular and molecular response of human keratinocytes exposed to a 1 cGy dose of X-rays. Chromatin immunoprecipitation showed GATA3 to be able to bind the promoter of 4 genes responding to a 1 cGy exposure. To go further into the role of GATA3 after ionizing radiation exposure, we studied the cellular and molecular consequences of radiation in GATA3 knock-down cells. Knockdown was obtained by lentiviral-mediated expression of an shRNA targeting the GATA3 transcript in differentiated keratinocytes. First, radiosensitivity was assessed: the toxicity, in terms of immediate survival (with XTT test), associated with 1 cGy radiation was found to be increased in GATA3 knock-down cells. The impact of GATA3 knock-down on the transcriptome of X-ray irradiated cells was also investigated, using oligonucleotide micro-arrays to assess changes between 3 h and 72 h post-irradiation in normal vs GATA3 knock-down backgrounds; transcriptome response was found to be completely altered in GATA3 knock-down cells, with a strong induction/repression peak 48 h after irradiation. Functional annotation revealed enrichment in genes known to be involved in chaperone activity, TGF{beta} signalling and stress response. Conclusion: Taken together, these data indicate that GATA3 is an important regulator of the cellular and molecular response of epidermal cells to very low doses of radiation. (authors)

  8. Arsenic Transformation Predisposes Human Skin Keratinocytes To UV-induced DNA Damage Yet Enhances Their Survival Apparently by Diminishing Oxidant Response

    OpenAIRE

    Sun, Yang(Department of Physics, Shanghai Jiao Tong University, Shanghai 200240, China); Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark o...

  9. Cis-urocanic acid synergizes with histamine for increased PGE2 production by human keratinocytes: link to indomethacin-inhibitable UVB-induced immunosuppression

    International Nuclear Information System (INIS)

    There is considerable evidence that suppression of the immune system by UVB (280-320 nm UV) irradiation is initiated by UVB-dependent isomerization of a specific skin photoreceptor, urocanic acid (UCA), from the trans to the cis form. Previous studies have confirmed that cis-UCA administration to mice 3-5 days prior to hapten sensitization at a distant site, suppresses the contact hypersensitivity (CHS) response upon challenge. This study demonstrates in mice that cis-UCA, like UVB, suppresses CHS to trinitrochlorobenzene by a mechanism partly dependent on prostanoid production. In vitro experimentation showed that human keratinocytes, isolated from neonatal foreskin, increased prostaglandin E2 (PGE2) production in response to histamine but not UCA alone. However, cis-UCA synergized with histamine for increased PGE2 production by keratinocytes. Cis-urocanic acid also increased the sensitivity of keratinocytes for PGE2 production in response to histamine. Prostaglandin E2 from keratinocytes exposed to cis-UCA and histamine may contribute directly, or indirectly, to the regulation of CHS responses by UVB irradiation. (Author)

  10. Sauchinone, a lignan from Saururus chinensis, protects human skin keratinocytes against ultraviolet B-induced photoaging by regulating the oxidative defense system

    International Nuclear Information System (INIS)

    Ultraviolet (UV) radiation from sunlight induces matrix metalloproteinase (MMP) expression, which are responsible for collagenous extracellular matrix proteins breakdown in skin, causing photoaging. Sauchinone is reported to have various bioactivity such as antioxidative, hepatoprotective, and anti-inflammatory effects. In the present study, we investigated the protective effect of sauchinone against UVB (50 mJ/cm2)-induced photoaging in HaCaT human epidermal keratinocytes. Sauchinone, at 5-40 μM, significantly protected keratinocytes against UVB-induced damage as assessed by cell viability and toxicity assay. Additionally, sauchinone, at 20-40 μM, prevented the upregulation of MMP-1 proteins and reduction of type 1 collagen induced by UVB. Other assays revealed that, in keratinocytes, sauchinone decreased reactive oxygen species (ROS) production and increased glutathione levels and heme oxygenase-1. Sauchinone also inhibited UVB-induced phosphorylation of mitogen-activated protein kinase (MAPK) signaling pathways. These results demonstrated that sauchinone protects skin keratinocytes through inhibition of extracellular signal-regulated kinase, c-Jun N-terminal kinase, and p38 MAPK signaling via upregulation of oxidative defense enzymes. (author)

  11. Biological activity of all-trans retinol requires metabolic conversion to all-trans retinoic acid and is mediated through activation of nuclear retinoid receptors in human keratinocytes.

    Science.gov (United States)

    Kurlandsky, S B; Xiao, J H; Duell, E A; Voorhees, J J; Fisher, G J

    1994-12-30

    The biological activity of all-trans retinol, in human keratinocytes, was investigated through metabolic and functional analyses that assessed the capacity for retinol uptake and metabolism and the mechanism of retinol-induced activation of gene transcription. Human keratinocytes converted all-trans retinol predominantly to retinyl esters, which accounted for 60 and 90% of cell-associated radiolabel after a 90-min pulse and a 48-h chase, respectively. Human keratinocytes also metabolized all-trans retinol to low levels of all-trans retinoic acid (11.47-131.3 ng/mg of protein) in a dose-dependent manner, between 0.3 and 10 microM added retinol. Small amounts of 13-cis retinoic acid (5.47-8.62 ng/mg of protein) were detected, but 9-cis retinoic acid was detected only when keratinocytes were incubated with radiolabeled retinol. There was no accumulation of the oxidized catabolic metabolites 4-hydroxy- or 4-oxoretinoic acid; however, 5,6-epoxy retinoic acid was detected at pharmacological levels (10 and 30 microM) of added retinol. Biological activity of retinol was assessed through analysis of two known retinoic acid-mediated responses: 1) reduction of type I epidermal transglutaminase and 2) activation of a retinoic acid receptor-dependent reporter gene, beta RARE3-tk-CAT. Both all-trans retinol and all-trans retinoic acid reduced type I epidermal transglutaminase in a dose-dependent manner; however, the ED50 for all-trans retinol (10 nM) was 10 times greater than for all-trans retinoic acid (1 nM). All-trans retinol also stimulated beta RARE3-tk-CAT reporter gene activity in a dose-dependent manner. Half-maximal induction was observed at 30 nM retinol, which was again 10-fold greater than observed with all-trans retinoic acid. Cotransfection of human keratinocytes with expression vectors for dominant negative mutant retinoic acid and retinoid X receptors reduced retinol-induced beta RARE3-tk-CAT reporter gene activation by 80%. Inhibition of conversion of all

  12. Effects of tiflucarbine as a dual protein kinase C/calmodulin antagonist on proliferation of human keratinocytes and release of reactive oxygen species from human leukocytes.

    Science.gov (United States)

    Hegemann, L; Fruchtmann, R; Bonnekoh, B; Schmidt, B H; Traber, J; Mahrle, G; Müller-Peddinghaus, R; van Rooijen, L A

    1991-01-01

    Various studies have suggested that calmodulin (CaM) is involved in the pathophysiology of psoriasis. Protein kinase C (PKC) is also accepted as playing a regulatory role in cell proliferation as well as in inflammatory processes. Therefore, we investigated the effects of the known CaM antagonist tiflucarbine (BAY/TVX P 4495) on two cellular systems related to the major clinical symptoms of psoriasis: proliferation of cultured human keratinocytes (HaCa T cell line) and release of reactive oxygen species (ROS) from human polymorphonuclear leukocytes (PMNL). Tiflucarbine inhibited both cellular responses in a dose dependent manner. Furthermore, tiflucarbine directly affected PKC, and may thus be considered to be a dual PKC/CaM antagonist with putative antipsoriatic activity. The effects of tiflucarbine on the different parameters were compared with those of the structurally unrelated dual PKC/CaM inhibitor W-7 and those of the potent PKC inhibitor staurosporine. The potencies of all three compounds were found to be in the same range as their PKC-inhibiting potency. Our data indicate that PKC, rather than CaM, may play a regulatory role in the release of ROS as well as in keratinocyte proliferation. Therefore, inhibition of PKC in general might have a therapeutic benefit in psoriasis. PMID:1801655

  13. Human keratinocytes are a source for tumor necrosis factor alpha: Evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light

    International Nuclear Information System (INIS)

    Tumor necrosis factor alpha (TNF-alpha), in addition to being cytotoxic for certain tumor cells, has turned out as a multifunctional cytokine that is involved in the regulation of immunity and inflammation. Since human keratinocytes have been demonstrated to be a potent source of various cytokines, it was investigated whether epidermal cells synthesize and release TNF-alpha. Supernatants derived from normal human keratinocytes (HNK) and human epidermoid carcinoma cell lines (KB, A431) were tested both in a TNF-alpha-specific ELISA and a bioassay. In supernatants of untreated epidermal cells, no or minimal TNF-alpha activity was found, while after stimulation with lipopolysaccharide (LPS) or ultraviolet (UV) light, significant amounts were detected. Western blot analysis using an antibody directed against human TNF-alpha revealed a molecular mass of 17 kD for keratinocyte-derived TNF-alpha. These biological and biochemical data were also confirmed by Northern blot analysis revealing mRNA specific for TNF-alpha in LPS- or ultraviolet B (UVB)-treated HNK and KB cells. In addition, increased TNF-alpha levels were detected in the serum obtained from human volunteers 12 and 24 h after a single total body UVB exposure, which caused a severe sunburn reaction. These findings indicate that keratinocytes upon stimulation are able to synthesize and release TNF-alpha, which may gain access to the circulation. Thus, TNF-alpha in concert with other epidermal cell-derived cytokines may mediate local and systemic inflammatory reactions during host defense against injurious events caused by microbial agents or UV irradiation

  14. Gene expression studies on human keratinocytes transduced with human growth hormone gene for a possible utilization in gene therapy; Estudos da expressao genica mediante utilizacao de queratinocitos humanos normais transduzidos com o gene do hormonio de crscimento humano. Possivel utilizacao em terapia genica

    Energy Technology Data Exchange (ETDEWEB)

    Mathor, Monica Beatriz

    1994-12-31

    Taking advantage of the recent progress in the DNA-recombinant techniques and of the potentiality of normal human keratinocytes primary culture to reconstitute the epidermis, it was decided to genetically transform these keratinocytes to produce human growth hormone under controllable conditions that would be used in gene therapy at this hormone deficient patients. The first step to achieve this goal was to standardize infection of keratinocytes with retrovirus producer cells containing a construct which included the gene of bacterial b-galactosidase. The best result was obtained cultivating the keratinocytes for 3 days in a 2:1 mixture of retrovirus producer cells and 3T3-J2 fibroblasts irradiated with 60 Gy, and splitting these infected keratinocytes on 3T3-J2 fibroblasts feeder layer. Another preliminary experiment was to infect normal human keratinocytes with interleukin-6 gene (hIL-6) that, in pathologic conditions, could be reproduced by keratinocytes and secreted to the blood stream. Thus, we verify that infected keratinocytes secrete an average amount of 500 ng/10{sup 6} cell/day of cytokin during the in vitro life time, that certify the stable character of the injection. These keratinocytes, when grafted in mice, secrete hIL-6 to the blood stream reaching levels of 40 pg/ml of serum. After these preliminary experiments, we construct a retroviral vector with the human growth hormone gene (h GH) driven by human metallothionein promoter (h PMT), designated DChPMTGH. Normal human keratinocytes were infected with DChPMTGH producer cells, following previously standardized protocol, obtaining infected keratinocytes secreting to the culture media 340 ng h GH/10{sup 6} cell/day without promoter activation. This is the highest level of h GH secreted in human keratinocytes primary culture described in literature. The h GH value increases approximately 10 times after activation with 100 {mu}M Zn{sup +2} for 8-12 hours. (author). 158 refs., 42 figs., 6 tabs.

  15. 乙酰胆碱对人表皮细胞冷存的影响%The Effect of Acetylcholine (Ach) on Preservation of Human Keratinocytes

    Institute of Scientific and Technical Information of China (English)

    张云涛; 霍孟华; 傅洪滨

    2001-01-01

    Objective: To investigate the effect of acetylcholine (Ach) on the preservation of human keratinocytes. Method: Use tissue engineering technology to separate and culture human keratinocyte in vitro and observe them using MTT method and histological and electron microscopic methods. Result: Different concentration of Ach can preserve more viability of human keratinocytes. The best concentration is 10- 8 to 10- 10 mol/L. Conclusion: Ach can preserve more viability of human kerationcytes during preservation.%目的:探讨乙酰胆碱(Ach)对人表皮细胞冷存活力的影响。方法:应用人表皮细胞的分离、培养技术,并进行MTT检测、病理切片以及电镜检测等手段进行观察。结果:不同浓度的Ach对冷存的表皮细胞均有一定的保存活力作用,其中以10-8~10-10mol/L的浓度为最佳。结论:认为Ach对冷存中的人表皮细胞有一定的保护作用,它可提高表皮细胞的保存活力。

  16. X-ray microanalysis of cultured keratinocytes: methodological aspects and effects of the irritant sodium lauryl sulphate on elemental composition.

    Science.gov (United States)

    Grängsjö, A; Pihl-Lundin, I; Lindberg, M; Roomans, G M

    2000-09-01

    Irritant substances have been shown to induce elemental changes in human and animal epidermal cells in situ. However, skin biopsies are a complicated experimental system and artefacts can be introduced by the anaesthesia necessary to take the biopsy. We therefore attempted to set up an experimental system for X-ray microanalysis (XRMA) consisting of cultured human keratinocytes. A number of methodological aspects were studied: different cell types, washing methods and different culture periods for the keratinocytes. It was also investigated whether the keratinocytes responded to exposure to sodium lauryl sulphate (SLS) with changes in their elemental composition. The concentrations of biologically important elements such as Na, Mg, P and K were different in HaCaT cells (a spontaneously immortalized non-tumorigenic cell line derived from adult human keratinocytes) compared to natural human epidermal keratinocytes. The washing procedure and time of culture influenced the intracellular elemental content, and rinsing with distilled water was preferred for further experiments. Changes in the elemental content in the HaCaT cells compatible with a pattern of cell injury followed by repair by cell proliferation were seen after treatment with 3.33 microM and 33 microM SLS. We conclude that XRMA is a useful tool for the study of functional changes in cultured keratinocytes, even though the preparation methods have to be strictly controlled. The method can conceivably be used for predicting effects of different chemicals on human skin. PMID:10971801

  17. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.

    Science.gov (United States)

    Ali, F; Khan, A Q; Khan, R; Sultana, S

    2016-02-01

    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar. PMID:25855085

  18. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    Science.gov (United States)

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26691653

  19. Treatment of burn injuries with keratinocyte cultures

    International Nuclear Information System (INIS)

    The German Institute for Cell and Tissue Replacement (DIZG) provides burned patients with skin and amnion for a temporary wound closure. Severely burned patients (>60% BSA for adults, >40% BSA for children) were supplied with autologous and allogenic grafts from cultured keratinocytes. The keratinocyte culture is done under GMP-conditions using the method of Rheinwald and Green. The 3T3 fibroblasts were irradiated with 60 Gy and used as feeder cells to produce keratinocyte sheets within 3 weeks. In this time up to 6.000 cm are available. The sheets were harvested by detachment with dispase (1,2 U/ml), fixed to gauze and transported to the hospital. The DIZG has a 3 years experience in the treatment of burns with keratinocyte sheets. The sheets were transplanted to patients in different hospitals, the total transplanted area is about 30.000 cm. This paper describes the experiences with ten severely burned patients treated with keratinocyte sheet

  20. Zinc deficiency or excess within the physiological range increases genome instability and cytotoxicity, respectively, in human oral keratinocyte cells.

    Science.gov (United States)

    Sharif, Razinah; Thomas, Philip; Zalewski, Peter; Fenech, Michael

    2012-04-01

    Zinc (Zn) is an essential component of Zn-finger proteins and acts as a cofactor for enzymes required for cellular metabolism and in the maintenance of DNA integrity. The study investigated the genotoxic and cytotoxic effects of Zn deficiency or excess in a primary human oral keratinocyte cell line and determined the optimal concentration of two Zn compounds (Zn Sulphate (ZnSO(4)) and Zn Carnosine (ZnC)) to minimise DNA damage. Zn-deficient medium (0 μM) was produced using Chelex treatment, and the two Zn compounds ZnSO(4) and ZnC were tested at concentrations of 0.0, 0.4, 4.0, 16.0, 32.0 and 100.0 μM. Cell viability was decreased in Zn-depleted cells (0 μM) as well as at 32 μM and 100 μM for both Zn compounds (P < 0.0001) as measured via the MTT assay. DNA strand breaks, as measured by the comet assay, were found to be increased in Zn-depleted cells compared with the other treatment groups (P < 0.05). The Cytokinesis Block Micronucleus Cytome assay showed a significant increase in the frequency of both apoptotic and necrotic cells under Zn-deficient conditions (P < 0.05). Furthermore, elevated frequencies of micronuclei (MNi), nucleoplasmic bridges (NPBs) and nuclear buds (NBuds) were observed at 0 and 0.4 μM Zn, whereas these biomarkers were minimised for both Zn compounds at 4 and 16 μM Zn (P < 0.05), suggesting these concentrations are optimal to maintain genome stability. Expression of PARP, p53 and OGG1 measured by western blotting was increased in Zn-depleted cells indicating that DNA repair mechanisms are activated. These results suggest that maintaining Zn concentrations within the range of 4-16 μM is essential for DNA damage prevention in cultured human oral keratinocytes. PMID:21935692

  1. Effects of an aqueous extract from the leaves of Chromolaena odorata (Eupolin) on the proliferation of human keratinocytes and on their migration in an in vitro model of reepithelialization.

    Science.gov (United States)

    Phan, T T; Hughes, M A; Cherry, G W

    2001-01-01

    Eupolin ointment, prepared from the leaves of Chromolaena odorata, has been shown to promote the healing of soft tissue wounds and burns in Vietnam. However, the mechanism by which this agent affects cells involved in the wound healing process is unknown. Cultured human keratinocytes were used in this study to investigate the effects of the Eupolin extract in vitro on processes involved in wound reepithelialization. Keratinocyte proliferation was monitored by a colorimetric assay and migration by the closure of a denuded area scratched in a confluent monolayer. Human keratinocyte proliferation was stimulated by low concentrations of the extract (from 0.1 to 5 microg/ml), cell differentiation by higher concentrations (50 to 300 microg/ml), and migration by intermediate concentrations (5 to 60 microg/ml). The increased proliferation and migration of human keratinocytes observed in vitro might explain, in part, the beneficial effects that have been observed in the clinic. PMID:11679139

  2. A Novel Role of the NRF2 Transcription Factor in the Regulation of Arsenite-Mediated Keratin 16 Gene Expression in Human Keratinocytes

    OpenAIRE

    Endo, Hitoshi; Sugioka, Yoshihiko; Nakagi, Yoshihiko; Saijo, Yasuaki; Yoshida, Takahiko

    2008-01-01

    Background Inorganic sodium arsenite (iAs) is a ubiquitous environmental contaminant and is associated with an increased risk of skin hyperkeratosis and cancer. Objectives We investigated the molecular mechanisms underlying the regulation of the keratin 16 (K16) gene by iAs in the human keratinocyte cell line HaCaT. Methods We performed reverse transcriptase polymerase chain reaction, luciferase assays, Western blots, and electrophoretic mobility shift assays to determine the transcriptional ...

  3. Assessment of the potential skin irritation of lysine-derivative anionic surfactants using mouse fibroblast and human keratinocytes as an alternative to animal testing

    OpenAIRE

    Sánchez Molina, Lourdes; Mitjans Arnal, Montserrat; Infante Martínez-Pardo, Ma. Rosa; Vinardell Martínez-Hidalgo, Ma. Pilar

    2004-01-01

    Purpose. The aim of this study was to identify new surfactants with low skin irritant properties for use in pharmaceutical and cosmetic formulations, employing cell culture as an alternative method to in vivo testing. In addition, we sought to establish whether potential cytotoxic properties were related to the size of the counterions bound to the surfactants. Methods. Cytotoxicity was assessed in the mouse fibroblast cell line 3T6, and the human keratinocyte cell line NCTC 2544, using the MT...

  4. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    OpenAIRE

    Nattaporn Pattarachotanant; Varaporn Rakkhitawatthana; Tewin Tencomnao

    2014-01-01

    Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17), was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K1...

  5. Suppression of keratinocyte differentiation in SCC-9 human squamous carcinoma cells by benzo(a)pyrene, 12-O-tetradecanoylphorbol-13-acetate and hydroxyurea

    OpenAIRE

    Rice, RH; Rong, X.

    1988-01-01

    In the human squamous carcinoma cell line SCC-9, the expression of two markers of keratinocyte differentiation, involucrin and transglutaminase, was greatly stimulated when growing cultures reached confluence. However, the two markers differed temporally in their induction, with transglutaminase reaching maximal levels shortly after confluence and involucrin a week later. If replication was arrested with hydroxyurea prior to confluence, transglutaminase induction occurred within several days ...

  6. Role of taurine accumulation in keratinocyte hydration.

    Science.gov (United States)

    Janeke, Guido; Siefken, Wilfried; Carstensen, Stefanie; Springmann, Gunja; Bleck, Oliver; Steinhart, Hans; Höger, Peter; Wittern, Klaus-Peter; Wenck, Horst; Stäb, Franz; Sauermann, Gerhard; Schreiner, Volker; Doering, Thomas

    2003-08-01

    Epidermal keratinocytes are exposed to a low water concentration at the stratum corneum-stratum granulosum interface. When epithelial tissues are osmotically perturbed, cellular protection and cell volume regulation is mediated by accumulation of organic osmolytes such as taurine. Previous studies reported the presence of taurine in the epidermis of several animal species. Therefore, we analyzed human skin for the presence of the taurine transporter (TAUT) and studied the accumulation of taurine as one potential mechanism protecting epidermal keratinocytes from dehydration. According to our results, TAUT is expressed as a 69 kDa protein in human epidermis but not in the dermis. For the epidermis a gradient was evident with maximal levels of TAUT in the outermost granular keratinocyte layer and lower levels in the stratum spinosum. No TAUT was found in the basal layer or in the stratum corneum. Keratinocyte accumulation of taurine was induced by experimental induction of skin dryness via application of silica gel to human skin. Cultured human keratinocytes accumulated taurine in a concentration- and osmolarity-dependent manner. TAUT mRNA levels were increased after exposure of human keratinocytes to hyperosmotic culture medium, indicating osmosensitive TAUT mRNA expression as part of the adaptation of keratinocytes to hyperosmotic stress. Keratinocyte uptake of taurine was inhibited by beta-alanine but not by other osmolytes such as betaine, inositol, or sorbitol. Accumulation of taurine protected cultured human keratinocytes from both osmotically induced and ultraviolet-induced apoptosis. Our data indicate that taurine is an important epidermal osmolyte required to maintain keratinocyte hydration in a dry environment. PMID:12880428

  7. Extinction of the HPV18 upstream regulatory region in cervical carcinoma cells after fusion with non-tumorigenic human keratinocytes under non-selective conditions.

    Science.gov (United States)

    Rösl, F; Achtstätter, T; Bauknecht, T; Hutter, K J; Futterman, G; zur Hausen, H

    1991-01-01

    'Universal fuser' clones of a human papillomavirus type 16 positive cervical carcinoma cell line (SiHa) were established to study the effect of a non-tumorigenic fusion partner on the regulation of a stably integrated chloramphenicol acetyltransferase (CAT) gene controlled by the HPV18 upstream regulatory region under non-selective conditions. The CAT expressing cells were fused with both non-tumorigenic, spontaneously immortalized human keratinocytes (HaCaT) and non-modified SiHa cells. The resulting hybrids were characterized by restriction enzyme fragment length polymorphism analysis and flow cytometry. While the non-selectable, HPV18-driven indicator gene is constitutively expressed in SiHa cells, the CAT activity is extinguished in SiHa x HaCaT cells, but still present in SiHa x SiHa hybrids. Examination of the cytokeratin expression pattern reveals that the keratinocyte phenotype seems not only to be dominant in terms of the extinction of the HPV18 regulatory region but also by the conservation of most of the differentiation markers of the non-tumorigenic fusion partner. Cycloheximide treatment and intracellular competition experiments using the transient COS7 fusion-amplification technique are accompanied by the reactivation of the marker gene in previously CAT- SiHa x HaCaT hybrids. These data strongly suggest that trans-acting negative regulatory factors derived from the non-malignant human keratinocytes are responsible for the extinction phenomenon. Images PMID:1709093

  8. The comparison of two methods to obtain human oral keratinocytes in primary culture; Comparacao de dois metodos de obtencao celular para cultura primaria de queratinocitos bucais humanos

    Energy Technology Data Exchange (ETDEWEB)

    Klingbeil, Maria Fatima Guarizo

    2006-07-01

    The therapeutic procedures frequently used in oral treatments for the pathological diseases are surgical, resulting in failures of the mucosal continuity.The possibility to obtain transplantable oral epithelia from an in vitro cell culture opens new utilization perspectives not only to where it comes from, but also as a reconstructive material for other parts of the human body, such as: urethra, epithelia corneo-limbal, cornea, ocular surface. Many researchers still use controversial methods for obtaining cells. It was therefore evaluated and compared the efficiency in both methods: enzymatic and direct explant to obtain oral keratinocytes from human oral mucosa. Fragments of intra oral epithelial tissues from healthy human subjects, undergoing dental surgeries, were donated to the research project. The keratinocytes were cultivated over a feeder-layer from a previously irradiated 3T3 Swiss albino fibroblasts. In this study it was compared the time needed in the cell obtention, the best cell amount between both methods, the life-span, the cell capacity to form an in vitro epithelia and its morphologic structure. The results in the assessment of both methods have shown the possibility to obtain keratinocytes from a small oral fragment, but at the same time we may verify the advantages and peculiar restrictions for each one of both analyzed methods. (author)

  9. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    Energy Technology Data Exchange (ETDEWEB)

    Khadjavi, Amina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Magnetto, Chiara [Istituto Nazionale di Ricerca Metrologica (INRIM), Torino (Italy); Panariti, Alice [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Argenziano, Monica [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Gulino, Giulia Rossana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Rivolta, Ilaria [Dipartimento di Scienze della Salute, Università di Milano Bicocca, Monza (Italy); Cavalli, Roberta [Dipartimento di Scienza e Tecnologia del Farmaco, Università di Torino, Torino (Italy); Giribaldi, Giuliana [Dipartimento di Oncologia, Università di Torino, Torino (Italy); Guiot, Caterina [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Prato, Mauro, E-mail: mauro.prato@unito.it [Dipartimento di Neuroscienze, Università di Torino, Torino (Italy); Dipartimento di Scienze della Sanità Pubblica e Pediatriche, Università di Torino, Torino (Italy)

    2015-08-01

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  10. Chitosan-shelled oxygen-loaded nanodroplets abrogate hypoxia dysregulation of human keratinocyte gelatinases and inhibitors: New insights for chronic wound healing

    International Nuclear Information System (INIS)

    Background: : In chronic wounds, efficient epithelial tissue repair is hampered by hypoxia, and balances between the molecules involved in matrix turn-over such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) are seriously impaired. Intriguingly, new oxygenating nanocarriers such as 2H,3H-decafluoropentane-based oxygen-loaded nanodroplets (OLNs) might effectively target chronic wounds. Objective: : To investigate hypoxia and chitosan-shelled OLN effects on MMP/TIMP production by human keratinocytes. Methods: : HaCaT cells were treated for 24 h with 10% v/v OLNs both in normoxia or hypoxia. Cytotoxicity and cell viability were measured through biochemical assays; cellular uptake by confocal microscopy; and MMP and TIMP production by enzyme-linked immunosorbent assay or gelatin zymography. Results: : Normoxic HaCaT cells constitutively released MMP-2, MMP-9, TIMP-1 and TIMP-2. Hypoxia strongly impaired MMP/TIMP balances by reducing MMP-2, MMP-9, and TIMP-2, without affecting TIMP-1 release. After cellular uptake by keratinocytes, nontoxic OLNs abrogated all hypoxia effects on MMP/TIMP secretion, restoring physiological balances. OLN abilities were specifically dependent on time-sustained oxygen diffusion from OLN core. Conclusion: : Chitosan-shelled OLNs effectively counteract hypoxia-dependent dysregulation of MMP/TIMP balances in human keratinocytes. Therefore, topical administration of exogenous oxygen, properly encapsulated in nanodroplet formulations, might be a promising adjuvant approach to promote healing processes in hypoxic wounds. - Highlights: • Hypoxia impairs MMP9/TIMP1 and MMP2/TIMP2 balances in HaCaT human keratinocytes. • Chitosan-shelled oxygen-loaded nanodroplets (OLNs) are internalised by HaCaT cells. • OLNs are not toxic to HaCaT cells. • OLNs effectively counteract hypoxia effects on MMP/TIMP balances in HaCaT cells. • OLNs appear as promising and cost-effective therapeutic tools for hypoxic

  11. Proteomic assessment of sulfur mustard-induced protein adducts and other protein modifications in human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Although some toxicological mechanisms of sulfur mustard (HD) have been uncovered, new knowledge will allow for advanced insight in the pathways that lead towards epidermal-dermal separation in skin. In the present investigation, we aimed to survey events that occur at the protein level in human epidermal keratinocytes (HEK) during 24 h after exposure to HD. By using radiolabeled 14C-HD, it was found that proteins in cultured HEK are significant targets for alkylation by HD. HD-adducted proteins were visualized by two-dimensional gel electrophoresis and analyzed by mass spectrometry. Several type I and II cytokeratins, actin, stratifin (14-3-3σ) and galectin-7 were identified. These proteins are involved in the maintenance of the cellular cytoskeleton. Their alkylation may cause changes in the cellular architecture and, in direct line with that, be determinative for the onset of vesication. Furthermore, differential proteomic analysis was applied to search for novel features of the cellular response to HD. Partial breakdown of type I cytokeratins K14, K16 and K17 as well as the emergence of new charge variants of the proteins heat shock protein 27 and ribosomal protein P0 were observed. Studies with caspase inhibitors showed that caspase-6 is probably responsible for the breakdown of type I cytokeratins in HEK. The significance of the results is discussed in terms of toxicological relevance and possible clues for therapeutic intervention

  12. Dissecting the calcium-induced differentiation of human primary keratinocytes stem cells by integrative and structural network analyses.

    Directory of Open Access Journals (Sweden)

    Kiana Toufighi

    2015-05-01

    Full Text Available The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55% are composed of non-dynamic and dynamic gene products ('di-chromatic', 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation.

  13. Dissecting the Calcium-Induced Differentiation of Human Primary Keratinocytes Stem Cells by Integrative and Structural Network Analyses

    Science.gov (United States)

    Toufighi, Kiana; Yang, Jae-Seong; Luis, Nuno Miguel; Aznar Benitah, Salvador; Lehner, Ben; Serrano, Luis; Kiel, Christina

    2015-01-01

    The molecular details underlying the time-dependent assembly of protein complexes in cellular networks, such as those that occur during differentiation, are largely unexplored. Focusing on the calcium-induced differentiation of primary human keratinocytes as a model system for a major cellular reorganization process, we look at the expression of genes whose products are involved in manually-annotated protein complexes. Clustering analyses revealed only moderate co-expression of functionally related proteins during differentiation. However, when we looked at protein complexes, we found that the majority (55%) are composed of non-dynamic and dynamic gene products (‘di-chromatic’), 19% are non-dynamic, and 26% only dynamic. Considering three-dimensional protein structures to predict steric interactions, we found that proteins encoded by dynamic genes frequently interact with a common non-dynamic protein in a mutually exclusive fashion. This suggests that during differentiation, complex assemblies may also change through variation in the abundance of proteins that compete for binding to common proteins as found in some cases for paralogous proteins. Considering the example of the TNF-α/NFκB signaling complex, we suggest that the same core complex can guide signals into diverse context-specific outputs by addition of time specific expressed subunits, while keeping other cellular functions constant. Thus, our analysis provides evidence that complex assembly with stable core components and competition could contribute to cell differentiation. PMID:25946651

  14. Up-regulation of keratin 17 expression in human HaCaT keratinocytes by interferon-gamma.

    Science.gov (United States)

    Bonnekoh, B; Huerkamp, C; Wevers, A; Geisel, J; Sebök, B; Bange, F C; Greenhalgh, D A; Böttger, E C; Krieg, T; Mahrle, G

    1995-01-01

    The immortalized human keratinocyte cell line HaCaT was used to assess the effect of interferon-gamma (IFN-gamma) on expression of keratin K17. Both IFN-gamma and K17 have been implicated in the pathophysiology of psoriasis. Western and quantitative enzyme-linked immunosorbent assay analyses demonstrated increasing induction of K17 protein by 48 h exposure to IFN-gamma at concentrations of 10, 50, and 250 U/ml. At 50 U/ml IFN-gamma, immunohistochemical analysis revealed numerous K17-positive foci, whereas in situ hybridization demonstrated K17 message in the majority of cells. In addition, at low (5 U/ml) concentrations of IFN-gamma, cell proliferation and protein synthesis decreased, as determined by 3H-thymidine labeling and 14C-amino acid uptake. These data suggest that aberrant K17 expression observed in psoriatic lesions may be a consequence of IFN-gamma overexpression, and that the HaCaT cell line may be a useful in vitro model system to elucidate the underlying mechanisms. PMID:7528246

  15. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells

    International Nuclear Information System (INIS)

    Eicosapentaenoic acid (EPA) is an omega-3 (ω-3) polyunsaturated fatty acid (PUFA), which has anti-inflammatory and anti-cancer properties. Some reports have demonstrated that EPA inhibits NF-κB activation induced by tumor necrosis factor (TNF)-α or lipopolysaccharide (LPS) in various cells. However, its detailed mode of action is unclear. In this report, we investigated whether EPA inhibits the expression of TNF-α-induced matrix metalloproteinases (MMP)-9 in human immortalized keratinocytes (HaCaT). TNF-α induced MMP-9 expression by NF-κB-dependent pathway. Pretreatment of EPA inhibited TNF-α-induced MMP-9 expression and p65 phosphorylation. However, EPA could not affect IκB-α phosphorylation, nuclear translocation of p65, and DNA binding activity of NF-κB. EPA inhibited TNF-α-induced p65 phosphorylation through p38 and Akt inhibition and this inhibition was IKKα-dependent event. Taken together, we demonstrate that EPA inhibits TNF-α-induced MMP-9 expression through inhibition of p38 and Akt activation

  16. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an invivo model

    International Nuclear Information System (INIS)

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 μg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs.

  17. Central role of mitochondria and p53 in PUVA-induced apoptosis in human keratinocytes cell line NCTC-2544

    International Nuclear Information System (INIS)

    Despite strong evidence concerning the high efficiency of PUVA therapy (psoralen plus UVA light), its mechanism of action has not yet been fully elucidated. In this study, we have evaluated in a cell line of human keratinocytes (NCTC-2544) the effects of two linear psoralen derivatives, 8-methoxypsoralen (8-MOP) and 5-methoxypsoralen (5-MOP), that are widely used in PUVA therapy and two angular derivatives, Angelicin (ANG) and 4,6,4'-trymetyl angelicin (TMA). All derivatives photoinduce cellular death, TMA being the most active compound. The cell cycle analysis showed that the four derivatives induce, 24 h after irradiation, a cell cycle arrest in G1 phase later followed by massive apoptosis. The G1 arrest is correlated to an increase in the expression of p21Waf1/Cip1, a protein associated with the cell cycle block and apoptosis. Furthermore, treatment of NCTC-2544 resulted in p53 activation by 5-MOP, 8-MOP, and ANG but not TMA and its phosphorylation at serine-15. The levels of p21Waf1/Cip1 paralleled p53 protein staining pattern suggesting that p53 activation correlated with p21Waf1/Cip1 induction. Simultaneous to p53 activation, psoralens induced mitochondrial depolarization, cytochrome c release, mitochondrial production of reactive oxygen species, as well as caspase-3 and -9 activation. Thus these results strongly indicate the necessity of p53 activation and the induction of the apoptotic machinery downstream of mitochondria

  18. Assessment of dermal toxicity of nanosilica using cultured keratinocytes, a human skin equivalent model and an in vivo model.

    Science.gov (United States)

    Park, Yoon-Hee; Kim, Ji Na; Jeong, Sang Hoon; Choi, Jae Eun; Lee, Seung-Ho; Choi, Byeong Hyeok; Lee, Jung Pyo; Sohn, Kyung Hee; Park, Kui Lea; Kim, Meyoung-Kon; Son, Sang Wook

    2010-01-12

    Assessments of skin irritation potentials are important aspects of the development of nanotechnology. Nanosilica is currently being widely used for commercial purposes, but little literature is available on its skin toxicity and irritation potential. This study was designed to determine whether nanosilica has the potential to cause acute cutaneous toxicity, using cultured HaCaT keratinocytes (CHK), a human skin equivalent model (HSEM), and invivo model. Nanosilica was characterized by scanning electron microscopy. We evaluated the cytotoxic effects of nanosilica on CHKs and the HSEM. In addition, we also investigated whether two commercially available nanosilicas with different sizes (7 and 10-20 nm) have different effects. To confirm invitro results, we evaluated the irritation potentials of nanosilicas on rabbit skin. Nanosilicas reduced the cell viabilities of CHKs in a dose-dependent manner. However, the HSEM revealed no irritation at 500 microg/ml of nanosilica. Furthermore, this result concurred with Draize skin irritation test findings. The present study data indicate that nanosilica does not cause acute cutaneous irritation. Furthermore, this study shows that the HSEM used provides more useful screening data than the conventional cell culture model on the relative toxicities of NPs. PMID:19850098

  19. Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-{beta} signaling

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Reuben H., E-mail: rkim@dentistry.ucla.edu [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Lieberman, Mark B.; Lee, Rachel [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Shin, Ki-Hyuk [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); Mehrazarin, Shebli; Oh, Ju-Eun [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); Park, No-Hee [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States); David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Kang, Mo K., E-mail: mkang@dentistry.ucla.edu [UCLA School of Dentistry, Los Angeles, CA 90095 (United States); UCLA Dental Research Institute, Los Angeles, CA 90095 (United States); UCLA Jonsson Comprehensive Cancer Center, Los Angeles, CA 90095 (United States)

    2010-10-01

    We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-{beta} signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-{beta} signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-{beta}1 levels, phosphorylation of Smad2/3, and increased expression of p15{sup INK4B} and p57{sup KIP2}. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-{beta}1 induced dephosphorylation of Smad2/3, and diminished the level of p15{sup INK4B} and p57{sup KIP2}. Moreover, Bmi-1 expression led to the inhibition of TGF-{beta}-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15{sup INK4B}, and p57{sup KIP2}. In addition, an exposure of senescent NHOK to TGF-{beta} receptor I kinase inhibitor or anti-TGF-{beta} antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-{beta} signaling pathway in NHOK.

  20. Bmi-1 extends the life span of normal human oral keratinocytes by inhibiting the TGF-β signaling

    International Nuclear Information System (INIS)

    We previously demonstrated that Bmi-1 extended the in vitro life span of normal human oral keratinocytes (NHOK). We now report that the prolonged life span of NHOK by Bmi-1 is, in part, due to inhibition of the TGF-β signaling pathway. Serial subculture of NHOK resulted in replicative senescence and terminal differentiation and activation of TGF-β signaling pathway. This was accompanied with enhanced intracellular and secreted TGF-β1 levels, phosphorylation of Smad2/3, and increased expression of p15INK4B and p57KIP2. An ectopic expression of Bmi-1 in NHOK (HOK/Bmi-1) decreased the level of intracellular and secreted TGF-β1 induced dephosphorylation of Smad2/3, and diminished the level of p15INK4B and p57KIP2. Moreover, Bmi-1 expression led to the inhibition of TGF-β-responsive promoter activity in a dose-specific manner. Knockdown of Bmi-1 in rapidly proliferating HOK/Bmi-1 and cancer cells increased the level of phosphorylated Smad2/3, p15INK4B, and p57KIP2. In addition, an exposure of senescent NHOK to TGF-β receptor I kinase inhibitor or anti-TGF-β antibody resulted in enhanced replicative potential of cells. Taken together, these data suggest that Bmi-1 suppresses senescence of cells by inhibiting the TGF-β signaling pathway in NHOK.

  1. Sonoporation delivery of monoclonal antibodies against human papillomavirus 16 E6 restores p53 expression in transformed cervical keratinocytes.

    Directory of Open Access Journals (Sweden)

    Melissa Togtema

    Full Text Available High-risk types of human papillomavirus (HPV, such as HPV16, have been found in nearly all cases of cervical cancer. Therapies targeted at blocking the HPV16 E6 protein and its deleterious effects on the tumour suppressor pathways of the cell can reverse the malignant phenotype of affected keratinocytes while sparing uninfected cells. Through a strong interdisciplinary collaboration between engineering and biology, a novel, non-invasive intracellular delivery method for the HPV16 E6 antibody, F127-6G6, was developed. The method employs high intensity focused ultrasound (HIFU in combination with microbubbles, in a process known as sonoporation. In this proof of principle study, it was first demonstrated that sonoporation antibody delivery into the HPV16 positive cervical carcinoma derived cell lines CaSki and SiHa was possible, using chemical transfection as a baseline for comparison. Delivery of the E6 antibody using sonoporation significantly restored p53 expression in these cells, indicating the antibody is able to enter the cells and remains active. This delivery method is targeted, non-cytotoxic, and non-invasive, making it more easily translatable for in vivo experiments than other transfection methods.

  2. 1,4-Naphthoquinones as inducers of oxidative damage and stress signaling in HaCaT human keratinocytes.

    Science.gov (United States)

    Klaus, Viola; Hartmann, Tobias; Gambini, Juan; Graf, Peter; Stahl, Wilhelm; Hartwig, Andrea; Klotz, Lars-Oliver

    2010-04-15

    Selected biological effects of 1,4-naphthoquinone, menadione (2-methyl-1,4-naphthoquinone) and structurally related quinones from natural sources--the 5-hydroxy-naphthoquinones juglone, plumbagin and the 2-hydroxy-naphthoquinones lawsone and lapachol--were studied in human keratinocytes (HaCaT). 1,4-naphthoquinone and menadione as well as juglone and plumbagin were highly cytotoxic, strongly induced reactive oxygen species (ROS) formation and depleted cellular glutathione. Moreover, they induced oxidative DNA base damage and accumulation of DNA strand breaks, as demonstrated in an alkaline DNA unwinding assay. Neither lawsone nor lapachol (up to 100 microM) were active in any of these assays. Cytotoxic and oxidative action was paralleled by stimulation of stress signaling: all tested quinones except lawsone and lapachol strongly induced phosphorylation of the epidermal growth factor receptor (EGFR) and the related ErbB2 receptor tyrosine kinase. EGFR activation by plumbagin, juglone and menadione was attenuated by a superoxide dismutase mimetic, indicating that ROS-related mechanisms contribute to EGFR activation by these naphthoquinones. PMID:20153715

  3. Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes

    International Nuclear Information System (INIS)

    Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways. (author)

  4. Upregulation of adhesion complex proteins and fibronectin by human keratinocytes treated with an aqueous extract from the leaves of Chromolaena odorata (Eupolin).

    Science.gov (United States)

    Phan, T T; Allen, J; Hughes, M A; Cherry, G; Wojnarowska, F

    2000-01-01

    The fresh leaves and extract of the plant Chromolaena odorata are a traditional herbal treatment in developing countries for burns, soft tissue wounds and skin infections. We have previously shown that the extract had an effect on the growth and proliferation of keratinocytes and fibroblasts in culture. This study has demonstrated that Eupolin extract increased expression of several components of the adhesion complex and fibronectin by human keratinocytes. Using indirect immunofluorescence we found increased expression (dose-dependent) of laminin 5, laminin 1, collagen IV, and fibronectin. The expression of the b1 and b4 integrins was upregulated by the extract at low concentrations (0.1 and 1 microg/ml), but the expression was decreased at higher doses of Eupolin (10 microg-150 microg/ml). A number of clinical studies carried out by Vietnamese and international medical investigators have demonstrated the efficacy of this extract on the wound healing process. In this study we have shown that Eupolin stimulated the expression of many proteins of the adhesion complex and fibronectin by human keratinocytes. The adhesion complex proteins are essential to stabilise epithelium and this effect could contribute to the clinical efficacy of Eupolin in healing. PMID:11056422

  5. Baicalin downregulates Porphyromonas gingivalis lipopolysaccharide-upregulated IL-6 and IL-8 expression in human oral keratinocytes by negative regulation of TLR signaling.

    Directory of Open Access Journals (Sweden)

    Wei Luo

    Full Text Available Periodontal (gum disease is one of the main global oral health burdens and severe periodontal disease (periodontitis is a leading cause of tooth loss in adults globally. It also increases the risk of cardiovascular disease and diabetes mellitus. Porphyromonas gingivalis lipopolysaccharide (LPS is a key virulent attribute that significantly contributes to periodontal pathogenesis. Baicalin is a flavonoid from Scutellaria radix, an herb commonly used in traditional Chinese medicine for treating inflammatory diseases. The present study examined the modulatory effect of baicalin on P. gingivalis LPS-induced expression of IL-6 and IL-8 in human oral keratinocytes (HOKs. Cells were pre-treated with baicalin (0-80 µM for 24 h, and subsequently treated with P. gingivalis LPS at 10 µg/ml with or without baicalin for 3 h. IL-6 and IL-8 transcripts and proteins were detected by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The expression of nuclear factor-κB (NF-κB, p38 mitogen-activated protein kinase (MAPK and c-Jun N-terminal kinase (JNK proteins was analyzed by western blot. A panel of genes related to toll-like receptor (TLR signaling was examined by PCR array. We found that baicalin significantly downregulated P. gingivalis LPS-stimulated expression of IL-6 and IL-8, and inhibited P. gingivalis LPS-activated NF-κB, p38 MAPK and JNK. Furthermore, baicalin markedly downregulated P. gingivalis LPS-induced expression of genes associated with TLR signaling. In conclusion, the present study shows that baicalin may significantly downregulate P. gingivalis LPS-upregulated expression of IL-6 and IL-8 in HOKs via negative regulation of TLR signaling.

  6. UVB-irradiated human keratinocytes and interleukin-1αindirectly increase MAP kinase/AP-1 activation and MMP-1 production in UVA-irradiated dermal fibroblasts

    Institute of Scientific and Technical Information of China (English)

    WANG Xiao-yong; BI Zhi-gang

    2006-01-01

    Background Solar ultraviolet (UV) irradiation induces the production of matrix metalloproteinases (MMPs) by activating cellular signalling transduction pathways. MMPs are responsible for the degradation and/or inhibition of synthesis of collagenous extracellular matrix in connective tissues. We mimicked the action of environmental ultraviolet on skin and investigated the effects of UVB-irradiated human keratinocytes HaCaT and IL-1α on mitogen activated protein (MAP) kinase activation, c-Jun and c-Fos (AP-1 is composed of Jun and Fos proteins)mRNA expression and MMP-1 production in UVA-irradiated dermal fibroblasts.Methods Following UVA irradiation, the culture medium of fibroblasts was replaced by culture medium from UVB-irradiated HaCaT, or replaced by the complete culture medium with interleukin (IL)-1α. MAP kinase activity expression in fibroblasts was detected by Western blot. c-Jun and c-Fos mRNA expressions were determined by reverse transcriptional polymerase chain reaction (RT-PCR); MMP-1 production in culture medium was detected by enzyme-linked immunosorbent assay (ELISA).Results Culture medium from UVB-irradiated keratinocytes increased MAP kinase activity and c-Jun mRNA expression in UVA-irradiated fibroblasts. IL-1α increased MAP kinase activity and c-Jun mRNA expression,IL-1 α also increased c-Fos mRNA expression. Both culture media from UVB-irradiated human keratinocytes and externally applied IL-1 α increased MMP-1 production in UVA-irradiated fibroblasts.Conclusions UVB-irradiated keratinocytes and IL-1α indirectly promote MMP-1 production in UVA-irradiated fibroblasts by increasing MAP kinase/AP-1 activity. IL-1 may play an important role in the paracrine activation and dermal collagen excessive degradation leading to skin photoaging.

  7. HPV16 E7 protein and hTERT proteins defective for telomere maintenance cooperate to immortalize human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Jonathan Miller

    Full Text Available Previous studies have shown that wild-type human telomerase reverse transcriptase (hTERT protein can functionally replace the human papillomavirus type 16 (HPV-16 E6 protein, which cooperates with the viral E7 protein in the immortalization of primary keratinocytes. In the current study, we made the surprising finding that catalytically inactive hTERT (hTERT-D868A, elongation-defective hTERT (hTERT-HA, and telomere recruitment-defective hTERT (hTERT N+T also cooperate with E7 in mediating bypass of the senescence blockade and effecting cell immortalization. This suggests that hTERT has activities independent of its telomere maintenance functions that mediate transit across this restriction point. Since hTERT has been shown to have a role in gene activation, we performed microarray studies and discovered that E6, hTERT and mutant hTERT proteins altered the expression of highly overlapping sets of cellular genes. Most important, the E6 and hTERT proteins induced mRNA and protein levels of Bmi1, the core subunit of the Polycomb Group (PcG complex 1. We show further that Bmi1 substitutes for E6 or hTERT in cell immortalization. Finally, tissue array studies demonstrated that expression of Bmi1 increased with the severity of cervical dysplasia, suggesting a potential role in the progression of cervical cancer. Together, these data demonstrate that hTERT has extra-telomeric activities that facilitate cell immortalization and that its induction of Bmi1 is one potential mechanism for mediating this activity.

  8. E2 proteins of high risk human papillomaviruses down-modulate STING and IFN-κ transcription in keratinocytes.

    Directory of Open Access Journals (Sweden)

    Nuchsupha Sunthamala

    Full Text Available In the early stages of human papillomavirus (HPV infection, the viral proteins elicit specific immune responses that can participate to regression of ano-genital lesions. HPV E6 protein for instance can reduce type I interferon (IFN including IFN-κ that is involved in immune evasion and HPV persistence. To evaluate the role of E2 protein in innate immunity in HPV16-associated cervical lesions, genome-wide expression profiling of human primary keratinocytes (HPK transduced by HPV16 E2 was investigated using microarrays and innate immunity associated genes were specifically analyzed. The analyses showed that the expression of 779 genes was modulated by HPV16E2 and 92 of them were genes associated with innate immunity. Notably IFN-κ and STING were suppressed in HPK expressing the E2 proteins of HPV16 or HPV18 and the trans-activation amino-terminal domain of E2 was involved in the suppressive effect. The relationship between STING, IFN-κ and interferon stimulated genes (ISGs in HPK was confirmed by gene silencing and real time PCR. The expression of STING and IFN-κ were further determined in clinical specimens by real time PCR. STING and IFN-κ were down-modulated in HPV positive low grade squamous intraepithelial lesions compared with HPV negative controls. This study demonstrates that E2 proteins of high risk HPV reduce STING and IFN-κ transcription and its downstream target genes that might be an immune evasion mechanism involved in HPV persistence and cervical cancer development.

  9. Large-scale analysis of protein expression changes in human keratinocytes immortalized by human papilloma virus type 16 E6 and E7 oncogenes

    Directory of Open Access Journals (Sweden)

    Arnouk Hilal

    2009-08-01

    Full Text Available Abstract Background Infection with high-risk type human papilloma viruses (HPVs is associated with cervical carcinomas and with a subset of head and neck squamous cell carcinomas. Viral E6 and E7 oncogenes cooperate to achieve cell immortalization by a mechanism that is not yet fully understood. Here, human keratinocytes were immortalized by long-term expression of HPV type 16 E6 or E7 oncoproteins, or both. Proteomic profiling was used to compare expression levels for 741 discrete protein features. Results Six replicate measurements were performed for each group using two-dimensional difference gel electrophoresis (2D-DIGE. The median within-group coefficient of variation was 19–21%. Significance of between-group differences was tested based on Significance Analysis of Microarray and fold change. Expression of 170 (23% of the protein features changed significantly in immortalized cells compared to primary keratinocytes. Most of these changes were qualitatively similar in cells immortalized by E6, E7, or E6/7 expression, indicating convergence on a common phenotype, but fifteen proteins (~2% were outliers in this regulatory pattern. Ten demonstrated opposite regulation in E6- and E7-expressing cells, including the cell cycle regulator p16INK4a; the carbohydrate binding protein Galectin-7; two differentially migrating forms of the intermediate filament protein Cytokeratin-7; HSPA1A (Hsp70-1; and five unidentified proteins. Five others had a pattern of expression that suggested cooperativity between the co-expressed oncoproteins. Two of these were identified as forms of the small heat shock protein HSPB1 (Hsp27. Conclusion This large-scale analysis provides a framework for understanding the cooperation between E6 and E7 oncoproteins in HPV-driven carcinogenesis.

  10. Plant polyphenols differentially modulate inflammatory responses of human keratinocytes by interfering with activation of transcription factors NFκB and AhR and EGFR-ERK pathway

    International Nuclear Information System (INIS)

    Molecular mechanisms underlying modulation of inflammatory responses in primary human keratinocytes by plant polyphenols (PPs), namely the glycosylated phenylpropanoid verbascoside, the stilbenoid resveratrol and its glycoside polydatin, and the flavonoid quercetin and its glycoside rutin were evaluated. As non-lethal stimuli, the prototypic ligand for epidermal growth factor receptor (EGFR) transforming growth factor alpha (TGFalpha), the combination of tumor necrosis factor (TNFalpha) and interferon (IFNgamma) (T/I), UVA + UVB irradiation, and bacterial lipopolysaccharide (LPS) were used. We demonstrated differential modulation of inflammatory responses in keratinocytes at signal transduction, gene transcription, and protein synthesis levels as a function of PP chemical structure, the pro-inflammatory trigger used, and PP interaction with intracellular detoxifying systems. The PPs remarkably inhibited constitutive, LPS- and T/I-induced but not TGFalpha-induced ERK phosphorylation. They also suppressed NFkappaB activation by LPS and T/I. Verbascoside and quercetin invariably impaired EGFR phosphorylation and UV-associated aryl hydrocarbon receptor (AhR)-mediated signaling, while rutin, polydatin and resveratrol did not affect EGFR phosphorylation and further activated AhR machinery in UV-exposed keratinocytes. In general, PPs down-regulated gene expression of pro-inflammatory cytokines/enzymes, except significant up-regulation of IL-8 observed under stimulation with TGFalpha. Both spontaneous and T/I-induced release of IL-8 and IP-10 was suppressed, although 50 μM resveratrol and polydatin up-regulated IL-8. At this concentration, resveratrol activated both gene expression and de novo synthesis of IL-8 and AhR-mediated mechanisms were involved. We conclude that PPs differentially modulate the inflammatory response of human keratinocytes through distinct signal transduction pathways, including AhR and EGFR. - Graphical abstract: Display Omitted Highlights:

  11. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    OpenAIRE

    SLOMINSKI, ANDRZEJ T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.

    2013-01-01

    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-...

  12. APOPTOSIS GENE EXPRESSION IN HUMAN EPDERMAL KERATINOCYTES TREATED WITH SODIUM ARSENITE USING REAL TIME PCR ARRAY

    Science.gov (United States)

    Arsenic exposure via contaminated drinking water is a great public health concern worldwide. Chronic arsenic exposure has been associated with human skin, lung and bladder cancer and other chronic effects. We have previous reported that sodium arsenite stimulated cell proliferati...

  13. Human epidermal keratinocytes death and expression of protein markers of apoptosis after ionizing radiation exposure

    OpenAIRE

    Sharon Wong; Han Hor Chor; Sathiya Moorthy; Chee Tian Ong; Toan Thang Phan; Jaide Jay Lu

    2013-01-01

    Purpose: Knowledge of the pathophysiology of the irradiated skin is important to understand the tolerance and cosmetic response of the human skin to radiation. There are limited studies on the effect of radiotherapy dosage and fraction size in inducing apoptotic cell death in human skin. The expression of apoptotic biomarkers within a controlled population in different fractionation schemes has also never been studied. This study aims to investigate radiation induced apoptotic cell death in h...

  14. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes

    International Nuclear Information System (INIS)

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  15. Effect of irradiation on cell cycle, cell death and expression of its related proteins in normal human oral keratinocytes

    International Nuclear Information System (INIS)

    To investigate the radiosensitivity of the normal human oral keratinocytes (NHOK), and the effect of irradiation on cell cycle and protein expression. To evaluate the radiosensitivity of NHOK, the number of colonies and cells were counted after irradiation and the SF2 (survival fraction as 2 Gy) value, and the cell survival curve fitted on a linear-quadratic model were obtained. LDH analysis was carried out to evaluate the necrosis of NHOK at 1, 2,3, and 4 days after 2, 10, and 20 Gy irradiation. Cell cycle arrest and the induction of apoptosis were analyzed using flow cytometry at 1, 2, 3, and 4 days after 2, 10, and 20 Gy irradiation. Finally, proteins related cell cycle arrest and apoptosis were analysed by Western blot. The number of survival cell was significantly decreased in a dose-dependent manner. The cell survival curve showed SF2, α, and β values to be 0.568, 0.209, and 0.020 respectively. At 20 Gy irradiated cells showed higher optical density than the control group. After irradiation, apoptosis was not observed but G2 arrest was observed in the NHOK cells. 1 day after 10 Gy irradiation, the expression of p53 remained unchanged, the p21WAF1/Cip1 increased and the mdm2 decreased. The expression of bax, bcl-2, cyclin B1, and cyclin D remained unchanged. These results indicate that NHOK responds to irradiation by G2 arrest, which is possibly mediated by the expression of p21WAF1/Cip1, and that cell necrosis occurs by high dose irradiation.

  16. Deoxynivalenol induced mouse skin tumor initiation: Elucidation of molecular mechanisms in human HaCaT keratinocytes.

    Science.gov (United States)

    Mishra, Sakshi; Tewari, Prachi; Chaudhari, Bhushan P; Dwivedi, Premendra D; Pandey, Haushila P; Das, Mukul

    2016-11-01

    Among food contaminants, mycotoxins are toxic to both human and animal health. Our prior studies suggest that Deoxynivalenol (DON), a mycotoxin, behaves as a tumor promoter by inducing edema, hyperplasia, ODC activity and activation of MAPK's in mouse skin. In this study, topical application of DON, 336 and 672 nmol significantly enhanced ROS levels, DNA damage and apoptosis with concomitant downregulation of Ki-67, cyclin D, cyclin E, cyclin A and cyclin-dependent kinases (CDK4 and CDK2) thereby resulting in tumor initiation in mouse skin. Further, the elucidation of molecular mechanisms of tumor initiation by DON (0.42-3.37 nmol/ml) in HaCaT keratinocytes, revealed (i) enhanced ROS generation with cell cycle phase arrest in G0/G1 phase, (ii) increase in levels of 8-OxoG (6-24 hr) and γH2AX protein, (iii) significant enhancement in oxidative stress marker enzymes LPO, GSH, GR with concomitant decrease in antioxidant enzymes catalase, GPx, GST, SOD and mitochondrial membrane potential after DON (1.68 nmol) treatment, (iv) suppression of Nrf2 translocation to nucleus, enhanced phosphorylation with subsequent activation ERK1/2, p38 and JNK MAPK's following DON (1.68 nmol) treatment, (v) overexpression of c-jun, c-fos proteins, upregulation of Bax along with downregulation of Bcl-2 proteins, (vi) increase in cytochrome-c, caspase-9, caspase-3 and poly ADP ribose polymerase levels leads to apoptosis. Pretreatment of superoxide dismutase, mannitol and ethanol to HaCaT cells resulted in significant reduction in ROS levels and apoptosis indicating the role of superoxide and hydroxyl radicals in DON induced apoptosis as an early event and skin tumor initiation as a late event. PMID:27389473

  17. Lactate dehydrogenase release as an indicator of dithranol-induced membrane injury in cultured human keratinocytes. A time profile study.

    Science.gov (United States)

    Bonnekoh, B; Farkas, B; Geisel, J; Mahrle, G

    1990-01-01

    HaCaT cells, a rapidly multiplying human keratinocyte line, were tested for their sensitivity to antipsoriatic dithranol with regard to classical proliferation parameters and for the drug's action on the plasma membrane integrity by the dose- and time-dependent release of cytosolic lactate dehydrogenase (LDH). In the case of 3H thymidine as well as 14C amino acid incorporation the 50% inhibition concentration (IC50) was 0.2 microM dithranol 24 h after initial exposure to the drug. For protein content of attached cells the IC50 proved to be greater than 3.0 microM. Using 0.3, 1.0 and 3.0 microM dithranol, significant (p less than 0.05) dose dependent LDH release of 0.866 +/- 0.387, 1.842 +/- 1.127 and 2.938 +/- 1.635 mU per hour and cm2 confluent culture area was measured between the 5th and the 24th hour, compared to an acetone control of 0.504 +/- 0.299 mU/h x cm2. Between the 2nd and the 4th hour as well as from the 25th to the 48th hour and the 49th to the 72nd hour the LDH release after dithranol treatment did not exceed the control value. In accordance with these findings dose-dependent morphological signs of cell injury were detected by phase contrast microscopy beyond the 4th hour. The data reveal that: HaCaT cells are a very sensitive target for the antiproliferative action of dithranol; the drug causes considerable plasma membrane damage even at concentrations as low as 0.3 microM; and this membrane damage becomes evident after a latency of at least 4 h and for a limited period of up to 24 h. PMID:2221984

  18. Protective effects of the thiol compounds GSH and NAC against sulfur mustard toxicity in a human keratinocyte cell line.

    Science.gov (United States)

    Balszuweit, Frank; Menacher, Georg; Schmidt, Annette; Kehe, Kai; Popp, Tanja; Worek, Franz; Thiermann, Horst; Steinritz, Dirk

    2016-02-26

    Sulfur mustard (SM) is a chemical warfare agent causing blistering, inflammation and ulceration of the skin. Thiol compounds such as glutathione (GSH) and N-acetylcysteine (NAC) have been suggested as potential antidotes. We investigated SM toxicity in a human keratinocyte cell line (HaCaT) and used GSH and NAC to counteract its cytotoxic effects. Cells were treated with 1, 5 or 10mM GSH or NAC and exposed to 30, 100 or 300μM SM. Different treatment regimens were applied to model extra- and intra-cellular GSH/NAC effects on SM toxicity. Necrosis, apoptosis and interleukin-6 and -8 levels were determined 24h post-exposure. Necrosis and apoptosis increased with SM dose. Interleukin-6 and -8 production peaked at 100μM and decreased at 300μM probably due to reduced ability for interleukin biosynthesis. Intracellular GSH/NAC diminished necrosis induced by 100μM SM. Extracellular GSH/NAC protected against necrosis and apoptosis induced by 100 and 300μM SM. Interleukin-6 and -8 production, induced by 100μM SM was reduced by GSH/NAC. However, low-dose GSH/NAC treatment of cells exposed to 300μM SM led to increased interleukin production. Thus, moderately poisoned cells are mostly responsible for SM-induced secretion of pro-inflammatory cytokines. GSH and NAC treatment can reduce SM-induced toxic effects. Protective effects were more pronounced by extracellular GSH or NAC administration. Rescue of severely poisoned cells may result in a strong secretion of pro- inflammatory cytokines. In summary, thiol compounds such as GSH or NAC constitute a promising approach to improve the therapy for SM injury. Additional intervention to prevent adverse effects of interleukin production might be beneficial. PMID:26361990

  19. Reduction of radiochemotherapy-induced early oral mucositis by recombinant human keratinocyte growth factor (palifermin): Experimental studies in mice

    International Nuclear Information System (INIS)

    Purpose: To study the effect of recombinant human keratinocyte growth factor (rHuKGF or palifermin) on oral mucositis induced by radiochemotherapy in a mouse model. Methods and Materials: Cis-diamminedichloroplatinum (cisplatin) and/or 5-fluorouracil were given before single dose irradiation, combined with palifermin before or after the treatment, or both. Daily fractionated irradiation for 2 weeks was followed by graded test doses. With additional chemotherapy in Week 1, palifermin was given before radiotherapy and at the end of the first week, or additionally at the end of Week 2. Radiochemotherapy in Week 2 was combined with palifermin at the end of Weeks 1 and 2, Weeks 1, 2, and 3, or additionally before radiotherapy. Ulceration of mouse tongue mucosa was analyzed as the endpoint. Results: The dose associated with ulcer induction in 50% of the mice (ED50) for single-dose irradiation was 11.5 ± 0.7 Gy. Palifermin increased the ED50 to about 19 Gy in all protocols tested. Similar values were observed when chemotherapy was added before irradiation. With fractionated irradiation, palifermin increased the ED50 for test irradiation from 5.7 ± 1.5 Gy to 12-15 Gy, depending on the administration protocol. With chemotherapy in Week 1, two palifermin injections had no significant effect, but a third injection increased the ED50 to 13 Gy. With chemotherapy in Week 2, all palifermin protocols resulted in ED50 values of 13-14 Gy. Conclusion: A marked increase in oral mucosal radiation tolerance by palifermin was found, which was preserved in combinations with chemotherapy using cisplatin and/or 5-fluorouracil

  20. Proteomic Analysis of Arsenic-Induced Oxidative Stress in Human Epidermal Keratinocytes

    Science.gov (United States)

    Chronic exposure to inorganic arsenic (IAs) has been associated with the development of several human cancers, including those found in the skin, lung, urinary bladder, liver, prostate and kidney. The precise mechanisms by which arsenic causes cancer are unknown. Defining the mod...

  1. Human papillomavirus promotes Epstein-Barr virus maintenance and lytic reactivation in immortalized oral keratinocytes.

    Science.gov (United States)

    Makielski, Kathleen R; Lee, Denis; Lorenz, Laurel D; Nawandar, Dhananjay M; Chiu, Ya-Fang; Kenney, Shannon C; Lambert, Paul F

    2016-08-01

    Epstein-Barr virus and human papillomaviruses are human tumor viruses that infect and replicate in upper aerodigestive tract epithelia and cause head and neck cancers. The productive phases of both viruses are tied to stratified epithelia highlighting the possibility that these viruses may affect each other's life cycles. Our lab has established an in vitro model system to test the effects of EBV and HPV co-infection in stratified squamous oral epithelial cells. Our results indicate that HPV increases maintenance of the EBV genome in the co-infected cells and promotes lytic reactivation of EBV in upper layers of stratified epithelium. Expression of the HPV oncogenes E6 and E7 were found to be necessary and sufficient to account for HPV-mediated lytic reactivation of EBV. Our findings indicate that HPV increases the capacity of epithelial cells to support the EBV life cycle, which could in turn increase EBV-mediated pathogenesis in the oral cavity. PMID:27179345

  2. In Vivo Multiphoton NADH Fluorescence Reveals Depth-Dependent Keratinocyte Metabolism in Human Skin

    OpenAIRE

    Balu, Mihaela; Mazhar, Amaan; Hayakawa, Carole K.; Mittal, Richa; Krasieva, Tatiana B.; Konig, Karsten; Venugopalan, Vasan; Tromberg, Bruce J.

    2013-01-01

    We employ a clinical multiphoton microscope to monitor in vivo and noninvasively the changes in reduced nicotinamide adenine dinucleotide (NADH) fluorescence of human epidermal cells during arterial occlusion. We correlate these results with measurements of tissue oxy- and deoxyhemoglobin concentration during oxygen deprivation using spatial frequency domain imaging. During arterial occlusion, a decrease in oxyhemoglobin corresponds to an increase in NADH fluorescence in the basal epidermal c...

  3. Human atopic dermatitis skin-derived T cells can induce a reaction in mouse keratinocytes in vivo

    DEFF Research Database (Denmark)

    Martel, Britta C; Blom, Lars; Dyring-Andersen, Beatrice;

    2015-01-01

    through keratinocyte activation and consequently cause development of eczematous lesions. Punch biopsies of lesional skin from AD patients were used to establish skin-derived T cell cultures and which were transferred into NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that subcutaneous...

  4. Extrapolating between toxicity endpoints of metal oxide nanoparticles: Predicting toxicity to Escherichia coli and human keratinocyte cell line (HaCaT) with Nano-QTTR.

    Science.gov (United States)

    Kar, Supratik; Gajewicz, Agnieszka; Roy, Kunal; Leszczynski, Jerzy; Puzyn, Tomasz

    2016-04-01

    Synthesis of novel nanoparticles should always be accompanied by a comprehensive assessment of risk to human health and to ecosystem. Application of in silico models is encouraged by regulatory authorities to fill the data gaps related to the properties of nanoparticles affecting the environment and human health. Interspecies toxicity correlations provide a tool for estimation of contaminant's sensitivity with known levels of uncertainty for a diverse pool of species. We propose here first interspecies cytotoxicity correlation models between Escherichia coli (prokaryotic system) and human keratinocyte cell line (HaCaT) (eukaryotic system) to assess the discriminatory features for cytotoxicity of metal oxide nanoparticles. The nano-QTTR models can be employed for extrapolating cytotoxicity to E. coli and human keratinocyte cell line (HaCaT) for metal nanoparticles when the data for the other species are available. Informative illustrations of the contributing mechanisms of toxic action of the metal oxide nanoparticles to the HaCaT cell line as well as to the E. coli are identified from the developed nano quantitative toxicity-toxicity relationship (nano-QTTR) models. PMID:26773833

  5. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    OpenAIRE

    Hiroshi Ishida; Radharaman Ray; Jack Amnuaysirikul; Keiko Ishida; Prabhati Ray

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of N...

  6. Comparison between human fetal and adult skin

    OpenAIRE

    Coolen, N.A.; Schouten, K.C.; Middelkoop, E.; Ulrich, M.

    2009-01-01

    Healing of early-gestation fetal wounds results in scarless healing. Since the capacity for regeneration is probably inherent to the fetal skin itself, knowledge of the fetal skin composition may contribute to the understanding of fetal wound healing. The aim of this study was to analyze the expression profiles of different epidermal and dermal components in the human fetal and adult skin. In the human fetal skin (ranging from 13 to 22 weeks’ gestation) and adult skin biopsies, the expression...

  7. Oxidative stress induced by palytoxin in human keratinocytes is mediated by a H+-dependent mitochondrial pathway

    International Nuclear Information System (INIS)

    In the last decades, massive blooms of palytoxin (PLTX)-producing Ostreopsis cf. ovata have been observed along Mediterranean coasts, usually associated to human respiratory and cutaneous problems. At the molecular level, PLTX induces a massive intracellular Na+ influx due to the transformation of Na+/K+ ATPase in a cationic channel. Recently, we have demonstrated that Na+ overload is the crucial step in mediating overproduction of reactive oxygen species (ROS) and cell death in human HaCaT keratinocytes, tentatively explaining PLTX-induced skin irritant effects. In the present study the molecular mechanisms of ROS production induced by PLTX-mediated Na+ intracellular overload have been investigated. In HaCaT cells, PLTX exposure caused accumulation of superoxide anion, but not of nitric oxide or peroxynitrite/hydroxyl radicals. Even if RT-PCR and western blot analysis revealed an early NOX-2 and iNOS gene and protein over-expressions, their active involvement seemed to be only partial since selective inhibitors did not completely reduce O2− production. A significant role of other enzymes (COX-1, COX-2, XO) was not evidenced. Nigericin, that counteracts Na+-mediated H+-imbalance, dissipating ΔpH across mitochondrial inner membrane, and the uncouplers DNP significantly reduced O2− production. These inhibitions were synergistic when co-exposed with complex-I inhibitor rotenone. These results suggest a novel mechanism of O2− production induced by PLTX-mediated ionic imbalance. Indeed, the H+ intracellular overload that follows PLTX-induced intracellular Na+ accumulation, could enhance ΔpH across mitochondrial inner membrane, that seems to be the driving force for O2− production by reversing mitochondrial electron transport. Highlights: ► PLTX induces superoxide (O2−) production by reversing mitochondrial transport chain. ► The mechanism of O2− production is dependent on PLTX-induced ionic imbalance. ► The results led to the proposal of a novel

  8. Nitric oxide produced by ultraviolet-irradiated keratinocytes stimulates melanogenesis.

    OpenAIRE

    Roméro-Graillet, C; Aberdam, E; Clément, M.; Ortonne, J P; Ballotti, R

    1997-01-01

    Ultraviolet (UV) radiation is the main physiological stimulus for human skin pigmentation. Within the epidermal-melanin unit, melanocytes synthesize and transfer melanin to the surrounding keratinocytes. Keratinocytes produce paracrine factors that affect melanocyte proliferation, dendricity, and melanin synthesis. In this report, we show that normal human keratinocytes secrete nitric oxide (NO) in response to UVA and UVB radiation, and we demonstrate that the constitutive isoform of keratino...

  9. Cigarette Smoke Affects ABCAl Expression via Liver X Receptor Nuclear Translocation in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Claudia Sticozzi

    2010-09-01

    Full Text Available Cutaneous tissue is the first barrier against outdoor insults. The outer most layer of the skin, the stratum corneum (SC, is formed by corneocytes embedded in a lipid matrix (cholesterol, ceramide and fatty acids. Therefore, the regulation of lipids and, in particular, of cholesterol homeostasis in the skin is of great importance. ABCA1 is a membrane transporter responsible for cholesterol efflux and plays a key role in maintaining cellular cholesterol levels. Among the many factors that have been associated with skin diseases, the environmental stressor cigarette smoke has been recently studied. In the present study, we demonstrate that ABCA1 expression in human cells (HaCaT was increased (both mRNA and protein levels after CS exposure. This effect was mediated by the inhibition of NFkB (aldehydes adducts formation that allows the translocation of liver X receptor (LXR. These findings suggest that passive smoking may play a role in skin cholesterol levels and thus affect cutaneous tissues functions.

  10. Activation of the human keratinocyte B1 bradykinin receptor induces expression and secretion of metalloproteases 2 and 9 by transactivation of epidermal growth factor receptor.

    Science.gov (United States)

    Matus, Carola E; Ehrenfeld, Pamela; Pavicic, Francisca; González, Carlos B; Concha, Miguel; Bhoola, Kanti D; Burgos, Rafael A; Figueroa, Carlos D

    2016-09-01

    The B1 bradykinin receptor (BDKRB1) is a component of the kinin cascade localized in the human skin. Some of the effects produced by stimulation of BDKRB1 depend on transactivation of epidermal growth factor receptor (EGFR), but the mechanisms involved in this process have not been clarified yet. The primary purpose of this study was to determine the effect of a BDKRB1 agonist on wound healing in a mouse model and the migration and secretion of metalloproteases 2 and 9 from human HaCaT keratinocytes and delineate the signalling pathways that triggered their secretion. Although stimulation of BDKRB1 induces weak chemotactic migration of keratinocytes and wound closure in an in vitro scratch-wound assay, the BDKRB1 agonist improved wound closure in a mouse model. BDKRB1 stimulation triggers synthesis and secretion of both metalloproteases, effects that depend on the activity of EGFR and subsequent phosphorylation of ERK1/2 and p38 mitogen-activated protein kinases and PI3K/Akt. In the mouse model, immunoreactivity for both gelatinases was concentrated around wound borders. EGFR transactivation by BDKRB1 agonist involves Src kinases family and ADAM17. In addition to extracellular matrix degradation, metalloproteases 2 and 9 regulate cell migration and differentiation, cell functions that are associated with the role of BDKRB1 in keratinocyte differentiation. Considering that BDKRB1 is up-regulated by inflammation and/or by cytokines that are abundant in the inflammatory milieu, more stable BDKRB1 agonists may be of therapeutic value to modulate wound healing. PMID:27093919

  11. Effects of UVB-induced oxidative stress on protein expression and specific protein oxidation in normal human epithelial keratinocytes: a proteomic approach

    Directory of Open Access Journals (Sweden)

    De Marco Federico

    2010-03-01

    Full Text Available Abstract Background The UVB component of solar ultraviolet irradiation is one of the major risk factors for the development of skin cancer in humans. UVB exposure elicits an increased generation of reactive oxygen species (ROS, which are responsible for oxidative damage to proteins, DNA, RNA and lipids. In order to examine the biological impact of UVB irradiation on skin cells, we used a parallel proteomics approach to analyze the protein expression profile and to identify oxidatively modified proteins in normal human epithelial keratinocytes. Results The expression levels of fifteen proteins - involved in maintaining the cytoskeleton integrity, removal of damaged proteins and heat shock response - were differentially regulated in UVB-exposed cells, indicating that an appropriate response is developed in order to counteract/neutralize the toxic effects of UVB-raised ROS. On the other side, the redox proteomics approach revealed that seven proteins - involved in cellular adhesion, cell-cell interaction and protein folding - were selectively oxidized. Conclusions Despite a wide and well orchestrated cellular response, a relevant oxidation of specific proteins concomitantly occurs in UVB-irradiated human epithelial Keratinocytes. These modified (i.e. likely dysfunctional proteins might result in cell homeostasis impairment and therefore eventually promote cellular degeneration, senescence or carcinogenesis.

  12. The Peroxisome Proliferator-Activated Receptor Gamma System Regulates Ultraviolet B-Induced Prostaglandin E2 Production in Human Epidermal Keratinocytes

    Directory of Open Access Journals (Sweden)

    Raymond L. Konger

    2010-01-01

    Full Text Available Studies using PPARγ agonists in mouse skin have suggested that peroxisome proliferator-activated receptor gamma (PPARγ is irrelevant to cutaneous photobiology. However, in several epithelial cell lines, ultraviolet B (UVB has been shown to induce the nonenzymatic production of oxidized phospholipids that act as PPARγ agonists. UVB is also a potent inducer of prostaglandin E2  (PGE2 production and COX-2 expression in keratinocytes and PPARγ is coupled to increased PGE2 production in other cell lines. In this current study, we demonstrate that PPARγ agonists, but not PPARα or PPARβ/δ agonists, induce PGE2 production and COX-2 expression in primary human keratinocytes (PHKs. Importantly, PPARγ agonist-induced COX-2 expression and PGE2 production were partially inhibited by the PPARγ antagonist, GW9662, indicating that both PPARγ-dependent and -independent pathways are likely involved. GW9662 also suppressed UVB and tert-butylhydroperoxide- (TBH- induced PGE2 production in PHKs and intact human epidermis and partially inhibited UVB-induced COX-2 expression in PHKs. These findings provide evidence that PPARγ is relevant to cutaneous photobiology in human epidermis.

  13. The protective effect of recombinant human keratinocyte growth factor on radiation-induced pulmonary toxicity in rats

    International Nuclear Information System (INIS)

    Purpose: Radiation-induced lung toxicity is a significant dose-limiting side effect of radiotherapy for thoracic tumors. Recombinant human keratinocyte growth factor (rHuKGF) has been shown to be a mitogen for type II pneumocytes. The purpose of this study was to determine whether rHuKGF prevents or ameliorates the severity of late lung damage from fractionated irradiation in a rat model. Methods and materials: Female Fisher 344 rats were irradiated to the right hemithorax with a dose of 40 Gy/5 fractions/5 days. rHuKGF at dose of 5 mg/kg or 15 mg/kg was given via a single intravenous injection 10 min after the last fraction of irradiation. Animals were followed for 6 months after irradiation. Results: The breathing rate increased beginning at 6 weeks and reached a peak at 14 weeks after irradiation. The average breathing frequencies in the irradiated groups with rHuKGF (5 mg/kg and 15 mg/kg) treatment were significantly lower than that in the group receiving radiation without rHuKGF (116.5 ± 1.0 and 115.2 ± 0.8 vs 123.5 ± 1.2 breaths/min, p < 0.01). The severity of lung fibrosis and the level of immunoreactivity of integrin αvβ6, TGFβ1, type II TGFβ receptor, Smad3, and phosphorylated Smad2/3 were significantly decreased only in the group receiving irradiation plus high-dose rHuKGF treatment compared with irradiation plus vehicle group, suggesting a dose response for the effect of rHuKGF. Conclusions: This study is the first to demonstrate that rHuKGF treatment immediately after irradiation protects against late radiation-induced pulmonary toxicity. These results suggest that restoration of the integrity of the pulmonary epithelium via rHuKGF stimulation may downregulate the TGF-β-mediated fibrosis pathway. These data also support the use of rHuKGF in a clinical trial designed to prevent radiation-induced lung injury

  14. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    International Nuclear Information System (INIS)

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs

  15. Binding of antibodies to the extractable nuclear antigens SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by ultraviolet light (UVL): Implications for the pathogenesis of photosensitive cutaneous lupus

    Energy Technology Data Exchange (ETDEWEB)

    Furukawa, F.; Kashihara-Sawami, M.; Lyons, M.B.; Norris, D.A. (Univ. of Colorado School of Medicine, Denver (USA))

    1990-01-01

    Autoantibodies to the non-histone nucleoprotein antigens SS-A/Ro, SS-B/La, and RNP are highly associated with photosensitive cutaneous lupus erythematosus (LE). In order to better understand the potential mechanisms of ultraviolet (UV) light on photosensitivity in patients with cutaneous LE, we designed immunopathologic in vitro and in vivo experiments to evaluate the effects of UV on the binding of such autoantibodies to the surface of human keratinocytes, one major target of immunologic damage in photosensitive LE. Short-term 2% paraformaldehyde fixation of suspensions of cultured human keratinocytes previously incubated with monospecific antiserum probes enabled the detection of ENA expression on the cell surface by flow-cytometry analysis. UVB light (280-320 nm) induced the binding of monospecific antibody probes for SS-A/Ro and SS-B/La on keratinocytes in a dose-dependent pattern with maximal induction observed at the dose of 200 mJ/cm2 UVB. Binding of SS-A/Ro, SS-B/La, and RNP antibody was augmented strongly, but binding of anti-Sm was very weak. In contrast, UVA (320-400 nm) light had no effect on the induction of binding of these antibody probes. Identical results were seen by standard immunofluorescence techniques. Hydroxyurea-treated keratinocytes showed similar induction of those antigens by UVB irradiation, which suggested that ENA expression on cultured keratinocytes by UVB were cell-cycle independent. Tunicamycin, an inhibitor of glycosylation of proteins, reduced UVB light effect on the SS-A/Ro and SS-B/La antigen's expression. These in vitro FACS analyses revealed that ENA augmentation on the keratinocyte cell surface was dose dependent, UVB dependent, glycosylation dependent, and cell-cycle independent. In vivo ENA augmentation on the keratinocyte surface was examined in suction blister epidermal roofs.

  16. A novel control of human keratin expression: cannabinoid receptor 1-mediated signaling down-regulates the expression of keratins K6 and K16 in human keratinocytes in vitro and in situ

    Directory of Open Access Journals (Sweden)

    Yuval Ramot

    2013-02-01

    Full Text Available Cannabinoid receptors (CB are expressed throughout human skin epithelium. CB1 activation inhibits human hair growth and decreases proliferation of epidermal keratinocytes. Since psoriasis is a chronic hyperproliferative, inflammatory skin disease, it is conceivable that the therapeutic modulation of CB signaling, which can inhibit both proliferation and inflammation, could win a place in future psoriasis management. Given that psoriasis is characterized by up-regulation of keratins K6 and K16, we have investigated whether CB1 stimulation modulates their expression in human epidermis. Treatment of organ-cultured human skin with the CB1-specific agonist, arachidonoyl-chloro-ethanolamide (ACEA, decreased K6 and K16 staining intensity in situ. At the gene and protein levels, ACEA also decreased K6 expression of cultured HaCaT keratinocytes, which show some similarities to psoriatic keratinocytes. These effects were partly antagonized by the CB1-specific antagonist, AM251. While CB1-mediated signaling also significantly inhibited human epidermal keratinocyte proliferation in situ, as shown by K6/Ki-67-double immunofluorescence, the inhibitory effect of ACEA on K6 expression in situ was independent of its anti-proliferative effect. Given recent appreciation of the role of K6 as a functionally important protein that regulates epithelial wound healing in mice, it is conceivable that the novel CB1-mediated regulation of keratin 6/16 revealed here also is relevant to wound healing. Taken together, our results suggest that cannabinoids and their receptors constitute a novel, clinically relevant control element of human K6 and K16 expression.

  17. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Directory of Open Access Journals (Sweden)

    Benjamin C Thompson

    Full Text Available Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV radiation and affects DNA damage and repair. Nicotinamide (vitamin B3 reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2 solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer.

  18. Transfection of pseudouridine-modified mRNA encoding CPD-photolyase leads to repair of DNA damage in human keratinocytes: a new approach with future therapeutic potential

    Science.gov (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; Rózsa, Dávid; Nagy, Georgina; Juhász, Attila; Juhász, István; van der Horst, Gijsbertus; Horkay, Irén; Remenyik, Éva; Karikó, Katalin; Emri, Gabriella

    2013-01-01

    UVB irradiation induces harmful photochemical reactions, including formation of cyclobutane pyrimidine dimers (CPDs) in DNA. Accumulation of unrepaired CPD lesions causes inflammation, premature ageing and skin cancer. Photolyases are DNA repair enzymes that can rapidly restore DNA integrity in a light-dependent process called photoreactivation, but these enzymes are absent in humans. Here, we present a novel mRNA-based gene therapy method that directs synthesis of a marsupial, Potorous tridactylus, CPD-photolyase in cultured human keratinocytes. Pseudouridine was incorporated during in vitro transcription to make the mRNA non-immunogenic and highly translatable. Keratinocytes transfected with lipofectamine-complexed mRNA expressed photolyase in the nuclei for at least 2 days. Exposing photolyase mRNA-transfected cells to UVB irradiation resulted in significantly less CPD in those cells that were also treated with photoreactivating light, which is required for photolyase activity. The functional photolyase also diminished other UVB-mediated effects, including induction of IL-6 and inhibition of cell proliferation. These results demonstrate that pseudouridine-containing photolyase mRNA is a powerful tool to repair UVB-induced DNA lesions. The pseudouridine-modified mRNA approach has a strong potential to discern cellular effects of CPD in UV-related cell biological studies. The mRNA-based transient expression of proteins offers a number of opportunities for future application in medicine. PMID:24211294

  19. Nicotinamide enhances repair of arsenic and ultraviolet radiation-induced DNA damage in HaCaT keratinocytes and ex vivo human skin.

    Science.gov (United States)

    Thompson, Benjamin C; Halliday, Gary M; Damian, Diona L

    2015-01-01

    Arsenic-induced skin cancer is a significant global health burden. In areas with arsenic contamination of water sources, such as China, Pakistan, Myanmar, Cambodia and especially Bangladesh and West Bengal, large populations are at risk of arsenic-induced skin cancer. Arsenic acts as a co-carcinogen with ultraviolet (UV) radiation and affects DNA damage and repair. Nicotinamide (vitamin B3) reduces premalignant keratoses in sun-damaged skin, likely by prevention of UV-induced cellular energy depletion and enhancement of DNA repair. We investigated whether nicotinamide modifies DNA repair following exposure to UV radiation and sodium arsenite. HaCaT keratinocytes and ex vivo human skin were exposed to 2μM sodium arsenite and low dose (2J/cm2) solar-simulated UV, with and without nicotinamide supplementation. DNA photolesions in the form of 8-oxo-7,8-dihydro-2'-deoxyguanosine and cyclobutane pyrimidine dimers were detected by immunofluorescence. Arsenic exposure significantly increased levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine in irradiated cells. Nicotinamide reduced both types of photolesions in HaCaT keratinocytes and in ex vivo human skin, likely by enhancing DNA repair. These results demonstrate a reduction of two different photolesions over time in two different models in UV and arsenic exposed cells. Nicotinamide is a nontoxic, inexpensive agent with potential for chemoprevention of arsenic induced skin cancer. PMID:25658450

  20. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying

    2004-04-01

    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  1. The amine-containing cutaneous irritant heptylamine inhibits the volume-regulated anion channel and mobilizes intracellular calcium in normal human epidermal keratinocytes.

    Science.gov (United States)

    Raoux, Matthieu; Colomban, Cécile; Delmas, Patrick; Crest, Marcel

    2007-06-01

    Many amines are skin irritants and cause contact dermatitis. However, little is known about their mechanisms of action in keratinocytes except that they induce the release of the inflammatory mediators cytokines and ATP. Here, we tested whether volume-regulated anion channels (VRACs) in primary cultures of normal human epidermal keratinocytes are modulated by the referenced amine-containing cutaneous irritant heptylamine. Under isotonic conditions, we isolated the VRAC current (I(VRAC)) from other conductances using a high Ca(2+)-buffering internal solution. I(VRAC) ran up after patch rupturing and reached a plateau within 15 min. It was reversibly and dose-dependently inhibited by heptylamine with an IC(50) value of 260 microM. Cell-swelling caused by the application of a hypotonic solution increased 2.7-fold I(VRAC) and reduced the inhibition of VRAC by heptylamine with a dose-response curve shifted approximately 10-fold to the right. In addition, we showed, using cell-attached patch recordings, that adding heptylamine to the bath inhibited VRAC activity. This suggests that heptylamine diffuses into the membrane to inhibit VRAC. Finally, we demonstrated that heptylamine induced Ca(2+)-store depletion and that VRAC inhibition was not caused by the increase in cytosolic Ca(2+). Taken together, these results identify heptylamine as a blocker of VRAC and suggest that Ca(2+)-store depletion may be involved in mechanisms of irritant contact dermatitis caused by heptylamine. PMID:17384225

  2. Local Treatment of Hand-Foot Syndrome with Uridine/Thymidine: In Vitro Appraisal on a Human Keratinocyte Cell Line HaCaT

    Directory of Open Access Journals (Sweden)

    J. Hartinger

    2012-01-01

    Full Text Available 5-fluorouracil (5-FU is one of the most commonly used antineoplastic drugs in the anticancer therapy. The hand-foot (HF syndrome (palmar-plantar erythrodysesthesia is an adverse effect frequently related to long-term i.v. administration of 5-FU or its orally applicable prodrug capecitabine. Its severity can even lead to interruption of the otherwise effective anticancer therapy. Tentative practice in some clinics has shown that topical application of 10% uridine ointment is beneficial for calming down the HF syndrome. This study is focused on verifying the alleged protective activity of uridine in the in vitro model of cultured human keratinocyte cell line HaCaT. We also tested the protective effects of thymidine alone or uridine-thymidine combination. The cellular viability time progression was measured in order to evaluate the effect of protective agents by three different types of cytopathogenicity tests—NTCA test (non-destructive test of cellular activity, modified MTT test and RTCA (real-time cell analyser, Roche. All three methods proved the ability of uridine and uridine-thymidine combination to protect keratinocytes against 5-FU damage in vitro. While thymidine alone did not show any remarkable effect, the thymidine-uridine combination demonstrated enhanced protective activity compared to uridine alone. Our findings provided the supporting rationale for using uridine or uridine-thymidine ointments in the HF syndrome local therapy.

  3. Inhibitory Activity of the Flower Buds of Lonicera japonica Thunb. against Histamine Production and L-Histidine Decarboxylase in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Yoshihiro Inami

    2014-06-01

    Full Text Available In previous studies we found that anionic surfactants such as sodium laurate (SL and/or sodium dodecylsulfate (SDS exert actions on epidermal keratinocytes rather than mast cells to give rise of histamine production and skin itching through increasing the expression of the 53-kDa active form of l-histidine decarboxylase (HDC. In addition, with treatment of SL in a three-dimensional human keratinocyte culture, increases in both the 53-kDa HDC and histamine production are detected and thus this culture assay is applied to screen anti-itching materials from natural resources. In this study, the inhibitory activity of “Kin-gin-ka” (flower buds of Lonicera japonica Thunb., FLJ against histamine production and expression of the active form of HDC were examined in this culture assay. FLJ is a well-known traditional Chinese medicine, being used to treat fevers, coughs and some infectious diseases. The result showed both FLJ and chlorogenic acid had inhibitory activities against the expression of 53-kDa HDC and histamine production. However, chlorogenic acid showed a weaker effect on histamine production than that of FLJ, suggesting that other chemical constituents besides chlorogenic acid could contribute to the inhibitory activities. Thus, a further chemical study of FLJ is now under investigation.

  4. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    Energy Technology Data Exchange (ETDEWEB)

    Mera, Kentaro [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Kawahara, Ko-ichi [Department of Laboratory and Vascular Medicine Cardiovascular and Respiratory Disorders Advanced Therapeutics, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Tada, Ko-ichi; Kawai, Kazuhiro [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Hashiguchi, Teruto; Maruyama, Ikuro [Department of Laboratory and Vascular Medicine Cardiovascular and Respiratory Disorders Advanced Therapeutics, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan); Kanekura, Takuro, E-mail: takurok@m2.kufm.kagoshima-u.ac.jp [Department of Dermatology, Field of Sensory Organology, Kagoshima University Graduate School of Medical and Dental Sciences, 8-35-1 Sakuragaoka, Kagoshima 890-8520 (Japan)

    2010-06-25

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-L{alpha}, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm{sup 2} irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm{sup 2} UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  5. ER signaling is activated to protect human HaCaT keratinocytes from ER stress induced by environmental doses of UVB

    International Nuclear Information System (INIS)

    Proteins are folded properly in the endoplasmic reticulum (ER). Various stress such as hypoxia, ischemia and starvation interfere with the ER function, causing ER stress, which is defined by the accumulation of unfolded protein (UP) in the ER. ER stress is prevented by the UP response (UPR) and ER-associated degradation (ERAD). These signaling pathways are activated by three major ER molecules, ATF6, IRE-1 and PERK. Using HaCaT cells, we investigated ER signaling in human keratinocytes irradiated by environmental doses of ultraviolet B (UVB). The expression of Ero1-Lα, an upstream signaling molecule of ER stress, decreased at 1-4 h after 10 mJ/cm2 irradiation, indicating that the environmental dose of UVB-induced ER stress in HaCaT cells, without growth retardation. Furthermore, expression of intact ATF6 was decreased and it was translocated to the nuclei. The expression of XBP-1, a downstream molecule of IRE-1, which is an ER chaperone whose expression is regulated by XBP-1, and UP ubiquitination were induced by 10 mJ/cm2 UVB at 4 h. PERK, which regulates apoptosis, was not phosphorylated. Our results demonstrate that UVB irradiation generates UP in HaCaT cells and that the UPR and ERAD systems are activated to protect cells from UVB-induced ER stress. This is the first report to show ER signaling in UVB-irradiated keratinocytes.

  6. Effects of in vitro UVA irradiation and PUVA treatment on membrane fatty acids and activities of antioxidant enzymes in human keratinocytes

    International Nuclear Information System (INIS)

    Human Keratinocytes (NCTC 2544) in culture were exposed to either plain ultraviolet A (UVA) irradiation or to 8-methoxypsoralen plus UVA (PUVA) treatment. Lipid peroxidation, activities of antioxidant enzymes, and percentage amounts of 14C-arachidonic acid in various cellular lipid subclasses and in the culture medium were measured. Both UVA irradiation and PUVA treatment induced significant changes in the distribution of arachidonic acid and increased the liberation of arachidonic acid from membrane phospholipids. At 24 h after either UVA irradiation or PUVA treatment the formation of thiobarbituric acid reactive material was significantly increased, whereas the amount of conjugated dienes was unaffected. The activities of the antioxidant enzymes, catalase and superoxide dismutase, were already significantly decreased at 0.5 h after UVA irradiation or PUVA treatment. The enzyme activities were partially restored during the following 24 h incubation. From the present study, we suggest that in keratinocytes both plain UVA irradiation and PUVA treatment induce changes in the distribution of membrane fatty acids and cause an impairment in the enzymic defense system against oxidative stress

  7. Anti-Inflammatory Effects of Concentrated Ethanol Extracts of Edelweiss (Leontopodium alpinum Cass. Callus Cultures towards Human Keratinocytes and Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Lulli Daniela

    2012-01-01

    Full Text Available Edelweiss (Leontopodium alpinum Cass. is traditionally employed in folk medicine as an anti-inflammatory remedy. In nature, the plant is sparsely available and protected; therefore production of callus cultures was established. A concentrated ethanolic extract of culture homogenate, with leontopodic acid representing 55±2% of the total phenolic fraction (ECC55, was characterized for anti-inflammatory properties in primary human keratinocytes (PHKs and endotheliocytes (HUVECs. Inflammatory responses were induced by UVA+UVB, lipopolysaccharide (LPS, oxidized low-density lipoprotein (oxLDL, and a mixture of proinflammatory cytokines. Trichostatin A, a sirtuin inhibitor, was used to induce keratinocyte inflammatory senescence. ECC55 (10–50 μg/mL protected PHK from solar UV-driven damage, by enhancing early intracellular levels of nitric oxide, although not affecting UV-induced expression of inflammatory genes. Comparison of the dose-dependent inhibition of chemokine (IL-8, IP-10, MCP-1 and growth factor (GM-CSF release from PHK activated by TNFα + IFNγ showed that leontopodic acid was mainly responsible for the inhibitory effects of ECC55. Sirtuin-inhibited cell cycle, proliferation, and apoptosis markers were restored by ECC55. The extract inhibited LPS-induced IL-6 and VCAM1 genes in HUVEC, as well as oxLDL-induced selective VCAM1 overexpression. Conclusion. Edelweiss cell cultures could be a valuable source of anti-inflammatory substances potentially applicable for chronic inflammatory skin diseases and bacterial and atherogenic inflammation.

  8. Xenobiotic metabolism capacities of human skin in comparison with a 3D epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: activating enzymes (Phase I).

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Blatz, Veronika; Jäckh, Christine; Freytag, Eva-Maria; Fabian, Eric; Landsiedel, Robert; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    Skin is important for the absorption and metabolism of exposed chemicals such as cosmetics or pharmaceuticals. The Seventh Amendment to the EU Cosmetics Directive prohibits the use of animals for cosmetic testing for certain endpoints, such as genotoxicity; therefore, there is an urgent need to understand the xenobiotic metabolizing capacities of human skin and to compare these activities with reconstructed 3D skin models developed to replace animal testing. We have measured Phase I enzyme activities of cytochrome P450 (CYP) and cyclooxygenase (COX) in ex vivo human skin, the 3D skin model EpiDerm™ (EPI-200), immortalized keratinocyte-based cell lines and primary normal human epidermal keratinocytes. Our data demonstrate that basal CYP enzyme activities are very low in whole human skin and EPI-200 as well as keratinocytes. In addition, activities in monolayer cells differed from organotypic tissues after induction. COX activity was similar in skin, EPI-200 and NHEK cells, but was significantly lower in immortalized keratinocytes. Hence, the 3D model EPI-200 might represent a more suitable model for dermatotoxicological studies. Altogether, these data help to better understand skin metabolism and expand the knowledge of in vitro alternatives used for dermatotoxicity testing. PMID:22509833

  9. Opposed arsenite-mediated regulation of p53-survivin is involved in neoplastic transformation, DNA damage, or apoptosis in human keratinocytes

    International Nuclear Information System (INIS)

    Highlights: ► Different concentrations of arsenite cause biphasic effects in HaCaT cells. ► p53-survivin signal pathway plays a role in arsenite-induced biphasic effects. ► ERKs inactivate p53, but improve survivin expression by NF-κB/mot-2. ► JNKs block survivin expression by preventing p53 from mdm2-mediated degradation. ► ERKs and JNKs play roles in arsenite-induced biphasic effects. -- Abstract: Biphasic dose–response relationship induced by environmental agents is often characterized with the effect of low-dose stimulation and high dose inhibition. Some studies showed that arsenite may induce cell proliferation and apoptosis via biphasic dose–response relationship in human cells; however, mechanisms underlying this phenomenon are not well understood. Our present study shows that, for human keratinocytes (HaCaT) cells, a low concentration of arsenite activates extracellular signal-regulated kinases (ERKs), which leads to up-regulation of nuclear factor κB (NF-κB) binding to DNA and to elevated, NF-κB-dependent expression of mot-2 (a p53 inhibitor) and survivin (an inhibitor of apoptosis). Activation of p53 is blocked, and neoplastic transformation is enhanced. Inhibition of ERKs reduces cell proliferation and neoplastic transformation. In contrast, a high concentration of arsenite activates c-Jun N-terminal kinases (JNKs), positive regulators of p53, by binding to p53 and preventing its murine double minute 2 (mdm2)-mediated degradation. The elevated levels of p53 lead to repair of DNA damage and apoptosis. Inhibition of JNKs increases DNA damage but decreases apoptosis. By identifying a mechanism whereby ERKs and JNKs-mediated regulation of the p53-survivin signal pathway is involved in the biphasic effects of arsenite on human keratinocytes, our data expand understanding of arsenite-induced cell proliferation, neoplastic transformation, DNA damage, and apoptosis.

  10. Cultured keratinocyte grafting on various biologic matrices

    Institute of Scientific and Technical Information of China (English)

    1998-01-01

    Objective: To make attempts to use cell constructs from subconfluent keratinocyte cultures, which contain a much glue (TissucollR) and directly applied onto full thickness wounds in athymic mice or combined with allogenic split thickness overgrafts and compared with cultured sheet grafts. This keratinocyte fibrin glue suspension (KFGS) has also been used in burns up to 88% burned TBSA as well as in chronic wounds. Keratinocytes were also seeded onto various biomaterials (BiobraneR, HYAFF LaserskinR, IntegraTM, TissuFascieR) as carriers. Results: Human suspended keratinocytes were effective to reorganize to skin in vivo both in nude mice and in patients and superior if compared to sheet grafts. 3~ 5 d after seeding onto various biomaterials, cell reached subconfluence and were ready for grafting. These cell-membrane constructs were always tured on microspheres in spinner cultures could increase the cell yield, and the subconfluently covered microspheres were directly grafted onto" the wound. Conclusion: These experiments demonstrated that keratinocytes can grow on a variety of carrier materials in vitro and these cell constructs were able to spontaneously reform a multilayer neoepithelium in vivo. The current screening looks for the ideal carrier for keratinocytes that also would serve as a temporary wound cover and induce dermis formation by tissue conduction which further may be enhanced by gene therapy.

  11. Antimicrobial agent triclosan is a proton ionophore uncoupler of mitochondria in living rat and human mast cells and in primary human keratinocytes.

    Science.gov (United States)

    Weatherly, Lisa M; Shim, Juyoung; Hashmi, Hina N; Kennedy, Rachel H; Hess, Samuel T; Gosse, Julie A

    2016-06-01

    Triclosan (TCS) is an antimicrobial used widely in hospitals and personal care products, at ~10 mm. Human skin efficiently absorbs TCS. Mast cells are ubiquitous key players both in physiological processes and in disease, including asthma, cancer and autism. We previously showed that non-cytotoxic levels of TCS inhibit degranulation, the release of histamine and other mediators, from rat basophilic leukemia mast cells (RBL-2H3), and in this study, we replicate this finding in human mast cells (HMC-1.2). Our investigation into the molecular mechanisms underlying this effect led to the discovery that TCS disrupts adenosine triphosphate (ATP) production in RBL-2H3 cells in glucose-free, galactose-containing media (95% confidence interval EC50 = 7.5-9.7 µm), without causing cytotoxicity. Using these same glucose-free conditions, 15 µm TCS dampens RBL-2H3 degranulation by 40%. The same ATP disruption was found with human HMC-1.2 cells (EC50 4.2-13.7 µm), NIH-3 T3 mouse fibroblasts (EC50 4.8-7.4 µm) and primary human keratinocytes (EC50 3.0-4.1 µm) all with no cytotoxicity. TCS increases oxygen consumption rate in RBL-2H3 cells. Known mitochondrial uncouplers (e.g., carbonyl cyanide 3-chlorophenylhydrazone) previously were found to inhibit mast cell function. TCS-methyl, which has a methyl group in place of the TCS ionizable proton, affects neither degranulation nor ATP production at non-cytotoxic doses. Thus, the effects of TCS on mast cell function are due to its proton ionophore structure. In addition, 5 µm TCS inhibits thapsigargin-stimulated degranulation of RBL-2H3 cells: further evidence that TCS disrupts mast cell signaling. Our data indicate that TCS is a mitochondrial uncoupler, and TCS may affect numerous cell types and functions via this mechanism. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26204821

  12. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Nattaporn Pattarachotanant

    2014-01-01

    Full Text Available Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17, was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3. The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis.

  13. Effect of Gloriosa superba and Catharanthus roseus Extracts on IFN-γ-Induced Keratin 17 Expression in HaCaT Human Keratinocytes.

    Science.gov (United States)

    Pattarachotanant, Nattaporn; Rakkhitawatthana, Varaporn; Tencomnao, Tewin

    2014-01-01

    Gloriosa superba and Catharanthus roseus are useful in traditional medicine for treatment of various skin diseases and cancer. However, their molecular effect on psoriasis has not been investigated. In this study, the effect of ethanol extracts derived from G. superba leaves and C. roseus stems on the expression of psoriatic marker, keratin 17 (K17), was investigated in human keratinocytes using biochemical and molecular experimental approaches. Both extracts could reduce the expression of K17 in a dose-dependent manner through JAK/STAT pathway as demonstrated by an observation of reduced phosphorylation of STAT3 (p-STAT3). The inhibitory activity of G. superba extract was more potent than that of C. roseus. The Pearson's correlation between K17 and cell viability was shown positive. Taken together, the extracts of G. superba and C. roseus may be developed as alternative therapies for psoriasis. PMID:25435888

  14. The Inflammasome and the Epidermal Growth Factor Receptor (EGFR Are Involved in the Staphylococcus aureus-Mediated Induction of IL-1alpha and IL-1beta in Human Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Maren Simanski

    Full Text Available Staphylococcus (S. aureus is an important pathogen causing various infections including those of the skin. Keratinocytes are able to sense invading S. aureus and to initiate a fast defense reaction by the rapid release of innate defense mediators such as antimicrobial peptides and cytokines. There is increasing evidence that the cytokines IL-1alpha and IL-1beta, which both signal through the IL-1 receptor, play an important role in cutaneous defense against S. aureus. The aim of this study was to gain more insight into the underlying mechanisms leading to the S. aureus-induced IL-1alpha and IL-1beta expression in keratinocytes. Infection of human primary keratinocytes with S. aureus led to the induction of gene expression and protein secretion of IL-1alpha and IL-1beta. Full S. aureus-induced IL-1 protein release required the inflammasome components caspase-1 and ASC (apoptosis-associated speck-like protein containing a CARD whereas gene induction of IL-1alpha and IL-beta by S. aureus was not dependent on caspase-1 and ASC. Since patients receiving anti-cancer therapy by inhibition of the epidermal growth factor receptor (EGFR often suffer from skin infections caused by S. aureus we additionally evaluated whether the EGFR pathway may be involved in the IL-1alpha and IL-1beta induction by S. aureus. Inactivation of the EGFR with a blocking antibody decreased the S. aureus-mediated IL-1alpha and IL-1beta induction in primary keratinocytes. Moreover, the use of siRNA experiments revealed that ADAM17 (A Disintegrin and A Metalloprotease 17, a metalloproteinase known to mediate the shedding and release of EGFR ligands, was required for full induction of IL-1alpha and IL-1beta in keratinocytes infected with S. aureus. A failure of keratinocytes to adequately upregulate IL-1alpha and IL-1beta may promote S. aureus skin infections.

  15. TiO2 nanoparticles alleviate toxicity by reducing free Zn2+ ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    International Nuclear Information System (INIS)

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO2) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO2, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO2 was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml−1 after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO2 nanoparticles which remained non-toxic until very high concentrations. It was found that TiO2 nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO2 nanoparticles caused an attenuation of free intracellular Zn2+ ions concentration, by adsorbing and immobilizing free Zn2+ ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present

  16. TiO{sub 2} nanoparticles alleviate toxicity by reducing free Zn{sup 2+} ion in human primary epidermal keratinocytes exposed to ZnO nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kathawala, Mustafa Hussain; Ng, Kee Woei, E-mail: kwng@ntu.edu.sg; Loo, Say Chye Joachim, E-mail: joachimloo@ntu.edu.sg [Nanyang Technological University, School of Materials Science and Engineering (Singapore)

    2015-06-15

    Nanoparticles have been a subject of intense safety screenings due to their influx in various applications. Although recent studies have reported on the plausible cytotoxicity of nanoparticles, many of these focused only on single-material nanoparticles, while the cytotoxicity of dual-nanoparticle systems (e.g., ZnO with TiO{sub 2}) has remained unexplored. For example, commercial products like sunscreens and cosmetics contain both nano-sized ZnO and TiO{sub 2}, but cytotoxicity studies of such systems are meager. In this paper, the cytotoxicity of this dual-nanoparticle system comprising both ZnO and TiO{sub 2} was evaluated in vitro on skin-mimicking human primary epidermal keratinocytes (HPEKs). Inductively coupled plasma mass spectrometry, flow cytometry, and confocal microscopy were used to investigate the uptake of nanoparticles and free ions. Results revealed that ZnO nanoparticles were partially soluble (up to 20 μg ml{sup −1} after 1 day) and could induce strong cytotoxicity as compared to the insoluble TiO{sub 2} nanoparticles which remained non-toxic until very high concentrations. It was found that TiO{sub 2} nanoparticles could play “vigilante” by protecting keratinocytes from acute toxicity of ZnO nanoparticles. This is in agreement with the observation that TiO{sub 2} nanoparticles caused an attenuation of free intracellular Zn{sup 2+} ions concentration, by adsorbing and immobilizing free Zn{sup 2+} ions. This study reveals a unique dual-nanoparticle observation in vitro on HPEKs, and highlights the importance of dual-nanoparticulate toxicity studies, especially in applications where more than one nanoparticle material-type is present.

  17. Ethanol Extract of Cirsium japonicum var. ussuriense Kitamura Exhibits the Activation of Nuclear Factor Erythroid 2-Related Factor 2-dependent Antioxidant Response Element and Protects Human Keratinocyte HaCaT Cells Against Oxidative DNA Damage

    Science.gov (United States)

    Yoo, Ok-Kyung; Choi, Bu Young; Park, Jin-Oh; Lee, Ji-Won; Park, Byoung-Kwon; Joo, Chul Gue; Heo, Hyo-Jung; Keum, Young-Sam

    2016-01-01

    Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and NAD(P)H:quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression. PMID:27051652

  18. UV-B Radiation Induces Macrophage Migration Inhibitory Factor–Mediated Melanogenesis through Activation of Protease-Activated Receptor-2 and Stem Cell Factor in Keratinocytes

    OpenAIRE

    Enomoto, Akiko; Yoshihisa, Yoko; Yamakoshi, Takako; Ur Rehman, Mati; Norisugi, Osamu; HARA Hiroshi; Matsunaga, Kenji; Makino, Teruhiko; Nishihira, Jun; Shimizu, Tadamichi

    2011-01-01

    UV radiation indirectly regulates melanogenesis in melanocytes through a paracrine regulatory mechanism involving keratinocytes. Protease-activated receptor (PAR)-2 activation induces melanosome transfer by increasing phagocytosis of melanosomes by keratinocytes. This study demonstrated that macrophage migration inhibitory factor (MIF) stimulated PAR-2 expression in human keratinocytes. In addition, we showed that MIF stimulated stem cell factor (SCF) release in keratinocytes; however, MIF ha...

  19. Ascorbic Acid, Ultraviolet C Rays, and Glucose but not Hyperthermia Are Elicitors of Human β-Defensin 1 mRNA in Normal Keratinocytes

    Directory of Open Access Journals (Sweden)

    Luis Antonio Cruz Díaz

    2015-01-01

    Full Text Available Hosts’ innate defense systems are upregulated by antimicrobial peptide elicitors (APEs. Our aim was to investigate the effects of hyperthermia, ultraviolet A rays (UVA, and ultraviolet C rays (UVC as well as glucose and ascorbic acid (AA on the regulation of human β-defensin 1 (DEFB1, cathelicidin (CAMP, and interferon-γ (IFNG genes in normal human keratinocytes (NHK. The indirect in vitro antimicrobial activity against Staphylococcus aureus and Listeria monocytogenes of these potential APEs was tested. We found that AA is a more potent APE for DEFB1 than glucose in NHK. Glucose but not AA is an APE for CAMP. Mild hypo- (35°C and hyperthermia (39°C are not APEs in NHK. AA-dependent DEFB1 upregulation below 20 mM predicts in vitro antimicrobial activity as well as glucose- and AA-dependent CAMP and IFNG upregulation. UVC upregulates CAMP and DEFB1 genes but UVA only upregulates the DEFB1 gene. UVC is a previously unrecognized APE in human cells. Our results suggest that glucose upregulates CAMP in an IFN-γ-independent manner. AA is an elicitor of innate immunity that will challenge the current concept of late activation of adaptive immunity of this vitamin. These results could be useful in designing new potential drugs and devices to combat skin infections.

  20. Sphingomyelinase D from Loxosceles laeta Venom Induces the Expression of MMP7 in Human Keratinocytes: Contribution to Dermonecrosis.

    Science.gov (United States)

    Corrêa, Mara A; Okamoto, Cinthya K; Gonçalves-de-Andrade, Rute M; van den Berg, Carmen W; Tambourgi, Denise V

    2016-01-01

    Envenomation by Loxosceles spider is characterized by the development of dermonecrosis. In previous studies, we have demonstrated that increased expression/secretion of matrix metalloproteinases 2 and 9, induced by Loxosceles intermedia venom Class 2 SMases D (the main toxin in the spider venom), contribute to the development of cutaneous loxoscelism. In the present study we show that the more potent venom containing the Class 1 SMase D from Loxosceles laeta, in addition to increasing the expression/secretion of MMP2 and MMP9, also stimulates the expression of MMP7 (Matrilysin-1), which was associated with keratinocyte cell death. Tetracycline, a matrix metalloproteinase inhibitor, prevented cell death and reduced MMPs expression. Considering that L. laeta venom is more potent at inducing dermonecrosis than L. intermedia venom, our results suggest that MMP7 may play an important role in the severity of dermonecrosis induced by L. laeta spider venom SMase D. In addition, the inhibition of MMPs by e.g. tetracyclines may be considered for the treatment of the cutaneous loxoscelism. PMID:27078876

  1. The transcriptional regulator gene E2 of the Human Papillomavirus (HPV) 16 influences the radiosensitivity of cervical keratinocytes

    International Nuclear Information System (INIS)

    Clinical studies have demonstrated that HPV induced tumors constitute a specific subclass of cancer with a better response to radiation treatment. The purpose of this study was to investigate meaning of viral E2-gene for radiosensitivity. W12 cells contain episomal HPV 16 genomes, whereas S12 cells, which derive from the W12 line, contain HPV DNA as integrated copies. Clonogenic survival was analyzed using 96-well in vitro test. Using flow cytometry cell cycle analyses were performed. Expression of pRb and p53 were analyzed using intracellular staining. W12 cells (intact E2 gene) showed a lower survival fraction than S12 cells. W12 cells developed a G2/M block 24 h after irradiation with 2 Gy whereas S12 showed no G2/M bloc. After irradiation S12 cells developed polyploidy and pRb-positive cells decreased. W12 cells showed no change of pRb-positive cells. Depending on E2 gene status differences in cell cycle regulation might cause radioresistance. The E2/E7/pRb pathway seems to influence HPV-induced radiosensitivity. Our experiments demonstrated an effect of HPV on radiosensitivity of cervical keratinocytes via viral transcription regulator E2 pathway

  2. APR-246/PRIMA-1MET rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations

    OpenAIRE

    Shen, Jinfeng; van den Bogaard, Ellen H.; Kouwenhoven, Evelyn N.; Vladimir J.N. Bykov; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S.; Gilissen, Christian; Van Heeringen, Simon J.; Schalkwijk, Joost; Van Bokhoven, Hans; Wiman, Klas G.; Zhou, Huiqing

    2013-01-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patien...

  3. Structure-function relationship of new anthralin derivatives assayed for growth inhibition and cytotoxicity in human keratinocyte cultures.

    Science.gov (United States)

    Bonnekoh, B; Tanzer, H; Seidel, M; Geisel, J; Merk, H F; Mahrle, G; Wiegrebe, W

    1991-11-01

    HaCaT keratinocyte cultures were exposed to twelve hydrophilic anthralin derivatives 1 to 12 with substituents at C-1 and C-8 of the anthrone skeleton, of one H at C-10 and of both H's at C-10 by lacton rings. After 3 microM treatment growth was determined by cellular protein content, 3H-thymidine- and 14C-amino-acid-uptake and cytotoxicity by the release of cytoplasmic LDH into the culture medium. In comparison to acetone control (100%) anthralin suppressed mean protein content, as well as DNA- and protein-synthesis to 33, 28, and 21%, respectively, and the drug revealed an enzyme release of 660%. In relation to the parent drug we found similar cell growth inhibitory effects of compounds 4, 6, 8, 9, 10, and 12. Deriv. 4, 8, and 10 were, however, to some extent less cytotoxic than anthralin, whereas deriv. 6, 9, and 12 were in the same range. An extreme suppression of growth parameters which differed from the anthralin effect by a factor 0.5-0.8 was caused by deriv. 11, showing the same cytotoxicity. Deriv. 1, 2, 3, 5, and 7 did not demonstrate any cytotoxicity. Concerning growth parameters, deriv. 2 induced a slight stimulation, deriv. 3 and 7 were completely ineffective, deriv. 1 and 5 induced slightly to moderately inhibited proliferation but both being much less effective than anthralin. These data indicate that the "minimum structure" concept by Krebs and Schaltegger--claiming 1-hydroxy-9-anthrone as a precondition for clinical antipsoriatic potency--is not valid at least in cell-biological tests and point toward possible usefulness of some experimental model compounds as alternative antipsoriatics. PMID:1804068

  4. Papain Degrades Tight Junction Proteins of Human Keratinocytes In Vitro and Sensitizes C57BL/6 Mice via the Skin Independent of its Enzymatic Activity or TLR4 Activation

    OpenAIRE

    Stremnitzer, Caroline; Manzano-Szalai, Krisztina; Willensdorfer, Anna; Starkl, Philipp(*); Pieper, Mario; König, Peter; Mildner, Michael; Tschachler, Erwin; Reichart, Ursula; Jensen-Jarolim, Erika

    2015-01-01

    Papain is commonly used in food, pharmaceutical, textile, and cosmetic industries and is known to induce occupational allergic asthma. We have previously shown that the papain-like cysteine protease Dermatophagoides pteronyssinus 1 from house dust mite exhibits percutaneous sensitization potential. We aimed here to investigate the potential of papain itself in epicutaneous sensitization. The effects of papain on tight junction (TJ) proteins were tested in vitro in human primary keratinocytes....

  5. Adipose derived mesenchymal stem cells express keratinocyte lineage markers in a co-culture model.

    Science.gov (United States)

    Irfan-Maqsood, M; Matin, M M; Heirani-Tabasi, A; Bahrami, M; Naderi-Meshkin, H; Mirahmadi, M; Hassanzadeh, H; Sanjar Moussavi, N; Raza-Shah, H; Raeesolmohaddeseen, M; Bidkhori, H; Bahrami, A R

    2016-01-01

    Cutaneous wound healing is a complex type of biological event involving proliferation, differentiation, reprograming, trans/de-differentiation, recruitment, migration, and apoptosis of a number of cells (keratinocytes, fibroblasts, endothelial cells, nerve cells and stem cells) to regenerate a multi-layered tissue that is damaged by either internal or external factors. The exact regeneration mechanism of damaged skin is still unknown but the epithelial and other kinds of stem cells located in skin play crucial roles in the healing process. In this work, a co-culture model composed of adipose derived mesenchymal stem cells and keratinocytes was developed to understand the cellular differentiation behaviour in wound healing. Human mesenchymal stem cells were isolated from waste lipoaspirates. Keratinocytes were isolated from neonatal rats skin as well from human adult skin. Both types of cells were cultured and their culturing behaviour was observed microscopically under regular intervals of time. The identity of both cells was confirmed by flow cytometry and qRT-PCR. Cells were co-cultured under the proposed co-culturing model and the model was observed for 7, 14 and 21 days. The cellular behaviour was studied based on change in morphology, colonization, stratification, migration and expression of molecular markers. Expression of molecular markers was studied at transcriptional level and change in cellular morphology and migration capabilities was observed under the invert microscope regularly. Successfully isolated and characterized mesenchymal stem cells were found to express keratinocyte lineage markers i.e. K5, K10, K14, K18, K19 and Involucrin when co-cultured with keratinocytes after 14 and 21 days. Their expression was found to increase by increasing the time span of cell culturing. The keratinocyte colonies started to disappear after 10 days of culturing which might be due to stratification process initiated by possibly transdifferentiated stem cells. It can

  6. Radiation sensitivity of adult human parenchymal hepatocytes

    International Nuclear Information System (INIS)

    The purpose of this study was to determine the radiosensitivity and repair kinetics of adult human parenchymal hepatocytes. Discarded viable human liver was obtained from the surgical pathology laboratory, and the cells were enzymatically isolated via a modification of the 2-step in situ collagenase perfusion technique used for the rat. The isolated hepatocytes were cultured with MEM media (10% FCS) in collagen coated 60 mm plates. Three hr after the cells were placed in culture, the media was changed to remove any dead unattached hepatocytes. After 24hr the viable hepatocytes were removed from the plates with collagenase and irradiated (40C, 21% O/sub 2/) with /sup 60/Co (1 Gy/min). The alkaline elution technique was used to quantify the single strand breaks (SSB). A linear dose response curve was obtained when the strand scission factor was plotted versus radiation dose and the slopes for the rat (4 cases) and human hepatocytes (6 cases) were 0.0302 and 0.0221 Gy/sup -1/, respectively. Thus, human hepatocytes are approximately 25% more radioresistant than those from the rat; this correlates with the GSH levels in the human hepatocytes (15 mM) being 20% greater than that in rat hepatocytes (12 mM). In contrast, the kinetics of repair of SSB in human hepatocytes was t/sub 1/2 fast/ = 20 min. t/sub 1/2 slow/ = 267 min) approximately 3 times slower than that in rat hepatocytes (t/sub 1/2 fast/ = 6 min, t/sub 1/2 slow/ = 98 min) and after 3 hr of repair the percent of the initial damage remaining was 20% and 15%, respectively. These date imply that in comparison to rat hepatocytes, human hepatocytes would be more radioresistant to large single doses, but equal if not more sensitive to fractionated radiation treatment

  7. The oxidation of p-phenylenediamine, an ingredient used for permanent hair dyeing purposes, leads to the formation of hydroxyl radicals: Oxidative stress and DNA damage in human immortalized keratinocytes.

    Science.gov (United States)

    Zanoni, Thalita B; Hudari, Felipe; Munnia, Armelle; Peluso, Marco; Godschalk, Roger W; Zanoni, Maria Valnice B; den Hartog, Gertjan J M; Bast, Aalt; Barros, Silvia B M; Maria-Engler, Silvya S; Hageman, Geja J; de Oliveira, Danielle Palma

    2015-12-15

    The hair-dyeing ingredient, p-phenylenediamine (PPD), was previously reported to be mutagenic, possibly by inducing oxidative stress. However, the exact mechanism of PPD in inducing oxidative stress upon skin exposure during hair-dyeing in human keratinocytes remains unknown. The aim of our studies was therefore to investigate the toxicity of PPD and its by-products in human immortalized keratinocytes (HaCaT) after auto-oxidation and after reaction with hydrogen peroxide (H2O2). We found that the PPD half maximal effective cytotoxic concentration (EC50) to HaCaT is 39.37 and 35.63 μg/mL after 24 and 48 h, respectively, without addition of H2O2 to induce oxidation. When PPD (10 or 100 μg/mL) is combined with 10.5 μg/mL of H2O2, intracellular ROS production by HaCaT after 1 h was significantly increased and enhanced levels of DNA damage were observed after 4 h of exposure. After 24 h incubations, 20 μg/mL of PPD increased the level of DNA oxidation in HaCaT. Also, we found that the in vitro reaction between PPD and H2O2, even below the maximum allowance by cosmetic industries, released hydroxyl radicals which can damage DNA. Taken together, we conclude that PPD alone and when combined with H2O2 increases the formation of reactive oxygen species in human keratinocytes, leading to oxidative stress and subsequent DNA damage. These alterations suggest that the mechanism by which PPD exposure, alone or combined with H2O2, damages keratinocytes by the formation of the high reactive HO∙ radicals. PMID:26456176

  8. Cytotoxicity and Proliferation Studies with Arsenic in Established Human Cell Lines: Keratinocytes, Melanocytes, Dendritic Cells, Dermal Fibroblasts, Microvascular Endothelial Cells, Monocytes and T-Cells

    Directory of Open Access Journals (Sweden)

    Hari H. P. Cohly

    2003-01-01

    Full Text Available Abstract: Based on the hypothesis that arsenic exposure results in toxicity and mitogenecity, this study examined the dose-response of arsenic in established human cell lines of keratinocytes (HaCaT, melanocytes (1675, dendritic cells (THP-1/A23187, dermal fibroblasts (CRL1904, microvascular endothelial cells (HMEC, monocytes (THP-1, and T cells (Jurkat. Cytotoxicity was determined by incubating THP-1, THP-1+ A23187 and JKT cells in RPMI 1640, 1675 in Vitacell, HMEC in EBM, and dermal fibroblasts and HaCaT in DMEM with 10% fetal bovine serum, 1% streptomycin and penicillin for 72 hrs in 96-well microtiter plates, at 37oC in a 5% CO2 incubator with different concentrations of arsenic using fluorescein diacetate (FDA. Cell proliferation in 96-well plates was determined in cultured cells starved by prior incubation for 24 hrs in 1% FBS and exposed for 72 hours, using the 96 cell titer proliferation solution (Promega assay. Cytotoxicity assays yielded LD50s of 9 μg/mL for HaCaT, 1.5 μg/mL for CRL 1675, 1.5 μg/mL for dendritic cells, 37 μg/mL for dermal fibroblasts, 0.48 μg/mL for HMEC, 50 μg/mL for THP-1 cells and 50 μg/mL for JKT-T cells. The peak proliferation was observed at 6 μg/mL for HaCaT and THP-1 cells, 0.19 μg/mL for CRL 1675, dendritic cells, and HMEC, and 1.5 μg/mL for dermal fibroblasts and Jurkat T cells. These results show that arsenic is toxic at high doses to keratinocytes, fibroblasts, monocytes and T cells, and toxic at lower doses to melanocytes, microvascular endothelial cells and dendritic cells. Proliferation studies showed sub-lethal doses of arsenic to be mitogenic.

  9. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Greinert, R.; Breibart, E.W.; Mitchell, D.; Smida, J.; Volkmer, B

    2000-07-01

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  10. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Mei Jing Piao

    2015-09-01

    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  11. Arsenite induced poly(ADP-ribosyl)ation of tumor suppressor P53 in human skin keratinocytes as a possible mechanism for carcinogenesis associated with arsenic exposure

    International Nuclear Information System (INIS)

    Arsenite is an environmental pollutant. Exposure to inorganic arsenic in drinking water is associated with elevated cancer risk, especially in skin. Arsenite alone does not cause skin cancer in animals, but arsenite can enhance the carcinogenicity of solar UV. Arsenite is not a significant mutagen at non-toxic concentrations, but it enhances the mutagenicity of other carcinogens. The tumor suppressor protein P53 and nuclear enzyme PARP-1 are both key players in DNA damage response. This laboratory demonstrated earlier that in cells treated with arsenite, the P53-dependent increase in p21WAF1/CIP1 expression, normally a block to cell cycle progression after DNA damage, is deficient. Here we show that although long-term exposure of human keratinocytes (HaCaT) to a nontoxic concentration (0.1 μM) of arsenite decreases the level of global protein poly(ADP-ribosyl)ation, it increases poly(ADP-ribosyl)ation of P53 protein and PARP-1 protein abundance. We also demonstrate that exposure to 0.1 μM arsenite depresses the constitutive expression of p21 mRNA and P21 protein in HaCaT cells. Poly(ADP-ribosyl)ation of P53 is reported to block its activation, DNA binding and its functioning as a transcription factor. Our results suggest that arsenite's interference with activation of P53 via poly(ADP-ribosyl)ation may play a role in the comutagenic and cocarcinogenic effects of arsenite.

  12. Characterisation of Human Keratinocytes by Measuring Cellular Repair Capacity of UVB-Induced DNA Damage and Monitoring of Cytogenetic Changes in Melanoma Cell Lines

    International Nuclear Information System (INIS)

    The molecular mechanisms for UV-induced photocarcinogenesis are far from being understood in detail, especially in the case of malignant melanoma of the skin. Nevertheless, it is known that deficiencies in cellular repair processes of UV-induced DNA damage (e.g. in the case of Xeroderma pigmentosum) represent important aetiological factors in the multistep development of skin cancer. The repair kinetics have therefore been studied of an established skin cell line (HaCaT), primary human keratinocytes, melanocytes and melanoma cell lines, using fluorescence microscopy and flow cytometry. Our data show a high degree of interindividual variability in cellular repair capacity for UV-induced DNA lesions, which might be due to individual differences in the degree of tolerable damage and/or the onsets of saturation of the enzymatic repair system. The cytogenetic analysis of melanoma cell lines, using spectral karyotyping (SKY) furthermore proves that malignant melanoma of the skin are characterised by high numbers of chromosomal aberrations. (author)

  13. Oxidative stress and DNA damage induced by cadmium in the human keratinocyte HaCaT cell line: Role of glutathione in the resistance to cadmium

    International Nuclear Information System (INIS)

    Cadmium affects the cellular homeostasis and generates damage via complex mechanisms involving interactions with other metals and oxidative stress induction. In this work we used a human keratinocyte cell line (HaCaT) as a model to study the oxidative damage induced by cadmium to cellular macromolecules, its effect on the antioxidant systems and the role of glutathione in cell protection toward cadmium toxicity. The cells were incubated for 24 and 48 h with cadmium (3, 15, 50 and 100 μM). High doses of cadmium were required to induce a cytotoxicity: 100 μM lead to 30% mortality after 24 h and 50% after 48 h. The oxidation of lipids and proteins and the DNA damage, respectively, assessed by thiobarbituric acid reactants determination, thiol group measurement and comet assay, were observed for 50-100 μM cadmium. The cytotoxic effects were strongly correlated to the cellular cadmium content. The glutathione peroxidase and the catalase activities were decreased, while the glutathione reductase activity and the glutathione concentration were increased after cadmium treatment. The superoxide dismutases activities were unchanged. A depletion in glutathione prior to cadmium exposure increased the cytotoxic effects and provoked DNA damage. Our results suggested that the hydroxyl radical could be the major compound involved in the oxidative stress generated by cadmium and that glutathione could play a major role in the protection of HaCaT cells from cytotoxicity but mostly from DNA damage induced by cadmium

  14. Chlorpyrifos induces NLRP3 inflammasome and pyroptosis/apoptosis via mitochondrial oxidative stress in human keratinocyte HaCaT cells.

    Science.gov (United States)

    Jang, Yoonjeong; Lee, Ah Young; Jeong, Sang-Hee; Park, Kyung-Hun; Paik, Min-Kyoung; Cho, Nam-Joon; Kim, Ji-Eun; Cho, Myung-Haing

    2015-12-01

    Chlorpyrifos (CPF) has been widely used around the world as a pesticide for both agricultural and residential application. Although various studies have reported toxicity and health-related effects from CPF exposure, the molecular mechanism of CPF toxicity to skin has not been well-characterized. The present study determined the potential mechanism involved in skin toxicity of CPF using the HaCaT human skin keratinocyte cell line. After treating to HaCaT cells, CPF triggered reactive oxygen species (ROS) generation and mitochondrial oxidative stress. We focused on NLRP3 inflammasome, known to induce innate immune response. We used mitochondrial ROS (mROS) scavenger mitoTEMPO to demonstrate a role for mROS in NLRP3 inflammasome and programmed cell death induced by CPF. Our results showed that CPF provoked NLRP3 inflammasome and pyroptosis/apoptosis via an increase of mROS in HaCaT cells. This study proposes that CPF induces innate immune response and skin inflammation through activating the NLRP3 inflammasome in skin epithelial cells. CPF may lead to cutaneous disease conditions and antioxidants could be proposed for therapy against skin exposure to CPF. PMID:26435000

  15. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes.

    Science.gov (United States)

    Ronpirin, Chalinee; Pattarachotanant, Nattaporn; Tencomnao, Tewin

    2016-01-01

    This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB), a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS), and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight), while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively). Ethanol and aqueous fractions of A. carambola (250 µg/mL) significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL) significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL) and aqueous (50, 100 and 250 µg/mL) fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD). Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications. PMID:27057195

  16. Antioxidant and Anti-Inflammatory Effects of Selected Natural Compounds Contained in a Dietary Supplement on Two Human Immortalized Keratinocyte Lines

    Directory of Open Access Journals (Sweden)

    Elena Fasano

    2014-01-01

    Full Text Available Several advantages may derive from the use of dietary supplements containing multiple natural antioxidants and/or anti-inflammatory agents. At present, however, there is scarce information on the properties and potential of combined supplements. To fill the gap, the antioxidant and anti-inflammatory activities exerted by a combination of seven natural components (coenzyme Q10, krill oil, lipoic acid, resveratrol, grape seed oil, α-tocopherol, and selenium contained in a dietary supplement used for the prevention of skin disorders were investigated in vitro. Each component was administered, alone or in combination, to human keratinocytes, and the inhibition of Reactive Oxygen Species production and lipid peroxidation as well as the ability to reduce inflammatory cytokine secretion and to modulate Nuclear Factor-κB pathway was evaluated. The combination exhibited high antioxidant activity and in specific conditions the combination’s efficiency was higher than that of the most powerful components administered individually. Moreover, the combination showed remarkable anti-inflammatory properties. It reduced more efficiently than each component the secretion of Monocyte Chemoattractant Protein-1, a crucial cytokine for the development of chronic inflammation in skin, and inhibited Nuclear Factor-κB molecular pathway. Overall, our findings suggest that the combined formulation may have the potential to powerfully inhibit oxidative stress and inflammation at skin level.

  17. Antioxidant and anti-inflammatory effects of selected natural compounds contained in a dietary supplement on two human immortalized keratinocyte lines.

    Science.gov (United States)

    Fasano, Elena; Serini, Simona; Mondella, Nadia; Trombino, Sonia; Celleno, Leonardo; Lanza, Paola; Cittadini, Achille; Calviello, Gabriella

    2014-01-01

    Several advantages may derive from the use of dietary supplements containing multiple natural antioxidants and/or anti-inflammatory agents. At present, however, there is scarce information on the properties and potential of combined supplements. To fill the gap, the antioxidant and anti-inflammatory activities exerted by a combination of seven natural components (coenzyme Q10, krill oil, lipoic acid, resveratrol, grape seed oil, α-tocopherol, and selenium) contained in a dietary supplement used for the prevention of skin disorders were investigated in vitro. Each component was administered, alone or in combination, to human keratinocytes, and the inhibition of Reactive Oxygen Species production and lipid peroxidation as well as the ability to reduce inflammatory cytokine secretion and to modulate Nuclear Factor-κB pathway was evaluated. The combination exhibited high antioxidant activity and in specific conditions the combination's efficiency was higher than that of the most powerful components administered individually. Moreover, the combination showed remarkable anti-inflammatory properties. It reduced more efficiently than each component the secretion of Monocyte Chemoattractant Protein-1, a crucial cytokine for the development of chronic inflammation in skin, and inhibited Nuclear Factor-κB molecular pathway. Overall, our findings suggest that the combined formulation may have the potential to powerfully inhibit oxidative stress and inflammation at skin level. PMID:25197638

  18. Remediation of textile azo dye acid red 114 by hairy roots of Ipomoea carnea Jacq. and assessment of degraded dye toxicity with human keratinocyte cell line.

    Science.gov (United States)

    Jha, Pamela; Jobby, Renitta; Desai, N S

    2016-07-01

    Bioremediation has proven to be the most desirable and cost effective method to counter textile dye pollution. Hairy roots (HRs) of Ipomoea carnea J. were tested for decolourization of 25 textile azo dyes, out of which >90% decolourization was observed in 15 dyes. A diazo dye, Acid Red 114 was decolourized to >98% and hence, was chosen as the model dye. A significant increase in the activities of oxidoreductive enzymes was observed during decolourization of AR114. The phytodegradation of AR114 was confirmed by HPLC, UV-vis and FTIR spectroscopy. The possible metabolites were identified by GCMS as 4- aminobenzene sulfonic acid 2-methylaniline and 4- aminophenyl 4-ethyl benzene sulfonate and a probable pathway for the biodegradation of AR114 has been proposed. The nontoxic nature of the metabolites and toxicity of AR114 was confirmed by cytotoxicity tests on human keratinocyte cell line (HaCaT). When HaCaT cells were treated separately with 150μgmL(-1) of AR114 and metabolites, MTT assay showed 50% and ≈100% viability respectively. Furthermore, flow cytometry data showed that, as compared to control, the cells in G2-M and death phase increased by 2.4 and 3.6 folds respectively on treatment with AR114 but remained unaltered in cells treated with metabolites. PMID:26971029

  19. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-01-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing. PMID:25866745

  20. Protective Effect of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. Extracts against Ultraviolet B-Induced Damage in Human Keratinocytes

    Directory of Open Access Journals (Sweden)

    Chalinee Ronpirin

    2016-01-01

    Full Text Available This study was aimed at investigating the antioxidant activity of Mangifera indica Linn., Cocos nucifera Linn., and Averrhoa carambola Linn. and their biological effect on human keratinocytes affected by the ultraviolet B (UVB, a major cause of cell damage and skin cancer through induction of DNA damage, production of reactive oxygen species (ROS, and apoptosis. The richest antioxidant activity was found in ethanol fraction of M. indica (21.32 ± 0.66 mg QE/g dry weight, while the lowest one was found in aqueous fractions of M. indica and C. nucifera (1.76 ± 2.10 and 1.65 ± 0.38 mg QE/g dry weight, respectively. Ethanol and aqueous fractions of A. carambola (250 µg/mL significantly reduced the number of apoptotic cells. The expression of cleaved caspase 3 in UVB-treated group was significantly greater than that in untreated group. Both fractions of A. carambola (50, 100, and 250 µg/mL significantly decreased the expression of cleaved caspase 3. Regarding the induction of DNA repair, ethanol (100 and 250 µg/mL and aqueous (50, 100 and 250 µg/mL fractions of A. carambola significantly decreased the percentage of cyclobutane pyrimidine dimers (CPD. Taken together, our results suggest that both fractions of A. carambola may be potentially developed for dermal applications.

  1. Differential cytokine modulation of the genes LAMA3, LAMB3, and LAMC2, encoding the constitutive polypeptides, alpha 3, beta 3, and gamma 2, of human laminin 5 in epidermal keratinocytes.

    Science.gov (United States)

    Korang, K; Christiano, A M; Uitto, J; Mauviel, A

    1995-07-24

    Laminin 5, an anchoring filament protein previously known as nicein/kalinin/epiligrin, consists of three polypeptide chains, alpha 3, beta 3, and gamma 2, encoded by the genes LAMA3, LAMB3, and LAMC2, respectively. The expression of laminin 5 was detected by Northern hybridization with specific cDNA probes in various epidermal keratinocyte cultures, whereas no expression of any of the three genes could be detected in foreskin fibroblast cultures. Transforming growth factor-beta (TGF-beta) enhanced LAMA3, LAMB3, and LAMC2 gene expression in human epidermal keratinocytes, as well as in HaCaT and Balb/K cells in culture, although the extent of enhancement was greater for LAMA3 and LAMC2 genes than for LAMB3. Interestingly, tumor necrosis factor-alpha, (TNF-alpha) alone did not alter the expression of LAMB3 and LAMC2 genes in human epidermal keratinocytes, whereas it inhibited the expression of LAMA3. These results suggest that the expression of the three genes encoding the laminin 5 subunits is not coordinately regulated by the cytokines tested. PMID:7635220

  2. Skin metabolism of aminophenols: Human keratinocytes as a suitable in vitro model to qualitatively predict the dermal transformation of 4-amino-2-hydroxytoluene in vivo

    International Nuclear Information System (INIS)

    4-Amino-2-hydroxytolune (AHT) is an aromatic amine ingredient in oxidative hair colouring products. As skin contact occurs during hair dyeing, characterisation of dermal metabolism is important for the safety assessment of this chemical class. We have compared the metabolism of AHT in the human keratinocyte cell line HaCaT with that observed ex-vivo in human skin and in vivo (topical application versus oral (p.o.) and intravenous (i.v.) route). Three major metabolites of AHT were excreted, i.e. N-acetyl-AHT, AHT-sulfate and AHT-glucuronide. When 12.5 mg/kg AHT was applied topically, the relative amounts of each metabolite were altered such that N-acetyl-AHT product was the major metabolite (66% of the dose in comparison with 37% and 32% of the same applied dose after i.v. and p.o. administration, respectively). N-acetylated products were the only metabolites detected in HaCaT cells and ex-vivo whole human skin discs for AHT and p-aminophenol (PAP), an aromatic amine known to undergo N-acetylation in vivo. Since N-acetyltransferase 1 (NAT1) is the responsible enzyme, kinetics of AHT was further compared to the standard NAT1 substrate p-aminobenzoic acid (PABA) in the HaCaT model revealing similar values for Km and Vmax. In conclusion NAT1 dependent dermal N-acetylation of AHT represents a 'first-pass' metabolism effect in the skin prior to entering the systemic circulation. Since the HaCaT cell model represents a suitable in vitro assay for addressing the qualitative contribution of the skin to the metabolism of topically-applied aromatic amines it may contribute to a reduction in animal testing

  3. Interactive effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin and retinoids on proliferation and differentiation in cultured human keratinocytes: quantification of cross-linked envelope formation

    International Nuclear Information System (INIS)

    Dioxins are potent inducers of chloracne in humans. This skin aberration can be interpreted as an altered differentiation pattern of acinar sebaceous base cells and a change in the rate of terminal differentiation of the keratinocytes. We measured this rate induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in primary cultures of human keratinocytes. As parameters for differentiation, we quantified the 35S-methionine incorporation into cross-linked envelopes (revealing the total CLE biomass), as well as the number of microscopically visible CLEs. It was shown that TCDD is a very potent inducer of both CLE biomass and number with a half-maximal effect concentration (EC50) of 1.4 nM. CLE biomass was maximally increased 10-fold and the number of cells in culture producing a CLE was increased from 15% in control cultures to maximally 75% of the cells in TCDD-treated cultures. Both effects were Ca2+-dependent and increased with elevated cell density, being optimal in post-confluent cultures. Retinoic acid dose-dependently decreased the effect of 10-8 M TCDD, 10-6 M having a nearly complete antagonistic action. This interaction of retinoic acid with TCDD-induced differentiation was non-competitive. Retinol was equally potent as an antagonist of the TCDD-induced elevation of CLE formation as compared with retinoic acid. Retinyl palmitate and etretinate were not very effective as TCDD antagonists. Supplementation of hydrocortisone suppressed the TCDD-induced keratinocyte differentiation. It was concluded that CLE biomass quantification provides a reliable and sensitive parameter for keratinocyte differentiation. In this in vitro system it is shown that TCDD strongly induces a switch from proliferation to terminal differentiation and that this effect can be antagonized effectively by retinoic acid and retinol. (orig.)

  4. Anti-oxidant effects of the extracts from the leaves of Chromolaena odorata on human dermal fibroblasts and epidermal keratinocytes against hydrogen peroxide and hypoxanthine-xanthine oxidase induced damage.

    Science.gov (United States)

    Thang, P T; Patrick, S; Teik, L S; Yung, C S

    2001-06-01

    In cutaneous tissue repair, oxidants and antioxidants play very important roles. In local acute and chronic wounds, oxidants are known to have the ability to cause as cell damage and may function as inhibitory factors to wound healing. The administration of anti-oxidants or free radical scavengers is reportedly helpful, notably in order to limit the delayed sequelae of thermal trauma and to enhance the healing process. Extracts from the leaves of Chromolaena odorata have been shown to be beneficial for treatment of wounds. Studies in vitro of these extracts demonstrated enhanced proliferation of fibroblasts, endothelial cells and keratinocytes, stimulation of keratinocyte migration in an in vitro wound assay, up-regulation of production by keratinocytes of extracellular matrix proteins and basement membrane components, and inhibition of collagen lattice contraction by fibroblasts. In this study, the anti-oxidant effects of both total ethanol and polyphenolic extracts from the plant leaves on hydrogen peroxide and hypoxanthine-xanthine oxidase induced damage to human fibroblasts and keratinocytes were investigated. Cell viability was monitored by a colorimetric assay. The results showed that for fibroblasts, toxicity of hydrogen peroxide or hypoxanthine xanthine oxidase on cells was dose-dependent. Total ethanol extract (TEE) at 400 and 800 microg/ml showed maximum and consistent protective cellular effect on oxidant toxicity at low or high doses of oxidants. The 50 microg/ml concentration of TEE also had significant and slightly protective effects on fibroblasts against hydrogen peroxide and hypoxanthine-xanthine oxidase induced damage, respectively. For keratinocytes, a dose-dependent relationship of oxidant toxicity was only seen with hydrogen peroxide but the protective action of the extract correlated with oxidant dosage. TEE at 400 and 800 microg/ml showed dose-dependent effects with both low and high concentration of oxidants. TEE at 50 microg/ml had no

  5. Cell pattern in adult human corneal endothelium.

    Directory of Open Access Journals (Sweden)

    Carlos H Wörner

    Full Text Available A review of the current data on the cell density of normal adult human endothelial cells was carried out in order to establish some common parameters appearing in the different considered populations. From the analysis of cell growth patterns, it is inferred that the cell aging rate is similar for each of the different considered populations. Also, the morphology, the cell distribution and the tendency to hexagonallity are studied. The results are consistent with the hypothesis that this phenomenon is analogous with cell behavior in other structures such as dry foams and grains in polycrystalline materials. Therefore, its driving force may be controlled by the surface tension and the mobility of the boundaries.

  6. Inhibition of Genotoxic Effects of UVC Radiation on Human Keratinocyte HaCaT Cells by Echinacea Purpurea (L.) Moench Herbal Extract

    International Nuclear Information System (INIS)

    Exposure of skin to ultraviolet (UV) radiation might provoke acute and chronic inflammation and oxidative stress which might cause DNA damage leading to skin photoaging and photocarcinogenesis. Previously we showed that Echinacea purpurea (L.) Moench (EH) extract, rich in phenolic acids, has protective effect on human blood lymphocytes exposed to UVC radiation. In this study we checked whether the pre-treatment of human keratinocyte HaCaT cells with lyophilisate of EH (1 and 10 mg/mL) could reduce or prevent primary DNA damage induced by UVC radiation (253.7 nm) in laboratory conditions. Prior to that experiment we examined cell viability using MTT test upon exposure to EH and UVC (30 and 60 min) alone and in combination. Primary DNA damage in HaCaT cells was studied using the alkaline comet assay. Exposure of cells to EH and UVC alone or EH in combination with UV radiation did not reduce cell viability. Opposite to that UV radiation (30 and 60 min) caused a significant increase in the level of primary DNA damage (P < 0.001). Pre-treatment of cells with both concentrations of EH was not genotoxic to HaCaT cells. Only concentration of 1 mg/mL EH successfully protected the cells against the effects of 30 min exposure to UVC radiation. Positive results obtained in this study speak in favour of continuing the research on effectiveness of Echinacea purpurea preparations and their potential application in developing cosmetic products for skin protection.(author)

  7. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm2) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  8. Tumourigenesis driven by the human papillomavirus type 16 Asian-American e6 variant in a three-dimensional keratinocyte model.

    Directory of Open Access Journals (Sweden)

    Robert Jackson

    Full Text Available Infection with a transforming human papillomavirus (HPV such as type 16 (of species Alphapapillomavirus 9 causes ano-genital and oral tumours via viral persistence in human squamous cell epithelia. Epidemiological studies showed that the naturally occurring HPV16 Asian-American (AA variant (sublineage D2/D3 is found more often than the European Prototype (EP (sublineage A1 in high-grade cervical neoplasia and tumours compared to non-cancer controls. Just three amino acid changes within the early gene, E6, of HPV16 AA have been linked to this augmented tumourigenicity. The AAE6 variant's greater immortalizing and transforming potential over EPE6 has recently been confirmed in retrovirally-transduced keratinocytes expressing the E6 gene only. However, the tumourigenic role of the full-length viral genome of HPV16 has not yet been addressed with regard to these E6 variants. To investigate this process in the context of these two HPV16 E6 genotypes, an organotypic tissue culture model was used to simulate the HPV infectious life cycle. The AAE6 variant demonstrated an enhanced ability over EPE6 to drive the viral life cycle toward tumourigenesis, as evidenced phenotypically-by a more severe grade of epithelial dysplasia with higher proliferation and deregulated differentiation, and molecularly-by high viral oncogene E6 and E7 expression, but lack of productive viral life cycle markers. In contrast, EPE6 had low E6 and E7 but high E1∧E4 expression, indicative of a productive life cycle. We suggest increased viral integration into the host genome for AAE6 as one possible mechanism for these observed differences from EPE6. Additionally, we found downstream effects on immortalization and host innate immune evasion. This study highlights how minor genomic variations in transforming viruses can have a significant affect on their tumourigenic ability.

  9. α6 Integrin and CD44 Enrich for a Primary Keratinocyte Population That Displays Resistance to UV-Induced Apoptosis

    OpenAIRE

    Wray, Helen; Mackenzie, Ian C.; Storey, Alan; Navsaria, Harshad

    2012-01-01

    Epidermal human keratinocytes are exposed to a wide range of environmental genotoxic insults, including the UV component of solar radiation. Epidermal homeostasis in response to cellular or tissue damage is maintained by a population of keratinocyte stem cells (KSC) that reside in the basal layer of the epithelium. Using cell sorting based on cell-surface markers, we have identified a novel α6 integrinhigh+/CD44+ sub-population of basal keratinocytes. These α6 integrinhigh+/CD44+ keratinocyte...

  10. Aberrantly Expressed Genes in HaCaT Keratinocytes Chronically Exposed to Arsenic Trioxide

    OpenAIRE

    Udensi, Udensi K; Cohly, Hari H.P.; Barbara E. Graham-Evans; Kenneth Ndebele; Natàlia Garcia-Reyero; Bindu Nanduri; Tchounwou, Paul B.; Isokpehi, Raphael D.

    2011-01-01

    Inorganic arsenic is a known environmental toxicant and carcinogen of global public health concern. Arsenic is genotoxic and cytotoxic to human keratinocytes. However, the biological pathways perturbed in keratinocytes by low chronic dose inorganic arsenic are not completely understood. The objective of the investigation was to discover the mechanism of arsenic carcinogenicity in human epidermal keratinocytes. We hypothesize that a combined strategy of DNA microarray, qRT-PCR and gene functio...

  11. Lactobacillus rhamnosus GG Inhibits the Toxic Effects of Staphylococcus aureus on Epidermal Keratinocytes

    OpenAIRE

    Mohammedsaeed, Walaa; Andrew J. McBain; Cruickshank, Sheena M.; O'Neill, Catherine A.

    2014-01-01

    Few studies have evaluated the potential benefits of the topical application of probiotic bacteria or material derived from them. We have investigated whether a probiotic bacterium, Lactobacillus rhamnosus GG, can inhibit Staphylococcus aureus infection of human primary keratinocytes in culture. When primary human keratinocytes were exposed to S. aureus, only 25% of the keratinocytes remained viable following 24 h of incubation. However, in the presence of 108 CFU/ml of live L. rhamnosus GG, ...

  12. Xenobiotic metabolism capacities of human skin in comparison with a 3D-epidermis model and keratinocyte-based cell culture as in vitro alternatives for chemical testing: phase II enzymes.

    Science.gov (United States)

    Götz, Christine; Pfeiffer, Roland; Tigges, Julia; Ruwiedel, Karsten; Hübenthal, Ulrike; Merk, Hans F; Krutmann, Jean; Edwards, Robert J; Abel, Josef; Pease, Camilla; Goebel, Carsten; Hewitt, Nicola; Fritsche, Ellen

    2012-05-01

    The 7th Amendment to the EU Cosmetics Directive prohibits the use of animals in cosmetic testing for certain endpoints, such as genotoxicity. Therefore, skin in vitro models have to replace chemical testing in vivo. However, the metabolic competence neither of human skin nor of alternative in vitro models has so far been fully characterized, although skin is the first-pass organ for accidentally or purposely (cosmetics and pharmaceuticals) applied chemicals. Thus, there is an urgent need to understand the xenobiotic-metabolizing capacities of human skin and to compare these activities to models developed to replace animal testing. We have measured the activity of the phase II enzymes glutathione S-transferase, UDP-glucuronosyltransferase and N-acetyltransferase in ex vivo human skin, the 3D epidermal model EpiDerm 200 (EPI-200), immortalized keratinocyte-based cell lines (HaCaT and NCTC 2544) and primary normal human epidermal keratinocytes. We show that all three phase II enzymes are present and highly active in skin as compared to phase I. Human skin, therefore, represents a more detoxifying than activating organ. This work systematically compares the activities of three important phase II enzymes in four different in vitro models directly to human skin. We conclude from our studies that 3D epidermal models, like the EPI-200 employed here, are superior over monolayer cultures in mimicking human skin xenobiotic metabolism and thus better suited for dermatotoxicity testing. PMID:22509834

  13. Have you got any cholesterol? Adults' views of human nutrition

    Science.gov (United States)

    Schibeci, Renato; Wong, Khoon Yoong

    1994-12-01

    The general aim of our human nutrition project is to develop a health education model grounded in ‘everyday’ or ‘situated’ cognition (Hennessey, 1993). In 1993, we began pilot work to document adult understanding of human nutrition. We used a HyperCard stack as the basis for a series of interviews with 50 adults (25 university students, and 25 adults from offcampus). The interviews were transcribed and analysed using the NUDIST computer program. A summary of the views of these 50 adults on selected aspects of human nutrition is presented in this paper.

  14. Human Adult Olfactory Bulb Neurogenesis? Novelty Is the Best Policy

    OpenAIRE

    Macklis, Jeffrey Daniel

    2012-01-01

    There is ongoing controversy as to whether the understanding of adult mammalian neurogenesis gained from rodent studies is applicable to humans. In this issue of Neuron, Bergmann et al. (2012) propose that adult human olfactory bulb neurogenesis with long-term neuronal survival is extremely limited.

  15. Adult Education & Human Resource Development: Overlapping and Disparate Fields

    Science.gov (United States)

    Watkins, Karen E.; Marsick, Victoria J.

    2014-01-01

    Adult education and human resource development as fields of practice and study share some roots in common but have grown in different directions in their histories. Adult education's roots focused initially on citizenship for a democratic society, whereas human resource development's roots are in performance at work. While they have…

  16. APR-246/PRIMA-1(MET) rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations.

    Science.gov (United States)

    Shen, Jinfeng; van den Bogaard, Ellen H; Kouwenhoven, Evelyn N; Bykov, Vladimir J N; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S; Gilissen, Christian; van Heeringen, Simon J; Schalkwijk, Joost; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing

    2013-02-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patient keratinocytes cultured either in submerged 2D cultures or in 3D skin equivalents have impaired epidermal differentiation and stratification. Treatment of these patient keratinocytes with the mutant p53-targeting compound APR-246/PRIMA-1(MET) (p53 reactivation and induction of massive apoptosis) that has been successfully tested in a phase I/II clinical trial in cancer patients partially but consistently rescued morphological features and gene expression during epidermal stratification in both 2D and 3D models. This rescue coincides with restoration of p63 target-gene expression. Our data show that EEC patient keratinocytes with p63 mutations can be used for characterization of the abnormal molecular circuitry in patient skin and may open possibilities for the design of novel pharmacological treatment strategies for patients with mutant p63-associated developmental abnormalities. PMID:23355676

  17. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jones, S.K. (Bristol Royal Infirmary (United Kingdom))

    1992-06-01

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author).

  18. Ultraviolet radiation (UVR) induces cell-surface Ro/SSA antigen expression by human keratinocytes in vitro: a possible mechanism for the UVR induction of cutaneous lupus lesions

    International Nuclear Information System (INIS)

    Antinuclear antibodies are useful markers of connective tissue disease. In this study, UVB but not UVA induced the expression of Ro/SSA antigen on keratinocyte surfaces in vitro. This expression was also found with the extractable nuclear antigens RnP and Sm, but not with single or double-stranded DNA. The expression was prevented by blocking protein synthesis, suggesting that it was an active process. The results suggest that UVB exposure may result in the expression of Ro/SSA antigen on the surfaces of basal keratinocytes in vivo. This antigen could then bind circulating antibody leading to the cutaneous lesions in neonatal and subacute cutaneous lupus erythematosus. (Author)

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    International Nuclear Information System (INIS)

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response

  20. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  1. The human keratinocyte two-dimensional gel protein database (update 1995): mapping components of signal transduction pathways

    DEFF Research Database (Denmark)

    Celis, J E; Rasmussen, H H; Gromov, P;

    1995-01-01

    identified (protein name, organelle components, etc.) using a procedure or a combination of procedures that include (i) comigration with known human proteins, (ii) 2-D gel immunoblotting using specific antibodies, (iii) microsequencing of Coomassie Brilliant Blue stained proteins, (iv) mass spectrometry, (v...

  2. Establishment of primary keratinocyte culture from horse tissue biopsates

    Directory of Open Access Journals (Sweden)

    Jernej OGOREVC

    2015-12-01

    Full Text Available Primary cell lines established from skin tissue can be used in immunological, proteomic and genomic studies as in vitro skin models. The goal of our study was to establish a primary keratinocyte cell culture from tissue biopsates of two horses. The primary keratinocyte cell culture was obtained by mechanical and enzymatic dissociation and with explant culture method. The result was a heterogeneous primary culture comprised of keratinocytes and fibroblasts. To distinguish epithelial and mesenchymal cells immunofluorescent characterisation was performed, using antibodies against cytokeratin 14 and vimentin. We successfully at attained a primary cell line of keratinocytes, which could potentially be used to study equine skin diseases, as an animal model for human diseases, and for cosmetic and therapeutic product testing.

  3. CD44v6 expression in human skin keratinocytes as a possible mechanism for carcinogenesis associated with chronic arsenic exposure

    Directory of Open Access Journals (Sweden)

    S. Huang

    2013-01-01

    Full Text Available Inorganic arsenic is a well-known human skin carcinogen. Chronic arsenic exposure results in various types of human skin lesions, including squamous cell carcinoma (SCC. To investigate whether mutant stem cells participate in arsenic-associated carcinogenesis, we repeatedly exposed the HaCaT cells line to an environmentally relevant level of arsenic (0.05 ppm in vitro for 18 weeks. Following sodium arsenic arsenite administration, cell cycle, colony-forming efficiency (CFE, cell tumorigenicity, and expression of CD44v6, NF-κB and p53, were analyzed at different time points (0, 5, 10, 15, 20, 25 and 30 passages. We found that a chronic exposure of HaCaT cells to a low level of arsenic induced a cancer stem- like phenotype. Furthermore, arsenic-treated HaCaT cells also became tumorigenic in nude mice, their growth cycle was predominantly in G2/M and S phases. Relative to nontreated cells, they exhibited a higher growth rate and a significant increase in CFE. Western blot analysis found that arsenic was capable of increasing cell proliferation and sprouting of cancer stem-like phenotype. Additionally, immunohistochemical analysis demonstrated that CD44v6 expression was up-regulated in HaCaT cells exposed to a low level of arsenic during early stages of induction. The expression of CD44v6 in arsenic-treated cells was positively correlated with their cloning efficiency in soft agar (r=0.949, P=0.01. Likewise, the expressions of activating transcription factor NF-κB and p53 genes in the arsenic-treated HaCaT cells were significantly higher than that in non-treated cells. Higher expressions of CD44v6, NF-κB and p53 were also observed in tumor tissues isolated from Balb/c nude mice. The present results suggest that CD44v6 may be a biomarker of arsenic-induced neoplastic transformation in human skin cells, and that arsenic promotes malignant transformation in human skin lesions through a NF-κB signaling pathway-stimulated expression of CD44v6.

  4. Adult Human Neurogenesis: from Microscopy to Magnetic Resonance Imaging

    Directory of Open Access Journals (Sweden)

    AmandaSierra

    2011-04-01

    Full Text Available Neural stem cells reside in well-defined areas of the adult human brain and are capable of gene-rating new neurons throughout the life span. In rodents, it is well established that the new born neurons are involved in olfaction as well as in certain forms of memory and learning. In humans, the functional relevance of adult human neurogenesis is being investigated, in particular its implication in the etiopathology of a variety of brain disorders. Adult neurogenesis in the human brain was discovered by utilizing methodologies directly imported from the rodent research, such as immunohistological detection of proliferation and cell-type specific biomarkers in postmortem or biopsy tissue. However, in the vast majority of cases, these methods do not support longitudinal studies; thus, the capacity of the putative stem cells to form new neurons under different disease conditions cannot be tested. More recently, new technologies have been specifically developed for the detection and quantification of neural stem cells in the living human brain. These technologies rely on the use of magnetic resonance imaging, available in hospitals worldwide. Although they require further validation in rodents and primates, these new methods hold the potential to test the contribution of adult human neurogenesis to brain function in both health and disease. This review reports on the current knowledge on adult human neurogenesis. We first review the different methods available to assess human neurogenesis, both ex vivo and in vivo and then appraise the changes of adult neurogenesis in human diseases.

  5. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration

    OpenAIRE

    Walaa Mohammedsaeed; Sheena Cruickshank; Andrew J. McBain; Catherine A. O’Neill

    2015-01-01

    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobaci...

  6. High-Glucose Environment Enhanced Oxidative Stress and Increased Interleukin-8 Secretion From Keratinocytes

    OpenAIRE

    Lan, Cheng-Che E.; Wu, Ching-Shuang; Huang, Shu-Mei; Wu, I-Hui; Chen, Gwo-Shing

    2013-01-01

    Impaired wound healing frequently occurs in patients with diabetes. Interleukin (IL)-8 production by keratinocyte is responsible for recruiting neutrophils during healing. Intense inflammation is associated with diabetic wounds, while reduction of neutrophil infiltration is associated with enhanced healing. We hypothesized that increased neutrophil recruitment by keratinocytes may contribute to the delayed healing of diabetic wounds. Using cultured human keratinocytes and a diabetic rat model...

  7. Morphological and biochemical analysis by atomic force microscopy and scanning near-field optical microscopy techniques of human keratinocytes (HaCaT) exposed to extremely low frequency 50 Hz magnetic field

    Science.gov (United States)

    Rieti, Sabrina; Manni, Vanessa; Lisi, Antonella; Grimaldi, Settimio; Generosi, Renato; Luce, Marco; Perfetti, Paolo; Cricenti, Antonio; Pozzi, Deleana; Giuliani, Livio

    2002-10-01

    We studied the effect of the interaction of electromagnetic radiation with human keratinocytes (HaCaT), at low (50 Hz, 1 mT) frequency using both atomic force microscopy (AFM) and scanning near-field optical microscopy (SNOM) techniques. AFM analysis showed modifications in shape and morphology in exposed cells, while SNOM indirect immunofluorescence analysis revealed an increase of segregation of β4 integrin (an adhesion marker) in the cell membrane of the same cells, suggesting that a higher percentage of the exposed cells shows a modified pattern of this adhesion marker.

  8. Role of HuR and p38MAPK in Ultraviolet B-induced Post-transcriptional Regulation of COX-2 Expression in the Human Keratinocyte Cell Line HaCaT*

    OpenAIRE

    Fernau, Niklas S.; Fugmann, Dominik; Leyendecker, Martin; Reimann, Kerstin; Grether-Beck, Susanne; Galban, Stefanie; Ale-Agha, Niloofar; Krutmann, Jean; Klotz, Lars-Oliver

    2009-01-01

    COX-2 (cyclooxygenase-2) is a pivotal player in inflammatory processes, and ultraviolet radiation is a known stimulus for COX-2 expression in skin cells. Here, an induction of COX-2 expression in HaCaT human keratinocytes was observed only upon exposure of cells to UVB (280–320 nm) but not to UVA radiation (320–400 nm), as demonstrated by reverse transcription-PCR and Western blotting. Prostaglandin E2 levels were elevated in cell culture supernatants of HaCaT cells exposed to UVB. COX-2 mRNA...

  9. Light-Induced Cytotoxicity of 16 Polycyclic Aromatic Hydrocarbons on the US EPA Priority Pollutant List in Human Skin HaCaT Keratinocytes: Relationship Between Phototoxicity and Excited State Properties

    OpenAIRE

    Wang, Shuguang; Sheng, Yinghong; Feng, Manliang; Leszczynski, Jerzy; Wang, Lei; Tachikawa, Hiroyasu; Yu, Hongtao

    2007-01-01

    The photocytotoxicity of 16 polycyclic aromatic hydrocarbons (PAHs) on the priority pollutant list of the United States Environmental Protection Agency (US EPA) were tested in human skin HaCaT keratinocytes. A selected PAH was mixed with HaCaT cells and irradiated with a solar simulator lamp for a dose equivalent to 5 min of outdoor sunlight and the cell viability was determined immediately and also after 24 h of incubation. For the cells without incubation after the treatments, it is found t...

  10. Co-cultivation of keratinocyte-human mesenchymal stem cell (hMSC) on sericin loaded electrospun nanofibrous composite scaffold (cationic gelatin/hyaluronan/chondroitin sulfate) stimulates epithelial differentiation in hMSCs: In vitro study.

    Science.gov (United States)

    Bhowmick, Sirsendu; Scharnweber, Dieter; Koul, Veena

    2016-05-01

    Fortifying the scaffold with bioactive molecules and glycosaminoglycans (GAGs), is an efficient way to design new generation tissue engineered biomaterials. In this study, we evaluated the synergistic effect of electrospun nanofibrous composite scaffold (cationic gelatin/hyaluronan/chondroitin sulfate) loaded with sericin and, contact co-culture of human mesenchymal stem cells (hMSCs)-keratinocytes on hMSCs' differentiation towards epithelial lineage. Cationic gelatin is prepared with one step novel synthesis process by grafting quaternary ammonium salts to the backbone of gelatin. Release kinetics studies showed that Fickian diffusion is the major release mechanism for both GAGs and sericin/gelatin. In vitro biocompatibility of the electrospun scaffold was evaluated in terms of LDH and DNA quantification assay on human foreskin fibroblast, human keratinocyte and hMSC. Significant proliferation (∼ 4-6 fold) was detected after culturing all three cell on the electrospun scaffold containing sericin. After 5 days of contact co-culture, results revealed that electrospun scaffold containing sericin promote epithelial differentiation of hMSC in terms of several protein markers (keratin 14, ΔNp63α and Pan-cytokeratin) and gene expression of some dermal proteins (keratin 14, ΔNp63α). Findings of this study will foster the progress of current skin tissue engineering scaffolds by understanding the skin regeneration and wound healing process. PMID:26946262

  11. Adult Literacy Education and Human Rights: A View from Afghanistan

    Science.gov (United States)

    Andersen, Susan M.; Kooij, Christina S.

    2007-01-01

    In this article, we argue that adult literacy as part of international development is an issue of both human rights and women's rights. We explore this by presenting a case study of the effects of one innovative adult literacy program in Afghanistan that places men and women, as well as various ethnicities, together in the same classroom as…

  12. A Polyphenol-Enriched Fraction of Rose Oil Distillation Wastewater Inhibits Cell Proliferation, Migration and TNF-α-Induced VEGF Secretion in Human Immortalized Keratinocytes.

    Science.gov (United States)

    Wedler, Jonas; Rusanov, Krasimir; Atanassov, Ivan; Butterweck, Veronika

    2016-07-01

    Water steam distillation of rose flowers separates the essential oil from the polyphenol-containing rose oil distillation wastewater. Recently, a strategy was developed to separate rose oil distillation wastewater into a polyphenol depleted water fraction and a polyphenol-enriched fraction [RF20-(SP-207)]. The objective of the present study was to investigate RF20-(SP-207) and fraction F(IV), augmented in quercetin and ellagic acid, for possible antiproliferative effects in immortalized human keratinocytes (HaCaT) since rose petals are known to contain compounds with potential antiproliferative activity.RF20-(SP-207) revealed dose-dependent antiproliferative activity (IC50 of 9.78 µg/mL). In a nontoxic concentration of 10 µg/mL, this effect was stronger than that of the two positive controls LY294002 (10 µM, PI3 K-inhibitor, 30 % inhibition) and NVP-BEZ235 (100 nM, dual PI3 K/mTOR inhibitor, 30 % inhibition) and clearly exceeded the antiproliferative action of quercetin (50 µM, 25 % inhibition) and ellagic acid (1 µM, 15 % inhibition). Time-lapse microscopy detected a significant impairment of cell migration of RF20-(SP-207) and F(IV). At concentrations of 10 µg/mL of both, extract and fraction, cell migration was strongly suppressed (51 % and 28 % gap closure, respectively, compared to 95 % gap closure 24 hours after control treatment). The suppression of cell migration was comparable to the positive controls LY294002, NVP-BEZ235, and quercetin. Furthermore, basal and TNF-α-stimulated VEGF-secretion was significantly reduced by RF20-(SP-207) and F(IV) at 10 µg/mL (44 % vs. untreated control).In conclusion, RF20-(SP-207) showed promising antiproliferative and antimigratory effects and could be developed as a supportive, therapy against hyperproliferation-involved skin diseases. PMID:27093251

  13. Dopaminerge Differenzierung adulter humaner hippocampaler Stammzellen

    OpenAIRE

    Türk, Matthias

    2013-01-01

    Hintergrund und Ziele: Nachdem seit der ersten Hälfte des letzten Jahrhunderts durch mehrere Experimente adulte Neurogenese schließlich nachgewiesen und somit Cajals Dogma widerlegt werden konnte, erlebten die Neurowissenschaften durch die Möglichkeit zur Isolation adulter neuraler Stammzellen ein exponentielles Wachstum. Gleichzeitig mit der basiswissenschaftlichen Aufarbeitung der adulten Neurogenese sowohl im Tier, als auch im Menschen, kam die Idee der therapeutischen Verwendung dieser, v...

  14. Functional analysis of ZFP36 proteins in keratinocytes.

    Science.gov (United States)

    Prenzler, Frauke; Fragasso, Annunziata; Schmitt, Angelika; Munz, Barbara

    2016-08-01

    The ZFP36 family of zinc finger proteins, including ZFP36, ZFP36L1, and ZFP36L2, regulates the production of growth factors and cytokines via destabilization of the respective mRNAs. We could recently demonstrate that in cultured keratinocytes, expression of the ZFP36, ZFP36L1, and ZFP36L2 genes is induced by growth factors and cytokines and that ZFP36L1 is a potent regulator of keratinocyte VEGF production. We now further analyzed the localization and function of ZFP36 proteins in the skin, specifically in epidermal keratinocytes. We found that in human epidermis, the ZFP36 protein could be detected in basal and suprabasal keratinocytes, whereas ZFP36L1 and ZFP36L2 were expressed mainly in the basal layer, indicating different and non-redundant functions of the three proteins in the epidermis. Consistently, upon inhibition of ZFP36 or ZFP36L1 expression using specific siRNAs, there was no major effect on expression of the respective other gene. In addition, we demonstrate that both ZFP36 and ZFP36L1 influence keratinocyte cell cycle, differentiation, and apoptosis in a distinct manner. Finally, we show that similarly as ZFP36L1, ZFP36 is a potent regulator of keratinocyte VEGF production. Thus, it is likely that both proteins regulate angiogenesis via paracrine mechanisms. Taken together, our results suggest that ZFP36 proteins might control reepithelialization and angiogenesis in the skin in a multimodal manner. PMID:27182009

  15. Distinctive molecular responses to ultraviolet radiation between keratinocytes and melanocytes.

    Science.gov (United States)

    Sun, Xiaoyun; Kim, Arianna; Nakatani, Masashi; Shen, Yao; Liu, Liang

    2016-09-01

    Solar ultraviolet radiation (UVR) is the major risk factor for skin carcinogenesis. To gain new insights into the molecular pathways mediating UVR effects in the skin, we performed comprehensive transcriptomic analyses to identify shared and distinctive molecular responses to UVR between human keratinocytes and melanocytes. Keratinocytes and melanocytes were irradiated with varying doses of UVB (10, 20 and 30 mJ/cm(2) ) then analysed by RNA-Seq at different time points post-UVB radiation (4, 24 and 72 h). Under basal conditions, keratinocytes and melanocytes expressed similar number of genes, although they each expressed a distinctive subset of genes pertaining to their specific cellular identity. Upon UVB radiation, keratinocytes displayed a clear pattern of time- and dose-dependent changes in gene expression that was different from melanocytes. The early UVB-responsive gene set (4 h post-UVR) differed significantly from delayed UVB-responsive gene sets (24 and 72 h). We also identified multiple novel UVB signature genes including PRSS23, SERPINH1, LCE3D and CNFN, which were conserved between melanocyte and keratinocyte lines from different individuals. Taken together, our findings elucidated both common and distinctive molecular features between melanocytes and keratinocytes and uncovered novel UVB signature genes that might be utilized to predict UVB photobiological effects on the skin. PMID:27119462

  16. Inhibitors of cysteine cathepsin and calpain do not prevent ultraviolet-B-induced apoptosis in human keratinocytes and HeLa cells

    DEFF Research Database (Denmark)

    Bang, Bo; Baadsgaard, Ole; Skov, Lone;

    2004-01-01

    Caspases, members of the cysteine protease family, execute UVB-induced apoptosis in several cell lines and keratinocytes. Several researchers investigating UVB-induced apoptosis have demonstrated a dose-dependent protective effect of the synthetic peptide caspase inhibitor zVAD-fmk. However, z......VAD-fmk displays a dose-dependent protective effect against UVB-induced apoptosis, even at doses higher than those required to block all known proapoptotic caspases. In addition, it is known that zVAD-fmk also inhibits other cysteine proteases including cathepsins and calpains, and these proteases have recently...... been demonstrated to play a role in the execution of programmed cell death induced by other stimuli, e.g. TNF-alpha. The purpose of the present study was therefore to investigate whether inhibitors of cysteine cathepsins and calpains could prevent UVB-induced apoptosis in HeLa cells and keratinocytes...

  17. Bacteriology of moderate (chronic) periodontitis in mature adult humans.

    OpenAIRE

    Moore, W E; Holdeman, L V; Cato, E P; Smibert, R M; Burmeister, J A; Ranney, R R

    1983-01-01

    A total of 171 taxa was represented among 1,900 bacterial isolates from 60 samples of sites affected with moderate periodontitis in 22 mature adult humans. The composition of the subgingival sulcus flora was statistically significantly different from that of the adjacent supragingival flora and the subgingival flora of 14 people with healthy gingiva, but was not significantly different from that of sulci affected with severe periodontitis in 21 young human adults. The sulcus floras of moderat...

  18. Editorial: Technology for higher education, adult learning and human performance

    OpenAIRE

    Minhong Wang; Chi-Cheng Chang; Feng Wu

    2013-01-01

    This special issue is dedicated to technology-enabled approaches for improving higher education, adult learning, and human performance. Improvement of learning and human development for sustainable development has been recognized as a key strategy for individuals, institutions, and organizations to strengthen their competitive advantages. It becomes crucial to help adult learners and knowledge workers to improve their self-directed and life-long learning capabilities. Meanwhile, advances in t...

  19. Effect of Spa Spring Water on Cytokine Expression in Human Keratinocyte HaCaT Cells and on Differentiation of CD4+ T Cells

    OpenAIRE

    Lee, Ho-Pyo; Choi, Yoon-Jung; Cho, Kyung-Ah; Woo, So-Youn; Yun, Seong-Taek; Lee, Jong Tae; Kim, Hong Jig; Lee, Kyung-Ho; Kim, Jin-Wou

    2012-01-01

    Background Skin acts as the first line of defense against any foreign materials outside of our body. In inflammatory skin disease, the pathogenesis is due to an immune reaction in the keratinocytes, immune cells and soluble mediators. Balneotherapy is widely used for the treatment of inflammatory skin disease, but the mechanisms are only partly understood by immune regulation. Balneotherapy in dermatologic disease can affect the secretion of pro-inflammatory cytokines, IL-1α and tumor necrosi...

  20. The Peroxisome Proliferator-Activated Receptor Gamma System Regulates Ultraviolet B-Induced Prostaglandin E2 Production in Human Epidermal Keratinocytes

    OpenAIRE

    Konger, Raymond L.; Kellie Clay Martel; Danielle Jernigan; Qiwei Zhang; Travers, Jeffrey B.

    2010-01-01

    Studies using PPARγ agonists in mouse skin have suggested that peroxisome proliferator-activated receptor gamma (PPARγ) is irrelevant to cutaneous photobiology. However, in several epithelial cell lines, ultraviolet B (UVB) has been shown to induce the nonenzymatic production of oxidized phospholipids that act as PPARγ agonists. UVB is also a potent inducer of prostaglandin E2  (PGE2) production and COX-2 expression in keratinocytes and PPARγ is coupled to increased PGE2 production in other...

  1. Matrix metalloproteinases-2,-3,-7,-9 and-10, but not MMP-11, are differentially expressed in normal, benign tumorigenic and malignant human keratinocyte cell lines

    OpenAIRE

    Bachmeier, B. E.; Boukamp, P.; Lichtinghagen, R.; Fusenig, N. E.; E Fink

    2000-01-01

    In order to investigate the correlations between constitutive proteinase expression and the degree of tumorigenicity of cancer cells we have studied a model system of three keratinocyte cell lines. RT-PCR studies showed that the cell lines express the genes of matrix metalloproteinase-2, -3, -7, -9, -10 and -11, indicating that they are able to synthesize the corresponding enzymes. Actual MMP synthesis was proven by zymography and Western blotting. In conditioned media gelatinolytic activitie...

  2. Effect of Wnt3a on Keratinocytes Utilizing in Vitro and Bioinformatics Analysis

    Directory of Open Access Journals (Sweden)

    Ju-Suk Nam

    2014-03-01

    Full Text Available Wingless-type (Wnt signaling proteins participate in various cell developmental processes. A suppressive role of Wnt5a on keratinocyte growth has already been observed. However, the role of other Wnt proteins in proliferation and differentiation of keratinocytes remains unknown. Here, we investigated the effects of the Wnt ligand, Wnt3a, on proliferation and differentiation of keratinocytes. Keratinocytes from normal human skin were cultured and treated with recombinant Wnt3a alone or in combination with the inflammatory cytokine, tumor necrosis factor α (TNFα. Furthermore, using bioinformatics, we analyzed the biochemical parameters, molecular evolution, and protein–protein interaction network for the Wnt family. Application of recombinant Wnt3a showed an anti-proliferative effect on keratinocytes in a dose-dependent manner. After treatment with TNFα, Wnt3a still demonstrated an anti-proliferative effect on human keratinocytes. Exogenous treatment of Wnt3a was unable to alter mRNA expression of differentiation markers of keratinocytes, whereas an altered expression was observed in TNFα-stimulated keratinocytes. In silico phylogenetic, biochemical, and protein–protein interaction analysis showed several close relationships among the family members of the Wnt family. Moreover, a close phylogenetic and biochemical similarity was observed between Wnt3a and Wnt5a. Finally, we proposed a hypothetical mechanism to illustrate how the Wnt3a protein may inhibit the process of proliferation in keratinocytes, which would be useful for future researchers.

  3. Peroxisome Proliferator-Activated Receptor-alpha Is a Functional Target of p63 in Adult Human Keratinocytes

    DEFF Research Database (Denmark)

    Pozzi, Silvia; Boergesen, Michael; Sinha, Satrajit;

    2009-01-01

    recognizable p63-binding motif, suggesting that it acts through interactions with other transcription factors (TFs). Distinct PPARalpha transcripts are differentially regulated by p63, indicating a bimodal action in promoter and/or transcription start specification. PPARalpha repression is consistent with lack...

  4. Lactobacillus reuteri protects epidermal keratinocytes from Staphylococcus aureus-induced cell death by competitive exclusion.

    Science.gov (United States)

    Prince, Tessa; McBain, Andrew J; O'Neill, Catherine A

    2012-08-01

    Recent studies have suggested that the topical application of probiotic bacteria can improve skin health or combat disease. We have utilized a primary human keratinocyte culture model to investigate whether probiotic bacteria can inhibit Staphylococcus aureus infection. Evaluation of the candidate probiotics Lactobacillus reuteri ATCC 55730, Lactobacillus rhamnosus AC413, and Lactobacillus salivarius UCC118 demonstrated that both L. reuteri and L. rhamnosus, but not L. salivarius, reduced S. aureus-induced keratinocyte cell death in both undifferentiated and differentiated keratinocytes. Keratinocyte survival was significantly higher if the probiotic was applied prior to (P 0.05). The protective effect of L. reuteri was not dependent on the elaboration of inhibitory substances such as lactic acid. L. reuteri inhibited adherence of S. aureus to keratinocytes by competitive exclusion (P = 0.026). L. salivarius UCC118, however, did not inhibit S. aureus from adhering to keratinocytes (P > 0.05) and did not protect keratinocyte viability. S. aureus utilizes the α5β1 integrin to adhere to keratinocytes, and blocking of this integrin resulted in a protective effect similar to that observed with probiotics (P = 0.03). This suggests that the protective mechanism for L. reuteri-mediated protection of keratinocytes was by competitive exclusion of the pathogen from its binding sites on the cells. Our results suggest that use of a topical probiotic prophylactically could inhibit the colonization of skin by S. aureus and thus aid in the prevention of infection. PMID:22582077

  5. Methylparaben potentiates UV-induced damage of skin keratinocytes

    International Nuclear Information System (INIS)

    For many years, methylparaben (MP) has been used as a preservative in cosmetics. In this study, we investigated the effects of ultraviolet-B (UVB) exposure on MP-treated human skin keratinocytes. HaCaT keratinocyte was cultured in MP-containing medium for 24 h, exposed to UVB (15 or 30 mJ/cm2) and further cultured for another 24 h. Subsequent cellular viability was quantified by MTT-based assay and cell death was qualified by fluorescent microscopy and flow cytometry. Oxidative stress, nitric oxide (NO) production and cellular lipid peroxidation were measured using fluorescent probes. In addition, activation of nuclear factor kappa B and activator protein-1 was assessed by electro-mobility gel-shift assay. Practical concentrations of MP (0.003%) had a little or no effect on cellular viability, oxidative stress, NO production, lipid peroxidation and activation of nuclear transcription factors in HaCaT keratinocytes. Low-dose UVB also had little or no effect on these parameters in HaCaT keratinocytes. However, UVB exposure significantly increased cell death, oxidative stress, NO production, lipid peroxidation and activation of transcription factors in MP-treated HaCaT keratinocytes. These results indicate that MP, which has been considered a safe preservative in cosmetics, may have harmful effects on human skin when exposed to sunlight

  6. Expression of the cystic fibrosis gene in adult human lung.

    OpenAIRE

    Engelhardt, J F; Zepeda, M; Cohn, J.A.; Yankaskas, J R; Wilson, J. M.

    1994-01-01

    Critical to an understanding of the pulmonary disease in cystic fibrosis (CF) and the development of effective gene therapies is a definition of the distribution and regulation of CF gene expression in adult human lung. Previous studies have detected the product of the CF gene, the CF transmembrane conductance regulator (CFTR), in submucosal glands of human bronchi. In this report, we have characterized the distribution of CFTR RNA and protein in the distal airway and alveoli of human lungs. ...

  7. The Asian-American variant of human papillomavirus type 16 exhibits higher activation of MAPK and PI3K/AKT signaling pathways, transformation, migration and invasion of primary human keratinocytes.

    Science.gov (United States)

    Hochmann, Jimena; Sobrinho, João S; Villa, Luisa L; Sichero, Laura

    2016-05-01

    Asian-American (AA) HPV-16 variants are associated with higher risk of cancer. Abnormal activation of intracellular signaling play a critical role in cancer development and progression. Our aim was to elucidate mechanisms underlying the higher oncogenic potential attributed to AA variant. We evaluated activation of MAPK and PI3K/AKT pathways in primary human keratinocytes (PHKs) transduced with E6/E7 of three HPV-16 variants: E-P, AA, E-350G. Phenotypes examined included migration, anchorage independent growth and invasion. AA PHKs presented the highest levels of active proteins involved in all cascades analyzed: MAPK-ERK, MAPK-p38 and PI3K-AKT. AA PHKs were more efficient in promoting anchorage independent growth, and in stimulating cell migration and invasion. MEK1 inhibition decreased migration. The mesenchymal phenotype marker vimentin was increased in AA PHKs. Our results suggest that MEK1, ERK2, AKT2 hyperactivation influence cellular behavior by means of GSK-3b inactivation and EMT induction prompting AA immortalized PHKs to more efficiently surpass carcinogenesis steps. PMID:26945151

  8. Review on Adult Neurogenesis in Humans and Other Mammals

    OpenAIRE

    Tesfamichael Berhe

    2015-01-01

    Research in the field of adult neurogenesis has recently indicated significant progress.The objective of this paper is to review the basic concepts, new findings and clinical implications of neurogenesis making emphasis on the significance, especially in humans. Although scientists still debate the extent and purpose of neurogenesis in the adult brain, research has identified certain areas of the brain where it is most evident. These areas include the hippocampus, caudate nucleus, and olfacto...

  9. Ultrastructural evaluation of human keratinocyte growth and differentiation on a fibrin substrate Avaliação ultraestrutural do crescimento e da diferenciação de queratinócitos sobre um substrato de fibrina

    Directory of Open Access Journals (Sweden)

    Daniela Yukie Sakai Tanikawa

    2010-12-01

    Full Text Available PURPOSE: In order to circumvent several difficulties that have been met in the routine use of the in vitro keratinocyte cultures using the standard procedure described by Rheinwald and Green, and obtain a more resilient and the least possible immunogeneic skin substitute for a future clinical application, this work studied a new keratinocyte culture system, which envisages the utilization of a fibrin substrate in association with high densities of human keratinocytes. METHODS: Through light and transmission electron microscopy and immunohistochemical assays, long-term proliferative and differentiative characteristics of keratinocytes cultured onto a fibrin gel under immerse and air-liquid interface culture conditions were evaluated. RESULTS: Despite the absence of a dermal substitute, the results demonstrated that the proposed composite was constituted of a transparent and elastic fibrin film covered by a well-attached, multistratified epithelium with morphological characteristics that resemble human epidermis, including the neoformation, albeit incomplete, of the basement membrane. CONCLUSIONS: Increased mechanical resistance due to the presence of an easy handling substrate, the delivery of nonclonfluent keratinocytes as well as the removal of animal-derived cells from the culture system suggest its potential use for future transplantation purposes.OBJETIVO: Com o intuito de contornar diversas dificuldades encontradas no uso rotineiro de queratinócitos cultivados in vitro pela técnica descrita por Rheinwald e Green, e obter um substituto cutâneo mais resistente e o menos imunogênico possível para futuras aplicações clínicas, este trabalho avaliou um novo sistema de cultura de queratinócitos que prevê a utilização de um substrato de fibrina em associação com queratinócitos humanos em alta densidade. MÉTODOS: Através de microscopia óptica e eletrônica e análise imunohistoquímica, foram avaliadas as caracter

  10. Adult human metapneumonovirus (hMPV) pneumonia mimicking Legionnaire's disease.

    Science.gov (United States)

    Cunha, Burke A; Irshad, Nadia; Connolly, James J

    2016-01-01

    In adults hospitalized with viral pneumonias the main differential diagnostic consideration is influenza pneumonia. The respiratory viruses causing viral influenza like illnesses (ILIs), e.g., RSV may closely resemble influenza. Rarely, extrapulmonary findings of some ILIs may resemble Legionnaire's disease (LD), e.g., adenovirus, human parainfluenza virus (HPIV-3). We present a most unusual case of human metapneumonovirus pneumonia (hMPV) with some characteristic extrapulmonary findings characteristic of LD, e.g., relative bradycardia, as well as mildly elevated serum transaminases and hyphosphatemia. We believe this is the first reported case of hMPV pneumonia in a hospitalized adult that had some features of LD. PMID:26988110

  11. Sphingolipid metabolism in organotypic mouse keratinocyte cultures.

    Science.gov (United States)

    Madison, K C; Swartzendruber, D C; Wertz, P W; Downing, D T

    1990-12-01

    Ceramides are the dominant component of the stratum corneum intercellular lipid lamellae, which constitute the epidermal permeability barrier. Only pig and human epidermal ceramides have been extensively characterized and the structures of the ceramides of cultured keratinocytes have not been previously investigated. In the present studies, we have characterized the ceramides synthesized by organotypic lifted mouse keratinocyte cultures for the first time and compared them to the ceramides of intact mouse epidermis. Both mouse epidermis and cultures contained five ceramides, ceramide 1 being the least polar and ceramide 5 the most polar. Ceramide 1 was a group of acylceramides, i.e., very-long-chain omega-hydroxyceramides with an ester-linked nonhydroxy fatty acid. Ceramide 2 contained medium-length saturated nonhydroxy fatty acids. (In culture, the ceramide 2 band was split into two parts with the slightly more polar ceramide 2' containing short-chain saturated nonhydroxy fatty acids.) Ceramide 5 contained short-chain alpha-hydroxy fatty acids. The structures of ceramides 1, 2, and 5 were analagous to those of pig and human epidermis. Mouse epidermal ceramide 3 was quite unusual, containing beta-hydroxy fatty acids, a structure not previously identified among mammalian ceramides. In contrast, culture ceramide 3 was composed of omega-hydroxy fatty acids with a chain-length distribution similar to that of ceramide 1. Mouse ceramide 4 was composed of fatty acids with chromatographic mobility similar to hydroxy fatty acids but with different chemical reactivity; it remains only partially characterized. Culture ceramide 4 was present in quantities too small for analysis. All ceramides in mouse epidermis and cultures contained only sphingosine bases, whereas pig and human ceramides also contain phytosphingosine. These results indicate that considerable diversity of ceramide structures occurs among mammalian species and that cultured keratinocytes may only partially

  12. New facets of keratin K77: interspecies variations of expression and different intracellular location in embryonic and adult skin of humans and mice.

    Science.gov (United States)

    Langbein, Lutz; Reichelt, Julia; Eckhart, Leopold; Praetzel-Wunder, Silke; Kittstein, Walter; Gassler, Nikolaus; Schweizer, Juergen

    2013-12-01

    The differential expression of keratins is central to the formation of various epithelia and their appendages. Structurally, the type II keratin K77 is closely related to K1, the prototypical type II keratin of the suprabasal epidermis. Here, we perform a developmental study on K77 expression in human and murine skin. In both species, K77 is expressed in the suprabasal fetal epidermis. While K77 appears after K1 in the human epidermis, the opposite is true for the murine tissue. This species-specific pattern of expression is also found in conventional and organotypic cultures of human and murine keratinocytes. Ultrastructure investigation shows that, in contrast to K77 intermediate filaments of mice, those of the human ortholog are not attached to desmosomes. After birth, K77 disappears without deleterious consequences from human epidermis while it is maintained in the adult mouse epidermis, where its presence has so far gone unnoticed. After targeted Krt1 gene deletion in mice, K77 is normally expressed but fails to functionally replace K1. Besides the epidermis, both human and mouse K77 are present in luminal duct cells of eccrine sweat glands. The demonstration of a K77 ortholog in platypus but not in non-mammalian vertebrates identifies K77 as an evolutionarily ancient component of the mammalian integument that has evolved different patterns of intracellular distribution and adult tissue expression in primates. PMID:24057875

  13. The weight of nations: an estimation of adult human biomass

    Directory of Open Access Journals (Sweden)

    Walpole Sarah

    2012-06-01

    Full Text Available Abstract Background The energy requirement of species at each trophic level in an ecological pyramid is a function of the number of organisms and their average mass. Regarding human populations, although considerable attention is given to estimating the number of people, much less is given to estimating average mass, despite evidence that average body mass is increasing. We estimate global human biomass, its distribution by region and the proportion of biomass due to overweight and obesity. Methods For each country we used data on body mass index (BMI and height distribution to estimate average adult body mass. We calculated total biomass as the product of population size and average body mass. We estimated the percentage of the population that is overweight (BMI > 25 and obese (BMI > 30 and the biomass due to overweight and obesity. Results In 2005, global adult human biomass was approximately 287 million tonnes, of which 15 million tonnes were due to overweight (BMI > 25, a mass equivalent to that of 242 million people of average body mass (5% of global human biomass. Biomass due to obesity was 3.5 million tonnes, the mass equivalent of 56 million people of average body mass (1.2% of human biomass. North America has 6% of the world population but 34% of biomass due to obesity. Asia has 61% of the world population but 13% of biomass due to obesity. One tonne of human biomass corresponds to approximately 12 adults in North America and 17 adults in Asia. If all countries had the BMI distribution of the USA, the increase in human biomass of 58 million tonnes would be equivalent in mass to an extra 935 million people of average body mass, and have energy requirements equivalent to that of 473 million adults. Conclusions Increasing population fatness could have the same implications for world food energy demands as an extra half a billion people living on the earth.

  14. Antioxidants protect keratinocytes against M. ulcerans mycolactone cytotoxicity.

    Directory of Open Access Journals (Sweden)

    Alvar Grönberg

    Full Text Available BACKGROUND: Mycobacterium ulcerans is the causative agent of necrotizing skin ulcerations in distinctive geographical areas. M. ulcerans produces a macrolide toxin, mycolactone, which has been identified as an important virulence factor in ulcer formation. Mycolactone is cytotoxic to fibroblasts and adipocytes in vitro and has modulating activity on immune cell functions. The effect of mycolactone on keratinocytes has not been reported previously and the mechanism of mycolactone toxicity is presently unknown. Many other macrolide substances have cytotoxic and immunosuppressive activities and mediate some of their effects via production of reactive oxygen species (ROS. We have studied the effect of mycolactone in vitro on human keratinocytes--key cells in wound healing--and tested the hypothesis that the cytotoxic effect of mycolactone is mediated by ROS. METHODOLOGY/PRINCIPAL FINDINGS: The effect of mycolactone on primary skin keratinocyte growth and cell numbers was investigated in serum free growth medium in the presence of different antioxidants. A concentration and time dependent reduction in keratinocyte cell numbers was observed after exposure to mycolactone. Several different antioxidants inhibited this effect partly. The ROS inhibiting substance deferoxamine, which acts via chelation of Fe(2+, completely prevented mycolactone mediated cytotoxicity. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that mycolactone mediated cytotoxicity can be inhibited by deferoxamine, suggesting a role of iron and ROS in mycolactone induced cytotoxicity of keratinocytes. The data provide a basis for the understanding of Buruli ulcer pathology and the development of improved therapies for this disease.

  15. Keratinocyte dysfunction in vitiligo epidermis: cytokine microenvironment and correlation to keratinocyte apoptosis

    OpenAIRE

    Moretti, Silvia; Fabbri, Paolo; Baroni, Gianna; Berti, Samantha; Ban, Daniele; Berti, Emilio; Nassini, Romina; Lotti, Torello; Massi, Daniela

    2009-01-01

    Vitiligo is a skin disorder characterized by loss of functional melanocytes. Keratinocytes contribute to melanocyte homeostasis, and keratinocyte alteration may play a role in melanocyte dysfunction in vitiligo. In particular, the release of melanogenic mediators and the level of functioning keratinocytes may affect melanocyte dysfunction in vitiligo epidermis. Keratinocyte-derived mediators involved in pigmentation, analysed by in situ hybridization, and epidermal apo...

  16. Two adult human voxel phantoms based on polygon mesh surfaces

    International Nuclear Information System (INIS)

    Among computational models used in radiation protection, voxel phantoms based on computer tomographic (CT), nuclear magnetic resonance (NMR) or colour photographic images, became very popular in recent years. Although being a true to nature representation of the scanned individual the scanning is usually made in supine position, which causes a shift of internal organs towards the ribcage, a compression of the lungs and a reduction of the sagittal diameter especially in the abdominal region compared to the anatomy of a person in upright standing position, which in turn can influence absorbed or equivalent dose estimates. This study proposes a method for human phantom design using tools recently developed in the areas of computer graphics and animated films and applies them to the creation and modeling of artificial 3D human organs and tissues. Two models, a male and a female adult human phantom have been developed based on anatomical atlases, observing at the same time the anatomical specifications published by the International Commission on Radiological Protection for the male and female reference adult. The phantoms are called FAXAA (Female Adult voXelAverage-Average) and MAXAA (Male Adult voXelAverage-Average) because they represent female and male adults with average weight and average height. (author)

  17. Human Papillomavirus Type 16 E5 Protein Induces Expression of Beta Interferon through Interferon Regulatory Factor 1 in Human Keratinocytes

    OpenAIRE

    Muto, Valentina; Stellacci, Emilia; Lamberti, Angelo Giuseppe; Perrotti, Edvige; Carrabba, Aurora; Matera, Giovanni; Sgarbanti, Marco; Battistini, Angela; Liberto, Maria Carla; Focà, Alfredo

    2011-01-01

    Crucial steps in high-risk human papillomavirus (HR-HPV)-related carcinogenesis are the integration of HR-HPV into the host genome and loss of viral episomes. The mechanisms that promote cervical neoplastic progression are, however, not clearly understood. During HR-HPV infection, the HPV E5 protein is expressed in precancerous stages but not after viral integration. Given that it has been reported that loss of HPV16 episomes and cervical tumor progression are associated with increased expres...

  18. An anatomically comprehensive atlas of the adult human brain transcriptome

    NARCIS (Netherlands)

    Hawrylycz, M.J.; Beckmann, C.F.; et al., et al.

    2012-01-01

    Neuroanatomically precise, genome-wide maps of transcript distributions are critical resources to complement genomic sequence data and to correlate functional and genetic brain architecture. Here we describe the generation and analysis of a transcriptional atlas of the adult human brain, comprising

  19. Efficient keratinocyte differentiation strictly depends on JNK-induced soluble factors in fibroblasts.

    Science.gov (United States)

    Schumacher, Marion; Schuster, Christian; Rogon, Zbigniew M; Bauer, Tobias; Caushaj, Nevisa; Baars, Sebastian; Szabowski, Sibylle; Bauer, Christine; Schorpp-Kistner, Marina; Hess, Jochen; Holland-Cunz, Stefan; Wagner, Erwin F; Eils, Roland; Angel, Peter; Hartenstein, Bettina

    2014-05-01

    Previous studies demonstrated that fibroblast-derived and JUN-dependent soluble factors have a crucial role on keratinocyte proliferation and differentiation during cutaneous wound healing. Furthermore, mice with a deficiency in Jun N-terminal kinases (JNKs) , JNK1 or JNK2, showed impaired skin development and delayed wound closure. To decipher the role of dermal JNK in keratinocyte behavior during these processes, we used a heterologous coculture model combining primary human keratinocytes and murine fibroblasts. Although cocultured JNK1/JNK2-deficient fibroblasts did not affect keratinocyte proliferation, temporal monitoring of the transcriptome of differentiating keratinocytes revealed that efficient keratinocyte differentiation not only requires the support by fibroblast-derived soluble factors, but is also critically dependent on JNK1 and JNK2 signaling in these cells. Moreover, we showed that the repertoire of fibroblast transcripts encoding secreted proteins is severely disarranged upon loss of JNK under the coculture conditions applied. Finally, our data demonstrate that efficient keratinocyte terminal differentiation requires constant presence of JNK-dependent and fibroblast-derived soluble factors. Taken together, our results imply that mesenchymal JNK has a pivotal role in the paracrine cross talk between dermal fibroblasts and epidermal keratinocytes during wound healing. PMID:24335928

  20. Telocytes of the human adult trigeminal ganglion.

    Science.gov (United States)

    Rusu, Mugurel Constantin; Cretoiu, Dragos; Vrapciu, Alexandra Diana; Hostiuc, Sorin; Dermengiu, Dan; Manoiu, Vasile Sorin; Cretoiu, Sanda Maria; Mirancea, Nicolae

    2016-06-01

    Telocytes (TCs) are typically defined as cells with telopodes by their ultrastructural features. Their presence was reported in various organs, however little is known about their presence in human trigeminal ganglion. To address this issue, samples of trigeminal ganglia were tested by immunocytochemistry for CD34 and examined by transmission electron microscopy (TEM). We found that TCs are CD34 positive and form networks within the ganglion in close vicinity to microvessels and nerve fibers around the neuronal-glial units (NGUs). TEM examination confirmed the existence of spindle-shaped and bipolar TCs with one or two telopodes measuring between 15 to 53 μm. We propose that TCs are cells with stemness capacity which might contribute in regeneration and repair processes by: modulation of the stem cell activity or by acting as progenitors of other cells present in the normal tissue. In addition, further studies are needed to establish if they might influence the neuronal circuits. PMID:27147447

  1. A Two-Stepped Culture Method for Efficient Production of Trichogenic Keratinocytes.

    Science.gov (United States)

    Chan, Chih-Chieh; Fan, Sabrina Mai-Yi; Wang, Wei-Hung; Mu, Yi-Fen; Lin, Sung-Jan

    2015-10-01

    Successful hair follicle (HF) neogenesis in adult life depends on the existence of both capable dermal cells and competent epidermal keratinocytes that recapitulate embryonic organogenesis through epithelial-mesenchymal interaction. In tissue engineering, the maintenance of trichogenic potential of adult epidermal cells, while expanding them remains a challenging issue. We found that although HF outer root sheath keratinocytes could be expanded for more than 100 passages as clonogenic cells without losing the proliferative potential with a 3T3J2 fibroblast feeder layer, these keratinocytes were unable to form new HFs when combined with inductive HF dermal papilla (DP) cells. However, when these high-passage keratinocytes were cocultured with HF DP cells for 4 days in vitro, they regained the trichogenic ability to form new HFs after transplantation. We found that the short-term coculture with DP cells enhanced both Wnt/β-catenin signaling, a signaling cascade key to HF development, and upregulated the expression of HF-specific genes, including K6, K16, K17, and K75, in keratinocytes, indicating that these cells were poised toward a HF fate. Hence, efficient production of trichogenic keratinocytes can be obtained by a two-stepped procedure with initial cell expansion with a 3T3J2 fibroblast feeder followed by short-term coculture with DP cells. PMID:25951188

  2. Editorial: Technology for higher education, adult learning and human performance

    Directory of Open Access Journals (Sweden)

    Minhong Wang

    2013-09-01

    Full Text Available This special issue is dedicated to technology-enabled approaches for improving higher education, adult learning, and human performance. Improvement of learning and human development for sustainable development has been recognized as a key strategy for individuals, institutions, and organizations to strengthen their competitive advantages. It becomes crucial to help adult learners and knowledge workers to improve their self-directed and life-long learning capabilities. Meanwhile, advances in technology have been increasingly enabling and facilitating learning and knowledge-related initiatives.. They have largely extended learning opportunities through the provision of resource-rich and learner-centered environment, computer-based learning support, and expanded social interactions and networks. Papers in this special issue are representative of ongoing research on integration of technology with learning for innovation and sustainable development in higher education institutions and organizational and community environments.

  3. Possible role for metallothionein in the cellular defense mechanism against UVB irradiation in neonatal human skin fibroblasts

    International Nuclear Information System (INIS)

    The role of metallothionein (MT) in protecting skin cells against UVB irradiation was investigated. Fibroblast strains from normal adult (HS-K) and neonatal (NB1RGB) human skins as well as keratinocyte strains from human skin (SV40-HSK) and newborn Balb/c mouse skin (Pam 212) were exposed to UVB irradiation. (Author)

  4. Differentiation of human keratinocytes: changes in lipid synthesis, plasma membrane lipid composition, and 125I-EGF binding upon administration of 25-hydroxycholesterol and mevinolin

    International Nuclear Information System (INIS)

    We have studied the relationship between differentiation capacity, plasma membrane composition, and epidermal growth factor (EGF) receptor expression of normal keratinocytes in vitro. The plasma membrane composition of the cells was modulated experimentally by cholesterol depletion, using specific inhibitors of cholesterol synthesis, such as 25-hydroxycholesterol and mevinolin. Exposure of the cells towards these inhibitors resulted in a drastic decrease of cholesterol biosynthesis, as determined from 14C-acetate incorporation into the various lipid fractions. This effect on cholesterol biosynthesis was reflected by changes in plasma membrane composition, as determined by lipid analysis of isolated plasma membrane fractions, these resulting in a decreased cholesterol-phospholipid ratio. The experimental modulation of plasma membrane composition by 25-hydroxycholesterol or mevinolin were accompanied by a decreased cornified envelope formation and by high expression of EGF binding sites. These phenomena were more pronounced in cells induced to differentiate by exposure of cells grown under low Ca2+ to normal Ca2+ concentrations, as compared to cells grown persistently under low Ca2+ concentrations. These results suggest a close correlation between plasma membrane composition, differentiation capacity, and EGF receptor expression

  5. Identification of Cyclobutane Pyrimidine Dimer-Responsive Genes Using UVB-Irradiated Human Keratinocytes Transfected with In Vitro-Synthesized Photolyase mRNA

    Science.gov (United States)

    Boros, Gábor; Miko, Edit; Muramatsu, Hiromi; Weissman, Drew; Emri, Eszter; van der Horst, Gijsbertus T. J.; Szegedi, Andrea; Horkay, Irén; Emri, Gabriella; Karikó, Katalin; Remenyik, Éva

    2015-01-01

    Major biological effects of UVB are attributed to cyclobutane pyrimidine dimers (CPDs), the most common photolesions formed on DNA. To investigate the contribution of CPDs to UVB-induced changes of gene expression, a model system was established by transfecting keratinocytes with pseudouridine-modified mRNA (Ψ-mRNA) encoding CPD-photolyase. Microarray analyses of this model system demonstrated that more than 50% of the gene expression altered by UVB was mediated by CPD photolesions. Functional classification of the gene targets revealed strong effects of CPDs on the regulation of the cell cycle and transcriptional machineries. To confirm the microarray data, cell cycle-regulatory genes, CCNE1 and CDKN2B that were induced exclusively by CPDs were selected for further investigation. Following UVB irradiation, expression of these genes increased significantly at both mRNA and protein levels, but not in cells transfected with CPD-photolyase Ψ-mRNA and exposed to photoreactivating light. Treatment of cells with inhibitors of c-Jun N-terminal kinase (JNK) blocked the UVB-dependent upregulation of both genes suggesting a role for JNK in relaying the signal of UVB-induced CPDs into transcriptional responses. Thus, photolyase mRNA-based experimental platform demonstrates CPD-dependent and -independent events of UVB-induced cellular responses, and, as such, has the potential to identify novel molecular targets for treatment of UVB-mediated skin diseases. PMID:26121660

  6. Identification of Cyclobutane Pyrimidine Dimer-Responsive Genes Using UVB-Irradiated Human Keratinocytes Transfected with In Vitro-Synthesized Photolyase mRNA.

    Directory of Open Access Journals (Sweden)

    Gábor Boros

    Full Text Available Major biological effects of UVB are attributed to cyclobutane pyrimidine dimers (CPDs, the most common photolesions formed on DNA. To investigate the contribution of CPDs to UVB-induced changes of gene expression, a model system was established by transfecting keratinocytes with pseudouridine-modified mRNA (Ψ-mRNA encoding CPD-photolyase. Microarray analyses of this model system demonstrated that more than 50% of the gene expression altered by UVB was mediated by CPD photolesions. Functional classification of the gene targets revealed strong effects of CPDs on the regulation of the cell cycle and transcriptional machineries. To confirm the microarray data, cell cycle-regulatory genes, CCNE1 and CDKN2B that were induced exclusively by CPDs were selected for further investigation. Following UVB irradiation, expression of these genes increased significantly at both mRNA and protein levels, but not in cells transfected with CPD-photolyase Ψ-mRNA and exposed to photoreactivating light. Treatment of cells with inhibitors of c-Jun N-terminal kinase (JNK blocked the UVB-dependent upregulation of both genes suggesting a role for JNK in relaying the signal of UVB-induced CPDs into transcriptional responses. Thus, photolyase mRNA-based experimental platform demonstrates CPD-dependent and -independent events of UVB-induced cellular responses, and, as such, has the potential to identify novel molecular targets for treatment of UVB-mediated skin diseases.

  7. Neuropeptide Y in the Adult and Fetal Human Pineal Gland

    OpenAIRE

    Morten Møller; Pansiri Phansuwan-Pujito; Corin Badiu

    2014-01-01

    Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passag...

  8. The radiosensitivity of keratinocytes from tongue and skin; enhanced radioresistance following serial cultivation

    International Nuclear Information System (INIS)

    A study has been carried out of the radiation response of keratinocytes from human skin, mouse skin and mouse tongue to 0-10 Gy of γ-radiation, carried out in suspension at 200C. The Dsub(o)values for primary cultures of keratinocytes was similar to those obtained in vivo for mice, suggesting that this in vitro assay could be used to measure the sensitivity of keratinocytes treated with various cytotoxic agents. Sensitivity appears to change on subculturing and hence subcultures may be less appropriate for determining in vivo cell sensitivities. (UK)

  9. Investigation of double strand breaks induced by alpha particle irradiation using C.N.B.G. microbeam in human keratinocytes; Mise en evidence de cassures double brin de l'ADN induites par irradiation de keratinocytes humains en microfaisceau alpha

    Energy Technology Data Exchange (ETDEWEB)

    Pouthier, Th

    2006-12-15

    To understand the mechanisms of interaction of ionizing radiation with living tissues exposed to low and protracted doses remains a major issue for risk evaluation. The response cannot be found in epidemiological studies because the only available data concern accidental exposures to high doses of radiation. The natural exposure represents the main source of exposure in the daily life, just before the medical sources (radiology, radiotherapy). In addition, this kind of exposure is very difficult to reproduce in vitro by irradiating cell lines. The method per preference is based on random irradiation of cell populations. The mean number of particles having traversed cells is then calculated on the basis of Poisson statistics. In addition to inevitable multiple impacts, the numerous potential intracellular targets (nuclei, cytoplasm), the indirect effects induced by the impact of particles on neighbouring cells or simply the extracellular targets, constitute phenomena that make more complex the interpretation of experimental data. A charged particle microbeam was developed at C.E.N.B.G. to perform the targeted irradiation of individual cells with a targeting precision of a few microns. It is possible to deliver a counted number of alpha particles down to the ultimate dose of one alpha per cell, to target predetermined cells and then to observe the response of the neighbouring cells. This facility has been validated during this work on human keratinocyte cells expressing a recombinant nuclear fluorescent protein (histone H2B-GFP). The combination of ion micro-beams with confocal microscopy and numeric quantitative analysis allowed the measurement of DNA double strand breaks via the phosphorylation of the histone H2A.X in individual cells. The mechanisms of DNA reparation and apoptosis induction were also in the scope of those studies. The experimental results obtained during this thesis validate the methodology we have developed by demonstrating the targeting

  10. Targeting expression of keratinocyte growth factor to keratinocytes elicits striking changes in epithelial differentiation in transgenic mice.

    OpenAIRE

    Guo, L.; Yu, Q C; E. Fuchs

    1993-01-01

    Keratinocyte growth factor (KGF) is a member of the fibroblast growth factor (FGF) family. Synthesized by cells of the dermal component of skin, KGF's potent mitogenic activity is on the epidermal component, which harbors the receptors for this factor. To explore the possible role of KGF in mesenchymal-epithelial interactions in skin, we used a human keratin 14 promoter to target expression of human KGF cDNA to the stratified squamous epithelia of transgenic mice. Mice expressing KGF in their...

  11. Lactobacillus rhamnosus GG Lysate Increases Re-Epithelialization of Keratinocyte Scratch Assays by Promoting Migration.

    Science.gov (United States)

    Mohammedsaeed, Walaa; Cruickshank, Sheena; McBain, Andrew J; O'Neill, Catherine A

    2015-01-01

    A limited number of studies have investigated the potential of probiotics to promote wound healing in the digestive tract. The aim of the current investigation was to determine whether probiotic bacteria or their extracts could be beneficial in cutaneous wound healing. A keratinocyte monolayer scratch assay was used to assess re-epithelialization; which comprises keratinocyte proliferation and migration. Primary human keratinocyte monolayers were scratched then exposed to lysates of Lactobacillus (L) rhamnosus GG, L. reuteri, L. plantarum or L. fermentum. Re-epithelialization of treated monolayers was compared to that of untreated controls. Lysates of L. rhamnosus GG and L. reuteri significantly increased the rate of re-epithelialization, with L. rhamnosus GG being the most efficacious. L. reuteri increased keratinocyte proliferation while L. rhamnosus GG lysate significantly increased proliferation and migration. Microarray analysis of L. rhamnosus GG treated scratches showed increased expression of multiple genes including the chemokine CXCL2 and its receptor CXCR2. These are involved in normal wound healing where they stimulate keratinocyte proliferation and/or migration. Increased protein expression of both CXCL2 and CXCR2 were confirmed by ELISA and immunoblotting. These data demonstrate that L. rhamnosus GG lysate accelerates re-epithelialization of keratinocyte scratch assays, potentially via chemokine receptor pairs that induce keratinocyte migration. PMID:26537246

  12. Nitric Oxide Donors Suppress Chemokine Production by Keratinocytes in Vitro and in Vivo

    Science.gov (United States)

    Giustizieri, Maria Laura; Albanesi, Cristina; Scarponi, Claudia; De Pità, Ornella; Girolomoni, Giampiero

    2002-01-01

    Nitric oxide (NO) is involved in the modulation of inflammatory responses. In psoriatic skin, NO is highly produced by epidermal keratinocytes in response to interferon-γ and tumor necrosis factor-α. In this study, we investigated whether the NO donors, S-nitrosoglutathione (GS-NO) and NOR-1, could regulate chemokine production by human keratinocytes activated with interferon-γ and tumor necrosis factor-α. In addition, we studied the effects of the topical application of a GS-NO ointment on chemokine expression in lesional psoriatic skin. NO donors diminished in a dose-dependent manner and at both mRNA and protein levels the IP-10, RANTES, and MCP-1 expression in keratinocytes cultured from healthy patients and psoriatic patients. In contrast, constitutive and induced interleukin-8 production was unchanged. GS-NO-treated psoriatic skin showed reduction of IP-10, RANTES, and MCP-1, but not interleukin-8 expression by keratinocytes. Moreover, the number of CD14+ and CD3+ cells infiltrating the epidermis and papillary dermis diminished significantly. NO donors also down-regulated ICAM-1 protein expression without affecting mRNA accumulation in vitro, and suppressed keratinocyte ICAM-1 in vivo. Finally, NO donors inhibited nuclear factor-κB and STAT-1, but not AP-1 activities in transiently transfected keratinocytes. These results define NO donors as negative regulators of chemokine production by keratinocytes. PMID:12368213

  13. [Cytokinetics and keratins of keratinocytes from skin of the elderly].

    Science.gov (United States)

    Wevers, A; Schulze, H J; Mahrle, G; Steigleder, G K

    1989-11-15

    Regarding the keratin pattern of non-exposed skin, we found no significant qualitative or quantitative differences between 6 old persons (mean age 85 years) and 4 young adults (mean age 20 years). There was, however, a slight increase of proliferation keratins (K6, K16) in aged skin. In non-exposed skin taken from 6 old (mean age 70 years) and 5 young persons (mean age 37 years), longterm primary submersion cultures of keratinocytes did not show any significant differences as far as the classical parameters of growth behavior were concerned (i.e. plating efficiency, cell count, and labeled thymidine incorporation). In accordance with these findings, daily measurements of the thymidine kinase activity in the supernatants revealed discrete but not significant differences between keratinocytes in aged people and those in young persons. PMID:2481907

  14. Sphingolipid metabolism in organotypic mouse keratinocyte cultures

    International Nuclear Information System (INIS)

    Ceramides are the dominant component of the stratum corneum intercellular lipid lamellae, which constitute the epidermal permeability barrier. Only pig and human epidermal ceramides have been extensively characterized and the structures of the ceramides of cultured keratinocytes have not been previously investigated. In the present studies, we have characterized the ceramides synthesized by organotypic lifted mouse keratinocyte cultures for the first time and compared them to the ceramides of intact mouse epidermis. Both mouse epidermis and cultures contained five ceramides, ceramide 1 being the least polar and ceramide 5 the most polar. Ceramide 1 was a group of acylceramides, i.e., very-long-chain omega-hydroxyceramides with an ester-linked nonhydroxy fatty acid. Ceramide 2 contained medium-length saturated nonhydroxy fatty acids. (In culture, the ceramide 2 band was split into two parts with the slightly more polar ceramide 2' containing short-chain saturated nonhydroxy fatty acids.) Ceramide 5 contained short-chain alpha-hydroxy fatty acids. The structures of ceramides 1, 2, and 5 were analagous to those of pig and human epidermis. Mouse epidermal ceramide 3 was quite unusual, containing beta-hydroxy fatty acids, a structure not previously identified among mammalian ceramides. In contrast, culture ceramide 3 was composed of omega-hydroxy fatty acids with a chain-length distribution similar to that of ceramide 1. Mouse ceramide 4 was composed of fatty acids with chromatographic mobility similar to hydroxy fatty acids but with different chemical reactivity; it remains only partially characterized. Culture ceramide 4 was present in quantities too small for analysis. All ceramides in mouse epidermis and cultures contained only sphingosine bases, whereas pig and human ceramides also contain phytosphingosine

  15. Sphingolipid metabolism in organotypic mouse keratinocyte cultures

    Energy Technology Data Exchange (ETDEWEB)

    Madison, K.C.; Swartzendruber, D.C.; Wertz, P.W.; Downing, D.T. (Univ. of Iowa College of Medicine, Iowa City (USA))

    1990-12-01

    Ceramides are the dominant component of the stratum corneum intercellular lipid lamellae, which constitute the epidermal permeability barrier. Only pig and human epidermal ceramides have been extensively characterized and the structures of the ceramides of cultured keratinocytes have not been previously investigated. In the present studies, we have characterized the ceramides synthesized by organotypic lifted mouse keratinocyte cultures for the first time and compared them to the ceramides of intact mouse epidermis. Both mouse epidermis and cultures contained five ceramides, ceramide 1 being the least polar and ceramide 5 the most polar. Ceramide 1 was a group of acylceramides, i.e., very-long-chain omega-hydroxyceramides with an ester-linked nonhydroxy fatty acid. Ceramide 2 contained medium-length saturated nonhydroxy fatty acids. (In culture, the ceramide 2 band was split into two parts with the slightly more polar ceramide 2' containing short-chain saturated nonhydroxy fatty acids.) Ceramide 5 contained short-chain alpha-hydroxy fatty acids. The structures of ceramides 1, 2, and 5 were analagous to those of pig and human epidermis. Mouse epidermal ceramide 3 was quite unusual, containing beta-hydroxy fatty acids, a structure not previously identified among mammalian ceramides. In contrast, culture ceramide 3 was composed of omega-hydroxy fatty acids with a chain-length distribution similar to that of ceramide 1. Mouse ceramide 4 was composed of fatty acids with chromatographic mobility similar to hydroxy fatty acids but with different chemical reactivity; it remains only partially characterized. Culture ceramide 4 was present in quantities too small for analysis. All ceramides in mouse epidermis and cultures contained only sphingosine bases, whereas pig and human ceramides also contain phytosphingosine.

  16. In vitro proliferation of adult human beta-cells.

    Directory of Open Access Journals (Sweden)

    Sabine Rutti

    Full Text Available A decrease in functional beta-cell mass is a key feature of type 2 diabetes. Glucagon-like peptide 1 (GLP-1 analogues induce proliferation of rodent beta-cells. However, the proliferative capacity of human beta-cells and its modulation by GLP-1 analogues remain to be fully investigated. We therefore sought to quantify adult human beta-cell proliferation in vitro and whether this is affected by the GLP-1 analogue liraglutide.Human islets from 7 adult cadaveric organ donors were dispersed into single cells. Beta-cells were purified by FACS. Non-sorted cells and the beta-cell enriched ("beta-cells" population were plated on extracellular matrix from rat (804G and human bladder carcinoma cells (HTB9 or bovine corneal endothelial ECM (BCEC. Cells were maintained in culture+/-liraglutide for 4 days in the presence of BrdU.Rare human beta-cell proliferation could be observed either in the purified beta-cell population (0.051±0.020%; 22 beta-cells proliferating out of 84'283 beta-cells counted or in the non-sorted cell population (0.055±0.011%; 104 proliferating beta-cells out of 232'826 beta-cells counted, independently of the matrix or the culture conditions. Liraglutide increased human beta-cell proliferation on BCEC in the non-sorted cell population (0.082±0.034% proliferating beta-cells vs. 0.017±0.008% in control, p<0.05.These results indicate that adult human beta-cell proliferation can occur in vitro but remains an extremely rare event with these donors and particular culture conditions. Liraglutide increases beta-cell proliferation only in the non-sorted cell population and only on BCEC. However, it cannot be excluded that human beta-cells may proliferate to a greater extent in situ in response to natural stimuli.

  17. Combined treatment with sodium butyrate and PD153035 enhances keratinocyte differentiation

    OpenAIRE

    Carrion, Sandra Leon; Sutter, Carrie Hayes; Sutter, Thomas R.

    2014-01-01

    Epidermal growth factor (EGF) receptor (EGFR) signaling is a critical determinant of keratinocyte proliferation and differentiation in both normal and diseased skin. Here we explore the effects of combined treatment with the differentiation-promoting agent sodium butyrate (SB) and the EGFR inhibitor (EGFRI) PD153035 on terminal differentiation of normal human epidermal keratinocytes (NHEKs). Cells treated with SB showed increased expression of the levels of mRNA and protein of the differentia...

  18. Microtubule Disruption in Keratinocytes Induces Cell-Cell Adhesion through Activation of Endogenous E-Cadherin

    OpenAIRE

    Kee, Sun-Ho; Steinert, Peter M.

    2001-01-01

    The association of the cytoskeleton with the cadherin–catenin complex is essential for strong cell-cell adhesion in epithelial cells. In this study, we have investigated the effect of microtubule organization on cell-cell adhesion in differentiating keratinocytes. When microtubules of normal human epidermal keratinocytes (NHEKs) grown in low calcium media (0.05 mM) were disrupted with nocodazole or colcemid, cell-cell adhesion was induced through relocalization of the ...

  19. Pimecrolimus Enhances TLR2/6-Induced Expression of Antimicrobial Peptides in Keratinocytes

    OpenAIRE

    Büchau, Amanda S.; Schauber, Jürgen; Hultsch, Thomas; Stuetz, Anton; Richard L Gallo

    2008-01-01

    Calcineurin inhibitors are potent inhibitors of T-cell-receptor mediated activation of the adaptive immune system. The effects of this class of drug on the innate immune response system are not known. Keratinocytes are essential to innate immunity in skin and rely on toll-like receptors (TLRs) and antimicrobial peptides to appropriately recognize and respond to injury or microbes. In this study we examined the response of cultured human keratinocytes to pimecrolimus. We observed that pimecrol...

  20. Mechanosensory and ATP Release Deficits following Keratin14-Cre-Mediated TRPA1 Deletion Despite Absence of TRPA1 in Murine Keratinocytes.

    Directory of Open Access Journals (Sweden)

    Katherine J Zappia

    Full Text Available Keratinocytes are the first cells that come into direct contact with external tactile stimuli; however, their role in touch transduction in vivo is not clear. The ion channel Transient Receptor Potential Ankyrin 1 (TRPA1 is essential for some mechanically-gated currents in sensory neurons, amplifies mechanical responses after inflammation, and has been reported to be expressed in human and mouse skin. Other reports have not detected Trpa1 mRNA transcripts in human or mouse epidermis. Therefore, we set out to determine whether selective deletion of Trpa1 from keratinocytes would impact mechanosensation. We generated K14Cre-Trpa1fl/fl mice lacking TRPA1 in K14-expressing cells, including keratinocytes. Surprisingly, Trpa1 transcripts were very poorly detected in epidermis of these mice or in controls, and detection was minimal enough to preclude observation of Trpa1 mRNA knockdown in the K14Cre-Trpa1fl/fl mice. Unexpectedly, these K14Cre-Trpa1fl/fl mice nonetheless exhibited a pronounced deficit in mechanosensitivity at the behavioral and primary afferent levels, and decreased mechanically-evoked ATP release from skin. Overall, while these data suggest that the intended targeted deletion of Trpa1 from keratin 14-expressing cells of the epidermis induces functional deficits in mechanotransduction and ATP release, these deficits are in fact likely due to factors other than reduction of Trpa1 expression in adult mouse keratinocytes because they express very little, if any, Trpa1.

  1. Ontogeny of morningness-eveningness across the adult human lifespan

    Science.gov (United States)

    Randler, Christoph

    2016-02-01

    Sleep timing of humans can be classified alongside a continuum from early to late sleepers, with some people (larks) having an early activity, early bed, and rise times and others (owls) with a more nocturnally orientated activity. Only a few studies reported that morningness-eveningness changes significantly during the adult lifespan based on community samples. Here, I applied a different methodological approach to seek for evidence for the age-related changes in morningness-eveningness preferences by using a meta-data from all available studies. The new aspect of this cross-sectional approach is that only a few studies themselves address the age-related changes of the adult lifespan development, but that many studies are available that provide exactly the data needed. The studies came from 27 countries and included 36,939 participants. Age was highly significantly correlated with scores on the Composite Scale of Morningness ( r = 0.70). This relationship seems linear, because a linear regression explained nearly the same amount of variance compared to other models such as logarithmic, quadratic, or cubic models. The standard deviation of age correlated with the standard deviation of CSM scores ( r = 0.55), suggesting when there is much variance in age in a study; in turn, there is much variance in morningness. This meta-analytical approach shows that morningness-eveningness changes across the adult lifespan and that older age is related to higher morningness.

  2. Early reversal cells in adult human bone remodeling

    DEFF Research Database (Denmark)

    Abdelgawad, Mohamed Essameldin; Delaisse, Jean-Marie; Hinge, Maja;

    2016-01-01

    . Earlier preclinical studies indicate that reversal cells degrade the organic matrix left behind by the osteoclasts and that this degradation is crucial for the initiation of the subsequent bone formation. To our knowledge, this study is the first addressing these catabolic activities in adult human bone......The mechanism coupling bone resorption and formation is a burning question that remains incompletely answered through the current investigations on osteoclasts and osteoblasts. An attractive hypothesis is that the reversal cells are likely mediators of this coupling. Their nature is a big matter of...... debate. The present study performed on human cancellous bone is the first one combining in situ hybridization and immunohistochemistry to demonstrate their osteoblastic nature. It shows that the Runx2 and CD56 immunoreactive reversal cells appear to take up TRAcP released by neighboring osteoclasts...

  3. Keratinocyte Apoptosis is Decreased in Psoriatic Epidermis

    Directory of Open Access Journals (Sweden)

    Fatma Eskioğlu

    2009-12-01

    Full Text Available Background and Design: Abnormal differentiation and hyperproliferation of keratinocytes are the hallmarks of psoriasis vulgaris. Although psoriasis vulgaris is generally accepted as a disease of decreased keratinocyte apoptosis, the results are contradictory. The aim of the current study is to investigate whether decreased keratinocyte apoptosis contributes to the formation of a thickened epidermis as increased keratinocyte proliferation. Material and Method: Forty-three untreated psoriasis vulgaris patients and 20 healthy control subjects were included into the study. Biopsy specimens taken from the enrollee were evaluated by immunohistochemical staining for Ki-67 expressions to show the proliferation of keratinocytes and by the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling (TUNEL method to show the apoptotic keratinocytes. Results: Apoptotic index (percentage of the TUNEL positive cells was significantly lower in psoriatic epidermis (0.33±0.64 than in normal epidermis (0.75±0.85; whereas Ki-67 index (percentage of positively staining cells for Ki-67 was significantly higher in psoriatic epidermis (30.86±10.49 than in normal epidermis (11.65±2.98, (p=0.021 and p=0.00; respectively. Conclusion: Decreased keratinocyte apoptosis also contribute to increased epidermal thickness in psoriasis as well as increased keratinocyte proliferation.

  4. Scanning Ion Conductance Microscopy of Live Keratinocytes

    Science.gov (United States)

    Hegde, V.; Mason, A.; Saliev, T.; Smith, F. J. D.; McLean, W. H. I.; Campbell, P. A.

    2012-07-01

    Scanning ion conductance microscopy (SICM) is perhaps the least well known technique from the scanning probe microscopy (SPM) family of instruments. As with its more familiar counterpart, atomic force microscopy (AFM), the technique provides high-resolution topographic imaging, with the caveat that target structures must be immersed in a conducting solution so that a controllable ion current may be utilised as the basis for feedback. In operation, this non-contact characteristic of SICM makes it ideal for the study of delicate structures, such as live cells. Moreover, the intrinsic architecture of the instrument, incorporating as it does, a scanned micropipette, lends itself to combination approaches with complementary techniques such as patch-clamp electrophysiology: SICM therefore boasts the capability for both structural and functional imaging. For the present observations, an ICnano S system (Ionscope Ltd., Melbourn, UK) operating in 'hopping mode' was used, with the objective of assessing the instrument's utility for imaging live keratinocytes under physiological buffers. In scans employing cultured HaCaT cells (spontaneously immortalised, human keratinocytes), we compared the qualitative differences of live cells imaged with SICM and AFM, and also with their respective counterparts after chemical fixation in 4% paraformaldehyde. Characteristic surface microvilli were particularly prominent in live cell imaging by SICM. Moreover, time lapse SICM imaging on live cells revealed that changes in the pattern of microvilli could be tracked over time. By comparison, AFM imaging on live cells, even at very low contact forces (

  5. Evaluation of the cytotoxic effects of humid lightweight coal ash derived from the disposal of waste on normal human keratinocyte and endothelial cell lines in 2-D and 3-D culture.

    Science.gov (United States)

    Scanarotti, Chiara; Vernazza, Stefania; Brignone, Massimiliano; Danailova, Jenia; Pronzato, Maria A; Bassi, Anna M

    2013-12-01

    The presence of waste in the environment has frequently been indicated as a significant risk to human health. Therefore, landfill sites and the disposal of urban solid and non-hazardous waste by incineration are subject to much environmental monitoring, in addition to the regulations already in place. However, little action has been taken, and consequently no specific legislation exists, in relation to the assessment of the real biological risk of various substances, including chemical mixtures and ashes, derived from the incineration processes. This study assessed the cytotoxic potential of humid lightweight coal ash (LA) derived from incineration processes and waste management, on two cell lines: NCTC 2544 normal human keratinocytes and HECV endothelial cells. To reach this goal and to assess more-realistic methods for animal replacement, we employed different in vitro experimental approaches: acute and longer exposure to LA, by direct and indirect contact (0-2mg/ml and 16mg, respectively), both in 2-D and 3-D cultures. In 2-D HECV cultures, we observed a decrease in the viability index, but only during direct contact with LA doses higher than 0.1mg/ml. Moreover, some striking differences in cytotoxicity were observed between the 2-D and 3-D models. Taken together, these observations indicate that, for studying pollutant toxicity during longer exposure times, 3-D cultures in direct contact with the pollutant seem to offer a more suitable approach - they mimic the in vivo behaviour of cells more realistically and under strictly controlled conditions. Thus, in readiness for possible forthcoming European regulations, we believe that the proposed study, even in its preliminary phase, can provide new advice on the assessment of the toxic and biological potential of particular chemical compounds derived from waste management processes. PMID:24512233

  6. Melatonin enhances mitochondrial ATP synthesis, reduces reactive oxygen species formation, and mediates translocation of the nuclear erythroid 2-related factor 2 resulting in activation of phase-2 antioxidant enzymes (γ-GCS, HO-1, NQO1) in ultraviolet radiation-treated normal human epidermal keratinocytes (NHEK).

    Science.gov (United States)

    Kleszczyński, Konrad; Zillikens, Detlef; Fischer, Tobias W

    2016-09-01

    Melatonin is an ubiquitous molecule with a variety of functions including potent antioxidative properties. Due to its lipophilic character, it easily crosses cellular and intracellular membranes and reaches all subcellular organelles. Because of its ability to scavenge free radicals, melatonin protects against oxidative stress, for example, induced by ultraviolet radiation (UVR). Here, we investigated, in a dose-dependent (0, 10, 25, and 50 mJ/cm(2) ) and time-dependent (0, 4, 24, 48 hr post-UVR) manner, whether melatonin prevents the UVR-mediated alterations in ATP synthesis and the generation of reactive oxygen species (ROS) in normal human epidermal keratinocytes (NHEK). Additionally, we evaluated the molecular mechanism of action of melatonin with regard to activation of phase-2 antioxidative enzymes via nuclear erythroid 2-related factor (Nrf2). We found that (i) melatonin counteracted UVR-induced alterations in the ATP synthesis and reduced free radical formation; (ii) melatonin induced the translocation of Nrf2 transcription factor from the cytosol into the nucleus resulting in, (iii) melatonin enhanced gene expression of phase-2 antioxidative enzymes including γ-glutamylcysteine synthetase (γ-GCS), heme oxygenase-1 (HO-1), and NADPH: quinone dehydrogenase-1 (NQO1) representing an elevated antioxidative response of keratinocytes. These results suggest that melatonin not only directly scavenges ROS, but also significantly induces the activation of phase-2 antioxidative enzymes via the Nrf2 pathway uncovering a new action mechanism that supports the ability of keratinocytes to protect themselves from UVR-mediated oxidative stress. PMID:27117941

  7. EFFECTS OF ARSENITE IN TELOMERE AND TELOMERASE IN RELATION TO CELL PROLIFERATION AND APOPTOSIS IN HUMAN KERATINOCYTES AND LEUKEMIA CELLS IN VITRO

    Science.gov (United States)

    Telomeres are critical in maintaining chromosome and genomic stability. Arsenic, a human carcinogen as well as an anticancer agent, is known for its clastogenicity. To better understand molecular mechanisms of arsenic actions, we investigated arsenite effects on telomere and telo...

  8. Neuropeptide Y in the Adult and Fetal Human Pineal Gland

    Directory of Open Access Journals (Sweden)

    Morten Møller

    2014-01-01

    Full Text Available Neuropeptide Y was isolated from the porcine brain in 1982 and shown to be colocalized with noradrenaline in sympathetic nerve terminals. The peptide has been demonstrated to be present in sympathetic nerve fibers innervating the pineal gland in many mammalian species. In this investigation, we show by use of immunohistochemistry that neuropeptide Y is present in nerve fibers of the adult human pineal gland. The fibers are classical neuropeptidergic fibers endowed with large boutons en passage and primarily located in a perifollicular position with some fibers entering the pineal parenchyma inside the follicle. The distance from the immunoreactive terminals to the pinealocytes indicates a modulatory function of neuropeptide Y for pineal physiology. Some of the immunoreactive fibers might originate from neurons located in the brain and be a part of the central innervation of the pineal gland. In a series of human fetuses, neuropeptide Y-containing nerve fibers was present and could be detected as early as in the pineal of four- to five-month-old fetuses. This early innervation of the human pineal is different from most rodents, where the innervation starts postnatally.

  9. Tumourigenesis Driven by the Human Papillomavirus Type 16 Asian-American E6 Variant in a Three-Dimensional Keratinocyte Model

    OpenAIRE

    Robert Jackson; Melissa Togtema; Lambert, Paul F.; Ingeborg Zehbe

    2014-01-01

    Infection with a transforming human papillomavirus (HPV) such as type 16 (of species Alphapapillomavirus 9) causes ano-genital and oral tumours via viral persistence in human squamous cell epithelia. Epidemiological studies showed that the naturally occurring HPV16 Asian-American (AA) variant (sublineage D2/D3) is found more often than the European Prototype (EP) (sublineage A1) in high-grade cervical neoplasia and tumours compared to non-cancer controls. Just three amino acid changes within ...

  10. Human behavioral momentum in a sample of older adults.

    Science.gov (United States)

    Plaud, J J; Plaud, D M; von Duvillard, S P

    1999-04-01

    Behavioral momentum, the persistence of behavior under altered environmental contingencies, is derived from Newtonian physics and operant psychology. It has relevance to behavior analysis in terms of shaping strong behaviors and ensuring effective relapse prevention strategies in behavior modification and therapy. The authors investigated whether changing the operant schedule contingencies affects the responses of older humans to different stimuli when reinforcement density is systematically manipulated. Fifteen older adults participated in a computer study in which each of 2 keys in a baseline condition was associated with the same schedule of reinforcement and multiple variable intervals; the only difference was that 1 reinforcer was 10 times larger than the other. After 6 sessions, the authors changed the contingency schedule to either an extinction condition, a variable-time schedule, or a different variable-interval schedule, to assess how participants' responses persisted when reinforcement contingencies were systematically changed. The results were consistent with the predictions of behavioral momentum. The participants not only biased their responses in favor of the more densely reinforcing key, but when contingencies changed, they showed significantly biased responses. Results supported the conclusion that healthy older adults allocate their behaviors in a manner very sensitive to training stimuli conditions; consistent with the basic principles of behavioral momentum, they show a degree of resistance to change in their behaviors when the behavioral contingencies are altered. PMID:10368942

  11. Melatonin protects skin keratinocyte from hydrogen peroxide-mediated cell death via the SIRT1 pathway.

    Science.gov (United States)

    Lee, Ju-Hee; Moon, Ji-Hong; Nazim, Uddin Md; Lee, You-Jin; Seol, Jae-Won; Eo, Seong-Kug; Lee, John-Hwa; Park, Sang-Youel

    2016-03-15

    Melatonin (N-acetyl-5-methoxytryptamine), which is primarily synthesized in and secreted from the pineal gland, plays a pivotal role in cell proliferation as well as in the regulation of cell metastasis and cell survival in a diverse range of cells. The aim of this study is to investigate protection effect of melatonin on H2O2-induced cell damage and the mechanisms of melatonin in human keratinocytes. Hydrogen peroxide dose-dependently induced cell damages in human keratinocytes and co-treatment of melatonin protected the keratinocytes against H2O2-induced cell damage. Melatonin treatment activated the autophagy flux signals, which were identified by the decreased levels of p62 protein. Inhibition of autophagy flux via an autophagy inhibitor and ATG5 siRNA technique blocked the protective effects of melatonin against H2O2-induced cell death in human keratinocytes. And we found the inhibition of sirt1 using sirtinol and sirt1 siRNA reversed the protective effects of melatonin and induces the autophagy process in H2O2-treated cells. This is the first report demonstrating that autophagy flux activated by melatonin protects human keratinocytes through sirt1 pathway against hydrogen peroxide-induced damages. And this study also suggest that melatonin could potentially be utilized as a therapeutic agent in skin disease. PMID:26918354

  12. Melatonin protects skin keratinocyte from hydrogen peroxide-mediated cell death via the SIRT1 pathway

    Science.gov (United States)

    Lee, Ju-Hee; Moon, Ji-Hong; Nazim, Uddin MD.; Lee, You-Jin; Seol, Jae-Won; Eo, Seong-Kug; Lee, John-Hwa; Park, Sang-Youel

    2016-01-01

    Melatonin (N-acetyl-5-methoxytryptamine), which is primarily synthesized in and secreted from the pineal gland, plays a pivotal role in cell proliferation as well as in the regulation of cell metastasis and cell survival in a diverse range of cells. The aim of this study is to investigate protection effect of melatonin on H2O2-induced cell damage and the mechanisms of melatonin in human keratinocytes. Hydrogen peroxide dose-dependently induced cell damages in human keratinocytes and co-treatment of melatonin protected the keratinocytes against H2O2-induced cell damage. Melatonin treatment activated the autophagy flux signals, which were identified by the decreased levels of p62 protein. Inhibition of autophagy flux via an autophagy inhibitor and ATG5 siRNA technique blocked the protective effects of melatonin against H2O2-induced cell death in human keratinocytes. And we found the inhibition of sirt1 using sirtinol and sirt1 siRNA reversed the protective effects of melatonin and induces the autophagy process in H2O2-treated cells. This is the first report demonstrating that autophagy flux activated by melatonin protects human keratinocytes through sirt1 pathway against hydrogen peroxide-induced damages. And this study also suggest that melatonin could potentially be utilized as a therapeutic agent in skin disease. PMID:26918354

  13. Role of HuR and p38MAPK in ultraviolet B-induced post-transcriptional regulation of COX-2 expression in the human keratinocyte cell line HaCaT.

    Science.gov (United States)

    Fernau, Niklas S; Fugmann, Dominik; Leyendecker, Martin; Reimann, Kerstin; Grether-Beck, Susanne; Galban, Stefanie; Ale-Agha, Niloofar; Krutmann, Jean; Klotz, Lars-Oliver

    2010-02-01

    COX-2 (cyclooxygenase-2) is a pivotal player in inflammatory processes, and ultraviolet radiation is a known stimulus for COX-2 expression in skin cells. Here, an induction of COX-2 expression in HaCaT human keratinocytes was observed only upon exposure of cells to UVB (280-320 nm) but not to UVA radiation (320-400 nm), as demonstrated by reverse transcription-PCR and Western blotting. Prostaglandin E(2) levels were elevated in cell culture supernatants of HaCaT cells exposed to UVB. COX-2 mRNA stability was dramatically increased by UVB irradiation. Both the stabilization of COX-2 mRNA and the enhancement of COX-2 steady-state mRNA and protein levels caused by UVB were prevented both by inhibition and small interfering RNA-induced depletion of p38(MAPK), a kinase strongly activated upon exposure to UVB, suggesting p38(MAPK)-dependent mRNA stabilization as a mechanism of UVB-induced COX-2 expression. A dramatic decrease in COX-2 expression induced by UVB was elicited by small interfering RNA-based depletion of a stress-responsive mRNA stabilizing protein regulated by p38(MAPK), i.e. HuR; UVB-induced elevation of COX-2 mRNA and protein levels coincided with an accumulation of HuR in the cytoplasm and was attenuated in cells depleted of HuR. Moreover, UVB-induced generation of prostaglandin E(2) by HaCaT cells was blunted by HuR depletion, suggesting that stress kinases (such as p38(MAPK)) as well as HuR are excellent targets for approaches aiming at interfering with induction of COX-2 expression by UVB. PMID:19917608

  14. Role of HuR and p38MAPK in Ultraviolet B-induced Post-transcriptional Regulation of COX-2 Expression in the Human Keratinocyte Cell Line HaCaT*

    Science.gov (United States)

    Fernau, Niklas S.; Fugmann, Dominik; Leyendecker, Martin; Reimann, Kerstin; Grether-Beck, Susanne; Galban, Stefanie; Ale-Agha, Niloofar; Krutmann, Jean; Klotz, Lars-Oliver

    2010-01-01

    COX-2 (cyclooxygenase-2) is a pivotal player in inflammatory processes, and ultraviolet radiation is a known stimulus for COX-2 expression in skin cells. Here, an induction of COX-2 expression in HaCaT human keratinocytes was observed only upon exposure of cells to UVB (280–320 nm) but not to UVA radiation (320–400 nm), as demonstrated by reverse transcription-PCR and Western blotting. Prostaglandin E2 levels were elevated in cell culture supernatants of HaCaT cells exposed to UVB. COX-2 mRNA stability was dramatically increased by UVB irradiation. Both the stabilization of COX-2 mRNA and the enhancement of COX-2 steady-state mRNA and protein levels caused by UVB were prevented both by inhibition and small interfering RNA-induced depletion of p38MAPK, a kinase strongly activated upon exposure to UVB, suggesting p38MAPK-dependent mRNA stabilization as a mechanism of UVB-induced COX-2 expression. A dramatic decrease in COX-2 expression induced by UVB was elicited by small interfering RNA-based depletion of a stress-responsive mRNA stabilizing protein regulated by p38MAPK, i.e. HuR; UVB-induced elevation of COX-2 mRNA and protein levels coincided with an accumulation of HuR in the cytoplasm and was attenuated in cells depleted of HuR. Moreover, UVB-induced generation of prostaglandin E2 by HaCaT cells was blunted by HuR depletion, suggesting that stress kinases (such as p38MAPK) as well as HuR are excellent targets for approaches aiming at interfering with induction of COX-2 expression by UVB. PMID:19917608

  15. Human herpesvirus 7 is a constitutive inhabitant of adult human saliva.

    OpenAIRE

    Wyatt, L S; Frenkel, N

    1992-01-01

    We report the frequent isolation of human herpesvirus 7 from the saliva of healthy adults. Virus isolates recovered from different individuals exhibited minimal restriction enzyme polymorphism, which was mostly confined to heterogeneous (het) sequences in the genome. DNAs of isolates recovered from the same individual over a period of several months showed the same characteristic het fragments, indicating the stability of the het sequences upon virus replication and shedding in vivo. In contr...

  16. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    International Nuclear Information System (INIS)

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals

  17. 3D co-cultures of keratinocytes and melanocytes and cytoprotective effects on keratinocytes against reactive oxygen species by insect virus-derived protein microcrystals

    Energy Technology Data Exchange (ETDEWEB)

    Shimabukuro, Junji; Yamaoka, Ayako; Murata, Ken-ichi [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Kotani, Eiji [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan); Hirano, Tomoko [Venture Laboratory, Kyoto Institute of Technology, Kyoto (Japan); Nakajima, Yumiko [Functional Genomics Group, COMB, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa (Japan); Matsumoto, Goichi [Division of Oral Surgery, Yokohama Clinical Education Center of Kanagawa Dental University, Yokohama (Japan); Mori, Hajime, E-mail: hmori@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Kyoto (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Kyoto (Japan)

    2014-09-01

    Stable protein microcrystals called polyhedra are produced by certain insect viruses. Cytokines, such as fibroblast growth factors (FGFs), can be immobilized within polyhedra. Here, we investigated three-dimensional (3D) co-cultures of keratinocytes and melanocytes on collagen gel containing FGF-2 and FGF-7 polyhedra. Melanocytes were observed to reside at the base of the 3D cell culture and melanin was also typically observed in the lower layer. The 3D cell culture model with FGF-2 and FGF-7 polyhedra was a useful in vitro model of the epidermis due to effective melanogenesis, proliferation and differentiation of keratinocytes. FGF-7 polyhedra showed a potent cytoprotective effect when keratinocytes were treated with menadione, which is a generator of reactive oxygen species. The cytoprotective effect was activated by the inositol triphosphate kinase–Akt pathway leading to upregulation of the antioxidant enzymes superoxide dismutase and peroxiredoxin 6. - Highlights: • 3D cultures using FGF-2 and FGF-7 microcrystals as a human skin model • Cytoprotection of keratinocytes against ROS by FGF-7 microcrystals • Overexpression of SOD and Prdx6 in keratinocytes by FGF-7 microcrystals.

  18. A biokinetic model for systemic technetium in adult humans

    International Nuclear Information System (INIS)

    The International Commission on Radiological Protection (ICRP) currently is updating its biokinetic and dosimetric models for internally deposited radionuclides. Technetium (Tc), the lightest element that exists only in radioactive form, has two important isotopes from the standpoint of potential risk to humans: the long-lived isotope99Tm(T1/2=2.1x105 y) is present in high concentration in nuclear waste, and the short-lived isotope 99mTc (T1/2=6.02 h) is the most commonly used radionuclide in diagnostic nuclear medicine. This paper reviews data on the biological behavior of technetium and proposes a biokinetic model for systemic technetium in the adult human body for use in radiation protection. Compared with the ICRP s current occupational model for systemic technetium, the proposed model provides a more realistic description of the paths of movement of technetium in the body; provides greater consistency with experimental and medical data; and, for most radiosensitive organs, yields substantially different estimates of cumulative activity (total radioactive decays within the organ) following uptake of 99Tm or 99mTc to blood

  19. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder;

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40...

  20. Comparison of epidermal keratinocytes and dermal fibroblasts as potential target cells for somatic gene therapy of phenylketonuria

    DEFF Research Database (Denmark)

    Christensen, Rikke; Güttler, Flemming; Jensen, Thomas G

    2002-01-01

    gene therapy. We have previously shown that overexpression of PAH and GTP-CH in primary human keratinocytes leads to high levels of phenylalanine clearance without BH(4) supplementation [Gene Ther. 7 (2000) 1971]. Here, we investigate the capacity of fibroblasts, another cell type from the skin, to...... metabolize phenylalanine. After retroviral gene transfer of PAH and GTP-CH both normal and PKU patient fibroblasts were able to metabolize phenylalanine, however, in lower amounts compared to genetically modified keratinocytes. Further comparative analyses between keratinocytes and fibroblasts revealed a...

  1. Professional Fulfillment and Satisfaction of US and Canadian Adult Education and Human Resource Development Faculty

    Science.gov (United States)

    Peterson, Shari L.; Wiesenberg, Faye

    2004-01-01

    This comparative study explored the professional fulfillment and job satisfaction of US and Canadian college and university faculty in the fields of Adult Education and Human Resource Development. In Autumn 2001, we disseminated electronically "The Adult Education and Human Resource Development Faculty Survey" to a selected sample of Canadian and…

  2. A biokinetic model for systemic technetium in adult humans.

    Science.gov (United States)

    Leggett, R; Giussani, A

    2015-06-01

    This paper reviews biokinetic data for technetium and proposes a biokinetic model for systemic technetium in adult humans. The development of parameter values focuses on data for pertechnetate TcO(-)(4) the most commonly encountered form of technetium and the form expected to be present in body fluids. The model is intended as a default model for occupational or environmental intake of technetium, i.e. applicable in the absence of form- or site-specific information. Tissues depicted explicitly in the model include thyroid, salivary glands, stomach wall, right colon wall, liver, kidneys, and bone. Compared with the ICRP's current biokinetic model for occupational or environmental intake of technetium (ICRP 1993, 1994), the proposed model provides a more detailed and biologically realistic description of the systemic behaviour of technetium and is based on a broader set of experimental and medical data. For acute input of (99m)Tc (T(1/2) = 6.02 h) to blood, the ratios of cumulative (time-integrated) activity predicted by the current ICRP model to that predicted by the proposed model range from 0.4-7 for systemic regions addressed explicitly in both models. For acute input of (99)Tc (T(1/2) = 2.1 × 10(5) year) to blood, the corresponding ratios range from 0.2-30. PMID:25859762

  3. Induction of dental epithelial cell differentiation marker gene expression in non-odontogenic human keratinocytes by transfection with thymosin beta 4

    Directory of Open Access Journals (Sweden)

    Tamotsu Kiyoshima

    2014-01-01

    Full Text Available Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported that thymosin beta 4 (Tmsb4x is closely related to the initiation and development of the tooth germ. We herein attempted to establish odontogenic epithelial cells from non-odontogenic HaCaT cells by transfection with TMSB4X. TMSB4X-transfected cells formed nodules that were positive for Alizarin-red S (ALZ and von Kossa staining (calcium phosphate deposits when cultured in calcification-inducing medium. Three selected clones showing larger amounts of calcium deposits than the other clones, expressed PITX2, Cytokeratin 14, and Sonic Hedgehog. The upregulation of odontogenesis-related genes, such as runt-related transcription factor 2 (RUNX2, Amelogenin (AMELX, Ameloblastin (AMBN and Enamelin (ENAM was also detected. These proteins were immunohistochemically observed in nodules positive for the ALZ and von Kossa staining. RUNX2-positive selected TMSB4X-transfected cells implanted into the dorsal subcutaneous tissue of nude mice formed matrix deposits. Immunohistochemically, AMELX, AMBN and ENAM were observed in the matrix deposits. This study demonstrated the possibility of induction of dental epithelial cell differentiation marker gene expression in non-odontogenic HaCaT cells by TMSB4X.

  4. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults.

    Directory of Open Access Journals (Sweden)

    Nadja Larsen

    Full Text Available BACKGROUND: Recent evidence suggests that there is a link between metabolic diseases and bacterial populations in the gut. The aim of this study was to assess the differences between the composition of the intestinal microbiota in humans with type 2 diabetes and non-diabetic persons as control. METHODS AND FINDINGS: The study included 36 male adults with a broad range of age and body-mass indices (BMIs, among which 18 subjects were diagnosed with diabetes type 2. The fecal bacterial composition was investigated by real-time quantitative PCR (qPCR and in a subgroup of subjects (N = 20 by tag-encoded amplicon pyrosequencing of the V4 region of the 16S rRNA gene. The proportions of phylum Firmicutes and class Clostridia were significantly reduced in the diabetic group compared to the control group (P = 0.03. Furthermore, the ratios of Bacteroidetes to Firmicutes as well as the ratios of Bacteroides-Prevotella group to C. coccoides-E. rectale group correlated positively and significantly with plasma glucose concentration (P = 0.04 but not with BMIs. Similarly, class Betaproteobacteria was highly enriched in diabetic compared to non-diabetic persons (P = 0.02 and positively correlated with plasma glucose (P = 0.04. CONCLUSIONS: The results of this study indicate that type 2 diabetes in humans is associated with compositional changes in intestinal microbiota. The level of glucose tolerance should be considered when linking microbiota with metabolic diseases such as obesity and developing strategies to control metabolic diseases by modifying the gut microbiota.

  5. PARTICIPANT’S ASSESSMENT TOWARDS HUMAN DEVELOPMENT ADULT EDUCATION PROGRAM IN MALAYSIA

    OpenAIRE

    Abdul Razaq Ahmad; Norhasni Zainal Abiddin; Wan Hasmah Wan Mamat

    2009-01-01

    Adult education has been sidelined by mainstream educational researchers in Malaysia. The purpose of this article was to survey the effect of Society Development Department (KEMAS) adult education from the participants’ perspectives. The focus was on the participants’ achievements in cognitive, affective, and skill in the KEMAS programs especially in Human Development. Human intellectual is an important resource to develop a country. Thus, this study was used to focus on human development t...

  6. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Directory of Open Access Journals (Sweden)

    Xiuju Dai

    Full Text Available Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal.

  7. Eccrine sweat contains IL-1α, IL-1β and IL-31 and activates epidermal keratinocytes as a danger signal.

    Science.gov (United States)

    Dai, Xiuju; Okazaki, Hidenori; Hanakawa, Yasushi; Murakami, Masamoto; Tohyama, Mikiko; Shirakata, Yuji; Sayama, Koji

    2013-01-01

    Eccrine sweat is secreted onto the skin's surface and is not harmful to normal skin, but can exacerbate eczematous lesions in atopic dermatitis. Although eccrine sweat contains a number of minerals, proteins, and proteolytic enzymes, how it causes skin inflammation is not clear. We hypothesized that it stimulates keratinocytes directly, as a danger signal. Eccrine sweat was collected from the arms of healthy volunteers after exercise, and levels of proinflammatory cytokines in the sweat were quantified by ELISA. We detected the presence of IL-1α, IL-1β, and high levels of IL-31 in sweat samples. To investigate whether sweat activates keratinocytes, normal human keratinocytes were stimulated with concentrated sweat. Western blot analysis demonstrated the activation of NF-κB, ERK, and JNK signaling in sweat-stimulated keratinocytes. Real-time PCR using total RNA and ELISA analysis of supernatants showed the upregulation of IL-8 and IL-1β by sweat. Furthermore, pretreatment with IL-1R antagonist blocked sweat-stimulated cytokine production and signal activation, indicating that bioactive IL-1 is a major factor in the activation of keratinocytes by sweat. Moreover, IL-31 seems to be another sweat stimulator that activates keratinocytes to produce inflammatory cytokine, CCL2. Sweat is secreted onto the skin's surface and does not come into contact with keratinocytes in normal skin. However, in skin with a defective cutaneous barrier, such as atopic dermatitis-affected skin, sweat cytokines can directly act on epidermal keratinocytes, resulting in their activation. In conclusion, eccrine sweat contains proinflammatory cytokines, IL-1 and IL-31, and activates epidermal keratinocytes as a danger signal. PMID:23874436

  8. Primary Adult Human Retinal Pigment Epithelial Cell Cultures on Human Amniotic Membranes

    Directory of Open Access Journals (Sweden)

    Singhal Shweta

    2005-01-01

    Full Text Available Purpose: Retinal pigment epithelial (RPE cells grow well on surfaces that provide an extracellular matrix. Our aim was to establish primary adult human RPE cell cultures that retain their epithelial morphology in vitro using human amniotic membrane (hAM as substrate. Materials and Methods: Human cadaver eyeballs (16 were obtained from the eye bank after corneal trephination. RPE cells were harvested by a mechanical dissection of the inner choroid surface (10, group 1 or by b enzymatic digestion using 0.25% Trypsin/0.02% EDTA (6, group 2. The cells were explanted onto de-epithelialized hAM, nourished using DMEM/HAMS F-12 media and monitored for growth under the phase contrast microscope. Cell cultures were characterised by whole mount studies and paraffin sections. Growth data in the two groups were compared using the students′ ′t′ test. Results: Eleven samples (68.75% showed positive cultures with small, hexagonal cells arising from around the explant which formed a confluent and progressively pigmented monolayer. Whole mounts showed closely placed polygonal cells with heavily pigmented cytoplasm and indistinct nuclei. The histologic sections showed monolayers of cuboidal epithelium with variable pigmentation within the cytoplasm. Growth was seen by day 6-23 (average 11.5 days in the mechanical group, significantly earlier ( P Conclusions: Primary adult human RPE cell cultures retain epithelial morphology in vitro when cultured on human amniotic membranes . Mechanical dissection of the inner choroid surface appears to be an effective method of isolating RPE cells and yields earlier growth in cultures as compared to isolation by enzymatic digestion

  9. Sodium fluoride influences the expression of keratins in cultured keratinocytes

    OpenAIRE

    Prado, Euridice; Wurtz, Tilmann; Ferbus, Didier; Shabana, El-Hassan; FOREST, Nadine; Berdal, Ariane

    2010-01-01

    Epithelia in lung, skin, and kidney are often exposed to fluoride, and tissue damage in lung and kidney due to fluoride is well documented. Nevertheless, the biological effects of fluoride on epithelia are poorly investigated. In the present study, we report effects of sodium fluoride (NaF) on the differentiation of a human epithelial cell line, HaCaT. These cells may serve as a keratinocyte model, because they express a wide spectrum of keratins (Ks), and they associate into stratified tissu...

  10. HISTOLOGICAL SEXUAL DIFFERENCES IN ADULT HUMAN PARATHYROID GLANDS

    Directory of Open Access Journals (Sweden)

    Fating Anita

    2014-07-01

    Full Text Available CONTEXT (BACKGROUND: Increasing problems of calcium deficiency with physiological conditions like pregnancy, lactation etc. it becomes the need of time to focus attention towards these glands as one of the essential entity. Hence we have undertaken this study to have an idea about normal variation in the gland as per sex. AIMS: To reveal sexual differences in adult human parathyroid glands. METHODS AND MATERIAL: Parathyroid glands from 25 autopsied cases of 20 to 59 years were studied after staining with Hematoxylin & Eosin, Masson’s Trichrome & Reticulin stains. STATISTICAL ANALYSIS: Data is analyzed on statistical software intercooled STATA version 8.0. Data was presented in mean± standard deviation & categorical variables were expressed in percentages. Comparison of oxyphil scores in male & female was done by unpaired‘t’ test. P < 0.05 was taken as statistical significance. RESULTS: Stroma composed of short often branching reticular fibres along with blood vessels and fat cells. By statistical examination the amount of fat was more in case of females than in males of same age groups. Oxyphil cells being less numerous than chief cells were distinguished by their dark eosinophilic, granular cytoplasm and were arranged mostly in closely packed groups without interstitial fat in between the cells. Oxyphil cells also found as placed singly among chief cells. It was also observed as continuous masses or anastomosing columns. As compared with males oxyphil cells are more in females. CONCLUSIONS: By statistical analysis 1 Percentage of stromal fat in case of females was slightly greater than in males of same age group. 2 The score of oxyphil cells in females was double to more than triple as compared to male score of same age group. 3 This study is clinically important as hormonal changes occurs early in females than in males and it is in favor of providing supplementary calcium with D3 along with minimal dose of estrogen as age advances in

  11. Nanosized fibers' effect on adult human articular chondrocytes behavior

    International Nuclear Information System (INIS)

    Tissue engineering with chondrogenic cell based therapies is an expanding field with the intention of treating cartilage defects. It has been suggested that scaffolds used in cartilage tissue engineering influence cellular behavior and thus the long-term clinical outcome. The objective of this study was to assess whether chondrocyte attachment, proliferation and post-expansion re-differentiation could be influenced by the size of the fibers presented to the cells in a scaffold. Polylactic acid (PLA) scaffolds with different fiber morphologies were produced, i.e. microfiber (MS) scaffolds as well as nanofiber-coated microfiber scaffold (NMS). Adult human articular chondrocytes were cultured in the scaffolds in vitro up to 28 days, and the resulting constructs were assessed histologically, immunohistochemically, and biochemically. Attachment of cells and serum proteins to the scaffolds was affected by the architecture. The results point toward nano-patterning onto the microfibers influencing proliferation of the chondrocytes, and the overall 3D environment having a greater influence on the re-differentiation. In the efforts of finding the optimal scaffold for cartilage tissue engineering, studies as the current contribute to the knowledge of how to affect and control chondrocytes behavior. - Highlights: ► Chondrocyte behavior in nanofiber-coated microfiber versus microfiber scaffolds ► High porosity (> 90%) and large pore sizes (a few hundred μm) of nanofibrous scaffolds ► Proliferation enhanced by presence of nanofibers ► Differentiation not significantly affected ► Cell attachment improved in presence of both nanofibers and serum

  12. Air-stimulated ATP release from keratinocytes occurs through connexin hemichannels.

    Directory of Open Access Journals (Sweden)

    Travis P Barr

    Full Text Available Cutaneous ATP release plays an important role in both epidermal stratification and chronic pain, but little is known about ATP release mechanisms in keratinocytes that comprise the epidermis. In this study, we analyzed ATP release from cultured human neonatal keratinocytes briefly exposed to air, a process previously demonstrated to trigger ATP release from these cells. We show that exposing keratinocytes to air by removing media for 15 seconds causes a robust, long-lasting ATP release. This air-stimulated ATP release was increased in calcium differentiated cultures which showed a corresponding increase in connexin 43 mRNA, a major component of keratinocyte hemichannels. The known connexin hemichannel inhibitors 1-octanol and carbenoxolone both significantly reduced air-stimulated ATP release, as did two drugs traditionally used as ABC transporter inhibitors (glibenclamide and verapamil. These same 4 inhibitors also prevented an increase in the uptake of a connexin permeable dye induced by air exposure, confirming that connexin hemichannels are open during air-stimulated ATP release. In contrast, activity of the MDR1 ABC transporter was reduced by air exposure and the drugs that inhibited air-stimulated ATP release had differential effects on this transporter. These results indicate that air exposure elicits non-vesicular release of ATP from keratinocytes through connexin hemichannels and that drugs used to target connexin hemichannels and ABC transporters may cross-inhibit. Connexins represent a novel, peripheral target for the treatment of chronic pain and dermatological disease.

  13. Production of superoxide anions by keratinocytes initiates P. acnes-induced inflammation of the skin.

    Directory of Open Access Journals (Sweden)

    Philippe A Grange

    2009-07-01

    Full Text Available Acne vulgaris is a chronic inflammatory disorder of the sebaceous follicles. Propionibacterium acnes (P. acnes, a gram-positive anareobic bacterium, plays a critical role in the development of these inflammatory lesions. This study aimed at determining whether reactive oxygen species (ROS are produced by keratinocytes upon P. acnes infection, dissecting the mechanism of this production, and investigating how this phenomenon integrates in the general inflammatory response induced by P. acnes. In our hands, ROS, and especially superoxide anions (O2(*-, were rapidly produced by keratinocytes upon stimulation by P. acnes surface proteins. In P. acnes-stimulated keratinocytes, O2(*- was produced by NAD(PH oxidase through activation of the scavenger receptor CD36. O2(*- was dismuted by superoxide dismutase to form hydrogen peroxide which was further detoxified into water by the GSH/GPx system. In addition, P. acnes-induced O2(*- abrogated P. acnes growth and was involved in keratinocyte lysis through the combination of O2(*- with nitric oxide to form peroxynitrites. Finally, retinoic acid derivates, the most efficient anti-acneic drugs, prevent O2(*- production, IL-8 release and keratinocyte apoptosis, suggesting the relevance of this pathway in humans.

  14. Infliximab inhibits DNA repair in ultraviolet B-irradiated premalignant keratinocytes

    DEFF Research Database (Denmark)

    Faurschou, A.; Gniadecki, R.; Wulf, Hans Chr.

    2008-01-01

    affects the cell cycle and DNA repair in premalignant human keratinocytes after ultraviolet-B (UVB) irradiation. We found that infliximab-treated cells exhibited an enhanced G2/M cell cycle arrest and increased apoptosis after 10-20 mJ/cm(2) UVB. In spite of this, the level of cyclobutane pyrimidine...... and stimulates the G2/M checkpoint and apoptosis in UVB-irradiated keratinocytes, the repair of CPD is impaired. It is conceivable that anti-TNF alpha treatments may contribute to the accumulation of mutagenic lesions in the epidermis and enhance the early stages of skin carcinogenesis Udgivelsesdato...

  15. Brain stem auditory evoked responses in human infants and adults

    Science.gov (United States)

    Hecox, K.; Galambos, R.

    1974-01-01

    Brain stem evoked potentials were recorded by conventional scalp electrodes in infants (3 weeks to 3 years of age) and adults. The latency of one of the major response components (wave V) is shown to be a function both of click intensity and the age of the subject; this latency at a given signal strength shortens postnatally to reach the adult value (about 6 msec) by 12 to 18 months of age. The demonstrated reliability and limited variability of these brain stem electrophysiological responses provide the basis for an optimistic estimate of their usefulness as an objective method for assessing hearing in infants and adults.

  16. Reaching beyond the United States: Adventures in International Adult Education and Human Resource Development

    Science.gov (United States)

    Henschke, John A.

    2005-01-01

    In this article, the author shares his experience of how travel and adult education merged, for him, into a major emphasis in international adult education (AE) and human resource development (HRD). International ventures have been some of the most exciting and learning-filled aspects of the author's career in AE and HRD. His involvement in…

  17. MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation

    International Nuclear Information System (INIS)

    Highlights: ► miR-191 expression is upregulated in senescencent human epidermal keratinocytes. ► miR-191 overexpression is sufficient per se to induce senescence in keratinocytes. ► SATB1 and CDK6 are downregulated in senescence and are direct miR-191 targets. ► SATB1 and CDK6 silencing by siRNA triggers senescence in HEKn cells. -- Abstract: Keratinocyte replicative senescence has an important role in time-dependent changes of the epidermis, a tissue with high turnover. Senescence encompasses growth arrest during which cells remain metabolically active but acquire a typical enlarged, vacuolar and flattened morphology. It is also accompanied by the expression of endogenous senescence-associated-β-galactosidase and specific gene expression profiles. MicroRNAs levels have been shown to be modulated during keratinocytes senescence, playing key roles in inhibiting proliferation and in the acquisition of senescent markers. Here, we identify miR-191 as an anti-proliferative and replicative senescence-associated miRNA in primary human keratinocytes. Its overexpression is sufficient per se to induce senescence, as evaluated by induction of several senescence-associated markers. We show that SATB1 and CDK6 3′UTRs are two miR-191 direct targets involved in this pathway. Cdk6 and Satb1 protein levels decrease during keratinocytes replicative senescence and their silencing by siRNA is able to induce a G1 block in cell cycle, accompanied by an increase in senescence-associated markers.

  18. Propagation of Adult SSCs: From Mouse to Human

    OpenAIRE

    Martin, Laura A.; Marco Seandel

    2013-01-01

    Adult spermatogonial stem cells (SSCs) represent a distinctive source of stem cells in mammals for several reasons. First, by giving rise to spermatogenesis, SSCs are responsible for the propagation of a father’s genetic material. As such, autologous SSCs have been considered for treatment of infertility and other purposes, including correction of inherited disorders. Second, adult spermatogonia can spontaneously produce embryonic-like stem cells in vitro, which could be used a...

  19. Isolation of alveolar epithelial type II progenitor cells from adult human lungs

    OpenAIRE

    Fujino, Naoya; Kubo, Hiroshi; Suzuki, Takaya; Ota, Chiharu; Hegab, Ahmed E.; He, Mei; Suzuki, Satoshi; Suzuki, Takashi; Yamada, Mitsuhiro; Kondo, Takashi; Kato, Hidemasa; Yamaya, Mutsuo

    2010-01-01

    Resident stem/progenitor cells in the lung are important for tissue homeostasis and repair. However, a progenitor population for alveolar type II (ATII) cells in adult human lungs has not been identified. The aim of this study is to isolate progenitor cells from adult human lungs with the ability to differentiate into ATII cells. We isolated colony-forming cells that had the capability for self-renewal and the potential to generate ATII cells in vitro. These undifferentiated progenitor cells ...

  20. MORPHOLOGICAL STUDY OF THE BASILAR ARTERY IN ADULT HUMAN CADAVERS

    Directory of Open Access Journals (Sweden)

    Harish A. Wankhede

    2014-09-01

    Full Text Available Background: The basilar artery is the large median and major artery of the posterior circulation of the brain. Many variations are seen in the basilar artery, majority of them in position, origin and shape of the artery. Many authors have documented various anomalies as well as differences of the anatomy in this area in the Indian population as compared to the Western literature. Context and purpose of study: Many studies are available on the anterior circulation of the brain i.e. on vessels of the circle of Willis but studies on the posterior circulation are very few. And such studies so far had been done mostly in the American and European races and are mostly based on imaging techniques. Studies in the Indian population have been few. Hence the present study is concentrated on the morphological study of the basilar artery of human adult brain, to show the frequency and type of variations in the morphology of the basilar artery. Results: The basilar artery most commonly takes origin from the vertebral artery where left vertebral artery is greater in size than the right vertebral artery (72.5%. Level of formation of the basilar artery is most commonly observed at the ponto-medullary junction (62.5%. Length of the basilar artery varied from minimum 2.4cm to maximum 3.6cm. More commonly artery lies in the range of 2.6-3.0cm (57.5%. Diameter of the basilar artery at origin ranges from 3.2-4.2mm, at mid level from 3-4mm and at termination 3.1-4mm. Level of termination of the basilar artery is more commonly at the mid brain-pons junction (50%. Most of the basilar arteries are of straight type (55% and next common is bent or curved type (37.5%. Fenestration of 4mm is seen in proximal part of the one basilar artery (2.5%. Conclusion: Variations of the basilar artery are common. Neurosurgical importance of this study lies during the exposure of the region for different purposes. Knowledge of the vascular variations will increase the success of the

  1. Selenoproteins are essential for proper keratinocyte function and skin development.

    Directory of Open Access Journals (Sweden)

    Aniruddha Sengupta

    Full Text Available Dietary selenium is known to protect skin against UV-induced damage and cancer and its topical application improves skin surface parameters in humans, while selenium deficiency compromises protective antioxidant enzymes in skin. Furthermore, skin and hair abnormalities in humans and rodents may be caused by selenium deficiency, which are overcome by dietary selenium supplementation. Most important biological functions of selenium are attributed to selenoproteins, proteins containing selenium in the form of the amino acid, selenocysteine (Sec. Sec insertion into proteins depends on Sec tRNA; thus, knocking out the Sec tRNA gene (Trsp ablates selenoprotein expression. We generated mice with targeted removal of selenoproteins in keratin 14 (K14 expressing cells and their differentiated descendents. The knockout progeny had a runt phenotype, developed skin abnormalities and experienced premature death. Lack of selenoproteins in epidermal cells led to the development of hyperplastic epidermis and aberrant hair follicle morphogenesis, accompanied by progressive alopecia after birth. Further analyses revealed that selenoproteins are essential antioxidants in skin and unveiled their role in keratinocyte growth and viability. This study links severe selenoprotein deficiency to abnormalities in skin and hair and provides genetic evidence for the role of these proteins in keratinocyte function and cutaneous development.

  2. Monocular Visual Deprivation Suppresses Excitability in Adult Human Visual Cortex

    DEFF Research Database (Denmark)

    Lou, Astrid Rosenstand; Madsen, Kristoffer Hougaard; Paulson, Olaf Bjarne;

    2011-01-01

    The adult visual cortex maintains a substantial potential for plasticity in response to a change in visual input. For instance, transcranial magnetic stimulation (TMS) studies have shown that binocular deprivation (BD) increases the cortical excitability for inducing phosphenes with TMS. Here, we...... employed TMS to trace plastic changes in adult visual cortex before, during, and after 48 h of monocular deprivation (MD) of the right dominant eye. In healthy adult volunteers, MD-induced changes in visual cortex excitability were probed with paired-pulse TMS applied to the left and right occipital cortex....... Stimulus–response curves were constructed by recording the intensity of the reported phosphenes evoked in the contralateral visual field at range of TMS intensities. Phosphene measurements revealed that MD produced a rapid and robust decrease in cortical excitability relative to a control condition without...

  3. Cyclic stretch induces upregulation of endothelin-1 with keratinocytes in vitro: Possible role in mechanical stress-induced hyperpigmentation

    International Nuclear Information System (INIS)

    Highlights: → Influence of cyclic stretch on melanogenetic paracrine cytokines was investigated. → Keratinocyte-derived endothelin-1 was upregulated with cyclic stretch. → Degree of upregulation increases dose-dependently. → This upregulation possibly plays a role in the pathogenesis of pigmented disorders. -- Abstract: The aim of this study was to investigate the possible pathological relation between mechanical stress and hyperpigmentation. We did this by investigating the influence of cyclic stretch on the expression of keratinocyte- and fibroblast-derived melanogenetic paracrine cytokines in vitro. Using primary human keratinocytes and fibroblasts, alterations of mRNA expression of melanogenetic paracrine cytokines due to cyclic stretch were investigated using a real-time polymerase chain reaction (PCR). The cytokines included basic fibroblast growth factor (bFGF), stem cell factor (SCF), granulocyte/macrophage colony-stimulating factor, interleukin-1α, and endothelin-1 (ET-1) for keratinocytes and bFGF, SCF, and hepatocyte growth factor for fibroblasts. The dose dependence of keratinocyte-derived ET-1 upregulation was further investigated using real-time PCR and an enzyme-linked immunosorbent assay. We also investigated the effects of cyclic stretch on the proliferation and differentiation of keratinocytes. Among the melanogenetic paracrine cytokines investigated, keratinocyte-derived ET-1 was consistently upregulated in all four cell lines. The degree of upregulation increased with the degree of the length and frequency of the stretch; in contrast, cell number and differentiation markers showed no obvious alterations with cyclic stretch. Keratinocyte-derived ET-1 upregulation possibly plays a significant role in the pathogenesis of pigmented disorders, such as friction melanosis, caused by mechanical stress.

  4. Cyclic stretch induces upregulation of endothelin-1 with keratinocytes in vitro: Possible role in mechanical stress-induced hyperpigmentation

    Energy Technology Data Exchange (ETDEWEB)

    Kurita, Masakazu, E-mail: masakazukurita@gmail.com [Department of Plastic Surgery, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi, Tokyo 181-8611 (Japan); Okazaki, Mutsumi [Department of Plastic and Reconstructive Surgery, Graduate School, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8510 (Japan); Fujino, Takashi [Department of Pathology, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi, Tokyo 181-8611 (Japan); Takushima, Akihiko; Harii, Kiyonori [Department of Plastic Surgery, Kyorin University School of Medicine, 6-20-2 Shinkawa, Mitaka-shi, Tokyo 181-8611 (Japan)

    2011-05-27

    Highlights: {yields} Influence of cyclic stretch on melanogenetic paracrine cytokines was investigated. {yields} Keratinocyte-derived endothelin-1 was upregulated with cyclic stretch. {yields} Degree of upregulation increases dose-dependently. {yields} This upregulation possibly plays a role in the pathogenesis of pigmented disorders. -- Abstract: The aim of this study was to investigate the possible pathological relation between mechanical stress and hyperpigmentation. We did this by investigating the influence of cyclic stretch on the expression of keratinocyte- and fibroblast-derived melanogenetic paracrine cytokines in vitro. Using primary human keratinocytes and fibroblasts, alterations of mRNA expression of melanogenetic paracrine cytokines due to cyclic stretch were investigated using a real-time polymerase chain reaction (PCR). The cytokines included basic fibroblast growth factor (bFGF), stem cell factor (SCF), granulocyte/macrophage colony-stimulating factor, interleukin-1{alpha}, and endothelin-1 (ET-1) for keratinocytes and bFGF, SCF, and hepatocyte growth factor for fibroblasts. The dose dependence of keratinocyte-derived ET-1 upregulation was further investigated using real-time PCR and an enzyme-linked immunosorbent assay. We also investigated the effects of cyclic stretch on the proliferation and differentiation of keratinocytes. Among the melanogenetic paracrine cytokines investigated, keratinocyte-derived ET-1 was consistently upregulated in all four cell lines. The degree of upregulation increased with the degree of the length and frequency of the stretch; in contrast, cell number and differentiation markers showed no obvious alterations with cyclic stretch. Keratinocyte-derived ET-1 upregulation possibly plays a significant role in the pathogenesis of pigmented disorders, such as friction melanosis, caused by mechanical stress.

  5. Effects of SHIKONIN on Cel Proliferation and Melanin Transfer of Co-Cultured Human Melanocytes and Keratinocytes%紫草素对黑素转运的影响

    Institute of Scientific and Technical Information of China (English)

    解士海; 潘武辉; 宗国勇; 黄小雄

    2014-01-01

    目的:探讨紫草素(Sh)在人表皮共培养体系中对黑素转运的影响。方法采用MTT法测定紫草素对人黑素细胞(MC)与角质形成细胞(KC)共培养体系增殖的影响,利用荧光标记技术以及流式细胞仪研究紫草素对于黑素转运的影响。结果0.25μmol/L、0.5μmol/L和1μmol/L紫草素对于人表皮共培养体系增殖无影响,0.25μmol/L、0.5μmol/L和1μmol/L紫草素对于共培养体系中黑素转运有剂量依赖地促进作用。结论紫草素对于共培养体系中黑素转运有剂量依赖的促进作用。%Objective: To study the Effects of SHIKONIN on cellProliferation and Melanin transfer of Co-Cultured of melanocytes and keratinocytes Methods: MTT method, Flow cytometry were employed to measure the cellviability, melanin transfer of co-cultured melanocytes and keratinocytes Results No influence was observed on co-cultured melanocytes and keratinocytes cellproliferation by 0.25μmol/L, 0.5μmol/L, or 1μmol/L of SHIKONIN . The melanin transfer were clearly enhanced by SHIKONIN in a dose-dependent manner at concentrations of 0.25μmol/L, 0.5μmol/L, and 1μmol/L Conclusion SHIKONIN exhibits a dose-dependent enhancing effects on melanin transfer in co-cultured melanocytes and keratinocytes.

  6. The Human Function Compunction: Teleological Explanation in Adults

    Science.gov (United States)

    Kelemen, Deborah; Rosset, Evelyn

    2009-01-01

    Research has found that children possess a broad bias in favor of teleological--or purpose-based--explanations of natural phenomena. The current two experiments explored whether adults implicitly possess a similar bias. In Study 1, undergraduates judged a series of statements as "good" (i.e., correct) or "bad" (i.e., incorrect) explanations for…

  7. Keratinocyte proliferation, differentiation, and apoptosis-Differential mechanisms of regulation by curcumin, EGCG and apigenin

    International Nuclear Information System (INIS)

    We have proposed that it is important to examine the impact of chemopreventive agents on the function of normal human epidermal keratinocytes since these cells comprise the barrier that protects the body from a range of environmental insults. In this context, it is widely appreciated that cancer may be retarded by consumption or topical application of naturally occurring food-derived chemopreventive agents. Our studies show that (-)-epigallocatechin-3-gallate (EGCG), a green tea-derived polyphenol, acts to enhance the differentiation of normal human keratinocytes as evidenced by its ability to increase involucrin (hINV), transglutaminase type 1 (TG1) and caspase-14 gene expression. EGCG also stimulates keratinocyte morphological differentiation. These actions of EGCG are mediated via activation of a nPKC, Ras, MEKK1, MEK3, p38δ-ERK1/2 signaling cascade which leads to increased activator protein 1 (AP1) and CAATT enhancer binding protein (C/EBP) transcription factor expression, increased binding of these factors to DNA, and increased gene transcription. In contrast, apigenin, a dietary flavonoid derived from plants and vegetables, and curcumin, an agent derived from turmeric, inhibit differentiation by suppressing MAPK signal transduction and reducing API transcription factor level. Curcumin also acts to enhance apoptosis, although EGCG and apigenin do not stimulate apoptosis. In addition, all of these agents inhibit keratinocyte proliferation. These findings indicate that each of these diet-derived chemopreventive agents has a profound impact on normal human keratinocyte function and that they operate via distinct and sometimes opposing mechanisms. However, all are expected to act as chemopreventive agents

  8. Increase of particulate nitric oxide synthase activity and peroxynitrite synthesis in UVB-irradiated keratinocyte membranes

    International Nuclear Information System (INIS)

    Here we demonstrate that human keratinocytes possess a Ca2+/ calmodulin-dependent particulate NO synthase that can be activated to release NO after exposure to UVB radiation. UVB irradiation (up to 20 mJ/cm2) of human keratinocyte plasma membranes resulted in a dose-dependent increase in NO and L-[3H]citrulline production that was inhibited by approx. 90% in the presence of N-monomethyl-L-arginine (L-NMMA). In time-course experiments with UVB-irradiated plasma membranes the changes in NO production were followed by analogous changes in soluble guanylate cyclase (sGC) activity. In reconstitution experiments, when particulate NO synthase was added to purified sGC isolated from keratinocyte cytosol, a 4-fold increase in cGMP was observed; the cGMP was increased by NO synthesized after UVB irradiation (up to 20 mJ/cm2) of particulate NO synthase. A 5-fold increase in superoxide (O2-) and a 7-fold increase in NO formation followed by an 8-fold increase in peroxynitrite (ONOO-) production by UVB (20 mJ/cm2)-irradiated keratinocyte microsomes was observed. UVB radiation (20 mJ/cm2) decreased plasma membrane lipid fluidity as indicated by steady-state fluorescence anisotropy. Membrane fluidity changes were prevented by L-NMMA. Changes in Arrhenius plots of particulate NO synthase in combination with changes in its allosteric properties induced by UVB radiation are consistent with a decreased fluidity of the lipid microenvironment of the enzyme. The present studies provide important new clues to the role of NO and ONOO- released by UVB-irradiated human keratinocytes in skin erythema and inflammation. (Author)

  9. Molecular Mechanism of Adult Neurogenesis and its Association with Human Brain Diseases.

    Science.gov (United States)

    Liu, He; Song, Ni

    2016-01-01

    Recent advances in neuroscience challenge the old dogma that neurogenesis occurs only during embryonic development. Mounting evidence suggests that functional neurogenesis occurs throughout adulthood. This review article discusses molecular factors that affect adult neurogenesis, including morphogens, growth factors, neurotransmitters, transcription factors, and epigenetic factors. Furthermore, we summarize and compare current evidence of associations between adult neurogenesis and human brain diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and brain tumors. PMID:27375363

  10. Effects triggered by platinum nanoparticles on primary keratinocytes

    Directory of Open Access Journals (Sweden)

    Konieczny P

    2013-10-01

    Full Text Available Piotr Konieczny,1,* Anna Grazyna Goralczyk,1,* Radoslaw Szmyd,1,* Lukasz Skalniak,1,* Joanna Koziel,2 Francesca Larese Filon,3 Matteo Crosera,4 Agnieszka Cierniak,1 Ewa K Zuba-Surma,5 Julia Borowczyk,5 Eliza Laczna,5 Justyna Drukala,5 Elzbieta Pyza,6 Danuta Semik,6 Olga Woznicka,6 Andrzej Klein,1 Jolanta Jura11Department of General Biochemistry, 2Department of Microbiology, Jagiellonian University, Kraków, Poland; 3Department of Public Health Sciences, 4Department of Chemical and Pharmaceutical Sciences, University of Trieste, Trieste, Italy; 5Department of Cell Biology, 6Department of Cell Biology and Imaging, Jagiellonian University, Kraków, Poland*These authors equally contributed to this workAbstract: The platinum (Pt-group elements (PGEs represent a new kind of environmental pollutant and a new hazard for human health. Since their introduction as vehicle-exhaust catalysts, their emissions into the environment have grown considerably compared with their low natural concentration in the earth crust. PGE emissions from vehicle catalysts can be also in the form of nanometer-sized particles (Pt nanoparticles [PtNPs]. These elements, both in their metallic form or as ions solubilized in biological media, are now recognized as potent allergens and sensitizers. Human skin is always exposed to toxic particles; therefore, in the present study we addressed the question of whether polyvinylpyrrolidone-coated PtNPs may have any negative effects on skin cells, including predominantly epidermal keratinocytes. In this study, PtNPs of two sizes were used: 5.8 nm and 57 nm, in concentrations of 6.25, 12.5, and 25 µg/mL. Both types of NPs were protected with polyvinylpyrrolidone. Primary keratinocytes were treated for 24 and 48 hours, then cytotoxicity, genotoxicity, morphology, metabolic activity, and changes in the activation of signaling pathways were investigated in PtNP-treated cells. We found that PtNPs trigger toxic effects on primary keratinocytes

  11. Clinical characteristics analysis of adult human adenovirus type 7 infection

    Institute of Scientific and Technical Information of China (English)

    张乃春

    2014-01-01

    Objective To investigate the clinical characteristics of patients infected with human adenovirus type 7 and to provide guidance for early diagnosis and timely control of the outbreak.Methods A total of 301 patients infected with the human adenoviruses who were quarantined in hospital from December 2012 to February 2013 were observed.Epidemiological questionnaires were used to collect data of clinical features of the disease including

  12. The weight of nations: an estimation of adult human biomass

    OpenAIRE

    Walpole Sarah; Prieto-Merino David; Edwards Phil; Cleland John; Stevens Gretchen; Roberts Ian

    2012-01-01

    Abstract Background The energy requirement of species at each trophic level in an ecological pyramid is a function of the number of organisms and their average mass. Regarding human populations, although considerable attention is given to estimating the number of people, much less is given to estimating average mass, despite evidence that average body mass is increasing. We estimate global human biomass, its distribution by region and the proportion of biomass due to overweight and obesity. M...

  13. A century of trends in adult human height

    Science.gov (United States)

    2016-01-01

    Being taller is associated with enhanced longevity, and higher education and earnings. We reanalysed 1472 population-based studies, with measurement of height on more than 18.6 million participants to estimate mean height for people born between 1896 and 1996 in 200 countries. The largest gain in adult height over the past century has occurred in South Korean women and Iranian men, who became 20.2 cm (95% credible interval 17.5–22.7) and 16.5 cm (13.3–19.7) taller, respectively. In contrast, there was little change in adult height in some sub-Saharan African countries and in South Asia over the century of analysis. The tallest people over these 100 years are men born in the Netherlands in the last quarter of 20th century, whose average heights surpassed 182.5 cm, and the shortest were women born in Guatemala in 1896 (140.3 cm; 135.8–144.8). The height differential between the tallest and shortest populations was 19-20 cm a century ago, and has remained the same for women and increased for men a century later despite substantial changes in the ranking of countries. DOI: http://dx.doi.org/10.7554/eLife.13410.001 PMID:27458798

  14. Development and application of the Chinese adult female computational phantom Rad-HUMAN

    International Nuclear Information System (INIS)

    Rad-HUMAN is a whole-body numerical phantom of a Chinese adult woman which contains 46 organs and tissues and was created by MCAM6 software using the color photographs of the Chinese Visible Human dataset. This dataset was obtained from a 22-year old Chinese female cadaver judged to represent normal human anatomy as much as possible. The density and elemental composition recommended in the ICRP Publication 89 and in the ICRU report 44 were assigned to the organ and tissue in Rad-HUMAN for radiation protection purpose. The last step was to implement the anatomical data into a Monte Carlo code. Rad-HUMAN contains more than 28.8 billion tiny volume units, which produces an accurately whole-body numerical phantom of a Chinese adult female

  15. Happiness, depression and human benevolence beliefs in institutionalized and non institutionalized major adults

    Directory of Open Access Journals (Sweden)

    Walter L. Arias

    2013-12-01

    Full Text Available In this study we analyze the relations between happiness, depression and human benevolence beliefs in a group of major people who live in asylums (24 and others who live with their families (38. We use Lima’s happiness scale, Yesavage’s Geriatric depression scale and Belief in human scale. We found that there were no significant differences between two groups of major adults in depression levels, but in happiness, positive sense of life and satisfaction with life, non institutionalized older adults had higher punctuations than major people who lived in asylums.

  16. The human traffickers and exploitation of children and young adults.

    Directory of Open Access Journals (Sweden)

    Sara Scala

    2012-06-01

    Full Text Available The article focuses on the traffic of children, who are kidnapped, cheated and purchased by their families to be exploited in many ways. These victims have severe mental and physical traumas. Many of them, slaves of their exploiters, remain invisible and live their lifes without fundamental rights and without any kind of support or help. The traffic in human beings is a new kind of slavery, which acts in the dark, is criminal and involves different subjects of different ages, different nationalities and generations. The traffic in human beings is managed by transnational criminal organizations and is a disturbing and growing phenomena around the world.

  17. Reorganization of the interchromosomal network during keratinocyte differentiation.

    Science.gov (United States)

    Sehgal, Nitasha; Seifert, Brandon; Ding, Hu; Chen, Zihe; Stojkovic, Branislav; Bhattacharya, Sambit; Xu, Jinhui; Berezney, Ronald

    2016-06-01

    The well-established human epidermal keratinocyte (HEK) differentiation model was investigated to determine possible alterations in chromosome territory (CT) association during differentiation. The seven human chromosomes (1, 4, 11, 12, 16, 17, and 18) selected for this analysis are representative of the chromosome size and gene density range of the overall human genome as well as including a majority of genes involved in epidermal development and differentiation (CT1, 12, and 17). Induction with calcium chloride (Ca(2+)) resulted in morphological changes characteristic of keratinocyte differentiation. Combined multi-fluorescence in situ hybridization (FISH) and computational image analysis on the undifferentiated (0 h) and differentiated (24 h after Ca(2+) treatment) HEK revealed that (a) increases in CT volumes correspond to overall nuclear volume increases, (b) radial positioning is gene density-dependent at 0 h but neither gene density- nor size-dependent at 24 h, (c) the average number of interchromosomal associations for each CT is gene density-dependent and similar at both time points, and (d) there are striking differences in the single and multiple pairwise interchromosomal association profiles. Probabilistic network models of the overall interchromosomal associations demonstrate major reorganization of the network during differentiation. Only ~40 % of the CT pairwise connections in the networks are common to both 0 and 24 h HEK. We propose that there is a probabilistic chromosome positional code which can be significantly altered during cell differentiation in coordination with reprogramming of gene expression. PMID:26490167

  18. PROTEIN THERAPEUTICS FOR JUNCTIONAL EPIDERMOLYSIS BULLOSA: INCORPORATION OF RECOMBINANT β3 CHAIN INTO LAMININ 332 IN β3-/- KERATINOCYTES IN VITRO

    OpenAIRE

    Igoucheva, Olga; Kelly, Aislinn; Uitto, Jouni; Alexeev, Vitali

    2007-01-01

    Junctional epidermolysis bullosa (JEB) is an inherited mechanobullous disease characterized by reduced adherence of the epidermal keratinocytes to the underlying dermis and often caused by the absence of functional laminin 332 due to the lack or dysfunction of its β3 chain. As there are no specific therapies for the JEB, we tested whether protein replacement strategy could be applicable for the restoration of the laminin 332 assembly and reversion of the JEB phenotype in human keratinocytes t...

  19. Gut microbiota in human adults with type 2 diabetes differs from non-diabetic adults

    DEFF Research Database (Denmark)

    Larsen, Nadja; Vogensen, Finn Kvist; van der Berg, Franciscus Winfried J;

    2010-01-01

    Background Recent evidence suggests that there is a link between metabolic diseases and bacterial populations in the gut. The aim of this study was to assess the differences between the composition of the intestinal microbiota in humans with type 2 diabetes and non-diabetic persons as control...... control metabolic diseases by modifying the gut microbiota....... = 0.04). Conclusions The results of this study indicate that type 2 diabetes in humans is associated with compositional changes in intestinal microbiota. The level of glucose tolerance should be considered when linking microbiota with metabolic diseases such as obesity and developing strategies to...

  20. Local Glucocorticoid Activation by 11β-Hydroxysteroid Dehydrogenase 1 in Keratinocytes: The Role in Hapten-Induced Dermatitis.

    Science.gov (United States)

    Terao, Mika; Itoi, Saori; Matsumura, Sayaka; Yang, Lingli; Murota, Hiroyuki; Katayama, Ichiro

    2016-06-01

    Over the past decade, extra-adrenal cortisol production was reported in various tissues. The enzyme that catalyzes the conversion of hormonally inactive cortisone into active cortisol in cells is 11β-hydroxysteroid dehydrogenase 1 (11β-HSD1). We recently reported that 11β-HSD1 is also expressed in keratinocytes and regulates inflammation and keratinocyte proliferation. To investigate the function of 11β-HSD1 in keratinocytes during inflammation in vivo, we created keratinocyte-specific 11β-HSD1 knockout (K5-Hsd11b1-KO) mice and analyzed the inflammatory response in models of hapten-induced contact irritant dermatitis. K5-Hsd11b1-KO mice showed enhanced ear swelling in low-dose oxazolone-, 2,4,6-trinitro-1-chlorobenzene (TNCB)-, and 2,4-dinitrofluorobenzene-induced irritant dermatitis associated with increased inflammatory cell infiltration. Topical application of corticosterone dose dependently suppressed TNCB-induced ear swelling and cytokine expression. Similarly in mouse keratinocytes in vitro, corticosterone dose dependently suppressed 2,4,6-trinitrobenzenesulfonic acid-induced IL-1α and IL-1β expression. The effect of 11-dehydrocorticosterone was attenuated in TNCB-induced irritant dermatitis in K5-Hsd11b1-KO mice compared with wild-type mice. In human samples, 11β-HSD1 expression was decreased in epidermis of psoriasis vulgaris compared with healthy skin. Taken together, these data suggest that corticosterone activation by 11β-HSD1 in keratinocytes suppresses hapten-induced irritant dermatitis through suppression of expression of cytokines, such as IL-1α and IL-1β, in keratinocytes. PMID:27070821

  1. Anomalous features of EMT during keratinocyte transformation.

    Directory of Open Access Journals (Sweden)

    Tamar Geiger

    Full Text Available During the evolution of epithelial cancers, cells often lose their characteristic features and acquire a mesenchymal phenotype, in a process known as epithelial-mesenchymal transition (EMT. In the present study we followed early stages of keratinocyte transformation by HPV16, and observed diverse cellular changes, associated with EMT. We compared primary keratinocytes with early and late passages of HF1 cells, a cell line of HPV16-transformed keratinocytes. We have previously shown that during the progression from the normal cells to early HF1 cells, immortalization is acquired, while in the progression to late HF1, cells become anchorage independent. We show here that during the transition from the normal state to late HF1 cells, there is a progressive reduction in cytokeratin expression, desmosome formation, adherens junctions and focal adhesions, ultimately leading to poorly adhesive phenotype, which is associated with anchorage-independence. Surprisingly, unlike "conventional EMT", these changes are associated with reduced Rac1-dependent cell migration. We monitored reduced Rac1-dependent migration also in the cervical cancer cell line SiHa. Therefore we can conclude that up to the stage of tumor formation migratory activity is eliminated.

  2. Two animated adult human voxel phantoms based on polygon mesh surfaces

    International Nuclear Information System (INIS)

    Among computational models used in radiation protection, voxel phantoms based on computer tomographic (CT), nuclear magnetic resonance (NMR) or colour photographic images, became very popular in recent years. Although being a true to nature representation of the scanned individual the scanning is usually made in supine position, which causes a shift of internal organs towards the ribcage, a compression of the lungs and a reduction of the sagittal diameter especially in the abdominal region compared to the anatomy of a person in upright standing position, which in turn can influence absorbed or equivalent dose estimates. This study proposes a method for human phantom design using tools recently developed in the areas of computer graphics and animated films and applies them to the creation and modelling of artificial 3 D human organs and tissues. Two animated models, a male and a female adult human phantom have been developed based on anatomical atlases, observing at the same time the anatomical specifications published by the International Commission on Radiological Protection for the male and female reference adult. The phantoms are called FAXAA (Female Adult voXelAverage-Average) and MAXAA (Male Adult voXelAverage-Average) because they represent female and male adults with average weight and average height. (author)

  3. Canonical Genetic Signatures of the Adult Human Brain

    OpenAIRE

    Hawrylycz, Michael; Miller, Jeremy A.; Menon, Vilas; Feng, David; Dolbeare, Tim; Guillozet-Bongaarts, Angela L.; Anil G. Jegga; Aronow, Bruce J.; Lee, Chang-Kyu; Bernard, Amy; Glasser, Matthew F.; Dierker, Donna L; Menche, Jörge; Szafer, Aaron; Collman, Forrest

    2015-01-01

    The structure and function of the human brain are highly stereotyped, implying a conserved molecular program responsible for its development, cellular structure, and function. We applied a correlation-based metric of “differential stability” (DS) to assess reproducibility of gene expression patterning across 132 structures in six individual brains, revealing meso-scale genetic organization. The highest DS genes are highly biologically relevant, with enrichment for brain-related biological ann...

  4. Testosterone affects language areas of the adult human brain.

    Science.gov (United States)

    Hahn, Andreas; Kranz, Georg S; Sladky, Ronald; Kaufmann, Ulrike; Ganger, Sebastian; Hummer, Allan; Seiger, Rene; Spies, Marie; Vanicek, Thomas; Winkler, Dietmar; Kasper, Siegfried; Windischberger, Christian; Swaab, Dick F; Lanzenberger, Rupert

    2016-05-01

    Although the sex steroid hormone testosterone is integrally involved in the development of language processing, ethical considerations mostly limit investigations to single hormone administrations. To circumvent this issue we assessed the influence of continuous high-dose hormone application in adult female-to-male transsexuals. Subjects underwent magnetic resonance imaging before and after 4 weeks of testosterone treatment, with each scan including structural, diffusion weighted and functional imaging. Voxel-based morphometry analysis showed decreased gray matter volume with increasing levels of bioavailable testosterone exclusively in Broca's and Wernicke's areas. Particularly, this may link known sex differences in language performance to the influence of testosterone on relevant brain regions. Using probabilistic tractography, we further observed that longitudinal changes in testosterone negatively predicted changes in mean diffusivity of the corresponding structural connection passing through the extreme capsule. Considering a related increase in myelin staining in rodents, this potentially reflects a strengthening of the fiber tract particularly involved in language comprehension. Finally, functional images at resting-state were evaluated, showing increased functional connectivity between the two brain regions with increasing testosterone levels. These findings suggest testosterone-dependent neuroplastic adaptations in adulthood within language-specific brain regions and connections. Importantly, deteriorations in gray matter volume seem to be compensated by enhancement of corresponding structural and functional connectivity. Hum Brain Mapp 37:1738-1748, 2016. © 2016 Wiley Periodicals, Inc. PMID:26876303

  5. Adult human neural stem cell therapeutics: Currentdevelopmental status and prospect

    Institute of Scientific and Technical Information of China (English)

    Hyun Nam; Kee-Hang Lee; Do-Hyun Nam; Kyeung Min Joo

    2015-01-01

    Over the past two decades, regenerative therapies usingstem cell technologies have been developed for variousneurological diseases. Although stem cell therapy is anattractive option to reverse neural tissue damage and torecover neurological deficits, it is still under developmentso as not to show significant treatment effects in clinicalsettings. In this review, we discuss the scientific andclinical basics of adult neural stem cells (aNSCs), andtheir current developmental status as cell therapeuticsfor neurological disease. Compared with other typesof stem cells, aNSCs have clinical advantages, suchas limited proliferation, inborn differentiation potentialinto functional neural cells, and no ethical issues. Inspite of the merits of aNSCs, difficulties in the isolationfrom the normal brain, and in the in vitro expansion,have blocked preclinical and clinical study using aNSCs.However, several groups have recently developed noveltechniques to isolate and expand aNSCs from normaladult brains, and showed successful applications ofaNSCs to neurological diseases. With new technologiesfor aNSCs and their clinical strengths, previous hurdlesin stem cell therapies for neurological diseases could beovercome, to realize clinically efficacious regenerativestem cell therapeutics.

  6. Xenobiotics in vitro: the influence of L-cystine, pantothenat, and miliacin on metabolic and proliferative capacity of keratinocytes.

    Science.gov (United States)

    Obrigkeit, D Hoeller; Oepen, T; Jugert, F K; Merk, H F; Kubicki, J

    2006-01-01

    To investigate the effect of cell growth-stimulating agents on human epidermal keratinocytes, we exposed monolayers of normal human keratinocytes derived from foreskin to different concentrations of the amino acid L-cystine, the member of the vitamin B family D-pantothenat, the phytosterol miliacin, and a combination thereof in keratinocyte growth medium. As a test system for the metabolic capacity, we used the activity of mitochondrial deyhdrogenases as measured by XTT, and for the cell proliferation, we determined the BrdU-uptake. The additives, active ingredients of the hair growth drug PRIORIN, were added in the presence of fully supplemented keratinocyte growth medium or a deficient medium without L-cystine, L-methionine, L-histidin, D-pantothenat, epidermal growth factor, and bovine pituary gland extract. Deficient medium itself reduced the metabolic capacity of keratinocytes to 35% compared with keratinocytes in fully supplemented growth medium. In deficient medium cell, proliferation was not measurable. Increasing doses of L-cystine restored the reduced metabolic capacity from 46% (0.009 mg/L) to 54% (0.09 mg/L) and 92% (0.45 mg/L) in deficient medium. Addition of D-pantothenat (0.43 mg/L) enhanced the metabolic capacity to 150% only in fully supplemented growth medium, compared with untreated controls with growth medium. Miliacin (6 mg/mL) increased not only the metabolic capacity (162%) but also stimulated cell proliferation (215%) as measured by BrdU-uptake in growth medium. The combination of all three additives increased the metabolic capacity (245%) synergistically in growth medium. We were able to show effects of D-panthenol, L-lysine, and miliacin on proliferation and metabolic capacity of keratinocyte monocell culture, which was further increased by combination of the three substances. These basic results suggest a beneficial effect on keratinocyte growth and stimulation by products combining these substances (e.g., Priorin). Furthermore, this work

  7. Human-derived neural progenitors functionally replace astrocytes in adult mice

    OpenAIRE

    Chen, Hong; Qian, Kun; Chen, Wei; Hu, Baoyang; Blackbourn, Lisle W.; Du, Zhongwei; Ma, Lixiang; Liu, Huisheng; Knobel, Karla M.; Ayala, Melvin; Zhang, Su-Chun

    2015-01-01

    Astrocytes are integral components of the homeostatic neural network as well as active participants in pathogenesis of and recovery from nearly all neurological conditions. Evolutionarily, compared with lower vertebrates and nonhuman primates, humans have an increased astrocyte-to-neuron ratio; however, a lack of effective models has hindered the study of the complex roles of human astrocytes in intact adult animals. Here, we demonstrated that after transplantation into the cervical spinal co...

  8. Shifts in human skin and nares microbiota of healthy children and adults

    OpenAIRE

    Oh, Julia; Conlan, Sean; Polley, Eric C.; Segre, Julia A.; Kong, Heidi H.

    2012-01-01

    Background Characterization of the topographical and temporal diversity of the microbial collective (microbiome) hosted by healthy human skin established a reference for studying disease-causing microbiomes. Physiologic changes occur in the skin as humans mature from infancy to adulthood. Thus, characterizations of adult microbiomes might have limitations when considering pediatric disorders such as atopic dermatitis (AD) or issues such as sites of microbial carriage. The objective of this st...

  9. Happiness, depression and human benevolence beliefs in institutionalized and non institutionalized major adults

    OpenAIRE

    Walter L. Arias; Luis Yepez; Ana L. Núñez; Adriana Oblitas; Susana Pinedo; María A. Masías; Joice Hurtado

    2013-01-01

    In this study we analyze the relations between happiness, depression and human benevolence beliefs in a group of major people who live in asylums (24) and others who live with their families (38). We use Lima’s happiness scale, Yesavage’s Geriatric depression scale and Belief in human scale. We found that there were no significant differences between two groups of major adults in depression levels, but in happiness, positive sense of life and satisfaction with life, non institutionalized olde...

  10. Spatial Distribution of Stem Cell-Like Keratinocytes in Dissected Compound Hair Follicles of the Dog.

    Directory of Open Access Journals (Sweden)

    Dominique J Wiener

    Full Text Available Hair cycle disturbances are common in dogs and comparable to some alopecic disorders in humans. A normal hair cycle is maintained by follicular stem cells which are predominately found in an area known as the bulge. Due to similar morphological characteristics of the bulge area in humans and dogs, the shared particularity of compound hair follicles as well as similarities in follicular biomarker expression, the dog is a promising model to study human hair cycle and stem cell disorders. To gain insight into the spatial distribution of follicular keratinocytes with stem cell potential in canine compound follicles, we microdissected hair follicles in anagen and telogen from skin samples of freshly euthanized dogs. The keratinocytes isolated from different locations were investigated for their colony forming efficiency, growth and differentiation potential