WorldWideScience

Sample records for adult anastrepha obliqua

  1. A New Adult Diet Formulation for Sterile Males of Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Orozco-Dávila, Dina; Quintero-Fong, Luis

    2015-08-01

    A new adult diet formulation was evaluated for sterile Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) males at the emergence and release facility of fruit flies in Mexico. The formulation consists of hydrolyzed protein, sugar, juvenile hormone analogue methoprene, and water. The proportion of the ingredients between the solute (4% hydrolyzed protein and 96% sugar) and solvent (10% methoprene and 90% water) was 5:1. This new formulation was called the 1:24 formulation. The main objectives of this study were to develop a simple way to supply the 1:24 formulation to adults and to compare the sexual performance of these flies with the performance of flies fed a standard diet (called the Mubarqui formulation) used at the emergence and release facility of fruit flies in Mexico. The preparation, time, and cost also were evaluated. The results showed no significant differences in the sexual behaviors of the males (number of males mating, number of males calling, mating latency, and mating duration) between the 1:24 formulation and the Mubarqui formulation. However, the cost and the required preparation time are much lower for the 1:24 formulation process than for the Mubarqui formulation process. Based on these results, we recommend the 1:24 formulation as an additional adult diet option in the handling of sterile flies. Its application is practical and does not require changes in packaging systems. The contribution of our findings and their potential application to the improvement of the sterile insect technique are discussed. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Nutritive value of diets with different carbohydrates for adult Anastrepha obliqua (Macquart (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Tânia Mara de Lima Fontellas

    1999-01-01

    Full Text Available Adult Tephritidae, especially of the genus Anastrepha (Schiner, 1868, have been observed to feed on a wide variety of natural diets. The fruit on which they feed, in general, are rich in sugar content, chiefly glucose, frutose and sucrose, which are also the sugars that those insects utilise better. Neither the behavioural mechanisms, nor the physiological ones, that control food selection by insects, are well known. Because some of those aspects are not known for the species Anastrepha obliqua (Macquart, 1835 either, and in order to understand their biology better, three experiments were conducted. In the first experiment, it was checked whether there was a difference in metabolic profit by those insects, when fed the carbohydrates more frequently found in nature, as resulting in a bigger egg production and higher survival rate at the end of the experiment. In the second, it was checked whether A. obliqua can regulate diet ingestion according to carbohydrate content in dry as well as wet diets. In the third experiment, measurements were made to establish the lowest carbohydrate concentration flies are able to recognise in the diet. Analysis of the data showed that ingestion of carbohydrates which are commonly found in nature, in association with a protein source, is very well utilised by females of A. obliqua. It was also shown that .those insects are not probably able to compensate for the difference in carbohydrate content in dry diets, whereas they do so for wet diets. In relation to discrimination threshold, it seems that it is related to the higher occurrence of the carbohydrate in their normal diet, that is, they can recognise carbohydrates that are common in their natural diet better than the less frequent ones.

  3. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  4. There is no magic fruit fly trap: multiple biological factors influence the response of adult Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) individuals to MultiLure traps baited with BioLure or NuLure.

    Science.gov (United States)

    Díaz-Fleischer, Francisco; Arredondo, José; Flores, Salvador; Montoya, Pablo; Aluja, Martín

    2009-02-01

    Field-cage experiments were performed to determine the effectiveness of MultiLure traps (Better World MFG Inc., Fresno, CA) baited with NuLure (Miller Chemical and Fertilizer Corp., Hanover, PA) or BioLure (Suterra LLC, Inc., Bend, OR) in capturing individually marked Mexican fruit fly, Anastrepha ludens (Loew), and West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), of both sexes. Experimental treatments involved wild and laboratory-reared flies of varying ages (2-4 and 15-18 d) and dietary histories (sugar only, open fruit, open fruit plus chicken feces, and hydrolyzed protein mixed with sugar). Data were divided into two parts: total captures over a 24-h period and trap visits/landings, entrances into interior of trap ,and effective captures (i.e., drowning in liquid bait or water) over a 5-h detailed observation period (0600-1100 hours). The response to the two baits varied by fly species, gender, physiological state, age, and strain. Importantly, there were several highly significant interactions among these factors, underlining the complex nature of the response. The two baits differed in attractiveness for A. obliqua but not A. ludens. The effect of strain (wild versus laboratory flies) was significant for A. ludens but not A. obliqua. For effect of dietary history, adults of both species, irrespective of sex, were significantly less responsive to both baits when fed on a mixture of protein and sugar when compared with adults fed the other diets. Finally, we confirmed previous observations indicating that McPhail-type traps are quite inefficient. Considering the total 24-h fly tenure in the cage, and independent of bait treatment and fly type (i.e., strain, adult diet, gender and age), of a total of 2,880 A. obliqua and 2,880 A. ludens adults released into the field cages over the entire study (15 replicates), only 564 (19.6%) and 174 (6%) individuals, respectively, were effectively caught. When only considering the 5-h detailed

  5. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  6. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  7. Selection of artificial hosts for oviposition by wild Anastrepha obliqua (Macquart (Diptera, Tephritidae: influence of adult food and effect of experience Seleção de hospedeiros artificiais para oviposição por Anastrepha obliqua (Macquart (Diptera, Tephritidae selvagem: influência do alimento do adulto e efeito da experiência

    Directory of Open Access Journals (Sweden)

    Thamara A. B. S. Leal

    2008-09-01

    Full Text Available Several factors influence the selection of oviposition substrates by insects. The aim of the present work was to find answers to the following questions related to the oviposition behavior of Anastrepha obliqua. Can carbohydrates (glucose or sucrose present in the adult diet have influence on the female preference for an oviposition substrate with similar composition? Can the previous experience with a host containing one of mentioned carbohydrates interfere in further selection of oviposition substrates? The results showed that the kind of carbohydrate present in the adult diet did not affect the female preference for an artificial oviposition substrate, neither when it was presented by itself nor in combination with brewer's yeast. The effect of experience in the oviposition behavior was observed when there was a previous contact with artificial oviposition substrates containing yeast and sucrose. The data are discussed in terms of the behavioral plasticity presented by this species in relation to feeding and oviposition behaviors.Vários fatores podem atuar durante a seleção de substratos para oviposição por insetos. O presente estudo teve por objetivo responder às seguintes questões relacionadas ao comportamento de oviposição de Anastrepha obliqua. O carboidrato presente na dieta do adulto (glicose ou sacarose pode influenciar a preferência da fêmea por um substrato para oviposição com composição semelhante? A experiência prévia com um hospedeiro que possui um dos dois carboidratos citados pode interferir em escolhas futuras entre substratos para oviposição? Os resultados indicaram que o tipo de carboidrato presente na dieta do adulto não exerceu influência sobre a preferência das fêmeas por um substrato artificial para oviposição, tanto quando em combinação com lêvedo de cerveja ou quando sozinho. O efeito da experiência no comportamento de oviposição foi notado quando o contato prévio foi com substratos

  8. Selection of oviposition sites by wild Anastrepha obliqua (Macquart) (Diptera: Tephritidae) based on the nutritional composition

    Energy Technology Data Exchange (ETDEWEB)

    Fontellas-Brandalha, Tania M.L.; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia]. E-mail: zucoloto@ffclrp.usp.br

    2004-09-15

    Few works have studied in detail the types of nutrients associated to hosts which are attractive to females of Anastrepha obliqua (Macquart) and influence the choice of the oviposition site. The relationship of the males in the physiology and in the behavior of those females has also been scarcely studied and some ecological relationships seem to be quite important for the knowledge of this species' biology. Our objective in this study was to evaluate the discriminatory behavior of A. obliqua between oviposition sites containing different nutrients. The presence of the male and the nutritional status of the female were also considered in this work. Two experiments were developed: in the first, the preference of A. obliqua females between artificial oviposition substrates was evaluated; in the second, females were submitted to two types of artificial oviposition substrates in the presence and in the absence of males and were fed either on a poor diet or on an adequate diet concerning sucrose concentration. In the first experiment, A. obliqua showed higher preference for substrates containing brewer's yeast and sucrose. Substrate containing only yeast was the second most accepted. Offspring development and adult feeding may have determined the choice for the substrate containing brewer's yeast and sucrose. In addition, the presence of protein in the brewer's yeast may indicate nutritional quality to the females in a more accurate way than the sucrose. In the second experiment, the brewer's yeast was the most accepted by the females. The male absence was also an important factor in the selection of hosts and in the egg production of A. obliqua. (author)

  9. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha

    2010-06-01

    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study

  10. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    Science.gov (United States)

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-04-01

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Anastrepha ludens and Anastrepha serpentina (Diptera: Tephritidae) do not infest Psidium guajava (Myrtaceae), but Anastrepha obliqua occasionally shares this resource with Anastrepha striata in nature.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martin

    2011-08-01

    This study examined whether economically important fruit fly species Anastrepha ludens (Loew), Anastrepha serpentina (Wiedemann), and Anastrepha obliqua (Macquart) (Diptera: Tephritidae) may opportunistically exploit guavas, Psidium guajava L. (Myrtaceae), growing near preferred natural hosts. We collected 3,459 kg of guavas and 895 kg of other known host species [sour orange, Citrus aurantium L.; grapefruit, Citrus paradisi Macfadyen; mango, Mangifera indica L.; white sapote, Casimiroa edulis La Llave and Lex.; sapote, Pouteria sapota (Jacq.); sapodilla, Manilkara zapota L.; and wild plum, Spondias purpurea L. and Spondias mombin L.] along an altitudinal gradient over a 4-yr period (2006-2009). Plants were growing in sympatry in 23 localities where the guavas are usually infested in the state of Veracruz, M6xico. The guava samples yielded 20,341 Anastrepha spp. pupae in total (overall mean, 5.88 pupae per kg of fruit). Confirming previous reports, Anastrepha fraterculus (Wiedemann) and Anastrepha striata (Schiner) were found heavily infesting guavas in Veracruz. Importantly, although we did not find evidence that A. ludens and A. serpentina are able to attack this valuable commodity, we document for the first time in the agriculturally important state of Veracruz that P. guajava is an alternative natural host plant of A. obliqua. We recovered two fruit in the mango-growing locality of la Vibora, Tlalixcoyan, that harbored larvae of A. striata and A. obliqua. This finding has important practical implications for management of A. obliqua. Over the entire altitudinal gradient, when individual fruit infestation was examined, a dynamic pattern of species dominance was unveiled with guavas growing below 800 m above sea level mainly attacked by A. striata and a progressive replacement with increasing altitude by A. fraterculus. Interestingly, most individual fruit examined (97%) harbored a single species of fruit fly, a finding that may be taken as evidence of

  12. Effect of sucrose ingestion on the performance of wild Anastrepha obliqua (Macquart) females (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Fontellas, Tania M.L.; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2003-04-15

    Carbohydrates are the main source of energy for insects and the lack of these nutrients in the diet can cause serious damage to the biology of these arthropods. In order to better understand the effect of sucrose on the performance and dietary selection of adult Anastrepha obliqua (Macquart), the following experiments were carried out: 1) effect of different amount of sucrose on diet ingestion, longevity and egg production; 2) dietary selection that contains different amounts of sucrose, and 3) discrimination threshold for sucrose in adult individuals deprived or not of carbohydrates. The control diet showed the best results in relation to ingestion, longevity and egg production for these species, probably due to the fact that it presents an optimal nutritional balance between sucrose and yeast. The control diet was also the preferred diet of females, indicating a positive correlation between the nutritional value of a diet and chemical perception by A. obliqua. Sucrose-deprived females were able to perceive lower carbohydrate quantity than non-deprived females. This characteristic might represent a biological advantage since it reduces the food foraging time for these insects. (author)

  13. Resolution of inter and intra-species relationships of the West Indian fruit fly Anastrepha obliqua

    Science.gov (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), is an economically important pest that inhabits areas of South and Central America, Mexico and the Caribbean with occasional infestations in the southern United States. We examine intra-specific variation within Anastre...

  14. Morphometric divergence in populations of Anastrepha obliqua (Diptera, Tephritidae) from Colombia and some Neotropical locations.

    Science.gov (United States)

    Castañeda, Maria R; Selivon, Denise; Hernández-Ortiz, Vicente; Soto, Alberto; Canal, Nelson A

    2015-01-01

    The West Indian fruit fly, Anastrepha obliqua, is one of seven species of quarantine importance of its genus and is one of the most economically important fruit fly pests in Colombia. The taxonomic status of this species is a key issue for further implementation of any pest management program. Several molecular studies have shown enough variability within Anastrepha obliqua to suggest its taxonomic status could be revised; however, there are no morphological studies supporting this hypothesis. The aim of this work was to describe the morphological variability of Colombian populations of Anastrepha obliqua, comparing this variability with that of other samples from the Neotropics. Measurements were performed on individuals from 11 populations collected from different geographic Colombian localities and were compared with populations from Mexico (2), Dominica Island (1), Peru (1) and Brazil (2). Linear morphometric analyses were performed using 23 female morphological traits, including seven variables of the aculeus, three of the thorax, and six of the wing; seven ratios among them were also considered. Discriminant function analyses showed significant morphological differentiation among the Colombian populations, separating them into two groups. Furthermore, in the comparisons between Colombian samples with those from other countries, three clusters were observed. The possibility of finding more than one species within the nominal Anastrepha obliqua population is discussed.

  15. Phylogeography of West Indian fruit fly, Anastrepha obliqua, inferred with mtDNA sequencing

    Science.gov (United States)

    Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the West Indian fruit fly, is a frugivorous pest that occasionally finds its way to commercial growing areas outside its native distribution. It inhabits areas in Mexico, Central and South America, and the Caribbean, with occasional infestations...

  16. Influence of Methoprene on Pheromone Emission and Sexual Maturation of Anastrepha obliqua (Diptera: Tephritidae) males.

    Science.gov (United States)

    Muñoz-Barrios, Rodolfo; Cruz-López, Leopoldo; Rojas, Julio C; Hernández, Emilio; Liedo, Pablo; Gómez-Simuta, Yeudiel; Malo, Edi A

    2016-04-01

    It has been demonstrated that the application of juvenile hormone analog, methoprene, reduces the time required for sexual maturation and enhances mating success in several species of tephritid fruit flies. This study examined the effect of different concentrations of methoprene incorporated into the diet of adult flies and distinct sugar:protein (S:P) ratios on sexual maturity and pheromone emission of Anastrepha obliqua males. Diets with 0.2 and 0.5% of methoprene accelerated sexual maturation of males compared with untreated males. In subsequent assays, the enhancement of male pheromone emission and sexual maturation by the incorporation of 0.02% methoprene into a 24:1 (S: P) diet was confirmed. Among the volatiles released by males, (Z)-3-nonenol and (Z,Z)-3,6-nonadienol were emitted at higher quantities by flies treated with methoprene than untreated ones. The results show that methoprene accelerates sexual maturation of mass-reared A. obliqua males and increases their mating propensity. This would reduce the time required to attain sexual maturation by sterile males, thus decreasing fly handling costs and improving the efficacy of the sterile insect technique.

  17. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  18. Hemocyte types and total and differential counts in unparasitized and parasitized Anastrepha obliqua (Diptera, Tephritidae larvae

    Directory of Open Access Journals (Sweden)

    J. E. B. SILVA

    Full Text Available The hemocyte types, in addition to total and differential hemocyte counts were studied in parasitized and unparasitized Anastrepha obliqua larvae at the beginning and at the end of the third instar. In both developmental phases, in parasitized and unparasitized larvae, prohemocytes, plasmatocytes, granulocytes, adipohemocytes, spherulocytes and oenocytoids cells were observed. Mitotic figures indicate prohemocytes as stem cells. Prohemocytes, plasmatocytes and granulocytes are the most numerous cells in the hemolymph of A. obliqua. Difference in the total number of hemocytes was observed between unparasitized and parasitized larvae at the end of the third instar, but not at the beginning.

  19. Comparative Responses of Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to the Synthetic Attractant BioLure.

    Science.gov (United States)

    Déctor, Nayeli; Malo, Edi A; Rojas, Julio C; Liedo, Pablo

    2016-10-01

    The responses of wild and sterile Anastrepha ludens (Loew) and Anastrepha obliqua (Mcquart) fruit flies to the synthetic attractant BioLure were determined by electroantennography (EAG), in field cage tests using MultiLure traps, and by release-recapture field experiments using sterile flies. In EAG bioassays, no differences were found between species, sexes, sterile and wild flies. There were only specific differences and interactions in dose responses. More A. ludens than A. obliqua individuals were captured in multilure traps in field cage test. In A. ludens, there was not significant difference between the number of females and males captured, whereas in A. obliqua more females than males were caught. Age showed a bimodal response in both species and both sexes, with peaks at 4 and 14 d old. In the release-recapture experiments, there were significant differences between species, sexes, and orchards and among the days after release. More individuals of A. ludens than A obliqua were recaptured. Only in A. obliqua the difference between the sexes was significant, with a 3.60:1 female:male ratio. Orchard conditions affected the recapture rate, but in both orchards the largest number of flies recaptured occurred during the first day after release (46 and 88% in each orchard). Our results show that the response to this synthetic lure is species-specific and contribute to better interpret trapping data. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Efeitos das misturas de alguns alimentos na produção de óvulos em Anastrepha obliqua (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Creusa Maria Message

    1989-01-01

    Full Text Available Effect of mixtures of some foods on egg production in the fruit fly Anastrepha obliqua. Several diets based on mixtures of different foods (brewer's yeast Boneg, wheat germ Boneg and gevral Lederle were tested for their effect on egg production in Anastrepha obliqua. The best results were obtained with the mixture of brewer's yeast and wheat germ.

  1. Juvenile hormone analog enhances calling behavior, mating success, and quantity of volatiles released by Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Chacón-Benavente, Roxana; López-Guillen, Guillermo; Hernández, Emilio; Rojas, Julio C; Malo, Edi A

    2013-04-01

    The application of a juvenile hormone analog, methoprene, to newly emerged adult males reduced the time required for sexual maturation and enhanced mating success in several species of tephritid fruit flies. In this work, we investigated the effect of topical methoprene application on West Indian fruit fly, Anastrepha obliqua (Macquart), male calling, mating, and volatile release. Males treated with topical methoprene exhibited sexual maturation and reproductive behavior 2 d earlier when compared with control males treated with acetone. Methoprene-treated males began calling and mating at 4 d old, whereas control males did not call and mate until 6 d old. The gas chromotography-mass spectrometry analysis of volatiles showed that during calling A. obliqua males consistently released four compounds; three of them were identified as (Z)-3-nonenol, (Z,E)-α-farnesene, (E,E)-α-farnesene, and a fourth compound with the appearance of a farnesene isomer. Both treated and control males released the same compounds, although treated males started to release volatiles before that control males. The results are discussed in view of possible methoprene application with the aim of reducing costs in fly emergence and release facilities before eventual release of A. obliqua in the field, thus improving the sterile insect technique.

  2. Disinfestation of Averrhoa carambola infested with Anastrepha obliqua (Macquart, 1835) (Diptera - Tephritidae) using gamma radiation; Desinfestacao de Averrhoa carambola infestada por Anastrepha obliqua (Macquart, 1835) (Diptera - Tephritidae) atraves de radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, V.; Wiendl, F.M. [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil)

    1994-05-01

    The disinfestation dose of gamma radiation in Averrhoa carambola infested with larvae of Anastrepha obliqua was determined. Fruits were collected in the field, each having about 11 larvae in the last instar. Fruits were irradiated with the following ganna radiation doses: 0 (control), 50, 150, 300, 600 and 900 Gy. Each treatment consisted of 9 fruits (3 replications) giving the amount of 99 larvae for each treatment. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted to 25{+-} 5{sup 0} C and relative humidity of 70{+-} 5{sup 0} C, until larvae left the fruit and became transformed into pupae and adults. The lethal dose (LD{sub 100}) of gamma radiation for larvae in the fuits was 600 Gy and the dose of 50 Gy inhibited completely the total emergency of adults. (author). 19 refs, 1 figs, 1 tab.

  3. The current and future potential geographic range of West Indian fruit fly, Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Fu, Liao; Li, Zhi-Hong; Huang, Guan-Sheng; Wu, Xing-Xia; Ni, Wen-Long; Qü, Wei-Wei

    2014-04-01

    The West Indian fruit fly, Anastrepha obliqua (Macquart), is one of the most important pests throughout the Americas. CLIMEX 3.0 and ArcGIS 9.3 were used to model the current and future potential geographical distribution of this pest. Under current climatic conditions, A. obliqua is predicted to be able to establish throughout much of the tropics and subtropics, including not only North and South America, where it has been reported, but also southern Asia, northeastern Australia and Sub-Saharan Africa. The main factors limiting the pest's range expansion may be cold stress. Climate change expands the potential distribution of A. obliqua poleward as cold stress boundaries recede, but the predicted distribution in northwestern Australia and northern parts of Sub-Saharan Africa will decrease because of heat stress. Considering the widely suitable range for A. obliqua globally and in China, enhanced quarantine and monitoring measures should be implemented in areas that are projected to be suitable for the establishment of the pest under current and future climatic conditions. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  4. Egg length of Anastrepha obliqua Macquart (Diptera, Tephritidae according to oviposition rate and maternal age

    Directory of Open Access Journals (Sweden)

    Isabel C. Boleli

    1992-01-01

    Full Text Available The length of the entire egg, micropile and vitellus regions of Anastrepha obliqua Macquart, 1835 were measured during all opposition period. Obtained values were compared among them and with oviposition rate. The smallest eggs were produced during the first 35 oviposition days, period where the highest oviposition rate occured. The decrease in egg length was found to be due to a descrease in the vitellus region. Micropile length was found to be pratically constant throughout oviposition. Furthermore, no relationship between maternal age and length was detectable.

  5. Field evaluation of potential fruit-derived lures for Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Toledo, Jorge; Malo, Edi A; Cruz-López, Leopoldo; Rojas, Julio C

    2009-12-01

    Previous studies have shown that a nine-component blend (ethyl butyrate, isopropyl butyrate, hexan-1-ol, propyl butyrate, isobutyl butyrate, ethyl hexanoate, isopentyl butyrate, ethyl benzoate, and ethyl octanoate) isolated from Spondias mombin L. (Anacardiaceae) fruit are attractive to both sexes of West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), in laboratory and field cage tests. In this study, we evaluated the effectiveness of traps baited with the nine-component blend in capturing wild A. obliqua in a mango, Mangifera indica L. variety Ataulfo) orchard. In addition, we tested other S. mombin-derived lures to determine whether any of these effectively mimic the nine-component blend in attracting A. obliqua. In all trials, we compared the attractiveness of the S. mombin-derived lures against hydrolyzed protein, the standard bait for monitoring A. obliqua. We found that, in some trials, there was no difference in the number of females caught by traps baited with the nine-component blend or with hydrolyzed protein. In other trials, traps baited with hydrolyzed protein captured more females than traps baited with the nine-component blend. For males, in general there were no differences in the number of flies caught by traps baited either with the nine-component blend or with hydrolyzed protein. Traps baited with other S. mombin-derived lures captured fewer A. obliqua than traps baited with hydrolyzed protein. Traps baited with S. mombin-derived lures caught fewer species of nontarget tephritid flies and nontarget insects than traps baited with hydrolyzed protein.

  6. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    Science.gov (United States)

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  7. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua

    Science.gov (United States)

    Different lures based on hydrolyzed protein products were assayed in the field for their ability to attract Anastrepha suspensa and A. obliqua (Diptera: Tephritidae). Typically, ammonium acetate with putrescine and freeze-dried NuLure with ammonium acetate and putrescine attracted more flies than ot...

  8. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  9. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  10. Mapping of serotonin-immunoreactive neurons of Anastrepha obliqua Macquart larvae

    Directory of Open Access Journals (Sweden)

    Isabel Cristina Boleli

    1999-01-01

    Full Text Available Serotonin-immunoreactive neurons were identified in the central nervous system (CNS of Anastrepha obliqua Macquart, 1835 wandering stage larvae. The PAP immunocytochemical method was applied to the entire CNS (whole mounts. About 90 neurons were visualized in the CNS (20 in the brain and 70 in the ventral ganglion. Both somata and axons were strongly stained. These neurons showed a segmental arrangement and bilateral symmetry. All processes presented a basic projection pattern, in which the major fibres travel contralaterally. Comparison of these neurons with serotonergic neurons described in other insects suggests order-specific traits such as cerebral clusters and presence of only one 5-HT immunoreactive neuron in the 8th abdominal neuromere as well.

  11. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    Science.gov (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  12. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira

    2006-03-01

    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  13. Mass Rearing History and Irradiation Affect Mating Performance of the Male Fruit Fly, Anastrepha obliqua

    Science.gov (United States)

    Rull, Juan; Encarnación, Nery; Birke, Andrea

    2012-01-01

    As an initial step to improve the efficiency of the sterile insect technique applied to eradicate, suppress, and control wild Anastrepha obliqua (Macquart) (Diptera: Tephritidae) in mango producing areas of Mexico, the effect of radiation dose and mass rearing history on male mating performance was examined. Field cage tests in which both male and female laboratory flies were irradiated at different doses (0, 40, and 80 Gy) were released with cohorts of wild flies of both sexes, revealing that both mass rearing history and irradiation affected male mating performance. Laboratory males were accepted for copulation by wild females less frequently than wild males. Copulations involving laboratory males were shorter than those involving wild males. Irradiated males mated less frequently with wild females than wild males, and irradiated females appeared to be less able to reject courting males of both origins. High levels of fertility for untreated laboratory females crossed with males irradiated at different doses may reflect problems in mass rearing affecting homogeneity of pupal age before irradiation, and possibly masked a dose effect. Proposed remedial measures to improve male mating performance are discussed. PMID:22957485

  14. Food-based lure performance in three locations in Puerto Rico: attractiveness to Anastrepha suspensa and A. obliqua (Diptera;Tephritidae)

    Science.gov (United States)

    Lures based on odors released by hydrolyzed protein were assessed for their attractiveness to Anastrepha obliqua and A. suspensa at three locations in Puerto Rico in August through October 2009. Lures compared included ammonium acetate combined with putrescine, hydrolyzed corn protein (Nulure) with ...

  15. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera:Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications

    Science.gov (United States)

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens and A. obliqua, the main Tephritid pests of this crop in Mexico. In a field experiment, bagged, fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time,...

  16. Carambola Cultivar, Fruit Ripeness, and Damage by Conspecific Larvae Influence the Host-Related Behaviors of Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    López-Ley, Jorge Ulises; Toledo, Jorge; Malo, Edi A; Gomez, Jaime; Santiesteban, Antonio; Rojas, Julio C

    2016-02-01

    In this study, we investigated the influence of cultivar type, fruit ripeness, and damage by conspecific larvae on the attraction of Anastrepha obliqua (Macquart) (Diptera: Tephritidae) to and oviposition on carambola fruit (Averroha carambola L.). The attraction of both sexes of A. obliqua to fruit of different quality was evaluated through cage experiments in the field, and the oviposition preferences of mated females were examined in laboratory tests. Both sexes, mated or virgin, were more attracted to the "Maha" fruit than to the "Golden Star" fruit, and the females oviposited more frequently on the Maha cultivar than the Golden Star cultivar. Both sexes were more attracted to ripe and half-ripe Maha fruits than to mature green fruit, and although females did not show a preference for ovipositing on half-ripe or ripe fruits, they did not oviposit on mature green fruits. Males did not show a preference for the volatiles from uninfested, artificially damaged, or infested Maha fruits, but females were more attracted to uninfested fruits than to artificially damaged and infested Maha fruits. Furthermore, females preferred to oviposit on uninfested fruits compared with artificially damaged fruit, and they did not oviposit on infested fruits. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Desinfestação de Averrhoa carambola infestada por Anastrepha obliqua (Macquart, 1835 (diptera -Tephritidae através de radiação gama Desinfestation of Averrhoa carambola infested with Anastrepha obliqua (mac. 1835 (diptera - Tephritidae using gamma radiation

    Directory of Open Access Journals (Sweden)

    V. Arthur

    1994-08-01

    Full Text Available O experimento teve por objetivo determinar a dose de desinfestação para Averrhoa carambola infestada por larvas de Anastrepha obliqua. Para realização do experimento coletou-se frutos do campo e fez-se urna amostragem prévia, constatando-se que cada fruta continha em média 11 larvas de último instar do referido inseto praga. Esses frutos foram irradiados com as seguintes doses de radiação gama: 0 (test., 50, 150, 300, 600 e 900 Gy. Cada tratamento constou de 3 repetições num total de 9 frutas e aproximadamente 99 larvas por tratamento. Após a irradiação as frutas foram colocadas em câmara climatizada com 25 ± 5°C de temperatura e umidade relativa de 70 ± 5% onde aguardou-se que as larvas deixassem os frutos e se transformassem em pupas e posteriormente em adultos. Pelos resultados obtidos concluiu-se que a dose letal para (LD100 para larvas em frutos de carambola foi 600 Gy e a que impediu a emergência dos adultos foi a de 50 Gy.The aim of this experiment was to determine the desinfestation dose of gamma radiation in Averrhoa carambola infested with larvae of Anastrepha obliqua. Fruits were collected in the field, each having about 11 larvae in the last instar. Fruits were irradiated with the following gamma radiation doses: 0 (control, 50, 150, 300, 600 and 900 Gy. Each treatment consisted of 9 fruits (3 replications giving the amount of 99 larvae for each treatment. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted to 25 ± 5°C and relative humidity of 70 ± 5%, until larvae left the fruit and became transformed into pupae and adults. The lethal dose (LD100 of gamma radiation for larvae in the fruits was 600 Gy and the dose of 50 Gy inhibited completely the total emergency of adults.

  18. The presence of the sexual partner and nutritional condition alter the Anastrepha obliqua MacQuart (Diptera: Tephritidae) protein discrimination threshold

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2005-11-15

    The minimum protein amount that Anastrepha obliqua MacQuart can detect in its alimentary source is variable, though the causes of such variation are not very well known. In this study, the authors tested whether the sexual partners nutritional condition and presence devoid of direct contact alter the A. obliqua protein discrimination threshold. Male and female insects were assigned to groups as follows: (1) newly emerged, (2) deprived of protein source (yeast) during 18 days, (3) non-yeast-deprived during 18 days, (4) yeast-deprived in the presence of equally yeast-deprived sexual partners, (5) yeast-deprived in the presence of non-yeast-deprived partners, (6) non-yeast-deprived with yeast-deprived partners and (7) non-yeast-deprived with non-yeast-deprived partners. The sexual partners were maintained apart by a transparent plastic screen with small holes. Not only the males presence but also their nutritional condition have altered the females discrimination threshold, particularly when the females were deprived and when non- deprived females cohabited with deprived males. Therefore, the females threshold was determined by their own nutritional condition in addition to recognition of the males nutritional condition. The males discrimination threshold was higher for non-deprived subjects than for the deprived ones. The occurrence of responses in the absence of direct contact between males and females has shown that they may use a chemical mechanism for mutual recognition of the sexual partner nutritional condition. (author)

  19. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards.

    Science.gov (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco

    2014-06-01

    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  20. Visibility and Persistence of Marker Dyes and Effect on the Quality and Mating Competitiveness of Mass-Reared Flies (Diptera: Tephritidae): Anastrepha obliqua and Bisexual and Genetic Sexing (Tapachula-7) Strains of A. ludens.

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; López, Gladis; Díaz-Fleischer, Francisco

    2017-08-01

    Fluorescent dyes are commonly used in the sterile insect technique (SIT) for marking insects for a proper identification after recapture. However, the quality of the mark must be balanced against insect performance, because dyes can negatively affect some parameters of insect performance and reduce their effectiveness in control with the SIT. We determined the visibility and persistence and the effect of dyes on the quality of Anastrepha obliqua (Macquart) and Anastrepha ludens (Loew) (bisexual and genetic sexing strains) by testing four concentrations of a dye (Day-Glo) from 0 to 2.5 g dye/kg of pupae. Visibility and persistence of the mark were positively affected by dose and negatively affected by the length of time the samples were kept in a solution of 75% alcohol. However, upon dissection, even the lowest dose of dye was visible under a fluorescence microscope. Between dyed and undyed pupae (control), no significant differences were observed in rates of emergence, fliers and flight ability, and survival in two tests, with water and without food and without water and food, at any of the concentrations tested. Furthermore, no significant difference in mating competitiveness was detected between control pupae and those dyed at 1.0 and 2.5 g dye/kg pupae. We discuss our results with the possibility of reducing the dose of dye in these three flies, because the heads are large enough to capture sufficient particles to permit identification with the current methods of detection. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2016-07-01

    Full Text Available ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae is recorded for the first time parasitizing Anastrepha obliqua (Macquart (Diptera: Tephritidae in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae in Brazil.

  2. Tetrastichus giffardianus on pupae of Anastrepha in Brazil

    OpenAIRE

    Almerinda Amélia Rodrigues Araújo; Paulo Roberto Ramalho Silva; Ranyse Barbosa Querino Silva; Elizangela Pereira da Silva Sousa

    2016-01-01

    ABSTRACT: Tetrastichus giffardianus Silvestri (Hymenoptera: Eulophidae) is recorded for the first time parasitizing Anastrepha obliqua (Macquart) (Diptera: Tephritidae ) in fruits of umbu-cajazeira Spondias sp. (Anacardiaceae) in Brazil.

  3. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  4. Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs.

    Science.gov (United States)

    Figueiredo, Julia V A; Perondini, André L P; Selivon, Denise

    2017-03-01

    The inner chorion structure of Anastrepha eggs from 16 species of various infrageneric taxonomic groups is described by scanning and transmission electron microscopy. The layers of the chorion, the outer egg membrane, are structurally similar. Furthermore, an additional trabecular layer (ATL) that exists in some species, together with other characteristics, facilitates the recognition of four patterns of chorion structuring: Pattern I, in which the ATL layer is absent, is found in Anastrepha amita, the Anastrepha fraterculus complex, Anastrepha obliqua, Anastrepha sororcula, Anastrepha suspensa and Anastrepha zenildae (fraterculus group), and Anastrepha bistrigata and Anastrepha striata (striata group); Pattern II in Anastrepha serpentina (serpentina group), Anastrepha grandis (grandis group) and Anastrepha pseudoparallela (pseudoparallela group), in which the ATL presents large open spaces with pillars; Pattern III, found in Anastrepha consobrina (pseudoparallela group), in which the ATL is composed of round cavities; and Pattern IV, found in Anastrepha alveata and Anastrepha pickeli (spatulata group), where the large ATL cavities are reticulated. Comparatively, the chorion structure in Anastrepha eggs is more complex than in eggs of other fruit flies, e.g., Bactrocera, Rhagoletis and Ceratitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Evaluation of lufenuron as a chemosterilant against fruit flies of the genus Anastrepha (Diptera: Tephritidae).

    Science.gov (United States)

    Moya, Pilar; Flores, Salvador; Ayala, Ildefonso; Sanchis, Juan; Montoya, Pablo; Primo, Jaime

    2010-06-01

    Chemosterilisation with lufenuron bait stations is a recently developed technique that is being implemented for Ceratitis capitata Wiedemann control. The aim of this work was to evaluate the chemosterilising effect of lufenuron against four economically important Latin American fruit flies species: Anastrepha ludens (Loew.), A. obliqua Macquart, A. serpentina Wiedemann and A. striata Schiner (Diptera: Tephritidae) in order to design a similar strategy for their control. Sexually mature adults were treated by ingestion with concentrations ranging from 0.1 to 30.0 mg g(-1) of lufenuron in the diet. In addition, conspecific crosses with only one of the sexes being treated (30.0 mg g(-1)) were performed in order to appraise the contribution of each sex to the sterilising effect. In all cases, fecundity was not affected by the treatments, as opposed to fertility where all Anastrepha species studied were significantly affected, although to different extents. The conspecific crosses showed that treated males of A. ludens, A. obliqua and A. serpentina were not able to transmit the sterility to their respective untreated females. Only in the case of A. striata did crossing treated males with untreated females significantly reduced egg hatch. Although further investigations are required, the present results demonstrate that the use of lufenuron for controlling A. striata could be potentially viable.

  6. Diversity of Anastrepha spp. (Diptera: Tephritidae) and associated braconid parasitoids from native and exotic hosts in southeastern Bahia, Brazil.

    Science.gov (United States)

    Silva, Janisete G; Dutra, Vivian S; Santos, Mirian S; Silva, Nívea M O; Vidal, Daniela B; Nink, Ricardo A; Guimarães, Jorge A; Araujo, Elton L

    2010-10-01

    We documented fruit fly-host associations and infestation rates over 5 yr in the state of Bahia, Brazil, by systematically collecting native and introduced fruits in backyard and commercial orchards, experimental stations, and patches of native vegetation. Fruit were collected in multiple sites in the southern and southernmost regions of Bahia. A total of 942.22 kg from 27 fruit species in 15 plant families was collected throughout this study. Of these, 15 plant species from six families were infested by Anastrepha species. A total of 11,614 fruit flies was reared from the fruit (5,178 females and 6,436 males). No specimens of Ceratitis capitata (Wiedemann) were recovered. Eleven Anastrepha species were recovered from the collected fruit: Anastrepha antunesi Lima (0.04%), Anastrepha distincta Greene (0.1%), Anastrepha fraterculus (Wiedemann) (53.5%), Anastrepha leptozona Hendel (4.5%), Anastrepha manihoti Lima (0.1%), Anastrepha montei Lima (1.0%), Anastrepha obliqua (Macquart) (33.0%), Anastrepha pickeli Lima (2.0%), Anastrepha serpentina (Wiedemann) (1.0%), Anastrepha sororcula Zucchi (3.0%), and Anastrepha zenildae Zucchi (1.8%). We recovered 1,265 parasitoids (Hymenoptera: Braconidae) from Anastrepha pupae. Three species of braconids were found to parasitize larvae of nine Anastrepha species. The most common parasitoid species recovered was Doryctobracon areolatus (Szépligeti) (81.7%), followed by Utetes anastrephae (Viereck) (12.2%) and Asobara anastrephae (Muesebeck) (6.1%). We report A. fraterculus infesting Malay apple Syzygium malaccense (L.) Merr. & L. M. Perry and A. fraterculus, A. sororcula, and A. zenildae infesting araza Eugenia stipitata McVaugh for the first time in Brazil.

  7. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  8. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  9. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  10. Histopathological changes in third-instar and adult Anastrepha ludens (Diptera: Tephritidae) after in vitro heat treatment.

    Science.gov (United States)

    Caro-Corrales, Lorena; Caro-Corrales, Jose; Valdez-Ortiz, Angel; Lopez-Valenzuela, Jose; Lopez-Moreno, Hector; Coronado-Velazquez, Daniel; Hernandez-Ortiz, Emilio; Rendon-Maldonado, Jose

    2015-01-01

    The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most harmful pests of mango causing direct damage by oviposition on the fruit pulp. Mango for export is subjected to hydrothermal treatment as a quarantine method for the control of this pest, but exposure to heat for long periods of time reduces considerably the quality and shelf-life of treated fruit. The aim of this work was to study morphological changes of third-instar larvae and adults of A. ludens after in vitro exposure to high temperature at sublethal times. A heating block system was used to expose larvae at 46.1°C for 19.6 and 12.9 min, producing 94.6 and 70% mortality, respectively. Treated larvae were processed for optical microscopy. A fraction of surviving treated larvae was separated into containers with artificial diet to allow development into adults. Adult sexual organs were dissected and processed for transmission electron microscopy analysis. Results showed that 94.6% of the treated larvae died at 46.1°C for 19.6 min and none of the surviving larvae eclosed to adulthood, as they developed as malformed puparia. For the in vitro treatment at 46.1°C during 12.9 min, 70% of the treated larvae died and only 3.75% reached the adult stage, but ultrastructural damage in the male testes and in the female ovaries was observed. Additionally, 11.1% of the adult flies from the in vitro treatment also showed wing malformation and were incapable of flying. The analysis showed that surviving flies were unable to reproduce. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  11. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico

    Science.gov (United States)

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua and A. suspensa at four sites in Guánica, Puerto Rico; one forest fragment in Ponce, Puerto Rico; in a commercial mango orchard in Guayanilla, PR; and an experimental carambola orcha...

  12. Flutuação populacional de adultos de Anastrepha fraterculus (Wied. em cultivo protegido e convencional de videira Anastrepha fraterculus (Wied. adult seasonal fluctuation in plastic covering and conventional grapevine cultivation

    Directory of Open Access Journals (Sweden)

    Geraldo Chavarria

    2009-09-01

    Full Text Available A mosca-das-frutas sul-americana, Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae, é considerada praga-chave das fruteiras de clima temperado na região Sul do Brasil. No entanto, poucas informações encontram-se disponíveis quando a espécie está associada à cultura da videira. Neste trabalho, foi avaliado o efeito da cobertura plástica sobre a população de adultos de A. fraterculus durante o ciclo de cultivo da videira cv. Moscato Giallo. O experimento foi conduzido nos ciclos de 2005/06 e 2006/07, em vinhedo comercial localizado em Flores da Cunha-RS (latitude 29° 06' sul, longitude 51° 20' oeste e altitude de 541 m, coberto com plástico impermeável tipo ráfia (160 µm de 12 fileiras com 35 m, deixando-se cinco fileiras sem cobertura (controle. Os adultos foram monitorados nas duas áreas com armadilhas McPhail, utilizando-se como atrativo de proteína hidrolisada (BioAnastrepha® a 5%, no período de outubro a abril, nos dois ciclos. O pico populacional da espécie, nos dois ciclos, foi observado no período de maturação da uva. Não foram registradas diferenças significativas nas capturas entre as áreas, concluindo-se que a cobertura plástica não afeta a mobilidade e a flutuação populacional de A. fraterculus em cultivo protegido de videira.The South American Fruit Fly Anastrepha fraterculus (Wiedemann, 1830 (Diptera: Tephritidae is one of the most important pests of temperate fruits in Southern Brazil. Little information regarded to pest damage is available when this insect is associated with vineyards. In this work was evaluated the plastic cover effect on seasonal fluctuation of A. fraterculus adults in vineyards of cv. Moscato Giallo. The experiment was conducted on 2005/06 and 2006/07 seasons in a vineyard located in Flores da Cunha, RS (latitude 29° 06' South, longitude 51° 20' West and altitude 541 m, covered with an impermeable plastic cloth (2.65 m x 160 µm, in 12 rows with 35 m, with five rows

  13. Species of Anastrepha (Diptera: Tephritidae captured in a guava orchard (Psidium guajava L., Myrtaceae in Boa Vista, Roraima, Brazil

    Directory of Open Access Journals (Sweden)

    AL Marsaro Júnior

    Full Text Available The guava fruit (Psidium guajava is among the most strongly affected by fruit flies in Brazil. In the Brazilian Amazon, 11 species of Anastrepha have been reported in guava orchards to date. This work aimed to identify the species of Anastrepha present in a guava orchard in the municipality of Boa Vista, determine the species infesting the fruits, and identify any parasitoids present. Two McPhail traps with food bait were installed and weekly collections were made between January and December 2008. Fruits were also collected systematically during this period, with a view to determining the association between host plant and tephritid species. Nine species of Anastrepha were identified, in addition to one specimen belonging to a probable new species. Anastrepha striata Schiner, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart, and Anastrepha fraterculus (Wiedemann were the dominant species in the orchard, accounting for 84.8% of all captured individuals. All females collected directly from fruits were A. striata. Doryctobracon areolatus (Szépligeti was the only parasitoid species obtained. In this work, Anastrepha ethalea (Walker is reported for the first time in the state of Roraima.

  14. Species of Anastrepha (Diptera: Tephritidae) captured in a guava orchard (Psidium guajava L., Myrtaceae) in Boa Vista, Roraima, Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Deus, E G; Ronchi-Teles, B; Adaime, R; Silva Júnior, R J

    2013-11-01

    The guava fruit (Psidium guajava) is among the most strongly affected by fruit flies in Brazil. In the Brazilian Amazon, 11 species of Anastrepha have been reported in guava orchards to date. This work aimed to identify the species of Anastrepha present in a guava orchard in the municipality of Boa Vista, determine the species infesting the fruits, and identify any parasitoids present. Two McPhail traps with food bait were installed and weekly collections were made between January and December 2008. Fruits were also collected systematically during this period, with a view to determining the association between host plant and tephritid species. Nine species of Anastrepha were identified, in addition to one specimen belonging to a probable new species. Anastrepha striata Schiner, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart), and Anastrepha fraterculus (Wiedemann) were the dominant species in the orchard, accounting for 84.8% of all captured individuals. All females collected directly from fruits were A. striata. Doryctobracon areolatus (Szépligeti) was the only parasitoid species obtained. In this work, Anastrepha ethalea (Walker) is reported for the first time in the state of Roraima.

  15. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults

    Science.gov (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  16. Description of third instar larvae of Anastrepha curitis, Anastrepha pickeli and Anastrepha pulchra (Diptera: Tephritidae)

    Science.gov (United States)

    We describe and illustrate for the first time the third instar larvae of three Anastrepha species, Anastrepha pickeli Lima, Anastrepha pulchra Stone, and Anastrepha curitis Stone, and also the second instar of A. curitis. Internal structures, such as the cephalopharyngeal skeleton and spiracles, and...

  17. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com

  18. New protein sources in adults diet for mass-rearing of Anastrepha fraterculus (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Renata Morelli

    2012-12-01

    Full Text Available The aim of this study was to find alternatives to reduce the cost of mass production of the South American fruit fly (A. fraterculus by looking for locally available products as protein source in the diet of adults to replace the imported product without changing the quality parameters. Two yeast from a Brazilian company were evaluated. The quality parameters showed that the imported hydrolyzed yeast used in the adult diet could be perfectly replaced by the local products tested, with a reduction of over 80% of the cost of the diet. The quality of the produced insects remained the same and there were improvements in some quality parameters such as the volume of eggs produced, number of adults flying and longevity under the stress.

  19. Biodiversidade de moscas-das-frutas do gênero Anastrepha (Diptera, Tephritidae no campus da ESALQ-USP, Piracicaba, São Paulo

    Directory of Open Access Journals (Sweden)

    Keiko Uramoto

    2004-01-01

    Full Text Available Este trabalho foi conduzido na área abrangida pelo campus da Escola Superior de Agricultura Luiz de Queiroz da Universidade de São Paulo, no município de Piracicaba, Estado de São Paulo. Teve como objetivos, determinar a composição do gênero Anastrepha Schiner e verificar a associação das espécies de plantas hospedeiras, estabelecidas na área, com as espécies de Anastrepha. Foram examinadas 23.277 fêmeas de Anastrepha coletadas por meio de armadilhas McPhail e 18 espécies pertencentes a nove grupos de espécies foram registradas. Um total de 563 amostras de frutos pertencentes a nove famílias e, pelo menos, 23 espécies de plantas foi coletado em 47 estações de capturas. Foram identificadas 10.243 fêmeas e das 18 espécies de Anastrepha capturadas em armadilhas somente seis emergiram das amostras de frutos: A. bistrigata Bezzi, A. fraterculus (Wied., A. obliqua (Macquart, A. pseudoparallela (Loew, A. serpentina (Wied. e A. sororcula Zucchi. A. fraterculus infestou maior diversidade de frutos. Os hospedeiros preferidos de A. obliqua foram as espécies da família Anacardiaceae. A. pseudoparallela e A. serpentina infestaram exclusivamente Passifloraceae e Sapotaceae, respectivamente. A. fraterculus é registrada pela primeira vez em sapoti (Manilkara zapota L. no Brasil.Biodiversity of fruit flies of the genus Anastrepha (Diptera, Tephritidae at the ESALQ-USP campus, Piracicaba, São Paulo. The aim of this study was to determine the number of species of Anastrepha Schiner at the campus and to verify the association between host plant species and Anastrepha species in this area. A total of 23,277 females of Anastrepha collected in McPhail traps was examined, and 18 species belonging to nine species groups were recorded. A total of 563 fruit samples representing at least 23 plant species from nine families was collected in 47 capture sites. A total of 10,243 females was identified. Of the 18 Anastrepha species captured in traps

  20. UTILIZAÇÃO DA ANÁLISE DISCRIMINANTE EM ESTUDOS TAXONÔMICOS DE MOSCAS-DAS-FRUTAS DO GÊNERO Anastrepha Schiner, 1868 (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    E.L. ARAUJO

    1998-01-01

    Full Text Available As moscas-das-frutas Anastrepha fraterculus (Wiedemann, 1830, A. obliqua (Macquart, 1835, A. sororcula (Zucchi, 1979 e A. zenildae (Zucchi, 1979 foram submetidas a uma análise discriminante. Essas espécies do grupo fraterculus distinguem-se unicamente com base em detalhes do ápice do acúleo, que por serem muito semelhantes, dificultam a identificação específica. A análise discriminante permitiu a separação das quatro espécies de Anastrepha, com base em oito medidas do acúleo. Portanto, essa é mais uma técnica para auxiliar as identificações de espécies de Anastrepha, como já acontece em muitos outros grupos de insetos.A discriminant analysis was carried out for four species of the fraterculus group, Anastrepha fraterculus (Wiedemann, 1830, A. obliqua (Macquart, 1835, A. sororcula (Zucchi, 1979 and A. zenildae (Zucchi, 1979. These species can be distinguished only by minor morphological characters of the aculeus apex and sometimes there is great difficulty in determining specific limits. The study was based on eight measurements of the aculeus and it was possible to separate the species using the discriminant analysis. Therefore, this analysis is an additional tool for the identification of Anastrepha species as it was already observed for many other groups of insects.

  1. Toward an Automated Identification of Anastrepha Fruit Flies in the fraterculus group (Diptera, Tephritidae).

    Science.gov (United States)

    Perre, P; Faria, F A; Jorge, L R; Rocha, A; Torres, R S; Souza-Filho, M F; Lewinsohn, T M; Zucchi, R A

    2016-10-01

    In this study, we assess image analysis techniques as automatic identifiers of three Anastrepha species of quarantine importance, Anastrepha fraterculus (Wiedemann), Anastrepha obliqua (Macquart), and Anastrepha sororcula Zucchi, based on wing and aculeus images. The right wing and aculeus of 100 individuals of each species were mounted on microscope slides, and images were captured with a stereomicroscope and light microscope. For wing image analysis, we used the color descriptor Local Color Histogram; for aculei, we used the contour descriptor Edge Orientation Autocorrelogram. A Support Vector Machine classifier was used in the final stage of wing and aculeus classification. Very accurate species identifications were obtained based on wing and aculeus images, with average accuracies of 94 and 95%, respectively. These results are comparable to previous identification results based on morphometric techniques and to the results achieved by experienced entomologists. Wing and aculeus images produced equally accurate classifications, greatly facilitating the identification of these species. The proposed technique is therefore a promising option for separating these three closely related species in the fraterculus group.

  2. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae).

    Science.gov (United States)

    Mascarenhas, Rodrigo O; Prezotto, Leandro F; Perondini, André Luiz P; Marino, Celso Luiz; Selivon, Denise

    2016-01-01

    The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

  3. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae) and parasitoid wasps (Braconidae)

    Science.gov (United States)

    Mascarenhas, Rodrigo O; Prezotto, Leandro F; Perondini, André Luiz P; Marino, Celso Luiz; Selivon, Denise

    2016-01-01

    Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids. PMID:27648768

  4. Wolbachia in guilds of Anastrepha fruit flies (Tephritidae and parasitoid wasps (Braconidae

    Directory of Open Access Journals (Sweden)

    Rodrigo O Mascarenhas

    Full Text Available Abstract The endosymbiont Wolbachia is efficiently transmitted from females to their progenies, but horizontal transmission between different taxa is also known to occur. Aiming to determine if horizontal transmission might have occurred between Anastrepha fruit flies and associated braconid wasps, infection by Wolbachia was screened by amplification of a fragment of the wsp gene. Eight species of the genus Anastrepha were analyzed, from which six species of associated parasitoid wasps were recovered. The endosymbiont was found in seven Anastrepha species and in five species of braconids. The WSP Typing methodology detected eight wsp alleles belonging to Wolbachia supergroup A. Three were already known and five were new ones, among which four were found to be putative recombinant haplotypes. Two samples of Anastrepha obliqua and one sample of Doryctobracon brasiliensis showed multiple infection. Single infection by Wolbachia was found in the majority of samples. The distribution of Wolbachia harboring distinct alleles differed significantly between fruit flies and wasps. However, in nine samples of fruit flies and associated wasps, Wolbachia harbored the same wsp allele. These congruences suggest that horizontal transfer of Wolbachia might have occurred in the communities of fruit flies and their braconid parasitoids.

  5. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  6. Residual control and lethal concentrations of GF-120 (spinosad) for Anastrepha spp. (Diptera: Tephritidae).

    Science.gov (United States)

    Flores, Salvador; Gomez, Luis E; Montoya, Pablo

    2011-12-01

    The objective of this study was to determine the relationship between residual time of GF-120 (spinosad) treatment and mortality in three species of Anastrepha Schiner. Concentrations of 96, 72, 48, and 24 ppm were aged on mango leaves under field conditions for 0, 3, 7, 10, 14, 17, and 21 d after application. We found that Anastrepha ludens, A. obliqua, and A. serpentina were highly sensitive to spinosad. The effects of spinosad were not reduced over the 4 d after the initial application, even at a concentration of 24 ppm. Mortality at 14 d after the application of 72 and 96 ppm of spinosad was similar in each of the three fruit fly species. In addition, we found that 24 ppm of spinosad was consumed the most by each species even though no direct relationship between the rate of consumption per female and the dose of the product was observed, in this test, higher consumption of active ingredient was observed at a concentration of 72 ppm, for A. ludens, 48 ppm for A. obliqua, and 96 ppm for A. serpentina. Our results suggest that a spinosad concentration of 72 ppm may effectively control these pests for at least 10 d under field conditions.

  7. Differences in sperm storage and remating propensity between adult females of two morphotypes of the Anastrepha fraterculus (Diptera: Tephritidae) cryptic species complex.

    Science.gov (United States)

    Abraham, S; Rull, J; Mendoza, M; Liendo, M C; Devescovi, F; Roriz, A K; Kovaleski, A; Segura, D F; Vera, M T

    2014-06-01

    The South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species composed of at least seven morphotypes. Some of them, such as the Peruvian and Brazilian 1 morphotypes (which include Argentinean populations), exhibit strong pre-copulatory isolation, yet it is possible to obtain heterotypic crosses when forcing copulation of adults under laboratory conditions. The cross involving Peruvian males and Argentinean females produces F1 offspring with reduced viability in terms of egg hatch. This low hatchability could be caused by a reduced amount of sperm transferred to and stored by females mated with heterotypic males, which in turn could affect their post-copulatory behaviour. To test these hypotheses, we investigated sperm transfer and female mating and remating behaviour for homotypic and heterotypic crosses between adults of two morphotypes (Brazilian 1 [Argentina] and Peruvian [Peru]) of the A. fraterculus cryptic species complex. As reported before, Argentinean males and females mated earlier in the day than the other three mating combinations. Peruvian females engaged in shorter copulation times than Argentinean females. Peruvian females tended to store smaller quantities of sperm than Argentinean females, and almost a half of the crosses involving Argentinean males and Peruvian females were unsuccessful (no sperm transfer). However, there was no evidence that the cross between Peruvian males and Argentinean females resulted in storage of a critically small amount of sperm (posing risk of sperm shortage). Argentinean females were more willing to remate than Peruvian females, irrespective of male morphotype, but latency to remating was not affected by male or female morphotype. This study shows that mating behaviour differs between some of the A. fraterculus complex morphotypes, with female but not male morphotype determining female likelihood to remate.

  8. Electrophysiological and behavioural responses of the tea geometrid Ectropis obliqua (Lepidoptera: Geometridae) to volatiles from a non-host plant, rosemary, Rosmarinus officinalis (Lamiaceae).

    Science.gov (United States)

    Zhang, Zhengqun; Bian, Lei; Sun, Xiaoling; Luo, Zongxiu; Xin, Zhaojun; Luo, Fengjian; Chen, Zongmao

    2015-01-01

    A plant-based 'push-pull' strategy for Ectropis obliqua (Prout) (Lepidoptera: Geometridae) is being developed using semiochemicals in the volatiles of Rosmarinus officinalis (Lamiaceae). The aim of this study was to identify and quantify the bioactive components within R. officinalis by gas chromatography-electroantennographic detection (GC-EAD) and gas chromatography-mass spectrometry (GC-MS), and to test the antennal and behavioural responses of E. obliqua to these chemicals. The emission dynamics of bioactive chemicals was also monitored. GC-EAD experiments indicated that E. obliqua antennae responded to the following volatile compounds from R. officinalis: myrcene, α-terpinene, γ-terpinene, linalool, cis-verbenol, camphor, α-terpineol and verbenone, which were the minor constituents. Based on the dose-dependent antennal and behavioural responses of E. obliqua to these bioactive compounds, myrcene, γ-terpinene, linalool, cis-verbenol, camphor and verbenone were found to play a key role in repelling the moths, and the mixture that included all eight compounds was significantly more effective. The maximum emissions of these semiochemicals occurred at nightfall. The specifically bioactive compounds in R. officinalis volatiles are responsible for repelling E. obliqua adults. Results indicate that R. officinalis should be considered as a potential behaviour-modifying stimulus for 'push' components when developing 'push-pull' strategies for control of E. obliqua using semiochemicals. © 2014 Society of Chemical Industry.

  9. Lonomia obliqua Walker (Lepidoptera: Saturniidae: hemostasis implications

    Directory of Open Access Journals (Sweden)

    Silviane Maggi

    2015-06-01

    Full Text Available Summary In southern Brazil, since 1989, several cases of accidents produced by unwilling contact with the body of poisonous caterpillars of the moth species Lonomia obliqua Walker, 1855 (Lepidoptera: Saturniidae, were described. L. obliqua caterpillars have gregarious behavior and feed on leaves of host trees during the night, staying grouped in the trunk during the day, which favors the occurrence of accidents with the species. This caterpillar has the body covered with bristles that on contact with the skin of individuals, breaks and release their contents, inoculating the venom into the victim. The basic constitution of the venom is protein and its components produce physiological changes in the victim, which include disturbances in hemostasis. Hemorrhagic syndrome associated with consumption coagulopathy, intravascular hemolysis and acute renal failure are some of the possible clinical manifestations related to poisoning by L. obliqua. Specific laboratory tests for diagnosis of poisoning have not been described previously. The diagnosis of poisoning is made based on the patient's medical history, clinical manifestations, erythrocyte levels, and, primarily, parameters that evaluate blood coagulation. Treatment is performed with the use of supportive care and the administration of specific hyperimmune antivenom. Poisoning can be serious and even fatal.

  10. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  11. Faunistic analysis of the species of Anastrepha Schiner (Diptera: Tephritidae) in three municipalities of the state of Roraima, Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Nascimento, D B; Ronchi-Teles, B; Adaime, R

    2012-11-01

    The purpose of this work was to describe the population patterns of Anastrepha in three municipalities of the state of Roraima, Brazil, via faunistic analysis. Weekly collections were performed from January through December 2008, using McPhail traps containing 5% hydrolysed protein, in domestic orchards in the municipalities of Boa Vista, Bonfim and Pacaraima. We captured 301 females of Anastrepha in Boa Vista, 212 in Bonfim, and 167 in Pacaraima. Boa Vista presented the highest species richness (S = 10) and Pacaraima the lowest (S = 4). Anastrepha striata was the predominant species in Boa Vista (47.18%) and Pacaraima (65.87%), whereas A. obliqua predominated in Bonfim (46.23%). Boa Vista presented the highest Shannon-Wiener diversity index (H' = 1.19) and Margalef index (α = 1.58), and Bonfim presented the highest Pielou's evenness index (J' = 0.69). In Pacaraima the cumulative curves reached stability, confirming that the observed and expected species richness were the same. In the other two municipalities, the curves showed a moderate growth, suggesting that the sampling effort was not sufficient to produce an accurate depiction of species richness. In this study, Anastrepha zernyi is reported for the first time in Roraima.

  12. Two new species of Anastrepha Schiner (Diptera, Tephritidae) closely related to Anastrepha pickeli Lima.

    Science.gov (United States)

    Canal, N A; Uramoto, K; Zucchi, R A

    2013-02-01

    Anastrepha entodonta n. sp. and Anastrepha hadropickeli n. sp. are described and illustrated. The new species belong to the spatulata group. Both species occur sympatrically with Anastrepha pickeli Lima in the semiarid region of the state of Minas Gerais, Brazil. Anastrepha hadropickeli occurs also in the semiarid of the state of Rio Grande do Norte, Brazil, where it was misidentified as A. pickeli.

  13. Solar sterilization of abscised fruit: a cultural practice to reduce infestations of Anastrepha obliqua around orchards

    Science.gov (United States)

    Abscised mangoes, Mangifera indica L., of several varieties were stored under varying conditions of insolation, including no sun (stored in a laboratory), shade (stored under the shade of a mango tree), full sun (stored in direct view of the sun), and covered in a black plastic bag and stored in dir...

  14. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    Science.gov (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  15. Mass Trapping for Anastrepha suspensa

    Science.gov (United States)

    ABSTRACT In field tests conducted in south Florida to test grape juice as an alternative inexpensive bait for Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps baited with aqueous grape juice. These experiments included comparisons of grape juice with standard...

  16. Biochemical and biological properties of Lonomia obliqua bristle extract

    Directory of Open Access Journals (Sweden)

    A. M. Chudzinski-Tavassi

    2006-04-01

    Full Text Available Lonomia obliqua caterpillar is frequently seen in accidents with humans especially in the south of Brazil. Patients develop a hemorrhagic syndrome that can be treated with specific antilonomic serum. A consumptive coagulopathy was found to be the main cause of bleeding complications observed in patients after contact with L. obliqua. Studies revealed that L. obliqua caterpillar bristle extract (LOCBE displays a procoagulant activity that leads to intravascular thrombin formation, resulting in a special form of disseminated intravascular coagulation (DIC. Fibrinolysis seems to be secondary to the fibrin production, since no direct fibrinolytic activity was found in LOCBE. Two procoagulant toxins, a factor X activator (Losac and a prothrombin activator (Lopap, were isolated from LOCBE and characterized. Infusion of Lopap into experimental animals triggered a condition similar to that observed in human envenomation.

  17. Especies, distribución y hospedantes del género Anastrepha Schiner en el departamento del Tolima, Colombia

    Directory of Open Access Journals (Sweden)

    Castañeda Marìa del Rosario

    2010-08-01

    Full Text Available Las moscas del género Anastrepha constituyen una de las principales
    plagas de la fruticultura colombiana. El conocimiento
    de la diversidad de especies presentes en un área es el primer
    paso en el diseño de estudios tendientes a establecer tecnologías
    apropiadas de manejo. Además de un listado de las especies de
    Anastrepha identificadas en el Laboratorio de Entomología de
    la Universidad
    del Tolima desde 1988 hasta la fecha a través de
    diversos estudios realizados en este departamento, el presente
    trabajo incluye también la distribución y hospederos de dichas
    especies provenientes de diez municipios del departamento,
    con alturas entre 300 y 2.500 msnm. Se identificaron 60.688
    especímenes pertenecientes a 24 especies de Anastrepha.
    Mediante la recolección de frutos se asociaron 16 especies de
    hospederos (incluyendo
    cinco nuevos reportes a nueve especies
    de Anastrepha. Las especies A. distincta Greene, A. sororcula
    Zucchi y A. striata Schiner fueron las que presentaron una
    distribución altitudinal más amplia (300 a 2.200 msnm. Por
    su parte, A. obliqua solo se encontró desde los 300 hasta los
    1.550 msnm. Especies de importancia cuarentenaria como A.
    fraterculus (Wiedemann, A. grandis Macquart y A. serpentina
    (Wiedemann se encontraron por arriba de los 1.100, 960 y 900
    msnm, respectivamente.

  18. Comparison of Hydrolyzed Protein Baits and Various Grape Juice Products as Attractants for Anastrepha Fruit Flies (Diptera: Tephritidae).

    Science.gov (United States)

    Herrera, F; Miranda, E; Gómez, E; Presa-Parra, E; Lasa, R

    2016-02-01

    Mexican fruit flies, Anastrepha ludens (Loew; Diptera: Tephritidae), have traditionally been trapped in citrus orchards in Mexico using protein hydrolysates as bait. Recently, CeraTrap(®), an enzymatic hydrolyzed protein, has emerged as an effective lure for monitoring A. ludens at the orchard level and is currently being used by growers in the region of Veracruz. Several studies have revealed that grape juice is highly attractive to A. ludens, and recent work supports its potential use for regulation purposes. In our study, the attraction of A. ludens to different grape products was evaluated in citrus orchards and in comparison to other Anastrepha species in an area composed of mango and chicozapote orchards. Attraction to grape lures was compared with CeraTrap and the standard protein Captor +borax trap. In general, CeraTrap was more attractive than different commercial grape products in several experiments. Only Jumex, a commercial grape juice, did not differ significantly from CeraTrap in the capture of A. ludens males and females in a citrus crop. However, several drawbacks were detected when using Jumex grape juice: 1) higher tendency to capture males, 2) less selectivity against non-targeted insects, 3) higher capture of beneficial lacewings, and iv) the need to re-bait weekly owing to lower stability. In the area containing mango and chicozapote, CeraTrap was more attractive than Captor + borax for Anastrepha obliqua and Anastrepha serpentina, followed by grape juice products, which were the least attractive for these fruit fly species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Hospedeiros e parasitóides de Anastrepha spp. (Diptera: Tephritidae em Itaubal do Piririm, Estado do Amapá, Brasil Host and parasitoids of Anastrepha spp. (Diptera: Tephritidae in Itaubal do Piririm, Amapá State, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Adaime da Silva

    2007-04-01

    Full Text Available Este trabalho foi realizado no município de Itaubal do Piririm, Estado do Amapá, com o objetivo de registrar a ocorrência de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides. Foram coletadas 51 amostras de frutos, de 10 espécies vegetais, totalizando 69,5kg. Foram obtidos 1.169 pupários, dos quais emergiram 568 tefritídeos e 105 parasitóides. Quatro espécies de Anastrepha foram registradas: A. antunesi Lima, A. distincta Greene, A. obliqua Macquart e A. striata Schiner. Os hospedeiros de moscas-das-frutas foram taperebá (Spondias mombin, goiaba (Psidium guajava e ingá-cipó (Inga edulis, com índices de infestação de 1,3; 0,6 e 10,0 pupários/fruto e de 141,1; 20,7 e 26,5 pupários kg-1 de fruto, respectivamente. Duas espécies de parasitóides da família Braconidae foram obtidas: Doryctobracon areolatus (Szépligeti e Asobara anastrephae (Muesebeck.The occurrence of fruit flies on three host plants and their parasitoids was registered in Itaubal do Piririm, Amapá State, Brazil. Exactly 51 samples of fruits of 10 botanical species were collected and it totaled 69.5 kg. It was possible to obtain 1,169 puparia that emerged 568 Tephritidae and 105 parasitoids. Moreover, four species of Anastrepha were registered: A. antunesi Lima, A. distincta Greene, A. obliqua Macquart and A. striata Schiner. Spondias mombin, Psidium guajava and Inga edulis were the hosts of Tephritidae species, they had indexes of natural infestation of 1.3; 0.6 and 10.0 puparia/fruit and 141.1; 20.7 and 26.5 puparia kg-1 of fruit, respectively. Two species of Braconidae were obtained: Doryctobracon areolatus (Szépligeti and Asobara anastrephae (Muesebeck.

  20. Host status of grapefruit and Valencia oranges for Anastrepha serpentina and Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena M Tarshis

    2011-04-01

    Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) is sporadically captured in the Rio Grande Valley of Texas. Although its preferred hosts are in the Sapotaceae family, several varieties of Citrus, including grapefruit and oranges are listed as alternate hosts. Although Mexican fruit fly, Anastrepha ludens (Loew), is known to be a major pest of Citrus, doubt exists as to the status of Citrus as a breeding host for A. serpentina. To evaluate the host status of commercial Citrus for A. serpentina we compared oviposition and development with that of A. ludens under laboratory conditions with 'Rio Red' grapefruit (Citrus paradisi MacFayden) and 'Valencia' oranges [Citrus sinensis (L.) Osbeck] in different stages of maturity. Both fly species oviposited in early season fruit in which the eggs and larvae died in the fruit albedo. Survival of either species to the adult stage occurred in later season grapefruit. In oranges, no A. serpentina larvae survived compared with 150 A. ludens surviving to adults. Survival on both Citrus species was much lower for A. serpentina, only approximately 5% of eggs eclosed into larvae in grapefruit compared with approximatley 50% for A. ludens. In oranges approximately 16% of A. serpentina eggs eclosed compared with approximately 76% for A. ludens. In grapefruit, only one fourth as many A. serpentina larvae survived to the adult stage compared with A. ludens. Additional experiments were performed in a greenhouse on small, caged trees of la coma (Sideroxylon celastrinum H.B.K.), a Texas species of Sapotaceae. The A. serpentina females readily oviposited into these berries and normal adults emerged. The present low incidence of the adults, coupled with the high mortality during development of the larvae, suggests that Texas citrus is unlikely to support a breeding population of A. serpentina.

  1. Enhancing male sexual success in a lekking fly (Anastrepha suspensa Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality.

    Science.gov (United States)

    Pereira, Rui; Sivinski, John; Teal, Peter; Brockmann, Jane

    2010-11-01

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual success. However, sexual signals and interactions are likely to be physiologically expensive and so result in higher male mortality. Comparison of males kept in isolation for 35 days, but provided daily with a potential mate or a rival male, revealed that both male- and female-interactors shortened focal-male lifespan. In addition, focal males were either treated with methoprene or not, then either provided with protein in their sucrose-based diet or not. Protein proved to similarly double sexual success and also resulted in longer male life spans in all of the interactor-categories. However, there was no evidence that methoprene induced hypersexuality resulted in higher rates of mortality, i.e., the longevity of males treated with methoprene did not significantly differ from untreated males in the same interactor/diet categories. This apparent lack of costs to a putatively sexually selected signal is unexpected but presents an opportunity to increase the sexual competence of sterile flies with few consequences to their survival following mass-release. Published by Elsevier Ltd.

  2. Mass trapping is as effective as ground bait sprays for the control of Anastrepha (Diptera: Tephritidae) fruit flies in mango orchards.

    Science.gov (United States)

    Villalobos, Jorge; Flores, Salvador; Liedo, Pablo; Malo, Edi A

    2017-10-01

    Anastrepha fruit flies are considered one of the main phytosanitary problems for the fresh fruit industry in the USA, Caribbean islands and Latin America. Since 1994, the Mexican government has implemented the National Fruit Fly Program using an area-wide integrated pest management approach. In this paper, we evaluate the effectiveness of mass trapping and compare it with ground GF-120 spraying against Anastrepha obliqua and Anastrepha ludens populations in mango cv. Ataulfo orchards. Multilure® traps baited with Ceratrap® or Biolure® captured significantly more fruit flies than Captor 300 in field cage tests. Mass trapping and ground GF-120 spray significantly suppressed fruit fly populations compared with untreated plots. In Multilure traps placed in untreated plots, we captured significantly more fruit flies than in treated plots with mass trapping or GF-120 sprays. Plots treated with either mass trapping or GF-120 sprays reduced the percentage of infested fruit significantly compared with untreated plots. There was no difference between mass trapping and GF-120 ground bait spraying. Our results demonstrate that mass trapping was as effective as GF-120 ground spraying for the control of fruit flies in mango cv. Ataulfo orchards. The suppression effect of mass trapping was similar to GF-120 ground bait spraying. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  3. Eucalyptus obliqua seedling growth in organic vs. mineral soil horizons.

    Science.gov (United States)

    Barry, Karen M; Janos, David P; Nichols, Scott; Bowman, David M J S

    2015-01-01

    Eucalyptus obliqua, the most widespread timber tree in Tasmania, is a pioneer after fire which can eliminate the organic layer of forest soil, exposing the underlying mineral soil. We compared seedling growth, mycorrhiza formation, and mineral nutrient limitation in organic layer vs. mineral soil. We grew E. obliqua seedlings separately in pots of organic layer and mineral soil in a glasshouse. Additional treatments of organic soil only, involved fully crossed methyl-bromide fumigation and fertilization. Fertilization comprised chelated iron for 121 days after transplant (DAT) followed by soluble phosphorus. At 357 DAT, whole plant dry weight was three times greater in ambient organic than in mineral soil. In organic soil, fumigation halved ectomycorrhiza abundance and reduced seedling growth at 149 DAT, but by 357 DAT when negative effects of fumigation on seedling growth had disappeared, neither fumigation nor fertilization affected mycorrhiza abundance. Iron fertilization diminished seedling growth, but subsequent phosphorus fertilization improved it. E. obliqua seedlings grow much better in organic layer soil than in mineral soil, although phosphorus remains limiting. The prevalent forestry practice of burning to mineral soil after timber harvest exposes a poor growth medium likely only partially compensated by fire-induced mineral soil alterations.

  4. Eucalyptus obliqua seedling growth in organic versus mineral soil horizons

    Directory of Open Access Journals (Sweden)

    Karen eBarry

    2015-02-01

    Full Text Available Eucalyptus obliqua, the most widespread timber tree in Tasmania, is a pioneer after fire which can eliminate the organic layer of forest soil, exposing the underlying mineral soil. We compared seedling growth, mycorrhiza formation, and mineral nutrient limitation in organic layer versus mineral soil. We grew E. obliqua seedlings separately in pots of organic layer and mineral soil in a glasshouse. Additional treatments of organic soil only, involved fully crossed methyl-bromide fumigation and fertilization. Fertilization comprised chelated iron for 121 days after transplant (DAT followed by soluble phosphorus. At 357 DAT, whole plant dry weight was three times greater in ambient organic than in mineral soil. In organic soil, fumigation halved ectomycorrhiza abundance and reduced seedling growth at 149 DAT, but by 357 DAT when negative effects of fumigation on seedling growth had disappeared, neither fumigation nor fertilization affected mycorrhiza abundance. Iron fertilization diminished seedling growth, but subsequent phosphorus fertilization improved it. E. obliqua seedlings grow much better in organic layer soil than in mineral soil, although phosphorus remains limiting. The prevalent forestry practice of burning to mineral soil after timber harvest exposes a poor growth medium likely only partially compensated by fire-induced mineral soil alterations.

  5. Head Transcriptomes of Two Closely Related Species of Fruit Flies of the Anastrepha fraterculus Group Reveals Divergent Genes in Species with Extensive Gene Flow

    Directory of Open Access Journals (Sweden)

    Victor Borges Rezende

    2016-10-01

    Full Text Available Several fruit flies species of the Anastrepha fraterculus group are of great economic importance for the damage they cause to a variety of fleshy fruits. Some species in this group have diverged recently, with evidence of introgression, showing similar morphological attributes that render their identification difficult, reinforcing the relevance of identifying new molecular markers that may differentiate species. We investigated genes expressed in head tissues from two closely related species: A. obliqua and A. fraterculus, aiming to identify fixed single nucleotide polymorphisms (SNPs and highly differentiated transcripts, which, considering that these species still experience some level of gene flow, could indicate potential candidate genes involved in their differentiation process. We generated multiple libraries from head tissues of these two species, at different reproductive stages, for both sexes. Our analyses indicate that the de novo transcriptome assemblies are fairly complete. We also produced a hybrid assembly to map each species’ reads, and identified 67,470 SNPs in A. fraterculus, 39,252 in A. obliqua, and 6386 that were common to both species. We identified 164 highly differentiated unigenes that had a mean interspecific index (D¯ of at least 0.94. We selected unigenes that had Ka/Ks higher than 0.5, or had at least three or more highly differentiated SNPs as potential candidate genes for species differentiation. Among these candidates, we identified proteases, regulators of redox homeostasis, and an odorant-binding protein (Obp99c, among other genes. The head transcriptomes described here enabled the identification of thousands of genes hitherto unavailable for these species, and generated a set of candidate genes that are potentially important to genetically identify species and understand the speciation process in the presence of gene flow of A. obliqua and A. fraterculus.

  6. Co-Infestation and Spatial Distribution of Bactrocera carambolae and Anastrepha spp. (Diptera: Tephritidae) in Common Guava in the Eastern Amazon.

    Science.gov (United States)

    Deus, E G; Godoy, W A C; Sousa, M S M; Lopes, G N; Jesus-Barros, C R; Silva, J G; Adaime, R

    2016-01-01

    Field infestation and spatial distribution of introduced Bactrocera carambolae Drew and Hancock and native species of Anastrepha in common guavas [Psidium guajava (L.)] were investigated in the eastern Amazon. Fruit sampling was carried out in the municipalities of Calçoene and Oiapoque in the state of Amapá, Brazil. The frequency distribution of larvae in fruit was fitted to the negative binomial distribution. Anastrepha striata was more abundant in both sampled areas in comparison to Anastrepha fraterculus (Wiedemann) and B. carambolae The frequency distribution analysis of adults revealed an aggregated pattern for B. carambolae as well as for A. fraterculus and Anastrepha striata Schiner, described by the negative binomial distribution. Although the populations of Anastrepha spp. may have suffered some impact due to the presence of B. carambolae, the results are still not robust enough to indicate effective reduction in the abundance of Anastrepha spp. caused by B. carambolae in a general sense. The high degree of aggregation observed for both species suggests interspecific co-occurrence with the simultaneous presence of both species in the analysed fruit. Moreover, a significant fraction of uninfested guavas also indicated absence of competitive displacement. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

  7. [Accidents with caterpillar Lonomia obliqua (Walker, 1855). An emerging problem].

    Science.gov (United States)

    Sánchez, Matías N; Mignone Chagas, Mariana A; Casertano, Sergio A; Cavagnaro, Luis E; Peichoto, María E

    2015-01-01

    Lonomia obliqua (Walker, 1855) is a moth from the family Saturniidae, widely distributed in tropical rainforests of South America. In its larval stage (caterpillar) it is characterized by bristles that cover the animal's body. These structures are hard and branched spiny evaginations of the cuticle, underneath which a complex mixture of toxic molecules is stored. When spicules are brought into contact with the skin of people, toxins enter passively through the injury, causing not only local but also systemic poisoning (primarily hemorrhagic manifestations). When the whole animal is accidentally crushed, the insect's chitinous bristles are broken and the venomous secretions penetrate the human skin, reaching the blood circulation. Due to the numerous registered cases of erucism in Southern Brazil, the Butantan Institute has produced an antivenom able to neutralize the deleterious effects produced by contact with L. obliqua caterpillar bristles. In Argentina, these kinds of accidents are rare and restricted to the province of Misiones. Taking into account that to date there is no report in this country about clinical cases submitted to a specific treatment (antivenom), our aim is to communicate here six cases of Lonomia caterpillar-induced bleeding syndrome that were treated in the Hospital SAMIC of Puerto Iguazú (Misiones, Argentina) during 2014 with the antilonomic serum produced in Brazil. It is worthy to note that all patients evolved favorably within the first few hours, and for this reason, the use of this antivenom is recommended to treat the cases of Lonomia erucism in Argentina.

  8. The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects.

    Science.gov (United States)

    Sarno, Francesca; Ruiz, María F; Eirín-López, José M; Perondini, André L P; Selivon, Denise; Sánchez, Lucas

    2010-05-13

    In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent

  9. Environmental stability and morphologic variation in the bryozoan Homotrypa obliqua

    Energy Technology Data Exchange (ETDEWEB)

    Key, M.M. Jr

    1985-01-01

    Bryozoans as colonial organisms permit the separation of environmental and genetic contributions to morphologic variation. Previous analyses attempted to establish the effects of environmental stability on the partitioning of morphologic variation. Regrettably they utilized multiple species in different environments. To test this model definitively, colonies of the Ordovician bryozoan Homotrypa obliqua were sampled from paleoenvironments of different stabilities from Cincinnati. The Corryville and Fairmount beds provided ten colonies on which measures of zooecial shape and spacing on and between monticules were made. ANOVA and discriminant function analysis revealed that colonies from the deeper more stable environment of the Corryville beds exhibit more between colony variation. Colonies from the less stable Fairmount beds show relatively more within colony variation. This difference most likely results from less microenvironmental perturbation and/or greater within genotype developmental regulation in colonies from more stable environments. This is confirmed by correlation coefficient matrices that show biologically expected interdependence between characters only in the Corryville colonies. Thus, the partitioning of morphologic variation is a useful tool for predicting paleoenvironmental stability.

  10. Effects of Fuscoporia obliqua on Postprandial Glucose Excursion and Endothelial Dysfunction in Type 2 Diabetic Patients

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Postprandial hyperglycemia has been reported to elicit endothelial dysfunction and provoke future cardiovascular complications. A reduction of postprandial blood glucose levels by the glucosidase inhibitor Fuscoporia obliqua was associated with a risk reduction of cardiovascular complications, but the effects of Fuscoporia obliqua on endothelial function have never been elucidated. This study is aimed to assess the efficacy of Fuscoporia obliqua on postprandial metabolic parameters and endothelial function in type 2 diabetic patients. Postprandial peak glucose (14.47±1.27 vs. 8.50±0.53 mmol/liter), plasma glucose excursion (PPGE), and change in the area under the curve (AUC) glucose after a single loading of test meal (total 450 kcal; protein 15.3%; fat 32.3%; carbohydrate 51.4%) were significantly higher in the diet-treated type 2 diabetic patients (n=14) than the age- and sex-matched controls (n=12). The peak forearm blood flow response and total reactive hyperemic flow (flow debt repayment) during reactive hyperemia, indices of resistance artery endothelial function on strain-gauge plethysmography, were unchanged before and after meal loading in the controls. But those of the diabetics were significantly decreased 120 and 240 min after the test meal. A prior administration of Fuscoporia obliqua decreased postprandial peak glucose, PPGE, and AUC glucose. The peak forearm blood flow and flow debt repayment were inversely well correlated with peak glucose, PPGE, and AUC glucose, but not with AUC insulin or the other lipid parameters. Even a single loading of the test meal was shown to impair the endothelial function in type 2 diabetic patients, and the postprandial endothelial dysfunction was improved by a prior use of Fuscoporia obliqua. Fuscoporia obliqua might reduce macrovascular complication by avoiding endothelial injury in postprandial hyperglycemic status.

  11. 14种植物精油对茶尺蠖行为的影响%Effect of 14 Plant Essential Oils on the Behavior of Ectropis obliqua (Prout)

    Institute of Scientific and Technical Information of China (English)

    张正群; 孙晓玲; 罗宗秀; 高宇; 边磊; 辛肇军; 蔡晓明; 陈宗懋

    2014-01-01

    To study the repellency, oviposition deterrence and antifeeding effect of 14 plant essential oils against Ectropis obliqua (Prout) and to explore essential oils as the behavior-modifying stimuli of E. obliqua “push-pull”strategy in tea plantations. Behavioral bioassays were conducted to test the repellent and oviposition deterrence activity of 14 different essential oils on adults of E. obliqua, and the antifeeding activities of plant essential oils against the 3rd-instar larvae were investigated by leaf disc choice bioassays. The results showed that Ocimum basilicum oil, Rosmarinus officinalis oil, Cinnamomum zeylanicum oil, Cuminum cyminum oil and Pelargonium graveolens oil displayed strongest repellency against the female and male adults of E. obliqua, and R. officinalis oil and P. graveolens oil also have deterred oviposition for female E. obliqua. Under three tested concentrations of essential oil, C. cyminum oil, O. basilicum oil and Agastache rugosa oil showed strong antifeeding activities to E. obliqua larvae. The antifeedant rates of essential oils increased differently, and the growth rates of E. obliqua larvae decreased with the increase of concentration of essential oils. The results demonstrated that among those 14 plant essential oils, R. officinalis oil, O. basilicum oil, C. cyminum oil and P. graveolens oil showed the remarkable behavior regulating functions on E. obliqua, with the potential to be developed as the components of the „push-pull‟strategy for control of this pest.%为获得能够应用于茶园茶尺蠖Ectropis obliqua“推-拉”策略的行为调节剂,在室内测定了茶尺蠖成虫对14种植物精油的趋性反应,及植物精油对茶尺蠖雌虫产卵行为的干扰作用,并采用叶碟法测定了植物精油对茶尺蠖幼虫的拒食作用。结果表明,罗勒、迷迭香、肉桂、茴香及天竺葵5种植物精油对茶尺蠖成虫表现出一定的驱避活性,并且迷迭香油和天竺葵油还

  12. Wolbachia in Anastrepha fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Coscrato, Virginia E; Braz, Antônio S K; P Perondini, André L; Selivon, Denise; Marino, Celso L

    2009-09-01

    Endosymbiotic bacteria of the genus Wolbachia are widespread among arthropods and cause a variety of reproductive abnormalities, such as cytoplasmic incompatibility, thelytokous parthenogenesis, male-killing, and host feminization. In this study, we used three sets of Wolbachia-specific primers (16S rDNA, ftsZ, and wsp) in conjunction with the polymerase chain reaction (PCR), cloning and sequencing to study the infection of fruit flies (Anastrepha spp. and Ceratitis capitata) by Wolbachia. The flies were collected at several localities in Brazil and at Guayaquil, Ecuador. All of the fruit flies studied were infected with Wolbachia supergroup A, in agreement with the high prevalence of this group in South America. Phylogenetic analysis showed that the wsp gene was the most sensitive gene for studying the relationships among Wolbachia strains. The Wolbachia sequences detected in these fruit flies were similar to those such as wMel reported for other fruit flies. These results show that the infection of Anastrepha fruit flies by Wolbachia is much more widespread than previously thought.

  13. Accident involving a 2-year-old child and Lonomia obliqua venom: clinical and coagulation abnormalities

    Directory of Open Access Journals (Sweden)

    Daniela Nasu Monteiro Medeiros

    2014-12-01

    Full Text Available Poisons of caterpillars have different effects on inflammatory and coagulation systems. This is a case report of a 2-year-old child that accidentally came in contact with several caterpillars of the species Lonomia obliqua. At first, the patient's exams presented abnormal coagulation and decreased fibrinogen, but the patient did not evolve to active bleeding or acute renal failure. The patient received antilonomic serum 15 h after the accident and the treatment was repeated after another 12 h due to persistent alterations shown by the coagulation exams. The venom of L. obliqua has several substances that act on the coagulation and inflammatory systems. The event is characterized by a hemorrhagic syndrome with decreases in fibrinogen. L. obliqua Stuart-factor activator (Losac and L. obliqua prothrombin activator protease (Lopap are components that act with procoagulatory effects. The pro-inflammatory action occurs due to metalloproteases, hyaluronidases and other substances with inflammatory activity. Studies on caterpillar venom can give new perspectives on the treatment of cancer and other diseases that cause dysfunction of the extra-cellular matrix.

  14. Development of synthetic volatile attractant for maleEctropis obliqua moths

    Institute of Scientific and Technical Information of China (English)

    SUN Xiao-ling; LI Xi-wang; XIN Zhao-jun; HAN Juan-juan; RAN Wei; LEI Shu

    2016-01-01

    The tea geometridEctropis obliquais one of the most serious leaf-feeding insect pests in tea (Camelia sinensis) in East Asia. Although several volatile chemicals emitted from tea plants have been reported to be attractive toE. obliqua moths, no synthetic attractants for E. obliqua moths have been developed. By measuring the behavioral responses of the moth to a series of chemicals in the lab, we found that a blend containing a ternary mixture containing (Z)-3-hexenal, (Z)-3-hexenyl hexanoate and benzyl alcohol clearly attracted toE. obliqua moths of both sex and that (Z)-3-hexenyl acetate could enhance the attractiveness of the ternary blend. Moreover, we found that the volatiles emitted from the plant-E. obliqua larva com-plex have the same attractiveness as: 1) the blend of volatiles containing the ternary mixture and 2) the blend containing (Z)-3-hexenyl acetate plus the ternary mixture to both male and female moths. In a ifeld bioassay, more male moths were observed on traps that were baited with the blend containing (Z)-3-hexenyl acetate plus the ternary mixture than on control traps. Our study raises the tantalizing possibility that synthetic blends could be deployed as attractants for pests in the ifeld.

  15. 芳香植物气味及提取液对茶尺蠖行为的影响%Effect of odors from different aromatic plants and extracts on the behavior of the tea geometrid, Ectropis obliqua (Prout)

    Institute of Scientific and Technical Information of China (English)

    张正群; 孙晓玲; 罗宗秀; 高宇; 边磊; 陈宗懋

    2012-01-01

    为了明确芳香植物对茶尺蠖Ectropisobliqua的驱避、拒食作用和获得应用于茶园茶尺蠖“推一拉”策略的植物材料,利用“Y”型嗅觉仪室内测定其成虫对芳香植物气味的趋性反应,并采用叶碟法测定芳香植物提取液对其幼虫的拒食作用及营养干扰效果。丁香罗勒、迷迭香、柠檬桉和芸香植株挥发物及甲醇提取液对茶尺蠖雌、雄成虫有显著的驱避效果。猫薄荷、迷迭香和鼠尾草的200mg/mL甲醇提取液对荼尺蠖3龄幼虫表现出显著拒食活性,24h后的选择性拒食率分别为93.85%、86.00%和77.32%,非选择性拒食率分别为85.77%、87.00%和88.05%。其中,迷迭香处理的幼虫生长率最低,仅为0.12mg/天,对幼虫的相对取食量、食物利用率和食物转化率等营养指标有影响。研究表明,10种芳香植物中迷迭香具有显著的行为调控功能,是构建茶尺蠖“推一拉”策略的理想材料。%To study the repellency and antifeedant effects of aromatic plants against Ectropis obliqua (Prout) and to acquire the suitable plants for E. obliqua "push-pull" strategy in tea plantations, behav- ioral responses of adults E. obliqua to the odors of ten different aromatic plants were measured by using "Y" shaped olfactometer in the laboratory, and the antifeedant activities and nutritional interfering effects of ten aromatic plant extracts against the 3rd-instar larvae were investigated using leaf disc choice bioas- says as well. The volatile and the methanol extracts of Ocimum basilicum, Rosmarinus officinalis, Cumi- hum maculata and Ruta graveolens plants displayed remarkable repellency against female and male E. obliqua. The methanol extracts of Nepeta cataria, R. officinalis and Salvia farinacea plants had strong an- tifeedant activities to E. obliqua larvae at the concentration of 200 mg/mL. Compared with control, the choice antifeedant rates of 24 h reached

  16. Reproductive parameters of Lonomia obliqua Walker, 1855 (Lepidoptera: Saturniidae in laboratory

    Directory of Open Access Journals (Sweden)

    Lisete Maria Lorini

    2004-08-01

    Full Text Available Lonomia obliqua is an insect that has urticant spines in the larval stage. This species may cause death as a result of haemorrhages caused by a toxin released from the caterpillar's spines onto the skin of the victim. Since 1989 when this species was identified in Rio Grande do Sul, Brazil, many accidents have happened. The aim of this study was to verify the oviposition, fecundity, fertility, viability of eggs and incubation period of the species. Adults were left in a moth's cage to mate and lay eggs. Thirteen couples were observed daily, and the number of eggs and the caterpillars emerged were recorded. The results showed a mean of 2.8 (± 1.3 ovipositions, a mean fecundity of 135.3 (± 54.4 eggs/female, a mean fertility of 111.9 (± 55.4 eggs/female, a mean egg viability of 80.9 (± 20.97 % and a mean incubation period of 31.8 (± 5.8 days.O objetivo desse trabalho foi estudar os parâmetros biológicos de oviposição, fecundidade, fertilidade, viabilidade dos ovos e período de incubação de Lonomia obliqua Walker, 1855, em laboratório. As lagartas foram coletadas no campo nos municípios de Santa Cruz do Sul, Erechim, Guaporé, Passo Fundo, Não-Me-Toque, São Jorge, Farroupilha e Vila Lângaro, no Rio Grande do Sul, e Concórdia em Santa Catarina. As lagartas foram mantidas em sala de criação, com a leitura diária da temperatura e umidade relativa do ar, até a emergência dos adultos. Após a sexagem, cada casal foi colocado em uma gaiola para acasalamento e postura. Acompanhou-se, diariamente, as posturas das fêmeas e a eclosão das lagartas, determinando-se o número de posturas por fêmea, a fecundidade, a fertilidade, a viabilidade e o período de incubação dos ovos. O número médio de oviposições foi de 2,8 (± 1,3, fecundidade média de 135,30 (± 54,4 ovos por fêmea, fertilidade média de 111,9 (± 55,4 ovos por fêmea. A viabilidade média dos ovos foi de 80,9 (± 21,0 % e obteve-se um período médio de incuba

  17. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  18. Limits to the host range of the highly polyphagous tephritid fruit fly Anastrepha ludens in its natural habitat.

    Science.gov (United States)

    Birke, A; Acosta, E; Aluja, M

    2015-12-01

    Anastepha ludens (Diptera: Tephritidae) is a highly polyphagous fruit fly that is able to develop in a wide range of hosts. Understanding the limits of this pest's host range could provide valuable information for pest management and plant breeding for pest resistance. Previous studies have shown that guavas (Psidium guajava (Myrtaceae) L.), are not attacked under natural conditions by A. ludens. To understand this phenomenon, guavas were exposed to natural infestation by A. ludens and to other fruit fly species that infest guavas in nature (Anastrepha striata Schiner, Anastepha fraterculus (Wiedemann), Anastepha obliqua (Macquart)). Once the susceptible phenological stage of guavas was determined, fruit infestation levels were compared between A. ludens and A. striata. Choice and non-choice tests were performed under field-cage conditions. Under field conditions, guavas were susceptible to A. striata and A. fraterculus attack all the way from when fruit was undeveloped to when fruit began to ripen. No infestation by A. ludens was recorded under natural conditions. Similar results were obtained when forced exposures were performed, indicating that unripe guavas were preferred by A. striata over ripe fruit, and that infestation rates were higher at early fruit maturity stages. Under forced oviposition conditions, A. ludens larvae were unable to develop in unripe guavas but did so in fully ripe fruit. However, A. ludens fitness parameters were dramatically affected, exhibiting reduced survival and reduced pupal weight compared to conspecifics that developed in a natural host, grapefruit. We confirm that P. guajava should not be treated as a natural host of this pestiferous species, and suggest that both behavioral aspects and the fact that larvae are unable to adequately develop in this fruit, indeed represent clear limits to A. ludens's broad host range.

  19. Disinfestation of apples attacked by the fruit fly Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) using gamma radiation of cobalt-60; Desinfestacao de macas atacadas por Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) atraves das radiacoes gama do cobalto-60

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, Valter; Wiendl, Frederico M. [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil)

    1996-04-01

    Apples, cv. Gala, artificially infested during 72 hours with adults of the fruit fly Anastrepha fraterculus (Wied.) were irradiated with the following gamma radiation doses: 0 (control), 25, 50, 75 and 100 Gy, at the dose rate of 1048 Gy per hour. After irradiation fruits were put in plastic bags with 80 ml of sugar cane bagasse. The bags were maintained in a rearing room at temperature 21 - 24 deg C, 65 - 75% R H, and photo period of 12 hours. Pupae obtained were sieved out and kept in small glass tubes. All doses tested did not allow emergence of adults. (author) 4 refs., 1 tab.

  20. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  1. A revision of the Anastrepha robusta species group (Diptera: Tephritidae)

    Science.gov (United States)

    The Anastrepha robusta species group is revised to include the following 29 species: A. amaryllis Tigrero (Ecuador), A. amazonensis, n. sp. (Brazil: Amazonas), A. bella, n. sp. (Panamá), A. binodosa Stone (Colombia, Brazil: Amazonas, Pará), A. concava Greene (Costa Rica to Ecuador and Brazil: Amazon...

  2. The fruitfly Anastrepha serpentina in Curaçao

    NARCIS (Netherlands)

    Burgers, A.C.J.

    1953-01-01

    On a private collecting trip to the Netherlands Antilles, in the winter of 1948—1949, I had the opportunity of studying an infestation of the sapodilla, caused by a well-known kind of fruitfly, Anastrepha serpentina, which, however, has never before been reported from these islands. The

  3. Distribution of Anastrepha spp. in carambola orchards: Evidence for migration

    Science.gov (United States)

    Carambola orchards in Juana Diaz, Corozal, and Isabela, PR, were monitored for Anastrepha spp. fruit flies using Multi-lure traps baited with putrescine and ammonium acetate. The number of flies at various locations within the orchards were statistically compared with the expected distribution if fl...

  4. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate

  5. Current knowledge of the species complex Anastrepha fraterculus (Diptera, Tephritidae) in Brazil

    Science.gov (United States)

    Vaníčková, Lucie; Hernández-Ortiz, Vicente; Bravo, Iara Sordi Joachim; Dias, Vanessa; Roriz, Alzira Kelly Passos; Laumann, Raul Alberto; Mendonça, Adriana de Lima; Paranhos, Beatriz Aguiar Jordão; do Nascimento, Ruth Rufino

    2015-01-01

    Abstract The study of the species complex Anastrepha fraterculus (Af complex) in Brazil is especially important in a taxonomical, evolutionary and pest management context, because there are evidences that some of them may occur in sympatry. In this review, we analyzed the main results supporting evidences that three cryptic species occur in Brazil. The taxonomical and phylogenetic relationships based on eggshell morphology, adult morphometrics, as well as cytotaxonomy and genetic differentiations are discussed. We also review available information on sexual behavior including acoustic communication of males during courtship and sexual incompatibility; and chemical signals involved in the communication between sexes, with a special focus on sex pheromones. We examined the role of long- and short-range pheromones (male-produced volatiles and cuticular hydrocarbons, respectively), their implications in sexual isolation, and their possible use for chemotaxonomic differentiation of the putative species of the Af complex. PMID:26798261

  6. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  7. Diagnostic characters within ITS2 DNA support molecular identification of Anastrepha suspensa

    Science.gov (United States)

    An approximately 220 bp fragment of the internal transcribed spacer 2 (ITS2) is screened as a diagnostic of Anastrepha suspensa and other pest fruit flies in the genus Anastrepha. The majority (96%) of the sites in this fragment are invariant among the test species but A. suspensa can be separated f...

  8. Copula duration, insemination and sperm allocation in Anastrepha ludens (Diptera: Tephritidae)

    Science.gov (United States)

    The juxtaposition and functional relationship of the sperm storage organs in Anastrepha ludens is described. The spermatheca squash technique has been used to determine mated status in tephritid fruit flies and thus as a measure of compatability and coverage for SIT programs. Female Anastrepha luden...

  9. The complete genome of a baculovirus isolated from an insect of medical interest: Lonomia obliqua (Lepidoptera: Saturniidae)

    Science.gov (United States)

    Aragão-Silva, C. W.; Andrade, M. S.; Ardisson-Araújo, D. M. P.; Fernandes, J. E. A.; Morgado, F. S.; Báo, S. N.; Moraes, R. H. P.; Wolff, J. L. C.; Melo, F. L.; Ribeiro, B. M.

    2016-01-01

    Lonomia obliqua (Lepidoptera: Saturniidae) is a species of medical importance due to the severity of reactions caused by accidental contact with the caterpillar bristles. Several natural pathogens have been identified in L. obliqua, and among them the baculovirus Lonomia obliqua multiple nucleopolyhedrovirus (LoobMNPV). The complete genome of LoobMNPV was sequenced and shown to have 120,022 bp long with 134 putative open reading frames (ORFs). Phylogenetic analysis of the LoobMNPV genome showed that it belongs to Alphabaculovirus group I (lepidopteran-infective NPV). A total of 12 unique ORFs were identified with no homologs in other sequenced baculovirus genomes. One of these, the predicted protein encoded by loob035, showed significant identity to an eukaryotic transcription terminator factor (TTF2) from the Lepidoptera Danaus plexippus, suggesting an independent acquisition through horizontal gene transfer. Homologs of cathepsin and chitinase genes, which are involved in host integument liquefaction and viral spread, were not found in this genome. As L. obliqua presents a gregarious behavior during the larvae stage the impact of this deletion might be neglectable. PMID:27282807

  10. Application of neutron activation analysis method in leaves of Casearia obliqua medicinal plant; Aplicacao do metodo de analise por ativacao com neutrons na analise de folhas da planta medicinal Casearia obliqua

    Energy Technology Data Exchange (ETDEWEB)

    Yamashita, Celina I.; Saiki, Mitiko [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)]. E-mail: celinayamashita@yahoo.com.br; mitiko@ipen.br; Sertie, Jaime A.A. [Sao Paulo Univ., SP (Brazil). Inst. de Ciencias Biomedicas

    2005-07-01

    The pharmacological properties of medicinal plants have been related to the presence of organic compounds, however elements are also known to have an important participation in the active compounds constitution process. In this study, instrumental neutron activation analysis (INAA) was applied to determine elements in leaves of Casearia obliqua medicinal plant collected at two different locations in the Atlantic Forest, Brazil, SP. Soil samples collected from where this plant was grown were also analyzed in order to verify if there is a correlation between the elements present in soils and plant leaves. Br, Ca, Cl, Co, Cr, Cs, Fe, K, La, Mn, Na, Rb, Sb, Sc and Zn were determined in C. obliqua leaves and the elements As, Ca, Ce, Eu, Fe, Hf, La, Lu, Nd, Rb, Sc, Sm, Tb, Th, U and Zn in soils. Soil samples collected from two different locations presented similar concentrations for most elements. Likewise, C. obliqua leaves collected from the two locations presented similar elemental contents. These results suggest that analysis of extracts from these leaf samples and the evaluation of their pharmacological activities should be carried out. Certified reference materials IAEA-Soil-7, USGS W-1, NIST 1573a Tomato Leaves and NIST 1515 Apple Leaves were analyzed and the quality of the obtained results was assured. (author)

  11. Viability of Cabralea canjerana extracts to control the South American fruit fly, Anastrepha fraterculus.

    Science.gov (United States)

    Magrini, Flaviane Eva; Specht, Alexandre; Gaio, Juliano; Girelli, Cristiane Priscila; Migues, Ignacio; Heinzen, Horacio; Sartori, Valdirene Camatti; Cesio, Veronica

    2014-04-10

    Several representatives of Meliaceae contain biologically active compounds that are toxic to insects with few negative effects on the environment and humans. Our study evaluated the activity of ethyl acetate and ethanol extracts from the fruit and seeds of Cabralea canjerana (Vellozo) Mart (Sapindales: Meliaceae) on Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae). Limonoids and triterpenes were detected in fruit and seed extracts. Each extract was added to an artificial diet at three concentrations and tested after 24, 48, and 72 hr of extract application. Ethyl acetate extracts were the most active ones and showed the effect of both dose and time elapses after application on the insects. The highest toxic effect on A. fraterculus adults was from ethyl acetate extracts from fruit, followed by extracts from seeds. These extracts showed antifeedant activities. Extract solutions sprinkled on fruits of Carica papaya (L.) (Brassicales: Caricaceae) caused oviposition repellency and negatively affected the biological development of A. fraterculus. Ethyl acetate extracts highly hampered oviposition, but seed extracts showed lesser oviposition deterrence. The fruit and seed extracts diminished pupal viability. Particularly, the ethyl acetate fruit extract caused malformed adults. The sex ratio was also affected, resulting in female predominance for the fruit extract, while the seed extract showed a dose-dependent effect. Low doses caused male abundance, but at higher concentrations the effect was reversed. These encouraging results showed that the C. canjerana extracts have great potential as new tools to be used in integrated pest management programs to protect fruits against A. fraterculus.

  12. Viability of Cabralea canjerana Extracts to Control the South American Fruit Fly, Anastrepha fraterculus

    Science.gov (United States)

    Magrini, Flaviane Eva; Specht, Alexandre; Gaio, Juliano; Girelli, Cristiane Priscila; Migues, Ignacio; Heinzen, Horacio; Sartori, Valdirene Camatti; Cesio, Veronica

    2014-01-01

    Several representatives of Meliaceae contain biologically active compounds that are toxic to insects with few negative effects on the environment and humans. Our study evaluated the activity of ethyl acetate and ethanol extracts from the fruit and seeds of Cabralea canjerana (Vellozo) Mart (Sapindales: Meliaceae) on Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae). Limonoids and triterpenes were detected in fruit and seed extracts. Each extract was added to an artificial diet at three concentrations and tested after 24, 48, and 72 hr of extract application. Ethyl acetate extracts were the most active ones and showed the effect of both dose and time elapses after application on the insects. The highest toxic effect on A. fraterculus adults was from ethyl acetate extracts from fruit, followed by extracts from seeds. These extracts showed antifeedant activities. Extract solutions sprinkled on fruits of Carica papaya (L.) (Brassicales: Caricaceae) caused oviposition repellency and negatively affected the biological development of A. fraterculus. Ethyl acetate extracts highly hampered oviposition, but seed extracts showed lesser oviposition deterrence. The fruit and seed extracts diminished pupal viability. Particularly, the ethyl acetate fruit extract caused malformed adults. The sex ratio was also affected, resulting in female predominance for the fruit extract, while the seed extract showed a dose-dependent effect. Low doses caused male abundance, but at higher concentrations the effect was reversed. These encouraging results showed that the C. canjerana extracts have great potential as new tools to be used in integrated pest management programs to protect fruits against A. fraterculus. PMID:25373194

  13. Haldane's rule and other aspects of reproductive isolation observed in the Anastrepha fraterculus complex (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Selivon Denise

    1999-01-01

    Full Text Available Some aspects of reproductive isolation between allopatric populations of two closely related species of the Anastrepha fraterculus complex (A. fraterculus sp. 1 and sp. 2 were evaluated in laboratory conditions. Most of the crosses were fertile in each species as well as between sp. 2 females and sp. 1 males. In the reciprocal cross only 41.7% of the matings yielded viable progeny. Egg hatching occurred at similar rates within the two species, but was significantly lower in the crosses between the species. Adult emergence did not differ significantly among crosses. The sex ratio of adult progeny within each species, as well as in the hybrid progeny derived from sp. 1 females crossed to sp. 2 males, did not differ from the expected 1:1 ratio. However, in the crosses between sp. 2 females to sp. 1 males, a significant deviation in the sex ratio in favor of females was observed, according to the Haldane's rule. The results reinforce previous data which indicated that A. fraterculus sp. 1 and A. fraterculus sp. 2 are distinct biological entities.

  14. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae)

    Science.gov (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  15. Pheromone Analyses of the Anastrepha fraterculus (Diptera: Tephritidae) Cryptic Species Complex

    National Research Council Canada - National Science Library

    Radka Břízová; Adriana L. Mendonça; Lucie Vanícková; Alana L. Mendonça; Carlos Eduardo Da Silva; Aleš Tomčala; Beatriz Aguiar Jordão Paranhos; Vanessa Simões Dias; Iara Sordi Joachim-Bravo; Michal Hoskovec; Blanka Kalinová; Ruth R. Do Nascimento

    2013-01-01

    ABSTRACT The South American fruit fly Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) cryptic species complex is presently one of the most studied pest models in terms of speciation and population mating compatibility...

  16. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae).

    Science.gov (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A

    2016-09-15

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  17. Precocious sexual signalling and mating in Anastrepha fraterculus (Diptera: Tephritidae) sterile males achieved through juvenile hormone treatment and protein supplements.

    Science.gov (United States)

    Liendo, M C; Devescovi, F; Bachmann, G E; Utgés, M E; Abraham, S; Vera, M T; Lanzavecchia, S B; Bouvet, J P; Gómez-Cendra, P; Hendrichs, J; Teal, P E A; Cladera, J L; Segura, D F

    2013-02-01

    Sexual maturation of Anastrepha fraterculus is a long process. Methoprene (a mimic of juvenile hormone) considerably reduces the time for sexual maturation in males. However, in other Anastrepha species, this effect depends on protein intake at the adult stage. Here, we evaluated the mating competitiveness of sterile laboratory males and females that were treated with methoprene (either the pupal or adult stage) and were kept under different regimes of adult food, which varied in the protein source and the sugar:protein ratio. Experiments were carried out under semi-natural conditions, where laboratory flies competed over copulations with sexually mature wild flies. Sterile, methoprene-treated males that reached sexual maturity earlier (six days old), displayed the same lekking behaviour, attractiveness to females and mating competitiveness as mature wild males. This effect depended on protein intake. Diets containing sugar and hydrolyzed yeast allowed sterile males to compete with wild males (even at a low concentration of protein), while brewer´s yeast failed to do so even at a higher concentration. Sugar only fed males were unable to achieve significant numbers of copulations. Methoprene did not increase the readiness to mate of six-day-old sterile females. Long pre-copulatory periods create an additional cost to the management of fruit fly pests through the sterile insect technique (SIT). Our findings suggest that methoprene treatment will increase SIT effectiveness against A. fraterculus when coupled with a diet fortified with protein. Additionally, methoprene acts as a physiological sexing method, allowing the release of mature males and immature females and hence increasing SIT efficiency.

  18. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-06-01

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Description of the third-instar of Anastrepha leptozona Hendel (Diptera: Tephritidae).

    Science.gov (United States)

    Lasserre, Daniel Frías; Ortiz, Vicente Hernández; Muñoz, Liliana López

    2009-01-01

    The morphology of the third-instar larva of Anastrepha leptozona Hendel is characterized using optical and scanning electron microscopy. The antennomaxillary complex, oral ridges, labium, stomal sensory organ, cephalopharyngeal skeleton, anterior and posterior spiracles and caudal segment are described and illustrated. Mature larvae of A. leptozona present a 'ventral sclerite' below the pharyngeal sclerite which is characterized for the first time in Anastrepha species.

  20. Effect of the gene transformer of Anastrepha on the somatic sexual development of Drosophila.

    Science.gov (United States)

    Ruiz, María-Fernanda; Sánchez, Lucas

    2010-01-01

    The gene transformer (tra) is the key regulatory memory device for sex determination in tephritid insects. The present manuscript addressed the question about the functional conservation of the tephritid Anastrepha Transformer protein to direct somatic sexual development in Drosophila (Drosophilidae). The transformer cDNA of Anastrepha encoding the putative full-length Tra protein was cloned in pUAST and introduced into Drosophila melanogaster. To express this protein, the GAL4-UAS system was used. The Anastrepha Tra protein induced the female-specific splicing of both dsx and fru pre-mRNAs in Drosophila XY male flies, so that these became transformed into females, though this transformation was incomplete (the sexually dimorphic foreleg basitarsus and the external terminalia were monitored). It was found that the degree of female transformation directly depended on the dose of Anastrepha tra and Drosophila transformer-2 (tra-2) genes, and that the Anastrepha Tra-Drosophila Tra2 complex is not as efficient as the Drosophila Tra-Tra2 complex at inducing the female-specific splicing of Drosophila dsx pre-mRNA. This can explain why the Anastrepha Tra protein cannot fully substitute for the endogenous Drosophila Tra protein.

  1. Ocorrência do fungo entomopatogênico Isaria javanica (Frieder. & Bally Samson & Hywell-Jones (Fungi, Sordariomycetes em lagartas de Lonomia obliqua Walker (Lepidoptera, Saturniidae, Hemileucinae Occurrence of the entomopathogenic fungus Isaria javanica (Frieder. & Bally Samson & Hywell-Jones (Fungi, Sordariomycetes infecting Lonomia obliqua Walker (Lepidoptera, Saturniidae, Hemileucinae caterpillars

    Directory of Open Access Journals (Sweden)

    Alexandre Specht

    2009-01-01

    Full Text Available Este fungo foi isolado pela primeira vez de lagartas de L. obliqua de uma agregação em plátano (Platanus acerifolia (Aiton Wild - Platanaceae, em Bento Gonçalves, RS, Brasil. Após isolamento, purificação e caracterização, realizou-se um teste de patogenicidade com lagartas sadias de L. obliqua para corroborar, sua infectividade pelo postulado de Koch. Constatou-se correspondência morfológica e molecular entre o inóculo e o reisolado, comprovando sua patogenicidade a L. obliqua.It is recorded for the first time the occurrence of the entomopathogenic fungus Isaria javanica (Frieder. & Bally Samson & Hywell-Jones (Fungi: Sordariomycetes infecting Lonomia obliqua Walker (Lepidoptera: Saturniidae: Hemileucinae caterpillars. This fungus was isolated from L. obliqua individuals collected from Platanus acerifolia (Aiton Wild- Platanaceae in Rio Grande do Sul state, Brazil. After isolation, purification and characterization, fungal conidia were inoculated on healthy L. obliqua caterpillars and from dead caterpillars the fungal isolates were again obtained. New isolates and the original isolate did not differ when compared by morphological and molecular tests.

  2. Selection by mating competitiveness improves the performance of Anastrepha ludens males of the genetic sexing strain Tapachula-7.

    Science.gov (United States)

    Quintero-Fong, L; Toledo, J; Ruiz, L; Rendón, P; Orozco-Dávila, D; Cruz, L; Liedo, P

    2016-10-01

    The sexual performance of Anastrepha ludens males of the Tapachula-7 genetic sexing strain, produced via selection based on mating success, was compared with that of males produced without selection in competition with wild males. Mating competition, development time, survival, mass-rearing quality parameters and pheromone production were compared. The results showed that selection based on mating competitiveness significantly improved the sexual performance of offspring. Development time, survival of larvae, pupae and adults, and weights of larvae and pupae increased with each selection cycle. Differences in the relative quantity of the pheromone compounds (Z)-3-nonenol and anastrephin were observed when comparing the parental males with the F4 and wild males. The implications of this colony management method on the sterile insect technique are discussed.

  3. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  4. Primeiro relato de ocorrência de Anastrepha serpentina e Anastrepha leptozona (Dip.: Tephritidae em abiu (Pouteria caimito no Estado de São Paulo

    Directory of Open Access Journals (Sweden)

    Raga Adalton

    2003-01-01

    Full Text Available Foi registrada pela primeira vez a infestação das moscas-das-frutas Anastrepha serpentina (Wied. e Anastrepha leptozona Hendel (Dip.: Tephritidae em abiu Pouteria caimito (Sapotaceae no Estado de São Paulo. Os frutos coletados foram oriundos da Coleção de Fruteiras Nativas e Exóticas, localizada na sede do Pólo Regional de Desenvolvimento Tecnológico do Vale do Ribeira (SP, município de Pariquera-Açu. Também emergiram espécimens de Neosilba glaberrima (Wied. (Lonchaeidae.

  5. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M

    2015-12-01

    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  6. A transgenic embryonic sexing system for Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Schetelig, Marc F; Handler, Alfred M

    2012-10-01

    The Sterile Insect Technique (SIT) is a highly successful biologically-based strategy to control pest insect populations that relies on the large-scale release of sterilized males to render females in the field non-reproductive. For medfly, a mutant-based sexing system is available as well as a transgenic system where a tetracycline-suppressible (Tet-off) toxic molecule is female-specifically produced. However, the former classical genetic system took many years to refine, and the latter system results in female death by a poorly understood mechanism, primarily in the pupal stage after rearing costs have been incurred. Here we describe a Tet-off transgenic embryonic sexing system (TESS) for Anastrepha suspensa that uses a driver construct having the promoter from the embryo-specific A. suspensa serendipity α gene, linked to the Tet-transactivator. This was used to drive the expression of a phospho-mutated variant of the pro-apoptotic cell death gene, Alhid, from Anastrepha ludens. The system uses a sex-specific intron splicing cassette linked to a cell death gene lethal effector. Progeny from TESS strains heterozygous for the transgene combination were 80-100% males, whereas four double homozygous TESS strains had 100% male-only progeny, with female death limited primarily to embryogenesis. In a large-scale test, more than 30,000 eggs from two strains resulted in 100% male-only progeny. The transgenic sexing approach described here is highly effective and cost-efficient by eliminating most, if not all, female insects early in embryogenesis using a well-characterized apoptotic mechanism. Published by Elsevier Ltd.

  7. Redescription of three species of Anastrepha (Diptera, Tephritidae) rediscovered in Brazil, with the establishment of a new synonym.

    Science.gov (United States)

    Uramoto, Keiko; Zucchi, Roberto A; Norrbom, Allen L

    2015-01-20

    The descriptions of Anastrepha matertela Zucchi and A. tenella Zucchi were based exclusively on the holotypes (female). Based on additional specimens collected in Brazil since their original descriptions, both species are redescribed and illustrated. A lectotype is designated for Anastrepha bivittata (Macquart, 1843), which also is redescribed and considered to be the senior synonym of A. fumipennis Lima, 1934. 

  8. Sex chromosomes in mitotic and polytene tissues of Anastrepha fraterculus (Diptera, Tephritidae) from Argentina: a review.

    Science.gov (United States)

    Giardini, María Cecilia; Milla, Fabián H; Lanzavecchia, Silvia; Nieves, Mariela; Cladera, Jorge L

    2015-01-01

    Cytogenetics, which is considered a fundamental tool to understand basic genetic and genomic issues of species, has greatly contributed to the description of polymorphisms both at inter- and intra-specific level. In fact, cytogenetics was one of the first approaches used to propose Anastrepha fraterculus (Diptera: Tephritidae) as a complex of cryptic species. Different morphological variants of sex chromosomes have been reported among Argentinean populations of Anastrepha fraterculus. However, since this high structural variability in sex chromosomes does not pose a reproductive barrier, their role in speciation is yet to be unveiled. This review provides an update on general aspects of cytogenetics in Argentinean Anastrepha fraterculus populations, focused on the prevalence of X-Y arrangements.

  9. Mitotic and polytene chromosome analysis in the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Garcia-Martinez, V; Hernandez-Ortiz, E; Zepeta-Cisneros, C S; Robinson, A S; Zacharopoulou, A; Franz, G

    2009-01-01

    The present study constitutes the first attempt to construct a polytene chromosome map of an Anastrepha species, Anastrepha ludens (Loew), a major agricultural pest. The mitotic karyotype has a diploid complement of 12 acrocentric chromosomes, including five pairs of autosomes and an XX/XY sex chromosome pair. The analysis of salivary gland polytene chromosomes has shown a total number of five polytene elements that correspond to the five autosomes. The characteristic features and the most prominent landmarks of each chromosome are described. By comparing chromosome banding patterns, the possible chromosomal homology between A. ludens and Ceratitis capitata (Wiedemann) is presented. This work shows that polytene maps of A. ludens are suitable for cytogenetic studies in this species and may be used as reference for other Anastrepha species, most of which are also serious agricultural pests.

  10. Toxicity and bioefficacy of individual and combination of diversified insecticides against jute hairy caterpillar, Spilarctia obliqua.

    Science.gov (United States)

    Selvaraj, K; Ramesh, V; Gotyal, B S; Satpathy, S

    2015-11-01

    Toxicity of conventional (profenofos 50 EC and λ-cyhalothrin 5 EC) and non-conventional (flubendiamide 480 SC, chlorantraniliprole 18.5 SC, emamectin benzoate 5 SG) insecticides was determined on the basis of median lethal concentration (LC50) values on third instar larvae of jute hairy caterpillar, Spilarctia obliqua under laboratory conditions. Further, the promising binary insecticides combinations with lesser LC50 values and adequate synergistic activity were evaluated under field conditions. The LC50 values calculated for insecticides viz., chlorantraniliprole, flubendiamide emamectin benzoate, λ-cyhalothrin and profenophos were 0.212, 0.232, 0.511, 0.985 and 3.263 ppm, respectively. Likewise, the LC50 values for flubendiamide with λ-cyhalothrin in 3:1 proportion was most toxic (0.103 ppm) amongst all the other binary combinations with λ-cyhalothrin. Chlorantraniliprole in combination with λ-cyhalothrin at 1:1 proportion (0.209 ppm) was most toxic followed by 3:1 proportion (0.345 ppm). Similarly, emamectin benzoate in combination with λ-cyhalothrin at 1:1 proportion was more toxic (0.271 ppm) than 3:1 ratio (0.333 ppm). Toxicity index of flubendiamide + λ-cyhalothrin (3:1 ratio) was highest (970.87). Bioefficacy of synergistic binary combinations along with individual insecticides established the superiority of profenophos + λ-cyhalothrin (3:1) with 89.12% reduction in infestation and recorded maximum fibre yield 38.67qha' under field condition. Moreover, combination of diverse insecticides group might sustain toxicity against the target insect for longer period with least probability of resistance development.

  11. Morphological characterization of the reproductive system of irradiated Anastrepha fraterculus

    Energy Technology Data Exchange (ETDEWEB)

    Bartolucci, Andrea, E-mail: andreabartolucci@iscamen.com.a [Instituto de Sanidad y Calidad Agropecuaria de Mendoza (ISCAMEN), Mendoza (Argentina); Vera, M. Teresa [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), (Argentina); Yusef, Veronica [Comision Nacional de Energia Atomica (Argentina). Centro Atomico Ezeiza; Oviedo, Andrea [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Field identification of released sterile insects is a major issue for eradication and suppression programs. Irradiated flies are normally identified by the presence of a fluorescent dye. When a fly lacks fluorescent dye, determination of gonadal state is necessary to identified between sterile or fertile flies. This is particularly relevant when population levels have decreased. Animal and identification is required to be as unequivocal as possible. Here we describe the reproductive system of irradiated Anastrepha fraterculus of different ages and we compare it with that of fertile flies in order to provide a diagnosis tool. Fertile and irradiated A. fraterculus were dissected from the day of emergence and until 15 days of age. Gross morphology was described and the gonads were measured. Germ cells were visualized in the testis. The reproductive systems of both males and females contained the same structures as other Anastrepha species. From day 1 to day 3, there were no detectable differences between irradiated and fertile males. The growing region encompassed half the testis total length and there was no free sperm in the seminal vesicle. On day 4 the presence of free sperm was seen in the seminal vesicle. At this stage irradiated males started differentiating from fertile ones: the growing region reduced in size and totally disappeared by day 11; sperm bundle zones occupied most of the testis; spermatids lost their triangular shape and sperm remained in the seminal vesicle without moving into the apical region. Testis length and width of irradiated males did not differ from fertile males. In females, the maturation of the ovaries involved a change in size that was more pronounced in the length of the ovary. This became noticeable at day 3. At this stage, the formation of yolk and the basal follicle began in fertile females and the oocyte had the same size as the trophocytes. From this point, the oocyte started growing. After day 8, the maturing oocyte reached

  12. Host Plant Record for the Fruit Flies, Anastrepha fumipennis and A. nascimentoi (Diptera, Tephritidae)

    Science.gov (United States)

    Uramoto, Keiko; Martins, David S.; Lima, Rita C. A.; Zucchi, Roberto A.

    2008-01-01

    The first host plant record for Anastrepha fumipennis Lima (Diptera: Tephritidae) in Geissospermum laeve (Vell.) Baill (Apocynaceae) and for A. nascimentoi Zucchi found in Cathedra bahiensis Sleumer (Olacaceae) was determined in a host plant survey of fruit flies undertaken at the “Reserva Natural da Companhia Vale do Rio Doce”. This reserve is located in an Atlantic Rain Forest remnant area, in Linhares county, state of Espírito Santo, Brazil. The phylogenetic relationships of Anastrepha species and their hosts are discussed. The occurrence of these fruit fly species in relation to the distribution range of their host plants is also discussed. PMID:20302458

  13. Insect feeding deterrent and growth inhibitory activities of scopoletin isolated from Artemisia annua against Spilarctia obliqua (Lepidoptera: Noctuidae)

    Institute of Scientific and Technical Information of China (English)

    Arun Kumar Tripathi; Rajendra Singh Bhakuni; Shikha Upadhyay; Rashmi Gaur

    2011-01-01

    Artemisia annua (Asteraceae) is well known for its antimalarial activities due to presence of the compound artemisinin. We isolated a methoxy coumarin from the stem part of A. annua and confirmed its identity as scopoletin through mass spectral data.The structure was established from 1H-nuclear magnetic resonance (NMR), 13C-NMR.The compound scopoletin was evaluated for its feeding deterrence and growth inhibitory potential against a noxious lepidopteran insect, Spilartctia obliqua Walker. Scopoletin gave FD50 (feeding deterrence of 50%) value of 96.7 μg/g diet when mixed into artificial diet. S. obliqua larvae (12-day-old) exposed to the highest concentration (250 μg/g diet)of scopoletin showed 77.1% feeding-deterrence. In a growth inhibitory assay, scopoletin provided 116.9% growth inhibition at the highest dose of 250 μg/g diet with a GI50 (growth inhibition of 50%) value of 20.9μg/g diet. Statistical analysis showed a concentrationdependent dose response relationship toward both feeding deterrent and growth inhibitory activities. Artemisinin is found mainly in the leaves of A. annua and not in the stems,which are typically discarded as waste. Therefore identification of scopoletin in stems of A. annua may be important as a source of this material for pest control.

  14. Efficacy of commercial traps and food odor attractants for mass trapping of Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Lasa, Rodrigo; Velázquez, Olinda E; Ortega, Rafael; Acosta, Emilio

    2014-02-01

    One of the most important factors for the success of a mass trapping strategy to control a fruit fly involves the selection of an effective trap-lure combination. Because different species of fruit flies respond differently to the physical characteristics of a trap and to bait volatiles, the evaluation of commercial traps and lures that have proved useful against other tephtrids is necessary to determine their efficacy for mass trapping of Anastrepha ludens (Loew) (Diptera: Tephritidae). Under caged conditions, a commercial hemispherical trap with lateral holes (Maxitrap Plus) proved more attractive to A. ludens (both sexes) than five other commercial traps that were all baited with hydrolyzed protein. Among these traps, bottom invaginated traps and traps with invaginated lateral holes constructed with transparent cylinders had the best physical retention properties. When evaluated under field conditions, the lure was critical for the efficacy of the trap, and one of the traps that performed poorly in attraction and retention cage tests (MS2) resulted as one of the most effective traps when baited with CeraTrap lure. Considering the use of different trap models under field conditions, CeraTrap liquid bait was more effective in A. ludens capture than Biolure dry synthetic bait, but both lures were not replaced during the entire course of the experiment. The percentage of captured females was also slightly higher using CeraTrap lure (67.2%) than using Biolure baits (54.5-58.8%). In field tests, 75-81% of females were mated and no significant differences were observed among trap-lure combinations. Trap selectivity against nontarget adult lacewings also differed among trap-lure combinations.

  15. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia

    Science.gov (United States)

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), ...

  16. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae)

    Science.gov (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  17. Phylogeographic structure in Anastrepha ludens (Diptera: Tephritidae) populations inferred with mtDNA

    Science.gov (United States)

    Anastrepha ludens (Loew), the Mexican fruit fly, is a major pest of citrus and mango. It has a wide distribution in Mexico and Central America with infestations occurring in Texas, California and Florida with origins believed to be centered in northeastern Mexico. This research evaluates the utilit...

  18. First record of Anastrepha flavipennis Greene (Diptera: Tephritidae) and of its host in the Brazilian Amazon.

    Science.gov (United States)

    Corrêa, E C; Silva, N M; Silva, F C C; Pena, M R

    2011-01-01

    Anastrepha flavipennis Greene was obtained from Pouteria glomerata (Sapotaceae) fruits, known as "abiurana-da-várzea" in the Brazilian Amazon. This is the first record of A. flavipennis for the state of Amazonas and of P. glomerata as a host for this fruit fly in the Amazon Basin.

  19. Development of a larval diet for the South American fruit fly Anastrepha fraterculus (Diptera:Tephritidae)

    Science.gov (United States)

    Mass-rearing protocols must be developed. In particular, a cost-effective larval diet, to implement the sterile insect technique against Anastrepha fratercculus (Wiedemann). The key elements of this diet are the optimal nutrients and their concentrations, diet supports or bulking agents, and the pH ...

  20. First record of Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) in citrus in Brazil.

    Science.gov (United States)

    Lemos, W P; da Silva, R A; Araújo, S C A; Oliveira, E L A; da Silva, W R

    2011-01-01

    Anastrepha serpentina (Wiedemann) is recorded for the first time in citrus (Rutaceae) in Brazil. Specimens were obtained from sweet orange (Citrus sinensis) sampled in the municipalities of Belém and Capitão Poço, and from mandarin orange (Citrus reticulata) from Tomé-Açu, state of Pará, Brazil.

  1. A new species of Anastrepha (Diptera: Tephritidae) from Euphorbia tehuacana (Euphorbiaceae) in Mexico.

    Science.gov (United States)

    Norrbom, Allen L; Castillo-Meza, Ana Lucía; García-Chávez, Juan Héctor; Aluja, Martín; Rull, Juan

    2014-03-24

    Anastrepha tehuacana, a new species of Tephritidae (Diptera) from Tehuacán, Puebla, Mexico reared from seeds of Euphorbia tehuacana (Brandegee) V.W. Steinm. (Euphorbiaceae), is described and illustrated. Its probable relationship to A. relicta Hernández-Ortiz is discussed.

  2. Grape Juice as an Attractant for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae)

    Science.gov (United States)

    In field tests conducted in south Florida to test grape juice as an alternative inexpensive bait for Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps baited with aqueous grape juice. These experiments included comparisons of grape juice with standard A. susp...

  3. Rationale for a generic phytosanitary irradiation dose of 70 Gy for the genus Anastrepha (Diptera: Tephritidae)

    Science.gov (United States)

    The phytosanitary irradiation (PI) literature of the genus Anastrepha was analyzed to determine if it was sufficient to support a generic dose <150 Gy (the accepted generic dose for all of Tephritidae) that could be used on fruit in areas of the tropical and subtropical Americas where only species o...

  4. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  5. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  6. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  7. Himenópteros parasitóides de larvas de Anastrepha spp. em frutos de carambola (Averrhoa carambola L. na região de Divinópolis, Minas Gerais, Brasil Himenopterous parasitoids of Anastrepha spp. larvae, in star fruit (Averrhoa carambola L. In divinópolis region, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Cláudio Gonçalves Silva

    2003-12-01

    Full Text Available Este trabalho foi conduzido com o objetivo de conhecer os parasitóides de moscas-da-fruta na região de Divinópolis-MG. As pupas foram obtidas pelo método de flutuação, sendo individualizadas em cápsulas de gelatina até a emergência das moscas adultas ou de seus parasitóides. A prevalência total de parasitismo foi de 14,8%. Trichopria anastrepha foi a espécie mais comum, com 44,5%.The objective of this work was to identify the parasitoids of fruit flies in Divinópolis-MG region. The pupae were obtained by the flotation method. They were individually placed in gelatin capsules until the emergency of the adult flies or their parasitoids. The overall prevalence of parasitism was 14,8%. Trichopria anastrepha was the most common specie with a frequency of 44,5%.

  8. Bioprospecçao de toxinas presentes na hemolinfa e extrato de cerdas da lagarta Lonomia obliqua

    OpenAIRE

    Gouveia, Ana Isabel da Costa Bernuci

    2012-01-01

    Resumo: Estudando o extrato de cerdas da lagarta Lonomia obliqua, detectamos uma atividade lítica sobre moléculas de ácido hialurônico. O extrato de cerdas também foi capaz de degradar condroitim sulfato purificado, porém, incapaz de hidrolisar moléculas de heparam sulfato e dermatam sulfato. Além disso, por meio de ensaios de cinética de degradação de ácido hialurônico, observamos que esta atividade lítica é causada por uma enzima do tipo hidrolase e não do tipo liase. Baseando-se no método ...

  9. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  10. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  11. Effects of male nutrition on sperm storage and remating behavior in wild and laboratory Anastrepha fraterculus (Diptera: Tephritidae) females.

    Science.gov (United States)

    Abraham, Solana; Goane, Lucía; Cladera, Jorge; Vera, M Teresa

    2011-11-01

    Male physiological condition can affect his ability to modulate female sexual receptivity. Thus, studying this aspect can have biological and practical implications. Here, we examine how male nutritional status affected the amount of sperm stored, remating rate and refractory period of the tephritid fruit fly Anastrepha fraterculus (Wiedemann) females. Both wild and laboratory flies were evaluated. We also examine female sperm storage patterns. Experiments were carried out by manipulating male adult diet and exposing these males to virgin females. Females mated with differently treated males were either dissected to count the amount of sperm stored or exposed to virgin males to determine remating rate and the length of the refractory period. We found that male nutritional status affected the amount of the sperm stored and the renewal of sexual receptivity in wild flies. For laboratory flies, male nutritional status affected the length of the refractory period but not the amount of sperm stored by females. In addition, we report that the ventral receptacle is not an important organ of sperm storage in this species. We conclude that male nutritional condition influences the ability to modulate female sexual receptivity, possibly through a combination of the quantity and quality of the ejaculate. From an applied perspective, providing males with an enriched diet will likely result in increased efficacy of the sterile insect technique. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    Science.gov (United States)

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  13. Determination of the Host Status of the 'Persian' Lime (Citrus latifolia Tanaka) for Anastrepha ludens (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; López, Gladis; Díaz-Fleischer, Francisco

    2015-02-01

    Field and laboratory no-choice oviposition tests were performed to determine whether the 'Persian' lime (Citrus latifolia Tanaka) is a host of Anastrepha ludens Loew (Diptera: Tephritidae). Trapping and fruit sampling were performed to determine adult population densities and the level of infestation in the two lime orchards. Additionally, unharvested and harvested limes were exposed to sexually mature flies and the number of eggs laid and the immature developmental rates were determined. As a control, parthenocarpic 'Ataulfo' mangoes (Mangifera indica L.), a suitable host for A. ludens, were exposed to similar experimental procedures. The fecundity and fertility of adults obtained from limes and mangoes were compared. Our results demonstrate that A. ludens, under forced infestation conditions, oviposit on limes and also on control fruit. However, differences were detected in unharvested and harvested fruit, as unharvested limes were not infested. In the case of harvested fruit, the numbers of eggs laid and survival rates of immatures were significantly lower for 'Persian' limes compared with mangoes. Egg clutches were larger in limes than in mangoes, and most were deposited in the albedo rather than in the pulp. Moreover, oviposition rates were much higher in limes than in mangoes. Despite the fact that few of the immatures reached adulthood, the females obtained from limes were as fecund and fertile as those obtained from mangoes. Although adult A. ludens flies were captured in the two orchards, fruit sampling showed a complete absence of natural infestation among 'Persian' limes. We discuss the importance of our findings for determining the host status for 'Persian' limes. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Effect ofalpha-difluormethylornithine on Anastrepha fraterculus (Diptera, Tephritidae) ovary size.

    Science.gov (United States)

    Cardoso, V V; Moreira, J C F; Oliveira, A K

    2009-02-01

    Ovarian sizes (length and width) were measured in young females of Anastrepha fraterculus (Wiedemann) (Diptera, Tephritidae) subjected or not to the inhibitor alpha-difluormethylornithine (alpha-DFMO). The most effective concentration of alpha-DMFO used was 50 mM and the ovarian measurements (length and width) of the treated females were smaller than those of females not treated with alpha-DMFO. These data may suggest some relationship between ornithine decarboxylase (ODC) and sexual maturation in A. fraterculus.

  15. Morphometry and distribution of sensilla on the antennae of Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Bisotto-de-Oliveira, R; Redaelli, L R; Sant'ana, J

    2011-01-01

    Antennal sensilla of Anastrepha fraterculus (Wied.) were examined using scanning electron microscopy. In the flagellum, there are trichoid, basiconic, clavate type I and II, and styloconic sensilla and microtrichia. Only microtrichiae and chaetica sensilla were observed in the scape and pedicel. The number of sensilla in the flagellum was similar between sexes. At the apex there was a higher density of trichoid and an absence of clavate sensilla, while basiconic sensilla were more abundant in the proximal region.

  16. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    Kendra, Paul E; Epsky, Nancy D; Montgomery, Wayne S; Heath, Robert R

    2008-10-01

    A current trapping system for Anastrepha fruit flies uses a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane). Development of more effective monitoring programs may be realized through identification of additional attractant chemicals. This study examined response of the Caribbean fruit fly, Anastrepha suspensa (Loew), to putrescine and four homologous terminal diamines, differing only in carbon chain length. Using a fixed dose of each diamine substrate, electroantennogram (EAG) responses from mature females to putrescine and cadaverine (1,5-diaminopentane) were not significantly different from each other but were significantly greater than responses to longer chain diamines. Over a range of doses tested, mean female EAG response was greater than male response to both putrescine and cadaverine. In an initial field test, capture of female flies in traps baited with ammonium acetate and either putrescine or cadaverine was higher than in traps baited with ammonium acetate and any of the other diamines. In a subsequent field test, traps baited with putrescine, cadaverine, or 1,6-diaminohexane in combination with ammonium acetate captured more female flies than traps baited with ammonium acetate alone. A significantly greater synergistic effect on female captures was observed with either putrescine or cadaverine than with 1,6-diaminohexane. Thus, of the diamines evaluated, cadaverine elicited both antennal and behavioral responses comparable to that of putrescine and will be studied further as a potential attractant for pest Anastrepha species.

  17. Effect of constant temperatures on the biology, life table, and thermal requirements of Aganaspis pelleranoi (Hymenoptera: Figitidae), a parasitoid of Anastrepha fraterculus (Diptera: Tephritidae).

    Science.gov (United States)

    Gonçalves, R S; Nava, D E; Andreazza, F; Lisbôa, H; Nunes, A M; Grützmacher, A D; Valgas, R A; Maia, A H N; Pazianotto, R A A

    2014-04-01

    Aganaspis pelleranoi (Brèthes, 1924) (Hymenoptera: Figitidae) is a koinobiont endoparasitoid of larvae of species of the genus Anastrepha and of Ceratitis capitata. It is a candidate for use as a biological control agent, as under field conditions, it may reach a parasitism rate of 62%. The objective of this study was to determine the effect of different constant temperatures on biological parameters of A. pelleranoi when parasitizing the larva of Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae), as well as to determine its thermal requirements. The study was conducted in environmental chambers at 18, 20, 22, 25, 28, and 30 ± 1°C; 70 ± 10% relative humidity; and a 12-h photophase. Females maintained at 18 and 20°C produced more progeny than females at other temperatures tested. The longevity of males and females was inversely proportional to temperature, ranging from 49.1 to 3.73 d for females and from 32.1 to 3.8 d for males at temperatures of 18-30°C, respectively. The duration of the biological cycle (egg-to-adult) was influenced by temperature, and ranged from 69.1 d at 18°C to 30 d at 25°C. No preimaginal development of A. pelleranoi occurred at 28 and 30°C. The relationship between temperature and the demographic parameters of A. pelleranoi showed a linear effect over the temperature range of 18-25°C. The lower temperature threshold and thermal constant were 11.69°C and 391.70 degree days, respectively.

  18. First instar larvae morphology of Opiinae (Hymenoptera: Braconidae) parasitoids of Anastrepha (Diptera: Tephritidae) fruit flies. Implications for interspecific competition.

    Science.gov (United States)

    Murillo, Félix D; Liedo, Pablo; Nieto-López, María Guadalupe; Cabrera-Mireles, Héctor; Barrera, Juan F; Montoya, Pablo

    2016-05-01

    The morphology of the first instars of the Opiinae braconids Diachasmimorpha longicaudata, Doryctobracon areolatus, Doryctobracon crawfordi, Utetes anastrephae and Opius hirtus (the first is exotic, and the others are natives to Mexico), parasitoids of Anastrepha fruit flies, are described and compared. The possible implications on interspecific competition among these species are discussed. The most significant adaptations found were: (1) the mouth apparatus, where the large mandibles and fang-shaped maxillary lobes present in D. longicaudata and U. anastrephae larvae were absent in O. hirtus, D. areolatus and D. crawfordi larvae, and (2) the degree of mobility for exploration and escape, such as the lateral and caudal appendages that were only present in D. longicaudata (ventrolateral appendages in the base of the head capsule), U. anastrephae (caudal lobe with two appendages) and D. areolatus (caudal lobe with a round apex with a globular shape). The first instar larvae of the species D. longicaudata show morphological adaptations that apparently confer competitive advantages against the larvae of D. areolatus, D. crawfordi and O. hirtus. However, the first instar larvae of U. anastrephae show larger mandibles, an adaptation that could enable this species to resist competition from D. longicaudata. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  20. Effects of gamma radiation on the sterility and behavioral quality of the caribbean fruit fly, Anastrepha suspensa (Loew (Diptera:Tephritidae Efeitos da radiação gama na esterilização e comportamento da mosca-do-caribe, Anastrepha suspensa (Low (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    J.M.M. Walder

    1993-09-01

    Full Text Available Pupae of Anastrepha suspensa (Loew were irradiated 2 days before adult eclosión in an air atmosphere with 15, 20, 25, 30, 50 and 70 Gy of gamma radiation (Co-60. The radiation effects on sterility and other parameters of quality and behavior of males and females of caribfly were established. Males became fully sterile with a dose of 50 Gy and females laid no eggs when exposed to 25 Gy. Radiation had no significant effect on adult eclosion, sex ratio, flight ability and irritability, but female mortality was affected significantly by radiation, showing higher survival rates in low dosage treatments. The mating behavior of the males was reduced significantly by increasing the radiation doses.Pupas de Anastrepha suspensa (Loew foram irradiadas dois dias antes da emergência dos adultos em atmosfera de ar com as doses de 15, 20, 25, 30, 50 e 70 Gy de radiação gama (Co-60. Foram avaliados os efeitos da radiação sobre a esterilidade e outros parâmetros de qualidade e comportamento de machos e fêmeas de mosca-do-caribe. Machos tornaram-se totalmente estéreis com uma dose de 50 Gy e as fêmeas não ovipositaram quando expostas a 25 Gy. A radiação não teve efeito significativo sobre a taxa de emergência de adultos, na razão sexual, na habilidade de vôo e na irritabilidade desses insetos. Somente a mortalidade das fêmeas foi afetada significativamente pela radiação, causando unia maior sobrevivência nas dosagens mais baixas. A atividade de acasalamento dos machos foi reduzida significativamente com o incremento da dosagem de radiação.

  1. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape.

    Science.gov (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D

    2016-08-01

    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  2. Development of Anastrepha fraterculus (Diptera: Tephritidae) Related to the Phenology of Blueberry, Blackberry, Strawberry Guava, and Surinam Cherry Fruits.

    Science.gov (United States)

    Bisognin, M; Nava, D E; Diez-Rodríguez, G I; Valgas, R A; Garcia, M S; Krolow, A C R; Antunes, L E C

    2015-02-01

    Anastrepha fraterculus (Wiedemann, 1830) is the main pest of temperate climate orcharding. The study investigated the development of A. fraterculus related to phenological stage of blueberry, blackberry, strawberry guava, and Surinam cherry trees. The phenological stages I (green fruits), II (intermediate ripening stage of fruits), and III (fruits close to harvesting) were determined, and they are from 8th, 10th, and 11th week; 6th, 8th, and 9th week; 8th, 13th, and 16th week; and 5th, 6th, and 7th week after the first flowering of blueberry, blackberry, strawberry guava, and Surinam cherry trees, respectively. We collected fruits from orchards to determine the infestation index using the formula: number of pupa/fruit weight. To investigate the development of A. fraterculus, we determined the following biological parameters: egg-to-adult period, weight of pupae, oviposition period, fecundity, number of pupae, and number of infested fruits. The infestation index for the fruits collected in the field was greater in strawberry guava and Surinam cherry fruits. In the laboratory, the development of A. fraterculus occurred in stage III of blueberry. In blackberry, besides stage III, we also observed the development in stage II, however, at lower infestation. In strawberry guava, the development of A. fraterulus occurred in stages II and III, and the development in both stages was similar. For Surinam cherry, the development occurred in the three phenological stages with similar values for biological parameters. Overall, of the four hosts studied, the strawberry guava and Surinam cherry fruits allowed a better biological development of A. fraterculus, corroborating its preference for fruits native to Brazil. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. INSETICIDAS VEGETAIS NO CONTROLE DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE GOIABA

    Directory of Open Access Journals (Sweden)

    Francisco Roberto Azevedo

    2013-09-01

    Full Text Available Objetivando avaliar os efeitos de inseticidas vegetais sobre Anastrepha spp. em pomar de goiaba, realizaram-se pesquisas em Barbalha, de 6 de maio a 24 de junho de 2011, testando Pironat®, Rotenat® e Natuneem®. Para avaliar o efeito sobre adultos, instalaram-se 20 armadilhas McPhail iscadas com proteína hidrolisada de milho a 5%, quantificando-se o número de insetos capturados. Na avaliação do efeito sobre larvas, colheram-se ao acaso 100 frutos maduros, verificando-se a presença de larvas vivas e mortas. Foram feitas três aplicações em ambos os experimentos com o auxílio de um atomizador costal motorizado, sendo as avaliações realizadas semanalmente. O extrato pirolenhoso do Pironat® repele satisfatoriamente adultos de Anastrepha spp., enquanto que a azadiractina presente no Natuneem® promove efeito inseticida sobre as larvas nas condições de campo, sendo estes produtos mais eficazes para o controle da praga a partir da segunda aplicação. Embora estes produtos vegetais não cheguem a causar 100% de controle, eles podem ser utilizados em programas de Manejo Agroecológico de Anastrepha spp. em pomares de goiaba, pois além de baratos, são de fácil aplicação e não provocam impacto ambiental em termos de risco de resíduos tóxicos nos frutos. Use este espaço para escrever o resumo.

  4. First Record of Calliephialtes sittenfeldae Associated with the Tephritid Fruit Fly Anastrepha spatulata in Mexico

    Science.gov (United States)

    López-Ortega, Maurilio; Khalaim, Andrey I.

    2012-01-01

    This paper reports for the first time an ichneumonid parasitoid Calliephialtes sittenfeldae Gauld Ugalde-Gómez et Hanson (Hymenoptera: Ichneumonidae) associated with a dipteran host Anastrepha spatulata Stone (Diptera: Tephritidae), recovered from fruit of Schoepfia schreberi (Santalales: Olacaceae) in central Veracruz, Mexico. Large numbers of this parasitoid were collected and reared from its fruit fly host in three localities of Veracruz, Mexico. Some observations of its biology are also reported. This is a first record of C. sittenfeldae from Mexico, and the first record of this parasitoid species, its insect host, and the host plant. The male of this species is described and illustrated for the first time. PMID:22970708

  5. Evidence for positive selection in the gene fruitless in Anastrepha fruit flies

    Science.gov (United States)

    2010-01-01

    Background Many genes involved in the sex determining cascade have indicated signals of positive selection and rapid evolution across different species. Even though fruitless is an important gene involved mostly in several aspects of male courtship behavior, the few studies so far have explained its high rates of evolution by relaxed selective constraints. This would indicate that a large portion of this gene has evolved neutrally, contrary to what has been observed for other genes in the sex cascade. Results Here we test whether the fruitless gene has evolved neutrally or under positive selection in species of Anastrepha (Tephritidae: Diptera) using two different approaches, a long-term evolutionary analysis and a populational genetic data analysis. The first analysis was performed by using sequences of three species of Anastrepha and sequences from several species of Drosophila using the ratio of nonsynonymous to synonymous rates of evolution in PAML, which revealed that the fru region here studied has evolved by positive selection. Using Bayes Empirical Bayes we estimated that 16 sites located in the connecting region of the fruitless gene were evolving under positive selection. We also investigated for signs of this positive selection using populational data from 50 specimens from three species of Anastrepha from different localities in Brazil. The use of standard tests of selection and a new test that compares patterns of differential survival between synonymous and nonsynonymous in evolutionary time also provide evidence of positive selection across species and of a selective sweep for one of the species investigated. Conclusions Our data indicate that the high diversification of fru connecting region in Anastrepha flies is due at least in part to positive selection, not merely as a consequence of relaxed selective constraint. These conclusions are based not only on the comparison of distantly related taxa that show long-term divergence time, but also on

  6. Evidence for positive selection in the gene fruitless in Anastrepha fruit flies

    Directory of Open Access Journals (Sweden)

    de Brito Reinaldo A

    2010-09-01

    Full Text Available Abstract Background Many genes involved in the sex determining cascade have indicated signals of positive selection and rapid evolution across different species. Even though fruitless is an important gene involved mostly in several aspects of male courtship behavior, the few studies so far have explained its high rates of evolution by relaxed selective constraints. This would indicate that a large portion of this gene has evolved neutrally, contrary to what has been observed for other genes in the sex cascade. Results Here we test whether the fruitless gene has evolved neutrally or under positive selection in species of Anastrepha (Tephritidae: Diptera using two different approaches, a long-term evolutionary analysis and a populational genetic data analysis. The first analysis was performed by using sequences of three species of Anastrepha and sequences from several species of Drosophila using the ratio of nonsynonymous to synonymous rates of evolution in PAML, which revealed that the fru region here studied has evolved by positive selection. Using Bayes Empirical Bayes we estimated that 16 sites located in the connecting region of the fruitless gene were evolving under positive selection. We also investigated for signs of this positive selection using populational data from 50 specimens from three species of Anastrepha from different localities in Brazil. The use of standard tests of selection and a new test that compares patterns of differential survival between synonymous and nonsynonymous in evolutionary time also provide evidence of positive selection across species and of a selective sweep for one of the species investigated. Conclusions Our data indicate that the high diversification of fru connecting region in Anastrepha flies is due at least in part to positive selection, not merely as a consequence of relaxed selective constraint. These conclusions are based not only on the comparison of distantly related taxa that show long

  7. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  8. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the

  9. Studies on chemical constituents of Fuscoporia obliqua%桦褐孔菌化学成分的研究

    Institute of Scientific and Technical Information of China (English)

    何坚; 冯孝章

    2001-01-01

    Object A systematic study on the chemical constituents ofFuscoporia oblique Fr. Te. LáT was carried out. Methods The constituents were isolated on silica gel column chromatography, identified by physico-chemical properties and structurally elucidated by spectral analysis (MS, 1H,13CNMR and IR). Results 9 compounds were identified, namely fuscoporine (Ⅰ), lanosterol (Ⅱ), 3β-hydroxy-lanosta-8, 24-diene-21-al (Ⅲ), 3β, 21-dihydroxy-lanosta-8, 24-diene (Ⅳ), 3β-hydroxy-lanosta-8, 24-diene-21-acid (Ⅴ), 3β, 22R-dihydroxy-lanosta-8, 24-diene (Ⅵ), ergosterol peroxide (Ⅶ), analog of sphingin (Ⅷ) and mannitol(Ⅸ). Conclusion Compound I is a new pigment and named as fuscoporine.%目的 对桦褐孔菌Fuscoporia obliquaFr.Te.LáT的化学成分进行系统研究。方法 采用硅胶柱层析进行分离,通过理化常数测定和波谱(MS、1H,13CNMR、IR)技术进行结构鉴定。结果 分析鉴定了9个化合物,它们分别为:桦褐孔菌素(fuscoporine,Ⅰ)、lanosterol(Ⅱ)、3β-hydroxy-lanosta-8,24-diene-21-al(Ⅲ)、3β,21-dihydroxy-lanosta-8,24-diene(Ⅳ)、3β-hydroxy-lanosta-8,24-diene-21-acid(Ⅴ)、3β,22R-dihydroxy-lanosta-8,24-diene(Ⅵ)、ergosterolperoxide(Ⅶ)、analogofsphingin(Ⅷ)和mannitol(Ⅸ)。结论 化合物Ⅰ为一新化合物,命名为桦褐孔菌素。

  10. Male sexual behavior and pheromone emission is enhanced by exposure to guava fruit volatiles in Anastrepha fraterculus

    Science.gov (United States)

    Host plant chemicals can influence sex pheromone communication of tephritid fruit flies, and affect strategies optimizing mating and reproduction. Previous studies suggest that females of the South American fruit fly, Anastrepha fraterculus, prefer to mate with laboratory males previously exposed to...

  11. Electroantennogram response and attraction of Anastrepha suspensa to volatiles of various sugar sources and aged sugar solutions

    Science.gov (United States)

    With the aim of finding new, sugar-based volatile attractants for economically important tephritid fruit fly species, we used electroantennography (EAG) to quantify olfactory responses of female Caribbean fruit fly, Anastrepha suspensa (Loew), to volatiles of six different sugars (refined white and ...

  12. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  13. Incipient speciation revealed in Anastrepha fraterculus (Diptera; Tephritidae) by studies on mating compatibility, sex pheromones, hybridisation and cytology

    Science.gov (United States)

    It is suggested that the nominal species Anastrepha fraterculus is a species complex and previous studies showed high levels of pre-zygotic isolation between two laboratory strains from Argentina and Peru. To further analyze this observation, experiments were carried out on the same populations and...

  14. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures.

    Science.gov (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R

    2009-08-01

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  15. Wolbachia strains in cryptic species of the Anastrepha fraterculus complex (Diptera, Tephritidae) along the Neotropical Region.

    Science.gov (United States)

    Prezotto, Leandro F; Perondini, André L P; Hernández-Ortiz, Vicente; Marino, Celso L; Selivon, Denise

    2017-01-01

    Infection by Wolbachia was described previously in eleven species of Anastrepha fruit flies some of which are important pests of fruticulture. One such species is the nominal Anastrepha fraterculus, the South American fruit fly, which actually comprises a complex of cryptic species. The suggestions of using Wolbachia for the control of these pest species, make imperative a more precise characterization of the existing strains of the bacteria. In this study, population samples of the A. fraterculus complex from Brazil, Argentina, Peru, Ecuador, Colombia, Guatemala and Mexico were analyzed for Wolbachia infection. The bacteria were genotyped by the MLST and WSP Typing methodologies. All samples were infected with Wolbachia of supergroup "A". For each of the five MLST genes, unique as well as already known alleles were detected. Nineteen sequence types for the concatenated sequences of the five MLST genes, and twenty wsp alleles were found in the samples. Host-specific haplotypes, shared strains among distinct hosts, and more than one strain of Wolbachia were found in some population samples. Recombination among the MLST genes and intragenic recombination between wsp haplotypes was rare. Phylogenetic analysis showed a great similarity among the Wolbachia strains in the A. fraterculus complex. However, some strains of Wolbachia are found throughout the Neotropical Region and there are specific strains in determined geographical areas. Copyright © 2016 Elsevier GmbH. All rights reserved.

  16. A morphometric and molecular study of Anastrepha pickeli Lima (Diptera: Tephritidae).

    Science.gov (United States)

    Bomfim, Z V; Lima, K M; Silva, J G; Costa, M A; Zucchi, Robert A

    2011-10-01

    This study investigated the level of morphometric and genetic variability among populations of Anastrepha pickeli Lima from several localities in Brazil, one locality in Bolivia and one in Paraguay. Traditional and geometric morphometric analyses were used, as well as sequencing of a fragment of the cytochrome oxidase gene (COI). Six variables were measured from the aculeus for traditional morphometric analysis and 14 landmarks from the right wing were used for geometric analysis, using 10 specimes/population. The aculeus tip length, aculeus width at the end of the cloaca opening, and the serrate part length contributed with 62.7% for grouping. According to the results from traditional morphometry, there was no significant difference, but the multivariate tests showed that the canonical variables were statistically significant, indicating a difference in the wing conformation among populations. Molecular phylogenetic analysis indicated that the populations clustered into three clades and revealed a high level of genetic variation within A. pickeli populations from various geographic regions. Anastrepha pickeli populations differed among them according to the methods used in this study, showing incongruence among the methods used.

  17. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  18. Flutuação populacional de Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae na Região Oeste de Santa Catarina, Brasil Population fluctuation of Anastrepha fraterculus (Wiedemann, 1830 (Diptera, Tephritidae in the Western Region of Santa Catarina State, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2003-01-01

    Full Text Available Fruit flies are the major pests in fruit orchards and require a frequent insecticide aplication control, which increases production cost and chemical residues in fruits. Adults of Anastrepha fraterculus were sampled from twelve peach, plum, orange, tangerine and acid lime orchards in four counties in the Western Region of Santa Catarina. Modified McPhail plastic traps, baited with glucose 10%, were used to collect the flies from October 1998 to September 2000. Trap monitoring, bait replacement and fruit flies sorting by species and sex were done weekly. A total of 4,164 specimens of A. fraterculus was collected and highest population was registered in the county of Chapecó (64,8% of all sampled flies. Adults were collected all year long, with the highest population peaks occurring from December and January, although the fluctuation was different for each fruit species due to their particular phenology and in different years. Positive correlation among temperature, atmospheric humidity and population levels of adults of A. fraterculus was observed. According to the degree days obtained for each year, 4851.9, 4632.9 and 4983.7, respectively in 1998, 1999 and 2000, it was established that A. fraterculus could present an average of 11.2 generations a year.

  19. Distribución natural de Nothofagus alpina y Nothofagus obliqua (nothofagaceae en Argentina, dos especies de primera importancia forestal de los bosques templados norpatagónicos Natural distribution of Nothofagus alpina and Nothofagus obliqua (Nothofagaceae in Argentina, two productively important tree species of the North Patagonian temperate forests

    Directory of Open Access Journals (Sweden)

    Yamila Sabatier

    2011-06-01

    Full Text Available Conocer la distribución natural de cualquier especie es esencial para poder planificar su conservación o uso. El Raulí [Nothofagus alpina (Poepp. & Endl. Oerst. = Nothofagus nervosa (Phil. Dim. et Mil.] y el Roble Pellín [Nothofagus obliqua (Mirb. Oerst. ssp. obliqua] son dos especies forestales de primera importancia en los bosques norpatagónicos, y objetos de un programa de domesticación en curso. En base al cruce de capas de información digital de estudios previos verificada por informantes locales calificados, por controles de campo y por interpretación sobre pantalla de imágenes provistas libremente por Google Earth, se mapeó la distribución natural de ambas especies en Argentina. La presencia del Raulí se registra sobre una superficie de 79.636 ha, mientras que sobre 33.859 ha se desarrollan bosques con presencia de Roble Pellín. La mayor parte de estas superficies se encuentran protegidas por el sistema de Parques Nacionales (97 % del área ocupada con Raulí y 83 % de la ocupada con Roble Pellín, sin embargo varios bosques relevantes para la conservación se hallan bajo jurisdicción de la Provincia de Neuquén, lo cual debería ser considerado al momento de planear una estrategia de conservación para ambas especies.Knowing the natural range of any species is essential to plan its conservation or use. The South-American beeches Raulí [Nothofagus alpina (Poepp. & Endl. Oerst. = Nothofagus nervosa (Phil. Dim. et Mil.] and Roble Pellín [Nothofagus obliqua (Mirb. Oerst. ssp. obliqua] are two important forest tree species of the North Patagonian forests, and the object of a current domestication program. Natural distribution of both beeches in Argentina was mapped based on digital information of previous works which was verified by local qualified informants, ground control check and visual interpretation of images freely provided by Google Earth. Raulí is present over a surface of 79,636 ha, while 33,859 ha are occupied by

  20. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel

    2015-08-01

    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  1. Comparison of Anastrepha ludens (Diptera: Tephritidae) Bisexual and Genetic Sexing (Tapachula-7) Strains: Effect of Hypoxia, Fly Density, Chilling Period, and Food Type on Fly Quality.

    Science.gov (United States)

    Arredondo, José; Ruiz, Lía; Hernández, Emilio; Montoya, Pablo; Díaz-Fleischer, Francisco

    2016-04-01

    The use of genetic sexing strain (GSS) insects in the sterile insect technique (SIT) makes necessary the revision of quality parameters of some stressful steps used during the packing process for aerial release because of possible differences in tolerance between fly strains. Here, we determined the effect of three periods of hypoxia (12, 24, and 36 h at pupal stage), three cage densities (1.0, 1.3, and 1.5 flies/cm2), two different foods (protein/sugar (1/24) and Mubarqui), and three chilling times (20 min [control], 90, and 180 min) on the quality parameters of flies of two Anastrepha ludens (Loew) strains (bisexual and GSS Tapachula-7). In general, the response to stressful conditions of both fly strains was qualitatively equivalent but quantitatively different, as flies of both strains responded equally to the stressful factors; however, flies of Tapachula-7 exhibited lower quality parameters than the control flies. Thus, hypoxia affected the flying ability but not the emergence or longevity of flies. The food type affected the adult weight; protein/sugar produced heavier flies that also survived longer and had a greater mating propensity. Flies under the lowest density were better fliers that those at the other two densities. Increasing chilling time reduced flight ability but not longevity or mating propensity. The implications of these findings for the use of A. ludens GSS in SIT programs are discussed herein.

  2. Effects of bait age and prior protein feeding on cumulative time-dependent mortality of Anastrepha ludens (Diptera: Tephritidae) exposed to GF-120 spinosad baits.

    Science.gov (United States)

    Mangan, Robert L

    2009-06-01

    A fruit fly bait to attract and kill adult fruit flies, GF-120, was tested in cages to determine effects of pretreatment diet and bait aging before use on cumulative mortality rates of Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae). Protein-starved and protein-fed, 9-d-old flies both experienced varying overall cumulative mortality at 4, 8, 24, and 48 h. Pretreatment diet had no significant effect on mortality. Overall mortality rates were below 10% for 4 h, 39-43% at 8 h, but mortality in all treatments increased to 89-93% by 24 h, and 99% by 48 h. In a second experiment, GF-120 baits were either freshly prepared or aged for 24 h. Subtreatments consisted of protein-fed and protein-starved flies. The 24-h-aged bait killed significantly more flies at 4 and 8 h than the freshly prepared bait. Protein-starved flies had significantly higher mortality at 4 h and marginally higher mortality at 8 h than protein-fed flies. At 24 and 48 h, there were no significant differences among treatments, and overall morality rose to 99-100% by 48 h. These results may explain differences noted in previous publications in which fruit fly mortality to GF-120 was reported as unusually low as well as reports of bait ineffectiveness for protein-fed flies. The overall impact of any initial repellency of GF-120 seems negligible as judged by overall cumulative mortality at later evaluation times.

  3. Volatile substances from male Anastrepha fraterculus wied. (Diptera: Tephritidae: identification and behavioural activity

    Directory of Open Access Journals (Sweden)

    Lima Ivanildo S.

    2001-01-01

    Full Text Available Volatile compounds produced by calling males of Anastrepha species have previously been reported from A. ludens and A. suspensa. Both species mate in the afternoon, release a similar range of compounds in different proportions, and only differ in the production of monoterpenes. When calling, male A. fraterculus releases two isomers of the sesquiterpene alpha-farnesene, three lactones (anastrephin, epianastrephin and (E,E-suspensolide, and two monoterpenes (limonene and (Z-beta-ocimene. The dimorphic male salivary glands produce and/or store the same isomers of alpha-farnesene and suspensolide, and four pyrazines. Two of these compounds have been previously reported from male A. ludens and A. suspensa. Salivary glands from virgin calling male A. fraterculus showed behavioural activity when bioassayed with virgin mature female flies, but immature females were not attracted.

  4. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  5. Relevant genetic differentiation among Brazilian populations of Anastrepha fraterculus (Diptera, Tephritidae)

    Science.gov (United States)

    Manni, Mosè; Lima, Kátia Manuela; Guglielmino, Carmela Rosalba; Lanzavecchia, Silvia Beatriz; Juri, Marianela; Vera, Teresa; Cladera, Jorge; Scolari, Francesca; Gomulski, Ludvik; Bonizzoni, Mariangela; Gasperi, Giuliano; Silva, Janisete Gomes; Malacrida, Anna Rodolfa

    2015-01-01

    Abstract We used a population genetic approach to detect the presence of genetic diversity among six populations of Anastrepha fraterculus across Brazil. To this aim, we used Simple Sequence Repeat (SSR) markers, which may capture the presence of differentiative processes across the genome in distinct populations. Spatial analyses of molecular variance were used to identify groups of populations that are both genetically and geographically homogeneous while also being maximally differentiated from each other. The spatial analysis of genetic diversity indicates that the levels of diversity among the six populations vary significantly on an eco-geographical basis. Particularly, altitude seems to represent a differentiating adaptation, as the main genetic differentiation is detected between the two populations present at higher altitudes and the other four populations at sea level. The data, together with the outcomes from different cluster analyses, identify a genetic diversity pattern that overlaps with the distribution of the known morphotypes in the Brazilian area. PMID:26798258

  6. Copulatory behaviour and the process of intromission in Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Briceño, R D; Orozco, Dina; Luis Quintero, J; Hanson, Paul; del Refugio Hernández, Ma

    2011-03-01

    Complex genitalia occur in many arthropods and in some species extreme female morphologies lead to serious mechanical difficulties for males. Tephritid flies offer examples of such complex genitalia. Because of their economic importance and the extensive use of sterile male releases for tephritid control in Texas and Mexico, studies have been done on various aspects of their basic reproductive biology, but the process of intromission has received little attention. The distiphallus of the male of Anastrepha ludens is complex. One membranous sac on the distiphallus is capable of rhythmic cycles of inflation and deflation. Inflations of the sac near the base of the distiphallus probably help propel the aedeagus deeper into the female along with stiffening of the basiphallus and may drive the genital rod (which does not transfer sperm) into the ventral receptacle. We were unable to establish an association between some of the behaviours displayed by males during mating and intromission process.

  7. Update of host plant list of Anastrepha fraterculus and Ceratitis capitata in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Orono, Luis E.; Albornoz-Medina, Patricia; Nunez-Campero, Segundo; Nieuwenhove, Guido A. van; Bezdjian, Laura P.; Martin, Cristina B.; Schliserman, Pablo; Ovruski, Sergio M. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    The study displays a complete picture of the host range of the two economically important fruit fly species in Argentina, the native Anastrepha fraterculus (Wiedemann) (South American Fruit Fly) and the exotic Ceratitis capitata (Wiedemann) (Mediterranean Fruit Fly or Medfly). This work provides information on the fruit type of each plant species, associated tephritid species, habitat where the fruit was collected, geographical location of each fruit collection area (latitude, longitude, and altitude), phyto geographic regions where each area is located, as well as a general description of the landscape characteristics of those habitats where the fruit samples with fly larvae were collected. A complete, detailed bibliographic review was made in order to provide all the relevant information needed for host use in natural setting. (author)

  8. Positive and purifying selection influence the evolution of doublesex in the Anastrepha fraterculus species group.

    Directory of Open Access Journals (Sweden)

    Iderval S Sobrinho

    Full Text Available The gene doublesex (dsx is considered to be under strong selective constraint along its evolutionary history because of its central role in somatic sex differentiation in insects. However, previous studies of dsx used global estimates of evolutionary rates to investigate its molecular evolution, which potentially miss signals of adaptive changes in generally conserved genes. In this work, we investigated the molecular evolution of dsx in the Anastrepha fraterculus species group (Diptera, Tephritidae, and test the hypothesis that this gene evolved solely by purifying selection using divergence-based and population-based methods. In the first approach, we compared sequences from Anastrepha and other Tephritidae with other Muscomorpha species, analyzed variation in nonsynonymous to synonymous rate ratios (dN/dS in the Tephritidae, and investigated radical and conservative changes in amino acid physicochemical properties. We show a general selective constraint on dsx, but with signs of positive selection mainly in the common region. Such changes were localized in alpha-helices previously reported to be involved in dimer formation in the OD2 domain and near the C-terminal of the OD1 domain. In the population-based approach, we amplified a region of 540 bp that spanned almost all of the region common to both sexes from 32 different sites in Brazil. We investigated patterns of selection using neutrality tests based on the frequency spectrum and locations of synonymous and nonsynonymous mutations in a haplotype network. As in the divergence-based approach, these analyses showed that dsx has evolved under an overall selective constraint, but with some events of positive selection. In contrast to previous studies, our analyses indicate that even though dsx has indeed evolved as a conserved gene, the common region of dsx has also experienced bouts of positive selection, perhaps driven by sexual selection, during its evolution.

  9. Positive and Purifying Selection Influence the Evolution of Doublesex in the Anastrepha fraterculus Species Group

    Science.gov (United States)

    Sobrinho, Iderval S.; de Brito, Reinaldo A.

    2012-01-01

    The gene doublesex (dsx) is considered to be under strong selective constraint along its evolutionary history because of its central role in somatic sex differentiation in insects. However, previous studies of dsx used global estimates of evolutionary rates to investigate its molecular evolution, which potentially miss signals of adaptive changes in generally conserved genes. In this work, we investigated the molecular evolution of dsx in the Anastrepha fraterculus species group (Diptera, Tephritidae), and test the hypothesis that this gene evolved solely by purifying selection using divergence-based and population-based methods. In the first approach, we compared sequences from Anastrepha and other Tephritidae with other Muscomorpha species, analyzed variation in nonsynonymous to synonymous rate ratios (dN/dS) in the Tephritidae, and investigated radical and conservative changes in amino acid physicochemical properties. We show a general selective constraint on dsx, but with signs of positive selection mainly in the common region. Such changes were localized in alpha-helices previously reported to be involved in dimer formation in the OD2 domain and near the C-terminal of the OD1 domain. In the population-based approach, we amplified a region of 540 bp that spanned almost all of the region common to both sexes from 32 different sites in Brazil. We investigated patterns of selection using neutrality tests based on the frequency spectrum and locations of synonymous and nonsynonymous mutations in a haplotype network. As in the divergence-based approach, these analyses showed that dsx has evolved under an overall selective constraint, but with some events of positive selection. In contrast to previous studies, our analyses indicate that even though dsx has indeed evolved as a conserved gene, the common region of dsx has also experienced bouts of positive selection, perhaps driven by sexual selection, during its evolution. PMID:22428050

  10. The Gene Transformer of Anastrepha Fruit Flies (Diptera, Tephritidae) and Its Evolution in Insects

    Science.gov (United States)

    Salvemini, Marco; Eirín-López, José María; Perondini, André L. P.; Selivon, Denise; Polito, Catello; Saccone, Giuseppe; Sánchez, Lucas

    2007-01-01

    In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA), and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA). Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality. PMID:18043746

  11. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  12. Identification and Comparative Study of Chemosensory Genes Related to Host Selection by Legs Transcriptome Analysis in the Tea Geometrid Ectropis obliqua.

    Directory of Open Access Journals (Sweden)

    Long Ma

    Full Text Available Host selection by female moths is fundamental to the survival of their larvae. Detecting and perceiving the non-volatile chemicals of the plant surface involved in gustatory detection determine the host preference. In many lepidopteran species, tarsal chemosensilla are sensitive to non-volatile chemicals and responsible for taste detection. The tea geometrid Ectropis obliqua is one devastating chewing pest selectively feeding on limited plants, requiring the specialized sensors to forage certain host for oviposition. In present study, we revealed the distribution of chemosensilla in the ventral side of female fifth tarsomere in E. obliqua. To investigate its molecular mechanism of gustatory perception, we performed HiSeq 2500 sequencing of the male- and female- legs transcriptome and identified 24 candidate odorant binding proteins (OBPs, 21 chemosensory proteins (CSPs, 2 sensory neuron membrane proteins (SNMPs, 3 gustatory receptors (GRs and 4 odorant receptors (ORs. Several leg-specific or enriched chemosensory genes were screened by tissue expression analysis, and clustered with functionally validated genes from other moths, suggesting the potential involvement in taste sensation or other physiological processes. The RPKM value analysis revealed that 9 EoblOBPs showed sex discrepancy in the leg expression, 8 being up-regulated in female and only 1 being over expressed in male. These female-biased EoblOBPs indicated an ecological adaption related with host-seeking and oviposition behaviors. Our work will provide basic knowledge for further studies on the molecular mechanism of gustatory perception, and enlighten a host-selection-based control strategy of insect pests.

  13. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  14. Taxonomy and phenotypic relationships of the Anastrepha fraterculus complex in the Mesoamerican and Pacific Neotropical dominions (Diptera, Tephritidae).

    Science.gov (United States)

    Hernández-Ortiz, Vicente; Canal, Nelson A; Salas, Juan O Tigrero; Ruíz-Hurtado, Freddy M; Dzul-Cauich, José F

    2015-01-01

    Previous morphometric studies based on linear measurements of female structures of the aculeus, mesonotum, and wing revealed the existence of seven morphotypes within the Anastrepha fraterculus cryptic species complex along the Neotropical Region. The current research followed linear and geometric morphometric approaches in 40 population samples of the nominal species Anastrepha fraterculus (Wiedemann) spread throughout the Meso-American and Pacific Neotropical dominions (including Mexico, Central America, Venezuela, Colombia, Ecuador, and Peru). The goals were to explore the phenotypic relationships of the morphotypes in these biogeographical areas; evaluate the reliability of procedures used for delimitation of morphotypes; and describe their current distribution. Findings determined that morphotypes previously recognized via the linear morphometrics were also supported by geometric morphometrics of the wing shape. In addition, we found an eighth morphotype inhabiting the highlands of Ecuador and Peru. Morphotypes are related into three natural phenotypic groups nominated as Mesoamerican-Caribbean lineage, Andean lineage, and Brazilian lineage. The hypothesis that lineages are not directly related to each other is discussed, supported by their large morphological divergence and endemicity in these three well-defined biogeographic areas. In addition, this hypothesis of the non-monophyly of the Anastrepha fraterculus complex is also supported by evidence from other authors based on molecular studies and the strong reproductive isolation between morphs from different lineages.

  15. Morphometric study of third-instar larvae from five morphotypes of the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae).

    Science.gov (United States)

    Canal, Nelson A; Hernández-Ortiz, Vicente; Salas, Juan O Tigrero; Selivon, Denise

    2015-01-01

    The occurrence of cryptic species among economically important fruit flies strongly affects the development of management tactics for these pests. Tools for studying cryptic species not only facilitate evolutionary and systematic studies, but they also provide support for fruit fly management and quarantine activities. Previous studies have shown that the South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species, but few studies have been performed on the morphology of its immature stages. An analysis of mandible shape and linear morphometric variability was applied to third-instar larvae of five morphotypes of the Anastrepha fraterculus complex: Mexican, Andean, Ecuadorian, Peruvian and Brazilian-1. Outline geometric morphometry was used to study the mouth hook shape and linear morphometry analysis was performed using 24 linear measurements of the body, cephalopharyngeal skeleton, mouth hook and hypopharyngeal sclerite. Different morphotypes were grouped accurately using canonical discriminant analyses of both the geometric and linear morphometry. The shape of the mandible differed among the morphotypes, and the anterior spiracle length, number of tubules of the anterior spiracle, length and height of the mouth hook and length of the cephalopharyngeal skeleton were the most significant variables in the linear morphometric analysis. Third-instar larvae provide useful characters for studies of cryptic species in the Anastrepha fraterculus complex.

  16. Evaluación de la intensidad del daño por Anastrepha fraterculus Wiedemann (Díptera: Tephritidae en 53 variedades de mango Mangifera indica L. y aspectos biológicos generales del insecto

    Directory of Open Access Journals (Sweden)

    Zapata O. Mario de J.

    1986-06-01

    Full Text Available To evaluate the damage intensity for Anastrepha fraterculus, in 53 varieties of mango at the basic orchard of the ICA-Palmira, there was no evident relationship between the epicarp texture an the infestation degreen. The fragrance, taste and soluble solids are characteristies more associated with a high or low degree of infestation. The following varieties are suggested as promissory: Froilan, Rosa, Pig-693, Mariquiteño, Kola Alphonse, Lorito , Spring Field. The incubation period of the pest in laboratory, lasted three days, the larval stage 17.66 days, pupal stage 17.80 days, and 7.78 days was the life of the adult. The relation of ocurrence of males and females was of 0.75: 1.00. The insects pretes shing days for copulation and egg laying.Al evaluar intensidad del daño de Anastrepha fraterculus en 53 variedades de mango del huerto básico del ICA Palmira, no se encontró relación aparente entre la textura de epicarpio y el grado de infestación. El aroma, sabor y sólidos solubles se asocian más con el grado de infestación se sugirieron como promisorias las variedades: Froilan, Rosa, Pig-693, Mariquiteño, Kola Alphonse, Lorito y Spring Field. El período de incubación de la plaga en el laboratorio tardó tres días, el estado larval 17.66, el pupal 17.80 y 7.78 días duró la longevidad del adulto. La relación de macho y hembra fue 0.75: 1.00, la mosca prefiere copular y ovipositar en días de alto brillo solar.

  17. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain

  18. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato

    2015-10-01

    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  19. Male sexual enhancement after methoprene treatment in Anastrepha fraterculus (Diptera: Tephritidae): A sustained response that does not fade away after sexual maturation.

    Science.gov (United States)

    Bachmann, G E; Devescovi, F; Nussenbaum, A L; Cladera, J L; Fernández, P C; Vera, M T; Teal, P E A; Segura, D F

    2017-08-01

    The juvenile hormone (JH) of insects triggers physiological changes related to reproduction in adults of both sexes. Methoprene is a sesquiterpene with some effects that are analogous to those of JH. Treatments with methoprene accelerate sexual maturation in males of the South American fruit fly Anastrepha fraterculus, giving young males a mating advantage over non-treated males of the same age. Here, we evaluated the effects of methoprene treatment on A. fraterculus males after the sexual maturation phase and tested whether this compound provides a long-term mating advantage. Moreover, we took the first step to unravel the mechanisms that underlie male sexual enhancement. We treated males 1day or 8days after adult emergence and compared mate choice between recently matured (young) females and females that had been mature for ca. 10days (aged females). We also addressed methoprene treatment effects on male sexual signalling. We found that methoprene treatment enhanced male sexual competitiveness even after the sexual maturation phase, and the effect did not decrease until males were older than 20days. However, when methoprene treatment was carried out close to sexual maturity, the mating enhancement was no longer observed, suggesting a non-immediate effect and excluding the possibility that methoprene acts as a pheromonal compound. Young and aged females tended to mate more frequently with treated-males. This might indicate that in a context of sexual selection, the potential benefits associated with reproductive success would be similar for females of both ages. Treated males released larger amounts of pheromonal compounds than non-treated males, but their courtship behaviour was not altered to the same extent, suggesting that methoprene treatment may accelerate differently the components of male courtship. We discuss potential benefits of using methoprene to increase the efficiency of the sterile insect technique, which is an environmentally safe method to

  20. Sterility and Sexual Competitiveness of Tapachula-7 Anastrepha ludens Males Irradiated at Different Doses.

    Science.gov (United States)

    Orozco-Dávila, Dina; Adriano-Anaya, Maria de Lourdes; Quintero-Fong, Luis; Salvador-Figueroa, Miguel

    2015-01-01

    A genetic sexing strain of Anastrepha ludens (Loew), Tapachula-7, was developed by the Mexican Program Against Fruit Flies to produce and release only males in programs where the sterile insect technique (SIT) is applied. Currently, breeding are found at a massive scale, and it is necessary to determine the optimum irradiation dose that releases sterile males with minimum damage to their sexual competitiveness. Under laboratory and field conditions, we evaluated the effects of gamma irradiation at doses of 0, 20, 40, 60 and 80 Gy on the sexual competitiveness of males, the induction of sterility in wild females and offspring survivorship. The results of the study indicate that irradiation doses have a significant effect on the sexual behavior of males. A reduction of mating capacity was inversely proportional to the irradiation dose of males. It is estimated that a dose of 60 Gy can induce more than 99% sterility in wild females. In all treatments, the degree of offspring fertility was correlated with the irradiation dose of the parents. In conclusion, the results of the study indicate that a dose of 60 Gy can be applied in sterile insect technique release programs. The application of this dose in the new genetic sexing strain of A. ludens is discussed.

  1. Phylogeographic Structure in Anastrepha ludens (Diptera: Tephritidae) Populations Inferred With mtDNA Sequencing.

    Science.gov (United States)

    Ruiz-Arce, Raul; Owen, Christopher L; Thomas, Donald B; Barr, Norman B; McPheron, Bruce A

    2015-06-01

    Anastrepha ludens (Loew) (Diptera: Tephritidae), the Mexican fruit fly, is a major pest of citrus and mango. It has a wide distribution in Mexico and Central America, with infestations occurring in Texas, California, and Florida with origins believed to have been centered in northeastern Mexico. This research evaluates the utility of a sequence-based approach for two mitochondrial (COI and ND6) gene regions. We use these markers to examine genetic diversity, estimate population structure, and identify diagnostic information for A. ludens populations. We analyzed 543 individuals from 67 geographic collections and found one predominant haplotype occurring in the majority of specimens. We observed 68 haplotypes in all and see differences among haplotypes belonging to northern and southern collections. Mexico haplotypes differ by few bases possibly as a result of a recent bottleneck event. In contrast to the hypothesis suggesting northeastern Mexico as the origin of this species, we see that specimens from two southern collections show high genetic variability delineating three mitochondrial groups. These data suggest that Central America is the origin for A. ludens. We show that COI and ND6 are useful for phylogeographic studies of A. ludens. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  2. Insect thermotolerance comparing host infestation methods: Anastrepha ludens (Diptera: Tephritidae) reared in grapefruit or diet.

    Science.gov (United States)

    Hallman, Guy J

    2014-08-01

    Research on insect control should be conducted in a manner that mimics as closely as is feasible its commercial application in all of its practicably conceivable forms. When significant deviations from commercial application are used in research, the effect of the deviations on efficacy should be evaluated. Pest control techniques are sometimes based on research that used untested assumptions about variables that might affect efficacy. For example, some phytosanitary treatments are based on research done with diet-reared larvae inserted into holes bored in fruits, although the effect of this manipulation has not been evaluated. This research compares this type of infestation of grapefruit with Mexican fruit fly, Anastrepha ludens (Loew), third instars with a more natural infestation technique whereby females were allowed to oviposit on picked grapefruit in laboratory cages and third instars were reared inside the fruit. Although the results did not show statistically significant differences between infestation techniques, tendencies in the data caution against researchers making assumptions about efficacy without testing them when experimental techniques stray from more natural situations for which the research is designed.

  3. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L

    2015-08-01

    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  4. Genetic variation of Anastrepha suspensa (Diptera: Tephritidae) in Florida and the Caribbean using microsatellite DNA markers.

    Science.gov (United States)

    Boykin, Laura M; Shatters, Robert G; Hall, David G; Dean, David; Beerli, Peter

    2010-12-01

    Anastrepha suspensa (Loew) (Diptera: Tephritidae), the Caribbean fruit fly, is indigenous to Florida and the Greater Antilles where it causes economic losses in fruit crops, including citrus. Because of the geographic separation of many of its native locations and anecdotal descriptions of regional differences in host preferences, there have been questions about the population structure of A. suspensa. Seven DNA microsatellite markers were used to characterize the population genetic structure of A. suspensa, in Florida and the Caribbean from a variety of hosts, including citrus. We genotyped 729 A. suspensa individuals from Florida, Puerto Rico, Cayman Island, Dominican Republic, and Jamaica. The investigated seven loci displayed from 5 to 19 alleles, with expected heterozygosities ranging from 0.05 to 0.83. There were five unique alleles in Florida and three unique alleles in the Caribbean samples; however, no microsatellite alleles were specific to a single host plant. Genetic diversity was analyzed using F(ST) and analysis of molecular variance and revealed low genetic diversity between Florida and Caribbean samples and also between citrus and noncitrus samples. Analyses using migrate revealed there is continuous gene flow between sampling sites in Florida and the Caribbean and among different hosts. These results support previous comparisons based on the mitochondrial cytochrome oxidase I locus indicating there is no genetic differentiation among locations in Florida and the Caribbean and that there is no separation into host races.

  5. A novel attractant for Anastrepha ludens (Diptera: Tephritidae) from a Concord grape product.

    Science.gov (United States)

    Robacker, David C; Massa, Michelle J; Sacchetti, Patrizia; Bartelt, Robert J

    2011-08-01

    An attractant for Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), was developed from a commercial product called Sabor Uva containing processed Concord grape juice. The principal volatile components of Sabor Uva aroma were identified and an aqueous mixture of 15 components that was gas chromatographically similar to Sabor Uva was prepared. This mixture was equivalent to Sabor Uva in attractiveness by using wind-tunnel bioassays. After deleting chemicals that did not contribute to attractiveness, and increasing the concentrations of the remaining chemicals, the final attractant contained propylene glycol (90,000 ppm, vol/vol), acetic acid (4500), methyl anthranilate (1800), ethyl 2-methylpropionate (670), and one or both of the esters ethyl 3-methylbutyrate (44) and 2-methylbutyl propionate (44), in aqueous solution. This mixture was approximately 1.8X as attractive as Sabor Uva by indirect comparison. Deletion of propylene glycol, acetic acid, methyl anthranilate, or ethyl 2-methylpropionate from the mixture significantly decreased attractiveness. Deletion of either of the other two esters seemed to diminish attractiveness although effects were not statistically significant. Deletion of water from the mixture significantly decreased attractiveness. We conclude that propylene glycol, acetic acid, methyl anthranilate, water, and at least one or as many as all three of the methyl-branched esters are essential for complete attractiveness.

  6. Predation of Anastrepha ludens (Diptera: Tephritidae) by Norops serranoi (Reptilia: Polychrotidae): functional response and evasion ability.

    Science.gov (United States)

    Dor, Ariane; Valle-Mora, Javier; Rodríguez-Rodríguez, Susana Eva; Liedo, Pablo

    2014-06-01

    The Mexican fruit fly, Anastrepha ludens (Loew), is one of the 10 worldwide more important fruit crop pests. Orchards of southeastern Chiapas also shelter the tree-dwelling lizard Norops serranoi (Köhler), which likely prey upon these flies. In standard laboratory conditions, we determined the functional response of four male and four female lizards on mass-reared fruit flies. We used a general logistic analysis of proportion of killed prey versus available prey to determine the shape of the functional response. Male lizards showed a type II functional response, while females showed a type III functional response. For the highest fruit fly densities, female lizards caught significantly more fruit flies than males did. The predator evasion ability and the survival of mass-reared and wild fruit flies were compared. Wild fruit flies evaded more male lizard attacks than mass-reared flies. However, when female lizards attacked, there was no significant difference between strains. Fruit flies survival was higher with male than with female lizards, but it did not depend on fruit fly strains. This is the first report of a vertebrate preying on the Mexican fruit fly, demonstrating that female lizards impose a higher predation pressure and are more efficient at capturing wild fruit flies than males. We discuss the implications of our results on mass-rearing and quality control of sterile flies.

  7. An EST database of the Caribbean fruit fly, Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Nirmala, Xavier; Schetelig, Marc F; Yu, Fahong; Handler, Alfred M

    2013-04-01

    Invasive tephritid fruit flies are a great threat to agriculture worldwide and warrant serious pest control measures. Molecular strategies that promote embryonic lethality in these agricultural pests are limited by the small amount of nucleotide sequence data available for tephritids. To increase the dataset for sequence mining, we generated an EST database by 454 sequencing of the caribfly, Anastrepha suspensa, a model tephritid pest. This database yielded 95,803 assembled sequences with 24% identified as independent transcripts. The percentage of caribfly sequences with hits to the closely related tephritid, Rhagoletis pomonella, transcriptome was higher (28%) than to Drosophila proteins/genes (18%) in NCBI. The database contained genes specifically expressed in embryos, genes involved in the cell death, sex-determination, and RNAi pathways, and transposable elements and microsatellites. This study significantly expands the nucleotide data available for caribflies and will be a valuable resource for gene isolation and genomic studies in tephritid insects. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Dynamics of genetic variability in Anastrepha fraterculus (Diptera: Tephritidae) during adaptation to laboratory rearing conditions.

    Science.gov (United States)

    Parreño, María A; Scannapieco, Alejandra C; Remis, María I; Juri, Marianela; Vera, María T; Segura, Diego F; Cladera, Jorge L; Lanzavecchia, Silvia B

    2014-01-01

    Anastrepha fraterculus is one of the most important fruit fly plagues in the American continent and only chemical control is applied in the field to diminish its population densities. A better understanding of the genetic variability during the introduction and adaptation of wild A. fraterculus populations to laboratory conditions is required for the development of stable and vigorous experimental colonies and mass-reared strains in support of successful Sterile Insect Technique (SIT) efforts. The present study aims to analyze the dynamics of changes in genetic variability during the first six generations under artificial rearing conditions in two populations: a) a wild population recently introduced to laboratory culture, named TW and, b) a long-established control line, named CL. Results showed a declining tendency of genetic variability in TW. In CL, the relatively high values of genetic variability appear to be maintained across generations and could denote an intrinsic capacity to avoid the loss of genetic diversity in time. The impact of evolutionary forces on this species during the adaptation process as well as the best approach to choose strategies to introduce experimental and mass-reared A. fraterculus strains for SIT programs are discussed.

  9. Olfactory response of Anastrepha striata (Diptera: Tephritidae) to guava and sweet orange volatiles.

    Science.gov (United States)

    Diaz-Santiz, Edvin; Rojas, Julio C; Cruz-López, Leopoldo; Hernández, Emilio; Malo, Edi A

    2016-10-01

    The behavioral responses of virgin and mated female Anastrepha striata Schiner (Diptera: Tephritidae) to guava (Psidium guajava L.) or sweet orange (Citrus sinensis L.) were evaluated separately using multilure traps in two-choice tests in field cages. The results showed that flies were more attracted to guava and sweet orange volatiles than to control (unbaited trap). The physiological state (virgin or mated) of females did not affect their attraction to the fruit volatiles. Combined analysis of gas chromatography coupled with electroantennography (GC-EAD) of volatile extracts of both fruits showed that 1 and 6 compounds from orange and guava, respectively elicited repeatable antennal responses from mated females. The EAD active compounds in guava volatile extracts were identified by gas chromatography-mass spectrometry (GC-MS) as ethyl butyrate, (Z)-3-hexenol, hexanol, ethyl hexanoate, hexyl acetate, and ethyl octanoate. Linalool was identified as the only antennal active compound in sweet orange extracts. In field cage tests, there were no significant differences between the number of mated flies captured by the traps baited with guava extracts and the number caught by traps baited with the 6-component blend that was formulated according to the relative proportions in the guava extracts. Similar results occurred when synthetic linalool was evaluated against orange extracts. From a practical point of view, the compounds identified in this study could be used for monitoring A. striata populations. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  10. Estimation of populations and sterility induction in Anastrepha luden (Diptera: Tephritidae) fruit flies.

    Science.gov (United States)

    Flores, Salvador; Montoya, Pablo; Toledo, Jorge; Enkerlin, Walther; Liedo, Pablo

    2014-08-01

    The relationship between different release densities of sterile flies and fly trap captures, expressed as flies per trap per day, in the monitoring of Anastrepha ludens (Loew) populations was evaluated in mango orchards. The induction of sterility in fertile females was evaluated using different ratios of sterile: fertile males under field cage conditions. A direct relationship between recaptured flies and densities of release sterile flies was found. However, trap efficiency, expressed as percentage of recaptured flies, decreased as the density of released flies increased. Sterility induction was positively correlated to the ratio of sterile: fertile flies. A significant difference in egg fertility among treatments was observed. The trajectory of sterility induction slowed down after a sterile: wild ratio of 30:1, which suggests that this ratio could be appropriate in an sterile insect technique program with A. ludens. Sterility induction was greater when only sterile males were released than when releasing both sterile males and females, but the differences were not significant. Our findings contribute to a better interpretation of fly captures obtained from the field trapping networks, and to an improvement in the efficiency of sterile insect technique against A. ludens fruit flies, through the implementation of more rational sterile fly release densities.

  11. Female receptivity in Anastrepha ludens (Diptera: Tephritidae) is not modulated by male accessory gland products.

    Science.gov (United States)

    Abraham, Solana; Nuñez-Beverido, Nicolás; Contreras-Navarro, Yair; Pérez-Staples, Diana

    2014-11-01

    In numerous insects, accessory gland products (AGPs) transferred from males to females during mating are responsible for female sexual inhibition, but these products can be affected by male condition. Here, we investigated the effect of AGPs on female receptivity of the Mexican fruit fly Anastrepha ludens (Loew), and the effect of male and female strain, male irradiation, AGP dose and sexual activity period on the effectiveness of these AGPs in inhibiting female remating. Injections of aqueous extracts of male accessory glands into the abdomen of females did not reduce their receptivity either at 0.2 or 0.8 male equivalent. Females injected with AGPs behaved like virgin females and not as mated females. Neither male origin, female origin (wild versus mass-reared), nor male irradiation (sterile versus fertile males) had an effect in inhibiting female remating. Also, injections of glands obtained during the sexual calling period of males, or obtained during the morning when males are not sexually active had no effect on female remating behavior. Mated mass-reared females were more likely to remate than wild females. We conclude that inhibition of female sexual receptivity of A. ludens is mediated by factors other than AGPs, such as the number of sperm stored by females, the stimulus of copulation per se or more probably, mediated by a combination of factors. More research is needed to elucidate the role of AGPs in this species. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Effect of host plant chemistry on genetic differentiation and reduction of gene flow among Anastrepha fraterculus (Diptera: Tephritidae) populations exploiting sympatric, synchronic hosts.

    Science.gov (United States)

    Oroño, Luis; Paulin, Laura; Alberti, Andrea C; Hilal, Mirna; Ovruski, Sergio; Vilardi, Juan C; Rull, Juan; Aluja, Martin

    2013-08-01

    Herbivore host specialization includes changes in behavior, driven by locally induced adaptations to specific plants. These adaptations often result in sexual isolation that can be gauged through detection of reduced gene flow between host associated populations. Hypothetically, reduced gene flow can be mediated both by differential response to specific plant kairomones and by the influence of larval diet on some adult traits such as pheromone composition. These hypotheses could serve as a model to explain rapid radiation of phytophagous tephritid fruit flies, a group that includes several complexes of cryptic species. The South American Fruit Fly Anastrepha fraterculus (Wiedemann) is a complex of at least seven cryptic species among which pheromone mediated sexual isolation resulted in rapid differentiation. Cryptic species also exhibit differences in host affiliation. In search of a model explaining rapid radiation in this group, we studied host plant chemical composition and genetic structure of three host associated sympatric populations of A. fraterculus. Chemical composition among host plant fruit varied widely both for nutrient and potentially toxic secondary metabolite content. Adaptation to plant chemistry appears to have produced population differentiation. We found host mediated differentiation to be stronger between populations exploiting sympatric synchronic hosts differing in chemical composition, than between populations that exploit hosts that fruit in succession. Gene flow among such host associated populations was extremely low. We propose as a working hypothesis for future research, that for those differences to persist over time, isolating mechanisms such as male produced sex pheromones and female preferences resulting from adaptation to different larval diets should evolve.

  13. Contribución al Estudio de las Moscas Anastrephas en Colombia.

    Directory of Open Access Journals (Sweden)

    González Mendoza Rafael

    1952-11-01

    Full Text Available 1. Colombia tiene amplias posibilidades de desarrollar una industria frutícola floreciente dadas las excepcionales condiciones de ubicación geográfica, diversidad de climas y de suelos. 2. La deficiente producción frutera actual es el resultado de una reunión de factores adversos, entre los que resalta el desconocimiento de los problemas científicos que afectan a dicha industria. En este aspecto, los problemas fitosanitarios, abandonados y faltos de investigación, ocupan lugar preponderante. 3. Las moscas Anastrephas constituyen la plaga más importante de la fruticultura nacional, y por esta razón, un estudio sobre estos insectos es un tema de importancia. 4. Las principales "moscas de las frutas" pertenecen dentro de la familia Trypetidae, a los géneros: Dacus, Rhaglethis, Ceratitis, Dactrocera y Anastrepha. 5. Los nombres comunes con que se conocen las moscas Anastrephas varían de un país a otro y se relacionan particularmente con el lugar de origen de las distintas especies o la fruta determinada como preterida por la mosca en una localidad. En Colombia la denominación vernácula más difundida es la de "gusano de las frutas". También se nombra el insecto como "mosca o gusano del mango" o "gusano de la guayaba". 6. Los nombres científicos de las moscas distinguen a una, gran cantidad de especies. En Colombia, varios autores han reportado la existencia de las especies A.fraterculus, A. ludens, A. mombinpracoptans, A. pikeli y A. serpentina. Todas estas especies inciden en las regiones colombianas comprendidas entre 0 y 2000 metros de altura, es decir, en casi todas las regiones agrícolas importantes (frutales, café, cacao de temperaturas entre 14° y 30° C. 7. Las moscas Anastrephas están confinadas casi exclusivamente al continente americano entre las latitudes 27° N. y 35° S. Particularmente, la especie A. fraterculus, una de las más difundidas en Colombia, fué determinada por Wiedemann (1830

  14. 茶尺蠖和灰茶尺蠖内共生菌Wolbachia的分子检测及序列分析%Molecular detection and sequence analysis of Wolbachia strains in Ectropis obliqua and Ectropis grisescens (Lepidoptera:Geometridae)

    Institute of Scientific and Technical Information of China (English)

    周孝贵; 付建玉; 刘守安; 毛腾飞; 肖强; 陈学新

    2016-01-01

    【目的】对茶尺蠖Ectropis obliqua及其近缘种灰茶尺蠖E. grisescens体内共生菌Wolbachia进行分子鉴定,确定两者体内Wolbachia的感染率及其进化地位,为进一步探讨其对茶尺蠖和灰茶尺蠖的潜在影响提供科学依据。【方法】采用Wolbachia的16S rRNA、ftsZ和wsp基因特异性引物,通过PCR扩增法检测了我国3个茶尺蠖地理种群(浙江杭州、余杭和江苏无锡)和3个灰茶尺蠖地理种群(浙江新昌、湖北浠水和江西南昌)中Wolbachia的感染情况,并进行测序和序列分析。【结果】茶尺蠖和灰茶尺蠖都感染了Wolbachia,灰茶尺蠖的Wolbachia感染率为100%,但茶尺蠖的Wolbachia感染率在22%~95%,且PCR产物电泳得到的条带微弱。wsp序列在茶尺蠖和灰茶尺蠖种间、种内无差异;但16S rRNA序列在茶尺蠖和灰茶尺蠖种间、种内差异为0.362%~0.727%之间;茶尺蠖样本未成功扩增出ftsZ序列,灰茶尺蠖样本获得2条ftsZ基因序列差异为1.647%。基于Wolbachia的16S rRNA和wsp基因构建的系统发育树表明,本研究中茶尺蠖和灰茶尺蠖种群所感染的Wolbachia全部属于B组的Pip亚组。【结论】茶尺蠖和灰茶尺蠖均被B组Pip亚组的Wolbachia感染,但感染率相差很大,这为研究Wolbachia对茶尺蠖和灰茶尺蠖生物学及生态学的影响奠定了基础。%[Objectives] The infection rates and taxonomic relationships between Wolbachia strains in the sister species Ectropis obliqua and E. grisescens (Lepidoptera: Geometridae) were identified by molecular methods in order to reveal the potential effects of this endosymbiont on these species. [Methods] Wolbachia infection in three populations of E. obliqua (Hangzhou and Yuhang, Zhejiang province; Wuxi, Jiangsu Province) and three populations of E. grisescens (Xinchang, Zhejiang Province; Xishui, Hubei Province; and Nanchang, Jiangxi Province) were detected using PCR with three specific

  15. Examination of the ligand-binding and enzymatic properties of a bilin-binding protein from the poisonous caterpillar Lonomia obliqua.

    Directory of Open Access Journals (Sweden)

    Ana B G Veiga

    Full Text Available The bilin-binding proteins (BBP from lepidopteran insects are members of the lipocalin family of proteins and play a special role in pigmentation through the binding of biliverdin IXγ. Lopap, a BBP-like protein from the venom of the toxic caterpillar Lonomia obliqua has been reported to act as a serine protease that activates the coagulation proenzyme prothrombin. Here we show that BBPLo, a variant of lopap from the same organism binds biliverdin IXγ, forming a complex that is spectrally identical with previously described BBP proteins. Although BBPLo is nearly identical in sequence to lopap, no prothrombinase activity was detected in our recombinant preparations using reconstituted systems containing coagulation factors Xa and Va, as well as anionic phospholipids. In addition to biliverdin, BBPLo was found to form a 1:1 complex with heme prompting us to examine whether the unusual biliverdin IXγ ligand of BBPs forms as a result of oxidation of bound heme in situ rather than by a conventional heme oxygenase. Using ascorbate or a NADPH(+-ferredoxin reductase-ferredoxin system as a source of reducing equivalents, spectral changes are seen that suggest an initial reduction of heme to the Fe(II state and formation of an oxyferrous complex. The complex then disappears and a product identified as a 5-coordinate carbonyl complex of verdoheme, an intermediate in the biosynthesis of biliverdin, is formed. However, further reaction to form biliverdin was not observed, making it unlikely that biliverdin IXγ is formed by this pathway.

  16. Examination of the ligand-binding and enzymatic properties of a bilin-binding protein from the poisonous caterpillar Lonomia obliqua.

    Science.gov (United States)

    Veiga, Ana B G; Ribeiro, José M C; Francischetti, Ivo M B; Xu, Xueqing; Guimarães, Jorge A; Andersen, John F

    2014-01-01

    The bilin-binding proteins (BBP) from lepidopteran insects are members of the lipocalin family of proteins and play a special role in pigmentation through the binding of biliverdin IXγ. Lopap, a BBP-like protein from the venom of the toxic caterpillar Lonomia obliqua has been reported to act as a serine protease that activates the coagulation proenzyme prothrombin. Here we show that BBPLo, a variant of lopap from the same organism binds biliverdin IXγ, forming a complex that is spectrally identical with previously described BBP proteins. Although BBPLo is nearly identical in sequence to lopap, no prothrombinase activity was detected in our recombinant preparations using reconstituted systems containing coagulation factors Xa and Va, as well as anionic phospholipids. In addition to biliverdin, BBPLo was found to form a 1:1 complex with heme prompting us to examine whether the unusual biliverdin IXγ ligand of BBPs forms as a result of oxidation of bound heme in situ rather than by a conventional heme oxygenase. Using ascorbate or a NADPH(+)-ferredoxin reductase-ferredoxin system as a source of reducing equivalents, spectral changes are seen that suggest an initial reduction of heme to the Fe(II) state and formation of an oxyferrous complex. The complex then disappears and a product identified as a 5-coordinate carbonyl complex of verdoheme, an intermediate in the biosynthesis of biliverdin, is formed. However, further reaction to form biliverdin was not observed, making it unlikely that biliverdin IXγ is formed by this pathway.

  17. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  18. Response of Anastrepha suspensa (Diptera: Tepritidae) to white and brown cane, coconut, date, date jaggery and panela sugar solutions with varying degrees of fermentation

    Science.gov (United States)

    We measured the EAG response of Anastrepha suspensa (Loew), the Caribbean fruit fly to six different sugars (white and brown cane, coconut, date, date jaggery and panela sugars). Wild and lab female flies of different physiological states (immature and mature) were tested in dry crystals and 10% su...

  19. Mixture-amount design and response surface modeling to assess the effects of flavonoids and phenolic acids on developmental performance of Anastrepha ludens

    Science.gov (United States)

    A mixture-amount experimental design and response surface modeling were used to study the effects of three flavonoids and two phenolic acids, alone or in mixtures, in an artificial larval diet on the development and survival of Mexican fruit fly (Anastrepha ludens [Loew]). Pupal weight, percentage o...

  20. Evaluación de la intensidad del daño por Anastrepha fraterculus Wiedemann (Díptera: Tephritidae) en 53 variedades de mango Mangifera indica L. y aspectos biológicos generales del insecto

    National Research Council Canada - National Science Library

    Zapata O. Mario de J; Alomía de Gutierrez Bertha

    1986-01-01

    To evaluate the damage intensity for Anastrepha fraterculus, in 53 varieties of mango at the basic orchard of the ICA-Palmira, there was no evident relationship between the epicarp texture an the infestation degreen...

  1. The temporal pattern of mating behavior of the fruit fly, Anastrepha zenildae in the laboratory.

    Science.gov (United States)

    Almeida, Lucia M de; Araújo, Arrilton; Mendes, Norma H D; Souza, João M G A de; Menezes, Alexandre A L

    2011-01-01

    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00-19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5-6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5-7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5-163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation.

  2. Morphometric Differentiation Among Anastrepha fraterculus (Diptera: Tephritidae) Exploiting Sympatric Alternate Hosts.

    Science.gov (United States)

    Gómez-Cendra, P V; Paulin, L E; Oroño, L; Ovruski, S M; Vilardi, J C

    2016-04-01

    Anastrepha fraterculus (Wiedemann) is currently considered a complex of cryptic species infesting fruits from Mexico to Argentina and represents an interesting biological model for evolutionary studies. Moreover, detecting and quantifying behavioral, morphological, and genetic differentiation among populations is also relevant to the application of environment-friendly control programs. Here, phenotypic differentiation among individuals coexisting in the wild in a Northern region of Argentina was unveiled and associated with host choice. Six morphometric traits were measured in sympatric flies exploiting three different host species. Phenotypic variation was shown to be host-dependent regardless of geographical or temporal overlap. Flies collected from synchronous alternate hosts (peach and walnut) differed from each other despite the lack of geographical isolation. By contrast, flies emerging from guavas that ripen about two months later than peach and walnut showed no significant differentiation in comparison to flies collected from walnuts, but they differ significantly from flies originating from peaches. This result is consistent with the hypothesis that the same population of flies shifts from walnuts to guavas throughout the year, whereas the population of flies that uses peaches as a host is probably exploiting other alternate hosts when peach availability decreases. Further research is needed to study the underlying mechanism. Results are consistent with previous molecular markers (inter-simple sequence repeat-ISSR) research on flies stemming from the same hosts and the same area, suggesting that differentiation among flies emerging from alternative hosts occurs at both genetic and phenotypic levels. The contribution of host preference in long-term genetic differentiation is discussed. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Kendra, Paul E; Epsky, Nancy D; Heath, Robert R

    2010-04-01

    Release-recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew) (Diptera: Tephritidae), to determine sampling range for a liquid protein bait (torula yeast/borax) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were done in a guava, Psidium guajava L., grove and involved releasing flies at a central point and recording the numbers captured after 7 h and 1, 2, 3, and 6 d in an array of 25 Multilure traps located 9-46 m from the release point. In all tests, highest rate of recapture occurred within the first day of release, so estimations of sampling range were based on a 24-h period. Trap distances were grouped into four categories (30 m from release point) and relative trapping efficiency (percentage of capture) was determined for each distance group. Effective sampling range was defined as the maximum distance at which relative trapping efficiency was > or = 25%. This corresponded to the area in which 90% of the recaptures occured. Contour analysis was also performed to document spatial distribution of fly dispersal. In tests with sterile flies, immature females dispersed farther and were recovered in higher numbers than mature females, regardless of attractant, and recapture of both cohorts was higher with torula yeast. For mature feral flies, range of the synthetic lure was determined to be 30 m. With sterile females, effective range of both attractants was 20 m. Contour maps indicated that wind direction had a strong influence on the active space of attractants, as reflected by distribution of captured flies.

  4. Male irradiation affects female remating behavior in Anastrepha serpentina (Diptera: Tephritidae).

    Science.gov (United States)

    Landeta-Escamilla, Anais; Hernández, Emilio; Arredondo, José; Díaz-Fleischer, Francisco; Pérez-Staples, Diana

    2016-02-01

    Female remating in target pest species can affect the efficacy of control methods such as the Sterile Insect Technique (SIT) but very little is known about the postcopulatory mating behavior of these pests. In this study, we investigated the remating behavior of female Anastrepha serpentina (Diptera: Tephritidae), an oligophagous pest of Sapotaceae. First, we tested how long the sexual refractory period of females lasted after an initial mating. Second, we tested the effect of male and female sterility, female ovipositing opportunities and male density on female propensity to remate. Lastly, we tested if the amount of sperm stored by females was correlated to the likelihood of females to remate. We found that receptivity of mass-reared A. serpentina females had a bimodal response, with up to 16% of mass-reared A. serpentina females remating five days after the initial copulation, decreasing to 2% at 10 and 15 days and increasing to 13% after 20 days. Compared to fertile males, sterile males were less likely to mate and less likely to inhibit females from remating. Copula duration of sterile males was shorter compared to fertile males. Remating females were less likely to mate with a sterile male as a second mate. Sterile females were less likely to mate or remate compared to fertile females. Opportunity to oviposit and male density had no effect on female remating probability. Sperm numbers were not correlated with female likelihood to remate. Information on the post-copulatory behavior of mass-reared A. serpentina will aid fruit fly managers in improving the quality of sterile males. We discuss our results in terms of the differences this species presents in female remating behavior compared to other tephritids. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. The Temporal Pattern of Mating Behavior of the Fruit Fly, Anastrepha zenildae in the Laboratory

    Science.gov (United States)

    de Almeida, Lucia M.; Araújo, Arrilton; Mendes, Norma H.D.; de Souza, João M.G.A.; Menezes, Alexandre A.L.

    2011-01-01

    The state of Rio Grande do Norte is an important fruit-producing and exporting area in northeastern Brazil. The success of this industry depends on fruit fly population control, especially in fly-free exporting zones. However, many fruits are not exported because of quarantine restrictions imposed by importing countries. A survey in the state has detected a considerable increase of the fruit fly, Anastrepha zenildae Zucchi (Diptera: Tephritidae), probably a result of the introduction of irrigated guava orchards that make fruit available all year. Knowledge of the sexual behavior of Tephritidae has great importance to pest control programs, particularly those that employ the Sterile Insect Technique. In order to characterize the reproductive behavior of A. zenildae, 32 individuals (16 males; 16 females) in each of six generations were submitted to an artificial 12:12 L:D cycle (750: < 1 lux, lights on 07:00–19:00) and observed over their lifetimes. The courtship and copulation occurred in leks and the episodes varied with the time of day, courtship being most frequent between Zeitgeber time (ZT) 3 and ZT 7, peaking at ZT 5–6. Copulations occurred between ZT 2 and ZT 8, with a higher frequency between ZT 5–7 and a peak at ZT 6. Mean duration was 0.28 ± 0.03 min/male (range: 5–163 min). Males in the leks attempted to copulate mainly between ZT 3 and ZT 7 with a peak at ZT 6, and males outside leks peaked at ZT 7. The different timing of sexual behaviors among related sympatric species, including A. zenildae, may contribute to species isolation. PMID:22236152

  6. Mineralización del nitrógeno, carbono y actividad enzimática del suelo en un bosque de Nothofagus obliqua (Mirb Oerst y una plantación de Pinus radiata D. Don. del centro-sur de Chile Nitrogen and carbon mineralization and enzyme activity in soils of Nothofagus obliqua (Mirb Oerst stands and Pinus radiata D. Don plantation in south-central Chile

    Directory of Open Access Journals (Sweden)

    YESSICA RIVAS

    2009-03-01

    Full Text Available En Chile, el establecimiento de plantaciones comerciales de rápido crecimiento ha sido sostenido en las últimas décadas mediante la sustitución de bosques nativos y conversión de suelos agrícolas. Pinus radiata D. Don es la principal especie productiva, debido a su crecimiento acelerado y adaptabilidad al clima y los suelos. En el presente estudio se plantea que la actividad biológica del suelo es variable a través del año, en respuesta a variaciones de precipitación, temperatura y contenido de humedad de suelo y que el cambio de uso de suelo desde un bosque templado de Nothofagus obliqua (Mirb Oerst a una plantación con coniferas exóticas, modifica la química del suelo y consecuentemente los procesos de N-min, C-min y la actividad biológica del suelo. Esta hipótesis fue examinada en un bosque de N. obliqua y una plantación de P. radiata del centro-sur de Chile (40°07' S, 72° O. Se evaluó mensualmente la tasa mineralización de nitrógeno (N-min, cabono (C-min y la actividad enzimática potencial del suelo (ureasa, proteasa e hidrólisis de la fluoresceína diacetato entre septiembre 2003 y mayo 2005. Los resultados demuestran que los niveles de las variables de actividad biológica del suelo fueron significativamente diferentes entre las parcelas de bosque y plantación (Lambda de Wilk = 0,022; F 5,80 = 733; P In Chile, commercial forests plantations have increased during the last decades due in part to replacement of native forests and conversion of agricultural soils. Pinus radiata D. Don has been the main tree planted, due to its rapid growth and adaptability. In the present study we proposed that biological activity varies along the year due to changes of precipitation, temperature and soil water content and mainly because the conversion of native forest to exotic P. radiata plantations alters the soil chemistry, N and C mineralization and the potential enzymatic activity in these soils. This hypothesis was examined in a

  7. Levantamento de moscas-das-frutas e de seus parasitóides no município de Ferreira Gomes, Estado do Amapá Survey of fruit flies and its parasitoids in Ferreira Gomes, Amapá State

    Directory of Open Access Journals (Sweden)

    Wilson Rodrigues da Silva

    2007-02-01

    Full Text Available Este trabalho objetivou efetuar um levantamento das espécies de moscas-das-frutas e de seus parasitóides, no município de Ferreira Gomes, Estado do Amapá. Entre os meses de março e julho de 2005, foram coletadas 38 amostras de frutos de seis espécies vegetais, totalizando 43,7kg. Foram obtidos 515 pupários, dos quais emergiram 123 adultos da família Tephritidae e 102 parasitóides. Foram obtidas cinco espécies de Anastrepha: A. fraterculus, A. obliqua, A. striata, A. antunesi e A. turpiniae. Os únicos hospedeiros de tefritídeos foram o taperebá (Spondias mombin e a goiaba (Psidium guajava, com índices de infestação natural de 0,51 e 0,24 pupário/fruto e de 52,3 e 5,4 pupários kg-1 de fruto, respectivamente. As espécies dominantes foram A. obliqua, no taperebá, e A. striata, na goiaba. Foram obtidos exemplares de quatro espécies de Braconidae: Doryctobracon areolatus, Utetes anastrephae, Opius bellus e Opius sp., sendo a primeira a mais abundante.This research was aimed at doing a survey on fruit flies and their parasitoids species in Ferreira Gomes, Amapá State, Brazil. Exactly 38 samples of fruits of six vegetables species were collected and it totaled 43,7kg from March to July of 2005. It was possible to obtain 515 puparia that emerged 123 Tephritidae adults and 102 parasitoids. Moreover, five species of Anastrepha were registered: A. fraterculus, A. obliqua, A. striata, A. antunesi and A. turpiniae. Spondias mombin and Psidium guajava were the only hosts of Tephritidae species, they had indices of natural infestation of 0.51 e 0.24 puparia/fruit and 52.3 and 5.4 puparia kg-1, respectively. The dominant species were A. obliqua, in S. mombin, and A. striata, in P. guajava. Four species of Braconidae were registered: Doryctobracon areolatus, Utetes anastrephae, Opius bellus and Opius sp. Of all these species, the first one was the most abundant.

  8. Male-specific Y-linked transgene markers to enhance biologically-based control of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Meza, J Salvador; Schetelig, Marc F; Zepeda-Cisneros, C Silvia; Handler, Alfred M

    2014-01-01

    Reliable marking systems are critical to the prospective field release of transgenic insect strains. This is to unambiguously distinguish released insects from wild insects in the field that are collected in field traps, and tissue-specific markers, such as those that are sperm-specific, have particular uses such as identifying wild females that have mated with released males. For tephritid fruit flies such as the Mexican fruit fly, Anastrepha ludens, polyubiquitin-regulated fluorescent protein body markers allow transgenic fly identification, and fluorescent protein genes regulated by the spermatocyte-specific β2-tubulin promoter effectively mark sperm. For sterile male release programs, both marking systems can be made male-specific by linkage to the Y chromosome. An A. ludens wild type strain was genetically transformed with a piggyBac vector, pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3}, having the polyubiquitin-regulated EGFP body marker, and the β2-tubulin-regulated DsRed.T3 sperm-specific marker. Autosomal insertion lines effectively expressed both markers, but a single Y-linked insertion (YEGFP strain) expressed only PUbnlsEGFP. This insertion was remobilized by transposase helper injection, which resulted in three new autosomal insertion lines that expressed both markers. This indicated that the original Y-linked Asβ2tub-DsRed.T3 marker was functional, but specifically suppressed on the Y chromosome. The PUbnlsEGFP marker remained effective however, and the YEGFP strain was used to create a sexing strain by translocating the wild type allele of the black pupae (bp+) gene onto the Y, which was then introduced into the bp- mutant strain. This allows the mechanical separation of mutant female black pupae from male brown pupae, that can be identified as adults by EGFP fluorescence. A Y-linked insertion of the pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3} transformation vector in A. ludens resulted in male-specific expression of the EGFP fluorescent protein marker, and was

  9. Evaluating the quality of the Mexican fruit-fly, Anastrepha ludens, as host for the parasitoid Melittobia digitata

    Directory of Open Access Journals (Sweden)

    J.M. González

    2013-08-01

    Full Text Available We investigated the presence of Melittobia digitata (Hymenoptera: Eulophidae and its associations with its natural hosts in Veracruz, Mexico. The parasitoid was confirmed to be present and found to attack prepupae of Trypoxylon and Sceliphron (Hymenoptera: Crabronidae and Sphecidae, respectively mud daubers as well as pupae of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae. Since A. ludens is a very important pest of citrus and mango in Mexico and Central America, we evaluated, in laboratory experiments, the quality of A. ludens as host of M. digitata comparing the development of the parasitoid in another unrelated fly species (Sarcophaga [Neobellieria] bullata (Diptera: Sarcophagidae and in mud dauber wasps (Trypoxylon sp. and Sceliphron sp.. The Mexican fruit fly appears to be a good-quality host for M. digitata, and the results are discussed in the context of their possible interest as a natural enemy of A. ludens.

  10. Characterisation of the chemical profiles of Brazilian and Andean morphotypes belonging to the Anastrepha fraterculus complex (Diptera, Tephritidae)

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ferreira, Luana Lima; de Aquino, Nathaly Costa; Tavares, Raphael de Farias; Rodriguez, Laura D.; Mendonça, Adriana de Lima; Canal, Nelson Augusto; do Nascimento, Ruth Rufino

    2015-01-01

    Abstract Fruit fly sexual behaviour is directly influenced by chemical and non-chemical cues that play important roles in reproductive isolation. The chemical profiles of pheromones and cuticular hydrocarbons (CHs) of eight fruit fly populations of the Andean, Brazilian-1 and Brazilian-3 morphotypes of the Anastrepha fraterculus cryptic species complex originating from Colombia (four populations) and Brazil (four populations) were analysed using two-dimensional gas chromatography with mass spectrometric detection. The resulting chemical diversity data were studied using principal component analyses. Andean morphotypes could be discriminated from the Brazilian-1 and Brazilian-3 morphotypes by means of male-borne pheromones and/or male and female CH profiles. The Brazilian-1 and Brazilian-3 morphotypes were found to be monophyletic. The use of chemical profiles as species- and sex-specific signatures for cryptic species separations is discussed. PMID:26798260

  11. Development, genetic and cytogenetic analyses of genetic sexing strains of the Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae).

    Science.gov (United States)

    Zepeda-Cisneros, Cristina Silvia; Meza Hernández, José Salvador; García-Martínez, Víctor; Ibañez-Palacios, Jorge; Zacharopoulou, Antigone; Franz, Gerald

    2014-01-01

    Anastrepha ludens is among the pests that have a major impact on México's economy because it attacks fruits as citrus and mangoes. The Mexican Federal government uses integrated pest management to control A. ludens through the Programa Nacional Moscas de la Fruta [National Fruit Fly Program, SAGARPA-SENASICA]. One of the main components of this program is the sterile insect technique (SIT), which is used to control field populations of the pest by releasing sterile flies. To increase the efficiency of this technique, we have developed a genetic sexing strain (GSS) in which the sexing mechanism is based on a pupal colour dimorphism (brown-black) and is the result of a reciprocal translocation between the Y chromosome and the autosome bearing the black pupae (bp) locus. Ten strains producing wild-type (brown pupae) males and mutant (black pupae) females were isolated. Subsequent evaluations for several generations were performed in most of these strains. The translocation strain named Tapachula-7 showed minimal effect on survival and the best genetic stability of all ten strains. Genetic and cytogenetic analyses were performed using mitotic and polytene chromosomes and we succeeded to characterize the chromosomal structure of this reciprocal translocation and map the autosome breakpoint, despite the fact that the Y chromosome is not visible in polytene nuclei following standard staining. We show that mitotic and polytene chromosomes can be used in cytogenetic analyses towards the development of genetic control methods in this pest species. The present work is the first report of the construction of GSS of Anastrepha ludens, with potential use in a future Moscafrut operational program.

  12. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  13. MONITORAMENTO POPULACIONAL DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE MANGA (Mangifera indica L. NO MUNICÍPIO DE JABOTICABAL – SP

    Directory of Open Access Journals (Sweden)

    Wilson Carlos Pazini

    2013-05-01

    Full Text Available The population monitoring of agricultural pests is an important tool to select the best control methodto be employed in a determined culture. Thus, the objective of this research was analyze the population fluctuation of Anastrepha spp. correlated with the mango tree phenology and the meteorological elements, temperature, relative humidity and pluviometric precipitation. The study was conducted between Mach 2009 to August 2010 in Jaboticabal, SP. For Anastrepha spp. monitoring, we randomly installed five yellow stick traps in an experimental orchard composed by a collection of mango varieties. These traps were replaced every fifteen days and carried to the Laboratory of Ecological Selectivity of the Department of Plant Protection (FCAV/UNESP to evaluate the sampled specimens. The meteorological data were recorded at the FCAV/UNESP Meteorological Station, located approximately 200 m from the study area. The results showed that the greater and more consistent Anastrepha spp. population density is between the spring and summer seasons, particularly related to the mature fruits. A weak positive correlation is observed between maximum temperature (°C and relative humitidy (% when compared with the Anastrepha spp. population density. There is moderate positive correlation between minimum and medium temperatures (°C and accumuluted pluviometric precipitation (mm when compared with the said agricultural pest.O monitoramento populacional de insetos considerados pragas agrícolas constitui uma importante ferramenta para a escolha do melhor método de controle a ser empregado em determinada cultura. Desta forma, o objetivo desta pesquisa foi analisar a flutuação populacional de Anastrepha spp. correlacionada com a fenologia da mangueira e com os elementos meteorológicos, temperatura, umidade relativa e precipitação pluviométrica. O estudo foi desenvolvido no período entre março de 2009 a agosto de 2010 no município de Jaboticabal, SP. Para o

  14. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  15. Synergism of Bacillus thuringiensis Combined with EoNPV against Ectropis obliqua%苏云金杆菌与EoNPV混用的增效作用

    Institute of Scientific and Technical Information of China (English)

    徐健; 肖强; 刘琴; 唐美君; 殷向东; 殷坤山; 祝树德

    2006-01-01

    采用生物测定方法测定茶尺蠖核型多角体病毒(Ectropis obliqua nucleopolyhedrovirus, EoNPV)和苏云金杆菌(Bacillus thuringiensis, Bt)的联合作用.5组不同含量EoNPV制剂(1.50×107 PIB/ml、1.25×107 PIB/ml、1.00×107 PIB/ml、7.50×106 PIB/ml和5.00×106 PIB/ml)中混合2 000 IU/mg Bt制剂后共毒系数在106.02至128.03之间,表明Bt与EoNPV混用具有增效作用.其中以1.00×107 PIB/ml EoNPV制剂与 2 000 IU/mg Bt制剂混用增效作用最明显,LC50为 817.03 μg/ml.对2龄茶尺蠖的杀虫速度,EoNPV+Bt制剂(1.00×107 PIB/ml EoNPV+2 000 IU/mg Bt)的LT50较单独使用EoNPV(2.00×107 PIB/ml)缩短了2 d,且EoNPV+Bt制剂对茶尺蠖具有拒食作用,茶尺蠖对EoNPV+Bt制剂处理茶树的食叶量比单独使用EoNPV制剂的食叶量减少65.9%.EoNPV+Bt制剂对茶刺蛾、茶银尺蠖等茶树鳞翅目害虫的兼治作用分别达85.8%和88.7%.多点田间药效试验结果表明,EoNPV+Bt制剂药后10 d对茶尺蠖防效达81.80%~93.24%.

  16. Flutuação populacional de Anastrepha fraterculus (Wiedemann e Ceratitis capitata (Wiedemann (Diptera, Tephritidae em pomares de pessegueiro em Porto Alegre, Rio Grande do Sul Population fluctuation of Anastrepha fraterculus (Wiedemann and Ceratitis capitata (Wiedemann (Diptera, Tephritidae in peach orchards in Porto Alegre, Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    1998-01-01

    Full Text Available This paper presents the study of population fluctuation of Anastrepha fraterculus (Wiedemann, 1824 and Ceratitis capitata (Wiedemann, 1830 in peach orchards in Porto Alegre city. The peak for A. fraterculus was in November and December and for C. capitata in December and January. There was no significant difference among the population levels in the cultivars Fla 13-72, Premier and Marli.

  17. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  18. Microsatellite markers from the 'South American fruit fly' Anastrepha fraterculus: a valuable tool for population genetic analysis and SIT applications

    Science.gov (United States)

    2014-01-01

    Background Anastrepha fraterculus Wiedemann is a horticultural pest which causes significant economic losses in the fruit-producing areas of the American continent and limits the access of products to international markets. The use of environmentally friendly control strategies against this pest is constrained due to the limited knowledge of its population structure. Results We developed microsatellite markers for A. fraterculus from four genomic libraries, which were enriched in CA, CAA, GA and CAT microsatellite motifs. Fifty microsatellite regions were evaluated and 14 loci were selected for population genetics studies. Genotypes of 122 individuals sampled from four A. fraterculus populations were analyzed. The level of polymorphism ranged from three to 13 alleles per locus and the mean expected heterozygosity ranged from 0.60 to 0.64. Comparison between allelic and genotypic frequencies showed significant differences among all pairs of populations. Conclusions This novel set of microsatellite markers provides valuable information for the description of genetic variability and population structure of wild populations and laboratory strains of A. fraterculus. This information will be used to identify and characterize candidate strains suitable to implement effective pest control strategies and might represent a first step towards having a more comprehensive knowledge about the genetics of this pest. PMID:25471285

  19. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  20. Asymmetry of frontal bristles and postocular setae in species and hybrids of the Anastrepha fraterculus complex (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    João Maria G.A. Souza

    2007-01-01

    Full Text Available Asymmetry of the frontal bristles and postocular setae was studied in samples from natural populations and laboratory colonies of Anastrepha sp. 1 aff. fraterculus, of A. sp. 2 aff. fraterculus, and in F1 hybrids obtained from laboratory reciprocal crosses. Natural populations were sampled in a zone of sympatry and in two geographically distant regions with different climatic conditions. Asymmetry was scored as the differences between the number of bristles and of setae on the right and left sides of the head, males and females analyzed independently. The two traits exhibited variability according to the model of fluctuating asymmetry (FA. No significant differences among samples were found in the FA of frontal bristles. A significant FA was observed for the postocular setae of A. sp. 1 males from a southern population (Vacaria, RS as compared to the asymmetry exhibited by males and females of some other samples. No significant differences in FA were observed among the interspecific hybrids and the laboratory samples of both parental species. The higher FA found in the males from Vacaria was attributed to climatic conditions prevailing in that region. The absence of a higher FA in hybrids may be related to the relatively recent evolutionary history of the two species.

  1. Male Sexual Behavior and Pheromone Emission Is Enhanced by Exposure to Guava Fruit Volatiles in Anastrepha fraterculus

    Science.gov (United States)

    Bachmann, Guillermo E.; Segura, Diego F.; Devescovi, Francisco; Juárez, M. Laura; Ruiz, M. Josefina; Vera, M. Teresa; Cladera, Jorge L.; Fernández, Patricia C.

    2015-01-01

    Background Plant chemicals can affect reproductive strategies of tephritid fruit flies by influencing sex pheromone communication and increasing male mating competitiveness. Objective and Methodology We explored whether exposure of Anastrepha fraterculus males to guava fruit volatiles and to a synthetic blend of volatile compounds released by this fruit affects the sexual performance of wild and laboratory flies. By means of bioassays and pheromone collection we investigated the mechanism underlying this phenomenon. Results Guava volatile exposure enhanced male mating success and positively affected male calling behavior and pheromone release in laboratory and wild males. Changes in male behavior appear to be particularly important during the initial phase of the sexual activity period, when most of the mating pairs are formed. Exposure of laboratory males to a subset of guava fruit volatiles enhanced mating success, showing that the response to the fruit might be mimicked artificially. Conclusions Volatiles of guava seem to influence male mating success through an enhancement of chemical and physical signals related to the communication between sexes. This finding has important implications for the management of this pest species through the Sterile Insect Technique. We discuss the possibility of using artificial blends to improve the sexual competitiveness of sterile males. PMID:25923584

  2. Ocorrência de moscas-das-frutas (Diptera: Tephritidae em mangueiras (Mangifera indica L. em Boa Vista, Roraima = The occurrence of fruit fly (Diptera: Tephritidae in mango (Mangifera indica L. in Boa Vista, Roraima

    Directory of Open Access Journals (Sweden)

    Adriana Bezerra Lima

    2012-08-01

    examined weekly, during which the bait was substituted and the capture insects removed, placed in labeled glass flasks properly and transported to the Laboratory of Entomology, Centro de Ciências Agrárias, Universidade Federal de Roraima - UFRR. The identification of the specimens was done at the Instituto Nacional de Pesquisa da Amazônia - INPA. a - INPA. During the period of eight months 24 adult specimens of Anastrepha were collected (9 females and 15 males. Four species were identified: A. serpentina, A. striata, A. obliqua and A. turpinae. The highest frequency of trapped insects was A. serpentina (44.44%, followed by A. striata and A. obliqua with 22.22%, and A. turpinae with 11.11%. The months of highest occurrence of Anastrepha spp., were June, July, and August. This is the first documentation of the specie Anastrepha turpinae Stone, 1942, in Roraima.

  3. Relações interespecíficas entre parasitoides nativos de moscas-das-frutas e o braconídeo exótico Diachasmimorpha longicaudata em frutos de 'umbu-cajá' Interespecific relations between native parasitoids of fruit flies and exotic braconid Diachasmimorpha longicaudata in fruits of 'umbu-cajá'

    Directory of Open Access Journals (Sweden)

    Zuzinaide Vidal Bomfim

    2010-02-01

    pupae were obtained, of which 3.963 Anastrepha obliqua (Macquart adults and 1.115 parasitoids of Braconidae family emerged. Three species of opiinae were identified before releasing. The higher relative frequency was of Doryctobracon areolatus (Szépligeti, followed by Asobara Anastrephae (Muesebeck and Utetes Anastrephae (Viereck. 24 and 48 hours after release the exotic parasitoid D. longicaudata on the field, the parasitism rate increased from 15.86% to 20.42% and 45.19%, respectively. It was found that the release of exotic species D. longicaudata has no negative effects on the occurrence of native parasitoids and helps to complement the natural biological control of A. obliqua in fruits of 'umbu-cajá' conditions of this study.

  4. Percepção química e visual de Anastrepha fraterculus (Diptera, Tephritidae em laboratório Chemical and visual perception of Anastrepha fraterculus (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Patrícia L. F. Gregorio

    2010-06-01

    Full Text Available A mosca-das-frutas-sul-americana, Anastrepha fraterculus (Wiedemann, 1830, é uma das principais pragas da fruticultura no Brasil. Durante a alimentação, as larvas fazem galerias nos frutos, alterando o sabor e prejudicando a produção e comercialização dos mesmos. O presente trabalho teve como objetivo estudar fatores envolvidos na escolha do hospedeiro por A. fraterculus. Foram avaliadas as respostas eletroantenográficas de machos e fêmeas a extratos etanólicos de frutos verdes e maduros de pessegueiro - Prunus persica, cultivar Chimarrita (Rosaceae, pitangueira - Eugenia uniflora (Myrtaceae, guabirobeira - Campomanesia xanthocarpa (Myrtaceae e araçazeiro - Psidium cattleianum (Myrtaceae. Foram também observadas as influências da cor (amarela, verde e vermelha e da composição do substrato de oviposição (polpas de araçá, guabiroba, pitanga e pêssego na fecundidade da espécie. As respostas eletroantenográficas de fêmeas foram significativamente distintas para os extratos de guabiroba verde e madura, araçá maduro e pitanga verde. Em antenas de machos, as maiores despolarizações médias foram registradas em resposta aos extratos de guabiroba verde e madura, araçá verde e maduro e pitanga verde. As respostas eletrofisiológicas geradas não diferiram estatisticamente entre os sexos, para todos os tratamentos. A cor do substrato não afetou a oviposição. As fêmeas ovipositaram mais nos substratos contendo polpa de pêssego e de guabiroba, quando comparados aos respectivos controles.The South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 is one of the greatest threats to the fruit growing industry in Brazil. During the feeding process, the larvae build galleries within the fruit, altering the flavor and damaging its production and commercialization. The present work had as its objective to study the factors involved in the choice of the host by A. fraterculus. Electroantennographic responses of the males and

  5. Disinfestation of mangoes by irradiation; Desinfestacion de mango por irradiacion

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E

    1992-05-15

    The mango is a fruit-bearing very important in the mexican economy. Mexico is between the first positions of the world like country producing with an average export volume of 40,000 annual tons in the last years. For this reason it was decided to make this investigation, which was developed according to the investigation protocols proposed by the Agricultural Research Service of the USA (ARS - US DOA). The objective is to account with the technical and scientific necessary bases to propose to the US DOA the regulation of the irradiation process like quarantine treatment for Mexican export mango. The goals are: to determine in the laboratory the minimum dose (Dmin.) to inhibit the emergency of adults of the species of the fruit flies of more importance for Mexico. To confirm the least radiation dose Dmin. for quarantine treatment based on the safety value Probit-9. To evaluate the mango quality irradiated to 2 and 2.5 times the Dmin. proposal for quarantine treatment. According to information provided by the General Direction of Vegetable Sanity, it was determined that the fly species of the fruit of more economic importance for Mexico are of the genus Anastrepha ludens, Anastrepha serpentina, Anastrepha obliqua and Ceratitis capitata. (Author)

  6. Fatores climáticos na dinâmica populacional de Anastrepha spp. (diptera: tephritidae e de Scymnus spp. (coleoptera: coccinellidae em um pomar experimental de goiaba (Psidium guajava L.

    Directory of Open Access Journals (Sweden)

    Ricardo Aparecido Calore

    2013-03-01

    Full Text Available Este trabalho objetivou caracterizar a dinâmica populacional de Anastrepha spp. e de Scymnus spp. em pomar experimental semiorgânico de goiaba (Psidium guajava L., em Pindorama-SP, na Agência Paulista de Tecnologia dos Agronegócios (APTA e correlacioná-la com fatores meteorológicos. Para o levantamento da dinâmica populacional, os espécimes foram monitorados com armadilhas adesivas amarelas (25 cm x 9,5 cm, trocadas a cada 15 dias, no período de um ano (entre junho de 2009 e junho de 2010. Os insetos foram avaliados e quantificados no Laboratório de Seletividade Ecológica da UNESP-FCAV em Jaboticabal-SP. Observou-se a ocorrência de Anastrepha spp. e Scymnus spp. durante todo o período de amostragem. Com base nos resultados obtidos e nas condições de desenvolvimento do presente trabalho, foram possíveis as seguintes conclusões: a Ocorre aumento na densidade populacional de Anastrepha spp. com o aumento das temperaturas mínima, média e máxima; b Os picos populacionais de Anastrepha spp. ocorrem de janeiro a março e coincidem com o período de disponibilidade de frutos maduros no pomar de goiaba; c Constatam-se as maiores ocorrências do predador Scymnus spp. no período de setembro a dezembro, e as menores ocorrências, em fevereiro e março; d As precipitações não interferem na dinâmica populacional de Anastrepha spp. e de Scymnus spp..

  7. Biological control potential of entomopathogenic nematodes for management of Caribbean fruit fly, Anastrepha suspensa Loew (Tephritidae).

    Science.gov (United States)

    Heve, William K; El-Borai, Fahiem E; Carrillo, Daniel; Duncan, Larry W

    2017-06-01

    Caribbean fruit fly (Caribfly) is a serious economic insect pest because of development of larvae that hatch from eggs oviposited into fruits by female adults. This study assessed the virulence of twelve entomopathogenic nematode (EPN) isolates to Caribfly in laboratory bioassays as a starting point toward evaluation of management strategies for the fruit-to-soil-dwelling stages of A. suspensa in fields infested by Caribfly. Inoculation of A. suspensa with 1 mL of ca 200 IJs larva(-1) killed Caribfly at either larval or pupal stage. Pupae were more resistant to EPN infections than larvae. Adult emergence from inoculated pupae in soil microcosms was significantly lower than that observed in filter paper assays. Longest or largest steinernematids suppressed emergence of more adult Caribfly from pupae in soils, whereas shorter heterorhabditids were more infectious to Caribfly larvae. The highest mortalities of A. suspensa were caused by exotic nematodes Steinernema feltiae and Heterorhabditis bacteriophora, followed by the native Heterorhabditis indica and the exotic Steinernema carpocapsae. Entomopathogenic nematodes reduced the development of Caribfly larvae and pupae to adult in our bioassays, suggesting that EPNs have potential for biological control of A. suspensa. Future work will assess management strategies, using the virulent EPNs, in orchards infested by A. suspensa. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  8. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  9. Random mating and reproductive compatibility among Argentinean and southern Brazilian populations of Anastrepha fraterculus (Diptera: Tephritidae).

    Science.gov (United States)

    Rull, J; Abraham, S; Kovaleski, A; Segura, D F; Islam, A; Wornoayporn, V; Dammalage, T; Tomas, U Santo; Vera, M T

    2012-08-01

    As a prerequisite for area-wide application of the sterile insect technique in an area encompassing northern Argentina and southern Brazil, prezygotic and postzygotic reproductive compatibility among three geographically distant populations in the area was tested. In field cages, sexually mature adults of each population were found to be sexually compatible, mating duration was not affected by fly origin and there was no clear evidence of spatial partition of mating location. In the laboratory, homotypic and heterotypic crosses for all possible combinations displayed similar levels of fertility and yielded F1 adults without distortion of the sex ratio. Finally, F1 hybrid and parental adults produced equally viable F2 eggs. Put together, our results and those from earlier studies suggest that a large area, ranging from Buenos Aires to the surroundings of São Paulo, could be managed using a single A. fraterculus mass-reared strain. At the northern margin of this area, two A. fraterculus morphotypes appear to coexist in sympatry. We delineate future research to further delimit the distribution of the aff1 morphotype (Argentina-southern Brazil) and to gain insight into evolutionary patterns producing divergence and radiation of tropical fruit fly species.

  10. カバノアナタケ(Fuscopiria obliqua)メタノールエキスのヒト繊維肉腫細胞株HT1080細胞増殖抑制活性

    OpenAIRE

    畠, 恵司; 堀, 一之; 根田, 仁; 菅原, 冬樹; 嶋田, 康子; 志田, 優; 高橋, 砂織; Keishi, Hata; Kazuyuki, Hori; Hitoshi, Neda; Fuyuki, Sugawara; Yasuko, SHIMADA; Masaru, Shida; Saori, TAKAHASHI; 秋田県総合食品研究所

    2005-01-01

    We examined the anti-proliferative effects of methanol extracts from Fuscopiria obliqua (FO-MeOHex) on the human fibrosarcoma cell line, HT1080. The extracts exhibited cytostatic activity toward HT1080 cells at concentrations over 50 μg/ml and induced HT1080 cell apoptosis at over 500 μg/ml. The cell cycle of HT1080 cells treated with 200 μg/ml of FO-MeOHex were arrested in G0/G1 phase. Fo-MeOHex induced the morphological changes of HT1080 cells by the disruption of stress fibers in HT1080 ce...

  11. The effects of constant and alternating temperatures on the reproductive potential, life span, and life expectancy of Anastrepha fraterculus (Wiedemann (Dipteria: Tephritidae

    Directory of Open Access Journals (Sweden)

    V. V. CARDOSO

    Full Text Available Ovarian development, oviposition, larval eclosion, ornithine decarboxylase (ODC activity, ovarian, testis and ejaculatory apodeme measurements (length, width, and area, and the number of spermatozoa of Anastrepha fraterculus (Wiedemann were analyzed at alternating (20º/6ºC and 20º/13°C and constant (6°C; 25°C temperatures. Life span and life expectancy were also analyzed for both genders. All the results suggest that temperature, especially alternating temperatures, increase not only male and female reproductive potential but also their life span and life expectancy. These changes can be a powerful strategy triggered by A. fraterculus as a means to survive the stressful temperature conditions found in winter in the apple production region in Brazil, enabling this species to increase its population density and cause apple damage when spring begins.

  12. The effects of constant and alternating temperatures on the reproductive potential, life span, and life expectancy of Anastrepha fraterculus (Wiedemann (Dipteria: Tephritidae

    Directory of Open Access Journals (Sweden)

    CARDOSO V. V.

    2002-01-01

    Full Text Available Ovarian development, oviposition, larval eclosion, ornithine decarboxylase (ODC activity, ovarian, testis and ejaculatory apodeme measurements (length, width, and area, and the number of spermatozoa of Anastrepha fraterculus (Wiedemann were analyzed at alternating (20masculine/6masculineC and 20masculine/13degreesC and constant (6degreesC; 25degreesC temperatures. Life span and life expectancy were also analyzed for both genders. All the results suggest that temperature, especially alternating temperatures, increase not only male and female reproductive potential but also their life span and life expectancy. These changes can be a powerful strategy triggered by A. fraterculus as a means to survive the stressful temperature conditions found in winter in the apple production region in Brazil, enabling this species to increase its population density and cause apple damage when spring begins.

  13. Irradiation of mangoes as a quarantine treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bustos R, M.E.; Enkerlin H, W.; Toledo A, J.; Reyes F, J.; Casimiro G, A

    1991-06-15

    This research project was conducted following guidelines of research protocols for post-harvest treatments developed by the United States Department of Agriculture CUSA. Laboratory bioassays included the irradiation of mangoes infested with third instar larvae of Anastrepha serpentina (Wied), A. ludens (Loew), A. obliqua (Macquart) and Ceratitis capitata (Wied) , at doses from 10 to 250 Gy. Irradiation doses were applied using a Co-60 AECL Model JS-7400 irradiator. The design was chosen to obtain a maximum to minimum ratio equal to, or less than, 1.025. C. capitata was the species most tolerant to irradiation. A dose of 60 Gy applied to third instar fruit fly larvae sterilized this species and prevented emergence of adults of the other three species. A dose of 250 Gy was required to prevent emergence of C. capitata. In fertility tests using emerged adults of A . Iudens, and A. obliqua a dose of 30 Gy gave 45 % and 27 % fertility, respectively. Adults of A. serpentina that emerged, died before reaching sexual maturity. The confirmatory tests, at probit-9 security level, were done at 100 Gy for the three species of Anastrepha and at 150 Gy for C. capitata. The quality of mangoes irradiated up to 1000 Gy was evaluated by chemical, physiological, and sensorial tests. The determination of vitamin C indicated that there was no loss of the nutritive value of the fruit. It also was observed that fruit metabolism was not accelerated since no significant increase in respiration or transpiration was registered and consumers accepted both treated and untreated fruit in the same way. (Author)

  14. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina

    Science.gov (United States)

    2014-01-01

    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication

  15. Genetics and biology of Anastrepha fraterculus: research supporting the use of the sterile insect technique (SIT) to control this pest in Argentina.

    Science.gov (United States)

    Cladera, Jorge L; Vilardi, Juan C; Juri, Marianela; Paulin, Laura E; Giardini, M Cecilia; Gómez Cendra, Paula V; Segura, Diego F; Lanzavecchia, Silvia B

    2014-01-01

    Two species of true fruit flies (taxonomic family Tephritidae) are considered pests of fruit and vegetable production in Argentina: the cosmopolitan Mediterranean fruit fly (Ceratitis capitata Wiedemann) and the new world South American fruit fly (Anastrepha fraterculus Wiedemann). The distribution of these two species in Argentina overlaps north of the capital, Buenos Aires. Regarding the control of these two pests, the varied geographical fruit producing regions in Argentina are in different fly control situations. One part is under a programme using the sterile insect technique (SIT) for the eradication of C. capitata, because A. fraterculus is not present in this area. The application of the SIT to control C. capitata north of the present line with the possibility of A. fraterculus occupying the niche left vacant by C. capitata becomes a cause of much concern. Only initial steps have been taken to investigate the genetics and biology of A. fraterculus. Consequently, only fragmentary information has been recorded in the literature regarding the use of SIT to control this species. For these reasons, the research to develop a SIT protocol to control A. fraterculus is greatly needed. In recent years, research groups have been building a network in Argentina in order to address particular aspects of the development of the SIT for Anastrepha fraterculus. The problems being addressed by these groups include improvement of artificial diets, facilitation of insect mass rearing, radiation doses and conditions for insect sterilisation, basic knowledge supporting the development of males-only strains, reduction of male maturation time to facilitate releases, identification and isolation of chemical communication signals, and a good deal of population genetic studies. This paper is the product of a concerted effort to gather all this knowledge scattered in numerous and often hard-to-access reports and papers and summarize their basic conclusions in a single publication.

  16. Long aculeus and behavior of Anastrepha ludens render gibberellic acid ineffective as an agent to reduce 'ruby red' grapefruit susceptibility to the attack of this pestiferous fruit fly in commercial groves.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martín; Greany, Patrick; Bigurra, Everardo; Pérez-Staples, Diana; McDonald, Roy

    2006-08-01

    Treating Mexican grapefruit with gibberellic acid (GA3) before color break, significantly delayed peel color change and increased peel puncture resistance, but it did not reduce grapefruit susceptibility to Mexican fruit fly, Anastrepha ludens (Loew) attack under natural conditions. Despite GA3 treatments, larval infestation levels increased with higher fruit fly populations, which also increased as the season progressed. Late in the season, infestation levels were even higher in GA3-treated fruit compared with untreated fruit, possibly because treated fruit were in better condition at that stage. Egg clutch size was significantly greater in very unripe, hard, GA3-treated fruit at the beginning of the harvest season and in December, compared with control fruit. Under laboratory conditions, egg injection into different regions of the fruit suggested that A. ludens eggs are intoxicated by peel oil content in the flavedo region. However, A. ludens' long aculeus allows females to oviposit eggs deeper into the peel (i.e., albedo), avoiding toxic essential oils in the flavedo. This makes A. ludens a particularly difficult species to control compared with other citrus-infesting species such as Anastrepha suspensa (Loew), Anastrepha fraterculus (Wiedemann), and Ceratitis capitata (Wiedemann) (fly species with significantly shorter aculei), which can be effectively managed with GA3 sprays. We discuss our findings in light of their practical implications and with respect to the oviposition behavior of various fruit flies attacking citrus.

  17. Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae) Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member.

    Science.gov (United States)

    Gariou-Papalexiou, Angeliki; Giardini, María Cecilia; Augustinos, Antonios A; Drosopoulou, Elena; Lanzavecchia, Silvia B; Cladera, Jorge L; Caceres, Carlos; Bourtzis, Kostas; Mavragani-Tsipidou, Penelope; Zacharopoulou, Antigone

    2016-01-01

    Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6) pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT) applications.

  18. Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member.

    Directory of Open Access Journals (Sweden)

    Angeliki Gariou-Papalexiou

    Full Text Available Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6 pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT applications.

  19. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic

    Science.gov (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  20. OCORRÊNCIA E ÍNDICE DE INFESTAÇÃO DE Anastrepha spp. (DIP., TEPHRITIADE EM Pouteria gardneriana Radlk. E Pouteria ramiflora (Mart. Radlk. (SAPOTACEAE, NOS CERRADOS DE GOIÁS OCCURENCE AND INFESTATION INDEXES OF Anastrepha spp. (DIP., TEPHIRITIDAE IN Pouteria gardneriana RADLK AND Pouteria ramjflora (MART. RADLK. (SAPOTACEAE IN “CERRADOS” OF THE STATE OF GOIÁS, BRAZIL

    Directory of Open Access Journals (Sweden)

    Nelson Augusto Canal Daza

    2007-09-01

    Full Text Available

    Dentre as frutíferas nativas dos cerrados goianos destacam-se as do gênero Pouteria, com ampla distribuição nas regiões tropicais e subtropicais de todo o mundo, sendo a P. ramiflora (curriola a mais comum. Pouteria gardneriana (guapeva ocorre geralmente nos solos mais úmidos, sempre agrupada na faixa de separação cerrados-veredas. Dos 25 municípios do Estado de Goiás amostrados, em nove foi registrada a ocorrência dessas duas espécies de Pouteria, cujos frutos são bastante suscetíveis ao ataque de moscas-das-frutas. Dos frutos de guapeva e curriola, emergiram adultos de Anastrepha (99,82% e apenas alguns exemplares de Ceratitis capitata (0,18%. As espécies coletadas em P. gardneriana foram: Anastrepha bistrigata, A. fraterculus, A. leptozona, A. serpentina, A. zenildae, A. zernyi e C. capitata. De P. ramiflora foram obtidas: A. fraterculus, A. leptozona, A. serpentina e A. zernyi. Dos pupários de Anastrepha

  1. Can consumption of antioxidant rich mushrooms extend longevity?: antioxidant activity of Pleurotus spp. and its effects on Mexican fruit flies' (Anastrepha ludens) longevity.

    Science.gov (United States)

    Sánchez, José E; Jiménez-Pérez, Gabriela; Liedo, Pablo

    2015-12-01

    The variability of antioxidant capacity of 14 strains of the edible oyster mushroom Pleurotus spp. was determined, and the effect of selected mushroom supplements on the longevity of the Mexican fruit fly, Anastrepha ludens, was evaluated. The antioxidant capacity of the fruiting bodies was determined by three different methods, measuring the free radical scavenging activity of methanolic extracts, the OH radical scavenging capacity, and the total phenol content. The inhibition percentage of the DPPH radical varied between 32.6 and 85.7% and total phenols varied between 30.6 and 143.3 mg/g. The strains with the highest (Pleurotus djamor ECS-0142) and lowest (Pleurotus ostreatus ECS-1123) antioxidant capacity were selected to study their effect on the survival, life expectancy, and mortality of the Mexican fruit fly A. ludens. The results demonstrated differing responses between male and female flies. High concentrations of mushrooms (5 and 20%) in the diet resulted in a decrease in life expectancy. However, flies on the diet with 1% P. djamor ECS-0142 showed slightly but significantly greater survival than those on the control diet. The possible adverse effect of protein content in mushroom extracts is discussed.

  2. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae) larvae, under laboratory conditions.

    Science.gov (United States)

    Foelkel, E; Voss, M; Monteiro, L B; Nishimura, G

    2017-03-01

    Entomopathogenic nematodes (EPNs) are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  3. The effect of irradiation and mass rearing on the anti-predator behaviour of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Rao, D; Aguilar-Argüello, S; Montoya, P; Díaz-Fleischer, F

    2014-04-01

    Fruit flies (Diptera: Tephritidae) are major pests worldwide. The sterile insect technique, where millions of flies are reared, sterilized by irradiation and then released, is one of the most successful and ecologically friendly methods of controlling populations of these pests. The mating behaviour of irradiated and non-irradiated flies has been compared in earlier studies, but there has been little attention paid to the anti-predator behaviour of mass-reared flies, especially with respect to wild flies. Tephritid flies perform a supination display to their jumping spider predators in order to deter attacks. In this study, we evaluated the possibility of using this display to determine the anti-predator capabilities of mass-reared irradiated, non-irradiated flies, and wild flies. We used an arena setup and observed bouts between jumping spiders (Phidippus audax Hentz) and male Mexican fruit flies (Anastrepha ludens Loew). We show that although all flies performed a supination display to their predator, wild flies were more likely to perform a display and were significantly more successful in avoiding attack than mass-reared flies. We suggest that this interaction can be used to develop a rapid realistic method of quality control in evaluating anti-predator abilities of mass-reared fruit flies.

  4. Remating behavior in Anastrepha fraterculus (Diptera: Tephritidae) females is affected by male juvenile hormone analog treatment but not by male sterilization.

    Science.gov (United States)

    Abraham, S; Liendo, M C; Devescovi, F; Peralta, P A; Yusef, V; Ruiz, J; Cladera, J L; Vera, M T; Segura, D F

    2013-06-01

    The sterile insect technique (SIT) has been proposed as an area-wide method to control the South American fruit fly, Anastrepha fraterculus (Wiedemann). This technique requires sterilization, a procedure that affects, along with other factors, the ability of males to modulate female sexual receptivity after copulation. Numerous pre-release treatments have been proposed to counteract the detrimental effects of irradiation, rearing and handling and increase SIT effectiveness. These include treating newly emerged males with a juvenile hormone mimic (methoprene) or supplying protein to the male's diet to accelerate sexual maturation prior to release. Here, we examine how male irradiation, methoprene treatment and protein intake affect remating behavior and the amount of sperm stored in inseminated females. In field cage experiments, we found that irradiated laboratory males were equally able to modulate female remating behavior as fertile wild males. However, females mated with 6-day-old, methoprene-treated males remated more and sooner than females mated with naturally matured males, either sterile or wild. Protein intake by males was not sufficient to overcome reduced ability of methoprene-treated males to induce refractory periods in females as lengthy as those induced by wild and naturally matured males. The amount of sperm stored by females was not affected by male irradiation, methoprene treatment or protein intake. This finding revealed that factors in addition to sperm volume intervene in regulating female receptivity after copulation. Implications for SIT are discussed.

  5. Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype.

    Science.gov (United States)

    Hernández-Ortiz, V; Gómez-Anaya, J A; Sánchez, A; McPheron, B A; Aluja, M

    2004-12-01

    Discriminant function and cluster analyses were performed on 19 morphometric variables of the aculeus, wing and mesonotum to determine whether populations of Anastrepha fraterculus (Wiedemann) from different parts of Mexico could be distinguished from populations from South America. Samples were collected from seven localities across Mexico, two from Brazil, and one each from Colombia and Argentina. Results showed there were statistically significant differences between Mexican and South American populations with respect to the aculeus (tip length, length of serrated section, mean number of teeth) and wing (width of S-band and connection between S- and V-bands). The degree of morphological variation observed among Mexican populations was extremely low, and as a consequence, the Mexican populations were identified as a single morphotype by discriminant analysis. The 'Andean morphotype'consisting of the Colombian population, and the 'Brazilian morphotype'consisting of the two Brazilian populations plus the single Argentinian population were also distinguished. It was concluded that the macro-geographical morphotypes from Mexico, Colombia, and Brazil plus Argentina correspond to three distinct taxonomic entities. Comparisons of results with those obtained from behavioural, karyotypic, isozyme and DNA studies suggest that sufficient evidence now exists to name a new Mexican species from within the A. fraterculus complex. This will be done in a separate publication. A provisional key to the morphotypes of A. fraterculus studied is provided.

  6. Quarantine cold treatments for Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) for citrus in Argentina: conclusions after 10 years of research

    Energy Technology Data Exchange (ETDEWEB)

    Willink, Eduardo; Gastaminza, Gerardo; Salvatore, Analia; Gramajo, M. Cecilia; Acenolaza, Mariana; Avila, Rosana; Favre, Paola, E-mail: ewillink@eeaoc.org.a [Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman (Argentina)

    2006-07-01

    Argentina has quarantine restrictions in some markets due to the presence of two quarantine fruit fly pests: Ceratitis capitata and Anastrepha fraterculus. One alternative is the use of cold quarantine treatments during transport of the commodities. Since 1996, the Estacion Experimental Agroindustrial Obispo Colombres (EEAOC), Tucuman, Argentina, has developed different cold quarantine treatments for citrus. In the present work we present all the data the EEAOC generated in the last ten years in order to facilitate the development of such cold treatments. Fruit flies were obtained from the colonies reared at EEAOC. Four citrus species were analyzed: lemon, grapefruit, orange and tangerines. Different varieties were analyzed for each fruit species. Sensitivity trials aiming at determine the most tolerant stage as well as to asses if there is any influence of varieties on cold tolerance were performed. Finally we compared the tolerance to cold between the two species. Sensitivity trials showed that mature larvae (L3) are the most tolerant stage for both fruit fly species. There was no effect of the varieties and the two fruit fly species were equally sensible to cold. Our results provide strong evidence in favor of concluding that any cold treatment developed for C. capitata is effective for A. fraterculus. (author)

  7. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae larvae, under laboratory conditions

    Directory of Open Access Journals (Sweden)

    E. Foelkel

    Full Text Available Abstract Entomopathogenic nematodes (EPNs are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  8. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  9. Acoustic courtship songs in males of the fruit fly Anastrepha ludens (Diptera: Tephritidae associated with geography, mass rearing and courtship success

    Directory of Open Access Journals (Sweden)

    R.D Briceño

    2009-11-01

    Full Text Available The Sterile Insect Technique (SIT has been used successfully to control or eradicate fruit flies. The commonly observed inferiority of mass-reared males, compared with wild males, when they are paired with wild females, is apparently due to their inadequate courtship. Anastrepha ludens males produce two types of wing vibration during courtship and mating, the "calling sound" and the "premating or precopulatory sound". There were clear differences in the calling songs between successful and unsuccessful courtships in sterile (irradiated and fertile Mexican flies. Among sterile flies, successful males produce longer buzzes, shorter interpulses and a higher power spectrum in the signal. Fertile flies showed the same trend. For mating songs a significant difference occurred in two parameters: power spectrum between sterile and fertile flies with respect to the type of song, and the signal duration and intensity were greater in non-irradiated flies. Calling songs of wild flies compared with laboratory grown flies from Mexico had shorter interpulses, longer pulses, and a greater power spectrum. However, in the case of premating songs, the only difference was in the intensity, which was significantly greater in wild males. An unexpected result was not observing pulses during pheromone deposition in wild males from Costa Rica. Comparing the premating songs of wild flies from Costa Rica and Mexico, no significant differences were observed in the duration, and the intensity of the signal was slightly greater in flies from Mexico. Rev. Biol. Trop. 57 (Suppl. 1: 257-265. Epub 2009 November 30.La técnica estéril del insecto (SIT se ha utilizado con éxito para controlar o para suprimir las moscas de fruta y su impacto en los cultivos. La inferioridad comúnmente observada de machos criados masivamente, comparada con los machos silvestres, cuando se aparean con las hembras silvestres es al parecer debido a su inadecuado cortejo. Los machos de Anastrepha

  10. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  11. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae).

    Science.gov (United States)

    Costa, M L Z; Pacheco, M G; Lopes, L A; Botteon, V W; Mastrangelo, T

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America.

  12. Fitness cost implications of PhiC31-mediated site-specific integrations in target-site strains of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Meza, José S; Díaz-Fleischer, Francisco; Sánchez-Velásquez, Lázaro R; Zepeda-Cisneros, Cristina Silvia; Handler, Alfred M; Schetelig, Marc F

    2014-01-01

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understanding the fitness cost implications of these manipulations for transgenic strain applications is critical. In this study independent piggyBac-mediated attP target-sites marked with DsRed were created in several genomic positions in the Mexican fruit fly, Anastrepha ludens. Two of these strains, one having an autosomal (attP_F7) and the other a Y-linked (attP_2-M6y) integration, exhibited fitness parameters (dynamic demography and sexual competitiveness) similar to wild type flies. These strains were thus selected for targeted insertion using, for the first time in mexfly, the phiC31-integrase recombination system to insert an additional EGFP-marked transgene to determine its effect on host strain fitness. Fitness tests showed that the integration event in the int_2-M6y recombinant strain had no significant effect, while the int_F7 recombinant strain exhibited significantly lower fitness relative to the original attP_F7 target-site host strain. These results indicate that while targeted transgene integrations can be achieved without an additional fitness cost, at some genomic positions insertion of additional DNA into a previously integrated transgene can have a significant negative effect. Thus, for targeted transgene insertions fitness costs must be evaluated both previous to and subsequent to new site-specific insertions in the target-site strain.

  13. Sexual behavior and male volatile compounds in wild and mass-reared strains of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae) held under different colony management regimes.

    Science.gov (United States)

    Bosa, Carlos Felipe; Cruz-López, Leopoldo; Zepeda-Cisneros, Cristina Silvia; Valle-Mora, Javier; Guillén-Navarro, Karina; Liedo, Pablo

    2016-02-01

    We compared the calling and mating behavior and volatile release of wild males Anastrepha ludens (Loew) with males from 4 mass-reared strains: (i) a standard mass-reared colony (control), (ii) a genetic sexing strain (Tap-7), (iii) a colony started from males selected on their survival and mating competitiveness abilities (selected), and (iv) a hybrid colony started by crossing wild males with control females. Selected and wild males were more competitive, achieving more matings under field cage conditions. Mass-reared strains showed higher percentages of pheromone calling males under field conditions except for Tap-7 males, which showed the highest percentages of pheromone calling males under laboratory cage conditions. For mature males of all strains, field-cage calling behavior increased during the last hour before sunset, with almost a 2 fold increase exhibited by wild males during the last half hour. The highest peak mating activity of the 4 mass-reared strains occurred 30 min earlier than for wild males. By means of solid phase microextraction (SPME) plus gas chromatography-mass spectrometry (GC-MS), the composition of volatiles released by males was analyzed and quantified. Wild males emitted significantly less amounts of (E,E)-α-farnesene but emitted significantly more amounts of (E,E)-suspensolide as they aged than mass-reared males. Within the 4 mass-reared strains, Tap-7 released significantly more amounts of (E,E)-α-farnesene and hybrid more of (E,E)-suspensolide. Differences in chemical composition could be explained by the intrinsic characteristics of the strains and the colony management regimes. Characterization of calling behavior and age changes of volatile composition between wild and mass-reared strains could explain the differences in mating competitiveness and may be useful for optimizing the sterile insect technique in A. ludens. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  14. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae)

    Science.gov (United States)

    Costa, M. L. Z.; Pacheco, M. G.; Lopes, L. A.; Botteon, V. W.; Mastrangelo, T.

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata. Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata. The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. PMID:27638956

  15. SUSCETIBILIDADE DE GENÓTIPOS DE MACIEIRA A Anastrepha fraterculus (DIPTERA: TEPHRITIDAE EM DIFERENTES CONDIÇÕES DE INFESTAÇÃO

    Directory of Open Access Journals (Sweden)

    JANAÍNA PEREIRA DOS SANTOS

    2015-03-01

    Full Text Available RESUMO O estudo objetivou registrar as injúrias de Anastrepha fraterculus (Diptera: Tephritidae, em dois estádios de desenvolvimento dos frutos das macieiras M-11/00 e ‘Catarina’, submetidos a três condições de infestação a campo, na safra de 2011/2012. O experimento foi conduzido em pomar mantido sob manejo orgânico, na Estação Experimental da Epagri de Caçador-SC. O número médio de moscas foi avaliado semanalmente, com quatro armadilhas do tipo McPhail. Frutos imaturos e maduros da seleção M-11/00 e da cultivar Catarina foram submetidos às condições de infestação artificial, controlada e natural. No início da frutificação, após o raleio, em cada genótipo, 500 frutos foram aleatoriamente ensacados com embalagens de tecido não texturizado (TNT. Os frutos submetidos à infestação artificial foram envoltos, individualmente, por uma gaiola contendo duas fêmeas acasaladas de A. fraterculus, que permaneceram por três dias para oviposição. Na infestação controlada, no mesmo dia da instalação das gaiolas, frutos protegidos tiveram as embalagens retiradas para que ficassem por três dias expostos. Frutos não ensacados foram utilizados para avaliar a infestação natural. Em cada estádio de desenvolvimento, foram registrados os valores dos atributos físico-químicos dos frutos. O número médio de A. fraterculus durante a safra foi de 3,08 moscas/armadilha/ semana. Na seleção M-11/00, em todas as condições de infestação, o número médio de larvas e pupários foi maior em frutos maduros. Na cv. Catarina, estes números não diferiram entre as condições de infestação nem entre os estádios de desenvolvimento. Pupários de A. fraterculus não foram observados em frutos de ‘Catarina’, e nesta cultivar constatou-se maior acidez e menor relação sólidos solúveis/acidez.

  16. Umbu-cajá como repositório natural de parasitoide nativo de moscas-das-frutas Umbu-cajá as natural repository of native fruit fly parasitoids

    Directory of Open Access Journals (Sweden)

    Romulo da Silva Carvalho

    2010-10-01

    Full Text Available O objetivo deste trabalho foi avaliar diversidade de espécies de mosca-das-frutas e de parasitóides nativos em frutos de umbu-cajá (Spondias spp.. Os frutos foram coletados em nove municípios do Estado da Bahia. Estimaram-se: a infestação dos frutos pelas moscas; o índice de parasitismo das moscas; e a frequência de ocorrência das espécies de parasitóides. Pela primeira vez, a infestação de Anastrepha obliqua em frutos de umbu-cajá e a presença do parasitóide Asobara anastrephae em larvas de Anastrepha obliqua foram registradas. O parasitoide nativo Doryctobracon areolatus foi o mais frequente. A umbu-cajazeira é repositório natural de parasitoides de tefritídeos, e sua preservação é fundamental para a manutenção das relações tróficas entre as espécies de mosca-das-frutas e parasitoides.The objective of this work was to assess the species diversity of fruit fly and their parasitoids in fruit of umbu-cajá (Spondias spp.. Fruit were collected in nine municipalities of the state of Bahia, Brazil. Fruit infestation, fruit fly parasitism rates, and frequencies of the parasitoid species were estimated. For the first time, Anastrepha obliqua infesting umbu-cajá fruit and the presence of the native parasitoid Asobara anastrephae in Anastrepha oblique larvae were recorded. The native parasitoid Doryctobracon areolatus was the most frequent. Umbu-cajá tree is a natural repository of Tephritidae parasitoids, and its preservation is essential for the maintenance of trophic relationships between fruit fly species and parasitoids.

  17. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  18. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  19. Species of fruit flies (Tephritidae obtained of McPhail trap in the Bahia State, Brazil/ Espécies de moscas-das-frutas (Tephritidae obtidas em armadilhas McPhail no Estado da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Miguel Francisco de Souza Filho

    2006-07-01

    Full Text Available The objective of this study was to provide knowledge on the species of fruit flies in commercial orchards in counties of the southern and extreme southern regions of the State of Bahia, Brazil. Flies were captured weekly by McPhail traps, using a hydrolyzed corn protein at 5%, as attractant. A total of 257 female was collected, and the species were identified as: Anastrepha fraterculus (77.4%, A. sororcula (4.7%, A. obliqua (2.7%, A. zenildae (0.8%, A. distincta (0.4%, A. consobrina (0.4%, Anastrepha sp.1 (5.1% and Ceratitis capitata (8.5%.O objetivo deste trabalho foi conhecer as espécies de moscas-das-frutas que ocorrem em pomares comerciais em alguns municípios da região sul e extremo-sul do estado da Bahia, Brasil. As moscas-dasfrutas foram capturadas, semanalmente, utilizando-se armadilhas McPhail, tendo como atrativo proteína hidrolisada de milho a 5%. Foi obtido um total de 257 espécimes fêmeas, pertencentes às espécies: Anastrepha fraterculus (77,4%, A. sororcula (4,7%, A. obliqua (2,7%, A. zenildae (0,8%, A. distincta (0,4%, A. consobrina (0,4%, Anastrepha sp.1 (5,1% e Ceratitis capitata (8,5%.

  20. Diversidade de moscas-das-frutas em pomares de citros no município de Araruama, RJ Diversity of fruit flies in citrus groves in the municipality of Araruama, RJ

    Directory of Open Access Journals (Sweden)

    Jorge Ferreira de Souza

    2008-04-01

    Full Text Available O objetivo deste estudo foi determinar as espécies de Tephritidae e Lonchaeidae (Diptera: Tephritoidea de ocorrência em pomares de laranja doce (Citrus sinensis Osbeck e tangerina (Citrus reticulata Blanco, no município de Araruama, RJ, durante o período de dezembro de 2002 a novembro de 2003. Os espécimes foram coletados em armadilhas McPhail contendo solução aquosa de proteína hidrolisada a 5% e em amostras de frutos de seis variedades de citros. Nas armadilhas, o total de 2.543 adultos de Tephritoidea (1.430 fêmeas e 1.023 machos foi capturado, sendo dez espécies de Tephritidae, quatro espécies e dois morfotipos de Lonchaeidae. Dos Tephritidae e capturados nas McPhail, quatro espécies (Anastrepha fraterculus, A. obliqua, A. sororcula e Ceratitis capitata infestaram frutos cítricos, enquanto que, dos Lonchaeidae, somente os morfotipos não infestaram as amostras de citros. Os resultados demonstram que a densidade populacional das moscas-das-frutas pode ser superestimada, quando baseada no número de moscas por armadilha, devido à captura de espécies que não infestam os frutos de interesse comercial.This study was aimed at determining the species of Tephritidae and Lonchaeidae (Diptera: Tephritoidea that occur on groves of sweet orange (Citrus sinensis Osbeck and tangerine (Citrus reticulata Blanco in the municipality of Araruama, state of Rio de Janeiro, Brazil, from December, 2002 to November, 2003. The specimens were collected by McPhail traps with aqueous solution of hydrolyzed protein to 5% and in fruits samples of six varieties of citrus. In the traps the total of 2,543 adults of Tephritoidea (1,430 females and 1,023 males was captured, being ten species of Tephritidae, four species and two morphotypes of Lonchaeidae. From the Tephritidae caught by the McPhail, four species (Anastrepha fraterculus, A. obliqua, A. sororcula and Ceratitis capitata infested citric fruits while the Lonchaeidae, the morphotypes did not infest

  1. Adult Strabismus

    Science.gov (United States)

    ... cause. Is eye straightening as an adult strictly cosmetic? No. Eye alignment surgery is performed in adults for several reasons. Adults ... this surgery? Eye muscle surgery is reconstructive (not cosmetic). In ... will cover strabismus surgery in adults, however, one should check with their ...

  2. Adult Education and Adult Learning

    DEFF Research Database (Denmark)

    Illeris, Knud

    Kort beskrivelse Bogen, 'Adult Education og Adult Learning', giver et fyldestgørende overblik over forståelsen af voksenuddannelse og læring. Abstract I "Adult Education and Adult Learning' ser Knud Illeris på voksenuddannelse fra to perspektiver. På den ene side beskrives de aktuelle udfordringer...

  3. ANÁLISE FAUNÍSTICA DE ESPÉCIES DE MOSCA-DAS-FRUTAS (DIP., TEPHRITIDAE EM MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    N.A. CANAL

    1998-01-01

    Full Text Available Em seis locais de quatro municípios (Janaúba, Jaíba, Nova Porteirinha e Itacarambí do norte do Estado de Minas Gerais, foram coletados 29.454 espécimes de mosca-das-frutas, pertencentes a Ceratitis capitata e a 20 espécies de Anastrepha. O levantamento foi feito entre janeiro de 94 e dezembro de 96, utilizando armadilhas plásticas tipo McPhail. Ceratitis capitata foi a espécie predominante em áreas urbanas. As espécies de Anastrepha predominaram em áreas rurais. A. obliqua, A. zenildae e Anastrepha n. sp.3 foram as espécies predominantes do gênero, entretanto, essa predominância variou de local para local em função da disponibilidade de hospedeiros. As comunidades apresentaram índices de diversidade baixos e quocientes de similaridade entre 73 e 100%.A total of 29,454 specimens of fruit fly were trapped in six sites of four counties (Janaúba, Jaíba, Nova Porteirinha and Itacarambí of the north of the State of Minas Gerais, Brazil. The specimens were collected using McPhail plastic traps from January 1994 to December 1996. The trapped fruit flies belonged to Ceratitis capitata and to 20 species of Anastrepha. Ceratitis capitata was the predominant species in the urban areas and Anastrepha species were predominant in the field areas. A. obliqua, A. zenildae and Anastrepha n. sp.3 were the predominant species of the genera, whereas the predominant species differed among localities, according to host availability. The diversity indexes were low and the coefficient of similarity varied from 73 to 100%.

  4. The Utilization of Sugars and Other Substances by Drosophila,

    Science.gov (United States)

    1948-03-01

    Anastrepha ludens (Baker, et al., 1944), and a number of others. The reviews of Trager, 1941.and 1947, 4nd Uvarov, 1928, furnish extensive re...investigated for several species. The results in hand for the adult and larval bee, the adult blowfly, and for the adult fruit flies Anastrepha and...follows: mannose is used by Calliphora, Anastrepha and Drosophila, but not by the bee. Indeed von Frisch (1934:) .and Staudenmayer (1936)),Ihave

  5. Polymyositis - adult

    Science.gov (United States)

    ... rash is a sign of a similar condition, dermatomyositis . Common symptoms include: Muscle weakness in the shoulders ... in the treatment of refractory adult and juvenile dermatomyositis and adult polymyositis: a randomized, placebo-phase trial. ...

  6. Adult teachers

    DEFF Research Database (Denmark)

    Larsen, Lea Lund

    2011-01-01

    In this paper I examine the research into the process of adult teachers’ practice-based learning as a part of an on-going project titled “Competence development through practice-based learning – a study of adult teacher’s learning processes”. The project relies on the notion of the adult teacher...... as a 'reflective practitioner’, who develops 'the language of practice’, through experience and learns when she is exposed to 'disjuncture’. Research done on continuing professional development and the inquiries done in the field of teacher thinking and within this the research on novices becoming expert...

  7. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control.

  8. Hymenopteran parasitoids associated with frugivorous larvae in a Brazilian caatinga-cerrado ecotone.

    Science.gov (United States)

    De Souza, A R; Lopes-Mielezrski, G N; Lopes, E N; Querino, R B; Corsato, C D A; Giustolin, T A; Zucchi, R A

    2012-04-01

    The purpose of this study was to investigate native species of parasitoids of frugivorous larvae and their associations with host plants in commercial guava orchards and in typical native dry forests of a caatinga-cerrado ecotone in the State of Minas Gerais, Brazil. Nine species of parasitoids were associated with larvae of Anastrepha (Tephritidae) and Neosilba (Lonchaeidae) in fruit of Psidium guajava L. (Myrtaceae), Ziziphus joazeiro Mart. (Rhamnaceae), Spondias tuberosa Arruda (Anacardiaceae), Spondias dulcis Forst. (Anacardiaceae), Syzygium cumini (L.) Skeels (Myrtaceae), and Randia armata (Sw.) DC. (Rubiaceae). Doryctobracon areolatus was the most abundant species, obtained from puparia of Anastrepha zenildae, An. sororcula, An. fraterculus, An. obliqua, and An. turpiniae. This is the first report of Asobara obliqua in Brazil and of As. anastrephae and Tropideucoila weldi in dry forests of Minas Gerais State. The number of species of parasitoids was higher in areas with greater diversity of cultivated species and lower pesticide use. The forest fragments adjacent to the orchards served as shelter for parasitoids of frugivorous larvae.

  9. CPR: Adult

    Medline Plus

    Full Text Available ... AID, CPR and AED LIFEGUARDING Refresher Putting It All Together: CPR—Adult (2:03) Refresher videos only ... Store Contact Us Privacy Policy Terms and Conditions All rights reserved. 2011 American National Red Cross.

  10. Adult Sinusitis

    Science.gov (United States)

    ... Epiphora (Excessive Tearing) Disclosure Statement Printer Friendly Adult Sinusitis Berrylin J. Ferguson, MD Sarah K. Wise, MD ... determine the best treatment for your condition. COMMON SINUSITIS SYMPTOMS Nasal obstruction or nasal congestion Thick & discolored ...

  11. Diversidade de moscas frugívoras (Diptera, Tephritoidea em áreas de matas decídua e ciliar no Pantanal sul-mato-grossense, Brasil Diversity of frugivorous flies (Diptera, Tephritoidea in areas of decidual and riparian forests in South Pantanal, Brazil

    Directory of Open Access Journals (Sweden)

    Edima Ramos Minzão

    2008-09-01

    Full Text Available O conhecimento da diversidade de espécies de moscas nos ecossistemas é importante para subsidiar na escolha de métodos ecologicamente corretos para o controle de tefritóideos (Tephritidae e Lonchaeidae pragas. O objetivo deste trabalho foi avaliar a diversidade de tefritóideos e seus padrões populacionais em áreas de matas decídua e ciliar. As moscas foram capturadas em armadilhas McPhail com atrativo alimentar em duas reservas florestais do município de Corumbá-MS, de agosto de 2003 a agosto de 2004. Treze espécies pertencentes a cinco gêneros e duas famílias foram registradas. No Sítio Pingo de Amor (mata decídua [MD], foram coletadas: Anastrepha dissimilis, A. fraterculus, A. obliqua, A. rheediae, A. sororcula, A. undosa e Ceratitis capitata (Tephritidae e de Lonchaeidae foram capturadas: Dasiops sp.1, Dasiops sp.2, Lonchaea sp.1, Lonchaea sp.2, Neosilba sp.1 e Neosilba sp.2. No Canal do Tamengo (mata ciliar [MC], foram obtidas todas as espécies mencionadas acima, exceto: A. dissimilis, A. rheediae, A. undosa, Dasiops sp.2 and Neosilba sp.2. O índice de diversidade de Shannon-Weaver (H', foi: 2,01 na MD e 1,51 na MC. Anastrepha obliqua foi caracterizada como muito abundante em ambas as reservas florestais. Na mata decídua A. sororcula foi constante e predominante e, Neosilba sp.1, muito abundante. Em ambos os ambientes A. obliqua, Lonchaea sp.2 e Neosilba sp.1 foram muito freqüentes e, A. obliqua e Neosilba sp.1 foram dominantes.The knowledge of fly species diversity and population patterns in the ecosystems is important to subsidy the choice of ecologically correct methods for control of tephritoid pests. The aim of this paper is to evaluate the diversity of tephritoids and their population patterns in a decidual and a riparian forest. Flies were caught in McPhail traps with food bait in two natural forest reserves at the Municipality of Corumbá-MS, from August 2003 to August 2004. Thirteen species belonging to five

  12. CPR: Adult

    Medline Plus

    Full Text Available Refresher Center Home FIRST AID, CPR and AED LIFEGUARDING Refresher Putting It All Together: CPR—Adult (2:03) Refresher videos only utilize this player QUICK LINKS Home RedCross.org Purchase Course Materials Shop Our Store ...

  13. Panic Disorder among Adults

    Science.gov (United States)

    ... Among U.S. Adults Any Disorder Among Children Any Anxiety Disorder Among Adults Any Anxiety Disorder Among Children Agoraphobia Among Adults Agoraphobia Among Children Generalized Anxiety Disorder Among Adults Generalized Anxiety Disorder Among Children Obsessive Compulsive Disorder ...

  14. Obstructive sleep apnea - adults

    Science.gov (United States)

    Sleep apnea - obstructive - adults; Apnea - obstructive sleep apnea syndrome - adults; Sleep-disordered breathing - adults; OSA - adults ... When you sleep, all of the muscles in your body become more relaxed. This includes the muscles that help keep your ...

  15. ESPÉCIES E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS EM UM POMAR COMERCIAL DE MANGUEIRA, NO LITORAL DO ESTADO DO CEARÁ

    Directory of Open Access Journals (Sweden)

    Joseph Jonathan Dantas de Oliveira

    2009-01-01

    Full Text Available The objective of this research was to know the species and the population fluctuation of fruit flies (Diptera: Tephritidae in a commercial mango (Mangifera indica L. orchard in the coast of Ceará State. The study was developed from July of 2005 to July of 2007, in the municipality of Beberibe (CE. The capture of the fruit flies was performed using McPhail traps with 5% corn protein hydrolyzed solution as attractant. Weekly, the captured insects were sorted, the fruit flies were maintained in 70% alcohol solution and subsequently identified. The population fluctuation was estimated using the FTD (Fly/Trap/Day index. During the research, six fruit flies species were captured: Anastrepha obliqua (Macquart (63%, A. zenildae Zucchi (7%, A. sororcula Zucchi (5%, A. fraterculus (Wied. (2%, A. distincta Greene (2% and Ceratitis capitata (Wied. (21%. The Anastrepha spp. and C. capitata population peaked was between April and July, in both years of study.

  16. Moscas frugívoras (Diptera, Tephritoidea coletadas em Aquidauana, MS Frugivorous flies (Diptera, Tephritoidea collected in Aquidauana, MS

    Directory of Open Access Journals (Sweden)

    Sérgio Roberto Rodrigues

    2006-03-01

    Full Text Available No Brasil as moscas frugívoras são pragas importantes de frutas e hortaliças. O conhecimento da flutuação populacional dessas espécies em cada bioma é um importante requisito para a adoção de estratégia de controle de pragas nos agroecossistemas. O objetivo desse trabalho foi avaliar a diversidade de espécies de moscas-das-frutas infestantes de frutas silvestres e cultivadas em Aquidauana, MS. Vinte e uma espécies de frutas foram amostradas de fevereiro de 2003 a janeiro de 2004. As espécies de Tephritidae encontradas foram: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 e Ceratitis capitata (Wiedemann, 1824. Os frugívoros Lonchaeidae e Muscidae encontrados foram: Neosilba sp. e Atherigona orientalis (Schiner, 1868, respectivamente. Um total de 2.568 moscas foram coletadas, das quais 2.394 representadas pela mosca-do-Mediterrâneo C. capitata. A associação entre moscas frugívoras e espécies de frutas é discutida.In Brazil, frugivorous flies represent important pests of fruits and vegetables. Information on populational fluctuation of these species in each biome is an important requirement for the adoption of a strategy of pest control in the agroecosystems. The objective of this paper is to assess the diversity of fruit fly species occurring in wild and cultived fruits in Aquidauana, MS. Twenty-nine fruit species were sampled from February 2003 to January 2004. The Tephritidae species recovered were: Anastrepha striata Schiner, 1868, Anastrepha obliqua (Macquart, 1835 and Ceratitis capitata (Wiedemann, 1824. The frugivorous Lonchaeidae and Muscidae recovered were: Neosilba sp. and Atherigona orientalis (Schiner, 1868, respectively. A total of 2.568 flies were obtained, from which 2.394 flies were the Mediterranean fruit fly, C. capitata. The association between frugivorous flies and the fruit species is discussed.

  17. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  18. Adult Immunization

    Directory of Open Access Journals (Sweden)

    Omer Coskun

    2008-04-01

    Full Text Available Despite the many advances in modern medicine, each year thousands of people in the world die from diseases that are easily prevented by safe and effective vaccines. Few measures in preventive medicine are of such proven value and as easy to implement as routine immunization against infectious diseases. Prevention of infection by immunization is a lifelong process. There are a number of vaccines that all adults (¡I18 years require. There are also other vaccines that need to be tailored to meet individual variations in risk resulting from occupation, foreign travel, underlying illness, lifestyle and age. In this study, we tried to review this important subject. [TAF Prev Med Bull 2008; 7(2.000: 159-166

  19. Adult flatfoot.

    Science.gov (United States)

    Toullec, E

    2015-02-01

    Adult flatfoot is defined as a flattening of the medial arch of the foot in weight-bearing and lack of a propulsive gait. The 3 lesion levels are the talonavicular, tibiotarsal and midfoot joints. The subtalar joint is damaged by the consequent rotational defects. Clinical examination determines deformity and reducibility, and assesses any posterior tibialis muscle deficit, the posterior tibialis tendon and spring ligament being frequently subject to degenerative lesions. Radiographic examination in 3 incidences in weight-bearing is essential, to determine the principal level of deformity. Tendon (posterior tibialis tendon) and ligamentous lesions (spring ligament and interosseous ligament) are analyzed on MRI or ultrasound. In fixed deformities, CT explores for arthritic evolution or specific etiologies. 3D CT reconstruction can analyze bone and joint morphology and contribute to the planning of any osteotomy. Medical management associates insoles and physiotherapy. Acute painful flatfoot requires strict cast immobilization. Surgical treatment associates numerous combinations of procedures, currently under assessment for supple flatfoot: for the hindfoot: medial slide calcaneal osteotomy, calcaneal lengthening osteotomy, or arthroereisis; for the midfoot: arthrodesis on one or several rays, or first cuneiform or first metatarsal osteotomy; for the ankle: medial collateral ligament repair with tendon transfer. Fixed deformities require arthrodesis of one or several joint-lines in the hindfoot; for the ankle, total replacement after realignment of the foot, or tibiotalocalcaneal fusion or ankle and hindfoot fusion; and, for the midfoot, cuneonavicular or cuneometatarsal fusion. Tendinous procedures are often associated. Specific etiologies may need individualized procedures. In conclusion, adult flatfoot tends to be diagnosed and managed too late, with consequent impact on the ankle, the management of which is complex and poorly codified.

  20. Mass production in liquid diet and radiosterilization of South American fruit fly Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae); Criacao massal em dieta liquida e radioesterilizacao da mosca-sulamericana Anastrepha sp.1 aff. fraterculus (Wied., 1830) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Kamiya, Aline Cristiane

    2010-07-01

    Both the biological control techniques as the Sterile Insect Technique (SIT), are used in many countries to control, suppress and even eradicate fruit flies and other pests in agriculture and public health. The use of such techniques minimizes the continuous employment of insecticides, protects the environment and conforms to standards for food safety. However, it is necessary to implement such programs, technology to produce millions of parasitoids and the pest in its own laboratory with biological quality similar to the insects found in nature and cost competitive with chemical control. The objectives of this study was to establish protocols for artificial rearing of A. sp. 1 aff. fraterculus in liquid larval diet that will achieve levels of mass production for a possible reduction in the cost of establishing and determining the dose of radiation sterilization of adult A. sp. 1 aff. fraterculus meeting the quality parameters required by the Sterile Insect Technique with insects from the creation of Radioentomology Laboratory of CENA/USP. Seven experimental diets compared to the conventional diet used in Radioentomology Lab. of CENA/USP, which was used as control. All seven diets have in common the exclusion of agar in its formulation. Only two of the diets tested were suitable for larval development of the fly, they compared with the standard diet, showed inferior results with respect to the volume of recovered larvae, pupae and weight of emergency, however, no significant differences regarding the periods of development , pupal recovery, sex ratio and longevity under stress. It is possible to replace the diet with agar for liquid diets for artificial creation of A. sp. 1 aff. fraterculus, reduced cost and greater convenience of handling, but due to their quality standards lower than the standard diet, more tests are needed especially regarding the adaptability of the insect to the new environment. To determine the sterilizing dose this study examined the

  1. Adults Need Vaccines, Too!

    Science.gov (United States)

    ... turn JavaScript on. Feature: Adult Vaccinations Adults Need Vaccines, Too! Past Issues / Summer 2015 Table of Contents ... of the millions of adults not receiving the vaccines you need? What vaccines do you need? All ...

  2. Brain tumor - primary - adults

    Science.gov (United States)

    ... Vestibular schwannoma (acoustic neuroma) - adults; Meningioma - adults; Cancer - brain tumor (adults) ... Primary brain tumors include any tumor that starts in the brain. Primary brain tumors can start from brain cells, ...

  3. INFESTAÇÃO DE MOSCAS-DAS-FRUTAS EM VARIEDADES DE MANGA (Mangifera indica L. NO ESTADO DE GOIÁS INFESTATION OF FRUIT FLY IN VARIETIES OF MANGO IN THE STATE OF GOIÁS

    Directory of Open Access Journals (Sweden)

    Juracy Rocha Braga Filho

    2007-09-01

    exports. Insect surveys are important in insect ecology, biology and control. From September 1999 to February 2000, ten mango varieties were surveyed for insects and level of natural fruit infestation in three counties of Goias. A total of 1195 pupae were obtained. Of the total adults, 80% were Anastrepha (484, 17.2% Lonchaeidae (104 and 2.8% Braconidae (17. Females belonging to Anastrepha genus and Neosilba genus represented 70.3% and 29.7%, respectively. Four Anastrepha species were identified: A. obliqua (48.78%, A. fraterculus (47.97%, A. sororcula (2.03% and A. turpiniae (1.22%; the latter species reported for the first time attacking mangoes in Goiás. Doryctobracon areolatus was obtained from Imperial and Tommy Atkins mango varieties and was described for the first time attacking mangoes in Goiás. Imperial and Tommy Atkins were the most susceptible varieties with the highest infestation levels (15.3 pupae/fruit and 7.0 pupae/fruit, respectively. Bourbon had no infestation and Sabina was slightly infested (0.363 pupae/fruit.

    KEY-WORDS: Insecta; Diptera; Tephritoidea; damage; parasitoids.

  4. Índice de infestação e diversidade de moscas-das-frutas em hospedeiros exóticos e nativos no pólo de fruticultura de Anagé, BA Index of infestation and diversity of fruit-flies in exotic hosts native to the fruitculture area in Anagé, Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2008-01-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são os principais entraves às exportações de manga nos pólos de fruticultura da Região Sudoeste da Bahia. O presente trabalho teve como objetivo estudar índices de infestação e a diversidade de moscas-das-frutas no pólo de fruticultura de Anagé, BA, visando obter subsídios para o manejo integrado dessas pragas na mangueira, na região. Os estudos foram realizados em 2004 e 2005, nos municípios de Anagé, Belo Campo e Caraíbas, BA, procedendo-se à coleta de frutos de 21 espécies vegetais, nativas e exóticas, e identificação das espécies de moscas associadas. Estimaram-se os índices de infestação em pupários/kg de fruto e pupários/fruto. Os maiores índices de infestação, em pupários/kg de fruto, ocorreram em serigüela (Spondias purpurea L. com 61,3, juá (Ziziphus joazeiro L., 38,3 e umbu (Spondias tuberosa L., 33,1, considerados hospedeiros primários de Anastrepha fraterculus (Wiedemann e A. obliqua (Macquart. As maiores infestações em pupários/fruto ocorreram em serigüela (0,9; umbu (0,7 e cajarana (Spondias sp. (0,2. Com base no monitoramento larval, registra-se, para as condições do pólo de fruticultura de Anagé, a ocorrência das espécies Anastrepha fraterculus, A. obliqua, A. dissimilis, A. amita, A. distincta, A. sororcula, A. zenildae e Ceratitis capitata. Registram-se, pela primeira vez, as seguintes associações bitróficas: juá com A. fraterculus, A. obliqua, A. dissimilis e A. distincta; e umbu com A. amita e A. sororcula.Fruit-flies (Diptera: Tephritidae are the main hindrance for mango exportation in the fruitculture areas of the Southwestern Region of Bahia. The purpose of the present work was to study the indexes of infestation and diversity of fruit-flies in the fruitculture area of Anagé, BA, in order to obtain subsidies to the integrated management of these pests in mango, in this region. Studies were carried out in 2004 and 2005 in the

  5. Adult Neurogenesis in Drosophila

    OpenAIRE

    Ismael Fernández-Hernández; Christa Rhiner; Eduardo Moreno

    2013-01-01

    Adult neurogenesis has been linked to several cognitive functions and neurological disorders. Description of adult neurogenesis in a model organism like Drosophila could facilitate the genetic study of normal and abnormal neurogenesis in the adult brain. So far, formation of new neurons has not been detected in adult fly brains and hence has been thought to be absent in Drosophila. Here, we used an improved lineage-labeling method to show that, surprisingly, adult neurogenesis occurs in the m...

  6. Biodiversidade de moscas-das-frutas (Diptera, Tephritoidea em matas nativas e pomares domésticos de dois municípios do Estado do Tocantins, Brasil Biodiversity of fruit flies (Diptera, Tephritoidea in native forests and orchards in two counties of the State of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Darcy A. do Bomfim

    2007-01-01

    Full Text Available Este trabalho apresenta análise faunística comparativa das espécies de moscas-das-frutas capturadas em armadilhas McPhail (junho a dezembro de 2002 com proteína hidrolisada de milho a 5%. Foram comparadas a riqueza de espécies e a estrutura populacional entre ambientes de mata e pomar dos municípios de Palmas e Porto Nacional, TO. Foram capturados 1.748 indivíduos de espécies de três gêneros de Tephritidae: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 e Ceratitis MacLeay, 1829. De Lonchaeidae foram capturadas espécies de três gêneros: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 e Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824. Dezenove espécies de Anastrepha foram coletadas, sendo a maioria dos indivíduos (69,1% de A. obliqua (Macquart, 1835. Não houve diferença significativa (P This paper presents comparative and faunistic analysis of the species of fruit flies captured in McPhail traps (from June to December 2002 baited with 5% corn protein hydrolyzed. Species richness and the patterns of population are compared between forest and orchard environments and between the counties of Palmas and Porto Nacional. A total of 1,748 individuals of Tephritidae belonging to species of three genera were collected: Tomoplagia Coquillett, 1910, Anastrepha Schiner, 1868 and Ceratitis MacLeay, 1829. Species of three genera of Lonchaeidae were also captured: Lonchaea Fallén, 1820, Neosilba McAlpine, 1962 and Dasiops Rondani, 1856. Ceratitis capitata (Wiedemann, 1824 and nineteen species of the genus Anastrepha were collected. Most of the collected individuals (69.1% belonged to A. obliqua (Macquart, 1935. The average numbers of tephritid individuals in Palmas and native forests were significantly lower than Porto Nacional and orchards, respectively. According to the Shannon diversity index (H' and test t used for comparing the fruit flies fauna among the environments, it was verified that only one comparison showed

  7. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  8. Clueless? Adult Mysteries with Young Adult Appeal.

    Science.gov (United States)

    Charles, John; Morrison, Joanna

    1997-01-01

    Presents a list of adult mystery titles for young adult readers. Includes first titles in a series (for reading in order); new and lesser-known mystery authors' works are the focus. Annotations include plot summary. The rest of each annotation is for professional use (includes date and name of award bestowed). (AEF)

  9. Young Adult Literature for Young Adult Males.

    Science.gov (United States)

    Gill, Sam D.

    1999-01-01

    Argues that young adult literature can play a significant role in the emotional and mental health of an adolescent as well as help young males become more literate. Offers a 19-item annotated list of young adult novels with male protagonists, sorted by themes: nature and adventure stories, sports stories, genre stories, historical stories, and…

  10. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  11. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  12. Adults Living with OI

    Science.gov (United States)

    ... Adults & Fractures Adult Health Dental Considerations Hearing Loss Pregnancy Surgical Considerations Social Security Talking with your Doctor Talking with your Orthopedist Vertebral Compression Fractures OI and Osteoporosis Can't find the information you're looking ...

  13. Canadian Adult Basic Education.

    Science.gov (United States)

    Brooke, W. Michael, Comp.

    "Trends," a publication of the Canadian Association for Adult Education, is a collection of abstracts on selected subjects affecting adult education; this issue is on adult basic education (ABE). It covers teachers and teacher training, psychological factors relating to the ABE teacher and students, manuals for teachers, instructional…

  14. Dimensions of Adult Learning

    Science.gov (United States)

    Foley, Griff, Ed.

    2004-01-01

    This broad introduction to adult and postcompulsory education offers an overview of the field for students, adult educators and workplace trainers. The book establishes an analytical framework to emphasize the nature of learning and agency of learners; examines the core knowledge and skills that adult educators need; discusses policy, research and…

  15. Adult Education in Turkey

    Science.gov (United States)

    Miser, Rifat; Ural, Ozana; Ünlühisarýklý, Özlem

    2013-01-01

    This study investigates the situation and practices of adult education in Turkey in terms of (a) participants, (b) providers, and (c) program areas. The data were derived from published statistical data and one-to-one interaction with adult education providers when such data are unavailable. Turkey has a long tradition of adult education with…

  16. Adults Role in Bullying

    Science.gov (United States)

    Notar, Charles E.; Padgett, Sharon

    2013-01-01

    Do adults play a role in bullying? Do parents, teachers, school staff, and community adult leaders influence bullying behavior in children and teenagers? This article will focus on research regarding all adults who have almost daily contact with children and teens and their part in how bullying is identified, addressed, and prevented. This article…

  17. The Adult Experience.

    Science.gov (United States)

    Belsky, Janet

    The 14 chapters of this textbook chronicle adult development from youth through old age, emphasizing both research and interviews with adults at various stages in their lives. Topics covered include the following: (1) the academic field of adult development; (2) theories and research methods; (3) aging and disease prevention; (4) sexuality and…

  18. Chronic obstructive pulmonary disease - adults - discharge

    Science.gov (United States)

    COPD - adults - discharge; Chronic obstructive airways disease - adults - discharge; Chronic obstructive lung disease - adults - discharge; Chronic bronchitis - adults - discharge; Emphysema - adults - discharge; Bronchitis - ...

  19. Obsessive Compulsive Disorder among Adults

    Science.gov (United States)

    ... Among U.S. Adults Any Disorder Among Children Any Anxiety Disorder Among Adults Any Anxiety Disorder Among Children Agoraphobia Among Adults Agoraphobia Among Children Generalized Anxiety Disorder Among Adults Generalized Anxiety Disorder Among Children Obsessive Compulsive Disorder ...

  20. Adult attachment styles

    Directory of Open Access Journals (Sweden)

    Maša Žvelc

    2007-01-01

    Full Text Available Theory of attachment primarily described early relationships between a child and his caretakers. In the last twenty years there is a growing interest in adult attachment research. Theories and research findings of adult attachment stem from two different methodological approaches. The first approach measures adult attachment through Adult Attachment Interview (AAI; Main, 1991 where the attachment is assessed through the narratives of adult people of their early child experiences with their primary caretakers. The second approach measures adult attachment with the help of self-evaluative questionnaires, developed by (a Hazan and Shaver (1987 who started this approach in the field of personality and social psychology, and (b Bartholomew and Horowitz (1991. Research shows that there is significant correlation between early and adult attachment style. Attachment styles are passed from generation to generation. Basic adult attachment styles are: securely attached, preoccupied, fearful-avoidant, dismissing-avoidant and disorganized. Previous research using Barholomew and Horowitz (1991 Relationship Questionnaire on 176 Slovenian students showed that 48% students are securely attached, 29% are fearful-avoidant, 10% are dismissing-avoidant, and 13% have preoccupied attachment style. Theory of attachment is very useful for understanding the behavior and subjective experiences of children and adults. It is applicable to different contexts (psychotherapy, counseling, education .... The paper proposes further research focused on integration of adult attachment styles and types of object relations measured by Test of object relations (Žvelc, 1998 and Pictorial test of Separation and Individuation (Žvelc, 2003.

  1. Enhancing male sexual success in a lekking fly (Ananstrepha suspensa (Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality

    Science.gov (United States)

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual su...

  2. Participation in adult learning

    DEFF Research Database (Denmark)

    Desjardins, Richard

    2010-01-01

    This entry presents an internationally comparative overview of adult learning patterns. Emphasis is placed on who is participating in adult learning and the observed unequal chances to participate. The entry covers three overarching questions that are central to participation research: a) What...

  3. Adult learning in modernity

    DEFF Research Database (Denmark)

    Rasmussen, Palle

    2007-01-01

    The paper discusses the conditions for the growth of adult education in modern societies. It is argued that in modern adult life individual biographical reflection plays an increasing role, not only for educational and occupational choice but also in the process of identity formation and emotional...

  4. Authenticity in Adult Learning

    Science.gov (United States)

    Ashton, Sam

    2010-01-01

    This paper is concerned with the relationship between authenticity and adult learning and prompted by some studies in which adult "authentic learning" is a central concept. The implication revealed by them is that real-worldness of learning contexts, learning content and learning tasks is perceived as conferring authenticity on learning. Here,…

  5. Phenylketonuria (PKU in adults

    Directory of Open Access Journals (Sweden)

    Mercedes Martínez-Pardo

    2014-07-01

    Full Text Available Monitoring phenylketonuria adult patients is an important subject which has created considerable interest in specialized metabolic clinics. The aim of this paper is to present an overview of the experience with these patients in the Unit of Metabolic Diseases at the Hospital Ramon y Cajal; the use of sapropterin in adults is included.

  6. Toward Transpersonal Adult Development

    Science.gov (United States)

    Boucouvalas, Marcie

    2016-01-01

    As a foundation for discussing transpersonal adult development, the author traces her trajectory, involvement in, and contribution to the modern transpersonal movement and her introduction of it to the adult learning literature, beginning during the early 1980s. Highlighted are the transpersonal domain and a differentiation between transpersonal…

  7. Tracking adult stem cells.

    Science.gov (United States)

    Snippert, Hugo J; Clevers, Hans

    2011-02-01

    The maintenance of stem-cell-driven tissue homeostasis requires a balance between the generation and loss of cell mass. Adult stem cells have a close relationship with the surrounding tissue--known as their niche--and thus, stem-cell studies should preferably be performed in a physiological context, rather than outside their natural environment. The mouse is an attractive model in which to study adult mammalian stem cells, as numerous experimental systems and genetic tools are available. In this review, we describe strategies commonly used to identify and functionally characterize adult stem cells in mice and discuss their potential, limitations and interpretations, as well as how they have informed our understanding of adult stem-cell biology. An accurate interpretation of physiologically relevant stem-cell assays is crucial to identify adult stem cells and elucidate how they self-renew and give rise to differentiated progeny.

  8. Adult and lifelong education

    DEFF Research Database (Denmark)

    Milana, Marcella; Holford, John; Mohorčič Špolar, Vida

    2014-01-01

    The contributions published in this special issue of Globalisation, Societies and Education draw from an international conference “Trans-nationalization of Educational Policy Making: Implications for Adult and Lifelong Learning”, held in Nottingham on 10-12 February 2012. The conference...... was organised by the Research Network on Policy Studies on Adult Education, established under the auspices of the European Society for the Research on the Education of Adults (ESREA). The aim of the conference was to explore how globalisation affects agency and policy processes in the area of adult and lifelong...... education, and the conditions or structures under which policy processes occur. The objective was to deepen understanding of how scientific inquiry – as a means of comprehending and interpreting current processes and their implications – can accompany and support contemporary developments in adult...

  9. Adult and lifelong education

    DEFF Research Database (Denmark)

    Milana, Marcella; Holford, John; Mohorčič Špolar, Vida

    2014-01-01

    The contributions published in this special issue of Globalisation, Societies and Education draw from an international conference “Trans-nationalization of Educational Policy Making: Implications for Adult and Lifelong Learning”, held in Nottingham on 10-12 February 2012. The conference...... and lifelong education. Accordingly, the focus was on on-going analysis and reflections on the implications for adult and lifelong education policies of globalization, and the trans-nationalization of decision-making that comes with it. This special issue brings together a first selection of papers presented...... was organised by the Research Network on Policy Studies on Adult Education, established under the auspices of the European Society for the Research on the Education of Adults (ESREA). The aim of the conference was to explore how globalisation affects agency and policy processes in the area of adult and lifelong...

  10. Schizophrenia in older adults.

    Science.gov (United States)

    Collier, Elizabeth; Sorrell, Jeanne M

    2011-11-01

    Although the number of people older than 55 with schizophrenia is expected to double during the next 20 years, the research data on older adults with schizophrenia are limited. This appears to be because until the middle of the 20th century, it was assumed that mental illness in older adults was a part of the aging process and because older adults are often excluded from research investigations. Nursing research is needed to explore how people with schizophrenia learn to manage their problems as they age, as well as how those who are first diagnosed with schizophrenia in later life adapt to their illness. Mental health nurses need to be cautious in assigning premature labels to older adults with mental illness that may lead to unsubstantiated assumptions about levels of disability. Instead, nurses should realize individual potential regarding undiscovered strengths and should attempt to create interventions that recognize and foster personal development for older adults with schizophrenia.

  11. Adults with Congenital Heart Defects

    Science.gov (United States)

    ... Disease Venous Thromboembolism Aortic Aneurysm More Web Booklet: Adults With Congenital Heart Defects Updated:Aug 29,2017 ... the list below to learn more. Web Booklet: Adults With Congenital Heart Defects Introduction Introduction: Adults with ...

  12. Depression in older adults.

    Science.gov (United States)

    Fiske, Amy; Wetherell, Julie Loebach; Gatz, Margaret

    2009-01-01

    Depression is less prevalent among older adults than among younger adults, but it can have serious consequences. More than half of cases represent a first onset in later life. Although suicide rates in the elderly are declining, they are still higher than in younger adults and are more closely associated with depression. Depressed older adults are less likely to endorse affective symptoms and more likely to display cognitive changes, somatic symptoms, and loss of interest than are depressed younger adults. Risk factors leading to the development of late-life depression likely comprise complex interactions among genetic vulnerabilities, cognitive diathesis, age-associated neurobiological changes, and stressful events. Insomnia is an often overlooked risk factor for late-life depression. We suggest that a common pathway to depression in older adults, regardless of which predisposing risks are most prominent, may be curtailment of daily activities. Accompanying self-critical thinking may exacerbate and maintain a depressed state. Offsetting the increasing prevalence of certain risk factors in late life are age-related increases in psychological resilience. Other protective factors include higher education and socioeconomic status, engagement in valued activities, and religious or spiritual involvement. Treatments including behavioral therapy, cognitive-behavioral therapy, cognitive bibliotherapy, problem-solving therapy, brief psychodynamic therapy, and life review/reminiscence therapy are effective but are too infrequently used with older adults. Preventive interventions including education for individuals with chronic illness, behavioral activation, cognitive restructuring, problem-solving skills training, group support, and life review have also received support.

  13. English in Adult Education

    OpenAIRE

    Ostrowska, Katarzyna, 1985-

    2014-01-01

    The study was conducted in order to investigate the effectiveness of a specialized program to meet the needs of adults who have diverse English skills and use English as a Lingua Franca. The program was developed for Menntastoðir, an adult education program in Reykjanesbær. Menntastoðir is an adult education institution that provides opportunities for improving adults’ knowledge and competences. The purpose of the study is to map out the type and amount of English exposure among Menntastoðir ...

  14. Adult Acute Lymphoblastic Leukemia

    Science.gov (United States)

    Faderl, Stefan; O’Brien, Susan; Pui, Ching-Hon; Stock, Wendy; Wetzler, Meir; Hoelzer, Dieter; Kantarjian, Hagop M.

    2016-01-01

    Acute lymphoblastic leukemia (ALL), a clonal expansion of hematopoietic blasts, is a highly heterogeneous disease comprising many entities for which distinct treatment strategies are pursued. Although ALL is a success story in pediatric oncology, results in adults lag behind those in children. An expansion of new drugs, more reliable immunologic and molecular techniques for the assessment of minimal residual disease, and efforts at more precise risk stratification are generating new aspects of adult ALL therapy. For this review, the authors summarized pertinent and recent literature on ALL biology and therapy, and they discuss current strategies and potential implications of novel approaches to the management of adult ALL. PMID:20101737

  15. Young Adult Books.

    Science.gov (United States)

    Epstein, Connie C.

    1987-01-01

    Considers the similarities between science fiction writing and young adult literature, and points out that several well-known authors, such as Robert Heinlein and Jane Yolen, write in both genres. (NKA)

  16. Nephrotic Syndrome in Adults

    Science.gov (United States)

    ... Kidney Disease Nephrotic Syndrome in Adults Related Topics Section Navigation Kidney Disease Acquired Cystic Kidney Disease Amyloidosis & ... for a Child with Kidney Disease Ectopic Kidney Medullary Sponge Kidney Kidney Dysplasia Kidney Failure Choosing a ...

  17. CPR - adult - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100219.htm CPR - adult - series—Check for responsiveness To use the ... A.M. Editorial team. Related MedlinePlus Health Topics CPR A.D.A.M., Inc. is accredited by ...

  18. Adult Basic Education: Reading.

    Science.gov (United States)

    Newman, Anabel P.

    This book is designed to provide practical suggestions and teaching approaches for both administrators and instructors involved in teaching reading to adults. The book contains the following chapters: (1) "Overview"; (2) "Diagnosing Learner Characteristics"; (3) "Goals and Objectives"; (4) "Planning…

  19. Older Adults and Alcohol

    Science.gov (United States)

    ... Problems Certain health problems are common in older adults. Heavy drinking can make these problems worse, including: Diabetes High blood pressure Congestive heart failure Liver problems Osteoporosis Memory problems Mood disorders Bad Interactions with Medications ...

  20. NOHSS Adult Indicators

    Data.gov (United States)

    U.S. Department of Health & Human Services — 2012-2014 (even years). Data from BRFSS for indicators of adult oral health for even years from 2012 through 2014. National estimates are represented by the median...

  1. Urinary tract infection - adults

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000521.htm Urinary tract infection - adults To use the sharing features on this page, please enable JavaScript. A urinary tract infection, or UTI, is an infection of the urinary ...

  2. Immunization Schedules for Adults

    Science.gov (United States)

    ... Everyone: Easy-to-read Schedules Infants and Children Preteens and Teens Adults Display Immunization Schedules and Quiz ... file Microsoft Word file Microsoft Excel file Audio/Video file Apple Quicktime file RealPlayer file Text file ...

  3. Older Adults and Depression

    Science.gov (United States)

    ... find more information? Reprints Share Older Adults and Depression Download PDF Download ePub Order a free hardcopy ... depression need treatment to feel better. Types of Depression There are several types of depression. The most ...

  4. Adult Day Services

    Science.gov (United States)

    ... the National Adult Day Services Association. 2. U.S. Health Care Costs: Background Brief , The Henry J. Kaiser Family Foundation (2008) (www.kaiseredu.org); excerpt from Nursing Homes and Assisted Living Industry Profile , First Research ( ...

  5. Pneumonia - adults - discharge

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000017.htm Pneumonia in adults - discharge To use the sharing features on this page, please enable JavaScript. You have pneumonia, which is an infection in your lungs. In ...

  6. Motivation and Adult Education.

    Science.gov (United States)

    Taylor, J. Rodney

    1982-01-01

    The author reviews theories of human motivation: Lewin's force field analysis, Skinner's operant reinforcement theory, and Maslow's hierarchy of needs. He then extracts the implications of these theories for adult learning. SK)

  7. Motivation and Adult Education.

    Science.gov (United States)

    Taylor, J. Rodney

    1982-01-01

    The author reviews theories of human motivation: Lewin's force field analysis, Skinner's operant reinforcement theory, and Maslow's hierarchy of needs. He then extracts the implications of these theories for adult learning. SK)

  8. Sinusitis in adults - aftercare

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000563.htm Sinusitis in adults - aftercare To use the sharing features ... Bending forward with your head down Allergies and Sinusitis Allergies that are not well-controlled can make ...

  9. Adult Neurogenesis in Fish.

    Science.gov (United States)

    Ganz, Julia; Brand, Michael

    2016-07-01

    Teleost fish have a remarkable neurogenic and regenerative capacity in the adult throughout the rostrocaudal axis of the brain. The distribution of proliferation zones shows a remarkable conservation, even in distantly related teleost species, suggesting a common teleost ground plan of proliferation zones. There are different progenitor populations in the neurogenic niches-progenitors positive for radial glial markers (dorsal telencephalon, hypothalamus) and progenitors with neuroepithelial-like characteristics (ventral telencephalon, optic tectum, cerebellum). Definition of these progenitors has allowed studying their role in normal growth of the adult brain, but also when challenged following a lesion. From these studies, important roles have emerged for intrinsic mechanisms and extrinsic signals controlling the activation of adult neurogenesis that enable regeneration of the adult brain to occur, opening up new perspectives on rekindling regeneration also in the context of the mammalian brain.

  10. NOHSS Adult Indicators

    Data.gov (United States)

    U.S. Department of Health & Human Services — 2012-2014 (even years). Data from BRFSS for indicators of adult oral health for even years from 2012 through 2014. National estimates are represented by the median...

  11. Mosquito, adult (image)

    Science.gov (United States)

    This illustration shows an adult southern house mosquito. This mosquito feeds on blood and is the carrier of many diseases, such as encephalitis, West Nile, dengue fever, yellow fever, and others. ( ...

  12. Speech impairment (adult)

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003204.htm Speech impairment (adult) To use the sharing features on ... 2017, A.D.A.M., Inc. Duplication for commercial use must be authorized in writing by ADAM ...

  13. About BMI for Adults

    Science.gov (United States)

    ... Nutrition Physical Activity Overweight & Obesity Healthy Weight Breastfeeding Micronutrient Malnutrition State and Local Programs About Adult BMI ... Nutrition Physical Activity Overweight & Obesity Healthy Weight Breastfeeding Micronutrient Malnutrition State and Local Programs Language: English Español ( ...

  14. Falls and Older Adults

    Science.gov (United States)

    ... version of this page please turn Javascript on. Falls and Older Adults About Falls Risk Increases With Age Many people have a ... problems -- rises with age. Click for more information Falls Lead to Fractures, Trauma Each year, more than ...

  15. Adult onset tic disorders

    OpenAIRE

    Chouinard, S; Ford, B.

    2000-01-01

    BACKGROUND—Tic disorders presenting during adulthood have infrequently been described in the medical literature. Most reports depict adult onset secondary tic disorders caused by trauma, encephalitis, and other acquired conditions. Only rare reports describe idiopathic adult onset tic disorders, and most of these cases represent recurrent childhood tic disorders.
OBJECTIVE—To describe a large series of patients with tic disorders presenting during adulthood, to compare cl...

  16. Cardiac imaging in adults

    Energy Technology Data Exchange (ETDEWEB)

    Jaffe, C.C.

    1987-01-01

    This book approaches adult cardiac disease from the correlative imaging perspective. It includes chest X-rays and angiographs, 2-dimensional echocardiograms with explanatory diagrams for clarity, plus details on digital radiology, nuclear medicine techniques, CT and MRI. It also covers the normal heart, valvular heart disease, myocardial disease, pericardial disease, bacterial endocarditis, aortic aneurysm, cardiac tumors, and congenital heart disease of the adult. It points out those aspects where one imaging technique has significant superiority.

  17. Adult extracardiac rhabdomyoma

    DEFF Research Database (Denmark)

    Bjørndal Sørensen, Kristine; Godballe, Christian; Ostergaard, Birthe;

    2006-01-01

    BACKGROUND: We present two cases of adult rhabdomyoma in the parapharyngeal space. They are rare benign tumors with a characteristic histologic appearance. METHODS: The tumors were studied by light and immunohistochemical analysis using stains characteristic of striated muscle fibers. RESULTS...... slight proliferation with incipient differentiation in an otherwise mature tumor. CONCLUSION: The head and neck area harbors 90% of adult rhabdomyomas and should be considered in a differential diagnosis in this region. Immunohistochemistry confirms that the tumors are almost totally mature neoplasms...

  18. Adult educators' core competences

    Science.gov (United States)

    Wahlgren, Bjarne

    2016-06-01

    Which competences do professional adult educators need? This research note discusses the topic from a comparative perspective, finding that adult educators' required competences are wide-ranging, heterogeneous and complex. They are subject to context in terms of national and cultural environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or "core" requirements, organising them into four thematic subcategories: (1) communicating subject knowledge; (2) taking students' prior learning into account; (3) supporting a learning environment; and (4) the adult educator's reflection on his or her own performance. At the end of his analysis of different competence profiles, the author notes that adult educators' ability to train adult learners in a way which then enables them to apply and use what they have learned in practice (thus performing knowledge transfer) still seems to be overlooked.

  19. China's Successful Adult Literacy Campaign.

    Science.gov (United States)

    Hopkins, Dorothy

    1986-01-01

    Describes the Chinese effort to eliminate adult illiteracy. The author discusses purposes of adult education, history of adult literacy education, adult illiteracy statistics, the design of literacy education, curriculum construction, teaching methods, evaluation of the literacy education process, impact of literacy education, and implications of…

  20. Empathy in Adult Education

    Directory of Open Access Journals (Sweden)

    Natalija Vrečer

    2015-10-01

    Full Text Available Empathy is an important part of emotional intelligence and the latter is crucial for human relations, whether they be interpersonal relations, relations among people at work, or in a wider community. Therefore, empathy is important for adult education, for guidance counsellors, and for other adult educators. Adult educators must be empathic in order to understand the perspectives and needs of the participants in the educational process and empathy is a precondition for understanding. The development of empathy as a competence is a lifelong learning process. Namely, despite some biological predispositions for empathy, the latter can be learnt. It is the contention of the article that empathy is one of the most important intercultural competencies, because if a person is not empathic, other intercultural competencies vary rarely cannot develop to their full extent. Thus empathy is a precondition for successful intercultural dialogue.

  1. Electroporation of adult zebrafish.

    Science.gov (United States)

    Rao, N Madhusudhana; Rambabu, K Murali; Rao, S Harinarayana

    2008-01-01

    We generated transient transgenic zebrafish by applying electrical pulses subsequent to injection of DNA into muscle tissue of 3-6-month old adult zebrafish. Electroporation parameters, such as number of pulses, voltage, and amount of plasmid DNA, were optimized and found that 6 pulses of 40 V/cm at 15 mug/fish increased the luciferase expression by 10-fold compared with those in controls. By measuring the expression of luciferase, in vivo by electroporation in adult zebrafish and in vitro using fish cell line (Xiphophorus xiphidium A2 cells), the strength of three promoters (CMV, human EF-1alpha, and Xenopus EF-1alpha) was compared. Subsequent to electroporation after injecting DNA in the mid region of zebrafish, expression of green fluorescent protein was found far away from the site of injection in the head and the tail sections. Thus, electroporation in adult zebrafish provides a rapid way of testing the behavior of gene sequences in the whole organism.

  2. Hypertension in young adults.

    Science.gov (United States)

    De Venecia, Toni; Lu, Marvin; Figueredo, Vincent M

    2016-01-01

    Hypertension remains a major societal problem affecting 76 million, or approximately one third, of US adults. While more prevalent in the older population, an increasing incidence in the younger population, including athletes, is being observed. Active individuals, like the young and athletes, are viewed as free of diseases such as hypertension. However, the increased prevalence of traditional risk factors in the young, including obesity, diabetes mellitus, and renal disease, increase the risk of developing hypertension in younger adults. Psychosocial factors may also be contributing factors to the increasing incidence of hypertension in the younger population. Increased left ventricular wall thickness and mass are increasingly found in young adults on routine echocardiograms and predict future cardiovascular events. This increasing incidence of hypertension in the young calls for early surveillance and prompt treatment to prevent future cardiac events. In this review we present the current epidemiological data, potential mechanisms, clinical implications, and treatment of hypertension in young patients and athletes.

  3. Back pain in adults.

    Science.gov (United States)

    Becker, Jonathan A; Stumbo, Jessica R

    2013-06-01

    This article provides a summary of the many causes of back pain in adults. There is an overview of the history and physical examination with attention paid to red flags that alert the clinician to more worrisome causes of low back pain. An extensive differential diagnosis for back pain in adults is provided along with key historical and physical examination findings. The various therapeutic options are summarized with an emphasis on evidence-based findings. These reviewed treatments include medication, physical therapy, topical treatments, injections, and complementary and alternative medicine. The indications for surgery and specialty referral are also discussed.

  4. Obesity in Older Adults.

    Science.gov (United States)

    Kalish, Virginia B

    2016-03-01

    The percentage of older obese adults is on the rise. Many clinicians underestimate the health consequences of obesity in the elderly, citing scarce evidence and concerns that weight loss might be detrimental to the health of older adults. Although overweight and obese elders are not at the same risk for morbidity and mortality as younger individuals, quality of life and function are adversely impacted. Weight loss plans in the elderly should include aerobic activities as well as balance and resistance activities to maintain optimal physical function. Published by Elsevier Inc.

  5. Migration and Adult Education

    Science.gov (United States)

    Gois, William

    2007-01-01

    The objective of this paper is to highlight the role of adult education as a tool in addressing labour migration issues, specifically those concerning the protection of migrant workers' rights and the transformation of the impact of migration into positive holistic developmental gains. The view of labour migration as a means to forge the economic…

  6. Adult Education in Brazil.

    Science.gov (United States)

    Ministerio da Educacao e Cultura, Rio de Janeiro (Brazil).

    The status and goals of adult education programs in Brazil are discussed in this report. Supplemental systems such as the Brazilian Literacy Movement (Mobral) and their results are described and evaluated. Charts detailing the evolution of literacy are shown and priorities in education are suggested. The progress of other educational entities is…

  7. Tracking adult stem cells

    NARCIS (Netherlands)

    Snippert, H.J.G.; Clevers, H.

    2011-01-01

    The maintenance of stem-cell-driven tissue homeostasis requires a balance between the generation and loss of cell mass. Adult stem cells have a close relationship with the surrounding tissue--known as their niche--and thus, stem-cell studies should preferably be performed in a physiological context,

  8. Adult intergenerational relationships

    NARCIS (Netherlands)

    Kalmijn, M.; Treas, J.; Scott, J.; Richards, M.

    2014-01-01

    This chapter gives an overview of research on the relationships between parents and their adult, grown-up children. Interest in intergenerational ties has increased again as a result of the aging of Western societies. The chapter discusses the following topics in the literature: (i) the degree to wh

  9. Adult issues in phenylketonuria.

    NARCIS (Netherlands)

    Hoeks, M.P.; Heijer, M. den; Janssen, M.C.H.

    2009-01-01

    Phenylketonuria (PKU) is a classical example of an inherited metabolic disease, in which mental retardation can be prevented successfully by using a diet. However, in adult PKU new problems occur, such as vitamin deficiencies, osteoporosis and the maternal PKU syndrome. The aim of this review articl

  10. Smoking and Older Adults

    Centers for Disease Control (CDC) Podcasts

    2008-10-27

    This podcast discusses the importance of older adults quitting smoking and other tobacco products. It is primarily targeted to public health and aging services professionals.  Created: 10/27/2008 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 11/20/2008.

  11. Adult onset Leigh syndrome

    Directory of Open Access Journals (Sweden)

    Pandit Lekha

    2007-01-01

    Full Text Available Leigh syndrome is a rare progressive mitochondrial disorder of oxidative metabolism. Though it has been reported in infancy and childhood, it is rarely described in adults. The authors describe a patient who had clinical and magnetic resonance imaging features diagnostic of Leigh syndrome, with supportive biochemical and muscle histochemistry evidence.

  12. Police and Adult Education.

    Science.gov (United States)

    Sims, Vic

    The literature on adult education for police is reviewed and criticized. Among the publications that have been influential in debating the need for police education are Charles B. Saunder's "The Challenge of Crime in a Free Society" (1976), which endorses the Presidential Commission on Law Enforcement's recommendations regarding the vital…

  13. Facilitation of Adult Development

    Science.gov (United States)

    Boydell, Tom

    2016-01-01

    Taking an autobiographical approach, I tell the story of my experiences facilitating adult development, in a polytechnic and as a management consultant. I relate these to a developmental framework of Modes of Being and Learning that I created and elaborated with colleagues. I connect this picture with a number of related models, theories,…

  14. Dealing with Adult Illiteracy.

    Science.gov (United States)

    USA Today, 1979

    1979-01-01

    Summarizes the findings of a recent study, "Adult Illiteracy in the United States: A Report to the Ford Foundation." Incidence of reading difficulties, effectiveness of literacy programs, and the relationship of reading ability to poverty are some of the topics discussed. New community-based literacy initiatives are recommended. (SJL)

  15. Adult issues in phenylketonuria.

    NARCIS (Netherlands)

    Hoeks, M.P.; Heijer, M. den; Janssen, M.C.H.

    2009-01-01

    Phenylketonuria (PKU) is a classical example of an inherited metabolic disease, in which mental retardation can be prevented successfully by using a diet. However, in adult PKU new problems occur, such as vitamin deficiencies, osteoporosis and the maternal PKU syndrome. The aim of this review

  16. More Adults Are Walking

    Centers for Disease Control (CDC) Podcasts

    2012-07-31

    This podcast is based on the August 2012 CDC Vital Signs report. While more adults are walking, only half get the recommended amount of physical activity. Listen to learn how communities, employers, and individuals may help increase walking.  Created: 7/31/2012 by Centers for Disease Control and Prevention (CDC).   Date Released: 8/7/2012.

  17. Dance for Older Adults.

    Science.gov (United States)

    Pruett, Diane Milhan, Ed.; And Others

    1983-01-01

    Dance programs for older adults that encourage exercise and socializing are described in six articles. Program guidelines of the American Alliance Committee on Aging are explained, and other articles emphasize a movement education approach that may involve intergenerational contact. A dance program held in a worship setting is also discussed. (PP)

  18. Depression - older adults

    Science.gov (United States)

    ... slowly than in younger adults. To better manage depression at home: Exercise regularly, if the provider says it is OK. Surround yourself with caring, positive people and do fun activities. ... signs of depression, and know how to react if these occur. ...

  19. Inguinal Herniography in adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, B. T.; Park, K. J. [57th Evacuation Hospital, Korea Army, Seoul (Korea, Republic of); Park, C. Y. [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1980-06-15

    Inguinal hernia in children is easily diagnosed in most cases: however, it is sometimes different or impossible to detect by physical examination. The some is true of a contralateral asymptomatic hernia. White have reported that herniography is easy to perform and has a high degree of accuracy and minimal morbidity. The diagnostic accuracy of herniography in detection of patent process vaginalis is 95-98% by white. Rowe found 40% of children over age of of 2 years and adults with a unilateral congenital hernia had an open process vaginalis in contralateral normal site and concluded that 20% of patients with a unilateral hernia will develop a contralateral hernia sometimes during life. It is necessary to check the condition of the normal site before surgery in unilateral hernia by herniogram. But in adults, the hernigraphy was not performed due to some reason. We found that the herniography in adults is also easy ro perform and high degree of accuracy. The results are: 1. Total number of studies are 25 patient of unilateral inguinal hernia. 2. We found 32% of adults male with unilateral hernia had an open process viginalis in contralateral normal site. 3. Slight more abdominal disconfort than children is noted during injection of Hypaque. 4. Prominent lateral recess of Douglaspouch and poor coating of contrast media to peritoneum are different radiologic finding from children.

  20. Adult educators' core competences

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2016-01-01

    environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or “core...

  1. Adult educators' core competences

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2016-01-01

    environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or “core...

  2. Adult Education in Beijing

    Institute of Scientific and Technical Information of China (English)

    1994-01-01

    The Chinese University of Science and Technology, Management and Administration, run by the local people, has achieved great success in adult edu cation. Jiang Shuyun (3rd L), head of the university, won the title of advanced industrialist from the State Science and Technology Commission.

  3. Teaching Nontraditional Adult Students: Adult Learning Theories in Practice

    Science.gov (United States)

    Chen, Joseph C.

    2014-01-01

    As the USA experiences rapid growth of nontraditional adult students in higher education, educators and institutions will increasingly need to look beyond the traditional youth-centric educational models to better address adult learning needs. To date, no research has been conducted examining the learning experiences of adult students enrolled in…

  4. Teaching Nontraditional Adult Students: Adult Learning Theories in Practice

    Science.gov (United States)

    Chen, Joseph C.

    2014-01-01

    As the USA experiences rapid growth of nontraditional adult students in higher education, educators and institutions will increasingly need to look beyond the traditional youth-centric educational models to better address adult learning needs. To date, no research has been conducted examining the learning experiences of adult students enrolled in…

  5. Stages of Adult Hodgkin Lymphoma

    Science.gov (United States)

    ... Treatment Adult NHL Treatment AIDS-Related Lymphoma Treatment Mycosis Fungoides & Sézary Syndrome Treatment Primary CNS Lymphoma Treatment ... Treatment Adult NHL Treatment AIDS-Related Lymphoma Treatment Mycosis Fungoides & Sézary Syndrome Treatment Primary CNS Lymphoma Treatment ...

  6. Finding Your Adult Vaccination Record

    Science.gov (United States)

    ... Button Past Emails CDC Features Is Your Adult Vaccination Record Up-To-Date? Language: English Español (Spanish) ... your medical history. Staying Up-To-Date on Vaccination is Important Every year thousands of adults in ...

  7. Liver Disease and Adult Vaccination

    Science.gov (United States)

    ... Resources for Healthcare Professionals Liver Disease and Adult Vaccination Recommend on Facebook Tweet Share Compartir Vaccines are ... have immunity to this disease Learn about adult vaccination and other health conditions Asplenia Diabetes Type 1 ...

  8. HIV Infection and Adult Vaccination

    Science.gov (United States)

    ... Resources for Healthcare Professionals HIV Infection and Adult Vaccination Recommend on Facebook Tweet Share Compartir Vaccines are ... percentage is less than 15%. Learn about adult vaccination and other health conditions Asplenia Diabetes Type 1 ...

  9. Renal Disease and Adult Vaccination

    Science.gov (United States)

    ... Resources for Healthcare Professionals Renal Disease and Adult Vaccination Recommend on Facebook Tweet Share Compartir Vaccines are ... have immunity to this disease Learn about adult vaccination and other health conditions Asplenia Diabetes Type 1 ...

  10. Congenital Heart Disease in Adults

    Science.gov (United States)

    ... and genetics may play a role. Why congenital heart disease resurfaces in adulthood Some adults may find that ... in following adults with congenital heart disease. Congenital heart disease and pregnancy Women with congenital heart disease who ...

  11. Spleen removal - open - adults - discharge

    Science.gov (United States)

    Splenectomy - adult - discharge; Spleen removal - adult - discharge ... You had surgery to remove your spleen. This operation is called splenectomy . The surgeon made a cut (incision) in the middle of your belly or on the left side ...

  12. Adult Education for Social Mobilization.

    Science.gov (United States)

    Echeverria, Luis

    1981-01-01

    Suggests some ideas that could stimulate and be incentives for defining programs of adult education in the future. These involve changing priorities, developing a framework which allows adult education programs to be established, and managing decision-making processes. (CT)

  13. Alcohol Use and Older Adults

    Science.gov (United States)

    ... version of this page please turn Javascript on. Alcohol Use and Older Adults Alcohol and Aging Adults of any age can have ... Escape (Esc) button on your keyboard.) What Is Alcohol? Alcohol, also known as ethanol, is a chemical ...

  14. Older Adults (and Oral Health)

    Science.gov (United States)

    ... Health Information Sorted by ... > OlderAdults Older Adults and Oral Health Main Content ​ Is dry mouth a natural part ... from fiction by reading this web page about oral health and growing older. Having the right information can ...

  15. Adult Literacy Programs: An Overview.

    Science.gov (United States)

    Newman, Anabel P.

    1994-01-01

    This article examines the broad array of adult literacy program alternatives currently available. These include government-funded adult education programs, such as Adult Basic Education and Even Start, volunteer programs such as Laubach Literacy Action and Literacy Volunteers of America, business and industry sponsored programs, community-based…

  16. Facilitating Creativity in Adult Learners

    Science.gov (United States)

    Tsai, Kuan Chen

    2013-01-01

    Creativity in education research has received increasing attention, although the major focus of this research has been on children. Despite pleas by several adult educators for promoting creativity, very few studies have focused on adult learners, leaving to it to be explored what approaches are useful for adult educators to facilitate creativity…

  17. Becoming adult educators in Denmark

    DEFF Research Database (Denmark)

    Milana, Marcella; Søgaard Lund, Lise

    2009-01-01

    In this paper we present an analysis of identity-construction processes among adult educators in Denmark and we address the question how adult educators develop professionalism, not least by taking advantage of existing opportunity structures for current and prospective adult educators. A between...

  18. Adult Learning and HRD. Symposium.

    Science.gov (United States)

    2002

    This symposium on adult learning and human resource development consists of three presentations. "Adult Learning Principles and Concepts in the Workplace: Implications for Training in HRD" (Margot B. Weinstein) reports on findings from interviews with restaurant employees who reported that training practices using adult learning…

  19. Backtalk: Adult Services in Oklahoma.

    Science.gov (United States)

    Giblon, Della L.; Henke, Esther Mae

    1980-01-01

    Describes projects of Oklahoma libraries designed to combat the problem of illiteracy among adults and explains Oklahoma Image, a humanities effort aimed at attracting out-of-school adults to public libraries by focusing on the state's multicultural heritage. Column also reports adult service news from other states. (JD)

  20. Adult Learning Center Curriculum Activities.

    Science.gov (United States)

    City Univ. of New York, Bronx. Herbert H. Lehman Coll. Inst. for Literacy Studies.

    These curriculum materials were collected from teachers in the Lehman College Adult Learning Center (New York). They include various activities and resources, such as a series of questions about the aims of teaching adults, a list of sources for adult basic education (ABE) materials, poems, and autobiographical materials. Teaching suggestions and…

  1. Conditional lethality strains for the biological control of Anastrepha species

    Science.gov (United States)

    Pro-apoptotic cell death genes are promising candidates for biologically-based autocidal control of pest insects as demonstrated by tetracycline (tet)-suppressible systems for conditional embryonic lethality in Drosophila melanogaster (Dm) and the medfly, Ceratitis capitata (Cc). However, for medfly...

  2. Adult Diapause in Coleoptera

    Directory of Open Access Journals (Sweden)

    Ivo Hodek

    2012-01-01

    Full Text Available Recent studies dealing with adult (reproductive diapause in the Coleoptera are reviewed, as a kind of supplement to the classic compendia. In the first two sections, the general characteristics of adult diapause are described and principal terms explained. Original articles dealing with 19 species from nine coleopteran families (Coccinellidae, Chrysomelidae, Bruchidae, Curculionidae, Carabidae, Silphidae, Scolytidae, Scarabaeidae, and Endomychidae are reviewed. Finally attempts are made at generalisations from the papers reviewed, and hypotheses on diapause evolution are inferred. A polyphenic character of diapause is a prominent feature in C. septempunctata and L. decemlineata, but has been found also in other Coleoptera and in insects generally and often generates voltinism heterogeneity within populations.

  3. Spatially regulated adult neurogenesis

    OpenAIRE

    Rikani, Azadeh A.; Choudhry, Zia; Choudhry, Adnan M; Zenonos, Georgios; Tariq, Sadaf; Mobassarah, Nusrat J

    2013-01-01

    Adult neurogenesis has been the center of attention for decades. Neuroscientists hope to understand the mechanism underlying this phenomenon that might provide a unique perception of brain repair in future. Neurogenesis is referred to the process in which neuronal stem cells and progenitors generate new neurons in non-pathologic setting. Although there are some similarities between two neurogenetic regions including hippocampus and olfactory bulb, however there are some important differences....

  4. Cochlear Implant in Adults

    Directory of Open Access Journals (Sweden)

    Jaleh Samadi

    2003-09-01

    Full Text Available Cochlear implant is the result of a great combination and collaboration of engineering and medicine. It is mainly because it has the most conflict with the human nervous system among all prosthesis. Cochlear implant helps a child with profound hearing loss to understand and articulate speech and let an adult person with hearing loss communicate with people by phone. Although these wonderful results could not be seen in all patients, will let us know about the great scientific findings.

  5. Adults Need Immunizations, Too!

    Centers for Disease Control (CDC) Podcasts

    2012-03-19

    In this podcast, Dr. Andrew Kroger from CDC’s National Center for Immunization and Respiratory Diseases discusses simple, safe, and effective ways adults can help protect themselves, their family, and their community from serious and deadly diseases.  Created: 3/19/2012 by National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 3/19/2012.

  6. Adult respiratory distress syndrome.

    Science.gov (United States)

    Cutts, S; Talboys, R; Paspula, C; Prempeh, E M; Fanous, R; Ail, D

    2017-01-01

    Adult respiratory distress syndrome (ARDS) has now been described as a sequela to such diverse conditions as burns, amniotic fluid embolism, acute pancreatitis, trauma, sepsis and damage as a result of elective surgery in general. Patients with ARDS require immediate intubation, with the average patient now being ventilated for between 8 and 11 days. While the acute management of ARDS is conducted by the critical care team, almost any surgical patient can be affected by the condition and we believe that it is important that a broader spectrum of hospital doctors gain an understanding of the nature of the pathology and its current treatment.

  7. Bochdalek hernia in adult

    OpenAIRE

    Oliveira,Daniel Riccioppo C.F. de; Aldo Junqueira Rodrigues Jr.

    2008-01-01

    Bochdalek´s hernia is a congenital malformation of the posterolateral diaphragm region. It is more common on the left and more frequently seen in newborns and rare in adults, with over a few 100 reported cases. We present a case of Bochdalek´s hernia in a 49-year-old patient with long term dyspeptic symptoms. The upper endoscopy showed a gastric fundus herniation sliding into the chest through the diaphragmatic defect. The patient also presented with a rare pulmonary malformation ...

  8. Adult abdominal hernias.

    LENUS (Irish Health Repository)

    Murphy, Kevin P

    2014-06-01

    Educational Objectives and Key Points. 1. Given that abdominal hernias are a frequent imaging finding, radiologists not only are required to interpret the appearances of abdominal hernias but also should be comfortable with identifying associated complications and postrepair findings. 2. CT is the imaging modality of choice for the assessment of a known adult abdominal hernia in both elective and acute circumstances because of rapid acquisition, capability of multiplanar reconstruction, good spatial resolution, and anatomic depiction with excellent sensitivity for most complications. 3. Ultrasound is useful for adult groin assessment and is the imaging modality of choice for pediatric abdominal wall hernia assessment, whereas MRI is beneficial when there is reasonable concern that a patient\\'s symptoms could be attributable to a hernia or a musculoskeletal source. 4. Fluoroscopic herniography is a sensitive radiologic investigation for patients with groin pain in whom a hernia is suspected but in whom a hernia cannot be identified at physical examination. 5. The diagnosis of an internal hernia not only is a challenging clinical diagnosis but also can be difficult to diagnose with imaging: Closed-loop small-bowel obstruction and abnormally located bowel loops relative to normally located small bowel or colon should prompt assessment for an internal hernia.

  9. Sexuality in older adults

    Directory of Open Access Journals (Sweden)

    Adrián Sapetti

    2015-07-01

    Full Text Available Just as the body and its functions undergo changes with age, in the same way sexuality shares this aging process. However, remember a golden rule that we are sexual since we are born until we die; only possibilities are modified with the passage of the years. This article intends to show the changes that occur in the sexual response of the elderly. If sexual life during youth was pleasant and satisfactory this will condition sexuality in the socalled third age and the elderly seek to maintain it, this is not the case for those who had a dysfunctional past. This article briefly describes the andropause and the SIM, vicissitudes, changes and differences in sexual response and chances to maintain eroticism in the older adult

  10. Adult autoimmune enteropathy

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Recent reports have suggested that autoimmune enteropathy involving the small bowel may occur in adults as well as in children. Apparently, the endoscopic and histological changes are similar to celiac disease before treatment, but these are not altered by any form of dietary restriction, including a gluten-free diet. As in celiac disease, histologic changes in gastric and colonic biopsies have also been recorded. Anti enterocyte antibodies detected with immunofluorescent methods have been reported by a few laboratories, but these antibodies appear not to be specific and may simply represent epiphenomena. A widely available, reproducible and quantitative anti-enterocyte antibody assay is needed that could be applied in small bowel disorders that have the histological appearance of celiac disease, but fail to respond to a gluten-free diet.

  11. Communication in Adult Education

    Directory of Open Access Journals (Sweden)

    Mihaela Časar

    1997-12-01

    Full Text Available In their paper the authors point to the importance of communication in adult education, seeing man as a relational creature. They stress the importance verbal as well as non-verbal communication, which discloses the speaker's attitude to both what is being said and the students. The authors detail the components of non-verbal communication, which the group leaders can use as guide­ lines in their educational work. They define constructive and destructive, content-related and relationship-related types of communication, concluding that communication is at its best when it is relaxed and involves all members of the group as well as the tutor-organiser. Only then can feedback be generated, resulting in a closer connectedness and enhanced quality of the process of education.

  12. [Degenerative adult scoliosis].

    Science.gov (United States)

    García-Ramos, C L; Obil-Chavarría, C A; Zárate-Kalfópulos, B; Rosales-Olivares, L M; Alpizar-Aguirre, A; Reyes-Sánchez, A A

    2015-01-01

    Adult scoliosis is a complex three-dimensional rotational deformity of the spine, resulting from the progressive degeneration of the vertebral elements in middle age, in a previously straight spine; a Cobb angle greater than 10° in the coronal plane, which also alters the sagittal and axial planes. It originates an asymmetrical degenerative disc and facet joint, creating asymmetrical loads and subsequently deformity. The main symptom is axial, radicular pain and neurological deficit. Conservative treatment includes drugs and physical therapy. The epidural injections and facet for selectively blocking nerve roots improves short-term pain. Surgical treatment is reserved for patients with intractable pain, radiculopathy and/ or neurological deficits. There is no consensus for surgical indications, however, it must have a clear understanding of the symptoms and clinical signs. The goal of surgery is to decompress neural elements with restoration, modification of the three-dimensional shape deformity and stabilize the coronal and sagittal balance.

  13. Adult foveomacular vitelliform dystrophy

    Directory of Open Access Journals (Sweden)

    Valdir Balarin

    2013-06-01

    Full Text Available Adult foveomacular vitelliform dystrophy is a rare pathology. Less than 1% of the reported cases display perifoveal capillary permeability. The three-year follow-up period of the case revealed a rare form, which had not yet been documented. The patient was a 40-year-old female with normal visual acuity, and a minor complaint of metamorphopsia on the left eye. Retinography showed a perifoveal yellowish subretinal area OS.Angiography showed perifoveal leakage OS. Follow up showed that, over 3 years, capillary incompetence disappeared and the yellow area underwent alterations, becoming atrophic OS. Angiography also showed hyperfluorescence (windows defect. Towards the end, it resembled the appearance of late stage of Best's Disease.

  14. [Vesicoureteral reflux in adults].

    Science.gov (United States)

    Rollino, Cristiana; D'Urso, Leonardo; Beltrame, Giulietta; Ferro, Michela; Quattrocchio, Giacomo; Quarello, Francesco

    2011-01-01

    Vesicoureteral reflux (VUR) may be congenital or acquired. The most frequent form of congenital VUR is primary VUR. Its prevalence in adults is not exactly known, but it is higher in women, whose greater propensity for urinary tract infections increases the likelihood of an instrumental examination leading to the diagnosis of less severe cases. In men, even severe VUR may go undiagnosed for a long time. Primary VUR is due to a defect in the valve mechanism of the ureterovesical junction. In physiological conditions, the terminal ureter enters the bladder wall obliquely and bladder contraction leads to compression of this intravesical portion. Abnormal length of the intravesical portion of the ureter due to a genetic mutation (whose location is yet to be established) leads to VUR. In its less severe forms VUR may be asymptomatic, but in 50-70% of cases it manifests with recurrent cystitis or pyelonephritis. The manifestations leading to a diagnosis of VUR in adults, besides urinary tract infections, are proteinuria, renal failure and hypertension. The gold-standard diagnostic examination is a micturating cystourethrogram. Reflux nephropathy develops as a result of a pathogenetic mechanism unrelated to high cavity pressure or urinary tract infections but due to reduced formation of the normal renal parenchyma (hypoplasia or dysplasia). Abnormal renal parenchyma development is attributable to the same genes that control the development of the ureters and ureterovesical junction. VUR is considered only a marker of this abnormal development, playing no role in scar formation. There is no conclusive evidence regarding the indications for VUR correction. However, the risk that VUR leads to recurrent pyelonephritis and reflux nephropathy must be kept in mind. VUR certainly has to be corrected in women who contemplate pregnancy.

  15. Adult Literacy. Trends and Issues Alerts.

    Science.gov (United States)

    ERIC Clearinghouse on Adult, Career, and Vocational Education, Columbus, OH.

    This document begins with an overview of trends and issues in the area of adult literacy. This overview briefly addresses: the number of adult illiterates, the costs of adult illiteracy, adult illiteracy as a barrier to increasing U.S. competitiveness, efforts that have focused on adult illiteracy, the issues that have surfaced, and…

  16. Book Display as Adult Service.

    Science.gov (United States)

    Moore, Matthew S.

    1997-01-01

    Defines book display as an adult service as choosing and positioning adult books from the library collection to increase their circulation. The author contrasts bookstore arrangement for sales versus library arrangement for access, including contrasting missions, genre grouping, weeding, problems, and dimensions. (Author/LRW)

  17. Neuropsychological Assessment of Adult Offenders

    Science.gov (United States)

    Marceau, Roger; Meghani, Rehana; Reddon, John R.

    2008-01-01

    This report is primarily concerned with reporting on the normative results obtained on a large sample of serious adult offenders. An expanded Halstead-Reitan Neuropsychological Test Battery was administered to 584 adult offenders (OF), 132 normal controls (NC), and 494 acute psychiatric patients (PP). Subjects were between 18 and 44 years of age.…

  18. Adult Literacy: Contexts and Challenges.

    Science.gov (United States)

    Newman, Anabel Powell; Beverstock, Caroline

    Reporting recent and significant studies across the spectrum of the literacy movement to help plan the United States' literacy future, this book discusses the history of the adult literacy movement, especially in the United States, and the emergent definitions of adult literacy. The book also reports on the scholarship about, practice of, and…

  19. Understanding Adult Education and Training.

    Science.gov (United States)

    Foley, Griff, Ed.

    This book introduces readers to issues, debates and literatures related to a number of central areas of practice in adult education and training, especially in Australia. It is intended as a first attempt to define the field of adult education in Australia in an analytical and theoretical, as opposed to a theoretical and practical sense. Written…

  20. Segmenting the Adult Education Market.

    Science.gov (United States)

    Aurand, Tim

    1994-01-01

    Describes market segmentation and how the principles of segmentation can be applied to the adult education market. Indicates that applying segmentation techniques to adult education programs results in programs that are educationally and financially satisfying and serve an appropriate population. (JOW)

  1. Segmenting the Adult Education Market.

    Science.gov (United States)

    Aurand, Tim

    1994-01-01

    Describes market segmentation and how the principles of segmentation can be applied to the adult education market. Indicates that applying segmentation techniques to adult education programs results in programs that are educationally and financially satisfying and serve an appropriate population. (JOW)

  2. Teachers of adults as learners

    DEFF Research Database (Denmark)

    Lund Larsen, Lea

    This poster is a part of an on-going qualitative empirical research project: “Teachers of adults as learners. A study on teachers’ experiences in practice”. Adult learners have particular needs and characteristics that their teachers must be able to address. Some of the competencies that teachers...

  3. Adult Learning Opportunities in Nepal

    Science.gov (United States)

    Regmi, Krishna; Regmi, Sharada

    2008-01-01

    This paper presents the initial findings from a study of education system in Nepal. This paper examines the adult learning opportunities within the educational and cultural contexts by reviewing available literature relevant to Nepal. Findings show that there are wider opportunities for adult learning than those considered from education and…

  4. Adult Learning Disorders: Contemporary Issues

    Science.gov (United States)

    Wolf, Lorraine E., Ed.; Schreiber, Hope E., Ed.; Wasserstein, Jeanette, Ed.

    2008-01-01

    Recent advances in neuroimaging and genetics technologies have enhanced our understanding of neurodevelopmental disorders in adults. The authors in this volume not only discuss such advances as they apply to adults with learning disorders, but also address their translation into clinical practice. One cluster of chapters addresses developmental…

  5. Sibling Status Effects: Adult Expectations.

    Science.gov (United States)

    Baskett, Linda Musun

    1985-01-01

    This study attempted to determine what expectations or beliefs adults might hold about a child based on his or her sibling status alone. Ratings on 50 adjective pairs for each of three sibling status types, only, oldest, and youngest child, were assessed in relation to adult expectations, birth order, and parental status of rater. (Author/DST)

  6. The Politics of Adult Education

    Science.gov (United States)

    Ellison, Art

    2016-01-01

    Art Ellison is longtime advocate for adult education, having managed numerous advocacy campaigns over the past forty years on the state and national levels. Prior to his employment in 1980 as the NH State Director of Adult Education he worked for many years as a high school teacher and as a community organizer. In this article, Ellison offers some…

  7. Work, Experience and Adult Education

    DEFF Research Database (Denmark)

    Rasmussen, Palle

    2006-01-01

    A presentation and discussion of the theories of work, experience and adult education developed by the German philosopher and sociologist Oskar Negt.......A presentation and discussion of the theories of work, experience and adult education developed by the German philosopher and sociologist Oskar Negt....

  8. Adult-onset tic disorders

    NARCIS (Netherlands)

    Eapen, [No Value; Lees, AJ; Lakke, JPWF; Trimble, MR; Robertson, MM

    2002-01-01

    We report on 8 patients with adult-onset motor tics and vocalisations. Three had compulsive tendencies in childhood and 3 had a family history of tics or obsessive-compulsive behaviour. In comparison with DSM-classified, younger-onset Gilles de la Tourette syndrome, adult-onset tic disorders are mor

  9. Professionalisation processes among adult educators

    DEFF Research Database (Denmark)

    Milana, Marcella; Larson, Anne

    2011-01-01

    In light of the increased interest in adult education and training (AET) in the EU as well as in national policy, the article looks into policy and practice when it comes to the professionalisation of those responsible for providing the AET – the adult educators. The article takes its theoretical...

  10. Clinical Interviewing with Older Adults

    Science.gov (United States)

    Mohlman, Jan; Sirota, Karen Gainer; Papp, Laszlo A.; Staples, Alison M.; King, Arlene; Gorenstein, Ethan E.

    2012-01-01

    Over the next few decades the older adult population will increase dramatically, and prevalence rates of psychiatric disorders are also expected to increase in the elderly cohort. These demographic projections highlight the need for diagnostic instruments and methods that are specifically tailored to older adults. The current paper discusses the…

  11. The Principal as Adult Developer.

    Science.gov (United States)

    Levine, Sarah L.

    1989-01-01

    Restructuring of the principalship must include the principal's role as an adult developer aware of the inextricable link between teacher growth and student development. Principal and teacher should work together to learn how adults develop, to discover conditions fostering growth, and to encourage each other to face new challenges. (MLH)

  12. Leisure Styles and Adult Education

    Science.gov (United States)

    London, Jack; Wenkert, Robert

    1969-01-01

    People with broad and diverse leisure activities are more likely to participate in adult education than people with a passive leisure style. This finding conflicts with a prevailing view that adult education competes with other leisure pursuits for the interest and attention of a potential audience. (SE)

  13. Neuropsychological Assessment of Adult Offenders

    Science.gov (United States)

    Marceau, Roger; Meghani, Rehana; Reddon, John R.

    2008-01-01

    This report is primarily concerned with reporting on the normative results obtained on a large sample of serious adult offenders. An expanded Halstead-Reitan Neuropsychological Test Battery was administered to 584 adult offenders (OF), 132 normal controls (NC), and 494 acute psychiatric patients (PP). Subjects were between 18 and 44 years of age.…

  14. Adult Learning, Economy and Society

    DEFF Research Database (Denmark)

    Olesen, Henning Salling

    2010-01-01

    The article relates the different types of adult education, continuing education and training to an overall societal context of socio-economic modernization by focussing on the multiple functions of adult learning. Each of well known empirical categories is seen in its historical relation to mode...

  15. Effective communication with older adults.

    Science.gov (United States)

    Daly, Louise

    2017-06-07

    Communication is an essential aspect of life, yet it can be taken for granted. Its centrality to being in the world and in professional practice often becomes evident when nurses and older adults encounter communication difficulties. The factors that can affect nurses' communication with older adults relate to the older adult, the nurse, sociocultural considerations and the environment, and the interactions between these factors. In adopting a person-centred approach to communicating with older adults, it is necessary to get to know the person as an individual and ensure communication meets their needs and abilities. Effective communication is essential in nursing practice and requires professional competence and engagement. This article can be used by nurses to support effective communication with older adults across the continuum of care.

  16. Obesity Prevention in Older Adults.

    Science.gov (United States)

    Volpe, Stella Lucia; Sukumar, Deeptha; Milliron, Brandy-Joe

    2016-06-01

    The number of older adults living in the USA, 65 years of age and older, has been steadily increasing. Data from the National Health and Nutrition Examination Survey (NHANES), 2007-2010, indicate that more than one-third of older adults, 65 years of age and older, were obese. With the increased rate of obesity in older adults, the purpose of this paper is to present research on different methods to prevent or manage obesity in older adults, namely dietary interventions, physical activity interventions, and a combination of dietary and physical activity interventions. In addition, research on community assistance programs in the prevention of obesity with aging will be discussed. Finally, data on federal programs for older adults will also be presented.

  17. Older adults challenged financially when adult children move home.

    Science.gov (United States)

    Wallace, Steven P; Padilla-Frausto, D Imelda

    2014-02-01

    This policy brief looks at the financial burdens imposed on older Californians when adult children return home, often due to a crisis not of their own making, to live with their parents. The findings show that on average in California, the amount of money that older adults need in order to maintain a minimally decent standard of living while supporting one adult child in their home increases their expenses by a minimum of 50 percent. Low-income older adults are usually on fixed incomes, so helping an adult child can provide the child with a critical safety net but at the cost of the parents' own financial well-being. Policy approaches to assisting this vulnerable population of older adults include implementing reforms to increase Supplemental Security Income (SSI), improving the availability of affordable housing, assuring that all eligible nonelderly adults obtain health insurance through health care reform's expansion of Medi-Cal and subsidies, and increasing food assistance through SNAP and senior meal programs.

  18. Just How Adult Is This Young Adult Book: Young Adult Books for the Junior High Readers.

    Science.gov (United States)

    Decker, Charlotte

    1999-01-01

    Discusses young adult novels and presents a bibliography to acquaint librarians with titles and authors that are suitable for emerging young adult readers in grades five through nine. Subject categories include realistic fiction, in the news, historical fiction, short stories, legendary characters, mysteries, science fiction/fantasy/horror, and…

  19. Just How Adult Is This Young Adult Book: Young Adult Books for the Junior High Readers.

    Science.gov (United States)

    Decker, Charlotte

    1999-01-01

    Discusses young adult novels and presents a bibliography to acquaint librarians with titles and authors that are suitable for emerging young adult readers in grades five through nine. Subject categories include realistic fiction, in the news, historical fiction, short stories, legendary characters, mysteries, science fiction/fantasy/horror, and…

  20. Adolescents and Young Adults with Cancer

    Science.gov (United States)

    ... Adults with Cancer Reports, Research, and Literature Quiz Adolescents and Young Adults with Cancer View this video ... Fund for Young Adults Vital Options Teens and Adolescents CureSearch Starlight Children's Foundation Teens Living with Cancer ...

  1. Transition from Pediatric to Adult OI Care

    Science.gov (United States)

    Moving from Pediatric to Adult Care Introduction Teen and young adult years are a critical time for major life changes. An ... for youth who have OI is moving from pediatric care into the adult care system. Children’s hospitals ...

  2. Coaching as a Strategy for Helping Adults

    Science.gov (United States)

    Wax, Dorothy M.; Wertheim, Judith

    2015-01-01

    This chapter focuses on the use of coaching for adult learners, the specific characteristics adults bring to the learning environment, and strategies for dealing with the obstacles adult learners may face.

  3. Adult Attention-Deficit / Hyperactivity Disorder (ADHD)

    Science.gov (United States)

    Adult attention-deficit/hyperactivity disorder (ADHD) Overview Adult attention-deficit/hyperactivity disorder (ADHD) is a mental health disorder that ... combination of persistent problems, such as difficulty paying attention, hyperactivity and impulsive behavior. Adult ADHD can lead ...

  4. Coaching as a Strategy for Helping Adults

    Science.gov (United States)

    Wax, Dorothy M.; Wertheim, Judith

    2015-01-01

    This chapter focuses on the use of coaching for adult learners, the specific characteristics adults bring to the learning environment, and strategies for dealing with the obstacles adult learners may face.

  5. Vitalistic thinking in adults.

    Science.gov (United States)

    Wilson, Stuart

    2013-11-01

    Vitalistic thinking has traditionally been associated with reasoning about biological phenomena. The current research aimed to investigate a broader range of vitalistic thinking than previously studied. Esoteric notions of 'energy' are frequently used by individuals when making causal attributions for strange occurrences, and previous literature has linked such thinking with paranormal, magical, and superstitious beliefs. Two experiments are described that aim to investigate whether adults are vitalistic when asked to make causal judgments, and whether this can be predicted by thinking styles and prior paranormal belief. Experiment 1 asked participants to rate three causal options (one of which was vitalistic) for six vignettes. Scores on one dimension of paranormal belief (New Age Philosophy) and analytical thinking significantly predicted vitalism, but scores on intuitive thinking and Traditional Paranormal Beliefs did not. Experiment 2 extended the findings by asking participants to generate their own causal responses. Again, paranormal belief was found to be the best predictor of vitalism, but this time Traditional Paranormal Beliefs were associated with vitalistic responses whilst both intuitive and analytical thinking were unable to significantly predict classification. Results challenge previous findings, suggesting that vitalistic thinking may operate differently when applied to everyday causal reasoning.

  6. Adult hereditary fructose intolerance

    Institute of Scientific and Technical Information of China (English)

    Mohamed Ismail Yasawy; Ulrich Richard Folsch; Wolfgang Eckhard Schmidt; Michael Schwend

    2009-01-01

    Hereditary fructose intolerance (HFI) is an underrecognized,preventable life-threatening condition. It is an autosomal recessive disorder with subnormal activity of aldolase B in the liver, kidney and small bowel. Symptoms are present only after the ingestion of fructose, which leads to brisk hypoglycemia, and an individual with continued ingestion will exhibit vomiting,abdominal pain, failure to thrive, and renal and liver failure. A diagnosis of HFI was made in a 50-year-old woman on the basis of medical history, response to Ⅳ fructose intolerance test, demonstration of aldolase B activity reduction in duodenal biopsy, and molecular analysis of leukocyte DNA by PCR showed homozygosity for two doses of mutant gene. HFI may remain undiagnosed until adult life and may lead to disastrous complications following inadvertent fructose or sorbitol infusion. Several lethal episodes of HFI following sorbitol and fructose infusion have been reported. The diagnosis can only be suspected by taking a careful dietary history, and this can present serious complications.

  7. Adult hereditary fructose intolerance.

    Science.gov (United States)

    Yasawy, Mohamed Ismail; Folsch, Ulrich Richard; Schmidt, Wolfgang Eckhard; Schwend, Michael

    2009-05-21

    Hereditary fructose intolerance (HFI) is an under-recognized, preventable life-threatening condition. It is an autosomal recessive disorder with subnormal activity of aldolase B in the liver, kidney and small bowel. Symptoms are present only after the ingestion of fructose, which leads to brisk hypoglycemia, and an individual with continued ingestion will exhibit vomiting, abdominal pain, failure to thrive, and renal and liver failure. A diagnosis of HFI was made in a 50-year-old woman on the basis of medical history, response to IV fructose intolerance test, demonstration of aldolase B activity reduction in duodenal biopsy, and molecular analysis of leukocyte DNA by PCR showed homozygosity for two doses of mutant gene. HFI may remain undiagnosed until adult life and may lead to disastrous complications following inadvertent fructose or sorbitol infusion. Several lethal episodes of HFI following sorbitol and fructose infusion have been reported. The diagnosis can only be suspected by taking a careful dietary history, and this can present serious complications.

  8. Clueless: Adult Mysteries with Young Adult Appeal 2002.

    Science.gov (United States)

    Charles, John; Morrison, Joanna

    2002-01-01

    This annotated bibliography includes adult mysteries that appeal to teen readers under the categories of Sherlock Holmes; reference sources; private investigators; amateur sleuths; historical sleuths; suspense and thrillers; police procedurals; mystery blends; and anthologies. (LRW)

  9. Down Syndrome in Adults: Staying Healthy

    Science.gov (United States)

    ... Shortfall Questionnaire Home Prevention and Wellness Staying Healthy Down Syndrome in Adults: Staying Healthy Down Syndrome in Adults: Staying Healthy Family HealthPrevention and WellnessStaying ...

  10. Computational models of adult neurogenesis

    Science.gov (United States)

    Cecchi, Guillermo A.; Magnasco, Marcelo O.

    2005-10-01

    Experimental results in recent years have shown that adult neurogenesis is a significant phenomenon in the mammalian brain. Little is known, however, about the functional role played by the generation and destruction of neurons in the context of an adult brain. Here, we propose two models where new projection neurons are incorporated. We show that in both models, using incorporation and removal of neurons as a computational tool, it is possible to achieve a higher computational efficiency that in purely static, synapse-learning-driven networks. We also discuss the implication for understanding the role of adult neurogenesis in specific brain areas like the olfactory bulb and the dentate gyrus.

  11. Chronic disease in older adults

    OpenAIRE

    Durán, Adriana; Pontificia Universidad Javeriana; Valderrama, Laura; Pontificia Universidad Javeriana; Uribe, Ana Fernanda; Pontificia Universidad Javeriana; González, Angélica; Pontificia Universidad Javeriana; Máximo Molina, Juan; Agencia de Evaluación de Tecnologías Sanitarias de Andalucía (AETSA)

    2016-01-01

    Methodology: A sample of 500 older adults was selected, between 60 and 96 years of age. A questionnaire of psychosocial factors in older adults designed by Baca, Gonzalez, and Uribe was used. Results: Hypertension, diabetes and osteoporosis were the most frequent diseases in older adults, although the greater percentage of this population did not refer any pathology. Married and widowers individuals presented more diseases as compared to unmarried, separated and people who live together.Concl...

  12. Adult education for democratic citizenship

    DEFF Research Database (Denmark)

    . The research literature review was designed as the foundation for the investigation of what is know about how adults can achieve competencies relevant for democratic citizenship in various European countries, what type of educational interventions have proven effective in this regards and how educational......The report presents, in brief, the findings from the study of research literature on Adult Education for Democratic Citizenship, which was carried out in the nine EU member states represented by the project: Austria, Denmark, Germany, Hungary, Poland, Romania, Slovenia, Spain and United Kingdom...... policy intervene in the field of Adult Education for Democratic Citizenship....

  13. Quitting Smoking for Older Adults

    Science.gov (United States)

    ... of this page please turn Javascript on. Quitting Smoking for Older Adults Quitting When You’re Older ... may wonder if it’s too late to quit smoking. Or you may ask yourself if it’s even ...

  14. Understanding Adult Overweight and Obesity

    Science.gov (United States)

    ... A Step in the Right Direction Understanding Adult Overweight and Obesity When we eat more calories than we burn, ... prevent or delay type 2 diabetes. How are overweight and obesity treated? The best way to control your weight ...

  15. Childhood intelligence and adult obesity

    National Research Council Canada - National Science Library

    Kanazawa, Satoshi

    2013-01-01

    Objective: Recent studies conclude childhood intelligence has no direct effect on adult obesity net of education, but evolutionary psychological theories suggest otherwise. Design and Methods: A population ( n = 17,419...

  16. Childhood obesity and adult morbidities

    National Research Council Canada - National Science Library

    Biro, Frank M; Wien, Michelle

    2010-01-01

    .... The consequences of childhood and adolescent obesity include earlier puberty and menarche in girls, type 2 diabetes and increased incidence of the metabolic syndrome in youth and adults, and obesity in adulthood...

  17. Dementia: Unique to Older Adults

    Science.gov (United States)

    ... lead to complications too. These include malnutrition, falls, osteoporosis (“thinning bones”), bone fractures, frailty, sleep problems, anxiety, agitation, delirium, and disturbed behavior. Caring for an older adult with dementia and other health problems can be ...

  18. Vaccinations for Adults with Diabetes

    Science.gov (United States)

    Vaccinations for Adults with Diabetes The table below shows which vaccinations you should have to protect your health if ... sure you and your healthcare provider keep your vaccinations up to date. Vaccine Do you need it? ...

  19. Epilepsy in Adults with TSC

    Science.gov (United States)

    ... Privacy Policy Sitemap Learn Engage Donate About TSC Epilepsy in Adults with TSC Individuals with tuberous sclerosis ... being well controlled for long periods of time. Epilepsy and Seizures Epilepsy is any brain disorder that ...

  20. Researching participation in adult education

    DEFF Research Database (Denmark)

    Kondrup, Sissel

    labour. This has fostered an interest in examining why and how people engage in adult education, how participation and especially non-participation in adult education can be explained and how participation rates can be increased. In this paper I outline different traditions within research on recruitment......It is a widespread perception that the challenge of increasing participation in adult education and training has intensified due to the transformation from industrial to knowledge based societies and the transformation implies that it becomes pivotal to increase the supply of highly qualified...... to and participation in adult education and training focusing primarily on unskilled and low skilled workers. I present how the traditions contribute to the perception of what effects participation and argue that the existing traditions must be extended and a new framework must be applied in order to understand how...

  1. Backtalk: Adult Services in Florida.

    Science.gov (United States)

    Giblon, Della L.

    1979-01-01

    Initiates a new state emphasis for the column by highlighting recent public library programs and services for adults in Florida. Music, photography, and women's programs offered by the Leon County Public Library are described in more detail. (JD)

  2. Teachers of adults as learners

    DEFF Research Database (Denmark)

    Lund Larsen, Lea

    need can be taught in formal settings, but in most teaching settings, the teachers act alone and develop their pedagogical approaches/-teaching strategies with no synchronous sparring from a colleague. Adult learners have particular needs and characteristics that their teachers must be able to address......This poster is a part of an on-going qualitative empirical research project: “Teachers of adults as learners. A study on teachers’ experiences in practice”. Adult learners have particular needs and characteristics that their teachers must be able to address. Some of the competencies that teachers...... (cf. Knowles, Brookfield, Illeris, Lawler, King, Wahlgreen). If we study adult teachers as learners in practice, we may be able to identify what the teachers’ practice requires, and thereby qualify the efforts of teacher educators....

  3. National Adult Tobacco Survey (NATS)

    Data.gov (United States)

    U.S. Department of Health & Human Services — 2013-2014. The National Adult Tobacco Survey (NATS) was created to assess the prevalence of tobacco use, as well as the factors promoting and impeding tobacco use...

  4. Diabetes: Unique to Older Adults

    Science.gov (United States)

    ... Stroke Urinary Incontinence Related Documents PDF Choosing Wisely: Diabetes Tests and Treatments Download Related Video Join our e-newsletter! Aging & Health A to Z Diabetes Unique to Older Adults This section provides information ...

  5. Understanding Adult Overweight and Obesity

    Science.gov (United States)

    ... in the Right Direction Understanding Adult Overweight and Obesity When we eat more calories than we burn, ... delay type 2 diabetes. How are overweight and obesity treated? The best way to control your weight ...

  6. Facts about Mumps for Adults

    Science.gov (United States)

    ... Recommendation: MMR About Mumps Measles, Mumps, Rubella (MMR) Facts about Mumps for Adults What is Mumps? Mumps ... are pregnant or severely immunosuppressed. Disease and vaccine facts FACT: Mumps can be prevented with a safe ...

  7. Facts about Rubella for Adults

    Science.gov (United States)

    ... About Rubella (German Measles) Measles, Mumps, Rubella (MMR) Facts about Rubella for Adults What is rubella? Rubella, ... are pregnant or severely immunosuppressed. Disease and vaccine facts FACT: Rubella can be prevented with a safe ...

  8. Facts about Measles for Adults

    Science.gov (United States)

    ... a Glance Adolescent Vaccination Recommendation: MMR About Measles Facts about Measles for Adults What is measles? Measles ... are pregnant or severely immunosuppressed. Disease and vaccine facts FACT: Measles can be prevented with a safe ...

  9. Paediatric and adult malignant glioma

    DEFF Research Database (Denmark)

    Jones, Chris; Perryman, Lara; Hargrave, Darren

    2012-01-01

    Gliomas in children differ from their adult counterparts by their distribution of histological grade, site of presentation and rate of malignant transformation. Although rare in the paediatric population, patients with high-grade gliomas have, for the most part, a comparably dismal clinical outcome...... to older patients with morphologically similar lesions. Molecular profiling data have begun to reveal the major genetic alterations underpinning these malignant tumours in children. Indeed, the accumulation of large datasets on adult high-grade glioma has revealed key biological differences between...... the adult and paediatric disease. Furthermore, subclassifications within the childhood age group can be made depending on age at diagnosis and tumour site. However, challenges remain on how to reconcile clinical data from adult patients to tailor novel treatment strategies specifically for paediatric...

  10. Professionalisation processes among adult educators

    DEFF Research Database (Denmark)

    Milana, Marcella; Larson, Anne

    2011-01-01

    In light of the increased interest in adult education and training (AET) in the EU as well as in national policy, the article looks into policy and practice when it comes to the professionalisation of those responsible for providing the AET – the adult educators. The article takes its theoretical...... as well as legal regulations from year 2000 and until today. Based on the analysis, the article concludes that in spite of differences in history and AET traditions between especially Denmark/Sweden on the one hand and Estonia on the other, a number of similarities in recent policy can be found. The first...... is an increase in the provision of AET. A second is a tendency for official requirements for teaching adults to be higher in general and vocational AET than in liberal AE. Also, in spite of the huge interest in AET, qualification of adult educators seems to be a non-issue in the analysed policy papers...

  11. Delirium: Issues for Older Adults

    Science.gov (United States)

    ... our e-newsletter! Aging & Health A to Z Delirium Unique to Older Adults This section provides information ... of life. Overview of this section: Differences between Delirium and Dementia Other Neurologic Disorders Some Important Causes ...

  12. Epilepsy in Adults with TSC

    Science.gov (United States)

    ... International TSC Research Conference Text Size Get Involved EPILEPSY IN ADULTS WITH TSC Download a PDF of ... age, including either new-onset seizures or ongoing epilepsy. Recent studies indicate that more than 80% of ...

  13. The human adult cardiomyocyte phenotype

    NARCIS (Netherlands)

    Bird, SD; Doevendans, PA; van Rooijen, MA; de la Riviere, AB; Hassink, RJ; Passier, R; Mummery, CL

    2003-01-01

    Aim: Determination of the phenotype of adult human atrial and ventricular myocytes based on gene expression and morphology. Methods: Atrial and ventricular cardiomyocytes were obtained from patients undergoing cardiac surgery using a modified isolation procedure. Myocytes were isolated and cultured

  14. Osteoporosis: Unique to Older Adults

    Science.gov (United States)

    ... our e-newsletter! Aging & Health A to Z Osteoporosis Unique to Older Adults This section provides information ... and widely-prescribed medications for the treatment of osteoporosis. Some serious side effects of these medication have ...

  15. Hip Fractures among Older Adults

    Science.gov (United States)

    ... online training for health care providers. Learn More Hip Fractures Among Older Adults Recommend on Facebook Tweet Share ... get older. What You Can Do to Prevent Hip Fractures You can prevent hip fractures by taking steps ...

  16. Nutrition: Unique to Older Adults

    Science.gov (United States)

    ... our e-newsletter! Aging & Health A to Z Nutrition Unique to Older Adults This section provides information ... teeth that are needed for grinding up food, nutrition suffers. If you are unable to chew and ...

  17. Researching participation in adult education

    DEFF Research Database (Denmark)

    Kondrup, Sissel

    It is a widespread perception that the challenge of increasing participation in adult education and training has intensified due to the transformation from industrial to knowledge based societies and the transformation implies that it becomes pivotal to increase the supply of highly qualified...... labour. This has fostered an interest in examining why and how people engage in adult education, how participation and especially non-participation in adult education can be explained and how participation rates can be increased. In this paper I outline different traditions within research on recruitment...... to and participation in adult education and training focusing primarily on unskilled and low skilled workers. I present how the traditions contribute to the perception of what effects participation and argue that the existing traditions must be extended and a new framework must be applied in order to understand how...

  18. Sustainability, Ecojustice, and Adult Education

    Science.gov (United States)

    Griswold, Wendy

    2017-01-01

    Adult education has a significant role to play in creating a just and sustainable world. This chapter explores a continuum of perspectives related to the environment and education and highlights sustainability and ecojustice education theory and practices in this volume.

  19. Bilateral Morgagni Hernia in Adult

    Directory of Open Access Journals (Sweden)

    Ali Celik

    2014-03-01

    Full Text Available       Morgagni hernia is a congenital anterior diaphragma hernias. Although it generally seen in childhood and on the right side, rarely seen bilaterally and adult. Computarize tomography is helpful in diagnosis for this lesions asymptomatic in adult. In this article, bilaterally morgagni hernia diagnosed a sixty-five year old male patient looked for due to dyspne was presented.

  20. Adult Learning Program Service (ALPS).

    Science.gov (United States)

    Carlisle, Robert

    The Adult Learning Program Service (ALPS) aims to reach eight and a half million adults between ages 25 and 44 and teach them reading and math skills they can use at home and on the job. ALPS proposes to reach those who have never finished high school but do have at least a sixth-grade reading level. They could use their new skills to prepare for…

  1. Adult attachment and psychosocial functioning

    OpenAIRE

    Pielage, Suzanne Brenda

    2006-01-01

    In the trilogy Attachment, Separation and Loss (1969, 1973, 1980), Bowlby theorized that early experiences with caregivers affect the quality of individuals’ later (romantic) relationships and, consequently, their mental health. The current thesis set out to examine the relationships between adult attachment and psychosocial functioning, predominately in the realm of close relationships. In the first part of the thesis, the focus lay on the assessment of the adult attachment construct. In Cha...

  2. What Does It Take to Be an Adult in Austria? Views of Adulthood in Austrian Adolescents, Emerging Adults, and Adults

    Science.gov (United States)

    Sirsch, Ulrike; Dreher, Eva; Mayr, Eva; Willinger, Ulrike

    2009-01-01

    The present study examined the defining features of emerging adulthood, subjects' conceptions of the transition to adulthood, and the perceived adult status in Austria. The sample consisted of 775 subjects (226 adolescents, 317 emerging adults, 232 adults). Results showed that most Austrian emerging adults feel themselves to be between adolescence…

  3. Severe sepsis in older adults.

    Science.gov (United States)

    Umberger, Reba; Callen, Bonnie; Brown, Mary Lynn

    2015-01-01

    Severe sepsis may be underrecognized in older adults. Therefore, the purpose of this article is to review special considerations related to early detection of severe sepsis in older adults. Normal organ changes attributed to aging may delay early detection of sepsis at the time when interventions have the greatest potential to improve patient outcomes. Systems are reviewed for changes. For example, the cardiovascular system may have a limited or absent compensatory response to inflammation after an infectious insult, and the febrile response and recruitment of white blood cells may be blunted because of immunosenescence in aging. Three of the 4 hallmark responses (temperature, heart rate, and white blood cell count) to systemic inflammation may be diminished in older adults as compared with younger adults. It is important to consider that older adults may not always manifest the typical systemic inflammatory response syndrome. Atypical signs such as confusion, decreased appetite, and unsteady gait may occur before sepsis related organ failure. Systemic inflammatory response syndrome criteria and a comparison of organ failure criteria were reviewed. Mortality rates in sepsis and severe sepsis remain high and are often complicated by multiple organ failures. As the numbers of older adults increase, early identification and prompt treatment is crucial in improving patient outcomes.

  4. LGBT Adult Immigrants in the United States

    OpenAIRE

    Gates, Gary J.

    2013-01-01

    There are approximately 267,000 LGBT-identified individuals among the adult undocumented immigrant population and an estimated 637,000 LGBT-identified individuals among the adult documented immigrant population. The report finds that approximately 71 percent of undocumented LGBT adults are Hispanic and 15 percent of undocumented LGBT adults are Asian or Pacific Islander.

  5. LGBT Adult Immigrants in the United States

    OpenAIRE

    GATES, GARY J.

    2013-01-01

    There are approximately 267,000 LGBT-identified individuals among the adult undocumented immigrant population and an estimated 637,000 LGBT-identified individuals among the adult documented immigrant population. The report finds that approximately 71 percent of undocumented LGBT adults are Hispanic and 15 percent of undocumented LGBT adults are Asian or Pacific Islander.

  6. Training of adult education teachers in Denmark

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    The article presents the Danish adult educational system, the extend of adult learning and the objectives of the adult education program. It presents the teacher training institutions and programs and the programs for continuing education in practice. Further on the article presents and discus...... the pedagogical principles and theories behind the training of teachers in adult education....

  7. Dealing with Disruptive Behavior of Adult Learners

    Science.gov (United States)

    Dobmeier, Robert; Moran, Joseph

    2008-01-01

    The adult education literature on disruptive behavior of adult learners was reviewed and a survey on disruptive behavior of adult learners was conducted with adult educators. The findings are synthesized in a conceptual framework for understanding the types and causes of disruptive behavior, which fall into the categories of inattention,…

  8. 38 CFR 18.438 - Adult education.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Adult education. 18.438 Section 18.438 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED... Adult Education § 18.438 Adult education. A recipient that provides adult education may not, on the...

  9. Imaging of adult brainstem gliomas

    Energy Technology Data Exchange (ETDEWEB)

    Purohit, Bela, E-mail: purohitbela@yahoo.co.in; Kamli, Ali A.; Kollias, Spyros S.

    2015-04-15

    Highlights: •BSG are classified on MRI into diffuse low-grade, malignant, focal tectal and exophytic subtypes. •Their prognosis and treatment is variable and is almost similar to adult supratentorial gliomas. •This article illustrates the imaging of adult BSGs on MRI and FET-PET. •We also describe prognostic factors and the treatment options of these tumours. -- Abstract: Brainstem gliomas (BSGs) are uncommon in adults accounting for about 2% of all intracranial neoplasms. They are often phenotypically low-grade as compared to their more common paediatric counterparts. Since brainstem biopsies are rarely performed, these tumours are commonly classified according to their MR imaging characteristics into 4 subgroups: (a) diffuse intrinsic low-grade gliomas, (b) enhancing malignant gliomas, (c) focal tectal gliomas and (d) exophytic gliomas/other subtypes. The prognosis and treatment is variable for the different types and is almost similar to adult supratentorial gliomas. Radiotherapy (RT) with adjuvant chemotherapy is the standard treatment of diffuse low-grade and malignant BSGs, whereas, surgical resection is limited to the exophytic subtypes. Review of previous literature shows that the detailed imaging of adult BSGs has not received significant attention. This review illustrates in detail the imaging features of adult BSGs using conventional and advanced MR techniques like diffusion weighted imaging (DWI), diffusion tensor imaging (DTI), MR perfusion weighted imaging (PWI), MR spectroscopy (MRS), as well as {sup 18}F-fluoro-ethyl-tyrosine positron emission tomography ({sup 18}F-FET/PET). We have discussed the pertinent differences between childhood and adult BSGs, imaging mimics, prognostic factors and briefly reviewed the treatment options of these tumours.

  10. Surgical Treatment of Adult Degenerative Scoliosis

    OpenAIRE

    Cho, Kyu-Jung; Kim, Young-tae; Shin, Sang-hyun; Suk, Se-Il

    2014-01-01

    The rapid increase of elderly population has resulted in increased prevalence of adult scoliosis. Adult scoliosis is divided into adult idiopathic scoliosis and adult degenerative scoliosis. These two types of scoliosis vary in patient age, curve pattern and clinical symptoms, which necessitate different surgical indications and options. Back pain and deformity are major indications for surgery in adult idiopathic scoliosis, whereas radiating pain to the legs due to foraminal stenosis is what...

  11. Defining Cigarette Smoking Status in Young Adults: A Comparison of Adolescent vs Adult Measures

    Science.gov (United States)

    Delnevo, Cristine D.; Lewis, M. Jane; Kaufman, Ira; Abatemarco, Diane J.

    2004-01-01

    Objective: To determine the agreement between 2 measures (adult vs adolescent) of current cigarette smoking among young adults. Methods: We examined data from 1007 young adults from the New Jersey Adult Tobacco Survey. The adult measure incorporates lifetime and present use, whereas the adolescent measure assesses past 30-day use. The kappa…

  12. Defining Cigarette Smoking Status in Young Adults: A Comparison of Adolescent vs Adult Measures

    Science.gov (United States)

    Delnevo, Cristine D.; Lewis, M. Jane; Kaufman, Ira; Abatemarco, Diane J.

    2004-01-01

    Objective: To determine the agreement between 2 measures (adult vs adolescent) of current cigarette smoking among young adults. Methods: We examined data from 1007 young adults from the New Jersey Adult Tobacco Survey. The adult measure incorporates lifetime and present use, whereas the adolescent measure assesses past 30-day use. The kappa…

  13. Weight Management in Older Adults

    Science.gov (United States)

    Gill, Lydia E.; Bartels, Stephen J.; Batsis, John A.

    2017-01-01

    As the number of older adults increases rapidly, the national epidemic of obesity is also affecting our aging population. This is particularly concerning given the numerous health risks and increased costs associated with this condition. Weight management is extremely important for older adults given the risks associated with abdominal adiposity, which is a typical fat redistribution during aging, and the prevalence of comorbid conditions in this age group. However, approaches to weight loss must be considered critically given the dangers of sarcopenia (a condition that occurs when muscle mass and quality is lost), the increase risk of hip fracture with weight loss, and the association between reduced mortality and increased BMI in older adults. This overview highlights the challenges and implications of measuring adiposity in older adults, the dangers and benefits of weight loss in this population, and provides an overview of the new Medicare Obesity Benefit. In addition we provide a summary of outcomes from successful weight loss interventions for older adults and discuss implications for advancing clinical practice. PMID:26627496

  14. Regenerative Endodontics for Adult Patients.

    Science.gov (United States)

    He, Ling; Kim, Sahng G; Gong, Qimei; Zhong, Juan; Wang, Sainan; Zhou, Xuedong; Ye, Ling; Ling, Junqi; Mao, Jeremy J

    2017-09-01

    The goal of endodontics is to save teeth. Since inception, endodontic treatments are performed to obturate disinfected root canals with inert materials such as gutta-percha. Although teeth can be saved after successful endodontic treatments, they are devitalized and therefore susceptible to reinfections and fractures. The American Association of Endodontists (AAE) has made a tremendous effort to revitalize disinfected immature permanent teeth in children and adolescents with diagnoses including pulp necrosis or apical periodontitis. The American Dental Association (ADA) in 2011 issued several clinical codes for regenerative endodontic procedures or apical revascularization in necrotic immature permanent teeth in children and adolescents. These AAE and ADA initiatives have stimulated robust interest in devising a multitude of tissue engineering approaches for dental pulp and dentin regeneration. Can the concept of regenerative endodontics be extended to revitalize mature permanent teeth with diagnoses including irreversible pulpitis and/or pulp necrosis in adults? The present article was written not only to summarize emerging findings to revitalize mature permanent teeth in adult patients but also to identify challenges and strategies that focus on realizing the goal of regenerative endodontics in adults. We further present clinical cases and describe the biological basis of potential regenerative endodontic procedures in adults. This article explores the frequently asked question if regenerative endodontic therapies should be developed for dental pulp and/or dentin regeneration in adults, who consist of the great majority of endodontic patients. Copyright © 2017 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  15. MRI of medulloblastoma in adults

    Energy Technology Data Exchange (ETDEWEB)

    Malheiros, S.M.F.; Santos, A.J.; Borges, L.R.R.; Guimaraes, I.F.; Franco, C.M.R.; Gabbai, A.A. [Department of Neurology, Universidade Federal de Sao Paulo Rua Botucatu 740, SP 04023-900, Sao Paulo (Brazil); Carrete, H. [Department of Radiology, Universidade Federal de Sao Paulo Rua Botucatu 740, SP 04023-900, Sao Paulo (Brazil); Stavale, J.N.; Pelaez, M.P. [Department of Pathology, Universidade Federal de Sao Paulo Rua Botucatu 740, SP 04023-900, Sao Paulo (Brazil)

    2003-07-01

    Medulloblastoma has variable appearances on MRI in both children and adults. Adults are more likely to have heterogeneous cerebellar hemisphere tumours, and this is thought to be related to the greater prevalence of desmoplastic tumours in adulthood. Few studies have addressed the MRI features of adult medulloblastoma and the specific characteristics of desmoplastic and classic tumours have not been analysed. Our aim was to analyse the imaging characteristics of desmoplastic (DM) and classic (CM) medulloblastomas in adult. We retrospectively studied preoperative MRI of six men and three women, median age 33 years, range 23-53 years, with pathologically proved medulloblastomas. There were six (67%) with DM. The tumour was in the cerebellar hemisphere in eight patients (89%), including the three with CM, one of which was bilateral. All tumours were heterogeneous, giving predominantly low or isointense signal on T1- and isointense signal on T2-weighted images. Cystic or necrotic areas in all patients were particularly visible on T2-weighted images. Contrast enhancement was absent in one DM and varied from slight to intense in eight (three CM), homogeneous in one DM and patchy in seven. All tumours extended to the surface of the cerebellum and two had well-defined margins. MRI does not allow a clear distinction between DM and CM in adults. (orig.)

  16. Adult onset pityriasis rubra pilaris

    Directory of Open Access Journals (Sweden)

    Sehgal Virendra

    2008-01-01

    Full Text Available Pityriasis rubra pilaris (PRP has always been an intriguing topic ever since its inception. It is a group of chronic disorders characterized by reddish orange plaques with pityriasiform scaling showing follicular keratoses, palmoplantar keratoderma, and sometimes, erythroderma. It occurs all over the world but with racial variations. Its incidence might vary and the age at onset, behavior, clinical appearance, and prognosis are considered to be very important for its classification. It may manifest either as Type I classical adult onset PRP, Type II atypical adult (onset PRP, or Type VI PRP (HIV-associated PRP pityriasis rubra pilaris in contrast to classical juvenile (Type III and circumscribed juvenile (Type IV encountered among children. Its diagnosis is largely clinical with microscopic pathology being a useful supplement, but it continues to be a therapeutic dilemma. We review the epidemiology of adult onset PRP here and take stock of the prevalent treatment options.

  17. Facial cystic lymphangioma in adults.

    Science.gov (United States)

    Biasotto, Matteo; Clozza, Emanuele; Tirelli, Giancarlo

    2012-07-01

    Lymphangiomas are uncommon congenital malformations of the lymphatic system, generally diagnosed during childhood. These malformations are rarely seen in adults, and the literature provides poor guidelines for treatment options that must be carefully applied to the facial region. Diagnosis in adult subjects is difficult to achieve, and also management of these conditions is still challenging because they tend to infiltrate adjacent tissues, causing frequent relapses. Radical surgery is the main form of treatment, avoiding the sacrifice of function or aesthetics of the patient. Two cases of cystic lymphangioma of the facial region found in adults are described from a clinical and pathologic point of view. The aim of this article was to point out that an early recognition of cystic lymphangioma is a crucial goal to initiate a prompt treatment avoiding serious complication.

  18. Health Literacy and Older Adults

    Directory of Open Access Journals (Sweden)

    Amy K. Chesser PhD

    2016-02-01

    Full Text Available Objective: The objective of this review was to assess published literature relating to health literacy and older adults. Method: The current review was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta Analyses. Results: Eight articles met inclusion criteria. All studies were conducted in urban settings in the United States. Study sample size ranged from 33 to 3,000 participants. Two studies evaluated health-related outcomes and reported significant associations between low health literacy and poorer health outcomes. Two other studies investigated the impact of health literacy on medication management, reporting mixed findings. Discussion: The findings of this review highlight the importance of working to improve health care strategies for older adults with low health literacy and highlight the need for a standardized and validated clinical health literacy screening tool for older adults.

  19. Abdominal wall blocks in adults

    DEFF Research Database (Denmark)

    Børglum, Jens; Gögenür, Ismail; Bendtsen, Thomas F

    2016-01-01

    Purpose of review Abdominal wall blocks in adults have evolved much during the last decade; that is, particularly with the introduction of ultrasound-guided (USG) blocks. This review highlights recent advances of block techniques within this field and proposes directions for future research.......  Recent findings Ultrasound guidance is now considered the golden standard for abdominal wall blocks in adults, even though some landmark-based blocks are still being investigated. The efficiency of USG transversus abdominis plane blocks in relation to many surgical procedures involving the abdominal wall...... been introduced with success. Future research should also investigate the effect of specific abdominal wall blocks on neuroendocrine and inflammatory stress response after surgery.  Summary USG abdominal wall blocks in adults are commonplace techniques today. Most abdominal wall blocks are assigned...

  20. Adult-onset food allergy.

    Science.gov (United States)

    Kivity, Shmuel

    2012-01-01

    The prevalence of food allergy is increasing in both the pediatric and adult populations. While symptom onset occurs mostly during childhood, there are a considerable number of patients whose symptoms first begin to appear after the age of 18 years. The majority of patients with adult-onset food allergy suffer from the pollen-plant allergy syndromes. Many of them manifest their allergy after exercise and consuming food to which they are allergic. Eosinophilic esophagitis, an eosinophilic inflammation of the esophagus affecting individuals of all ages, recently emerged as another allergic manifestation, with both immediate and late response to the ingested food. This review provides a condensed update of the current data in the literature on adult-onset allergy.