WorldWideScience

Sample records for adjacent normal skin

  1. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  2. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  3. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  4. TP53 mutations in clinically normal mucosa adjacent to oral carcinomas

    DEFF Research Database (Denmark)

    Thode, Christenze; Bilde, Anders; von Buchwald, Christian

    2010-01-01

    BACKGROUND: The tumour-suppressor protein p53 often accumulates in histologically normal epithelium adjacent to oral squamous cell carcinomas (OSCC). We investigated whether this was associated with mutations in TP53, the gene for p53, and might implicate impending malignancy. METHODS: Specimens...... products were separated by denatured gradient gel electrophoresis. Fragments with a deviant DGEE pattern were sequenced. RESULTS: TP53 mutations were found in six of 18 tumours. Fourteen specimens contained histologically normal mucosa adjacent to the tumour; 13 of these showed small clusters of p53...

  5. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  6. The skin immune system (SIS): distribution and immunophenotype of lymphocyte subpopulations in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.

    1987-01-01

    The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells

  7. Screening of the residual normal ovarian tissue adjacent to orthotopic epithelial ovarian carcinomas in nude mice.

    Science.gov (United States)

    Zhu, G H; Wang, S T; Yao, M Z; Cai, J H; Chen, C Y; Yang, Z X; Hong, L; Yang, S Y

    2014-04-16

    The objective of this study was to explore the feasibility and methods of screening the residual normal ovarian tissue adjacent to orthotopic ovarian carcinomas in nude mice. Human epithelial ovarian cancer cells (OVCAR3) were subcutaneously implanted for a tumor source and ovarian orthotopic transplantation. The cancer tissue, proximal paraneoplastic tissue, middle paraneoplastic tissue, remote paraneoplastic tissue, and normal ovarian tissue were removed. CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was detected by reverse transcription polymerase chain reaction. We obtained 35 paraneoplastic residual ovarian tissues with normal biopsies from 40 cases of an orthotopic epithelial ovarian carcinoma model (87.5%). CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was lower in proximal paraneoplastic tissue than in cancer tissue (P tissue (P tissue as well as among residual normal ovarian tissues with different severity (P > 0.05). In ovarian tissues of 20 normal nude mice, the expression of CK- 7, CA125, p53, survivin, MMP-2, and TIMP-2 was negative. Overall, the expression levels of CK-7, CA125, p53, survivin, MMP-2, TIMP-2, and other molecular markers showed a decreasing trend in the non-cancer tissue direction. The expression levels can be used as standards to screen residual normal ovarian tissue. We can obtain relatively safe normal ovarian tissues adjacent to epithelial ovarian cancer.

  8. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  9. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  10. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  11. Distribution of erlotinib in rash and normal skin in cancer patients receiving erlotinib visualized by matrix assisted laser desorption/ionization mass spectrometry imaging.

    Science.gov (United States)

    Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu

    2018-04-06

    The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.

  12. Limb regeneration from X-irradiated tails of Ambystoma mexicanum following transplantation of flank skin from region adjacent to hindlimb

    International Nuclear Information System (INIS)

    Hofmann, D.K.; Kleinebeckel, D.; Luther, W.

    1978-01-01

    In the experiments performed by W. Luther on young Ambystoma mexicanum, tails of host animals were irradiated with 2000 r. Afterwards a skin cuff was removed from the mid-tail region. From non-irradiated donor animals, square pieces of skin dorsally adjacent to both hindlimbs were grafted (either 90 0 -rotated or unrotated) to both sides of the denuded area of the irradiated host tail. After 3 weeks the tails were amputated across the skin transplants, and the structures which had regenerated from the distal portions of the tails were fixed 6-16 weeks later. Morhological and histological investigation revealed that 4 out of 12 regenerates from rotated grafts showed clear limb characteristics. (orig./AJ) [de

  13. Radiation-induced skin ulcer and rib fractures following percutaneous coronary intervention (PCI): A case of right back skin ulcer and adjacent rib fractures after single PCI.

    Science.gov (United States)

    Yasukochi, Yumi; Nakahara, Takeshi; Koike, Akihiro; Ichikawa, Ryutaro; Koga, Tetsuya; Furue, Masutaka

    2015-05-01

    We experienced a 75-year-old male patient with a refractory and severely painful skin ulcer on the right back. He had suffered from ischemic heart disease and undergone percutaneous coronary intervention 5 months prior to the consultation with us. The characteristic clinical appearance, location of the lesion and his past medical history led us to the diagnosis of radiation-induced skin ulcer. Magnetic resonance imaging, computed tomography as well as bone scintigraphy showed fractures of the right back rib adjacent to the ulcer, which was thought to be attributable to bone damage due to X-ray radiation and/or persistent secondary inflammation of the chronic ulcer. In the published work, there are no other reports of bone fractures associated with radiation dermatitis after coronary interventional radiology. © 2015 Japanese Dermatological Association.

  14. Altered expression of estrogen receptor-α variant messenger RNAs between adjacent normal breast and breast tumor tissues

    International Nuclear Information System (INIS)

    Leygue, Etienne; Dotzlaw, Helmut; Watson, Peter H; Murphy, Leigh C

    2000-01-01

    Using semiquantitative reverse transcription-polymerase chain reaction assays, we investigated the expression of variant messenger RNAs relative to wild-type estrogen receptor (ER)-α messenger RNA in normal breast tissues and their adjacent matched breast tumor tissues. Higher ER variant truncated after sequences encoding exon 2 of the wild-type ER-α (ERC4) messenger RNA and a lower exon 3 deleted ER-α variant (ERD3) messenger RNA relative expression in the tumor compartment were observed in the ER-positive/PR-positive and the ER-positive subsets, respectively. A significantly higher relative expression of exon 5 deleted ER-α varient (ERD5) messenger RNA was observed in tumor components overall. These data demonstrate that changes in the relative expression of ER-α variant messenger RNAs occur between adjacent normal and neoplastic breast tissues. We suggest that these changes might be involved in the mechanisms that underlie breast tumorigenesis. Estrogen receptor (ER)-α and ER-β are believed to mediate the action of estradiol in target tissues. Several ER-α and ER-β variant messenger RNAs have been identified in both normal and neoplastic human tissues. Most of these variants contain a deletion of one or more exons of the wild-type (WT) ER messenger RNAs. The putative proteins that are encoded by these variant messenger RNAs would therefore be missing some functional domains of the WT receptors, and might interfere with WT-ER signaling pathways. The detection of ER-α variants in both normal and neoplastic human breast tissues raised the question of their possible role in breast tumorigenesis. We have previously reported an increased relative expression of exon 5 deleted ER-α variant (ERD5) messenger RNA and of another ER-α variant truncated of all sequences following the exon 2 of the WT ER-α (ERC4) messenger RNA in breast tumor samples versus independent normal breast tissues. In contrast, a decreased relative expression of exon 3 deleted ER

  15. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  16. Direct immunofluorescence of normal skin in rheumatoid arthritis.

    Science.gov (United States)

    Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S

    1985-11-01

    The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.

  17. Mammary stem cell and macrophage markers are enriched in normal tissue adjacent to inflammatory breast cancer.

    Science.gov (United States)

    Reddy, Jay P; Atkinson, Rachel L; Larson, Richard; Burks, Jared K; Smith, Daniel; Debeb, Bisrat G; Ruffell, Brian; Creighton, Chad J; Bambhroliya, Arvind; Reuben, James M; Van Laere, Steven J; Krishnamurthy, Savitri; Symmans, William F; Brewster, Abenaa M; Woodward, Wendy A

    2018-06-01

    We hypothesized that breast tissue not involved by tumor in inflammatory breast cancer (IBC) patients contains intrinsic differences, including increased mammary stem cells and macrophage infiltration, which may promote the IBC phenotype. Normal breast parenchyma ≥ 5 cm away from primary tumors was obtained from mastectomy specimens. This included an initial cohort of 8 IBC patients and 60 non-IBC patients followed by a validation cohort of 19 IBC patients and 25 non-IBC patients. Samples were immunostained for either CD44 + CD49f + CD133/2 + mammary stem cell markers or the CD68 macrophage marker and correlated with IBC status. Quantitation of positive cells was determined using inForm software from PerkinElmer. We also examined the association between IBC status and previously published tumorigenic stem cell and IBC tumor signatures in the validation cohort samples. 8 of 8 IBC samples expressed isolated CD44 + CD49f + CD133/2 + stem cell marked cells in the initial cohort as opposed to 0/60 non-IBC samples (p = 0.001). Similarly, the median number of CD44 + CD49f + CD133/2 + cells was significantly higher in the IBC validation cohort as opposed to the non-IBC validation cohort (25.7 vs. 14.2, p = 0.007). 7 of 8 IBC samples expressed CD68 + histologically confirmed macrophages in initial cohort as opposed to 12/48 non-IBC samples (p = 0.001). In the validation cohort, the median number of CD68 + cells in IBC was 3.7 versus 1.0 in the non-IBC cohort (p = 0.06). IBC normal tissue was positively associated with a tumorigenic stem cell signature (p = 0.02) and with a 79-gene IBC signature (p stem cell signature and IBC-specific tumor signature. Collectively, these data suggest that IBC normal tissue differs from non-IBC tissue. Whether these changes occur before the tumor develops or is induced by tumor warrants further investigation.

  18. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  19. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  20. Effect of friction on vibrotactile sensation of normal and dehydrated skin.

    Science.gov (United States)

    Chen, S; Ge, S; Tang, W; Zhang, J

    2016-02-01

    Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Markers of fibrosis and epithelial to mesenchymal transition demonstrate field cancerization in histologically normal tissue adjacent to breast tumors

    Science.gov (United States)

    Trujillo, Kristina A.; Heaphy, Christopher M.; Mai, Minh; Vargas, Keith M.; Jones, Anna C.; Vo, Phung; Butler, Kimberly S.; Joste, Nancy E.; Bisoffi, Marco; Griffith, Jeffrey K

    2011-01-01

    Previous studies have shown that a field of genetically altered but histologically normal tissue extends 1 cm or more from the margins of human breast tumors. The extent, composition and biological significance of this field are only partially understood, but the molecular alterations in affected cells could provide mechanisms for limitless replicative capacity, genomic instability and a microenvironment that supports tumor initiation and progression. We demonstrate by microarray, qRT-PCR and immunohistochemistry a signature of differential gene expression that discriminates between patient-matched, tumor-adjacent histologically normal breast tissues located 1 cm and 5 cm from the margins of breast adenocarcinomas (TAHN-1 and TAHN-5, respectively). The signature includes genes involved in extracellular matrix remodeling, wound healing, fibrosis and epithelial to mesenchymal transition (EMT). Myofibroblasts, which are mediators of wound healing and fibrosis, and intra-lobular fibroblasts expressing MMP2, SPARC, TGF-β3, which are inducers of EMT, were both prevalent in TAHN-1 tissues, sparse in TAHN-5 tissues, and absent in normal tissues from reduction mammoplasty. Accordingly, EMT markers S100A4 and vimentin were elevated in both luminal and myoepithelial cells, and EMT markers α-smooth muscle actin and SNAIL were elevated in luminal epithelial cells of TAHN-1 tissues. These results identify cellular processes that are differentially activated between TAHN-1 and TAHN-5 breast tissues, implicate myofibroblasts as likely mediators of these processes, provide evidence that EMT is occurring in histologically normal tissues within the affected field and identify candidate biomarkers to investigate whether or how field cancerization contributes to the development of primary or recurrent breast tumors. PMID:21105047

  2. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  3. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan

    2012-01-01

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  4. On Predicting lung cancer subtypes using ‘omic’ data from tumor and tumor-adjacent histologically-normal tissue

    International Nuclear Information System (INIS)

    Pineda, Arturo López; Ogoe, Henry Ato; Balasubramanian, Jeya Balaji; Rangel Escareño, Claudia; Visweswaran, Shyam; Herman, James Gordon; Gopalakrishnan, Vanathi

    2016-01-01

    Adenocarcinoma (ADC) and squamous cell carcinoma (SCC) are the most prevalent histological types among lung cancers. Distinguishing between these subtypes is critically important because they have different implications for prognosis and treatment. Normally, histopathological analyses are used to distinguish between the two, where the tissue samples are collected based on small endoscopic samples or needle aspirations. However, the lack of cell architecture in these small tissue samples hampers the process of distinguishing between the two subtypes. Molecular profiling can also be used to discriminate between the two lung cancer subtypes, on condition that the biopsy is composed of at least 50 % of tumor cells. However, for some cases, the tissue composition of a biopsy might be a mix of tumor and tumor-adjacent histologically normal tissue (TAHN). When this happens, a new biopsy is required, with associated cost, risks and discomfort to the patient. To avoid this problem, we hypothesize that a computational method can distinguish between lung cancer subtypes given tumor and TAHN tissue. Using publicly available datasets for gene expression and DNA methylation, we applied four classification tasks, depending on the possible combinations of tumor and TAHN tissue. First, we used a feature selector (ReliefF/Limma) to select relevant variables, which were then used to build a simple naïve Bayes classification model. Then, we evaluated the classification performance of our models by measuring the area under the receiver operating characteristic curve (AUC). Finally, we analyzed the relevance of the selected genes using hierarchical clustering and IPA® software for gene functional analysis. All Bayesian models achieved high classification performance (AUC > 0.94), which were confirmed by hierarchical cluster analysis. From the genes selected, 25 (93 %) were found to be related to cancer (19 were associated with ADC or SCC), confirming the biological relevance of our

  5. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao

    2006-01-01

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  6. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  7. Skin perfusion measurement: the normal range, the effects of ambient temperature and its clinical application

    International Nuclear Information System (INIS)

    Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.

    1982-01-01

    Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level

  8. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  9. Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.

    Science.gov (United States)

    Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine

    2013-12-15

    The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.

  10. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  11. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  12. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  13. Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin

    Science.gov (United States)

    Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen

    2012-10-01

    An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.

  14. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  15. Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells

    International Nuclear Information System (INIS)

    Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki

    2008-01-01

    The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)

  16. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; hide

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  17. Increased expression of enhancer of Zeste Homolog 2 (EZH2) differentiates squamous cell carcinoma from normal skin and actinic keratosis.

    Science.gov (United States)

    Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi

    2014-01-01

    Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.

  18. Comparison of telomere length and insulin-like growth factor-binding protein 7 promoter methylation between breast cancer tissues and adjacent normal tissues in Turkish women.

    Science.gov (United States)

    Kaya, Zehra; Akkiprik, Mustafa; Karabulut, Sevgi; Peker, Irem; Gullu Amuran, Gokce; Ozmen, Tolga; Gulluoglu, Bahadır M; Kaya, Handan; Ozer, Ayse

    2017-09-01

    Both insulin-like growth factor-binding protein 7 (IGFBP7) and telomere length (TL) are associated with proliferation and senescence of human breast cancer. This study assessed the clinical significance of both TL and IGFBP7 methylation status in breast cancer tissues compared with adjacent normal tissues. We also investigated whether IGFBP7 methylation status could be affecting TL. Telomere length was measured by quantitative PCR to compare tumors with their adjacent normal tissues. The IGFBP7 promoter methylation status was evaluated by methylation-specific PCR and its expression levels were determined by western blotting. Telomeres were shorter in tumor tissues compared to controls (Pbreast cancer with invasive ductal carcinoma (IDC; n=72; P=.014) compared with other histological type (n=29), and TL in IDC with HER2 negative (n=53; P=.017) was higher than TL in IDC with HER2 positive (n=19). However, telomeres were shortened in advanced stages and growing tumors. IGFBP7 methylation was observed in 90% of tumor tissues and 59% of controls (P=.0002). Its frequency was significantly higher in IDC compared with invasive mixed carcinoma (IMC; P=.002) and it was not correlated either with protein expression or the other clinicopathological parameters. These results suggest that IGFBP7 promoter methylation and shorter TL in tumor compared with adjacent tissues may be predictive biomarkers for breast cancer. Telomere maintenance may be indicative of IDC and IDC with HER2 (-) of breast cancer. Further studies with larger number of cases are necessary to verify this association. © 2016 Wiley Periodicals, Inc.

  19. Survival of human diploid skin fibroblasts from normal individuals after X-irradiation

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.

    1988-01-01

    The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)

  20. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.

    2011-01-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  1. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  2. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

    1983-01-01

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  3. High load of Merkel cell polyomavirus DNA detected in the normal skin of Japanese patients with Merkel cell carcinoma.

    Science.gov (United States)

    Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori

    2016-09-01

    Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  5. Transcriptome profiling of the cancer, adjacent non-tumor and distant normal tissues from a colorectal cancer patient by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Yan'an Wu

    Full Text Available Colorectal cancer (CRC is one of the most commonly diagnosed cancers in the world. A genome-wide screening of transcriptome dysregulation between cancer and normal tissue would provide insight into the molecular basis of CRC initiation and progression. Compared with microarray technology, which is commonly used to identify transcriptional changes, the recently developed RNA-seq technique has the ability to detect other abnormal regulations in the cancer transcriptome, such as alternative splicing, novel transcripts or gene fusion. In this study, we performed high-throughput transcriptome sequencing at ~50× coverage on CRC, adjacent non-tumor and distant normal tissue. The results revealed cancer-specific, differentially expressed genes and differential alternative splicing, suggesting that the extracellular matrix and metabolic pathways are activated and the genes related to cell homeostasis are suppressed in CRC. In addition, one tumor-restricted gene fusion, PRTEN-NOTCH2, was also detected and experimentally confirmed. This study reveals some common features in tumor invasion and provides a comprehensive survey of the CRC transcriptome, which provides better insight into the complexity of regulatory changes during tumorigenesis.

  6. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  7. Influence of low-energy laser radiation on normal skin and certain tumor tissues

    Energy Technology Data Exchange (ETDEWEB)

    Pletnev, S.D.; Karpenko, O.M.

    For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.

  8. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  9. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2018-05-01

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  11. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  12. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...

  13. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  14. The examination of biophysical parameters of skin (transepidermal water loss, skin hydration and pH value) in different body regions of normal cats of both sexes.

    Science.gov (United States)

    Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H

    2011-04-01

    The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  15. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  16. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  17. A comparison study of lipid profile levels between skin tags affected people and normal population in Tehran, Iran

    Directory of Open Access Journals (Sweden)

    Abbas Rasi

    2014-01-01

    Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.

  18. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  19. Site, gender and age variation in normal skin colour on the back and the forearm: tristimulus colorimeter measurements.

    Science.gov (United States)

    Fullerton, A; Serup, J

    1997-02-01

    To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.

  20. Real-time visualization of melanin granules in normal human skin using combined multiphoton and reflectance confocal microscopy.

    Science.gov (United States)

    Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan

    2015-05-01

    Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Chemical peeling by SA-PEG remodels photo-damaged skin: suppressing p53 expression and normalizing keratinocyte differentiation.

    Science.gov (United States)

    Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka

    2006-02-01

    Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.

  2. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  3. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application

  4. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  5. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  6. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  7. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  8. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  9. Effects of the association of chemotherapy and radiotherapy on normal mouse skin

    International Nuclear Information System (INIS)

    Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.

    1978-01-01

    The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions

  10. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  11. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  12. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  13. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  14. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  15. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  16. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  17. Angiogenic effects of cryosurgery with liquid nitrogen on the normal skin of rats, through morphometric study.

    Science.gov (United States)

    Pimentel, Camila Bianco; Moraes, Aparecida Machado de; Cintra, Maria Letícia

    2014-01-01

    Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).

  18. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  19. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  20. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  1. Distribution of myofibroblast cells and microvessels around invasive ductal carcinoma of the breast and comparing with the adjacent range of their normal-to-DCIS zones.

    Science.gov (United States)

    Dabiri, Shahriar; Talebi, Amin; Shahryari, Jahanbanoo; Meymandi, Manzoumeh Shamsi; Safizadeh, Hossein

    2013-02-01

    This study seeks to determine the relationships between manifestation of myofibroblasts in the stroma tissue of hyperplastic pre-invasive breast lesions to invasive cancer by investigating clinicopathological data of patients, their effect on steroid receptor expression and HER2, and angiogenesis according to CD34 antigen expression. 100 cases of invasive ductal carcinoma were immunohistochemically investigated for the presence of smooth muscle actin (SMA), ER/PR, HER2, anti-CD34 antibody and microvessel count (MVC). Patients were scored in four different zones of invasive areas: invasive cancer, DCIS, fibrocystic disease ± ductal intraepithelial neoplasia (FCD ± DIN), and normal tissue.  There was a significant difference in stromal myofibroblasts between all areas except for the stroma of DCIS and FCD ± DIN (P normal areas (P = 0.054). There was a significant difference in MVC observed in all areas except for DCIS and FCD ± DIN (P < 0.001). We noted significant inverse correlations between MVC, HER2 expression, and the numbers of involved lymph nodes in invasive cancer and DCIS (P < 0.001). Most MVC were present in grade I, with the least frequent observed in grade III cases in the stroma of invasive cancer, DCIS and FCD ± DIN (P < 0.001).  Angiogenesis can be observed before any significant myofibroblastic changes in the pre-invasive breast lesions. The elevated content of myofibroblasts in stroma of tumor; probably may be a worse prognostic factor  and the steps from atypical epithelial hyperplasia to DCIS and then to the invasive carcinoma do not appear to be always part of a linear progression.

  2. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  3. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  4. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  5. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  6. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...

  7. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...

  9. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  10. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Directory of Open Access Journals (Sweden)

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  11. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1978-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  12. Radiosensitivity of fibroblasts obtained from a cafe-au-lait spot and normal-appearing skin of a patient with neurofibromatosis (NF-6)

    International Nuclear Information System (INIS)

    Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.

    1990-01-01

    Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells

  13. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  14. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  15. Hyperpigmentation of the skin associated with minocycline therapy

    International Nuclear Information System (INIS)

    Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.

    1985-01-01

    Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients

  16. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    Selsky, C.A.

    1976-01-01

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  17. Forehead Skin Blood Flow in Normal Neonates during Active and Quiet Sleep, Measured with a Diode Laser Doppler Instrument

    NARCIS (Netherlands)

    Suichies, H.E.; Aarnoudse, J.G.; Okken, A.; Jentink, H.W.; de Mul, F.F.M.; Greve, Jan

    1988-01-01

    Changes in forehead skin blood flow during active and quiet sleep were determined in 16 healthy neonates using a recently developed semi-conductor laser Doppler flow meter without light conducting fibres. Measurements were carried out at a postnatal age varying from 5 hours to 7 days. The two sleep

  18. An oral TRPV1 antagonist attenuates laser radiant-heat-evoked potentials and pain ratings from UV(B)-inflamed and normal skin.

    Science.gov (United States)

    Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram

    2013-02-01

    Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  19. Investigation of the predictive validity of laser-EPs in normal, UVB-inflamed and capsaicin-irritated skin with four analgesic compounds in healthy volunteers.

    Science.gov (United States)

    Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim

    2017-07-01

    The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical

  20. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  1. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-01-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  2. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  3. Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.

    Science.gov (United States)

    Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T

    1999-04-01

    The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.

  4. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  5. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  6. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    OpenAIRE

    Sobanska, Anna W.; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present ...

  7. Formation of DNA single-strand breaks by near-ultraviolet and gamma-rays in normal and Bloom's syndrome skin fibroblasts

    International Nuclear Information System (INIS)

    Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.

    1981-01-01

    The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks

  8. Effect of treatment in fractionated schedules with the combination of x-irradiation and six cytotoxic drugs on the RIF-1 tumor and normal mouse skin

    International Nuclear Information System (INIS)

    Lelieveld, P.; Scoles, M.A.; Brown, J.M.; Phil, D.; Kallman, R.F.

    1985-01-01

    RIF-1 tumors, implanted syngeneically in the gastrocnemius muscles of the right hind legs of C3H/Km mice, were treated either with X ray alone, drug alone, or drug and X ray combined. The drugs tested were bleomycin, BCNU, cis-diamminedichloro platinum, adriamycin, cyclophosphamide, and actinomycin-D. All drugs were administered either in the maximum tolerated dose or a dose that causes minimal tumor growth delay. Both drugs and X rays were administered either as a single dose or in five daily fractions. In addition to the single modality controls, seven different schedules of combined modalities were tested. Tumors were measured periodically after treatment in order that the day at which each tumor reached 4 times its initial cross-sectional area, i.e., its size at the time of treatment, could be determined. The effect of treatment on tumors was based upon excess growth delay (GD), i.e., T400% (treated)-T400% (untreated control). Treatment effects for the same combined modality schedules were also determined for normal skin, using the early skin reaction as an endpoint. Dose effect factors (DEF) were computed for all combined modality schedules and were based upon calculated radiation dose equivalents. We also calculated supra-additivity ratios, SR/sub I/ and SR/sub II/, therapeutic gain factors and adjusted therapeutic gain factors. The only drugs to produce significant supra-additivity with X rays were cis-Pt and cyclo

  9. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  10. Quantification of sunscreen ethylhexyl triazone in topical skin-care products by normal-phase TLC/densitometry.

    Science.gov (United States)

    Sobanska, Anna W; Pyzowski, Jaroslaw

    2012-01-01

    Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot(-1). Both methods were validated.

  11. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...

  12. Skin graft - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

  13. Skin blood flow from gas transport: helium xenon and laser Doppler compared

    International Nuclear Information System (INIS)

    Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

    1988-01-01

    A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics

  14. Skin blood flow from gas transport: helium xenon and laser Doppler compared

    Energy Technology Data Exchange (ETDEWEB)

    Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.

    1988-03-01

    A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics.

  15. A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, M A L M; Suppa, M; Marneffe, A

    2016-01-01

    properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....

  16. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    International Nuclear Information System (INIS)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E.

    1991-01-01

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with [3H]glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of [3H]chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics

  17. Proteomics reveals novel oxidative and glycolytic mechanisms in type 1 diabetic patients' skin which are normalized by kidney-pancreas transplantation.

    Directory of Open Access Journals (Sweden)

    Franco Folli

    2010-03-01

    Full Text Available In type 1 diabetes (T1D vascular complications such as accelerated atherosclerosis and diffused macro-/microangiopathy are linked to chronic hyperglycemia with a mechanism that is not yet well understood. End-stage renal disease (ESRD worsens most diabetic complications, particularly, the risk of morbidity and mortality from cardiovascular disease is increased several fold.We evaluated protein regulation and expression in skin biopsies obtained from T1D patients with and without ESRD, to identify pathways of persistent cellular changes linked to diabetic vascular disease. We therefore examined pathways that may be normalized by restoration of normoglycemia with kidney-pancreas (KP transplantation. Using proteomic and ultrastructural approaches, multiple alterations in the expression of proteins involved in oxidative stress (catalase, superoxide dismutase 1, Hsp27, Hsp60, ATP synthase delta chain, and flavin reductase, aerobic and anaerobic glycolysis (ACBP, pyruvate kinase muscle isozyme, and phosphoglycerate kinase 1, and intracellular signaling (stratifin-14-3-3, S100-calcyclin, cathepsin, and PPI rotamase as well as endothelial vascular abnormalities were identified in T1D and T1D+ESRD patients. These abnormalities were reversed after KP transplant. Increased plasma levels of malondialdehyde were observed in T1D and T1D+ESRD patients, confirming increased oxidative stress which was normalized after KP transplant.Our data suggests persistent cellular changes of anti-oxidative machinery and of aerobic/anaerobic glycolysis are present in T1D and T1D+ESRD patients, and these abnormalities may play a key role in the pathogenesis of hyperglycemia-related vascular complications. Restoration of normoglycemia and removal of uremia with KP transplant can correct these abnormalities. Some of these identified pathways may become potential therapeutic targets for a new generation of drugs.

  18. Both near ultraviolet radiation and the oxidizing agent hydrogen peroxide induce a 32-kDa stress protein in normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Keyse, S.M.; Tyrrell, R.M.

    1987-01-01

    We have analyzed the pattern of protein synthesis in solar near ultraviolet (334 nm, 365 nm) and near visible (405 nm) irradiated normal human skin fibroblasts. Two hours after irradiation we find that one major stress protein of approximately 32 kDa is induced in irradiated cells. This protein is not induced by ultraviolet radiation at wavelengths shorter than 334 nm and is not inducible by heat shock treatment of these cells. Although sodium arsenite, diamide, and menadione all induced a 32-kDa protein, they also induced the major heat shock proteins. In contrast, the oxidizing agent, hydrogen peroxide, induced the low molecular weight stress protein without causing induction of the major heat shock proteins. A comparison of the 32-kDa proteins induced by sodium arsenite, H 2 O 2 , and solar near ultraviolet radiation using chemical peptide mapping shows that they are closely related. These results imply that the pathways for induction of the heat shock response and the 32-kDa protein are not identical and suggest that, at least in the case of radiation and treatment with H 2 O 2 , the 32-kDa protein might be induced in response to cellular oxidative stress. This conclusion is supported by the observation that depletion of endogenous cellular glutathione prior to solar near ultraviolet irradiation lowers the fluence threshold for induction of the 32-kDa stress protein

  19. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    International Nuclear Information System (INIS)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  20. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  1. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  2. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  3. Esterification of all-trans-retinol in normal human epithelial cell strains and carcinoma lines from oral cavity, skin and breast: reduced expression of lecithin:retinol acyltransferase in carcinoma lines.

    Science.gov (United States)

    Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J

    2000-11-01

    When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.

  4. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  5. Preliminary observations on differences in the Raman spectra of cancerous and noncancerous cells and connective tissue of human skin

    Science.gov (United States)

    Short, Michael A.; Lui, Harvey; McLean, David I.; Zeng, Haishan; Alajlan, Abdulmajeed; Chen, Michael X.

    2005-04-01

    A less invasive method of reliably detecting skin cancers is required. Raman spectroscopy is just one of several spectroscopic methods that look promising, but are not yet sufficiently reliable. More information is needed on how and why the Raman spectra of cancerous skin tissue is different from its normal counterpart. We have used confocal micro-Raman spectroscopy with a spatial resolution of about a micron to obtain spectra of unstained thin sections of human skin. We found that there were clear differences in the Raman spectra between cancerous and non-cancerous tissue both in cells and in the connective tissue. The DNA contribution to the spectra was generally stronger in malignant cells than normal ones. In regions of the dermis far away from the tumor one obtains the usual collagen spectra of normal skin, but adjacent to the tumor the spectra no longer appeared to be those of native collagen.

  6. Study of skin and nail Candida species as a normal flora based on age groups in healthy persons in Tehran-Iran.

    Science.gov (United States)

    Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F

    2017-12-01

    The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.

  7. Blood flow in skin, subcutaneous adipose tissue and skeletal muscle in the forearm of normal man during an oral glucose load

    DEFF Research Database (Denmark)

    Bülow, J; Astrup, A; Christensen, N J

    1987-01-01

    Blood flow to the forearm, and the subcutaneous tissue and skin in the forearm were measured by strain gauge plethysmography, 133Xe-elimination and Laser Doppler flowmetry during an oral glucose load (I g glucose kg-1 lean body mass) and during control conditions. The forearm blood flow remained...... constant during both experiments. Glucose induced a two-fold vasodilatation in subcutaneous tissue. In skin, glucose induced a relative vasodilatation and later a relative vasoconstriction compared with control experiments. When estimated from forearm blood flow and subcutaneous and skin blood flows......, muscle blood flow decreased about 20-30% during both experiments. Proximal nervous blockade did not abolish the glucose-induced vasodilatation in subcutaneous tissue. In the glucose experiment, arterial glucose concentration increased to 7.8 +/- 1.17 mmol l-1 30 min after the load was given...

  8. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  9. Effect of Exercise-induced Sweating on facial sebum, stratum corneum hydration, and skin surface pH in normal population.

    Science.gov (United States)

    Wang, Siyu; Zhang, Guirong; Meng, Huimin; Li, Li

    2013-02-01

    Evidence demonstrated that sweat was an important factor affecting skin physiological properties. We intended to assess the effects of exercise-induced sweating on the sebum, stratum corneum (SC) hydration and skin surface pH of facial skin. 102 subjects (aged 5-60, divided into five groups) were enrolled to be measured by a combination device called 'Derma Unit SSC3' in their frontal and zygomatic regions when they were in a resting state (RS), at the beginning of sweating (BS), during excessive sweating (ES) and an hour after sweating (AS), respectively. Compared to the RS, SC hydration in both regions increased at the BS or during ES, and sebum increased at the BS but lower during ES. Compared to during ES, Sebum increased in AS but lower than RS. Compared to the RS, pH decreased in both regions at the BS in the majority of groups, and increased in frontal region during ES and in zygomatic region in the AS. There was an increase in pH in both regions during ES in the majority of groups compared to the BS, but a decrease in the AS compared to during ES. The study implies that even in summer, after we sweat excessively, lipid products should be applied locally in order to maintain stability of the barrier function of the SC. The study suggests that after a short term(1 h or less) of self adjustment, excessive sweat from moderate exercise will not impair the primary acidic surface pH of the facial skin. Exercise-induced sweating significantly affected the skin physiological properties of facial region. © 2012 John Wiley & Sons A/S.

  10. Adjacent field separations for homogenous dose distribution at particular depth and associated hot and cold spots

    International Nuclear Information System (INIS)

    Supe, S.S.; Deka, A.C.; Deka, B.C.; Sathiyanaranyanan, V.K.

    1991-01-01

    In radiotherapy treatment planning we come across many situations when treatment is given by using two adjacent fields, for e.g. for treatment of Hodgkin's disease. A pair of adjacent field have been used regularly for the treatment of ovarian tumours. A small separation is given at the skin level, otherwise hot spots are observed at the depth of interest. The separation depend upon tumour depths, and source to skin distance (SSD). Formulae have been derived for the separation as well as for hot and cold spots. The case of adjacent field becomes more complicated when anterior as well as posterior adjacent fields are used. It is not completely possible to avoid the hot and cold spots in such cases. This is partially avoided by shifting the gap on the skin surface during the course of treatment. (author). 2 refs., 2 tabs

  11. Efficacy of keishibukuryogan, a traditional Japanese herbal medicine, in treating cold sensation and numbness after stroke: clinical improvement and skin temperature normalization in 22 stroke patients.

    Science.gov (United States)

    Fujita, Keishi; Yamamoto, Tetsuya; Kamezaki, Takao; Matsumura, Akira

    2010-01-01

    Cold sensation and numbness have been reported as post-stroke sensory sequelae attributable to distal axonopathy, which is caused by chronic ischemia of diseased limbs resulting from dysfunction of vasomotor regulatory systems. Keishibukuryogan is a traditional herbal medicine used to treat symptoms of peripheral ischemia such as cold extremities. This study investigated clinical improvement and skin temperature in peripheral ischemia patients to determine the efficacy of keishibukuryogan in alleviating post-stroke cold sensation and numbness. Twenty-two stroke patients with cold sensation and/or numbness were enrolled in this study. Subjective cold sensation and numbness, evaluated using the visual analogue scale, were found in 21 and 31 limbs, respectively. The skin temperature of diseased and healthy limbs was recorded. We observed all patients for 4 weeks and 17 patients for 8 weeks after administration of keishibukuryogan. The skin temperature of diseased limbs was significantly higher than baseline at 4 weeks and 8 weeks, whereas that of healthy limbs did not change significantly. Cold sensation and numbness were significantly improved at 4 weeks and 8 weeks compared to baseline. Keishibukuryogan administration resulted in warming of diseased limbs and improved cold sensation and numbness, probably by increasing peripheral blood flow.

  12. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  13. Comparative potency of formulations of mometasone furoate in terms of inhibition of ′PIRHR′ in the forearm skin of normal human subjects measured with laser doppler velocimetry

    Directory of Open Access Journals (Sweden)

    Kulhalli Prabhakar

    2005-01-01

    Full Text Available BACKGROUND AND AIMS: Topical glucocorticoid formulations are widely used for effective treatment and control of a variety of dermatoses. Mometasone furoate is a newer corticoid that has high potency but low systemic toxicity. Pharmaceutical factors are known to significantly influence potency and systemic absorption of topically applied glucocorticoids. We studied the potency of "Elocon", a topical formulation of mometasone furoate, compared with two other branded formulations of the same corticoid. METHODS: Corticoid potency was measured by employing a pharmacodynamic parameter of an inhibitory effect of the corticoid on post-ischemic-reactive-hyperemic-response (PIRHR in human forearm skin under occlusive dressing. The PIRHR was expressed in terms of % increase in the skin blood flow (SBF as measured with laser doppler velocimetry (LDV. RESULTS : All three active branded formulations of mometasone furoate produced significant inhibition of PIRHR. The AUC(0-2min of PIRHR was ( Mean ± SEM , Control = 213.52 ± 11.80, Placebo = 209.77 ± 19.31, Formulation A = 119.83 ± 13.71, Formulation C = 53.67 ± 4.85 and Formulation D = 111.46 ± 22.87. Formulation "C" exhibited significantly higher topical anti-inflammatory potency than formulations "A" or "D". CONCLUSIONS: Thus, branded formulations of the same glucocorticoid, mometasone furoate significantly differed in their topical anti-inflammatory potency. "Elocon" was significantly more potent than the two other branded formulations studied.

  14. Immunohistochemical analysis of regulatory T cell markers FOXP3 and GITR on CD4(+) CD25(+) T cells in normal skin and inflammatory dermatoses

    NARCIS (Netherlands)

    de Boer, Onno J.; van der Loos, Chris M.; Teeling, Peter; van der Wal, Allard C.; Teunissen, Marcel B. M.

    2007-01-01

    Regulatory T cells (Treg) are a subset of T lymphocytes that play a central role in immunologic tolerance and in the termination of immune responses. The identification of these cells in normal and inflammatory conditions may contribute to a better understanding of underlying pathology. We

  15. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  16. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  17. Overexpression of Amyloid Precursor Protein Promotes the Onset of Seborrhoeic Keratosis and is Related to Skin Ageing.

    Science.gov (United States)

    Li, Yuanying; Wang, Yu; Zhang, Wei; Jiang, Leiwei; Zhou, Wenming; Liu, Zhi; Li, Shijun; Lu, Hongguang

    2018-02-28

    Seborrhoeic keratosis is an age-related skin disease. Amyloid precursor protein (APP) plays an important role in the pathogenesis of age-related Alzheimer's disease. The aim of this study was to elucidate the expression characteristics of APP in seborrhoeic keratosis tissues (n = 50), and explore whether the production of APP is related to the onset of seborrhoeic keratosis and skin ageing, including ultraviolet (UV)-induced ageing, as observed in normal skin (n = 79). The results of immunohistochemistry, Western blotting and quantitative real-time PCR showed that APP and its downstream products (i.e. amyloid-β42) were more highly expressed in seborrhoeic keratosis than in paired adjacent normal skin tissues. In contrast, the expression of its key secretase (i.e. β-secretase1) was generally low. Furthermore, APP expression was higher in UV-exposed than non-exposed skin sites, and expression in the older age group (61-85 years) was greater than that in the younger age group (41-60 years) in seborrhoeic keratosis tissues (pkeratosis and is a marker of skin ageing and UV damage. Further research will elucidate whether therapeutic mitigation of increased levels of APP in the skin might delay the onset of seborrhoeic keratosis and skin ageing.

  18. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  19. Skew-adjacency matrices of graphs

    NARCIS (Netherlands)

    Cavers, M.; Cioaba, S.M.; Fallat, S.; Gregory, D.A.; Haemers, W.H.; Kirkland, S.J.; McDonald, J.J.; Tsatsomeros, M.

    2012-01-01

    The spectra of the skew-adjacency matrices of a graph are considered as a possible way to distinguish adjacency cospectral graphs. This leads to the following topics: graphs whose skew-adjacency matrices are all cospectral; relations between the matchings polynomial of a graph and the characteristic

  20. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...

  1. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  2. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  4. Y-type congenital urethral duplication with normal dorsal urethra and small ventral fistula to perineal skin – 28th reported case

    Directory of Open Access Journals (Sweden)

    Donald E. Meier

    2016-05-01

    Full Text Available There are numerous types of urethral duplication previously described in the literature including a Type IIA2Y where a large ventral channel branches from the hypoplastic, dorsal, orthotopic urethra. There have been 27 previously reported cases of a similar defect, called “congenital posterior urethrocutaneous fistula” (CUPF with the only difference being that the ventral urethra is hypoplastic and the dorsal, orthotopic one normal. The difference in treatment for these 2 entities is markedly different, and preoperative identification of the appropriate abnormality is essential. Treatment of CUPF requires only safe excision of the ventral segment, but treatment for a Type IIA2Y duplication requires resection of the hypoplastic, orthotopic urethra and transposition of the larger ventral segment into the dorsal orthotopic position. The outcome for treatment of CUPF is much better than for treatment of Type IIA2Y entities. We herein present the 28th case of CUPF in the English literature with discussion of the anatomy, appropriate diagnostic criteria, and safe method of treatment for these entities.

  5. Hydrogen water intake via tube-feeding for patients with pressure ulcer and its reconstructive effects on normal human skin cells in vitro

    Science.gov (United States)

    2013-01-01

    Background Pressure ulcer (PU) is common in immobile elderly patients, and there are some research works to investigate a preventive and curative method, but not to find sufficient effectiveness. The aim of this study is to clarify the clinical effectiveness on wound healing in patients with PU by hydrogen-dissolved water (HW) intake via tube-feeding (TF). Furthermore, normal human dermal fibroblasts OUMS-36 and normal human epidermis-derived cell line HaCaT keratinocytes were examined in vitro to explore the mechanisms relating to whether hydrogen plays a role in wound-healing at the cellular level. Methods Twenty-two severely hospitalized elderly Japanese patients with PU were recruited in the present study, and their ages ranged from 71.0 to 101.0 (86.7 ± 8.2) years old, 12 male and 10 female patients, all suffering from eating disorder and bedridden syndrome as the secondary results of various underlying diseases. All patients received routine care treatments for PU in combination with HW intake via TF for 600 mL per day, in place of partial moisture replenishment. On the other hand, HW was prepared with a hydrogen-bubbling apparatus which produces HW with 0.8-1.3 ppm of dissolved hydrogen concentration (DH) and −602 mV to −583 mV of oxidation-reduction potential (ORP), in contrast to reversed osmotic ultra-pure water (RW), as the reference, with DH of < 0.018 ppm and ORP of +184 mV for use in the in vitro experimental research. In in vitro experiments, OUMS-36 fibroblasts and HaCaT keratinocytes were respectively cultured in medium prepared with HW and/or RW. Immunostain was used for detecting type-I collagen reconstruction in OUMS-36 cells. And intracellular reactive oxygen species (ROS) were quantified by NBT assay, and cell viability of HaCaT cells was examined by WST-1 assay, respectively. Results Twenty-two patients were retrospectively divided into an effective group (EG, n = 12) and a less effective group (LG, n = 10) according to

  6. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  7. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  8. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  9. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  10. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  11. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  12. Anti-oxidant defence mechanism in vitiliginous skin increases with skin type

    NARCIS (Netherlands)

    Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.

    2012-01-01

    Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing

  13. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  14. ICRP-26 and skin contamination

    International Nuclear Information System (INIS)

    Finnigan, T.; Huda, W.; Newbery, G.R.

    1979-01-01

    The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)

  15. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  16. Characterization of oily mature skin by biophysical and skin imaging techniques.

    Science.gov (United States)

    de Melo, M O; Maia Campos, P M B G

    2018-02-13

    The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Fluorescence excitation-emission matrix spectroscopy of vitiligo skin in vivo (Conference Presentation)

    Science.gov (United States)

    Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey

    2016-02-01

    Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.

  18. The glycan-specific sulfotransferase (R77W)GalNAc-4-ST1 putatively responsible for peeling skin syndrome has normal properties consistent with a simple sequence polymorphisim.

    Science.gov (United States)

    Fiete, Dorothy; Mi, Yiling; Beranek, Mary; Baenziger, Nancy L; Baenziger, Jacques U

    2017-05-01

    Expanded access to DNA sequencing now fosters ready detection of site-specific human genome alterations whose actual significance requires in-depth functional study to rule in or out disease-causing mutations. This is a particular concern for genomic sequence differences in glycosyltransferases, whose implications are often difficult to assess. A recent whole-exome sequencing study identifies (c.229 C > T) in the GalNAc-4-ST1 glycosyltransferase (CHST8) as a disease-causing missense R77W mutation yielding the genodermatosis peeling skin syndrome (PSS) when homozygous. Cabral et al. (Genomics. 2012;99:202-208) cite this sequence change as reducing keratinocyte GalNAc-4-ST1 activity, thus decreasing glycosaminoglycan sulfation, as the mechanism for this blistering disorder. Such an identification could point toward potential clinical and/or prenatal diagnosis of a harmful medical condition. However, GalNAc-4-ST1 has minimal activity toward glycosaminoglycans, instead modifying terminal β1,4-linked GalNAc on N- and O-linked oligosaccharides on specific glycoproteins. We find expression, processing and catalytic activity of GalNAc-4-ST1 completely equivalent between wild type and (R77W) sulfotransferases. Moreover, keratinocytes have little or no GalNAc-4-ST1 mRNA, indicating that they do not express GalNAc-4-ST1. In addition, loss-of-function of GalNAc-4-ST1 primarily presents as reproductive system aberrations rather than skin effects. These findings, an allele frequency of 0.004357, and a 10-fold difference in prevalence of CHST8 (c.299 C > T, R77W) across different ethnic groups, suggest that this sequence represents a "passenger" distributed polymorphism, a simple sequence variant form of the enzyme having normal activity, rather than a "driver" disease-causing mutation that accounts for PSS. This study presents an example for guiding biomedical research initiatives, as well as medical and personal/family perspectives, regarding newly-identified genomic sequence

  19. Proteomic Profiling of Radiation-Induced Skin Fibrosis in Rats: Targeting the Ubiquitin-Proteasome System

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wenjie [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China); Luo, Judong [Department of Radiotherapy, Changzhou Tumor Hospital, Soochow University, Changzhou (China); Sheng, Wenjiong; Xue, Jiao; Li, Ming [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Ji, Jiang [Department of Dermatology, the Second Affiliated Hospital of Soochow University, Suzhou (China); Liu, Pengfei [Department of Gastroenterology, the Affiliated Jiangyin Hospital of Southeast University, Jiangyin (China); Zhang, Xueguang [Institute of Medical Biotechnology and Jiangsu Stem Cell Key Laboratory, Medical College of Soochow University, Suzhou (China); Cao, Jianping [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Zhang, Shuyu, E-mail: zhang.shuyu@hotmail.com [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China)

    2016-06-01

    Purpose: To investigate the molecular changes underlying the pathogenesis of radiation-induced skin fibrosis. Methods and Materials: Rat skin was irradiated to 30 or 45 Gy with an electron beam. Protein expression in fibrotic rat skin and adjacent normal tissues was quantified by label-free protein quantitation. Human skin cells HaCaT and WS-1 were treated by x-ray irradiation, and the proteasome activity was determined with a fluorescent probe. The effect of proteasome inhibitors on Transforming growth factor Beta (TGF-B) signaling was measured by Western blot and immunofluorescence. The efficacy of bortezomib in wound healing of rat skin was assessed by the skin injury scale. Results: We found that irradiation induced epidermal and dermal hyperplasia in rat and human skin. One hundred ninety-six preferentially expressed and 80 unique proteins in the irradiated fibrotic skin were identified. Through bioinformatic analysis, the ubiquitin-proteasome pathway showed a significant fold change and was investigated in greater detail. In vitro experiments demonstrated that irradiation resulted in a decline in the activity of the proteasome in human skin cells. The proteasome inhibitor bortezomib suppressed profibrotic TGF-β downstream signaling but not TGF-β secretion stimulated by irradiation in HaCaT and WS-1 cells. Moreover, bortezomib ameliorated radiation-induced skin injury and attenuated epidermal hyperplasia. Conclusion: Our findings illustrate the molecular changes during radiation-induced skin fibrosis and suggest that targeting the ubiquitin-proteasome system would be an effective countermeasure.

  20. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  1. Skin graft viability test

    International Nuclear Information System (INIS)

    Wahner, H.W.; Robertson, J.S.

    1983-01-01

    With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter

  2. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  3. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  4. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  5. Hyperelastic skin

    Science.gov (United States)

    ... is most often seen in people who have Ehlers-Danlos syndrome. People with this disorder have very elastic skin. ... any member of your family been diagnosed with Ehlers-Danlos syndrome? What other symptoms are present? Genetic counseling may ...

  6. Skin Cancer

    Science.gov (United States)

    ... sunlamps. There are 2 types of UV rays: UVA rays (long-wave) – UVA rays penetrate clouds and glass. They penetrate the ... to cancer. But studies have shown that both UVA and UVB damage the skin and can cause ...

  7. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  8. UVB 311 nm tolerance of vitiligo skin increases with skin photo type

    NARCIS (Netherlands)

    Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete

    2005-01-01

    It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we

  9. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....

  10. Skin decontamination

    International Nuclear Information System (INIS)

    Moehrle, G.

    1975-01-01

    A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream

  11. Time-constrained project scheduling with adjacent resources

    NARCIS (Netherlands)

    Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.

    We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with adjacent resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by

  12. Time-constrained project scheduling with adjacent resources

    NARCIS (Netherlands)

    Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.

    2008-01-01

    We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with Adjacent Resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by

  13. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  14. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  15. An atlas of normal skeletal scintigraphy

    International Nuclear Information System (INIS)

    Flanagan, J.J.; Maisey, M.N.

    1985-01-01

    This atlas was compiled to provide the neophyte as well as the experienced radiologist and the nuclear medicine physician with a reference on normal skeletal scintigraphy as an aid in distinguishing normal variations in skeletal uptake from abnormal findings. Each skeletal scintigraph is labeled, and utilizing an identical scale, a relevant skeletal photograph and radiograph are placed adjacent to the scintigraph

  16. Spondylolisthesis adjacent to a cervical disc arthroplasty does not increase the risk of adjacent level degeneration.

    Science.gov (United States)

    Kieser, David Christopher; Cawley, Derek Thomas; Roscop, Cecile; Mazas, Simon; Coudert, Pierre; Boissiere, Louis; Obeid, Ibrahim; Vital, Jean-Marc; Pointillart, Vincent; Gille, Olivier

    2018-03-31

    To understand whether a spondylolisthesis in the sub-axial spine cranial to a cervical disc arthroplasty (CDA) construes a risk of adjacent level disease (ALD). A retrospective review of 164 patients with a minimum 5-year follow-up of a cervical disc arthroplasty was performed. Multi-level surgeries, including hybrid procedures, were included. Multiple implant types were included. The two inter-vertebral discs (IVD) cranial of the CDA were monitored for evidence of radiologic degeneration using the Kettler criteria. The rate of ALD in CDA found in this series was 17.8%, with most affecting the immediately adjacent IVD (27.4 and 7.6%, respectively p = 0.000). Pre-operative mild spondylolisthesis adjacent to a planned CDA was not found to be a risk factor for ALD within 5 years. Those with a degenerative spondylolisthesis are at higher risk of ALD (33%) than those with a non-degenerative cause for their spondylolisthesis (11%). Post-operative CDA alignment, ROM or induced spondylolisthesis do not affect the rate of ALD in those with an adjacent spondylolisthesis. Patients with ALD experience significantly worse 5-year pain and functional outcomes than those unaffected by ALD. A pre-operatively identified mild spondylolisthesis in the sub-axial spine cranially adjacent to a planned CDA is not a risk factor for ALD within 5 years. These slides can be retrieved under Electronic Supplementary Material.

  17. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for

  18. Matching the skin barrier to the skin type.

    Science.gov (United States)

    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  19. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  20. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures ...

  1. Skin Cancer Treatment

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  2. Stages of Skin Cancer

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  3. Bacterial skin flora of diabetic patients in the Jos University Teaching ...

    African Journals Online (AJOL)

    Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...

  4. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  5. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  6. [Skin hydration and hydrating products].

    Science.gov (United States)

    Duplan, H; Nocera, T

    2018-05-01

    One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

  7. Reduced FOXO1 expression accelerates skin wound healing and attenuates scarring.

    Science.gov (United States)

    Mori, Ryoichi; Tanaka, Katsuya; de Kerckhove, Maiko; Okamoto, Momoko; Kashiyama, Kazuya; Tanaka, Katsumi; Kim, Sangeun; Kawata, Takuya; Komatsu, Toshimitsu; Park, Seongjoon; Ikematsu, Kazuya; Hirano, Akiyoshi; Martin, Paul; Shimokawa, Isao

    2014-09-01

    The forkhead box O (FOXO) family has been extensively investigated in aging and metabolism, but its role in tissue-repair processes remains largely unknown. Herein, we clarify the molecular aspect of the FOXO family in skin wound healing. We demonstrated that Foxo1 and Foxo3a were both up-regulated during murine skin wound healing. Partial knockout of Foxo1 in Foxo1(+/-) mice throughout the body led to accelerated skin wound healing with enhanced keratinocyte migration, reduced granulation tissue formation, and decreased collagen density, accompanied by an attenuated inflammatory response, but we observed no wound phenotype in Foxo3a(-/-) mice. Fibroblast growth factor 2, adiponectin, and notch1 genes were significantly increased at wound sites in Foxo1(+/-) mice, along with markedly altered extracellular signal-regulated kinase 1/2 and AKT phosphorylation. Similarly, transient knockdown of Foxo1 at the wound site by local delivery of antisense oligodeoxynucleotides enhanced skin wound healing. The link between FOXO1 and scarring extends to patients, in particular keloid scars, where we see FOXO1 expression markedly increased in fibroblasts and inflammatory cells within the otherwise normal dermis. This occurs in the immediate vicinity of the keloid by comparison to the center of the mature keloid, indicating that FOXO1 is associated with the overgrowth of this fibrotic response into adjacent normal skin. Overall, our data indicate that molecular targeting of FOXO1 may improve the quality of healing and reduce pathological scarring. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  8. Acral peeling skin syndrome: report of two cases.

    Science.gov (United States)

    García, Elena García; Carreño, Rosario Granados; Martínez González, Miguel A; Reyes, José Jiménez

    2005-01-01

    Peeling skin syndrome is a rare dermatosis characterized by spontaneous and painless peeling of the skin. The authors report two patients with history of spontaneous, asymptomatic, and noninflammatory peeling skin of the acral surfaces after soaking in water. On light microscopy, blisters were located in the mid layers of the stratum corneum, above the granular layer. Ultrastructural examination revealed increased intercellular lipids and abnormal, "moth-eaten," keratohyalin granules, but the authors were unable to determine whether the separation initiated within the horny cells or between adjacent cells. These patients represented a localized variant of peeling skin syndrome.

  9. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  10. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  11. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can ... rarely, younger children can develop skin cancer. How can people with dark skin get skin cancer? Although ...

  12. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  13. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    Science.gov (United States)

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  14. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  15. Malware Normalization

    OpenAIRE

    Christodorescu, Mihai; Kinder, Johannes; Jha, Somesh; Katzenbeisser, Stefan; Veith, Helmut

    2005-01-01

    Malware is code designed for a malicious purpose, such as obtaining root privilege on a host. A malware detector identifies malware and thus prevents it from adversely affecting a host. In order to evade detection by malware detectors, malware writers use various obfuscation techniques to transform their malware. There is strong evidence that commercial malware detectors are susceptible to these evasion tactics. In this paper, we describe the design and implementation of a malware normalizer ...

  16. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  17. Histoplasma skin test

    Science.gov (United States)

    Histoplasmosis skin test ... health care provider cleans an area of your skin, usually the forearm. An allergen is injected just below the cleaned skin surface. An allergen is a substance that causes ...

  18. Skin Condition Finder

    Science.gov (United States)

    ... SKIN CONDITIONS HEALTH TOPICS FOR PROFESSIONALS Rash and Skin Condition Finder 1 Select Age Group Infant Child ... Toe Toe Webspace Toe Nail CLOSE About the Skin Condition Finder Have a health question or concern? ...

  19. Skin Complications of IBD

    Science.gov (United States)

    ... Home > Resources > Skin Complications of IBD Go Back Skin Complications of IBD Email Print + Share After arthritis, ... about 5% of people with inflammatory bowel disease. SKIN DISORDERS COMMONLY SEEN IN IBD ERHTHEMA NODOSUM The ...

  20. Skin Peeling Syndrome

    Directory of Open Access Journals (Sweden)

    Sharma Rajeev

    2000-01-01

    Full Text Available Peeling of the skin is an uncommonly encountered disorder. Occurrence of vesicles and bullae in peeling skin syndrome is very rare. We report a case of idiopathic peeling skin syndrome with vesicular lesions.

  1. Neuromuscular adaptations induced by adjacent joint training.

    Science.gov (United States)

    Ema, R; Saito, I; Akagi, R

    2018-03-01

    Effects of resistance training are well known to be specific to tasks that are involved during training. However, it remains unclear whether neuromuscular adaptations are induced after adjacent joint training. This study examined the effects of hip flexion training on maximal and explosive knee extension strength and neuromuscular performance of the rectus femoris (RF, hip flexor, and knee extensor) compared with the effects of knee extension training. Thirty-seven untrained young men were randomly assigned to hip flexion training, knee extension training, or a control group. Participants in the training groups completed 4 weeks of isometric hip flexion or knee extension training. Standardized differences in the mean change between the training groups and control group were interpreted as an effect size, and the substantial effect was assumed to be ≥0.20 of the between-participant standard deviation at baseline. Both types of training resulted in substantial increases in maximal (hip flexion training group: 6.2% ± 10.1%, effect size = 0.25; knee extension training group: 20.8% ± 9.9%, effect size = 1.11) and explosive isometric knee extension torques and muscle thickness of the RF in the proximal and distal regions. Improvements in strength were accompanied by substantial enhancements in voluntary activation, which was determined using the twitch interpolation technique and RF activation. Differences in training effects on explosive torques and neural variables between the two training groups were trivial. Our findings indicate that hip flexion training results in substantial neuromuscular adaptations during knee extensions similar to those induced by knee extension training. © 2017 The Authors. Scandinavian Journal of Medicine & Science In Sports Published by John Wiley & Sons Ltd.

  2. Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration

    Science.gov (United States)

    2012-03-01

    6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less

  3. p63 in skin development and ectodermal dysplasias

    Science.gov (United States)

    Koster, Maranke I.

    2010-01-01

    The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549

  4. Normal accidents

    International Nuclear Information System (INIS)

    Perrow, C.

    1989-01-01

    The author has chosen numerous concrete examples to illustrate the hazardousness inherent in high-risk technologies. Starting with the TMI reactor accident in 1979, he shows that it is not only the nuclear energy sector that bears the risk of 'normal accidents', but also quite a number of other technologies and industrial sectors, or research fields. The author refers to the petrochemical industry, shipping, air traffic, large dams, mining activities, and genetic engineering, showing that due to the complexity of the systems and their manifold, rapidly interacting processes, accidents happen that cannot be thoroughly calculated, and hence are unavoidable. (orig./HP) [de

  5. A Simple Device For Measuring Skin Friction

    Directory of Open Access Journals (Sweden)

    Gupta A.B

    1995-01-01

    Full Text Available A simple device for measuring skin friction in vivo is described. The frictional coefficient of normal Indian skin and the effect of hydration and application of talc and glycerol on the frictional coefficient and also the friction of ichthyotic skin have been determined with its help. The average value of friction of friction of normal India skin at forearm is found to be 0.41 +- 0.08, the hydration raises the value to 0.71 +- 0.11 and the effect of glycerol is also to school it up to 0.70+- 0.05, almost equal to that of water. The effect of talc however is opposite and its application lowers the friction to 0.21+-0.07. The mean coeff of friction for ichthyotic skin is found to be 0.21+- 0.0.5, which closely agrees with talc-treated normal skin. A good positive correlation (p<0.01 between friction and sebum level at skin site, with r = 0.64, has been observed.

  6. Clinical scoring and instrumental analysis to evaluate skin types.

    Science.gov (United States)

    Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G

    2013-04-01

    The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.

  7. Comparative human cellular radiosensitivity: I. The effect of SV40 transformation and immortalisation on the gamma-irradiation survival of skin derived fibroblasts from normal individuals and from ataxia-telangiectasia patients and heterozygotes.

    Science.gov (United States)

    Arlett, C F; Green, M H; Priestley, A; Harcourt, S A; Mayne, L V

    1988-12-01

    We have compared cell killing following 60Co gamma irradiation in 22 primary human fibroblast strains, nine SV40-immortalized human fibroblast lines and seven SV40-transformed pre-crisis human fibroblast cultures. We have examined material from normal individuals, from ataxia-telangiectasia (A-T) patients and from A-T heterozygotes. We have confirmed the greater sensitivity of A-T derived cells to gamma radiation. The distinction between A-T and normal cells is maintained in cells immortalized by SV40 virus but the immortal cells are more gamma radiation resistant than the corresponding primary fibroblasts. Cells transformed by plasmids (pSV3gpt and pSV3neo) expressing SV40 T-antigen, both pre- and post-crisis, show this increased resistance, indicating that it is expression of SV40 T-antigen, rather than immortalization per se which is responsible for the change. We use D0, obtained from a straight line fit, and D, estimated from a multitarget curve, as parameters to compare radiosensitivity. We suggest that both have their advantages; D0 is perhaps more reproducible, but D is more realistic when comparing shouldered and non-shouldered data.

  8. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard

    2001-01-01

    with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared......Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  9. Reconstructing Normality

    DEFF Research Database (Denmark)

    Gildberg, Frederik Alkier; Bradley, Stephen K.; Fristed, Peter Billeskov

    2012-01-01

    Forensic psychiatry is an area of priority for the Danish Government. As the field expands, this calls for increased knowledge about mental health nursing practice, as this is part of the forensic psychiatry treatment offered. However, only sparse research exists in this area. The aim of this study...... was to investigate the characteristics of forensic mental health nursing staff interaction with forensic mental health inpatients and to explore how staff give meaning to these interactions. The project included 32 forensic mental health staff members, with over 307 hours of participant observations, 48 informal....... The intention is to establish a trusting relationship to form behaviour and perceptual-corrective care, which is characterized by staff's endeavours to change, halt, or support the patient's behaviour or perception in relation to staff's perception of normality. The intention is to support and teach the patient...

  10. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease......BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... was to understand the reflections on cancer survivorship care of lymphoma survivors to aid the future planning of cancer survivorship care and overcome barriers to participation. METHODS: Data were generated in a hematological ward during 4 months of ethnographic fieldwork, including participant observation and 46...

  11. Biological Rhythms in the Skin

    Directory of Open Access Journals (Sweden)

    Mary S. Matsui

    2016-05-01

    Full Text Available Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN of the hypothalamus, which directs an organism’s rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional–translational autoregulatory loops. This master clock, following environmental cues, regulates an organism’s sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.

  12. Volumetric Visualization of Human Skin

    Science.gov (United States)

    Kawai, Toshiyuki; Kurioka, Yoshihiro

    We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.

  13. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  14. Skin, Hair, and Nails

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Skin, Hair, and Nails KidsHealth / For Parents / Skin, Hair, and ... piel, el cabello y las uñas About Skin, Hair and Nails Skin is our largest organ. If ...

  15. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  16. Preliminary experiments on quantification of skin condition

    Science.gov (United States)

    Kitajima, Kenzo; Iyatomi, Hitoshi

    2014-03-01

    In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.

  17. Urostomy - stoma and skin care

    Science.gov (United States)

    ... it well before you attach the pouch. Avoid skin care products that contain alcohol. These can make your skin ... the pouch to your skin. Use fewer special skin care products. This will make problems with your skin less ...

  18. Risks of Skin Cancer Screening

    Science.gov (United States)

    ... factors increase or decrease the risk of skin cancer. Skin cancer is a disease in which malignant (cancer) ... following PDQ summaries for more information about skin cancer: Skin Cancer Prevention Skin Cancer Treatment Melanoma Treatment Genetics ...

  19. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound and adjacent waters. 80.1395 Section 80.1395 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

  20. Early Verb Constructions in French: Adjacency on the Left Edge

    Science.gov (United States)

    Veneziano, Edy; Clark, Eve V.

    2016-01-01

    Children acquiring French elaborate their early verb constructions by adding adjacent morphemes incrementally at the left edge of core verbs. This hypothesis was tested with 2657 verb uses from four children between 1;3 and 2;7. Consistent with the Adjacency Hypothesis, children added clitic subjects frst only to present tense forms (as in…

  1. Objectifying the Adjacent and Opposite Angles: A Cultural Historical Analysis

    Science.gov (United States)

    Daher, Wajeeh; Musallam, Nadera

    2018-01-01

    The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles'…

  2. On Pathos Adjacency Cut Vertex Jump Graph of a Tree

    OpenAIRE

    Nagesh.H.M; R.Chandrasekhar

    2014-01-01

    In this paper the concept of pathos adjacency cut vertex jump graph PJC(T) of a tree T is introduced. We also present a characterization of graphs whose pathos adjacency cut vertex jump graphs are planar, outerplanar, minimally non-outerplanar, Eulerian and Hamiltonian.

  3. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    International Nuclear Information System (INIS)

    Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael

    2002-01-01

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  4. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)......Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...

  5. Effects of irradiation of skin flaps

    International Nuclear Information System (INIS)

    Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.

    1984-01-01

    The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage

  6. Loading effects of anterior cervical spine fusion on adjacent segments

    Directory of Open Access Journals (Sweden)

    Chien-Shiung Wang

    2012-11-01

    Full Text Available Adjacent segment degeneration typically follows anterior cervical spine fusion. However, the primary cause of adjacent segment degeneration remains unknown. Therefore, in order to identify the loading effects that cause adjacent segment degeneration, this study examined the loading effects to superior segments adjacent to fused bone following anterior cervical spine fusion. The C3–C6 cervical spine segments of 12 sheep were examined. Specimens were divided into the following groups: intact spine (group 1; and C5–C6 segments that were fused via cage-instrumented plate fixation (group 2. Specimens were cycled between 20° flexion and 15° extension with a displacement control of 1°/second. The tested parameters included the range of motion (ROM of each segment, torque and strain on both the body and inferior articular process at the superior segments (C3–C4 adjacent to the fused bone, and the position of the neutral axis of stress at under 20° flexion and 15° extension. Under flexion and Group 2, torque, ROM, and strain on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. Under extension and Group 2, ROM for the fused segment was less than that of Group 1; torque, ROM, and stress on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. These analytical results indicate that the muscles and ligaments require greater force to achieve cervical motion than the intact spine following anterior cervical spine fusion. In addition, ROM and stress on the bodies and facets of the joint segments adjacent to the fused bone were significantly increased. Under flexion, the neutral axis of the stress on the adjacent segment moved backward, and the stress on the bodies of the segments adjacent to the fused bone increased. These comparative results indicate that increased stress on the adjacent segments is caused by stress-shielding effects

  7. Lymphatic albumin clearance from psoriatic skin

    International Nuclear Information System (INIS)

    Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.

    1983-01-01

    In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return

  8. Correction of thickness measurement errors for two adjacent sheet structures in MR images

    International Nuclear Information System (INIS)

    Cheng Yuanzhi; Wang Shuguo; Sato, Yoshinobu; Nishii, Takashi; Tamura, Shinichi

    2007-01-01

    We present a new method for measuring the thickness of two adjacent sheet structures in MR images. In the hip joint, in which the femoral and acetabular cartilages are adjacent to each other, a conventional measurement technique based on the second derivative zero crossings (called the zero-crossings method) can introduce large underestimation errors in measurements of cartilage thickness. In this study, we have developed a model-based approach for accurate thickness measurement. We model the imaging process for two adjacent sheet structures, which simulate the two articular cartilages in the hip joint. This model can be used to predict the shape of the intensity profile along the sheet normal orientation. Using an optimization technique, the model parameters are adjusted to minimize the differences between the predicted intensity profile and the actual intensity profiles observed in the MR data. The set of model parameters that minimize the difference between the model and the MR data yield the thickness estimation. Using three phantoms and one normal cadaveric specimen, the usefulness of the new model-based method is demonstrated by comparing the model-based results with the results generated using the zero-crossings method. (author)

  9. Oily skin: an overview.

    Science.gov (United States)

    Sakuma, Thais H; Maibach, Howard I

    2012-01-01

    Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

  10. Proteomic profiling reveals candidate markers for arsenic-induced skin keratosis.

    Science.gov (United States)

    Guo, Zhiling; Hu, Qin; Tian, Jijing; Yan, Li; Jing, Chuanyong; Xie, Heidi Qunhui; Bao, Wenjun; Rice, Robert H; Zhao, Bin; Jiang, Guibin

    2016-11-01

    Proteomics technology is an attractive biomarker candidate discovery tool that can be applied to study large sets of biological molecules. To identify novel biomarkers and molecular targets in arsenic-induced skin lesions, we have determined the protein profile of arsenic-affected human epidermal stratum corneum by shotgun proteomics. Samples of palm and foot sole from healthy subjects were analyzed, demonstrating similar protein patterns in palm and sole. Samples were collected from the palms of subjects with arsenic keratosis (lesional and adjacent non-lesional samples) and arsenic-exposed subjects without lesions (normal). Samples from non-exposed healthy individuals served as controls. We found that three proteins in arsenic-exposed lesional epidermis were consistently distinguishably expressed from the unaffected epidermis. One of these proteins, the cadherin-like transmembrane glycoprotein, desmoglein 1 (DSG1) was suppressed. Down-regulation of DSG1 may lead to reduced cell-cell adhesion, resulting in abnormal epidermal differentiation. The expression of keratin 6c (KRT6C) and fatty acid binding protein 5 (FABP5) were significantly increased. FABP5 is an intracellular lipid chaperone that plays an essential role in fatty acid metabolism in human skin. This raises a possibility that overexpression of FABP5 may affect the proliferation or differentiation of keratinocytes by altering lipid metabolism. KRT6C is a constituent of the cytoskeleton that maintains epidermal integrity and cohesion. Abnormal expression of KRT6C may affect its structural role in the epidermis. Our findings suggest an important approach for future studies of arsenic-mediated toxicity and skin cancer, where certain proteins may represent useful biomarkers of early diagnoses in high-risk populations and hopefully new treatment targets. Further studies are required to understand the biological role of these markers in skin pathogenesis from arsenic exposure. Copyright © 2016 Elsevier Ltd

  11. Community conservation adjacent to Ruaha National Park, Tanzania

    Science.gov (United States)

    Sue Stolberger

    2007-01-01

    In the areas adjacent to Ruaha National Park where rural communities exist, much more work and education is required to enable them to benefit directly and indirectly from tourism and managing their own natural resources.

  12. Influence of cantilevered sheet pile deflection on adjacent roadways.

    Science.gov (United States)

    2009-06-01

    Cantilevered sheet pile walls are often used adjacent roadways as temporary support during construction. Excess movement of these walls has led to excessive roadway distress causing additional repairs to be necessary. This study assessed the effects ...

  13. Suprabasalt stratigraphy within and adjacent to the reference repository location

    International Nuclear Information System (INIS)

    Bjornstad, B.N.

    1983-01-01

    This data-package contains six detailed stratigraphic correlations and structure cross sections of suprabasalt sediments in the area adjacent to and including the Reference Repository Location. 4 refs., 1 fig

  14. Sleeping sickness surveys: game reserve adjacent villages in Malawi

    African Journals Online (AJOL)

    Sleeping sickness surveys: game reserve adjacent villages in Malawi. ... Sera from 160 game ranger volunteers and from 82 suspected cases_of Rhodesian sleeping sickness were tested by use of ELISA, ... AJOL African Journals Online.

  15. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  16. Infrared imaging of skin lesions

    Science.gov (United States)

    McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.

    2002-02-01

    IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.

  17. Examine Your Skin

    Science.gov (United States)

    ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  18. Examine Your Skin

    Medline Plus

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  19. Bleeding into the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003235.htm Bleeding into the skin To use the sharing features on this page, please enable JavaScript. Bleeding into the skin can occur from broken blood ...

  20. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.

  1. Laser surgery - skin

    Science.gov (United States)

    ... Bleeding Problem not going away Infection Pain Scarring Skin color changes Some laser surgery is done when you are asleep and ... TG, Elston DM, eds. Andrews' Diseases of the Skin: Clinical ... lasers, lights, and tissue interactions. In: Hruza GJ, Avram ...

  2. Examine Your Skin

    Medline Plus

    Full Text Available ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ...

  3. Objectifying the adjacent and opposite angles: a cultural historical analysis

    Science.gov (United States)

    Daher, Wajeeh; Musallam, Nadera

    2018-02-01

    The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles' concepts. We videoed the learning of a group of three high-achieving students who used technology, specifically GeoGebra, to explore geometric relations related to the adjacent and opposite angles' concepts. To analyze students' objectification of these concepts, we used the categories of objectification of knowledge (attention and awareness) and the categories of generalization (factual, contextual and symbolic), developed by Radford. The research results indicate that teacher's and students' verbal and visual signs, together with the software dynamic tools, mediated the students' objectification of the adjacent and opposite angles' concepts. Specifically, eye and gestures perceiving were part of the semiosis cycles in which the participating students were engaged and which related to the mathematical signs that signified the adjacent and the opposite angles. Moreover, the teacher's suggestions/requests/questions included/suggested semiotic signs/tools, including verbal signs that helped the students pay attention, be aware of and objectify the adjacent and opposite angles' concepts.

  4. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Checking your skin regularly can help you notice any unusual changes. Follow your health care provider's recommendations on how often to ...

  5. Skin Conditions during Pregnancy

    Science.gov (United States)

    ... during pregnancy. For most skin changes, however, health care providers are not sure of the exact cause. Why do dark spots and patches appear on the skin during pregnancy? Dark spots and patches are caused by an increase in the body’s melanin—a natural substance that gives color to the skin and ...

  6. Skin layer mechanics

    NARCIS (Netherlands)

    Geerligs, M.

    2010-01-01

    The human skin is composed of several layers, each with an unique structure and function. Knowledge about the mechanical behavior of these skin layers is important for clinical and cosmetic research, such as the development of personal care products and the understanding of skin diseases. Until

  7. The Volpe Center GPS Adjacent Band Compatibility Program Plan : GPS Adjacent Band Compatibility Workshop, Volpe Center, Cambridge MA

    Science.gov (United States)

    2014-09-18

    Approach to DOT GPS Adjacent Band Compatibility Assessment. Identify forums and provide public outreach to make sure the progress and work are as open and transparent as possible. Develop an implementation plan that incorporates aspects from the DOT ...

  8. Main approaches for delivering antioxidant vitamins through the skin to prevent skin ageing.

    Science.gov (United States)

    Gašperlin, Mirjana; Gosenca, Mirjam

    2011-07-01

    One of the major contributions to skin photoageing and diseases is oxidative stress, caused by UV radiation inducing reactive oxygen and nitrogen species. Successful prophylaxis and therapy would necessitate control of the oxidant/antioxidant balance at the affected site, which can be achieved through the external supply of endogenous antioxidants. This review discusses possible strategies for dermal delivery of the antioxidant vitamins E and C, as oral supplementation has proved insufficient. These antioxidants have low skin bioavailability, owing to their poor solubility, inefficient skin permeability, or instability during storage. These drawbacks can be overcome by various approaches, such as chemical modification of the vitamins and the use of new colloidal drug delivery systems. New knowledge is included about the importance of: enhancing the endogenous skin antioxidant defense through external supply; the balance between various skin antioxidants; factors that can improve the skin bioavailability of antioxidants; and new delivery systems, such as microemulsions, used to deliver vitamins C and E into the skin simultaneously. A promising strategy for enhancing skin protection from oxidative stress is to support the endogenous antioxidant system, with antioxidants containing products that are normally present in the skin.

  9. Taking Care of Your Skin

    Science.gov (United States)

    ... Educators Search English Español Taking Care of Your Skin KidsHealth / For Kids / Taking Care of Your Skin ... you're in. Why Be Nice to Your Skin? Like the heart, stomach, and brain, your skin ...

  10. The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

    Directory of Open Access Journals (Sweden)

    Jang Hwan Min

    2014-07-01

    Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

  11. Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

    DEFF Research Database (Denmark)

    Philipsen, P A; Knudsen, L; Gniadecka, M

    2013-01-01

    and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...

  12. SKIN CARE IN INFANTS

    Directory of Open Access Journals (Sweden)

    I. N. Zakharova

    2014-01-01

    Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.

  13. Nutrition and skin.

    Science.gov (United States)

    Pappas, Apostolos; Liakou, Aikaterini; Zouboulis, Christos C

    2016-09-01

    Nutrition has long been associated with skin health, including all of its possible aspects from beauty to its integrity and even the aging process. Multiple pathways within skin biology are associated with the onset and clinical course of various common skin diseases, such as acne, atopic dermatitis, aging, or even photoprotection. These conditions have been shown to be critically affected by nutritional patterns and dietary interventions where well-documented studies have demonstrated beneficial effects of essential nutrients on impaired skin structural and functional integrity and have restored skin appearance and health. Although the subject could be vast, the intention of this review is to provide the most relevant and the most well-documented information on the role of nutrition in common skin conditions and its impact on skin biology.

  14. Chronologic and actinically induced aging in human facial skin

    International Nuclear Information System (INIS)

    Gilchrest, B.A.; Szabo, G.; Flynn, E.; Goldwyn, R.M.

    1983-01-01

    Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation

  15. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  16. Clinical efficacy of artificial skin combined with vacuum sealing drainage in treating large-area skin defects

    Institute of Scientific and Technical Information of China (English)

    TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao

    2010-01-01

    Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.

  17. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

    Science.gov (United States)

    Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

    2018-02-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Differentiation of involved and uninvolved psoriatic skin from healthy skin using noninvasive visual, colorimeter and evaporimeter methods.

    Science.gov (United States)

    Pershing, L K; Bakhtian, S; Wright, E D; Rallis, T M

    1995-08-01

    Uninvolved skin of psoriasis may not be entirely normal. The object was to characterize healthy, uninvolved psoriatic skin and lesional skin by biophysical methods. Involved and uninvolved psoriatic and age-gender matched healthy skin was measured objectively with a colorimeter and evaporimeter and subjectively with visual assessment in 14 subjects. Visual assessment of erythema (E), scaling (S) and induration (I) as well as the target lesion score at the involved psoriatic skin sites were significantly elevated (puninvolved psoriatic skin >healthy skin (pcolorimeter L* and a* scale values at uninvolved psoriatic skin sites were lower and higher (pcolorimeter description (L*× b*)/a* significantly differentiated healthy skin from both involved and uninvolved psoriatic skin. These collective data highlight that even visually appearing uninvolved psoriatic skin is compromised compared with healthy skin. These objective, noninvasive but differential capabilities of the colorimeter and evaporimeter will aid in the mechanistic quantification of new psoriatic drug therapies and in conjuction with biochemical studies, add to understanding of the multifactorial pathogenesis of psoriasis.

  19. Ectodermal dysplasia-skin fragility syndrome

    Directory of Open Access Journals (Sweden)

    Vijay S Adhe

    2011-01-01

    Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.

  20. Biomechanics of Artificial Disc Replacements Adjacent to a 2-Level Fusion in 4-Level Hybrid Constructs: An In Vitro Investigation

    Science.gov (United States)

    Liao, Zhenhua; Fogel, Guy R.; Wei, Na; Gu, Hongsheng; Liu, Weiqiang

    2015-01-01

    Background The ideal procedure for multilevel cervical degenerative disc diseases remains controversial. Recent studies on hybrid surgery combining anterior cervical discectomy and fusion (ACDF) and artificial cervical disc replacement (ACDR) for 2-level and 3-level constructs have been reported in the literature. The purpose of this study was to estimate the biomechanics of 3 kinds of 4-level hybrid constructs, which are more likely to be used clinically compared to 4-level arthrodesis. Material/Methods Eighteen human cadaveric spines (C2–T1) were evaluated in different testing conditions: intact, with 3 kinds of 4-level hybrid constructs (hybrid C3–4 ACDR+C4–6 ACDF+C6–7ACDR; hybrid C3–5ACDF+C5–6ACDR+C6–7ACDR; hybrid C3–4ACDR+C4–5ACDR+C5–7ACDF); and 4-level fusion. Results Four-level fusion resulted in significant decrease in the C3–C7 ROM compared with the intact spine. The 3 different 4-level hybrid treatment groups caused only slight change at the instrumented levels compared to intact except for flexion. At the adjacent levels, 4-level fusion resulted in significant increase of contribution of both upper and lower adjacent levels. However, for the 3 hybrid constructs, significant changes of motion increase far lower than 4P at adjacent levels were only noted in partial loading conditions. No destabilizing effect or hypermobility were observed in any 4-level hybrid construct. Conclusions Four-level fusion significantly eliminated motion within the construct and increased motion at the adjacent segments. For all 3 different 4-level hybrid constructs, ACDR normalized motion of the index segment and adjacent segments with no significant hypermobility. Compared with the 4-level ACDF condition, the artificial discs in 4-level hybrid constructs had biomechanical advantages compared to fusion in normalizing adjacent level motion. PMID:26694835

  1. Can the Hydroxyapatite-Coated Skin-Penetrating Abutment for Bone Conduction Hearing Implants Integrate with the Surrounding Skin?

    Science.gov (United States)

    van Hoof, Marc; Wigren, Stina; Duimel, Hans; Savelkoul, Paul H M; Flynn, Mark; Stokroos, Robert Jan

    2015-01-01

    Percutaneous implants, such as bone conduction hearing implants, suffer from complications that include inflammation of the surrounding skin. A sealed skin-abutment interface can prevent the ingress of bacteria, which should reduce the occurrence of peri-abutment dermatitis. It was hypothesized that a hydroxyapatite (HA)-coated abutment in conjunction with soft tissue preservation surgery should enable integration with the adjacent skin. Previous research has confirmed that integration is never achieved with as-machined titanium abutments. Here, we investigate, in vivo, if skin integration is achievable in patients using a HA-coated abutment. One titanium abutment (control) and one HA-coated abutment (case) together with the surrounding skin were surgically retrieved from two patients who had a medical indication for this procedure. Histological sections of the skin were investigated using light microscopy. The abutment was qualitatively analyzed using scanning electron microscopy. The titanium abutment only had a partial and thin layer of attached amorphous biological material. The HA-coated abutment was almost fully covered by a pronounced thick layer of organized skin, composed of different interconnected structural layers. Proof-of-principle evidence that the HA-coated abutment can achieve integration with the surrounding skin was presented for the first time.

  2. In vivo study of human skin using pulsed terahertz radiation

    International Nuclear Information System (INIS)

    Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P

    2004-01-01

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation

  3. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  4. Emission of pesticides during drilling and deposition in adjacent areas

    Directory of Open Access Journals (Sweden)

    Heimbach, Udo

    2014-02-01

    Full Text Available In seven experiments seeds of maize, oil seed rape and barley, treated with neonicotinoids, were sown using pneumatic drilling equipment with deflectors attached in case of pneumatic suction systems. Directly adjacent to the drilled area of usually about 50 m width were replicated areas with bare soil as well as with crops. During maize (Zea mays drilling flowering oil seed rape (Brassica napus and during drilling of barley (Hordeum vulgare and oil seed rape flowering white mustard (Sinapis alba was adjacent. The amount of residues in the adjacent non crop areas in Petri dishes being distributed on the bare soil declined only slowly from 1 to 20 m distance from the area drilled. Seed batches with more abrasion and higher content of active substances in the dust resulted in higher residues off crop. After drilling of maize in four experiments in Petri dishes in adjacent non crop areas in 1-5 m distance between 0.02 and 0.40 g a.s./ha of neonicotinoids and in the adjacent oil seed rape a total of 0.05–0.80 g a.s./ha were detected. After drilling oil seed rape or barley these values were only 0.02–0.06 g a.s./ha in Petri dishes in non crop areas and 0.03-0.08 g a.s./ha in total in adjacent white mustard. In gauze net samplers installed vertically in 3 m distance in non crop areas up to seven times higher values were detected compared to Petri dishes.

  5. Modeling fires in adjacent ship compartments with computational fluid dynamics

    International Nuclear Information System (INIS)

    Wix, S.D.; Cole, J.K.; Koski, J.A.

    1998-01-01

    This paper presents an analysis of the thermal effects on radioactive (RAM) transportation pack ages with a fire in an adjacent compartment. An assumption for this analysis is that the adjacent hold fire is some sort of engine room fire. Computational fluid dynamics (CFD) analysis tools were used to perform the analysis in order to include convective heat transfer effects. The analysis results were compared to experimental data gathered in a series of tests on the United States Coast Guard ship Mayo Lykes located at Mobile, Alabama. (authors)

  6. Nonlinear spin wave coupling in adjacent magnonic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sadovnikov, A. V., E-mail: sadovnikovav@gmail.com; Nikitov, S. A. [Laboratory “Metamaterials,” Saratov State University, Saratov 410012 (Russian Federation); Kotel' nikov Institute of Radioengineering and Electronics, Russian Academy of Sciences, Moscow 125009 (Russian Federation); Beginin, E. N.; Morozova, M. A.; Sharaevskii, Yu. P.; Grishin, S. V.; Sheshukova, S. E. [Laboratory “Metamaterials,” Saratov State University, Saratov 410012 (Russian Federation)

    2016-07-25

    We have experimentally studied the coupling of spin waves in the adjacent magnonic crystals. Space- and time-resolved Brillouin light-scattering spectroscopy is used to demonstrate the frequency and intensity dependent spin-wave energy exchange between the side-coupled magnonic crystals. The experiments and the numerical simulation of spin wave propagation in the coupled periodic structures show that the nonlinear phase shift of spin wave in the adjacent magnonic crystals leads to the nonlinear switching regime at the frequencies near the forbidden magnonic gap. The proposed side-coupled magnonic crystals represent a significant advance towards the all-magnonic signal processing in the integrated magnonic circuits.

  7. Nonlinear spin wave coupling in adjacent magnonic crystals

    International Nuclear Information System (INIS)

    Sadovnikov, A. V.; Nikitov, S. A.; Beginin, E. N.; Morozova, M. A.; Sharaevskii, Yu. P.; Grishin, S. V.; Sheshukova, S. E.

    2016-01-01

    We have experimentally studied the coupling of spin waves in the adjacent magnonic crystals. Space- and time-resolved Brillouin light-scattering spectroscopy is used to demonstrate the frequency and intensity dependent spin-wave energy exchange between the side-coupled magnonic crystals. The experiments and the numerical simulation of spin wave propagation in the coupled periodic structures show that the nonlinear phase shift of spin wave in the adjacent magnonic crystals leads to the nonlinear switching regime at the frequencies near the forbidden magnonic gap. The proposed side-coupled magnonic crystals represent a significant advance towards the all-magnonic signal processing in the integrated magnonic circuits.

  8. Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

    Institute of Scientific and Technical Information of China (English)

    CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

    2005-01-01

    Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

  9. Cutaneous Leishmaniasis Induces a Transmissible Dysbiotic Skin Microbiota that Promotes Skin Inflammation.

    Science.gov (United States)

    Gimblet, Ciara; Meisel, Jacquelyn S; Loesche, Michael A; Cole, Stephen D; Horwinski, Joseph; Novais, Fernanda O; Misic, Ana M; Bradley, Charles W; Beiting, Daniel P; Rankin, Shelley C; Carvalho, Lucas P; Carvalho, Edgar M; Scott, Phillip; Grice, Elizabeth A

    2017-07-12

    Skin microbiota can impact allergic and autoimmune responses, wound healing, and anti-microbial defense. We investigated the role of skin microbiota in cutaneous leishmaniasis and found that human patients infected with Leishmania braziliensis develop dysbiotic skin microbiota, characterized by increases in the abundance of Staphylococcus and/or Streptococcus. Mice infected with L. major exhibit similar changes depending upon disease severity. Importantly, this dysbiosis is not limited to the lesion site, but is transmissible to normal skin distant from the infection site and to skin from co-housed naive mice. This observation allowed us to test whether a pre-existing dysbiotic skin microbiota influences disease, and we found that challenging dysbiotic naive mice with L. major or testing for contact hypersensitivity results in exacerbated skin inflammatory responses. These findings demonstrate that a dysbiotic skin microbiota is not only a consequence of tissue stress, but also enhances inflammation, which has implications for many inflammatory cutaneous diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Real significance of skin contamination is

    International Nuclear Information System (INIS)

    Sudmann, R.H.

    1983-01-01

    For five decades, health physicists have discussed the thickness, area, significance of radioactive contamination and the exposures to various portions of the skin. Concern about instances of skin contamination extend beyond the resultant organ dose simply because it is a recognizable and quantifiable event. As such, there is a tendency for management and regulatory agencies to use it as a trend indicator. The final result is a score card similar to the list of OSHA reportable accidents. In fact, the skin contamination incidence rate has a somewhat different meaning to the health physicist, to the manager, and to the regulator. The question must then be asked, What is the true significance of skin contamination, Is it the resultant skin dose, Is it an indicator of loss of control, Is it both or neither. In order to answer these questions, Rockwell Hanford Operations began analysis of the previous five years records of skin contamination cases. Since by policy each incidence of skin contamination is documented, a large percentage of the 425 records analyzed were of low level activity (less than 100 dpm/cm 2 ) on the extremeties, primarily hands and fingers. Most of these cases were readily decontaminated with soap and water. Individual elements studied included: detection/monitoring methods and limits; impact of type of operation on the incidence rate; causes of and methods for reduction of the incidence rate; reporting and documentation; and dose assessment. Results of the study indicate that skin contamination rarely presents a beta dose problem because it is normally highly localized on the extremeties. Only in unusual cases does it represent a potential for internal deposition. Thus, the real importance of skin contamination incidence is as an indicator of deteriorating conditions and should be reviewed by health physicists, managers and regulators as such

  11. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  12. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  13. Recommendations for skin decontamination

    International Nuclear Information System (INIS)

    1989-01-01

    Further to the reecommendations for determining the surface contamination of the skin and estimating the radiation exposure of the skin after contamination (SAAS-Mitt--89-16), measures for skin decontamination are recommended. They are necessary if (1) after simple decontamination by means of water, soap and brush without damaging the skin the surface contamination limits are exceeded and the radiation exposure to be expected for the undamaged healthy skin is estimated as to high, and if (2) a wound is contaminated. To remove skin contaminations, in general universally applicable, non-aggressive decontamination means and methods are sufficient. In special cases, nuclide-specific decontamination is required taking into account the properties of the radioactive substance

  14. Normal anatomy of lung perfusion SPECT scintigraphy

    International Nuclear Information System (INIS)

    Moskowitz, G.W.; Levy, L.M.

    1987-01-01

    Ten patients studies for possible pulmonary embolic disease had normal lung perfusion planar and SPECT scintigraphy. A computer program was developed to superimpose the CT scans on corresponding SPECT images. Superimposition of CT scans on corresponding SPECT transaxial cross-sectional images, when available, provides the needed definition and relationships of adjacent organs. SPECT transaxial sections provide clear anatomic definition of perfusion defects without foreground and background lung tissue superimposed. The location, shape, and size of the perfusion defects can be readily assessed by SPECT. An algorithm was developed for the differentiation of abnormal pulmonary perfusion patterns from normal structures on variation

  15. Functional analyses of the skin surface of the areola mammae: comparison between healthy adult male and female subjects and between healthy individuals and patients with atopic dermatitis.

    Science.gov (United States)

    Kikuchi, K; Tagami, H; Akaraphanth, R; Aiba, S

    2011-01-01

    Although the nipple and areola of the breast constitute a unique and prominent area on the chest, so far no study has been done on the functional properties of their skin surfaces. To study the stratum corneum (SC) covering the areola using noninvasive methods. Eighteen adult healthy subjects comprising nine men and nine women and 18 age- and sex-matched patients with atopic dermatitis (AD), none of whom had visible skin lesions, participated in the study. Transepidermal water loss (TEWL), skin surface hydration and skin surface lipid levels were measured on the areola and adjacent breast skin. The size of the skin surface corneocytes of these skin regions was assessed. All the healthy subjects showed significantly higher TEWL accompanied by smaller sized corneocytes on the areola than on the adjacent breast skin. Only female subjects revealed a significantly higher skin surface hydration state together with significantly increased skin surface lipid levels on the areola than on the adjacent breast skin. These sex differences were observed even in patients with AD. Comparison between healthy individuals and the patients with AD demonstrated higher TEWL, decreased skin surface hydration state and lower skin surface lipid levels associated with smaller sized corneocytes in the areola in the patients with AD, especially in male patients. In adults, the SC barrier function and SC water-binding capacity of the areola were functionally poorer than in the adjacent skin, being covered by smaller sized corneocytes and lower amounts of skin surface lipids, especially in men and in patients with AD. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.

  16. Herpetology of the American Madrean Archipelago and adjacent valleys

    Science.gov (United States)

    Lawrence L. C. Jones

    2005-01-01

    Approximately 110 species of amphibians (18 frogs and toads, and 1 salamander) and reptiles (47 snakes, 39 lizards, and 5 turtles) are known from the American Madrean Archipelago and adjacent valleys. The high diversity of the herpetofauna comes from a variety of factors, including a convergence of biotic communities representing deserts, grasslands, and mountains....

  17. Developmental tumors and adjacent cortical dysplasia: single or dual pathology?

    Science.gov (United States)

    Palmini, André; Paglioli, Eliseu; Silva, Vinicius Duval

    2013-12-01

    Developmental tumors often lead to refractory partial seizures and constitute a well-defined, surgically remediable epilepsy syndrome. Dysplastic features are often associated with these tumors, and their significance carries both practical and conceptual relevance. If associated focal cortical dysplasia (FCD) relates to the extent of the epileptogenic tissue, then presurgical evaluation and surgical strategies should target both the tumor and the surrounding dyslaminated cortex. Furthermore, the association has been included in the recently revised classification of FCD and the epileptogenicity of this associated dysplastic tissue is crucial to validate such revision. In addition to the possibility of representing dual pathology, the association of developmental tumors and adjacent dysplasia may instead represent a single developmental lesion with distinct parts distributed along a histopathologic continuum. Moreover, the possibility that this adjacent dyslamination is of minor epileptogenic relevance should also be entertained. Surgical data show that complete resection of the solid tumors and immediately adjacent tissue harboring satellites may disrupt epileptogenic networks and lead to high rates of seizure freedom, challenging the epileptogenic relevance of more extensive adjacent dyslaminated cortex. Whether the latter is a primary or secondary abnormality and whether dyslaminated cortex in the context of a second lesion may produce seizures after complete resection of the main lesion is still to be proven. Wiley Periodicals, Inc. © 2013 International League Against Epilepsy.

  18. The dynamics of microtidal lagoons and adjacent coasts

    NARCIS (Netherlands)

    Stive, M.J.F.; Capobianco, M.; Wang, Z.B.; Ruol, P.

    1996-01-01

    We have formulated an aggregated-scale behaviour-model for the interaction between a tidal basin and its adjacent coastal environment, without adopting a priory assumptions about their independent dynamic equilibrium behaviour. Necessarily so, the model combines observations and findings resuhing

  19. Do Mangroves Subsidize Carbon to Adjacent Mudflat Fish Communities?

    Science.gov (United States)

    Henkel, S.; Kasten, S.; Hartmann, J.; Staubwasser, M.; Hernandez, M. F.; West, L.; Midway, S. R.; Polito, M. J.

    2017-12-01

    Mangroves are often implicated as energetic sources for fisheries productivity. However, the validity of this connection still remains in contention. Stable isotopes may provide answers by tracking the use of specific basal carbon sources in fish and invertebrates living in mangrove-mudflat habitat mosaics. We analyzed 307 consumer samples representing n=44 fish and invertebrate species collected from mangrove forest creeks and adjacent mudflats in coastal Tanzania using bulk carbon and nitrogen stable isotope analysis. Given the proposed high productivity of mangrove habitats, we hypothesize that mudflat communities will have carbon stable isotope values similar to mangrove communities either through the flux of mangrove carbon into adjacent mudflats and/or via the movement of mudflat fish communities into and out of mangrove habitats. Alternatively, mangrove carbon is often refractory, which may result in mudflat communities with isotopic values that differ from those found in adjacent mangrove communities. This scenario would suggest limited carbon flow between mudflat and mangrove food webs and that the movement of fish into and out of mangrove habitats is related to shelter from predation more than feeding. Data analysis is ongoing to test these competing hypotheses. By understanding the contribution of mangrove carbon to adjacent habitats, managers in Tanzania can make better informed decisions regarding the protection of mangroves and the local fisheries, which are a crucial source of income and food.

  20. Measurement Methods to Determine Air Leakage Between Adjacent Zones

    Energy Technology Data Exchange (ETDEWEB)

    Hult, Erin L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Dickerhoff, Darryl J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Price, Phillip N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2012-09-01

    Air leakage between adjacent zones of a building can lead to indoor air quality and energy efficiency concerns, however there is no existing standard for measuring inter-zonal leakage. In this study, synthesized data and field measurements are analyzed in order to explore the uncertainty associated with different methods for collecting and analyzing fan pressurization measurements to calculate interzone leakage.

  1. Optimal induced universal graphs and adjacency labeling for trees

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Dahlgaard, Søren; Knudsen, Mathias Bæk Tejs

    2015-01-01

    bound. The lower bound and previously best upper bounds were presented in Alstrup and Rauhe (FOCS'02). Our upper bounds are obtained through a log2 n + O(1) labeling scheme for adjacency queries in forests. We hereby solve an open problem being raised repeatedly over decades, e.g. in Kannan, Naor...

  2. Human normal tissue reactions in radiotherapy

    International Nuclear Information System (INIS)

    Taniike, Keiko

    1990-01-01

    Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)

  3. Modeling of skin cancer dermatoscopy images

    Science.gov (United States)

    Iralieva, Malica B.; Myakinin, Oleg O.; Bratchenko, Ivan A.; Zakharov, Valery P.

    2018-04-01

    An early identified cancer is more likely to effective respond to treatment and has a less expensive treatment as well. Dermatoscopy is one of general diagnostic techniques for skin cancer early detection that allows us in vivo evaluation of colors and microstructures on skin lesions. Digital phantoms with known properties are required during new instrument developing to compare sample's features with data from the instrument. An algorithm for image modeling of skin cancer is proposed in the paper. Steps of the algorithm include setting shape, texture generation, adding texture and normal skin background setting. The Gaussian represents the shape, and then the texture generation based on a fractal noise algorithm is responsible for spatial chromophores distributions, while the colormap applied to the values corresponds to spectral properties. Finally, a normal skin image simulated by mixed Monte Carlo method using a special online tool is added as a background. Varying of Asymmetry, Borders, Colors and Diameter settings is shown to be fully matched to the ABCD clinical recognition algorithm. The asymmetry is specified by setting different standard deviation values of Gaussian in different parts of image. The noise amplitude is increased to set the irregular borders score. Standard deviation is changed to determine size of the lesion. Colors are set by colormap changing. The algorithm for simulating different structural elements is required to match with others recognition algorithms.

  4. Discovery of skin lymphocytes was a game changer in experimental dermatology

    NARCIS (Netherlands)

    Matos, Tiago R.; de Rie, Menno A.

    2017-01-01

    A substantial part of ongoing research in experimental dermatology focuses on skin T cellsfor that reason, we find important to highlight the pioneering work of Jan D. Bos et al. from 1987 (The skin immune system (SIS): Distribution and immunophenotype of lymphocyte subpopulations in normal skin)

  5. Analysis of effect of different construction methods of piles on the end effect on skin friction of piles

    Institute of Scientific and Technical Information of China (English)

    ZHOU Hongbo; CHEN Zhuchang

    2007-01-01

    Based on the comparative analysis of end effect on skin friction of displacement-pile (driven pile),the end effect on skin friction of bored pile is studied.The end effect on skin friction between driven pile and bored pile is different and the end effect on skin friction of bored pile is reduce of skin friction in the soil layer adjacent to the pile end.The degradation degree of skin friction is deduced with the increase of the distance from pile end.The concept of additional mud cake formed by the effect of cushion at the bottom of borehole during pouring concrete is introduced to explain the mechanism of end effect on skin friction of the bored pile.The test results of post-grouting piles indicate that the post-grouting technique is an effective way to improve the end effect on skin friction of bored pile.

  6. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  7. Cryopreserved embryo transfer: adjacent or non-adjacent to failed fresh long GnRH-agonist protocol IVF cycle.

    Science.gov (United States)

    Volodarsky-Perel, Alexander; Eldar-Geva, Talia; Holzer, Hananel E G; Schonberger, Oshrat; Reichman, Orna; Gal, Michael

    2017-03-01

    The optimal time to perform cryopreserved embryo transfer (CET) after a failed oocyte retrieval-embryo transfer (OR-ET) cycle is unknown. Similar clinical pregnancy rates were recently reported in immediate and delayed CET, performed after failed fresh OR-ET, in cycles with the gonadotrophin-releasing hormone (GnRH) antagonist protocol. This study compared outcomes of CET performed adjacently (<50 days, n = 67) and non-adjacently (≥50 to 120 days, n = 62) to the last OR-day of cycles with the GnRH agonist down-regulation protocol. Additional inclusion criteria were patients' age 20-38 years, the transfer of only 1-2 cryopreserved embryos, one treatment cycle per patient and artificial preparation for CET. Significantly higher implantation, clinical pregnancy and live birth rates were found in the non-adjacent group than in the adjacent group: 30.5% versus 11.3% (P = 0.001), 41.9% versus 17.9% (P = 0.003) and 32.3% versus 13.4% (P = 0.01), respectively. These results support the postponement of CET after a failed OR-ET for at least one menstrual cycle, when a preceding long GnRH-agonist protocol is used. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  8. Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.

    Science.gov (United States)

    Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra

    2015-09-01

    Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.

  9. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  10. Skin tribology: Science friction?

    NARCIS (Netherlands)

    van der Heide, Emile; Zeng, Xiangqiong; Masen, Marc Arthur

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is

  11. Examine Your Skin

    Medline Plus

    Full Text Available ... Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, PhD, Professor of Dermatology, Brown University, for permission to use this video. UPDATED: ... Melanoma Facts Melanoma Prevention ...

  12. Delineating the cell death mechanisms associated with skin electroporation.

    Science.gov (United States)

    Schultheis, Katherine; Smith, Trevor R F; Kiosses, William B; Kraynyak, Kimberly A; Wong, Amelia; Oh, Janet; Broderick, Kate Elizabeth

    2018-06-28

    The immune responses elicited following delivery of DNA vaccines to the skin has previously been shown to be significantly enhanced by the addition of electroporation (EP) to the treatment protocol. Principally, EP increases the transfection of pDNA into the resident skin cells. In addition to increasing the levels of in vivo transfection, the physical insult induced by EP is associated with activation of innate pathways which are believed to mediate an adjuvant effect, further enhancing DNA vaccine responses. Here, we have investigated the possible mechanisms associated with this adjuvant effect, primarily focusing on the cell death pathways associated with the skin EP procedure independent of pDNA delivery. Using the minimally invasive CELLECTRA®-3P intradermal electroporation device that penetrates the epidermal and dermal layers of the skin, we have investigated apoptotic and necrotic cell death in relation to the vicinity of the electrode needles and electric field generated. Employing the well-established TUNEL assay, we detected apoptosis beginning as early as one hour after EP and peaking at the 4 hour time point. The majority of the apoptotic events were detected in the epidermal region directly adjacent to the electrode needle. Using a novel propidium iodide in vivo necrotic cell death assay, we detected necrotic events concentrated in the epidermal region adjacent to the electrode. Furthermore, we detected up-regulation of calreticulin expression on skin cells after EP, thus labeling these cells for uptake by dendritic cells and macrophages. These results allow us to delineate the cell death mechanisms occurring in the skin following intradermal EP independently of pDNA delivery. We believe these events contribute to the adjuvant effect observed following electroporation at the skin treatment site.

  13. Pathological skin picking: case presentation and review of the literature

    Directory of Open Access Journals (Sweden)

    Maria Isabela Sarbu

    2015-04-01

    Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

  14. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  15. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  16. Reconstructing in-vivo reflectance spectrum of pigmented skin lesion by Monte Carlo simulation

    Science.gov (United States)

    Wang, Shuang; He, Qingli; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

    2012-03-01

    In dermatology applications, diffuse reflectance spectroscopy has been extensively investigated as a promising tool for the noninvasive method to distinguish melanoma from benign pigmented skin lesion (nevus), which is concentrated with the skin chromophores like melanin and hemoglobin. We carried out a theoretical study to examine melanin distribution in human skin tissue and establish a practical optical model for further pigmented skin investigation. The theoretical simulation was using junctional nevus as an example. A multiple layer skin optical model was developed on established anatomy structures of skin, the published optical parameters of different skin layers, blood and melanin. Monte Carlo simulation was used to model the interaction between excitation light and skin tissue and rebuild the diffuse reflectance process from skin tissue. A testified methodology was adopted to determine melanin contents in human skin based on in vivo diffuse reflectance spectra. The rebuild diffuse reflectance spectra were investigated by adding melanin into different layers of the theoretical model. One of in vivo reflectance spectra from Junctional nevi and their surrounding normal skin was studied by compare the ratio between nevus and normal skin tissue in both the experimental and simulated diffuse reflectance spectra. The simulation result showed a good agreement with our clinical measurements, which indicated that our research method, including the spectral ratio method, skin optical model and modifying the melanin content in the model, could be applied in further theoretical simulation of pigmented skin lesions.

  17. The Relative Utility of Skin Resistance and Skin Conductance

    National Research Council Canada - National Science Library

    Barland, Gordon

    1990-01-01

    The effectiveness of two circuits (constant current = skin resistance; constant voltage = skin conductance) used for measuring electrodermal activity during a psychophysiological detection of deception...

  18. The use of micro-plasma radiofrequency technology in secondary skin graft contraction: 2 case reports.

    Science.gov (United States)

    Ding, Jin-Ping; Fang, Lin; Wang, Lian-Zhao

    2015-01-01

    Secondary skin graft contraction leading to cosmetic deformity remains a great challenge. These two case reports present serious skin graft contraction and the treatment with micro-plasma radiofrequency technology. Two patients presented with complaints of post-burn depigmentation on the forehead and the hand, respectively, and received dermabrasion and thin split-thickness skin grafting. Then, many localized contraction lesions occurred after 4 weeks. The treatment selected was non-surgical removal using micro-plasma radiofrequency technology with the following energy parameters: a roller tip at 80 watts, three passes in different directions. No complications were observed. The contracted skin was ablated without affecting the pigment distribution. The consequents were that the color, appearance, and texture of the grafted skin matched the adjacent skin well and had better patient acceptance.

  19. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    DEFF Research Database (Denmark)

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

    2010-01-01

    BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

  20. Scar evaluation of split thickness skin graft donor site

    Directory of Open Access Journals (Sweden)

    Jani Muha

    2014-12-01

    Full Text Available BACKGROUND. Split thickness skin graft harvesting causes a certain degree of scaring on the donor site. Donor site scar can cause aesthetic and functional sequelae on the patient's body. Our goal was to study the process of donor site selection, and then evaluate donor site scars and their impact on patients. PATIENTS AND METHODS. This retrospective study included 45 patients aged 5 to 61 years (in average 36, who have been treated with STSG in the 2004–2010 period. 57.8% of them were men. On a follow-up visit, we photographed healed skin defects and donor sites. We then determined and compared the surface areas of skin defect and the donor site using the Adobe® Illustrator® CS5 computer program. Donor site scars were assessed according to the Vancouver scar scale (VSS. We examined scar’s light touch sensitivity with monofilaments and skin colouring compared to adjacent healthy skin using colorimeter. Patients were also interviewed about their treatment course in a form of a standardized questionnaire. RESULTS. Our research has revealed that 20.0% of patients participated in the decision making process of choosing the donor site, while in 80.0% the donor site was chosen by the surgeon himself. 6.7% of patients were not satisfied with their donor site. Most of the patients (37/45 had donor sites on their thighs. In average, the donor site surface area was 94% bigger than the skin defect area. We found statistically significant differences in VSS values, light touch sensitivity and skin colouring between donor site scaring and adjacent healthy skin. CONCLUSIONS. Donor site scar can represent a lasting aesthetic and functional disability for patients. Our research has shown that most of the patients do not participate in the donor site selection process, but are satisfied with their donor site. In most cases, STGSs are harvested from the thigh, other anatomical regions, where scarring would be aesthetically less obtrusive, are underused

  1. Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.

    Science.gov (United States)

    Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab

    2011-03-01

    OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.

  2. 33 CFR 148.217 - How can a State be designated as an adjacent coastal State?

    Science.gov (United States)

    2010-07-01

    ... an adjacent coastal State? 148.217 Section 148.217 Navigation and Navigable Waters COAST GUARD... General § 148.217 How can a State be designated as an adjacent coastal State? (a) Adjacent coastal States... as an adjacent coastal State in the notice may request to be designated as one if the environmental...

  3. Dry skin - self-care

    Science.gov (United States)

    ... pat skin dry then apply your moisturizer. Avoid skin care products and soaps that contain alcohol, fragrances, dyes, or other chemicals. Take short, warm baths or showers. Limit your ... gentle skin cleansers or soap with added moisturizers. Only use ...

  4. 6 Common Cancers - Skin Cancer

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues 6 Common Cancers - Skin Cancer Past Issues / Spring 2007 Table of Contents ... AP Photo/Herald-Mail, Kevin G. Gilbert Skin Cancer Skin cancer is the most common form of cancer ...

  5. Cryogen therapy of skin cancer

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.

    2001-01-01

    In this chapter authors studied the cure of skin cancer in particular cryogen therapy of skin cancer. They noted that cryogen therapy of skin cancer carried new possibilities and improved results of neoplasms treatment

  6. Extraosseous Gaucher cell deposition without adjacent bone involvement.

    Science.gov (United States)

    Meyer, Brendan J; Mills, Anne M; Gaskin, Cree M

    2014-10-01

    Extraosseous Gaucher cell deposits are a rare complication of Gaucher disease that can mimic malignancy. We describe a case of Gaucher cell deposition in the subcutaneous soft tissues overlying the lower thoracic spine in an 18-year-old woman with known type III Gaucher disease. This case is unique in the literature because this subcutaneous Gaucher mass was not associated with extension from underlying bone involvement or clear lymph node origin. It demonstrated no discernible continuity with the adjacent thoracic spinous processes, the cortices of which appeared intact. Although patients with Gaucher disease are at increased risk of malignancy, Gaucher cell deposition should remain a differential consideration for soft tissue masses with or without adjacent bone involvement in patients with known Gaucher disease.

  7. A new nuclear safety programme for areas adjacent to Finland

    International Nuclear Information System (INIS)

    Varjoranta, T.

    1997-01-01

    The projects aimed at improving nuclear and radiation safety in areas adjacent to Finland have been compiled into one programme. The purpose of the programme is to promote activities that minimise accident risks at nuclear power plants and that improve preparedness for situations involving a risk. Nuclear materials are also to be kept under strict control. In the last few years, nuclear and radiation safety has clearly improved in areas adjacent to Finland. But work is still needed to reduce the remaining risks. The Finnish support programme comprises two very definite functions. On one hand, the programme acts as a catalyst for projects launched by the Russians themselves or by the Western partners together, and strives to pave the way for international financing projects. On the other hand, assistance is given as direct support for certain hand-picked projects. (orig.)

  8. Fish species diversity and conservation in Beijing and adjacent areas

    OpenAIRE

    Chunguang Zhang; Yahui Zhao; Yingchun Xing; Ruilu Guo; Qing Zhang; Yun Feng; Enyuan Fan

    2011-01-01

    Based on field surveys between 2002 and 2010, and fish collections in the National Zoological Museum, Institute of Zoology, Chinese Academy of Sciences, a total of 93 wild fish species including 12 in-troduced species had been recorded in Beijing and adjacent areas. Eighty five of these species, including some migratory and estuarine fishes, are native to the region. Only 43 native wild species were collected in our field work from 2002 to 2010. Compared with the historical records, nearly 50...

  9. Plutonium in soil adjacent to Rocky Flats plant

    International Nuclear Information System (INIS)

    Hume, M.W.; Illsley, C.T.

    1979-01-01

    In 1975, lawsuits were filed claiming contaminated lands adjacent to the plant. Five remote as well as 89 sites on lands under litigation were sampled using four sampling techniques at each site. An additional 71 sites were sampled using the Rockwell International technique. No results approached the EPA proposed guideline screening level of 200 mCi/km 2 , although numerous sites to the last of the plant exceed 2 d/m/g (10 mCi/km 2 )

  10. The Benguela upwelling ecosystem lies adjacent to the south ...

    African Journals Online (AJOL)

    denise

    The Benguela upwelling ecosystem lies adjacent to the south-western coast of Africa, from southern Angola. (15°S) to Cape Agulhas (35°S; Fig. 1). Ecologically, it is split into separate northern and southern sub- systems by a zone of intense perennial upwelling near. Lüderitz (26–27.5°S; Shannon 1985). As is charac-.

  11. Epigenetic alterations of the SERPINE1 gene in oral squamous cell carcinomas and normal oral mucosa

    DEFF Research Database (Denmark)

    Gao, Shan; Nielsen, Boye Schnack; Krogdahl, Annelise

    2010-01-01

    , 17 of 20 patients with oral carcinoma were found to have between 2.5- and 50-fold increased tumor PAI-1 mRNA level, as compared with the matched tumor-adjacent normal tissues. The PAI-1 mRNA level in connective tissues from 15 healthy volunteers was similar to the level in tumor-adjacent normal...... tissues, but the level in epithelium was 5- to 10-fold lower. Analyzing DNA methylation of 25 CpG sites within 960 bp around the transcription initiation site of the SERPINE1 gene by bisulfite sequencing, we did the surprising observation that both tumors and tumor-adjacent normal tissue had a significant...... level of methylation, whereas there was very little methylation in tissue from healthy volunteers, suggesting that tumor-adjacent normal tissue already contains transformation-associated epigenetic changes. However, there was no general inverse correlation between PAI-1 mRNA levels and SERPINE1 gene...

  12. Symmetry breaking of adjacent tracks in perpendicular recording system

    International Nuclear Information System (INIS)

    Xie Huang; Wei Dan

    2007-01-01

    The track density increase in a perpendicular magnetic recording system is limited by the adjacent-track interference (ATI). In this work, a composite micromagnetic simulation model of the read/write process is developed to analyse ATI by the symmetry of signal and noise in two adjacent W = 60 nm tracks with the track pitch of the order of 100 nm. Based on the two-dimensional medium noise distribution of dibit recording, it is found that the noise in the first and later recorded tracks start to be asymmetric when the track pitch is lower than 2 W; if the read width is limited within 2/3 of the write width, the asymmetry of noise appears when the track pitch is less than 1.5 W. At higher recording densities, the signal-to-noise ratio degradation is mainly due to the noise caused by the interference from the signal of the adjacent track. Side writing can be effectively eliminated by the use of a guard band whose width is at least half the track width

  13. Using BRDFs for accurate albedo calculations and adjacency effect corrections

    Energy Technology Data Exchange (ETDEWEB)

    Borel, C.C.; Gerstl, S.A.W.

    1996-09-01

    In this paper the authors discuss two uses of BRDFs in remote sensing: (1) in determining the clear sky top of the atmosphere (TOA) albedo, (2) in quantifying the effect of the BRDF on the adjacency point-spread function and on atmospheric corrections. The TOA spectral albedo is an important parameter retrieved by the Multi-angle Imaging Spectro-Radiometer (MISR). Its accuracy depends mainly on how well one can model the surface BRDF for many different situations. The authors present results from an algorithm which matches several semi-empirical functions to the nine MISR measured BRFs that are then numerically integrated to yield the clear sky TOA spectral albedo in four spectral channels. They show that absolute accuracies in the albedo of better than 1% are possible for the visible and better than 2% in the near infrared channels. Using a simplified extensive radiosity model, the authors show that the shape of the adjacency point-spread function (PSF) depends on the underlying surface BRDFs. The adjacency point-spread function at a given offset (x,y) from the center pixel is given by the integral of transmission-weighted products of BRDF and scattering phase function along the line of sight.

  14. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  15. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    International Nuclear Information System (INIS)

    Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

    2013-01-01

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

  16. Age influences the skin reaction pattern to mechanical stress and its repair level through skin care products.

    Science.gov (United States)

    Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela

    2018-03-01

    Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Skin and antioxidants.

    Science.gov (United States)

    Poljsak, Borut; Dahmane, Raja; Godic, Aleksandar

    2013-04-01

    It is estimated that total sun exposure occurs non-intentionally in three quarters of our lifetimes. Our skin is exposed to majority of UV radiation during outdoor activities, e.g. walking, practicing sports, running, hiking, etc. and not when we are intentionally exposed to the sun on the beach. We rarely use sunscreens during those activities, or at least not as much and as regular as we should and are commonly prone to acute and chronic sun damage of the skin. The only protection of our skin is endogenous (synthesis of melanin and enzymatic antioxidants) and exogenous (antioxidants, which we consume from the food, like vitamins A, C, E, etc.). UV-induced photoaging of the skin becomes clinically evident with age, when endogenous antioxidative mechanisms and repair processes are not effective any more and actinic damage to the skin prevails. At this point it would be reasonable to ingest additional antioxidants and/or to apply them on the skin in topical preparations. We review endogenous and exogenous skin protection with antioxidants.

  18. Occupational skin cancers

    Energy Technology Data Exchange (ETDEWEB)

    Gawkrodger, D.J. [Royal Hallamshire Hospital, Sheffield (United Kingdom). Dept. of Dermatology

    2004-10-01

    Skin cancer due to occupation is more common than is generally recognized, although it is difficult to obtain an accurate estimate of its prevalence. Over the past two centuries, occupational skin cancers have particularly been due to industrial exposure of men (it seems more so than women) to chemical carcinogens such as polycyclic hydrocarbons (e.g. from coal tar products) or to arsenic. Industrial processes have improved in most Western countries to limit this type of exposure, but those with outdoor occupations are still exposed to solar ultraviolet irradiation without this being widely recognized as an industrial hazard. Ionizing radiation such as X-rays can also cause skin cancer. Occupational skin cancers often resemble skin tumours found in non-occupational subjects, e.g. basal cell carcinoma, squamous cell carcinoma and malignant melanoma, but some pre-malignant lesions can be more specific and point to an occupational origin, e.g. tar keratoses or arsenical keratoses. An uncommon but well-recognized cause of occupational skin cancer is that which results from scar formation following an industrial burn. In the future it will be necessary to focus on preventative measures, e.g. for outdoor workers, the need to cover up in the sun and use sun protective creams and a campaign for earlier recognition of skin cancers, which are usually curable if treated in their early stages.

  19. Tribology of human skin and mechanical skin equivalents in contact with textiles

    NARCIS (Netherlands)

    Derler, S.; Schrade, G.U.; Gerhardt, L.C.

    2007-01-01

    The friction of untreated human skin (finger) against a reference textile was investigated with 12 subjects using a force plate. In touch experiments, in which the subjects assessed the surface roughness of the textile at normal loads of 1.5 ± 0.7 N, the average friction coefficients ranged from

  20. Smarandachely Adjacent-Vertex-Distinguishing Proper Edge Chromatic Number of Cm∨Kn

    OpenAIRE

    Shunqin Liu

    2016-01-01

    According to different conditions, researchers have defined a great deal of coloring problems and the corresponding chromatic numbers. Such as, adjacent-vertex-distinguishing total chromatic number, adjacent-vertex-distinguishing proper edge chromatic number, smarandachely-adjacent-vertex-distinguishing proper edge chromatic number, smarandachely-adjacent-vertex-distinguishing proper total chromatic number. And we focus on the smarandachely adjacent-vertex-distinguishing proper edge chromatic...

  1. Ultrastructure of elastosis in facial rhytidectomy skin

    International Nuclear Information System (INIS)

    Rudolph, R.; Woodward, M.

    1981-01-01

    Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation

  2. Ultrasound skin tightening.

    Science.gov (United States)

    Minkis, Kira; Alam, Murad

    2014-01-01

    Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Directory of Open Access Journals (Sweden)

    Anjanappa

    2015-01-01

    Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

  4. Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin

    Directory of Open Access Journals (Sweden)

    Nisbet SJ

    2018-04-01

    Full Text Available Stephanie J Nisbet Skin Health Medical Affairs, GSK Consumer Healthcare, Weybridge, Surrey, UK Purpose: This 3-week, open-label, noncomparative clinical study evaluated the skin acceptability of a cosmetic moisturizer in subjects with sensitive skin, by monitoring adverse events (AEs and cutaneous discomfort related to normal usage.Materials and methods: Female subjects aged between 18–60 years, with Fitzpatrick phototype classification I–IV and sensitive skin, verified by a positive reaction on the stinging test at screening, were included. Subjects applied the moisturizer to their face and body twice daily for 21±2 days at home and recorded study product usage and feelings of cutaneous discomfort (eg, dryness, prickling, stinging, and itching in a diary; any AEs were reported to the clinic. At study end, skin acceptability of the moisturizer was investigator-assessed based on the nature of AEs and subjects’ self-reported feelings of discomfort, and by clinical evaluation of skin reactions in the area of moisturizer application (appearance of erythema, formation of edema, and skin desquamation; scored according to an adapted Draize and Kligman scale. Only subjects with a treatment compliance of ≥80% were included in the final analysis.Results: In total, 35 subjects initiated and completed the study; all were compliant to the minimum study product usage. Per investigator clinical dermatological assessment at study end, none of the 35 subjects had skin reactions in the area of moisturizer application and there were no reported AEs. One subject reported sensations of mild prickling and itching immediately after applying the moisturizer (not classified as AEs, which spontaneously remitted after complete absorption of the product and were noted only in exposed areas. These events were considered by the investigator as being possibly/probably related to the use of study product; however, no clinical signs of skin reaction were observed in

  5. Ultrasonography of Skin Changes in Legs with Chronic Venous Disease.

    Science.gov (United States)

    Caggiati, A

    2016-10-01

    In daily practice, ultrasonography (US) is used only to designate the location and pattern of venous lesions. Skin US is not performed between routine venous investigations. Skin morphology is evaluated by the same probes used for routine Duplex evaluation of superficial veins. US findings from evident skin lesions are comparatively evaluated with those from the surrounding apparently normal skin and from the contralateral leg. Inflammation and dermal edema can be found in the apparently normal skin of C2 legs. Swollen legs show thickening of the subcutaneous layer as a result of diffuse soaking or anechoic cavities, with or without dermal edema. Chronic hypodermitis is characterized by inflammatory edema in initial phases, and by liposclerosis in advanced cases. Recrudescence of inflammation provokes focal rarefactions of the subcutaneous layer, possibly related to ulcer opening. In legs with venous disorders, sonography refines clinical evaluation of the skin and may reveal changes not highlighted by inspection. Some of these changes could require further investigation because they have not yet been explained or described. Skin sonography should improve knowledge of the natural history of skin changes, as well as contribute to a better grading of venous diseases severity In particular, US evidence of cutaneous and subcutaneous changes in C2 legs should be considered to stratify the treatment in C2 legs, by identifying those in which varicose veins are not simply a cosmetic problem. Copyright © 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.

  6. Management of defects on lower extremities with the use of matriderm and skin graft.

    Science.gov (United States)

    Choi, Jun-Young; Kim, Seong-Hun; Oh, Gwang-Jin; Roh, Si-Gyun; Lee, Nae-Ho; Yang, Kyung-Moo

    2014-07-01

    The reconstruction of large skin and soft tissue defects on the lower extremities is challenging. The skin graft is a simple and frequently used method for covering a skin defect. However, poor skin quality and architecture are well-known problems that lead to scar contracture. The collagen-elastin matrix, Matriderm, has been used to improve the quality of skin grafts; however, no statistical and objective review of the results has been reported. Thirty-four patients (23 male and 11 female) who previously received a skin graft and simultaneous application of Matriderm between January 2010 and June 2012 were included in this study. The quality of the skin graft was evaluated using Cutometer, occasionally accompanied by pathologic findings. All 34 patients showed good skin quality compared to a traditional skin graft and were satisfied with their results. The statistical data for the measurement of the mechanical properties of the skin were similar to those for normal skin. In addition, there was no change in the engraftment rate. The biggest problem of a traditional skin graft is scar contracture. However, the dermal matrix presents an improvement in skin quality with elastin and collagen. Therefore, a skin graft along with a simultaneous application of Matriderm is safe and effective and leads to a significantly better outcome from the perspective of skin elasticity.

  7. Skin cancer of Nagasaki atomic bomb survivors, 3

    International Nuclear Information System (INIS)

    Sadamori, Naoki; Mine, Mariko; Hori, Makoto; Noda, Yoshinori; Fujiwara, Naoko; Takahara, Osamu; Sadamori, Michiko; Nishimoto, Katsutaro; Ota, Hisahiro.

    1990-01-01

    In Report 1 of this series, we suspected that the incidence of skin cancer in Nagasaki A-bomb survivors might have increased based on evidence of chromosomal aberrations and clonal formations in cultured skin cells. In Report 2, we described the results of a preliminary study using 110 cases of skin cancer collected from the three major hospitals in Nagasaki City (Nagasaki University Hospital, A-bomb Hospital and Citizens Hospital). In that study a high correlation was observed between the incidence of skin cancer and exposure distance in the analysis of all 110 cases and of the 50 male cases (p<0.01), but no such correlation was noted in a separate analysis of the 60 female cases. In this report, 140 cases of skin cancer collected from 31 hospitals in Nagasaki City and adjacent districts were statistically analyzed in respect to the estimated distance from the hypocenter, using the data of a total of 66,276 A-bomb survivors recorded in the Scientific Data Center of the Atomic Bomb Disaster, Nagasaki University School of Medicine. The results disclosed a high correlation between the incidence of skin cancer and the exposure distance (p<0.01). In addition, this correlation was the same even when the cases were analyzed separately according to sex. (author)

  8. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  9. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  10. Cure of skin cancer. Surgical cure of skin cancer

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.

    2001-01-01

    In this chapter authors studied the cure of skin cancer in particular the surgical cure of skin cancer. They noted that surgical cure of skin cancer is remain one of the primary and most important methods in treatment of skin cancer

  11. Artificial skin and patient simulator comprising the artificial skin

    NARCIS (Netherlands)

    2011-01-01

    The invention relates to an artificial skin (10, 12, 14), and relates to a patient simulator (100) comprising the artificial skin. The artificial skin is a layered structure comprising a translucent cover layer (20) configured for imitating human or animal skin, and comprising a light emitting layer

  12. Generation of Chimeric RNAs by cis-splicing of adjacent genes (cis-SAGe) in mammals.

    Science.gov (United States)

    Zhuo, Jian-Shu; Jing, Xiao-Yan; Du, Xin; Yang, Xiu-Qin

    2018-02-20

    Chimeric RNA molecules, possessing exons from two or more independent genes, are traditionally believed to be produced by chromosome rearrangement. However, recent studies revealed that cis-splicing of adjacent genes (cis- SAGe) is one of the major mechanisms underlying the formation of chimeric RNAs. cis-SAGe refers to intergenic splicing of directly adjacent genes with the same transcriptional orientation, resulting in read-through transcripts, termed chimeric RNAs, which contain sequences from two or more parental genes. cis-SAGe was first identified in tumor cells, since then its potential in carcinogenesis has attracted extensive attention. More and more scientists are focusing on it. With the development of research, cis-SAGe was found to be ubiquitous in various normal tissues, and might make a crucial contribution to the formation of novel genes in the evolution of genomes. In this review, we summarize the splicing pattern, expression characteristics, possible mechanisms, and significance of cis-SAGe in mammals. This review will be helpful for general understanding of the current status and development tendency of cis-SAGe.

  13. Allergy Skin Tests

    Science.gov (United States)

    ... and symptoms. Medications can interfere with results Before scheduling a skin test, bring your doctor a list ... of Privacy Practices Notice of Nondiscrimination Manage Cookies Advertising Mayo Clinic is a not-for-profit organization ...

  14. Caring for Tattooed Skin

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  15. Dry Skin (Xerosis)

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  16. Impairments in Skin Integrity.

    Science.gov (United States)

    Murphree, Rose W

    2017-09-01

    Altered skin integrity increases the chance of infection, impaired mobility, and decreased function and may result in the loss of limb or, sometimes, life. Skin is affected by both intrinsic and extrinsic factors. Intrinsic factors can include altered nutritional status, vascular disease issues, and diabetes. Extrinsic factors include falls, accidents, pressure, immobility, and surgical procedures. Ensuring skin integrity in the elderly requires a team approach and includes the individual, caregivers, and clinicians. The twenty-first century clinician has several online, evidence-based tools to assist with optimal treatment plans. Understanding best practices in addressing skin integrity issues can promote positive outcomes with the elderly. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test; Allergic rhinitis - allergy testing; Asthma - allergy testing; Eczema - allergy testing; Hayfever - allergy testing; Dermatitis - allergy testing; Allergy testing; ...

  18. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... Biopsy: The First Step Sentinel Node Biopsy Melanoma Treatment: Stages I & II Melanoma Treatment: Stage III Melanoma ...

  19. Examine Your Skin

    Medline Plus

    Full Text Available ... We Are Be On Our PAGE MIF Staff Programs & Services Scientific Advisory Board Advisory Board Patrons & Sponsors ... us for One-on-One Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video ...

  20. Occupational skin diseases

    DEFF Research Database (Denmark)

    Mahler, V; Aalto-Korte, K; Alfonso, J H

    2017-01-01

    BACKGROUND: Work-related skin diseases (WSD) are caused or worsened by a professional activity. Occupational skin diseases (OSD) need to fulfil additional legal criteria which differ from country to country. OSD range amongst the five most frequently notified occupational diseases (musculoskeletal...... diseases, neurologic diseases, lung diseases, diseases of the sensory organs, skin diseases) in Europe. OBJECTIVE: To retrieve information and compare the current state of national frameworks and pathways to manage patients with occupational skin disease with regard to prevention, diagnosis, treatment...... in Science and Technology (COST) Action TD 1206 (StanDerm) (www.standerm.eu). RESULTS: Besides a national health service or a statutory health insurance, most European member states implemented a second insurance scheme specifically geared at occupational diseases [insurance against occupational risks...

  1. Skin care and incontinence

    Science.gov (United States)

    ... skin care; Incontinence - pressure sore; Incontinence - pressure ulcer Patient Instructions Preventing pressure ulcers Images Male urinary system References Holroyd S. Incontinence-associated dermatitis: identification, prevention and care. Br J Nurs . 2015;24( ...

  2. Healthy Skin Matters

    Science.gov (United States)

    ... skin. If you’re helping out in the kitchen, make sure you use hot pads or wear ... in humans, plants, and animals, while others are essential for a healthy life. Propionibacterium acnes (P. acnes) ( ...

  3. Tuberculin Skin Testing

    Science.gov (United States)

    ... Appendix 1 Appendix 2 Appendix 3 Interim Laboratory Biosafety Guidance for XDR Mycobacterium tuberculosis strains Data & Statistics ... The Mantoux tuberculin skin test (TST) is the standard method of determining whether a person is infected ...

  4. [Currently available skin substitutes].

    Science.gov (United States)

    Oravcová, Darina; Koller, Ján

    2014-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

  5. Parasites and the skin

    African Journals Online (AJOL)

    2009-06-11

    Jun 11, 2009 ... those conditions that are encountered in daily practice and to remind you of those ... care conditions. Parasitic infections can be solely confined to the skin, as seen ..... endemic areas or may become chronic and disseminate.

  6. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  7. Fungal Skin Infections

    Science.gov (United States)

    ... Abbreviations Weights & Measures ENGLISH View Professional English Deutsch Japanese Espaniol Find information on medical topics, symptoms, drugs, ... touching the infected area. Diagnosis Skin scrapings or cultures Doctors may suspect a fungal infection when they ...

  8. Examine Your Skin

    Medline Plus

    Full Text Available ... Download a Skin Self-Exam Card Download a Patient Navigation Card Events, Webinars & Videos Events, Webinars & Videos Melanoma Patient Video Events Host an Event Past Webinars Upcoming ...

  9. Allergic Skin Conditions

    Science.gov (United States)

    ... most common types are atopic dermatitis (often called eczema) and contact dermatitis. Atopic Dermatitis (Eczema) Eczema is a chronic ... contact with your skin, they may cause a rash called contact dermatitis. There are two kinds of contact dermatitis: ...

  10. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... Light treatment to the skin and Restylane to tear troughs and outer eyebrow. Photo courtesy of Rebecca Fitzagerald, MD - Los Angeles, California Possible risks Soreness Mild bruising Temporary weakness of surrounding muscles Headache Drooping eyelid Why choose neuromodulators for aging ...

  11. Examine Your Skin

    Medline Plus

    Full Text Available ... Doctor Glossary of Terms Resources Resources Global Resources Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card Download a Patient Navigation Card ...

  12. Computed tomography of the normal sternum

    International Nuclear Information System (INIS)

    Goodman, L.R.; Teplick, S.K.; Kay, H.

    1983-01-01

    The normal CT anatomy of the sternum was studied in 35 patients. In addition to the normal appearance of the sternum, normal variants that may mimic desease were often noted. In the manubrium, part of the posterior cortical margin was unsharp and irregular in 34 of 35 patients. Part of the anterior cortical margin was indistinct in 20 of the 35 patients. Angulation of the CT gantry to a position more nearly perpendicular to the manubrium improved the definition of the cortical margins. The body of the sternum was ovoid to rectangular and usually had sharp cortical margins. Sections through the manubriosternal joint and xyphoid often demonstrated irregular mottled calcifications and indistinct margins again simulating bony lesions. The rib insertions, sternal clavicular joints, and adjacent soft-tissue appearance also were evaluated

  13. ReciPlySkin

    DEFF Research Database (Denmark)

    Popovic Larsen, Olga; Andersen, Mikkel; Munk-Andersen, Niklas

    2017-01-01

    The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report.......The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report....

  14. Adnexal Tumours Of Skin

    Directory of Open Access Journals (Sweden)

    Parate Sanjay N

    1998-01-01

    Full Text Available A total 120 cases of epidermal appendage tumours of skin were analysed and classified according to the classification provided by WHO’. Epidermal appendage tumours accounted for 12.87% of all skin tumours, of which 29.17% were benign and 70.83% were malignant. Most of the tumours (75.83% were in the head and face region. The most common tumour was basal cell epithelioma (55%.

  15. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  16. Stressed skin panels

    Energy Technology Data Exchange (ETDEWEB)

    Anon

    2001-07-01

    Advantages and disadvantages of stressed skin panels, also known as structural insulated panels (SIPs), are discussed as material and labour-saving alternatives to traditional stick framing. Stressed skin panels are manufactured 'sandwich' assemblies with a rigid insulating polystyrene foam core, whose interior and exterior surfaces are bonded into panels. The skins distribute and carry the structural loading while the bonded foam core provides insulation and keeps the two skins aligned. Since there are fewer framing members, there is little thermal bridging and the R-value remains high. SIPs are usually manufactured in four feet by eight feet panels, although some manufacturers can produce panels up to eight feet by forty feet. SIPs are resource efficient as they use less wood than conventional framing (about 25 per cent less); can structurally cover large spans, requiring less supplementary framing. Use of SIPs eliminate the need for headers over small openings; provide the ability to nail anywhere; create less scrap and waste; lessen vulnerability to unfavourable weather and other job-site hazards, can reduce delays, and often can produce significant savings in material and labour costs. Limitations include the more complex approaches to plumbing and electrical systems, although this can be minimized by designers by incorporating much of the plumbing and electrical work on interior (non-panel) walls. Most stressed skin panels require one-half inch interior gypsum drywall. If become wet, stressed skin panels take a long time to dry out and may harbour mold growth. Larger stressed-skin panels used in floors and roofs, may require cranes or other machinery for handling because of their weight. Although not without some environmental impact, overall, stressed skin panels are judged to be a resource-efficient building technology with significant energy-efficiency benefits and distinct advantages over stick framing. 3 photos.

  17. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  18. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation (ID 1669) and protection, of the skin from UV-induced damage (ID 1669) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation and protection of the skin from UV-induced damage. The scientific substantiation is based on the information provided by the Member States...... in the consolidated list of Article 13 health claims and references that EFSA has received from Member States or directly from stakeholders. The food constituent that is the subject of the health claim is a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium, and beta-carotene. The Panel...... considers that the combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium, and beta-carotene is sufficiently characterised....

  19. Energy Deposition in Adjacent LHC Superconducting Magnets from Beam Loss at LHC Transfer Line Collimators

    CERN Document Server

    Beavan, S; Kain, V

    2006-01-01

    Injection intensities for the LHC are over an order of magnitude above the damage threshold. The collimation system in the two transfer lines is designed to dilute the beam sufficiently to avoid damage in case of accidental beam loss or mis-steered beam. To maximise the protection for the LHC most of the collimators are located in the last 300 m upstream of the injection point where the transfer lines approach the LHC machine. To study the issue of possible quenches following beam loss at the collimators part of the collimation section in one of the lines, TI 8, together with the adjacent part of the LHC has been modeled in FLUKA. The simulated energy deposition in the LHC for worst-case accidental losses and as well as for losses expected during a normal filling is presented.

  20. New analysis methods for skin fine-structure via optical image and development of 3D skin Cycloscan(™).

    Science.gov (United States)

    Han, J Y; Nam, G W; Lee, H K; Kim, M J; Kim, E J

    2015-11-01

    This study was conducted to develop methods for measuring skin fine-structure via optical image and apparatus for photographing to analyze efficacy of anti-aging. We developed an apparatus named 3D Skin CycloScan(™) to evaluate the efficacy of cosmetics by imagification of skin fine-structure such as wrinkles, pores, and skin texture. The semi-sphere shaped device has 12 different sequential flashing light sources captures optical image simultaneously in one second to exclude the influence of the subject's movement. The normal map that is extracted through shape from shading method is composed of face contour and skin fine-structure parts. When the low-frequency component which is the result of the Gaussian Filter application is eliminated, we can get only skin fine-structure. In this normal map, it is possible to extract two-dimensional vector map called direction map and we can regulate the intensity of the image of wrinkles, pores, and skin texture after filtering the direction map. We performed a clinical study to apply this new apparatus and methods to evaluate an anti-aging efficacy of cosmetics visually and validate with other conventional methods. After using anti-aging cream including 2% adenosine for 8 weeks, the total amount of fine wrinkle around eye area detected via 3D Skin CycloScan(™) was reduced by 12.1%. Also, wrinkles on crow's feet measured by PRIMOS COMPACT(®) (GFMesstechnik GmbH, Germany) reduced 11.7%. According to an aspect of the present study, by changing the direction of the lights toward to subject's skin, we can obtain the information about the fine structures present on the skin such as wrinkles, pores, or skin texture and represent it as an image. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Adjacent segment disease and C-ADR: promises fulfilled?

    Science.gov (United States)

    Riew, K Daniel; Schenk-Kisser, Jeannette M.; Skelly, Andrea C.

    2012-01-01

    Study design: Systematic review. Clinical question: Do the rates and timing of adjacent segment disease (ASD) differ between cervical total disc arthroplasty (C-ADR) and anterior cervical discectomy and fusion (ACDF) in patients treated for cervical degenerative disc disease? Methods: A systematic search of MEDLINE/PubMed and bibliographies of key articles was done to identify studies with long-term follow-up for symptomatic and/or radiographic ASD comparing C-ADR with fusion for degenerative disc disease of the cervical spine. The focus was on studies with longer follow-up (48–60 months) of primary US Food and Drug Administration trials of Prestige ST, Prodisc-C, and Bryan devices as available. Trials of other discs with a minimum of 24 months follow-up were considered for inclusion. Studies evaluating lordosis/angle changes at adjacent segments and case series were excluded. Results: From 14 citations identified, four reports from three randomized controlled trials and four nonrandomized studies are summarized. Risk differences between C-ADR and ACF for symptomatic ASD were 1.5%–2.3% and were not significant across RCT reports. Time to development of ASD did not significantly differ between treatments. Rates of radiographic ASD were variable. No meaningful comparison of ASD rates based on disc design was possible. No statistical differences in adjacent segment range of motion were noted between treatment groups. Conclusion: Our analysis reveals that, to date, there is no evidence that arthroplasty decreases ASD compared with ACDF; the promise of arthroplasty decreasing ASD has not been fulfilled. PMID:23236312

  2. Microwave treatment of renal cell carcinoma adjacent to renal sinus.

    Science.gov (United States)

    Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

    2016-11-01

    To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4cm (100%, 29/29) and RCCs >4cm (75%, 9/12, p=0.021). During the median follow-up of 37.6 (range, 3.0-97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. US-guided percutaneous MWA appears to be a promising method for RCCs adjacent to renal sinus, especially for tumors ≤4cm. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  3. Skin manifestations of growth hormone-induced diseases.

    Science.gov (United States)

    Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

    2016-09-01

    The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

  4. Cystic adventitial degeneration: ectopic ganglia from adjacent joint capsules.

    Science.gov (United States)

    Ortmann, J; Widmer, M K; Gretener, S; Do, D D; Willenberg, T; Daliri, A; Baumgartner, I

    2009-11-01

    Cystic adventitial degeneration is a rare non-atherosclerotic cause of peripheral arterial occlusive disease, mainly seen in young men without other evidence of vascular disease. Diagnosis will be established by clinical findings and by ultrasound or angiography and can be treated by excision or enucleation of the affected arterial segment or by percutaneous ultrasound-guided aspiration. However, the etiology of adventitial cysts remains unknown. We report a case of cystic adventitial degeneration showing a connection between the joint capsule and the adventitial cyst, supporting the theory that cystic adventitial degeneration may represent ectopic ganglia from adjacent joint capsules.

  5. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    OpenAIRE

    Ninomiya, Koshi; Iwatsuki, Koichi; Ohnishi, Yu-ichiro; Ohkawa, Toshika; Yoshimine, Toshiki

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  6. Osteoid Osteoma of Cervical Spine in two adjacent Vertebrae

    Directory of Open Access Journals (Sweden)

    MR Etemadifar

    2005-09-01

    Full Text Available Osteoid osteoma is a benign bone tumor, mainly seen in 10-30 years male. Spine is a relatively common site and almost always, posterior elements are involved. Plain X-Ray-, CT scan and Isotope scan help to identify and localize spine lesions. We described one 18 years old boy with 3 years low neck pain. Isotope scan, MRI and CT scan showed two lesions in C7 and T1. Gross inspection and histopathology examination confirmed osteoid osteoma in two adjacent vertebrae which has not been reported elsewhere in the literature. Key words: Osteoid Osteoma, Spine, Multifocal

  7. Microwave treatment of renal cell carcinoma adjacent to renal sinus

    International Nuclear Information System (INIS)

    Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

    2016-01-01

    Highlights: • This study shows US-guided microwave ablation appears to be a promising method to treat renal cell carcinoma adjacent to renal sinus. • The estimated 1-, 3- and 5-year RCC-related survival were 100%, 93.3% and 93.3%, respectively. • The estimated 1-, 3- and 5-year overall survival were 97.1%, 87.8%, 83.6%, respectively. • For patients with RCC ≤4 cm, initial ablation success was 100% (29/29) and the estimated 5-year disease-free survival were 81.5%. - Abstract: Purpose: To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. Materials and methods: This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1 day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. Results: IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4 cm (100%, 29/29) and RCCs >4 cm (75%, 9/12, p = 0.021). During the median follow-up of 37.6 (range, 3.0–97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4 cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. Conclusion: US-guided percutaneous MWA

  8. Microwave treatment of renal cell carcinoma adjacent to renal sinus

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yongyan, E-mail: gaoyongyan7@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Department of Ultrasound, The General Hospital of Chinese People’s Armed Police Forces, 69 Yongding Road, Beijing, 100039 (China); Liang, Ping, E-mail: liangping301@hotmail.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Yu, Xiaoling, E-mail: 784107477@qq.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Yu, Jie, E-mail: 1411495161@qq.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Cheng, Zhigang, E-mail: 13691367317@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Han, Zhiyu, E-mail: hanzhiyu122@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Duan, Shaobo, E-mail: Dustin2662@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Huang, Hui, E-mail: 309hh@sina.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China)

    2016-11-15

    Highlights: • This study shows US-guided microwave ablation appears to be a promising method to treat renal cell carcinoma adjacent to renal sinus. • The estimated 1-, 3- and 5-year RCC-related survival were 100%, 93.3% and 93.3%, respectively. • The estimated 1-, 3- and 5-year overall survival were 97.1%, 87.8%, 83.6%, respectively. • For patients with RCC ≤4 cm, initial ablation success was 100% (29/29) and the estimated 5-year disease-free survival were 81.5%. - Abstract: Purpose: To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. Materials and methods: This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1 day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. Results: IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4 cm (100%, 29/29) and RCCs >4 cm (75%, 9/12, p = 0.021). During the median follow-up of 37.6 (range, 3.0–97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4 cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. Conclusion: US-guided percutaneous MWA

  9. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  10. Outer nuclear membrane fusion of adjacent nuclei in varicella-zoster virus-induced syncytia.

    Science.gov (United States)

    Wang, Wei; Yang, Lianwei; Huang, Xiumin; Fu, Wenkun; Pan, Dequan; Cai, Linli; Ye, Jianghui; Liu, Jian; Xia, Ningshao; Cheng, Tong; Zhu, Hua

    2017-12-01

    Syncytia formation has been considered important for cell-to-cell spread and pathogenesis of many viruses. As a syncytium forms, individual nuclei often congregate together, allowing close contact of nuclear membranes and possibly fusion to occur. However, there is currently no reported evidence of nuclear membrane fusion between adjacent nuclei in wild-type virus-induced syncytia. Varicella-zoster virus (VZV) is one typical syncytia-inducing virus that causes chickenpox and shingles in humans. Here, we report, for the first time, an interesting observation of apparent fusion of the outer nuclear membranes from juxtaposed nuclei that comprise VZV syncytia both in ARPE-19 human epithelial cells in vitro and in human skin xenografts in the SCID-hu mouse model in vivo. This work reveals a novel aspect of VZV-related cytopathic effect in the context of multinucleated syncytia. Additionally, the information provided by this study could be helpful for future studies on interactions of viruses with host cell nuclei. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....

  12. Polarization singularities of the object field of skin surface

    International Nuclear Information System (INIS)

    Angelsky, O V; Ushenko, A G; Ushenko, Yu A; Ushenko, Ye G

    2006-01-01

    The paper deals with the investigation of formation mechanisms of laser radiation polarization structure scattered by an optically thin surface layer of human skin in two registration zones: a boundary field and a far zone of Fraunhofer diffraction. The conditions of forming polarization singularities by such an object in the scattered radiation field have been defined. Statistical and fractal polarization structure of object fields of physiologically normal and pathologically changed skin has been studied. It has been shown that polarization singularities of radiation scattered by physiologically normal skin samples have a fractal coordinate structure. It is characteristic for fields of pathologically changed skin to have a statistical coordinate structure of polarization singularities in all diffraction zones

  13. Correlation between diagnostic capability of MR-mammography and histology of tissue adjacent to tumor

    Energy Technology Data Exchange (ETDEWEB)

    Takahara, Taro [St. Marianna Univ., Kawasaki, Kanagawa (Japan)

    1996-12-01

    The purpose of this paper is to evaluate correlation between the capability in the diagnosis of tumor extent and histology of adjacent tissue. MR-mammography (MRM) was obtained in twenty-one patients with surgically resected breast cancer by 0.5 T superconducting magnet (PHILIPS GY-ROSCAN T5-II, release 3.1). Pre and postcontrast 3D-spoiled gradient echo sequence were employed for MRM with spectral presaturation with inversion recovery (SPIR) and on-resonance MTC. The contrast determination time, the passing time of the center of k-space, was 1 min 50 s in 14 cases with key-hole imaging, and 2 min 46 s in 7 cases without key-hole imaging. Early enhancing area was considered as a tumor and an accuracy of tumor extent was evaluated by two radiologists. Accurate interpretation was obtained in 9 of 9 cases with atrophic mammary gland with fatty replacement and 3 of 3 cases with severe fibrosis in mammary gland. Seven cases were unclear in tumor margin due to intense enhancement of the adjacent tissue. One of 3 cases with normal mammary gland showed unclear margin of the tumor, which corresponded to the area of rich population of lobules in a young patient. Two of 2 cases of fibrocystic change with nonproliferative lesions in one case and proliferative lesions without atypia in another, showed unclear margin of tumor. Two cases of 2 intraductal spreading and 2 of 2 cases of massive interstitial invasion also showed unclear margin. The accuracy of tumor extent was found to have no correlation with either histology or enhancing ratio of the tumor. In conclusion, it is warranted to say that histology of adjacent tissue is an important factor to determine diagnostic capability of tumor extent by MRM. Fat replacement and fibrosis of the surrounding tissue are main causes of clear visualization of tumor, while normal mammary gland in young patients, fibrocystic change, intraductal spreading and invasion lead to the unclearness of tumor margin. (author)

  14. Correlation between diagnostic capability of MR-mammography and histology of tissue adjacent to tumor

    International Nuclear Information System (INIS)

    Takahara, Taro

    1996-01-01

    The purpose of this paper is to evaluate correlation between the capability in the diagnosis of tumor extent and histology of adjacent tissue. MR-mammography (MRM) was obtained in twenty-one patients with surgically resected breast cancer by 0.5 T superconducting magnet (PHILIPS GY-ROSCAN T5-II, release 3.1). Pre and postcontrast 3D-spoiled gradient echo sequence were employed for MRM with spectral presaturation with inversion recovery (SPIR) and on-resonance MTC. The contrast determination time, the passing time of the center of k-space, was 1 min 50 s in 14 cases with key-hole imaging, and 2 min 46 s in 7 cases without key-hole imaging. Early enhancing area was considered as a tumor and an accuracy of tumor extent was evaluated by two radiologists. Accurate interpretation was obtained in 9 of 9 cases with atrophic mammary gland with fatty replacement and 3 of 3 cases with severe fibrosis in mammary gland. Seven cases were unclear in tumor margin due to intense enhancement of the adjacent tissue. One of 3 cases with normal mammary gland showed unclear margin of the tumor, which corresponded to the area of rich population of lobules in a young patient. Two of 2 cases of fibrocystic change with nonproliferative lesions in one case and proliferative lesions without atypia in another, showed unclear margin of tumor. Two cases of 2 intraductal spreading and 2 of 2 cases of massive interstitial invasion also showed unclear margin. The accuracy of tumor extent was found to have no correlation with either histology or enhancing ratio of the tumor. In conclusion, it is warranted to say that histology of adjacent tissue is an important factor to determine diagnostic capability of tumor extent by MRM. Fat replacement and fibrosis of the surrounding tissue are main causes of clear visualization of tumor, while normal mammary gland in young patients, fibrocystic change, intraductal spreading and invasion lead to the unclearness of tumor margin. (author)

  15. Comparison of differences in knowledge about skin care bettwen young women and man

    Directory of Open Access Journals (Sweden)

    Katarzyna Bojarczuk

    2017-08-01

    Full Text Available Introduction: The skin of modern people is exposed daily to a number of irritants like stress, consequences of inadequate diet, exposure to chemicals and plastics. Those factors can pose a challenge not only for delicate skin of a child, or a woman, but also for more resistant skin of men. Every type of complexion requires individual care, adjusted to different conditions and life circumstances. The choice of proper skin care products should be based on basic skin type and also one's gender. Objectives: Evaluation of differences in students' knowledge about skin care in relation to their gender. Material and methods: Evaluation of students' knowledge concerning proper skin care guidelines was conducted among 210 students (150 women and 60 men using anonymous survey. Results: Majority of male respondents determined their skin type as a normal one (56.6%, majority of female respondents as a combination type (51.3%. Men in contrast to women are more often unable to evaluate the type of their own skin (16.7% vs 4.0%.  Acne was the most common skin condition students of both sexes complained about. Daily skin care activities are performed by 96.6% interviewed women and 63.3% men. The regular use of face skin care products was reported by 87.3% of women and 31.6% of men. Conclusions: 1. Majority of women evaluate their basic skin type as combination one, most men regarded their skin type as normal . 2. Women more often than men take care of their skin and use adequate skin care products. 3. Facial moisturizing lotion is the most frequently chosen skin care product by both women and men.

  16. Applications of positron annihilation to dermatology and skin cancer

    International Nuclear Information System (INIS)

    Liu, Guang; Chen, Hongmin; Chakka, Lakshmi; Gadzia, Joseph E.; Jean, Y.C.

    2007-01-01

    Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  17. Field enhancement due to anomalous skin effect inside a target

    International Nuclear Information System (INIS)

    Ma, G.; Tan, W.

    1996-01-01

    A new method based on Fourier transformation to study the skin effects is presented. Using this method, the field amplitude in plasma is represented in terms of electric conductivity, and the normal and anomalous skin effects are described through one formula by omitting the plasma dispersion or not. The results are in agreement with other publications [e.g., J. P. Matte and K. Aguenaou, Phys. Rev. A 45, 2558 (1992)] for equivalent parameters. But for deeper positions inside a target, which have not been studied by others, it is found that the field amplitude is considerably enhanced due to an anomalous skin effect, even for constant collision frequency. In addition, the skin absorptions and some calculations on an anomalous skin effect for different collision frequencies are also presented. copyright 1996 American Institute of Physics

  18. Resveratrol anti-ultraviolet-induced guinea pig skin injury

    International Nuclear Information System (INIS)

    Li Wenxing; Zhao Ying

    2014-01-01

    Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)

  19. Applications of positron annihilation to dermatology and skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)

    2007-07-01

    Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  20. Care and management of a stoma: maintaining peristomal skin health.

    Science.gov (United States)

    Boyles, Anna; Hunt, Sharon

    2016-09-22

    It is estimated that around one in 500 people in the UK are living with a stoma, with approximately 21 000 operations that result in stoma formation being performed each year ( Colostomy Association, 2016 ). These people face a unique set of challenges in maintaining the integrity of their peristomal skin. This article explores the normal structure and function of skin and how the care and management of a stoma presents challenges for maintaining peristomal skin health. Particular focus is paid to the incidence of skin problems for those living with a stoma, whether it is temporary or permanent, and the factors that contribute to skin breakdown in this population. Wider factors such as the central role of the clinical nurse specialist and the impact of product usage on positive outcomes and health economics are also considered.

  1. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Directory of Open Access Journals (Sweden)

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  2. ORNAMENTAL PLANTS OF CHECHNYA AND ITS ADJACENT AREAS

    Directory of Open Access Journals (Sweden)

    Musa A. Taysumov

    2018-01-01

    Full Text Available Abstract. The aim of the research is to summarize the scattered information about the types of decorative flora of the Chechen Republic and adjacent territories; to identify highly resistant ornamental plants for cities and settlements of the North Caucasus and other territories of Russia. Discussion. Currently, in a variety of botanical gardens of the North Caucasus grows a large number of decorative plant species, widely used in green construction. However, not all species posses the quality to sufficient resist unfavorable conditions of the changed abiotic and biotic environment. Among the studied, the most valuable and promising for widespread introduction are the species of more than 122 taxa, the decorative effect of which is preserved throughout the year with no signs of aging. Many examples of the targeted use of herbs, tree species, lianas, bulbous plants were cited in the research. We give a large list of Caucasian species for growing on lawns, flowerbeds, flower gardens, alpine and stony mountains, roadsides and parks, urban parks, squares and alleys as a type of gardening. Their decorative properties, vitality, durability, life form and other bio-ecological features, attitude to abiotic factors (soil conditions, illumination, temperature, soil and atmospheric humidification conditions, etc. were taken into account. Conclusion. We give a large list of ornamental species and various planting techniques of specific species are introduced in conditions of Chechnya and its adjacent territories as well as the methods of implementing in the landscaping practice in other (middle and northern regions of Russia.

  3. Absorbed dose distribution analyses in irradiation with adjacent fields

    International Nuclear Information System (INIS)

    Cudalbu, C.; Onuc, C.; Andrada, S.

    2002-01-01

    Because the special irradiation technique with adjacent fields is the most used in the case of medulloblastoma treatment, we consider very important to specify some general information about medulloblastoma. This malignant disease has a large incidence in children with age between 5-7 years. This tumor usually originates in the cerebellum and is referred to as primitive undifferentiated tumor. It may spread contiguously to the cerebellar peduncle, floor of the fourth ventricle, into the cervical spine. In addition, it may spread via the cerebrospinal fluid intracranially and/or to the spinal cord. For this purpose it is necessary to perform a treatment technique with cranial tangential fields combined with adjacent fields for the entire spinal cord to achieve a perfect coverage of the zones with malignant cells. The treatment in this case is an association between surgery-radio-chemotherapy, where the radiotherapy has a very important roll and a curative purpose. This is due to the fact that the migration of malignant cells in the body can't be controlled by surgery. Because of this special irradiation technique used in medulloblastoma treatment, we chase to describe in this paper this complex type of irradiation where the implications of the beams divergence in doses distribution are essentials

  4. Calculations of the electrostatic potential adjacent to model phospholipid bilayers.

    Science.gov (United States)

    Peitzsch, R M; Eisenberg, M; Sharp, K A; McLaughlin, S

    1995-03-01

    We used the nonlinear Poisson-Boltzmann equation to calculate electrostatic potentials in the aqueous phase adjacent to model phospholipid bilayers containing mixtures of zwitterionic lipids (phosphatidylcholine) and acidic lipids (phosphatidylserine or phosphatidylglycerol). The aqueous phase (relative permittivity, epsilon r = 80) contains 0.1 M monovalent salt. When the bilayers contain equipotential surfaces are discrete domes centered over the negatively charged lipids and are approximately twice the value calculated using Debye-Hückel theory. When the bilayers contain > 25% acidic lipid, the -25 mV equipotential profiles are essentially flat and agree well with the values calculated using Gouy-Chapman theory. When the bilayers contain 100% acidic lipid, all of the equipotential surfaces are flat and agree with Gouy-Chapman predictions (including the -100 mV surface, which is located only 1 A from the outermost atoms). Even our model bilayers are not simple systems: the charge on each lipid is distributed over several atoms, these partial charges are non-coplanar, there is a 2 A ion-exclusion region (epsilon r = 80) adjacent to the polar headgroups, and the molecular surface is rough. We investigated the effect of these four factors using smooth (or bumpy) epsilon r = 2 slabs with embedded point charges: these factors had only minor effects on the potential in the aqueous phase.

  5. The contribution of skin blood flow in warming the skin after the application of local heat; the duality of the Pennes heat equation.

    Science.gov (United States)

    Petrofsky, Jerrold; Paluso, Dominic; Anderson, Devyn; Swan, Kristin; Yim, Jong Eun; Murugesan, Vengatesh; Chindam, Tirupathi; Goraksh, Neha; Alshammari, Faris; Lee, Haneul; Trivedi, Moxi; Hudlikar, Akshay N; Katrak, Vahishta

    2011-04-01

    As predicted by the Pennes equation, skin blood flow is a major contributor to the removal of heat from an external heat source. This protects the skin from erythema and burns. But, for a person in a thermally neutral room, the skin is normally much cooler than arterial blood. Therefore, if skin blood flow (BF) increases, it should initially warm the skin paradoxically. To examine this phenomenon, 10 young male and female subjects participated in a series of experiments to examine the contribution of skin blood flow in the initial warming the skin after the application of local heat. Heat flow was measured by the use of a thermode above the brachioradialis muscle. The thermode was warmed by constant temperature water at 44°C entering the thermode at a water flow rate of 100 cm(3)/min. Skin temperature was measured by a thermistor and blood flow in the underlying skin was measured by a laser Doppler imager in single point mode. The results of the experiments showed that, when skin temperature is cool (31-32°C), the number of calories being transferred to the skin from the thermode cannot account for the rise in skin temperature alone. A significant portion of the rise in skin temperature is due to the warm arterialized blood traversing the skin from the core areas of the body. However, as skin temperature approaches central core temperature, it becomes less of a heat source and more of a heat sync such that when skin temperature is at or above core temperature, the blood flow to the skin, as predicted by Pennes, becomes a heat sync pulling heat from the thermode. Copyright © 2010 IPEM. Published by Elsevier Ltd. All rights reserved.

  6. Screening for skin cancer.

    Science.gov (United States)

    Helfand, M; Mahon, S M; Eden, K B; Frame, P S; Orleans, C T

    2001-04-01

    Malignant melanoma is often lethal, and its incidence in the United States has increased rapidly over the past 2 decades. Nonmelanoma skin cancer is seldom lethal, but, if advanced, can cause severe disfigurement and morbidity. Early detection and treatment of melanoma might reduce mortality, while early detection and treatment of nonmelanoma skin cancer might prevent major disfigurement and to a lesser extent prevent mortality. Current recommendations from professional societies regarding screening for skin cancer vary. To examine published data on the effectiveness of routine screening for skin cancer by a primary care provider, as part of an assessment for the U.S. Preventive Services Task Force. We searched the MEDLINE database for papers published between 1994 and June 1999, using search terms for screening, physical examination, morbidity, and skin neoplasms. For information on accuracy of screening tests, we used the search terms sensitivity and specificity. We identified the most important studies from before 1994 from the Guide to Clinical Preventive Services, second edition, and from high-quality reviews. We used reference lists and expert recommendations to locate additional articles. Two reviewers independently reviewed a subset of 500 abstracts. Once consistency was established, the remainder were reviewed by one reviewer. We included studies if they contained data on yield of screening, screening tests, risk factors, risk assessment, effectiveness of early detection, or cost effectiveness. We abstracted the following descriptive information from full-text published studies of screening and recorded it in an electronic database: type of screening study, study design, setting, population, patient recruitment, screening test description, examiner, advertising targeted at high-risk groups or not targeted, reported risk factors of participants, and procedure for referrals. We also abstracted the yield of screening data including probabilities and numbers

  7. Traumatic degloving lesion of penile and scrotal skin

    Directory of Open Access Journals (Sweden)

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  8. Changes in Transepidermal Water Loss and Skin Hydration according to Expression of Aquaporin-3 in Psoriasis

    Science.gov (United States)

    Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon

    2012-01-01

    Background Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. Objective The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. Methods The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. Results AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Conclusion Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin. PMID:22577267

  9. Formation of thymine containing dimers in skin exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, B E [Dundee Univ. (UK)

    1978-01-01

    Nuclear DNA appears to be the major molecular target for the inhibitory, mutagenic and lethal effects of ultraviolet radiation on cells in culture. Cyclobutyl dimers between adjacent pyrimidine bases, the major photochemical lesions for these effects in prokaryotes, also play a part in UVR effects on eukaryotes cells. Pyrimidine dimers have been isolated from in vivo UV-irradiated guinea pig and mouse skin. The wavelength dependence for dimer induction is similar to that for acute skin reactions but no direct causal relationship has been established. Sunlight UVR may induce dimers in skin DNA. Excision of dimers from mouse skin in vivo is deficient as it is for most rodent cells in culture; human cell excision is efficient and the difficulties in interpretation of UV-carcinogenesis results with mice in terms of human skin cancer are therefore increased.

  10. Use of skin stretchers for single-stage bilateral mastectomies in a dog and a cat.

    Science.gov (United States)

    Miyazaki, Yuta; Aikawa, Takeshi; Shimatsu, Taichi; Nishimura, Masaaki; Sadahiro, Shigeo

    2018-04-01

    To describe the application of skin stretchers for closure of single-stage bilateral mastectomies in a dog and a cat. Clinical case report. A 12-year-old intact female Miniature Dachshund and a 13-year-old spayed female domestic short-hair cat. Skin stretchers were applied to the site of the skin adjacent to mammary glands for 2-4 days before surgery. Cable tension was adjusted every 6-8 hours to elongate the skin and to achieve primary closure of single-stage bilateral mastectomy without tension. Wound closure after single-stage bilateral mastectomy was achieved without tension or major complication in both animals. Use of skin stretchers allows primary closure of single-stage bilateral mastectomy in dogs and cats. © 2017 The American College of Veterinary Surgeons.

  11. Friction coefficient of skin in real-time.

    Science.gov (United States)

    Sivamani, Raja K; Goodman, Jack; Gitis, Norm V; Maibach, Howard I

    2003-08-01

    Friction studies are useful in quantitatively investigating the skin surface. Previous studies utilized different apparatuses and materials for these investigations but there was no real-time test parameter control or monitoring. Our studies incorporated the commercially available UMT Series Micro-Tribometer, a tribology instrument that permits real-time monitoring and calculation of the important parameters in friction studies, increasing the accuracy over previous tribology and friction measurement devices used on skin. Our friction tests were performed on four healthy volunteers and on abdominal skin samples. A stainless steel ball was pressed on to the skin with at a pre-set load and then moved across the skin at a constant velocity of 5 mm/min. The UMT continuously monitored the friction force of the skin and the normal force of the ball to calculate the friction coefficient in real-time. Tests investigated the applicability of Amonton's law, the impact of increased and decreased hydration, and the effect of the application of moisturizers. The friction coefficient depends on the normal load applied, and Amonton's law does not provide an accurate description for the skin surface. Application of water to the skin increased the friction coefficient and application of isopropyl alcohol decreased it. Fast acting moisturizers immediately increased the friction coefficient, but did not have the prolonged effect of the slow, long lasting moisturizers. The UMT is capable of making real-time measurements on the skin and can be used as an effective tool to study friction properties. Results from the UMT measurements agree closely with theory regarding the skin surface.

  12. Effects of radiation on levels of DNA damage in normal non-adjacent mucosa from colorectal cancer cases.

    LENUS (Irish Health Repository)

    Sheridan, Juliette

    2013-03-01

    Defects in DNA repair pathways have been linked with colorectal cancer (CRC). Adjuvant radiotherapy has become commonplace in the treatment of rectal cancer however it is associated with a higher rate of second cancer formation. It is known that radiation results in DNA damage directly or indirectly by radiation-induced bystander effect (RIBE) by causing double-strand breaks (DSBs). The majority of work in RIBE has been performed in cell lines and limited studies have been in or ex vivo.

  13. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  14. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    DEFF Research Database (Denmark)

    Pedersen, C; Horn, T; Junge, Jette

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... of the patients without TRI, interferon activity was below detection level. The occurrence of TRI was not dependent on the presence of free p24 antigen in serum. It is concluded that the occurrence of TRI in entothelial cells of skin capillaries is associated with late stages of HIV infection and this may...

  15. Normal foot and ankle

    International Nuclear Information System (INIS)

    Weissman, S.D.

    1989-01-01

    The foot may be thought of as a bag of bones tied tightly together and functioning as a unit. The bones re expected to maintain their alignment without causing symptomatology to the patient. The author discusses a normal radiograph. The bones must have normal shape and normal alignment. The density of the soft tissues should be normal and there should be no fractures, tumors, or foreign bodies

  16. [A case of skin autograft for skin ulcers in ichthyosis].

    Science.gov (United States)

    Li, Shiwei; Yang, Xiaodong; Liu, Lijun; Tang, Xueyang

    2017-10-28

    Ichthyosis refers to a group of skin diseases characterized by abnormal keratinization of the epidermis, resulting in dryness, roughness and scale of the skin. A girl with ichthyosis, who presented with skin ulcers and infection of the right dorsal foot, was admitted to our department. An autologous razor-thin skin grafting procedure was performed to repair the skin ulcers after debridement and vacuum sealing drain. After 8 months of follow-up, both the donor and recipient site healed well and there were no newly formed ulcers or infections. Although the skin quality of ichthyosis is poor, the lesion area can still be used as donor or recipient cite.

  17. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  18. [ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

    Science.gov (United States)

    Song, Zhifang; Liu, Dewu

    2014-07-01

    To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

  19. UNITED STATES DEPARTMENT OF TRANSPORTATION GLOBAL POSITIONING SYSTEM (GPS) ADJACENT BAND COMPATIBILITY ASSESSMENT

    Science.gov (United States)

    2018-04-01

    The goal of the U.S. Department of Transportation (DOT) Global Positioning System (GPS) Adjacent Band Compatibility Assessment is to evaluate the maximum transmitted power levels of adjacent band radiofrequency (RF) systems that can be tolerated by G...

  20. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  1. Sprayed skin turbine component

    Science.gov (United States)

    Allen, David B

    2013-06-04

    Fabricating a turbine component (50) by casting a core structure (30), forming an array of pits (24) in an outer surface (32) of the core structure, depositing a transient liquid phase (TLP) material (40) on the outer surface of the core structure, the TLP containing a melting-point depressant, depositing a skin (42) on the outer surface of the core structure over the TLP material, and heating the assembly, thus forming both a diffusion bond and a mechanical interlock between the skin and the core structure. The heating diffuses the melting-point depressant away from the interface. Subsurface cooling channels (35) may be formed by forming grooves (34) in the outer surface of the core structure, filling the grooves with a fugitive filler (36), depositing and bonding the skin (42), then removing the fugitive material.

  2. Thyroid and skin

    Directory of Open Access Journals (Sweden)

    Dogra Alka

    2006-01-01

    Full Text Available The association of thyroid disorders with skin manifestations is complex. Both hypothryoidism and hyperthyroidism are known to cause these changes. In order to study this association of skin changes in relation to hypothyroidism, a study was carried out in the outpatients department of Dermatology of Dayanand Medical College and Hospital, Ludhiana, over a period of 3 months from Jan-March 2005. Thirty two patients were enrolled in the study and parameters were noted regarding history, general symptoms, cutaneous signs and associated diseases. We found gain in weight (71.85% and lethargy (65.62% to be the most common complaints. On cutaneous examination, dry, coarse texture of the skin (56%, pigmentary disorders (37.5% and telogen effluvium (40.62% were the most common findings. Other associated disorders were vitiligo, melasma, pemphigus, alopecia areata, xanthelasma palpebrarum, etc.

  3. Environment and the skin

    International Nuclear Information System (INIS)

    Suskind, R.R.

    1990-01-01

    The skin is an important organ of defense adaptation and a portal of entry for xenobiotics. It is vulnerable to physical, chemical, and biologic agents and capable of expressing responses to these agents in a variety of pathologic patterns. These patterns are characterized by morphologic and functional features which are elicited by careful examination and test procedures. Cutaneous cancer may result from exposure to nonionizing as well as ionizing radiation, to specific identifiable chemical hazards, and may be enhanced by trauma. Cutaneous hazards of chemical sources are largely found in the workplace and among consumer products, including drugs and toilet goods. Environmental skin diseases and injuries are preventable. Prior to use assessment for safety and for possible risks from exposure to an agent, product, or process is of primary importance in the prevention and control of environmental skin disease and injury

  4. Precancerous Skin Lesions.

    Science.gov (United States)

    Ferrándiz, C; Malvehy, J; Guillén, C; Ferrándiz-Pulido, C; Fernández-Figueras, M

    Certain clinically and histologically recognizable skin lesions with a degree of risk of progression to squamous cell carcinoma have been traditionally grouped as precancerous skin conditions but now tend to be classified as in situ carcinomas. This consensus statement discusses various aspects of these lesions: their evaluation by means of clinical and histopathologic features, the initial evaluation of the patient, the identification of risk factors for progression, and the diagnostic and treatment strategies available today. Copyright © 2016 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  6. Clinical application of a tissue-cultured skin autograft: an alternative for the treatment of non-healing or slowly healing wounds?

    Science.gov (United States)

    Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland

    2014-01-01

    The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.

  7. Skin cancer of Nagasaki atomic bomb survivors, 5

    International Nuclear Information System (INIS)

    Sadamori, Naoki; Mine, Mariko; Hori, Makoto; Noda, Yoshinori; Fujiwara, Naoko; Takahara, Osamu; Sadamori, Michiko; Nishimoto, Katsutaro; Ota, Hisahiro.

    1990-01-01

    We already reported that there was a high correlation between the exposure dose and the incidence of skin cancer in A-bomb survivors using the data of the Nagasaki Life Span Study of Radiation Effects Research Foundation and Nagasaki Tumor Registry. In Report 3 of this series, we confirmed that the correlation between the exposure distance and the incidence of skin cancer was statistically significant. In Report 4, we clarified that the incidence of skin cancer in proximally exposed Nagasaki A-bomb survivors when compared to distally exposed victims appears to be increasing since 1975. In this final report of the series, we examined the characteristics of skin cancer in Nagasaki A-bomb survivors using 140 skin cancer cases collected from 31 hospitals in Nagasaki City and adjacent districts on the basis of the data of a total of 66,276 A-bomb survivors recorded in the Scientific Data Center of Atomic Bomb Disaster, Nagasaki University School of Medicine. Among the various items examined, the only item that showed a statistical significance was the age at exposure in the cases of squamous cell carcinoma, i.e., those exposed within 2.5 km from the hypocenter were significantly younger than those exposed at 3.0 km or more. (author)

  8. Skin cancer of Nagasaki atomic bomb survivors, 4

    International Nuclear Information System (INIS)

    Sadamori, Naoki; Mine, Mariko; Hori, Makoto; Noda, Yoshinori; Fujiwara, Naoko; Takahara, Osamu; Sadamori, Michiko; Nishimoto, Katsutaro; Ota, Hisahiro.

    1990-01-01

    We previously reported that there was a high correlation between the exposure dose and the incidence of skin cancer in A-bomb survivors using the data of the Nagasaki Life Span Study of Radiation Effects Research Foundation and Nagasaki Tumor Registry. In Report 3 of this series, we clarified that the correlation between the exposure distance and the incidence of skin cancer was statistically significant in 140 cases of skin cancer collected from 31 hospitals in Nagasaki City and adjacent districts on the basis of the data of the total 66,276 A-bomb survivors recorded in the Scientific Data Center of Atomic Bomb Disaster, Nagasaki University School of Medicine, and that the correlation was the same even when the cases were divided by sex. In this report, we examined the chronological change of the incidence of skin cancer in Nagasaki A-bomb survivors, using the data of the Scientific Data Center of Atomic Bomb Disaster. It is likely that the incidence of skin cancer in Nagasaki A-bomb survivors has increased after 1962, especially after 1975 in those exposed within 2.5km from the hypocenter compared to those exposed at 3.0km or more. (author)

  9. Tritium in the Savannah River Estuary and adjacent marine waters

    International Nuclear Information System (INIS)

    Hayes, D.W.

    1978-01-01

    The tritium distribution in the Savannah River estuary and adjacent marine waters was measured to provide information on the dilution, mixing, and movement of Savannah River water in this region. The Savannah River marine region was chosen because the average tritium concentration in this river is 5 pCi/ml, whereas other rivers in the southeastern United States average less than 0.5 pCi/ml. The increased tritium concentration in the Savannah River is due to releases from the Savannah River Plant of the Department of Energy. Tritium measurements have proved particularly effective in estimating the flushing time of the Savannah River estuary (2.4 days) and in delineating the relative contribution to the water masses in Ossabaw and Port Royal Sounds from the River and from sea water. Ossabaw and Port Royal Sounds are located approximately 20 km south and north of the Savannah River estuary, respectively

  10. Tritium in the Savannah River estuary and adjacent marine waters

    International Nuclear Information System (INIS)

    Hayes, D.W.

    1979-01-01

    The tritium distribution in the Savannah River estuary and adjacent marine waters was measured to provide information on the dilution, mixing and movement of Savannah River water in this region. The Savannah River marine region was chosen because the average tritium concentration in this river is approximately 5 pCi/ml, whereas other rivers in the southeastern United States of America average less than 0.5 pCi/ml. The increased tritium concentration in the Savannah River is due to releases from the Savannah River Plant of the Department of Energy. Tritium measurements have proved particularly effective in estimating the flushing time of the Savannah River estuary (2.4 days) and in delineating the relative contribution to the water masses in Ossabaw and Port Royal Sounds from the river and from sea-water. Ossabaw and Port Royal Sounds are located approximately 20 km south and north of the Savannah River estuary respectively. (author)

  11. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Directory of Open Access Journals (Sweden)

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  12. Edge scour in current adjacent to stone covers

    DEFF Research Database (Denmark)

    Petersen, Thor Ugelvig; Sumer, B. Mutlu; Meyer, Knud Erik

    The present paper reports some early results of an experimental investigation of edge scour in currents. Two kinds of measurements are made (1) Particle Image Velocimetry (PIV) measurements of secondary currents that take place near a junction between the stone cover and the sand bed in a clear......-water experiment; and (2) scour measurements in actual scour experiment in the live-bed regime. The early results indicate that edge scour in a steady current propagating in-line with a stone layer is caused by the combined action of two effects; (1) Primary flow and (2) Secondary flow. The primary flow stirs up...... the sediment and puts into suspension, and the secondary flow carries it away from the junction between the stone layer and the sand bed, resulting in a scour hole forming adjacent to the toe of the stone layer....

  13. GOAT ROCKS WILDERNESS AND ADJACENT ROADLESS AREAS, WASHINGTON.

    Science.gov (United States)

    Church, S.E.; Close, T.J.

    1984-01-01

    The Goat Rocks Wilderness and adjacent roadless areas are a rugged, highly forested, scenic area located on the crest of the Cascade Range in south-central Washington. Several mineral claims have been staked in the area. Mineral surveys were conducted. Geochemical, geophysical, and geologic investigations indicate that three areas have probable mineral-resource potential for base metals in porphyry-type deposits. Available data are not adequate to permit definition of the potential for oil and gas. There is little likelihood for the occurrence of other kinds of energy resources in the area. Evaluation of resource potential in the three areas identified as having probable mineral-resource potential could be improved by more detailed geochemical studies and geologic mapping.

  14. Adjacent segment infection after surgical treatment of spondylodiscitis.

    Science.gov (United States)

    Siam, Ahmed Ezzat; El Saghir, Hesham; Boehm, Heinrich

    2016-03-01

    This is the first case series to describe adjacent segment infection (ASI) after surgical treatment of spondylodiscitis (SD). Patients with SD, spondylitis who were surgically treated between 1994 and 2012 were included. Out of 1187 cases, 23 (1.94 %) returned to our institution (Zentralklinik Bad Berka) with ASI: 10 males, 13 females, with a mean age of 65.1 years and a mean follow-up of 69 months. ASI most commonly involved L3-4 (seven patients), T12-L1 (five) and L2-3 (four). The mean interval between operations of primary infection and ASI was 36.9 months. All cases needed surgical intervention, debridement, reconstruction and fusion with longer instrumentation, with culture and sensitivity-based postoperative antimicrobial therapy. At last follow-up, six patients (26.1 %) were mobilized in a wheelchair with a varying degree of paraplegia (three had pre-existing paralysis). Three patients died within 2 months after the ASI operation (13 %). Excellent outcomes were achieved in five patients, and good in eight. Adjacent segment infection after surgical treatment of spondylodiscitis is a rare complication (1.94 %). It is associated with multimorbidity and shows a high mortality rate and a high neurological affection rate. Possible explanations are: haematomas of repeated micro-fractures around screw loosening, haematogenous spread, direct inoculation or a combination of these factors. ASI may also lead to proximal junctional kyphosis, as found in this series. We suggest early surgical intervention with anterior debridement, reconstruction and fusion with posterior instrumentation, followed by antimicrobial therapy for 12 weeks. Level IV retrospective uncontrolled case series.

  15. Cyclic peptides as potential therapeutic agents for skin disorders.

    Science.gov (United States)

    Namjoshi, Sarika; Benson, Heather A E

    2010-01-01

    There is an increasing understanding of the role of peptides in normal skin function and skin disease. With this knowledge, there is significant interest in the application of peptides as therapeutics in skin disease or as cosmeceuticals to enhance skin appearance. In particular, antimicrobial peptides and those involved in inflammatory processes provide options for the development of new therapeutic directions in chronic skin conditions such as psoriasis and dermatitis. To exploit their potential, it is essential that these peptides are delivered to their site of action in active form and in sufficient quantity to provide the desired effect. Many polymers permeate the skin poorly and are vulnerable to enzymatic degradation. Synthesis of cyclic peptide derivatives can substantially alter the physicochemical characteristics of the peptide with the potential to improve its skin permeation. In addition, cyclization can stabilize the peptide structure and thereby increase its stability. This review describes the role of cyclic peptides in the skin, examples of current cyclic peptide therapeutic products, and the potential for cyclic peptides as dermatological therapeutics and cosmeceuticals.

  16. Morphogenesis and Biomechanics of Engineered Skin Cultured Under Uniaxial Strain.

    Science.gov (United States)

    Blackstone, Britani N; Powell, Heather M

    2012-04-01

    Split-thickness autograft is the standard wound treatment for full-thickness burns. In large burns, sparse availability of uninjured skin prevents rapid closure of the wound, resulting in increased scar tissue formation or mortality. Tissue-engineered skin (ES) offers promise when autografts are not available. ES, constructed from a polymeric scaffold and skin cells, has been shown to reduce donor site area required to permanently close wounds, mortality, and morbidity from scarring but cannot restore all skin functions. Current generations of ES are orders of magnitude weaker than normal human skin, leading to difficulty in surgical application, greater susceptibility to mechanical damage during fabrication and application, and less elasticity and strength once engrafted. Previous studies to improve ES biomechanics focus on altering the scaffolding material, which resulted in modest improvements but often inhibited proper skin development. As the skin is naturally under static strain, adding these mechanical cues to the culture environment is hypothesized to improve ES biomechanics. ES was cultured under applied static strains ranging from 0% to 40% strain for a total of 10 days. Strain magnitudes of 10% and 20% strain resulted in significantly stronger ES than unstrained controls, showed upregulation of many genes encoding structural extracellular matrix proteins, and exhibited increased epidermal cell proliferation and differentiation. Enhanced biomechanical properties of ES can allow for facile surgical application and less damage during dressing changes. These findings suggest that mechanical cues play a significant role in skin development and should be further explored.

  17. Early skin tumor detection from microscopic images through image processing

    International Nuclear Information System (INIS)

    Siddiqi, A.A.; Narejo, G.B.; Khan, A.M.

    2017-01-01

    The research is done to provide appropriate detection technique for skin tumor detection. The work is done by using the image processing toolbox of MATLAB. Skin tumors are unwanted skin growth with different causes and varying extent of malignant cells. It is a syndrome in which skin cells mislay the ability to divide and grow normally. Early detection of tumor is the most important factor affecting the endurance of a patient. Studying the pattern of the skin cells is the fundamental problem in medical image analysis. The study of skin tumor has been of great interest to the researchers. DIP (Digital Image Processing) allows the use of much more complex algorithms for image processing, and hence, can offer both more sophisticated performance at simple task, and the implementation of methods which would be impossibly by analog means. It allows much wider range of algorithms to be applied to the input data and can avoid problems such as build up of noise and signal distortion during processing. The study shows that few works has been done on cellular scale for the images of skin. This research allows few checks for the early detection of skin tumor using microscopic images after testing and observing various algorithms. After analytical evaluation the result has been observed that the proposed checks are time efficient techniques and appropriate for the tumor detection. The algorithm applied provides promising results in lesser time with accuracy. The GUI (Graphical User Interface) that is generated for the algorithm makes the system user friendly. (author)

  18. Comparison of skin responses from macroscopic and microscopic UV challenges

    Science.gov (United States)

    Seo, InSeok; Bargo, Paulo R.; Chu, Melissa; Ruvolo, Eduardo; Kollias, Nikiforos

    2011-03-01

    The minimal erythema dose induced by solar-simulated radiation is a useful measure of UV sensitivity of skin. Most skin phototests have been conducted by projecting a flat field of UV radiation onto the skin in an area greater than 15 cm × 15 cm with an increment of radiation doses. In this study, we investigated the responses of human skin to solar-simulated radiation of different field sizes. Twelve human subjects of skin phototype I-IV were exposed to solar-simulated radiation (SSR) on their upper inner arm or on their lower back with a series of doses in increments of 20% in order to determine the threshold dose to induce a minimal perceptible erythema response (MED). Each dose was delivered with a liquid light guide (8 mm diameter on the back or 6 mm on the upper inner arm) and with quartz optical fibers of 200 μm diameter. The resulting skin responses were evaluated visually and investigated with a reflectance confocal microscope and imaging. The erythema response to the microscopic challenge was always diffuse with no clear boundaries extending to several times the exposed site diameter at doses greater than 2 MED. The skin returned to normal appearance from the microscopic challenge after two weeks of exposure while change in appearance for the larger areas persisted for several weeks to months. This new modality of testing provides the possibility to study skin at the microscopic level with a rapid recovery following challenge.

  19. Skin dosimetry - radiological protection aspects of skin dosimetry

    International Nuclear Information System (INIS)

    Dennis, J.A.

    1991-01-01

    Following a Workshop in Skin Dosimetry, a summary of the radiological protection aspects is given. Aspects discussed include routine skin monitoring and dose limits, the need for careful skin dosimetry in high accidental exposures, techniques for assessing skin dose at all relevant depths and the specification of dose quantities to be measured by personal dosemeters and the appropriate methods to be used in their calibration. (UK)

  20. Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

    Science.gov (United States)

    Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

    2009-05-01

    Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

  1. Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

    Institute of Scientific and Technical Information of China (English)

    WU Yan; LIU Houjun; LI Jiawen

    2007-01-01

    To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

  2. Frog skin function revisited

    DEFF Research Database (Denmark)

    Hviid Larsen, Erik; Ramløv, Hans

    2013-01-01

    of the epidermis. These mechanisms have evolved pari passu with life alternating between aquatic and terrestrial habitats associated with permeabilities of the skin controlled by external ion- and osmotic concentrations (loc. cit.). This allows for fast switching of the cutaneous uptake of chloride between active...

  3. Skin Cut Construction

    DEFF Research Database (Denmark)

    2017-01-01

    of the exhibition is to create a connection between the artistic and technological development through Danish rms and researchers who represent the newest technology in concrete treatment. The rst part exhibition (skin) will focus on the surface treatment of concrete (’graphical concrete’), the second (cut...

  4. Mechanical modeling of skin

    NARCIS (Netherlands)

    Oomens, C.W.J.; Peters, G.W.M.; Kassab, G.S.; Sacks, M.S.

    2016-01-01

    The chapter describes the work that was performed in the soft tissue biomechanics laboratory at Eindhoven University of Technology on the biomechanics of skin. A rationale is given for the changes from standard testing methods to inverse methods, from in vitro to in vivo and back to in vitro testing

  5. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  6. Skin Cancer Trends

    Science.gov (United States)

    ... Children from the Sun? Are There Benefits to Spending Time Outdoors? The Surgeon General’s Call to Action to Prevent Skin Cancer Related Resources Sun Safety Tips for Men Tips for Families Tips for Schools Tips for Employers Tips for ...

  7. Immunity and skin cancer

    International Nuclear Information System (INIS)

    Smith, E.B.; Brysk, M.M.

    1981-01-01

    Observations in humans and animal studies support the theory that immunologic surveillance plays an important role in limiting the development of skin malignancies. These immune responses undergo progressive diminution with age. In addition, other factors, such as bereavement, poor nutrition, and acute and chronic exposure to ultraviolet light, can further diminish immune mechanisms

  8. Examine Your Skin

    Medline Plus

    Full Text Available ... us for One-on-One Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video ... 29498 © 2013 Melanoma International Foundation. All Rights Reserved. Privacy Policy | Terms of Use Toll-free: 866-463- ...

  9. Skin lesion removal

    Science.gov (United States)

    ... likely to be done when there is a concern about a skin cancer. Most often, an area the shape of an ellipse is removed, as this makes it easier to close with stitches. The entire lesion is removed, going as deep as the fat, if needed, to ...

  10. Skin painting studies

    International Nuclear Information System (INIS)

    Witschi, H.P.; Smith, L.H.; Goad, M.E.; Anthony, W.B.; Gipson, L.C.; Stephens, T.J.; Whitaker, M.S.

    1987-01-01

    In order to estimate eventual risks to human health as a consequence of incidental and prolonged skin contact, it is necessary to obtain some information on the potential of coal-derived liquids to elicit skin cancer. In addition, it also must be established whether prolonged dermal exposure will produce signs of toxicity not only on the skin but to internal organs. During the past 2 years, they completed a life-long skin painting study with mice designed to answer some of these questions. The following materials were tested: Raw H-coal blend, containing 5700 ppm N; H-coal blend after low hydrotreatment (2650 ppm N); H-coal blend after high hydrotreatment (0.2 ppm N); H-coal home heating oil, a devolatilized version of the high-hydrotreatment H-coal blend; and an H-coal reformed naphtha. Two petroleum-derived references samples were used: Petroleum No. 2 fuel oil and high catalytically cracked naphtha. Benzo(a)pyrene was used as reference substance. Experimental animals were male and female C3H mice

  11. Light and skin disease

    International Nuclear Information System (INIS)

    Bauer, R.

    1991-01-01

    Because of the depletion of ozone in the stratosphere due to chlorofluorocarbons, the screening effect of this ozone layer on ultraviolet radiation (especially the so-called UV-B component) is reduced. This paper describes the impact of increased UV radiation on the human skin. Because of the 'ozone-hole', a distinct increase in the rate of skin cancer is to be expected which will affect all living beings but most of all man - an indirect consequence of the climate development. What makes the increased intensity of UV-B radiation so harmful is the fact that light-induced skin damage accumulates for the period of the life-time of the individual and cannot be reversed. A further thinning of stratospheric ozone would let through, in addition, the more short-waved ('harder') UV-C radiation. The latter, though clinically not significant currently, would then account for a further increase in the rate of malignant skin disease world-wide. (orig.) [de

  12. Skin peeling syndrome

    Directory of Open Access Journals (Sweden)

    Gharpuray Mohan

    1994-01-01

    Full Text Available We are reporting a case of skin peeling syndrome, a rare disorder in which sudden generalized exfoliation of the stratum corneum occurs. Histopathologically, there was well formed subcorneal pustule filled with polymorphs and nuclear dust, considering this to be a varient of subcorneal pustular dermatosis, we have put the patient on Dapsone.

  13. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, Erfan; Chunmao, Han; Lutgers, Helen L.; Links, Thera P.; Smit, Andries J.; Rakhorst, Gerhard; Graaff, Reindert

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e.g. due to

  14. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, E.; Chunmao, H.; Lutgers, H.L.; Links, T.P.; Smit, A.J.; Rakhorst, G.; de Graaff, R.

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to

  15. A new method for skin color enhancement

    Science.gov (United States)

    Zeng, Huanzhao; Luo, Ronnier

    2012-01-01

    Skin tone is the most important color category in memory colors. Reproducing it pleasingly is an important factor in photographic color reproduction. Moving skin colors toward their preferred skin color center improves the skin color preference on photographic color reproduction. Two key factors to successfully enhance skin colors are: a method to detect original skin colors effectively even if they are shifted far away from the regular skin color region, and a method to morph skin colors toward a preferred skin color region properly without introducing artifacts. A method for skin color enhancement presented by the authors in the same conference last year applies a static skin color model for skin color detection, which may miss to detect skin colors that are far away from regular skin tones. In this paper, a new method using the combination of face detection and statistical skin color modeling is proposed to effectively detect skin pixels and to enhance skin colors more effectively.

  16. On Mathematical Optimization for the Visualization of Frequencies and Adjacencies as Rectangular Maps

    DEFF Research Database (Denmark)

    Carrizosa, Emilio; Guerrero, Vanesa; Morales, Dolores Romero

    2018-01-01

    individuals as adjacent rectangular portions as possible and adding as few false adjacencies, i.e., adjacencies between rectangular portions corresponding to non-adjacent individuals, as possible. We formulate this visualization problem as a Mixed Integer Linear Programming (MILP) model. We propose......In this paper we address the problem of visualizing a frequency distribution and an adjacency relation attached to a set of individuals. We represent this information using a rectangular map, i.e., a subdivision of a rectangle into rectangular portions so that each portion is associated with one...

  17. Candida infection of the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000880.htm Candida infection of the skin To use the sharing features on this page, please enable JavaScript. Candida infection of the skin is a yeast infection ...

  18. Coronal MRI in the diagnosis of corona radiata infarcts adjacent to the lateral ventricles

    Energy Technology Data Exchange (ETDEWEB)

    Iwamoto, Toshihiko; Abe, Shin-e; Kanaya, Kiyoshi; Kubo, Hideki; Takasaki, Masaru (Tokyo Medical Coll. (Japan))

    1992-04-01

    To clarify pathophysiology of vascular lesions in corona radiata infarcts adjacent to the body of the lateral ventricle (CRILV), 17 patients with CRILV were studied by using magnetic resonance (MR) imaging. Based on the coronal MR images obtained between the anterior and posterior commissures, the patients were divided into two groups: (I) the group having infarcts below a line extending from the upper edge of the insular cistern to the external angle of the lateral ventricle adjacent to the corpus callosum (n=11); and (II) the group having lesions above the line towards the centrum semiovale (n=6). Most of the patients in both groups were male and had hypertension. Symptoms were gradually deteriorated and stroke in the morning was frequent in both groups, althrough the time from onset to completion was longer in Group II than Group I. In comparing clinical manifestations in Groups I and II, pure motor hemiparesis was found in 5 and 3 patients, and sensorimotor stroke in 2 and one patients, respectively. Drowsiness was found in 2 for Group I, while aphasia occurred in 2 for Group II. In addition, pseudobular and asymptomatic palsy occurred in each one patient for Group I. Prognosis was favorable in both groups, except for 2 who died of aspiration pneumonia. In Group I, 11 infarcts were well-defined, less than 15 mm in diameter on CT scans and were sclerotic in the main arteries without obstruction on angiograms. In contrast, Group II had ill-defined, larger low-density areas on CT scans and trunk obstruction of the internal carotid or middle cerebral arteries on angiograms. SPECT scans showed diffuse defect in Group II, in contrast to normal to diffuse or multiple defects in Group I. In Group I, lacunar lesions seemed to be caused by ischemia of the perforators, and in Group II, terminal zone infarcts in the territory of the cortical branches or watershed infarcts seemd to be caused by main trunk obstruction. (N.K.).

  19. A novel biomimetic orthodontic bonding agent helps prevent white spot lesions adjacent to brackets.

    Science.gov (United States)

    Manfred, Lauren; Covell, David A; Crowe, Jennifer J; Tufekci, Eser; Mitchell, John C

    2013-01-01

    To compare changes in enamel microhardness adjacent to orthodontic brackets after using bonding agents containing various compositions of bioactive glass compared to a traditional resin adhesive following a simulated caries challenge. Extracted human third molars (n  =  10 per group) had orthodontic brackets bonded using one of four novel bioactive glass (BAG)-containing orthodontic bonding agents (BAG-Bonds) or commercially available Transbond-XT. The four new adhesives contained BAG in varying percentages incorporated into a traditional resin monomer mixture. Teeth were cycled through low-pH demineralizing and physiologic-pH remineralizing solutions once each day over 14 days. Microhardness was measured on longitudinal sections of the teeth 100, 200, and 300 µm from the bracket edge and beneath the brackets, at depths of 25 to 200 µm from the enamel surface. Normalized hardness values were compared using three-way analysis of variance. Significantly less reduction in enamel microhardness was found with the experimental adhesives at depths of 25 and 50 µm at all distances from the bracket edge. In all groups, there were no significant changes in enamel microhardness past 125-µm depth. Results varied with the different BAG-Bonds, with 81BAG-Bond showing the smallest decrease in enamel microhardness. The BAG-Bonds tested in this study showed a reduction in the amount of superficial enamel softening surrounding orthodontic brackets compared to a traditional bonding agent. The results indicate that clinically, BAG-Bonds may aid in maintaining enamel surface hardness, therefore helping prevent white spot lesions adjacent to orthodontic brackets.

  20. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  1. Laser-induced fluorescence for the detection of esophageal and skin cancer

    Science.gov (United States)

    Vo-Dinh, Tuan; Panjehpour, Masoud; Overholt, Bergein F.; Julius, Clark E.; Overholt, Suzanne; Phan, Mary N.

    2003-07-01

    Laser-induced fluorescence (LIF) is used for in-vivo cancer diagnosis of the esophagus and skin cancer. For esophageal measurements a fiberoptic probe inserted through an endoscope was used. Autofluorescence of normal and malignant tissues were measured directly on patient skin without requiring an endoscope. Measurement of the fluorescence signal from the tissue was performed using laser excitation at 410 nm. The methodology was applied to differentiate normal and malignant tumors of the esophagus and malignant skin lesions. The results of this LIF approach were compared with histopathology results of the biopsy samples and indicated excellent agreement in the classification of normal and malignant tumors for the samples investigated.

  2. Folate in Skin Cancer Prevention

    OpenAIRE

    Williams, J.D.; Jacobson, Elaine L.; Kim, H.; Kim, M.; Jacobson, M.K.

    2012-01-01

    Skin, the largest, most exposed organ of the body, provides a protective interface between humans and the environment. One of its primary roles is protection against exposure to sunlight, a major source of skin damage where the UV radiation (UVR) component functions as a complete carcinogen. Melanin pigmentation and the evolution of dark skin is an adaptive protective mechanism against high levels of UVR exposure. Recently, the hypothesis that skin pigmentation balances folate preservation an...

  3. Methodology for the systematic reviews on an adjacent segment pathology.

    Science.gov (United States)

    Norvell, Daniel C; Dettori, Joseph R; Skelly, Andrea C; Riew, K Daniel; Chapman, Jens R; Anderson, Paul A

    2012-10-15

    A systematic review. To provide a detailed description of the methods undertaken in the systematic search and analytical summary of adjacent segment pathology (ASP) issues and to describe the process used to develop consensus statements and clinical recommendations regarding factors associated with the prevention and treatment of ASP. We present methods used in conducting the systematic, evidence-based reviews and development of expert panel consensus statements and clinical recommendations on the classification, natural history, risk factors, and treatment of radiographical and clinical ASP. Our intent is that clinicians will combine the information from these reviews with an understanding of their own capacities and experience to better manage patients at risk of ASP and consider future research for the prevention and treatment of ASP. A systematic search and critical review of the English-language literature was undertaken for articles published on the classification, risk, risk factors, and treatment of radiographical and clinical ASP. Articles were screened for relevance using a priori criteria, and relevant articles were critically reviewed. Whether an article was included for review depended on whether the study question was descriptive, one of therapy, or one of prognosis. The strength of evidence for the overall body of literature in each topic area was determined by 2 independent reviewers considering risk of bias, consistency, directness, and precision of results using a modification of the Grades of Recommendation Assessment, Development and Evaluation (GRADE) criteria. Disagreements were resolved by consensus. Findings from articles meeting inclusion criteria were summarized. From these summaries, consensus statements or clinical recommendations were formulated among subject experts through a modified Delphi process using the GRADE approach. A total of 3382 articles were identified and screened on 14 topics relating to the classification, risks, risk

  4. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  5. Maintaining Healthy Skin -- Part 2

    Science.gov (United States)

    ... and SCI • Depression and SCI • Taking Care of Pressure Sores • Maintaining Healthy Skin (Part I) • Maintaining Healthy Skin ( ... For information on establishing skin tolerance, see our “Pressure Sores” pamphlet.) Pressure releases in a wheelchair can be ...

  6. Maintaining Healthy Skin -- Part 1

    Science.gov (United States)

    ... with no breaks in the surface. It is warm (not hot or red) and neither dry and flaky nor moist and wrinkled. Healthy skin is a mirror of a healthy body. How to take care of your skin NUTRITION: To keep your skin healthy, eat a well- ...

  7. Skin Cancers of the Feet

    Science.gov (United States)

    ... Foot Health Awareness Month Diabetes Awareness What Are Skin Cancers of the Feet? Skin cancer can develop anywhere on the body, including ... cell carcinoma is the most common form of cancer on the skin of the feet. Most types of early squamous ...

  8. Elevation of telomerase activity in chronic radiation ulcer of human skin

    International Nuclear Information System (INIS)

    Li Xiaoying; Zhao Po; Wang Dewen; Yang Zhixiang

    1997-01-01

    Objective: To investigate the levels of telomerase activity in chronic radiation ulcers of human skin and the possible relationship between the enzyme and cancer transformation. Method: Using nonisotopic telomere repeat amplification protocol (TRAP), detections were performed in 20 cases of chronic radiation ulcers of human skin, 5 cases of normal skin tissues and 5 cases of carcinoma. Results: The positive rates for telomerase activity were 30.0%(6/20), 0(0/5) and 100%(5/5) in chronic radiation ulcers of human skin, normal skin and carcinoma, respectively. The telomerase activity in radiation ulcer was weaker than in carcinoma. Conclusion: The telomerase activity assay might be used as a marker for predicting the prognosis and the effect of treatment in chronic radiation ulcer of human skin

  9. The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis

    Directory of Open Access Journals (Sweden)

    Cormac W. Joyce, MB BCh

    2014-12-01

    Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.

  10. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

  11. Skin Cancer: Biology, Risk Factors & Treatment

    Science.gov (United States)

    ... turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer 2013 Table ... Articles Skin Cancer Can Strike Anyone / Skin Cancer: Biology, Risk Factors & Treatment / Timely Healthcare Checkup Catches Melanoma ...

  12. Behavioral Counseling to Prevent Skin Cancer

    Science.gov (United States)

    ... it might mean for you. What is skin cancer? Skin cancer is cancer that occurs in different kinds ... squamous cell carcinoma, and melanoma. Facts About Skin Cancer Skin cancer is the most common type of cancer ...

  13. Genetics Home Reference: acral peeling skin syndrome

    Science.gov (United States)

    ... Home Health Conditions Acral peeling skin syndrome Acral peeling skin syndrome Printable PDF Open All Close All ... to view the expand/collapse boxes. Description Acral peeling skin syndrome is a skin disorder characterized by ...

  14. Elemental composition of skin tissue by PIXE and INAA analyses

    International Nuclear Information System (INIS)

    Hollands, R.; Spyrou, N.M.

    1997-01-01

    Hypertrophic scars are a particular type of scar that can form after any type of dermal injury. They are unsightly, red, elevated above normal skin level, itchy and painful. At present no-one knows why these scars form. Due to the differences between scar tissue and normal skin it was decided to analyse skin tissue which at a later date would be compared to scar tissue. Spit skin graft (epidermis) samples as well as full thickness skin (epidermis to dermis) tissue were analysed using PIXE and RBS with a 2 MeV proton beam. The epidermis was compared to the dermis to see if there were any variations between the two. In all the samples P, S, Cl, K, Ca, Fe, and Cd were detected and in a majority of the samples Zn and Ba were found, using PIXE. It was found that, between the epidermis and dermis, there was an significant increase in P in the epidermis in both full thickness and split skin graft samples. Complementary elemental analysis was also performed using neutron activation, and Br, Na and Zn were detected. (author)

  15. Baby Poop: What's Normal?

    Science.gov (United States)

    ... I'm breast-feeding my newborn and her bowel movements are yellow and mushy. Is this normal for baby poop? Answers from Jay L. Hoecker, M.D. Yellow, mushy bowel movements are perfectly normal for breast-fed babies. Still, ...

  16. Characterization of adjacent breast tumors using oligonucleotide microarrays

    International Nuclear Information System (INIS)

    Unger, Meredith A; Rishi, Mazhar; Clemmer, Virginia B; Hartman, Jennifer L; Keiper, Elizabeth A; Greshock, Joel D; Chodosh, Lewis A; Liebman, Michael N; Weber, Barbara L

    2001-01-01

    Current methodology often cannot distinguish second primary breast cancers from multifocal disease, a potentially important distinction for clinical management. In the present study we evaluated the use of oligonucleotide-based microarray analysis in determining the clonality of tumors by comparing gene expression profiles. Total RNA was extracted from two tumors with no apparent physical connection that were located in the right breast of an 87-year-old woman diagnosed with invasive ductal carcinoma (IDC). The RNA was hybridized to the Affymetrix Human Genome U95A Gene Chip ® (12,500 known human genes) and analyzed using the Gene Chip Analysis Suite ® 3.3 (Affymetrix, Inc, Santa Clara, CA, USA) and JMPIN ® 3.2.6 (SAS Institute, Inc, Cary, NC, USA). Gene expression profiles of tumors from five additional patients were compared in order to evaluate the heterogeneity in gene expression between tumors with similar clinical characteristics. The adjacent breast tumors had a pairwise correlation coefficient of 0.987, and were essentially indistinguishable by microarray analysis. Analysis of gene expression profiles from different individuals, however, generated a pairwise correlation coefficient of 0.710. Transcriptional profiling may be a useful diagnostic tool for determining tumor clonality and heterogeneity, and may ultimately impact on therapeutic decision making

  17. A deterministic seismic hazard map of India and adjacent areas

    International Nuclear Information System (INIS)

    Parvez, Imtiyaz A.; Vaccari, Franco; Panza, Giuliano

    2001-09-01

    A seismic hazard map of the territory of India and adjacent areas has been prepared using a deterministic approach based on the computation of synthetic seismograms complete of all main phases. The input data set consists of structural models, seismogenic zones, focal mechanisms and earthquake catalogue. The synthetic seismograms have been generated by the modal summation technique. The seismic hazard, expressed in terms of maximum displacement (DMAX), maximum velocity (VMAX), and design ground acceleration (DGA), has been extracted from the synthetic signals and mapped on a regular grid of 0.2 deg. x 0.2 deg. over the studied territory. The estimated values of the peak ground acceleration are compared with the observed data available for the Himalayan region and found in good agreement. Many parts of the Himalayan region have the DGA values exceeding 0.6 g. The epicentral areas of the great Assam earthquakes of 1897 and 1950 represent the maximum hazard with DGA values reaching 1.2-1.3 g. (author)

  18. Earthquake response of adjacent structures with viscoelastic and friction dampers

    Directory of Open Access Journals (Sweden)

    Žigić Miodrag

    2015-01-01

    Full Text Available We study the seismic response of two adjacent structures connected with a dry friction damper. Each of them consists of a viscoelastic rod and a rigid block, which can slide without friction along the moving base. A simplified earthquake model is used for modeling the horizontal ground motion. Energy dissipation is taken by the presence of the friction damper, which is modeled by the set-valued Coulomb friction law. Deformation of viscoelastic rods during the relative motion of the blocks represents another way of energy dissipation. The constitutive equation of a viscoelastic body is described by the fractional Zener model, which includes fractional derivatives of stress and strain. The problem merges fractional derivatives as non-local operators and theory of set-valued functions as the non-smooth ones. Dynamical behaviour of the problem is governed by a pair of coupled multi-valued differential equations. The posed Cauchy problem is solved by use of the Grünwald-Letnikov numerical scheme. The behaviour of the system is analyzed for different values of system parameters.

  19. Repeated adjacent-segment degeneration after posterior lumbar interbody fusion.

    Science.gov (United States)

    Okuda, Shinya; Oda, Takenori; Yamasaki, Ryoji; Maeno, Takafumi; Iwasaki, Motoki

    2014-05-01

    One of the most important sequelae affecting long-term results is adjacent-segment degeneration (ASD) after posterior lumbar interbody fusion (PLIF). Although several reports have described the incidence rate, there have been no reports of repeated ASD. The purpose of this report was to describe 1 case of repeated ASD after PLIF. A 62-year-old woman with L-4 degenerative spondylolisthesis underwent PLIF at L4-5. At the second operation, L3-4 PLIF was performed for L-3 degenerative spondylolisthesis 6 years after the primary operation. At the third operation, L2-3 PLIF was performed for L-2 degenerative spondylolisthesis 1.5 years after the primary operation. Vertebral collapse of L-1 was detected 1 year after the third operation, and the collapse had progressed. At the fourth operation, 3 years after the third operation, vertebral column resection of L-1 and replacement of titanium mesh cages with pedicle screw fixation between T-4 and L-5 was performed. Although the patient's symptoms resolved after each operation, the time between surgeries shortened. The sacral slope decreased gradually although each PLIF achieved local lordosis at the fused segment.

  20. DNA sequence responsible for the amplification of adjacent genes.

    Science.gov (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  1. Modern sedimentary processes along the Doce river adjacent continental shelf

    Directory of Open Access Journals (Sweden)

    Valéria da Silva Quaresma

    Full Text Available In areas of the continental shelf where sediment supply is greater than the sediment dispersion capacity, an extensive terrigenous deposits and consequently submerged deltas can be formed. The Eastern Brazilian shelf is characterized by the occurrence of river feed deltas in between starving coasts. Herein, modern sedimentary processes acting along the Doce river adjacent continental shelf are investigated. The main objective was to understand the shelf sediment distribution, recognizing distinct sedimentary patterns and the major influence of river sediment discharge in the formation of shelf deposits. The study used 98 surficial samples that were analyzed for grain size, composition and bulk density. Results revealed 3 distinct sectors: south - dominated by mud fraction with a recent deposition from riverine input until 30 m deep and from this depth bioclastic sands dominate; central north - sand mud dominated, been recognized as a bypass zone of resuspended sediment during high energy events; and north - relict sands with high carbonate content. The modern sedimentation processes along the Doce river continental shelf is dominated by distinct sedimentary regimes, showing a strong fluvial influence associated with wave/wind induced sediment dispersion and a carbonate regime along the outer shelf. These regimes seem to be controlled by the distance from the river mouth and bathymetric gradients.

  2. Oligocene paleogeography of the northern Great Plains and adjacent mountains

    International Nuclear Information System (INIS)

    Seeland, D.

    1985-01-01

    Early Oligocene paleogeography of the northern Great Plains and adjacent mountains is inferred in part from published surface and subsurface studies of the pre-Oligocene surface. These studies are combined with published and unpublished information on clast provenance, crossbedding orientation, and Eocene paleogeography. The Oligocene Arctic Ocean-Gulf of Mexico continental divide extended from the southern Absaroka Mountains east along the Owl Creek Mountains, across the southern Powder River Basin, through the northern Black Hills, and eastward across South Dakota. Streams north of the divide flowed northeastward. The Olligocene White River Group contains 50 to 90 percent airfall pyroclastic debris from a northern Great Basin source. Most of the uranium deposits of the region in pre-Oligocene rocks can be related to a uranium source in the volcanic ash of the White River; in many places the pre-Oligocene deposits can be related to specific Oligocene channels. Uranium deposits in sandstones of major Oligocene rivers are an important new type of deposit. The Oligocene channel sandstones also contain small quantities of gold, molybdenum, gas, and oil

  3. Mechanical interactions between adjacent airways in the lung.

    Science.gov (United States)

    Ma, Baoshun; Bates, Jason H T

    2014-03-15

    The forces of mechanical interdependence between the airways and the parenchyma in the lung are powerful modulators of airways responsiveness. Little is known, however, about the extent to which adjacent airways affect each other's ability to narrow due to distortional forces generated within the intervening parenchyma. We developed a two-dimensional computational model of two airways embedded in parenchyma. The parenchyma itself was modeled in three ways: 1) as a network of hexagonally arranged springs, 2) as a network of triangularly arranged springs, and 3) as an elastic continuum. In all cases, we determined how the narrowing of one airway was affected when the other airway was relaxed vs. when it narrowed to the same extent as the first airway. For the continuum and triangular network models, interactions between airways were negligible unless the airways lay within about two relaxed diameters of each other, but even at this distance the interactions were small. By contrast, the hexagonal spring network model predicted that airway-airway interactions mediated by the parenchyma can be substantial for any degree of airway separation at intermediate values of airway contraction forces. Evidence to date suggests that the parenchyma may be better represented by the continuum model, which suggests that the parenchyma does not mediate significant interactions between narrowing airways.

  4. Cryogun cryotherapy for oral leukoplakia and adjacent melanosis lesions.

    Science.gov (United States)

    Chen, Hsin-Ming; Cheng, Shih-Jung; Lin, Hung-Pin; Yu, Chuan-Hang; Wu, Yang-Che; Chiang, Chun-Pin

    2015-09-01

    Our previous study has shown that cryogun cryotherapy is a good and effective treatment modality for oral leukoplakia. In this study, we used cryogun cryotherapy to treat 72 oral leukoplakia and adjacent smoking-induced melanosis (OLM) lesions on the buccal mucosae. Of 72 OLM lesions, 14 had epithelial hyperplasia with parakeratosis, 24 had epithelial hyperplasia with hyperkeratosis, 26 had mild dysplasia, seven had moderate dysplasia, and one had severe dysplasia. Complete regression was achieved in all 72 OLM lesions after a mean of 3.3 ± 1.3 cryogun cryotherapy treatments. We found that OLM lesions in patients without smoking habit, with the greatest diameter cryotherapy treatment to achieve complete regression than those OLM lesions in patients with smoking habit, with the greatest diameter ≥ 2.8 cm, without epithelial dysplasia, or with a surface keratin thickness > 50 μm (all P-values cryotherapy treatment number (all P-values cryotherapy treatment required to achieve complete regression of the OLM lesion by multivariate logistic regression analyses. Cryogun cryotherapy is an effective treatment modality for OLM lesions. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Flow and edge scour in current adjacent to stone covers

    DEFF Research Database (Denmark)

    Petersen, Thor U.; Sumer, B. Mutlu; Bøgelund, Jon

    2015-01-01

    This paper presents the results of an experimental investigation on edge scour adjacent to a stone cover laid on a sandy bed. The three-dimensional flow over the edge of the stone layer has been investigated by the use of particle image velocimetry. The flow measurements show a significant amount...... of turbulence in the primary flow near the junction between the stone layer and the sand bed and the formation of complex secondary-flow structures. The results show that the flow and the edge scour process in a steady current are governed by the size of the roughness elements and to some extent the side slope...... of the berm. The edge scour is caused by the combined action of the primary flow and the secondary flow. The primary flow stirs up the sediment and puts it into suspension, and the secondary flow carries it away from the junction between the stone layer and the sand bed, resulting in a scour hole forming...

  6. Review of vibration effect during piling installation to adjacent structure

    Science.gov (United States)

    Rahman, Nurul Aishah Abd; Musir, Adhilla Ainun; Dahalan, Nurol Huda; Ghani, Abdul Naser Abdul; Khalil, Muhamad Kasimi Abd

    2017-12-01

    Basically, many major structures across the world such as towers, high rise building, houses and bridges utilize pile as a support material. The use of pile is important to strengthen the structures. However, this has led to another problem to the nearest surrounding structures resulted from pile driving. As part of a construction work, unavoidable pile driving activity generates a vibration towards the surrounding structures if uncontrolled may cause damage to the adjacent structure. As the current construction works are frequently located in urban areas where the distance between the nearest building structures is not far, vibration may cause damage to nearby structures. Knowing which part of the building that is mostly affected by various vibration patterns from the impact of pile driving is crucial. Thus, it is very important to predict the impact of vibration during piling installation work. This paper reviews the vibrations generated by piling activity toward surrounding structures in terms sources of vibration, impact of piling installation, pile-soil interaction, and factors affecting the vibration impact of building as well as to study the parameters involved in vibration generation during piling works.

  7. Concentric network symmetry grasps authors' styles in word adjacency networks

    Science.gov (United States)

    Amancio, Diego R.; Silva, Filipi N.; Costa, Luciano da F.

    2015-06-01

    Several characteristics of written texts have been inferred from statistical analysis derived from networked models. Even though many network measurements have been adapted to study textual properties at several levels of complexity, some textual aspects have been disregarded. In this paper, we study the symmetry of word adjacency networks, a well-known representation of text as a graph. A statistical analysis of the symmetry distribution performed in several novels showed that most of the words do not display symmetric patterns of connectivity. More specifically, the merged symmetry displayed a distribution similar to the ubiquitous power-law distribution. Our experiments also revealed that the studied metrics do not correlate with other traditional network measurements, such as the degree or the betweenness centrality. The discriminability power of the symmetry measurements was verified in the authorship attribution task. Interestingly, we found that specific authors prefer particular types of symmetric motifs. As a consequence, the authorship of books could be accurately identified in 82.5% of the cases, in a dataset comprising books written by 8 authors. Because the proposed measurements for text analysis are complementary to the traditional approach, they can be used to improve the characterization of text networks, which might be useful for applications based on stylistic classification.

  8. Visual Memories Bypass Normalization.

    Science.gov (United States)

    Bloem, Ilona M; Watanabe, Yurika L; Kibbe, Melissa M; Ling, Sam

    2018-05-01

    How distinct are visual memory representations from visual perception? Although evidence suggests that briefly remembered stimuli are represented within early visual cortices, the degree to which these memory traces resemble true visual representations remains something of a mystery. Here, we tested whether both visual memory and perception succumb to a seemingly ubiquitous neural computation: normalization. Observers were asked to remember the contrast of visual stimuli, which were pitted against each other to promote normalization either in perception or in visual memory. Our results revealed robust normalization between visual representations in perception, yet no signature of normalization occurring between working memory stores-neither between representations in memory nor between memory representations and visual inputs. These results provide unique insight into the nature of visual memory representations, illustrating that visual memory representations follow a different set of computational rules, bypassing normalization, a canonical visual computation.

  9. Skin contamination dosimeter

    Science.gov (United States)

    Hamby, David M [Corvallis, OR; Farsoni, Abdollah T [Corvallis, OR; Cazalas, Edward [Corvallis, OR

    2011-06-21

    A technique and device provides absolute skin dosimetry in real time at multiple tissue depths simultaneously. The device uses a phoswich detector which has multiple scintillators embedded at different depths within a non-scintillating material. A digital pulse processor connected to the phoswich detector measures a differential distribution (dN/dH) of count rate N as function of pulse height H for signals from each of the multiple scintillators. A digital processor computes in real time from the differential count-rate distribution for each of multiple scintillators an estimate of an ionizing radiation dose delivered to each of multiple depths of skin tissue corresponding to the multiple scintillators embedded at multiple corresponding depths within the non-scintillating material.

  10. Ablative skin resurfacing.

    Science.gov (United States)

    Agrawal, Nidhi; Smith, Greg; Heffelfinger, Ryan

    2014-02-01

    Ablative laser resurfacing has evolved as a safe and effective treatment for skin rejuvenation. Although traditional lasers were associated with significant thermal damage and lengthy recovery, advances in laser technology have improved safety profiles and reduced social downtime. CO2 lasers remain the gold standard of treatment, and fractional ablative devices capable of achieving remarkable clinical improvement with fewer side effects and shorter recovery times have made it a more practical option for patients. Although ablative resurfacing has become safer, careful patient selection and choice of suitable laser parameters are essential to minimize complications and optimize outcomes. This article describes the current modalities used in ablative laser skin resurfacing and examines their efficacy, indications, and possible side effects. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  11. Subjective facial skin type, based on the sebum related symptoms, can reflect the objective casual sebum level in acne patients.

    Science.gov (United States)

    Choi, C W; Choi, J W; Youn, S W

    2013-05-01

    The relationship between the subjective skin type and the casual sebum level was not fully clarified. To investigate the characteristics of subjective skin type and to find the relationship between the subjective skin types and the skin type-related symptoms, casual sebum level, along with the objective skin type. Seven hundred and nine patients, clinically diagnosed with acne, were included. The questionnaire and the casual sebum level measurement were performed. The determining symptoms of each subjective skin type were investigated. The 95% confidence interval of casual sebum level of each subjective skin type was calculated. The most frequent subjective skin type was the combination type. The dryness, tightness, and oiliness can be conclusive symptoms in determining the subjective skin type. The mean and the 95% confidence interval of the casual sebum level was highest in the oily skin type, followed by the combination, normal, and dry skin type. We found that the subjective skin type was determined by the skin type-related symptoms. The 95% confidence intervals of the casual sebum level of each subjective skin type were established. Based on the skin type-related symptoms, the casual sebum level of acne patients can be estimated. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  12. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

  13. Relationship between screw sagittal angle and stress on endplate of adjacent segments after anterior cervical corpectomy and fusion with internal fixation: a Chinese finite element study.

    Science.gov (United States)

    Zhang, Yu; Tang, Yibo; Shen, Hongxing

    2017-12-01

    In order to reduce the incidence of adjacent segment disease (ASD), the current study was designed to establish Chinese finite element models of normal 3rd~7th cervical vertebrae (C3-C7) and anterior cervical corpectomy and fusion (ACCF) with internal fixation , and analyze the influence of screw sagittal angle (SSA) on stress on endplate of adjacent cervical segments. Mimics 8.1 and Abaqus/CAE 6.10 softwares were adopted to establish finite element models. For C4 superior endplate and C6 inferior endplate, their anterior areas had the maximum stress in anteflexion position, and their posterior areas had the maximum stress in posterior extension position. As SSA increased, the stress reduced. With an increase of 10° in SSA, the stress on anterior areas of C4 superior endplate and C6 inferior endplate reduced by 12.67% and 7.99% in anteflexion position, respectively. With an increase of 10° in SSA, the stress on posterior areas of C4 superior endplate and C6 inferior endplate reduced by 9.68% and 10.22% in posterior extension position, respectively. The current study established Chinese finite element models of normal C3-C7 and ACCF with internal fixation , and demonstrated that as SSA increased, the stress on endplate of adjacent cervical segments decreased. In clinical surgery, increased SSA is able to play important role in protecting the adjacent cervical segments and reducing the incidence of ASD.

  14. Vibroacoustic Skin Diagnostics Modeling

    Directory of Open Access Journals (Sweden)

    Svetlana М. Yatsun

    2013-01-01

    Full Text Available The article deals with the mathematical modeling of biological diagnosis of complex heterogeneous structure (skin, using non-destructive control method. The mathematical model, describing interaction of the material with electrodynamic vibration generator and sensor system, controlling the propagation of small disturbances was developed. The influence of material model parameters on the spectrum in the course of the propagation of the surface disturbance

  15. Skin barrier composition

    International Nuclear Information System (INIS)

    Osburn, F.G.

    1985-01-01

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)

  16. Skin barrier composition

    Energy Technology Data Exchange (ETDEWEB)

    Osburn, F G

    1985-06-12

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.

  17. SKIN RADIATION IN PANORAMIC

    Directory of Open Access Journals (Sweden)

    Herry Irawan

    2015-06-01

    Full Text Available Dental panoramic radiograph in Indonesia has been widely used. Modern diagnostic imaging equipment with minimum radiation is still very limited. One of the conditions in nuclear safety law, UU 10/1997, is an optimization of all radiation sources with DRL through skin dose measurements. In Indonesia, the national DRL has not been established yet, and there were no reports on the study of panoramic skin dose in Indonesia. The aim of this preliminary study was to obtain a panoramic skin dose radiation as reference to establish DRL in Indonesia. Panoramic radiographs of sixteen female and fifteen male patients, aged 4 – 48 years, were taken using the standard conventional method, with TLD chips attached in location groups. The chips were then read with the detector and integrator of BATAN, in high and low temperature condition at the same time. It was revealed that behind the right and left ear were the regions with the highest radiation dose received, followed by the back of the neck, left jaw, right jaw, and chin. The result of this study has shown the importance of DRL in Indonesia since the use of modern diagnostic imaging equipement that limits radiation dose to the minimum level is still very limited.

  18. Superficial skin ulcers

    International Nuclear Information System (INIS)

    Samaila, Modupeola O.; Rafindadi, Abdulmumini H.; Oluwole, Olabode P.; Adewuyi, Sunday A.

    2007-01-01

    Objective was to determine the underlying cause of superficial skin ulcers over a 15-year period. A retrospective histopathological analysis of 670 cases of superficial skin ulcers diagnosed in the Dept. of Pathology, Ahmadu Bello University Teaching Hospital, Zaria, Nigeria from January 1991 to December 2005. A total of 670 superficial skin ulcers were analyzed. The mail to female gender ratio was 409:261(1.5:1.0) and a peakage frequency of 44.3 %( 297) in the 5th and 6th decades. Spectrum of lesions encountered was categorized into inflammatory, infections, benign and malignant diseases. The malignant lesions were 309 (46.1%), non-specific inflammation 302 (45.1%), granulation tissue 25 (3.7%) and pseudoepitheliomatous hyperplasia 14 (2.1%). A total of 18(2.7%) specific infections were encountered, which included bacterial, fungal and viral infection. Benign lesions were 2(0.3%), comprising of neurofibroma and Bowen's disease. The most common malignant lesion was squamous cell carcinoma 203 (30.3%) with a male to female ratio of 128:75 (1.7:1.0). Of these 161 were well differentiated tumors. The lower limb was the prevalent site distribution of all the ulcers. Superficial ulcers may be harbinger of malignant diseases. Squamous cell carcinoma remains the most common malignant lesion arising from chronic superficial ulcers from our setting. Adequate tissue biopsy and early diagnosis may reduce the attendant morbidity of these ulcers. (author)

  19. Plasma skin regeneration technology.

    Science.gov (United States)

    Bogle, M A

    2006-09-01

    Plasma skin regeneration (PSR) technology uses energy delivered from plasma rather than light or radiofrequency. Plasma is the fourth state of matter in which electrons are stripped from atoms to form an ionized gas. The plasma is emitted in a millisecond pulse to deliver energy to target tissue upon contact without reliance on skin chromophores. The technology can be used at varying energies for different depths of effect, from superficial epidermal sloughing to deeper dermal heating. With the Portrait PSR device (Rhytec, Inc.) there are three treatment guidelines termed PSR1, PSR2, and PSR3. The PSR1 protocol uses a series of low-energy treatments (1.0,1.2 Joules) spaced 3 weeks apart. The PSR2 protocol uses one high-energy pass (3.0, 4.0 Joules) performed in a single treatment, and the PSR3 protocol uses two high-energy passes (3.0 4.0 Joules) performed in a single treatment. All protocols improve fine lines, textural irregularities, and dyspigmentation; however, skin tightening is probably more pronounced with the high-energy treatments.

  20. Making nuclear 'normal'

    International Nuclear Information System (INIS)

    Haehlen, Peter; Elmiger, Bruno

    2000-01-01

    The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

  1. [The application of delayed skin grafting combined traction in severe joint cicatricial contracture].

    Science.gov (United States)

    Xu, Zihan; Zhang, Zhenxin; Wang, Benfeng; Sun, Yaowen; Guo, Yadong; Gao, Wenjie; Qin, Gaoping

    2014-11-01

    To investigate the effect of delayed skin grafting combined traction in severe joint cicatricial contracture. At the first stage, the joint cicatricial contracture was released completely with protection of vessels, nerves and tendons. The wound was covered with allogenetic skin or biomaterials. After skin traction for 7-14 days, the joint could reach the extension position. Then the skin graft was performed on the wound. 25 cases were treated from Mar. 2000 to May. 2013. Primary healing was achieved at the second stage in all the cases. The skin graft had a satisfactory color and elasticity. Joint function was normal. All the patients were followed up for 3 months to 11 years with no hypertrophic scar and contraction relapse, except for one case who didn' t have enough active exercise on shoulder joint. Delayed skin grafting combined traction can effectively increase the skin graft survival rate and improve the joint function recovery.

  2. Further search for selectivity of positron annihilation in the skin and cancerous systems

    International Nuclear Information System (INIS)

    Liu Guang; Chen Hongmin; Chakka, Lakshmi; Cheng Meiling; Gadzia, Joseph E.; Suzuki, R.; Ohdaira, T.; Oshima, N.; Jean, Y.C.

    2008-01-01

    Positronium annihilation lifetime (PAL) spectroscopy and Doppler broadening energy spectra (DBES) have been used to search for selectivity and sensitivity for cancerous skin samples with and without cancer. This study is to further explore the melanoma cancerous system and other different types of skin samples. We found that the S parameter in melanoma skin samples cut at 0.39 mm depth from the same patient's skin is smaller than near the skin surface. However in 10 melanoma samples from different patients, the S parameters vary significantly. Similarly, among 10 normal skin samples without cancer, the S parameters also vary largely among different patients. To understand the sensitivity of PAS as a tool to detect cancer formation at the early stage, we propose a controlled and systematic study of in vivo experiments using UV-induced cancer skin from living animals

  3. An investigation into the management of acute skin reactions from tangential breast irradiation

    International Nuclear Information System (INIS)

    Meegan, M.A.; Haycocks, T.R.

    1997-01-01

    This research examined the acute skin reaction of two consecutive groups receiving tangetial breast irradiation for carcinoma of the breast. The first group used the traditional skin care advice of using warm water only within the treatment area, while the second group continued with their normal skin care regime. Data was collected on the physical manifestations of the acute reaction, medical history, the use of concurrent cytotoxic agents, treatment parameters and skin care products used. Statistical analysis using the T-test method showed no difference in the skin reaction between the two groups. The investigation has lead to a change of policy in the management of acute breast reactions. Patients receiving radiation therapy to the breast or chest wall can now use their routine skin care products with no adverse effect on skin reactions. (author)

  4. A systematic review of definitions and classification systems of adjacent segment pathology.

    Science.gov (United States)

    Kraemer, Paul; Fehlings, Michael G; Hashimoto, Robin; Lee, Michael J; Anderson, Paul A; Chapman, Jens R; Raich, Annie; Norvell, Daniel C

    2012-10-15

    Systematic review. To undertake a systematic review to determine how "adjacent segment degeneration," "adjacent segment disease," or clinical pathological processes that serve as surrogates for adjacent segment pathology are classified and defined in the peer-reviewed literature. Adjacent segment degeneration and adjacent segment disease are terms referring to degenerative changes known to occur after reconstructive spine surgery, most commonly at an immediately adjacent functional spinal unit. These can include disc degeneration, instability, spinal stenosis, facet degeneration, and deformity. The true incidence and clinical impact of degenerative changes at the adjacent segment is unclear because there is lack of a universally accepted classification system that rigorously addresses clinical and radiological issues. A systematic review of the English language literature was undertaken and articles were classified using the Grades of Recommendation Assessment, Development, and Evaluation criteria. RESULTS.: Seven classification systems of spinal degeneration, including degeneration at the adjacent segment, were identified. None have been evaluated for reliability or validity specific to patients with degeneration at the adjacent segment. The ways in which terms related to adjacent segment "degeneration" or "disease" are defined in the peer-reviewed literature are highly variable. On the basis of the systematic review presented in this article, no formal classification system for either cervical or thoracolumbar adjacent segment disorders currently exists. No recommendations regarding the use of current classification of degeneration at any segments can be made based on the available literature. A new comprehensive definition for adjacent segment pathology (ASP, the now preferred terminology) has been proposed in this Focus Issue, which reflects the diverse pathology observed at functional spinal units adjacent to previous spinal reconstruction and balances

  5. Photothermal Radiometry for Skin Research

    Directory of Open Access Journals (Sweden)

    Perry Xiao

    2016-02-01

    Full Text Available Photothermal radiometry is an infrared remote sensing technique that has been used for skin and skin appendages research, in the areas of skin hydration, hydration gradient, skin hydration depth profiling, skin thickness measurements, skin pigmentation measurements, effect of topically applied substances, transdermal drug delivery, moisture content of bio-materials, membrane permeation, and nail and hair measurements. Compared with other technologies, photothermal radiometry has the advantages of non-contact, non-destructive, quick to make a measurement (a few seconds, and being spectroscopic in nature. It is also colour blind, and can work on any arbitrary sample surfaces. It has a unique depth profiling capability on a sample surface (typically the top 20 µm, which makes it particularly suitable for skin measurements. In this paper, we present a review of the photothermal radiometry work carried out in our research group. We will first introduce the theoretical background, then illustrate its applications with experimental results.

  6. Effects of radiation on the skin

    International Nuclear Information System (INIS)

    Hopewell, J.W.

    1985-01-01

    The effects of X-irradiation on pig skin are described, comparing and contrasting the effects seen in human and rodent skin. It is concluded that, anatomically, pig skin is the best animal model for human skin. The applications of the 'pig skin model' to investigations of the problems of radiation therapy and radiological protection of human skin are discussed. (U.K.)

  7. Study of the skin effect in superconducting materials

    Energy Technology Data Exchange (ETDEWEB)

    Szeftel, Jacob, E-mail: jszeftel@lpqm.ens-cachan.fr [ENS Cachan, LPQM, 61 avenue du Président Wilson, 94230 Cachan (France); Sandeau, Nicolas [Aix Marseille Univ, CNRS, Centrale Marseille, Institut Fresnel, F-13013 Marseille (France); Khater, Antoine [Université du Maine, UMR 6087 Laboratoire PEC, F-72000 Le Mans (France)

    2017-05-03

    Highlights: • Comprehensive theoretical study of the skin effect in superconductors. • Based on Newton and Maxwell's equations. • Usual and anomalous skin effects dealt with in the same framework. - Abstract: The skin effect is analyzed to provide the numerous measurements of the penetration depth of the electromagnetic field in superconducting materials with a theoretical basis. Both the normal and anomalous skin effects are accounted for within a single framework, focusing on frequencies less than the superconducting gap. The emphasis is laid on the conditions required for the penetration depth to be equal to London's length, which enables us to validate an assumption widely used in the interpretation of all current experimental results.

  8. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  9. Touch Receptors Undergo Rapid Remodeling in Healthy Skin

    Directory of Open Access Journals (Sweden)

    Kara L. Marshall

    2016-11-01

    Full Text Available Sensory tissues exposed to the environment, such as skin, olfactory epithelia, and taste buds, continuously renew; therefore, peripheral neurons must have mechanisms to maintain appropriate innervation patterns. Although somatosensory neurons regenerate after injury, little is known about how these neurons cope with normal target organ changes. To elucidate neuronal plasticity in healthy skin, we analyzed the structure of Merkel-cell afferents, which are gentle touch receptors, during skin remodeling that accompanies mouse hair-follicle regeneration. The number of Merkel cells is reduced by 90% and axonal arbors are simplified during active hair growth. These structures rebound within just days. Computational modeling predicts that Merkel-cell changes are probabilistic, but myelinated branch stability depends on Merkel-cell inputs. Electrophysiology and behavior demonstrate that tactile responsiveness is less reliable during active growth than in resting skin. These results reveal that somatosensory neurons display structural plasticity at the cost of impairment in the reliability of encoding gentle touch.

  10. Novel biodegradable porous scaffold applied to skin regeneration.

    Science.gov (United States)

    Wang, Hui-Min; Chou, Yi-Ting; Wen, Zhi-Hong; Wang, Chau-Zen; Wang, Zhao-Ren; Chen, Chun-Hong; Ho, Mei-Ling

    2013-01-01

    Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  11. Novel biodegradable porous scaffold applied to skin regeneration.

    Directory of Open Access Journals (Sweden)

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  12. Transcriptome Analysis Reveals Markers of Aberrantly Activated Innate Immunity in Vitiligo Lesional and Non-Lesional Skin

    Science.gov (United States)

    Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen

    2012-01-01

    Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting

  13. Proposed derivation of skin contamination and skin decontamination limits

    International Nuclear Information System (INIS)

    Schieferdecker, H.; Koelzer, W.; Henrichs, K.

    1986-01-01

    From the primary dose limits for the skin, secondary dose limits were derived for skin contamination which can be used in practical radiation protection work. Analogous to the secondary dose limit for the maximum permissible body burden in the case of incorporation, dose limits for the 'maximum permissible skin burden' were calculated, with the help of dose factors, for application in the case of skin contamination. They can be derived from the skin dose limit values. For conditions in which the skin is exposed to temporary contamination, a limit of skin contamination was derived for immediately removable contamination and for one day of exposure. For non-removable contamination a dose limit of annual skin contamination was defined, taking into account the renewal of the skin. An investigation level for skin contamination was assumed, as a threshold, above which certain measures must be taken; these to include appropriate washing not more than three times, with the subsequent procedure determined by the level of residual contamination. The dose limits are indicated for selected radionuclides. (author)

  14. Evaluation of normal tissue responses to high-LET radiations

    International Nuclear Information System (INIS)

    Halnan, K.E.

    1979-01-01

    Clinical results presented have been analysed to evaluate normal tissue responses to high-LET radiations. Damage to brain, spinal cord, gut, skin, connective tissue and bone has occurred. A high RBE is probable for brain and possible for spinal cord and gut but other reasons for damage are also discussed. A net gain seems likely. Random controlled trials are advocated. (author)

  15. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    DEFF Research Database (Denmark)

    Remvig, Lars; Duhn, Ph; Ullman, S

    2010-01-01

    Objective: The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin...

  16. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    DEFF Research Database (Denmark)

    Remvig, L; Duhn, Ph; Ullman, S

    2010-01-01

    The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...

  17. Removal of heavy metal contamination from peanut skin extracts by waste biomass adsorption

    Science.gov (United States)

    Polyphenols are a rapidly increasing portion of the nutraceutical and functional food marketplace. Peanut skins are a waste product which have potential as a low-cost source of polyphenols. Extraction and concentration of peanut skin extracts can cause normally innocuous levels of the heavy metal co...

  18. A novel approach to measuring the frictional behaviour of human skin in vivo

    NARCIS (Netherlands)

    Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile

    2012-01-01

    Friction involving human skin plays a key role in human life. The availability of a portable tribometer improves the accessibility to large number of both subjects and anatomical sites. This is the first mobile device suitable to measure skin friction with a controlled and variable normal load

  19. The measurement of skin impedance for the diagnosis of skin cancer

    International Nuclear Information System (INIS)

    Menzies, S.; Crook, B.; McCarthy, W.

    1996-01-01

    Full text: In vivo skin impedance measurements have been reported to be diagnostic in differentiating benign from malignant skin tumours (Kiss G et al. Borgyogy Vener Szle 45: 164,1969; Melczer N. In: Cancer of the Skin. Saunders Co. Philadelphia, 1976, pp293-313). However, in contrast to non-melanoma skin cancer, only, a small sample of malignant melanomas were reported in these previous studies. We performed skin impedance measurements on a larger sample of melanomas in order to assess the potential use of such instrumentation for clinical diagnosis. The diagnostic method described by Kiss and Horvath was reproduced with only minor modifications. Low voltage impedance measurements at 1600 Hz were taken over each lesion and on nearby surrounding normal skin. Filter paper (4mm diameter) soaked in 0.1 M KCl was used at the skin-probe interface. A minimum of 2 skin and 1 lesion measurements were taken. All lesions were taken from relatively hairless sites and were non abraded or ulcerated. With the exception of 6 seborrhoeic keratoses all lesions were excised for histological diagnosis. The lesions tested were 27 invasive melanomas, 3 in situ melanomas, 27 basal cell carcinomas (BCC), 70 benign melanocytic lesions, 19 seborrhoeic keratoses, 5 Bowens disease (in situ SCC), 1 squamous cell carcinoma (SCC) and 25 other benign lesions. Results were interpreted as previously (Melczer) by the quotient of skin impedance / lesion impedance > 1.5 indicating malignancy. Analysis of total melanocytic lesions gave a sensitivity of 44% and specificity of 83% for the diagnosis of invasive melanoma (p < 0.05). Fifty two percent of BCCs were positively diagnosed. Analysis of all benign versus all invasive malignancy gave a sensitivity of 47% and specificity of 77% for the diagnosis of invasive malignancy (p < 0.01). While impedance measurements at 1600 Hz provide a statistically significant differentiation of melanoma versus non-melanoma and invasive malignancy versus benign lesions

  20. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... was characterized by calculation of the "percent error of the slope." The following permeability rates (g/m2h) of single solvents were measured: dimethyl sulfoxide (DMSO), 176; N-methyl-2-pyrrolidone, 171; dimethyl acetamide, 107; methyl ethyl ketone, 53; methylene chloride, 24; [3H]water, 14.8; ethanol, 11...