WorldWideScience

Sample records for adjacent normal skin

  1. Low-Molecular-Weight Hydrophilic and Lipophilic Antioxidants in Nonmelanoma Skin Carcinomas and Adjacent Normal-Looking Skin.

    Science.gov (United States)

    Grammenandi, Konstantina; Kyriazi, Maria; Katsarou-Katsari, Alexandra; Papadopoulos, Othon; Anastassopoulou, Ioanna; Papaioannou, Georgios T; Sagriotis, Alexandros; Rallis, Michail; Maibach, Howard I

    2016-01-01

    Low-molecular-weight antioxidants are some of the most efficient agents of the skin defense mechanism against environmental factors, such as cosmic rays, smoke, and pollutants. The total skin concentrations of hydrophilic ascorbic and uric acids, as well as lipophilic α-tocopherol, β-carotene, and ubiquinol-10 antioxidants were determined by an HPLC-EC detector from 18 biopsies of human nonmelanoma skin carcinomas and 18 biopsies from skin areas adjacent to carcinomas. No significant differences in the concentrations of lipophilic antioxidants in both carcinomas and normal-looking skin areas adjacent to carcinomas were observed. On the contrary, ascorbic and uric acid concentrations were found to be 18 and 36% lower in carcinomas than in normal-looking skin areas, respectively. No statistical significance was observed between antioxidant concentrations and age, sex, phototype, profession, site of tumor, frequency, and time of UV light exposure either. Accordingly the antioxidant concentrations in both cancerous skin and adjacent normal-looking areas were found to be much higher than in normal skin, in contrast to literature data.

  2. In ovo gene manipulation of melanocytes and their adjacent keratinocytes during skin pigmentation of chicken embryos.

    Science.gov (United States)

    Murai, Hidetaka; Tadokoro, Ryosuke; Sakai, Ken-Ichiro; Takahashi, Yoshiko

    2015-04-01

    During skin pigmentation in avians and mammalians, melanin is synthesized in the melanocytes, and subsequently transferred to adjacently located keratinocytes, leading to a wide coverage of the body surface by melanin-containing cells. The behavior of melanocytes is influenced by keratinocytes shown mostly by in vitro studies. However, it has poorly been investigated how such intercellular cross-talk is regulated in vivo because of a lack of suitable experimental models. Using chicken embryos, we developed a method that enables in vivo gene manipulations of melanocytes and keratinocytes, where these cells are separately labeled by different genes. Two types of gene transfer techniques were combined: one was a retrovirus-mediated gene infection into the skin/keratinocytes, and the other was the in ovo DNA electroporation into neural crest cells, the origin of melanocytes. Since the Replication-Competent Avian sarcoma-leukosis virus long terminal repeat with Splice acceptor (RCAS) infection was available only for the White leghorn strain showing little pigmentation, melanocytes prepared from the Hypeco nera (pigmented) were back-transplanted into embryos of White leghorn. Prior to the transplantation, enhanced green fluorescent protein (EGFP)(+) Neo(r+) -electroporated melanocytes from Hypeco nera were selectively grown in G418-supplemented medium. In the skin of recipient White leghorn embryos infected with RCAS-mOrange, mOrange(+) keratinocytes and transplanted EGFP(+) melanocytes were frequently juxtaposed each other. High-resolution confocal microscopy also revealed that transplanted melanocytes exhibited normal behaviors regarding distribution patterns of melanocytes, dendrite morphology, and melanosome transfer. The method described in this study will serve as a useful tool to understand the mechanisms underlying intercellular regulations during skin pigmentation in vivo.

  3. TP53 mutations in clinically normal mucosa adjacent to oral carcinomas

    DEFF Research Database (Denmark)

    Thode, Christenze; Bilde, Anders; von Buchwald, Christian;

    2010-01-01

    products were separated by denatured gradient gel electrophoresis. Fragments with a deviant DGEE pattern were sequenced. RESULTS: TP53 mutations were found in six of 18 tumours. Fourteen specimens contained histologically normal mucosa adjacent to the tumour; 13 of these showed small clusters of p53...... positive cells. Seven specimens contained both histological normal and dysplastic epithelial tissues adjacent to the tumour. A TP53 mutation was found in only one specimen; this mutation appeared in the normal mucosa, the adjacent tumour, and the epithelial dysplasia. CONCLUSION: We found that upregulation...... of p53 was a frequent event in histological normal mucosa adjacent to OSCC; however, it was rarely associated with a mutation in the TP53 gene....

  4. EXPRESSION MECHANISM AND CLINICAL SIGNIFICANCE OF NOB1 IN GASTRIC CANCER TISSUE AND ADJACENT NORMAL TISSUE.

    Science.gov (United States)

    Zhou, W-P; Liu, X; Yang, Y; Liu, Y-F

    2015-01-01

    This paper studies the effect and relationship of NOB1 in the development of gastric cancer, based on an analysis of NOB1expression in gastric cancer tissue and adjacent tissue. Thirty gastric cancer tissue samples taken during surgery with complete pathological data and their related adjacent normal tissue were examined in this study. NOB1 protein expression in gastric cancer tissue and adjacent normal tissue was detected by immunohistochemistry (IHC). Real-time PCR was used to detect NOB1 mRNA expression, which provided a basis on which to explore the clinical pathological characteristics for patients with gastric cancer. Results show that NOB1 protein in gastric cancer tissue and adjacent normal tissue were diffusely expressed both in the cytoplasm and nucleus. The positive expression rate in gastric cancer tissue was 73%, higher than that in adjacent normal tissue (47%). Both the reference NAPDH and NOB1 amplification are reflected in the amplification curve in standard S-shape and the unimodal solubility curve which was not altered by non-specific amplification and primer dimer. NOB1 mRNA relative expression in cancer tissue was 4.899∓1.412. NOB1 expression had no direct relationship with the patients’ age, gender, tumor differentiation or infiltration degree, lymphatic metastasis, distant metastasis nor pTNM periodization, but was directly related to the size of the tumor. All the findings in this paper suggest that NOB1 can be one of the focuses for diagnosing and treating gastric cancer and that its protein expression is likely to increase with the growth of tumor, thus playing a great role in the incidence and development of gastric cancer.

  5. Screening of the residual normal ovarian tissue adjacent to orthotopic epithelial ovarian carcinomas in nude mice.

    Science.gov (United States)

    Zhu, G H; Wang, S T; Yao, M Z; Cai, J H; Chen, C Y; Yang, Z X; Hong, L; Yang, S Y

    2014-04-16

    The objective of this study was to explore the feasibility and methods of screening the residual normal ovarian tissue adjacent to orthotopic ovarian carcinomas in nude mice. Human epithelial ovarian cancer cells (OVCAR3) were subcutaneously implanted for a tumor source and ovarian orthotopic transplantation. The cancer tissue, proximal paraneoplastic tissue, middle paraneoplastic tissue, remote paraneoplastic tissue, and normal ovarian tissue were removed. CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was detected by reverse transcription polymerase chain reaction. We obtained 35 paraneoplastic residual ovarian tissues with normal biopsies from 40 cases of an orthotopic epithelial ovarian carcinoma model (87.5%). CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was lower in proximal paraneoplastic tissue than in cancer tissue (P tissue (P tissue as well as among residual normal ovarian tissues with different severity (P > 0.05). In ovarian tissues of 20 normal nude mice, the expression of CK- 7, CA125, p53, survivin, MMP-2, and TIMP-2 was negative. Overall, the expression levels of CK-7, CA125, p53, survivin, MMP-2, TIMP-2, and other molecular markers showed a decreasing trend in the non-cancer tissue direction. The expression levels can be used as standards to screen residual normal ovarian tissue. We can obtain relatively safe normal ovarian tissues adjacent to epithelial ovarian cancer.

  6. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate miRNA...... expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  7. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...

  8. Using infrared and Raman microspectroscopies to compare ex vivo involved psoriatic skin with normal human skin

    Science.gov (United States)

    Leroy, Marie; Lefèvre, Thierry; Pouliot, Roxane; Auger, Michèle; Laroche, Gaétan

    2015-06-01

    Psoriasis is a chronic dermatosis that affects around 3% of the world's population. The etiology of this autoimmune pathology is not completely understood. The barrier function of psoriatic skin is known to be strongly altered, but the structural modifications at the origin of this dysfunction are not clear. To develop strategies to reduce symptoms of psoriasis or adequate substitutes for modeling, a deep understanding of the organization of psoriatic skin at a molecular level is required. Infrared and Raman microspectroscopies have been used to obtain direct molecular-level information on psoriatic and healthy human skin biopsies. From the intensities and positions of specific vibrational bands, the lipid and protein distribution and the lipid order have been mapped in the different layers of the skin. Results showed a similar distribution of lipids and collagen for normal and psoriatic human skin. However, psoriatic skin is characterized by heterogeneity in lipid/protein composition at the micrometer scale, a reduction in the definition of skin layer boundaries and a decrease in lipid chain order in the stratum corneum as compared to normal skin. A global decrease of the structural organization is exhibited in psoriatic skin that is compatible with an alteration of its barrier properties.

  9. Comparative Proteome Analysis of Breast Cancer and Adjacent Normal Breast Tissues in Human

    Institute of Scientific and Technical Information of China (English)

    Shi-Shan Deng; Tian-Yong Xing; Hong-Ying Zhou; Ruo-Hong Xiong; You-Guang Lu; Bin Wen; Shang-Qing Liu; Hui-Jun Yang

    2006-01-01

    Two-dimensional polyacryiamide gel electrophoresis (2D-PAGE) and matrixassisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF-MS), incorporated with online database searching, were performed to investigate differential proteins of breast cancer and adjacent normal breast tissues. Considering that serum albumin is abundantly presented in normal control samples, 15 differential spots detected in 11 out of 12 (91.7%) breast cancer samples were identified by online SIENA-2DPAGE database searching and MALDI-TOF/TOF-MS analysis. The results indicate that pathological changes of breast cancer are concerned with augmentation of substance metabolism, promotion of proteolytic activity, decline of activity of some inhibitors of enzymes, and so on. Some important proteins involved in the pathological process of breast cancer with changed expression may be useful biomarkers, such as alpha-1-antitrypsin, EF1-beta, cathepsin D, TCTP, SMT3A, RPS12, and PSMA1, among which SMT3A,RPS12, and PSMA1 were first reported for breast cancer in this study.

  10. Expression Quantitative Trait loci (QTL) in tumor adjacent normal breast tissue and breast tumor tissue

    Science.gov (United States)

    Quiroz-Zárate, Alejandro; Harshfield, Benjamin J.; Hu, Rong; Knoblauch, Nick; Beck, Andrew H.; Hankinson, Susan E.; Carey, Vincent; Tamimi, Rulla M.; Hunter, David J.; Quackenbush, John; Hazra, Aditi

    2017-01-01

    We investigate 71 single nucleotide polymorphisms (SNPs) identified in meta-analytic studies of genome-wide association studies (GWAS) of breast cancer, the majority of which are located in intergenic or intronic regions. To explore regulatory impacts of these variants we conducted expression quantitative loci (eQTL) analyses on tissue samples from 376 invasive postmenopausal breast cancer cases in the Nurses’ Health Study (NHS) diagnosed from 1990–2004. Expression analysis was conducted on all formalin-fixed paraffin-embedded (FFPE) tissue samples (and on 264 adjacent normal samples) using the Affymetrix Human Transcriptome Array. Significance and ranking of associations between tumor receptor status and expression variation was preserved between NHS FFPE and TCGA fresh-frozen sample sets (Spearman r = 0.85, p<10^-10 for 17 of the 21 Oncotype DX recurrence signature genes). At an FDR threshold of 10%, we identified 27 trans-eQTLs associated with expression variation in 217 distinct genes. SNP-gene associations can be explored using an open-source interactive browser distributed in a Bioconductor package. Using a new a procedure for testing hypotheses relating SNP content to expression patterns in gene sets, defined as molecular function pathways, we find that loci on 6q14 and 6q25 affect various gene sets and molecular pathways (FDR < 10%). Although the ultimate biological interpretation of the GWAS-identified variants remains to be uncovered, this study validates the utility of expression analysis of this FFPE expression set for more detailed integrative analyses. PMID:28152060

  11. Mast Cells in Adjacent Normal Colon Mucosa rather than Those in Invasive Margin are Related to Progression of Colon Cancer

    Institute of Scientific and Technical Information of China (English)

    Qing Xia; Xiao-shi Zhang; Ying-bo Chen; Ya Ding; Xiao-jun Wu; Rui-qing Peng; Qiang Zhou; Jing Zeng; Jing-hui Hou; Xing Zhang; Yi-xin Zeng

    2011-01-01

    Objective:Mast cells (MC) reside in the mucosa of the digestive tract as the first line against bacteria and toxins.Clinical evidence has implied that the infiltration of mast cells in colorectal cancers is related to malignant phenotypes and a poor prognosis.This study compared the role of mast cells in adjacent normal colon mucosa and in the invasive margin during the progression of colon cancer.Methods:Specimens were obtained from 39 patients with colon adenomas and 155 patients with colon cancers treated at the Sun Yat-sen University Cancer Center between January 1999 and July 2004.The density of mast cells was scored by an immunohistochemical assay.The pattern of mast cell distribution and its relationship with dinicopathologic parameters and 5-year survival were analyzed.Results:The majority of mast cells were located in the adjacent normal colon mucosa,followed by the invasive margin and least in the cancer stroma.Mast cell count in adjacent normal colon mucosa (MCCadjacent) was associated with pathologic classification,distant metastases and hepatic metastases,although it was not a prognostic factor.In contrast,mast cell count in the invasive margin (MCCinvasive) was associated with neither the clinicopathlogic parameters nor overall survival.Conclusion:Mast cells in the adjacent normal colon mucosa were related to the progression of colon cancer,suggesting that mast cells might modulate tumor progression via a long-distance mechanism.

  12. Distinctive Glycerophospholipid Profiles of Human Seminoma and Adjacent Normal Tissues by Desorption Electrospray Ionization Imaging Mass Spectrometry

    Science.gov (United States)

    Masterson, Timothy A.; Dill, Allison L.; Eberlin, Livia S.; Mattarozzi, Monica; Cheng, Liang; Beck, Stephen D. W.; Bianchi, Federica; Cooks, R. Graham

    2011-08-01

    Desorption electrospray ionization mass spectrometry (DESI-MS) has been successfully used to discriminate between normal and cancerous human tissue from different anatomical sites. On the basis of this, DESI-MS imaging was used to characterize human seminoma and adjacent normal tissue. Seminoma and adjacent normal paired human tissue sections (40 tissues) from 15 patients undergoing radical orchiectomy were flash frozen in liquid nitrogen and sectioned to 15 μm thickness and thaw mounted to glass slides. The entire sample was two-dimensionally analyzed by the charged solvent spray to form a molecular image of the biological tissue. DESI-MS images were compared with formalin-fixed, hematoxylin and eosin (H&E) stained slides of the same material. Increased signal intensity was detected for two seminolipids [seminolipid (16:0/16:0) and seminolipid (30:0)] in the normal tubule testis tissue; these compounds were undetectable in seminoma tissue, as well as from the surrounding fat, muscle, and blood vessels. A glycerophosphoinositol [PI(18:0/20:4)] was also found at increased intensity in the normal testes tubule tissue when compared with seminoma tissue. Ascorbic acid (i.e., vitamin C) was found at increased amounts in seminoma tissue when compared with normal tissue. DESI-MS analysis was successfully used to visualize the location of several types of molecules across human seminoma and normal tissues. Discrimination between seminoma and adjacent normal testes tubules was achieved on the basis of the spatial distributions and varying intensities of particular lipid species as well as ascorbic acid. The increased presence of ascorbic acid within seminoma compared with normal seminiferous tubules was previously unknown.

  13. Collagen IV in normal skin and in pathological processes

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu-Velez

    2012-01-01

    Full Text Available Context: Type IV collagen is a type of collagen found primarily in the skin within the basement membrane zone. The type IV collagen C4 domain at the C-terminus is not removed in post-translational processing, and the fibers are thus link head-to-head, rather than in a parallel fashion. Also, type IV collagen lacks a glycine in every third amino-acid residue necessary for the tight collagen helix. Thus, the overall collagen-IV conformation is structurally more pliable and kinked, relative to other collagen subtypes. These structural features allow collagen IV to form sheets, which is the primary structural form found in the cutaneous basal lamina. There are six human genes associated with collagen IV, specifically COL4A1, COL4A2, COL4A3, COL4A4, COL4A5 and COL4A6. The aim of this review is to highlight the significance of this protein in normal skin, and in selected diseases. Results: The alpha 3 protein constituent of type IV collagen is thought to be the antigen implicated in Goodpasture′s syndrome, wherein the immune system attacks the basement membranes of the renal glomeruli and pulmonary alveoli. In addition, mutations to the genes coding for type IV collagen lead to the Alport syndrome. Furthermore, autoantibodies directed against denatured human type IV collagen have been described in rheumatoid arthritis, scleroderma, and SLE. Structural studies of collagen IV have been utilized to differentiate between subepidermal blistering diseases, including bullous pemphigoid, acquired epidermolysis bullosa, anti-epiligrin cicatricial pemphigoid, and bullous lupus erythematosus. Collagen IV is also of importance in wound healing and in embryogenesis. Conclusions: Pathological studies have demonstrated that minor structural differences in collagen IV can lead to distinct, clinically different diseases.

  14. Reactive molecule species and antioxidative mechanisms in normal skin and skin aging.

    Science.gov (United States)

    Wölfle, Ute; Seelinger, Günter; Bauer, Georg; Meinke, Martina C; Lademann, Jürgen; Schempp, Christoph M

    2014-01-01

    Reactive oxygen and nitrogen species (ROS/RNS) which may exist as radicals or nonradicals, as well as reactive sulfur species and reactive carbon species, play a major role in aging processes and in carcinogenesis. These reactive molecule species (RMS), often referred to as 'free radicals' or oxidants, are partly by-products of the physiological metabolism. When RMS concentrations exceed a certain threshold, cell compartments and cells are injured and destroyed. Endogenous physiological mechanisms are able to neutralize RMS to some extent, thereby limiting damage. In the skin, however, pollutants and particularly UV irradiation are able to produce additional oxidants which overload the endogenous protection system and cause early aging, debilitation of immune functions, and skin cancer. The application of antioxidants from various sources in skin care products and food supplements is therefore widespread, with increasingly effective formulations being introduced. The harmful effects of RMS (aside from impaired structure and function of DNA, proteins, and lipids) are: interference with specific regulatory mechanisms and signaling pathways in cell metabolism, resulting in chronic inflammation, weakening of immune functions, and degradation of tissue. Important control mechanisms are: MAP-kinases, the aryl-hydrocarbon receptor (AhR), the antagonistic transcription factors nuclear factor-κB and Nrf2 (nuclear factor erythroid 2-related factor 2), and, especially important, the induction of matrix metalloproteinases which degrade dermal connective tissue. Recent research, however, has revealed that RMS and in particular ROS/RNS are apparently also produced by specific enzyme reactions in an evolutionarily adapted manner. They may fulfill important physiologic functions such as the activation of specific signaling chains in the cell metabolism, defense against infectious pathogens, and regulation of the immune system. Normal physiological conditions are characterized by

  15. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars;

    2008-01-01

    Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study....... In glabrous skin the stratum corneum is visible. Children had larger ET (p skin-type-related differences in ET were found. Conclusion: This study contributes to understanding OCT and PS-OCT images of normal skin and indicates that OCT...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  16. Asiaticoside enhances normal human skin cell migration, attachment and growth in vitro wound healing model.

    Science.gov (United States)

    Lee, Jeong-Hyun; Kim, Hye-Lee; Lee, Mi Hee; You, Kyung Eun; Kwon, Byeong-Ju; Seo, Hyok Jin; Park, Jong-Chul

    2012-10-15

    Wound healing proceeds through a complex collaborative process involving many types of cells. Keratinocytes and fibroblasts of epidermal and dermal layers of the skin play prominent roles in this process. Asiaticoside, an active component of Centella asiatica, is known for beneficial effects on keloid and hypertrophic scar. However, the effects of this compound on normal human skin cells are not well known. Using in vitro systems, we observed the effects of asiaticoside on normal human skin cell behaviors related to healing. In a wound closure seeding model, asiaticoside increased migration rates of skin cells. By observing the numbers of cells attached and the area occupied by the cells, we concluded that asiaticoside also enhanced the initial skin cell adhesion. In cell proliferation assays, asiaticoside induced an increase in the number of normal human dermal fibroblasts. In conclusion, asiaticoside promotes skin cell behaviors involved in wound healing; and as a bioactive component of an artificial skin, may have therapeutic value.

  17. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    to cold can be beneficial. The aim was to investigate whether desensitization can lower temperature thresholds and reduce release of histamine in the skin. Cold urticaria patients were subjected to desensitization and assessed for skin responses to cold stimulation and codeine before and after. Histamine...... prevented histamine release after skin exposure to cold. Surprisingly, skin histamine levels and release after codeine injection were found to be normal in desensitized patients....

  18. Skin pigmentation and texture changes after hair removal with the normal-mode ruby laser.

    Science.gov (United States)

    Haedersdal, M; Egekvist, H; Efsen, J; Bjerring, P

    1999-11-01

    Promising clinical results have been obtained with the normal mode ruby laser for removal of unwanted hair. Melanin within the hair follicles is thought to act as target for the ruby laser pulses, whereas epidermal melanin is thought to be a competitive chromophore, responsible for potential side effects. This study aimed (i) to objectify postoperative changes in skin pigmentation and texture and (ii) to evaluate the importance of variations in preoperative skin pigmentation for the development of side effects 12 weeks after 1 treatment with the normal-mode ruby laser. A total of 17 volunteers (skin types I-IV) were laser-treated in the hairy pubic region (n = 51 test areas). A shaved test area served as control. Skin reflectance spectroscopical measurements, 3-dimensional surface contour analysis and ultrasonography objectified postoperative changes in skin pigmentation and texture. Blinded clinical assessments revealed postoperative hyperpigmentation (2% of test areas) and hypopigmentation (10%), whereas no textural changes were seen. Reflectance spectroscopically-determined pigmentary changes depended on the degree of preoperative skin pigmentation, fairly pigmented skin types experiencing subclinical hyperpigmentation and darkly pigmented skin types experiencing subclinical hypopigmentation. Three-dimensional surface profilometry documented similar pre- and postoperative surface contour parameters, indicating that the skin surface texture is preserved after laser exposure. Ultrasonography revealed similar skin thicknesses in laser-exposed and untreated control areas. It is concluded that normal-mode ruby laser treatment is safe for hair removal in skin types I-IV.

  19. Detection of human papillomavirus in Chinese esophageal squamous cell carcinoma and its adjacent normal epithelium

    Institute of Scientific and Technical Information of China (English)

    Xiao-Bo Zhou; Mei Guo; Lan-Ping Quan; Wei Zhang; Zhe-Ming Lu; Quan-Hong Wang; Yang Ke; Ning-Zhi Xu

    2003-01-01

    AIM: To investigate the putative role of human papillomavirus (HPV) infection in the carcinogenesis of esophageal squamous cell carcinoma in China.METHODS: Twenty-three esophageal squamous cell carcinoma samples and the distal normal epithelium from Shanxi Province, and 25 more esophageal squamous cell carcinoma samples from Anyang city, two areas with a high incidence of esophageal cancer in China, were detected for the existence of HPV-16 DNA by PCR, mRNA in situ hybridization (ISH) and immunohistochemistry (IHC) targeting HPV-16 E6 gene. RESULTS: There were approximately 64 % (31/48) patients having HPV-16 DNA in tumor samples, among them nearly twothirds (19/31) samples were detected with mRNA expression of HPV-16 E6. However, in the normal esophageal epithelium from cancer patients, the DNA and mRNA of HPV-16 were found with much less rate: 34.7 % (8/23) and 26.1% (6/23) respectively.In addition, at protein level detected by IHC assay, 27.1% (13/48) tumor samples had virus oncoprotein E6 expression, while only one case of normal epithelium was found positive.CONCLUSION: HPV infection, especially type 16, should be considered as a risk factor for esophageal malignancies in China.

  20. Analysis of normal-tumour tissue interaction in tumours: prediction of prostate cancer features from the molecular profile of adjacent normal cells.

    Directory of Open Access Journals (Sweden)

    Victor Trevino

    Full Text Available Statistical modelling, in combination with genome-wide expression profiling techniques, has demonstrated that the molecular state of the tumour is sufficient to infer its pathological state. These studies have been extremely important in diagnostics and have contributed to improving our understanding of tumour biology. However, their importance in in-depth understanding of cancer patho-physiology may be limited since they do not explicitly take into consideration the fundamental role of the tissue microenvironment in specifying tumour physiology. Because of the importance of normal cells in shaping the tissue microenvironment we formulate the hypothesis that molecular components of the profile of normal epithelial cells adjacent the tumour are predictive of tumour physiology. We addressed this hypothesis by developing statistical models that link gene expression profiles representing the molecular state of adjacent normal epithelial cells to tumour features in prostate cancer. Furthermore, network analysis showed that predictive genes are linked to the activity of important secreted factors, which have the potential to influence tumor biology, such as IL1, IGF1, PDGF BB, AGT, and TGFβ.

  1. Comparison of the histological morphology between normal skin and scar tissue.

    Science.gov (United States)

    Yang, Shao-wei; Geng, Zhi-jun; Ma, Kui; Sun, Xiao-yan; Fu, Xiao-bing

    2016-04-01

    Skin wound healing is a complex event, and interrupted wound healing process could lead to scar formation. The aim of this study was to examine the morphological changes of scar tissue. Pathological staining (HE staining, Masson's trichrome staining, methenamine silver staining) was used to evaluate the morphological changes of regenerating epidermis in normal skin and scar tissue, and immunofluorescence staining to detect the expression of collagen IV, a component of basement membrane (BM), and the expression of integrinβ4, a receptor for BM laminins. Additionally, the expression of CK14, CK5, and CK10 was measured to evaluate the proliferation and differentiation of keratinocytes in normal skin and scar tissue. The results showed that the structure of the skin was histologically changed in scar tissue. Collagen IV, expressed under the epidermis of normal skin, was reduced distinctly in scar tissue. Integrinβ4, expressed in the basal layer of normal skin, was found absent in the basal layer of scar tissue. Additionally, it was found that keratinocytes in scarring epidermis were more proliferative than in normal skin. These results indicate that during the skin wound healing, altered formation of BM may affect the proliferation of keratinocytes, reepithelial and tissue remodeling, and then result in scar formation. Thus, remodeling BM structure during wound repair may be beneficial for improving healing in cutaneous wounds during clinical practice.

  2. Topical distribution of acyclovir in normal equine skin and equine sarcoids: An in vitro study.

    Science.gov (United States)

    Haspeslagh, M; Taevernier, L; Maes, A A; Vlaminck, L E M; De Spiegeleer, B; Croubels, S M; Martens, A M

    2016-06-01

    Topical acyclovir application is an owner-friendly treatment for occult equine sarcoids, without the caustic side-effects other topical treatments have. Variable clinical success rates have been described, but it is not known to what rate and extent acyclovir penetrates in and through equine skin from a topical formulation. In the current study, an in vitro Franz diffusion model was used to determine the permeation parameters for a generic 5% acyclovir cetomacrogol cream for both healthy and sarcoid equine skin. The distribution of acyclovir between different layers of both skin types was also evaluated. While acyclovir penetrated through both skin types, significantly less acyclovir permeated to the deep dermis of sarcoid skin (197.62ng/mm(3)) compared to normal skin (459.41ng/mm(3)). Within sarcoid skin samples, significantly higher acyclovir concentrations were found in the epidermis (983.59ng/mm(3)) compared to the superficial dermis (450.02ng/mm(3)) and the deep dermis. At each sample point, significantly more acyclovir permeated to the receptor fluid through normal skin compared to sarcoid skin, which is reflected in the significantly higher permeation parameters of normal skin. Normal skin was found to be more permissive for acyclovir, but even in sarcoid skin, enough acyclovir reached the deep dermis to treat a Herpes simplex virus infection. In the case of equine sarcoids, the treatment is aimed at the Bovine papillomavirus and no information is available on the susceptibility of the DNA polymerase of this virus for acyclovir. Therefore, further research is needed to determine the efficacy of acyclovir to treat equine sarcoids.

  3. Modulation of pro-inflammatory cytokines in normal and inflamed skin

    NARCIS (Netherlands)

    A.R. Companjen (Arjen)

    2001-01-01

    textabstractThis thesis describes the expression and modulation of pro-inflammatory cytokines in normal and inflamed skin. During the last few decades it has become clear that the skin comprises a complex network of interacting cells including keratinocytes (KC). dendritic cells (such as Langerhans

  4. cis-Expression QTL analysis of established colorectal cancer risk variants in colon tumors and adjacent normal tissue.

    Directory of Open Access Journals (Sweden)

    Lenora W M Loo

    Full Text Available Genome-wide association studies (GWAS have identified 19 risk variants associated with colorectal cancer. As most of these risk variants reside outside the coding regions of genes, we conducted cis-expression quantitative trait loci (cis-eQTL analyses to investigate possible regulatory functions on the expression of neighboring genes. Forty microsatellite stable and CpG island methylator phenotype-negative colorectal tumors and paired adjacent normal colon tissues were used for genome-wide SNP and gene expression profiling. We found that three risk variants (rs10795668, rs4444235 and rs9929218, using near perfect proxies rs706771, rs11623717 and rs2059252, respectively were significantly associated (FDR q-value ≤0.05 with expression levels of nearby genes (<2 Mb up- or down-stream. We observed an association between the low colorectal cancer risk allele (A for rs10795668 at 10p14 and increased expression of ATP5C1 (q = 0.024 and between the colorectal cancer high risk allele (C for rs4444235 at 14q22.2 and increased expression of DLGAP5 (q = 0.041, both in tumor samples. The colorectal cancer low risk allele (A for rs9929218 at 16q22.1 was associated with a significant decrease in expression of both NOL3 (q = 0.017 and DDX28 (q = 0.046 in the adjacent normal colon tissue samples. Of the four genes, DLGAP5 and NOL3 have been previously reported to play a role in colon carcinogenesis and ATP5C1 and DDX28 are mitochondrial proteins involved in cellular metabolism and division, respectively. The combination of GWAS findings, prior functional studies, and the cis-eQTL analyses described here suggest putative functional activities for three of the colorectal cancer GWAS identified risk loci as regulating the expression of neighboring genes.

  5. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  6. Exposure to Varying Strain Magnitudes Influences the Conversion of Normal Skin Fibroblasts Into Hypertrophic Scar Cells.

    Science.gov (United States)

    Kuang, Ruixia; Wang, Zhiguo; Xu, Quanchen; Cai, Xia; Liu, Tao

    2016-04-01

    Mechanical strain is a key contributor in the pathogenesis of hypertrophic scarring, whose optimal stretch magnitudes to initiate the differentiation of normal skin fibroblasts into aberrant fibroblasts phenotype remains largely unresolved. Influence of varying cyclic strain magnitudes on cultured human normal skin fibroblasts and its transformation into hypertrophic scar fibroblast-like phenotype is investigated in this study. Cultured fibroblasts isolated from hypertrophic scar and normal skin tissue were subjected to cyclic mechanical stretching under individual 10%, 15%, and 20% strain magnitudes at a frequency of 0.1 Hz for 24 hours. Stretched normal skin fibroblasts demonstrated significantly increased rates of cell proliferation, and also apparently oriented away nearly perpendicular to the applied stretching direction. Interestingly, the applied 10% strains magnitude resulted in a markedly enhanced cell proliferative ability compared with that of 20% strain magnitude. Parameters involving the mechanotransduction signaling, such as integrin β1 and P130Cas, were significantly improved at both mRNA and protein levels in the stretched normal skin fibroblasts, which was demonstrated in a negative magnitude-dependent manner. In addition, 10% strains magnitude triggered the highest expression levels of growth factor TGF-β1 and collagen matrix in stretched normal skin fibroblasts. Collectively, these results indicate that the 10% stretching magnitude, of the 3 strain magnitudes studied, is most effective for triggering the optimal mechanotransduction effects and biological responses inside cultured skin fibroblasts. The demonstrable conversion of normal skin fibroblasts into hypertrophic scar fibroblasts was also observed when 10% stretching magnitude was applied to cultured fibroblasts in vitro.

  7. Markers of fibrosis and epithelial to mesenchymal transition demonstrate field cancerization in histologically normal tissue adjacent to breast tumors

    Science.gov (United States)

    Trujillo, Kristina A.; Heaphy, Christopher M.; Mai, Minh; Vargas, Keith M.; Jones, Anna C.; Vo, Phung; Butler, Kimberly S.; Joste, Nancy E.; Bisoffi, Marco; Griffith, Jeffrey K

    2011-01-01

    Previous studies have shown that a field of genetically altered but histologically normal tissue extends 1 cm or more from the margins of human breast tumors. The extent, composition and biological significance of this field are only partially understood, but the molecular alterations in affected cells could provide mechanisms for limitless replicative capacity, genomic instability and a microenvironment that supports tumor initiation and progression. We demonstrate by microarray, qRT-PCR and immunohistochemistry a signature of differential gene expression that discriminates between patient-matched, tumor-adjacent histologically normal breast tissues located 1 cm and 5 cm from the margins of breast adenocarcinomas (TAHN-1 and TAHN-5, respectively). The signature includes genes involved in extracellular matrix remodeling, wound healing, fibrosis and epithelial to mesenchymal transition (EMT). Myofibroblasts, which are mediators of wound healing and fibrosis, and intra-lobular fibroblasts expressing MMP2, SPARC, TGF-β3, which are inducers of EMT, were both prevalent in TAHN-1 tissues, sparse in TAHN-5 tissues, and absent in normal tissues from reduction mammoplasty. Accordingly, EMT markers S100A4 and vimentin were elevated in both luminal and myoepithelial cells, and EMT markers α-smooth muscle actin and SNAIL were elevated in luminal epithelial cells of TAHN-1 tissues. These results identify cellular processes that are differentially activated between TAHN-1 and TAHN-5 breast tissues, implicate myofibroblasts as likely mediators of these processes, provide evidence that EMT is occurring in histologically normal tissues within the affected field and identify candidate biomarkers to investigate whether or how field cancerization contributes to the development of primary or recurrent breast tumors. PMID:21105047

  8. Microbial colonization of normal skin: Direct visualization of 194 skin biopsies.

    Science.gov (United States)

    Jahns, Anika C; Alexeyev, Oleg A

    2016-04-01

    Recent genetic studies have suggested the presence of numerous microbial species on and in the skin. We characterised microbial colonization of a large collection of skin biopsies from 194 healthy subjects by fluorescence assay. Forty per cent of all biopsies did not show any evidence for microbial colonization. Propionibacterium acnes was the sole predominant bacterial species in both sebaceous and non-sebaceous areas. Non- P. acnes species were present in approximately 30% of all colonized samples. . Only hair follicles and stratum corneum were colonized. Understanding of cutaneous microbiota requires validation from a variety of approaches and techniques.

  9. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    Energy Technology Data Exchange (ETDEWEB)

    Liu Xudong [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Zeng Bingfang [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Fan Cunyi [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Jiang Peizhu [Department of Orthopaedic Surgery, Shanghai No. 6 People' s Hospital, Shanghai Jiao Tong University, 600 Yishan Road, Shanghai 200233 (China); Hu Xiao [Department of Biomedical Engineering, Shanghai Jiao Tong University, Shanghai 200030 (China)

    2006-01-07

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable.

  10. Breast Field Cancerization: Isolation and Comparison of Telomerase-Expressing Cells in Tumor and Tumor Adjacent, Histologically Normal Breast Tissue

    Science.gov (United States)

    Trujillo, Kristina A.; Hines, William C.; Vargas, Keith M.; Jones, Anna C.; Joste, Nancy E.; Bisoffi, Marco; Griffith, Jeffrey K.

    2011-01-01

    Telomerase stabilizes chromosomes by maintaining telomere length, immortalizes mammalian cells, and is expressed in more than 90% of human tumors. However, the expression of human telomerase reverse transcriptase (hTERT) is not restricted to tumor cells. We have previously shown that a subpopulation of human mammary epithelial cells (HMEC) in tumor-adjacent, histologically normal (TAHN) breast tissues expresses hTERT mRNA at levels comparable with levels in breast tumors. In the current study, we first validated a reporter for measuring levels of hTERT promoter activity in early-passage HMECs and then used this reporter to compare hTERT promoter activity in HMECs derived from tumor and paired TAHN tissues 1, 3, and 5 cm from the tumor (TAHN-1, TAHN-3, and TAHN-5, respectively). Cell sorting, quantitative real-time PCR, and microarray analyses showed that the 10% of HMECs with the highest hTERT promoter activity in both tumor and TAHN-1 tissues contain more than 95% of hTERT mRNA and overexpress many genes involved in cell cycle and mitosis. The percentage of HMECs within this subpopulation showing high hTERT promoter activity was significantly reduced or absent in TAHN-3 and TAHN-5 tissues. We conclude that the field of normal tissue proximal to the breast tumors contains a population of HMECs similar in hTERT expression levels and in gene expression to the HMECs within the tumor mass and that this population is significantly reduced in tissues more distal to the tumor. PMID:21775421

  11. The Influence of Normal Load and Sliding Speed on Frictional Properties of Skin

    Institute of Scientific and Technical Information of China (English)

    Wei Tang; Shi-rong Ge; Hua Zhu; Xi-chuan Cao; Ning Li

    2008-01-01

    The study of frictional properties of human skin is important for medical research, skin care products and textile exploitation. In order to investigate the influence of normal load and sliding speed on the frictional properties of skin and its possible mechanism, tests were carried out on a multi-specimen friction tester. When the normal load increases from 0.1 N to 0.9 N,normal displacement and the friction coefficient of skin increase. The friction coefficient is dependent on the load, indicating that both adhesion and deformation contribute to the friction behaviour. The deformation friction was interpreted using the plough model of fiiction. When sliding speed increases from 0.5 mm·s-1 to 4 mm·s-1,the friction coefficient increases and "stick-slip" phenomena increase, indicating that hysteretic friction contributes to the friction. The hysteretic friction was interpreted using schematic of energy translation during the rigid spherical probe sliding on the soft skin surface, which provides an explanation for the influence of the sliding speed on the frictional characteristics of the skin.

  12. Normal range and lateral symmetry in the skin temperature profile of pregnant women

    Science.gov (United States)

    Pereira, Tânia; Nogueira-Silva, Cristina; Simoes, Ricardo

    2016-09-01

    Body skin temperature is a useful parameter for diagnosing diseases and infrared thermography can be a powerful tool in providing important information to detect body temperature changes in a noninvasive way. The aim of this work was to study the pattern of skin temperature during pregnancy, to establish skin temperature reference values and to find correlations between these and the pregnant population characteristics. Sixty-one healthy pregnant women (mean age 30.6 ± 5.1 years) in the 8th-40th gestational week with normal pregnancies were examined in 31 regions of interest (ROI). The ROIs were defined all over the body in order to determine the most influenced by factors such as age or body mass index (BMI). The results obtained in this work highlight that in normal pregnant women the skin temperature is symmetrically distributed, with the symmetrical areas differing less than 0.5 °C , with a mean value of 0.25 ± 0.23 °C . This study identified a significant negative correlation between the BMI and temperature. Age has been shown to have great influence on the skin temperature, with a significant increase of temperature observed with age. This work explores a novel medical application of infrared thermography and provides a characterization of thermal skin profile in human pregnancy for a large set of ROIs while also evaluating the effects of age and BMI.

  13. High-resolution magnetic resonance imaging in study of the skin: Normal patterns

    Energy Technology Data Exchange (ETDEWEB)

    Sans, Nicolas, E-mail: sans.n@chu-toulouse.fr [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Faruch, Marie; Chiavassa-Gandois, Helene; Ribes, Catherine Lalande Champetier de [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Paul, Carle [Service de Dermatologie, Centre Hospitalier Universitaire Larrey, Toulouse (France); Railhac, Jean-Jacques [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France)

    2011-11-15

    Purpose: To validate quantitative and qualitative criteria of normal healthy skin using high-resolution MR imaging. Materials and methods: FIESTA and spin echo sequences of the skin of the heel, back and calf were obtained in 31 healthy volunteers. A dedicated 3-in. coil for study of the skin was used to optimize reception sensitivity. Quantitative analysis was performed to measure skin thickness in these three sites and qualititative analysis aimed to differentiate the various skin layers. Results: With both sequences, the stratum corneum appeared as a hyperintense layer. The epidermis was visualized appeared as a fine, homogeneous, hyperintense line. The dermoepidermal junction was clearer particularly in the calf. The dermis was also identified in each sequence and in each anatomic site. The signal was hypointense in both sequences, homogeneous with spin echo and more heterogeneous with FIESTA. Moreover the interface between the papillary and the reticular dermis could be distinguished. The hypodermis was visualized in both sequences and in all sites and hypodermal inclusions in the dermis were seen particularly in the back and calf. Lastly, the pilosebaceous follicles and the deep vascular network of the reticular dermis were more clearly seen with FIESTA sequence. Measures of overall skin thickness and for each layer according to site, sex and MRI sequence were performed. Statistical analysis was then performed to seek significant differences between the results according to these parameters. Conclusion: MR imaging provides global analysis with high resolution of the various skin layers down to the hypodermis and the muscular fascia.

  14. Skin-pass rolling I – Studies on roughness transfer and elongation under pure normal loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness in skin-pass or temper rolling of steel strip is investigated focusing on roughness transfer and strip elongation under pure normal loading, i.e. with no tangential shear between tool and workpiece. The process is simulated by an elasto-plastic FE simulation of plane...

  15. Development of gene microarray in screening differently expressed genes in keloid and normal-control skin

    Institute of Scientific and Technical Information of China (English)

    陈伟; 付小兵; 葛世丽; 孙晓庆; 周岗; 赵志力; 盛志勇

    2004-01-01

    Background Keloid is an intricate lesion that is probably regulated by many genes. In this study, the authors used the technique of complementary DNA (cDNA) microarray to analyse abnormal gene expression in keloids and normal control skins. Methods The polymerase chain reaction (PCR) products of 8400 genes were spotted in an array on chemical-material-coated-glass plates. The DNAs were fixed on the glass plates. The total RNAs were isolated from freshly excised human keloid and normal control skins, and the mRNAs were then purified. The mRNA from both keloid and normal control skins were reversely transcribed to cDNAs, with the incorporation of fluorescent dUTP, for preparing the hybridisation probes. The mixed probes were then hybridised to the cDNA microarray. After thorough washing, the cDNA microarray was scanned for differing fluorescent signals from two types of tissues. Gene expression of tissue growth factor-β1 (TGF-β1) and of c-myc was detected with both RT-PCR and Northern blot hybridisation to confirm the effectiveness of cDNA microarray. Results Among the 8400 human genes, 402 were detected with different expression levels between keloid and normal control skins. Two hundred and fifty genes, including TGF-β1 and c-myc, were up-regulated and 152 genes were down-regulated. Higher expressions of TGF-β1 and c-myc in keloid were also revealed using RT-PCR and Northern blot methods. Conclusion cDNA microarray analysis provides a powerful tool for investigating differential gene expression in keloid and normal control skins. Keloid is a complicated lesion with many genes involved.

  16. Frequency of apoptotic keratinocytes in the feline epidermis: a retrospective light-microscopic study of skin-biopsy specimens from 327 cats with normal skin or inflammatory dermatoses.

    Science.gov (United States)

    Vogel, Jeff W; Scott, Danny W; Erb, Hollis N

    2009-12-01

    A retrospective light-microscopic study was performed on 294 biopsy specimens of haired skin from cats with various feline inflammatory dermatoses and specimens from cats with normal skin. Conditions expected to frequently have apoptotic epidermal keratinocytes (AKs) (including erythema multiforme, systemic lupus erythematosus, thymoma-associated exfoliative dermatitis, solar dermatitis, and viral dermatopathies) were found to have significantly more AKs than other types of inflammatory dermatoses. Nevertheless, we found more than two AKs in many skin-biopsy specimens from inflammatory conditions not expected to have frequent AKs (especially those from ectoparasitic dermatoses). Only a single AK was found in 1/33 cats with normal skin.

  17. Numerical simulation of an atmospheric pressure RF-driven plasma needle and heat transfer to adjacent human skin using COMSOL.

    Science.gov (United States)

    Schröder, Maximilian; Ochoa, Angel; Breitkopf, Cornelia

    2015-06-07

    Plasma medicine is an emerging field where plasma physics is used for therapeutical applications. Temperature is an important factor to take into account with respect to the applications of plasma to biological systems. During the treatment, the tissue temperature could increase to critical values. In this work, a model is presented, which is capable of predicting the skin temperature during a treatment with a radio frequency driven plasma needle. The main gas was helium. To achieve this, a discharge model was coupled to a heat transfer and fluid flow model. The results provide maximum application times for different power depositions in order to avoid reaching critical skin temperatures.

  18. Absorption spectra and light penetration depth of normal and pathologically altered human skin

    Science.gov (United States)

    Barun, V. V.; Ivanov, A. P.; Volotovskaya, A. V.; Ulashchik, V. S.

    2007-05-01

    A three-layered skin model (stratum corneum, epidermis, and dermis) and engineering formulas for radiative transfer theory are used to study absorption spectra and light penetration depths of normal and pathologically altered skin. The formulas include small-angle and asymptotic approximations and a layer-addition method. These characteristics are calculated for wavelengths used for low-intensity laser therapy. We examined several pathologies such as vitiligo, edema, erythematosus lupus, and subcutaneous wound, for which the bulk concentrations of melanin and blood vessels or tissue structure (for subcutaneous wound) change compared with normal skin. The penetration depth spectrum is very similar to the inverted blood absorption spectrum. In other words, the depth is minimal at blood absorption maxima. The calculated absorption spectra enable the power and irradiation wavelength providing the required light effect to be selected. Relationships between the penetration depth and the diffuse reflectance coefficient of skin (unambiguously expressed through the absorption coefficient) are analyzed at different wavelengths. This makes it possible to find relationships between the light fields inside and outside the tissue.

  19. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  20. Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair

    Science.gov (United States)

    Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.; Rao, J. S.; Rayford, A. R.; Reddy, B. R.; Sears, J.; Thielke, R.; Ulm, M.; Vanderby, R.

    1994-01-01

    The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.

  1. T-Cadherin Expression in the Epidermis and Adnexal Structures of Normal Skin

    Science.gov (United States)

    Buechner, Stanislaw; Erne, Paul; Resink, Therese J.

    2016-01-01

    Background T-cadherin is an atypical glycosylphosphatidylinositol-anchored member of the cadherin superfamily of adhesion molecules. The role of T-cadherin in biology of the skin is poorly understood. Expression of T-cadherin in basal keratinocytes and dermal blood vessels of the healthy epidermis has been demonstrated, but studies on expression in skin appendages are rare. Methods We conducted an immunohistochemical analysis of T-cadherin expression in the epidermis and adnexal structures of normal skin. Results T-cadherin expression is restricted to basal keratinocytes of the epidermis. The basal cell layer of sebaceous glands was T-cadherin positive, whereas sebocytes were negative. Within apocrine glands, only myoepithelial cells were T-cadherin positive. In contrast, both the secretory coils and excretory ducts of eccrine glands were T-cadherin positive. In terminal hair follicles, the outer root sheath layers strongly expressed T-cadherin throughout different regions of the follicle, with the strongest immunoreactivity at the bulge and suprabulbar regions. T-cadherin and CK15 stem cell marker similarly localized within the bulge and suprabulbar region. T-cadherin and CD34 stem cell marker similarly localized at the suprabulbar level. Conclusion The specific patterns of T-cadherin expression in the epidermis and adnexal structures suggest an important guardian role in skin homeostasis. PMID:27904857

  2. Connective tissue growth factor promoter activity in normal and wounded skin

    Directory of Open Access Journals (Sweden)

    Kapoor Mohit

    2008-10-01

    Full Text Available Abstract In skin, connective tissue growth factor (CTGF/CCN2 is induced during tissue repair. However, what the exact cell types are that express CTGF in normal and wounded skin remain controversial. In this report, we use transgenic knock-in mice in which the Pacific jellyfish Aequorea victoria enhanced green fluorescent protein (E-GFP gene has been inserted between the endogenous CTGF promoter and gene. Unwounded (day 0 and wounded (days 3 and 7 skin was examined for GFP to detect cells in which the CTGF promoter was active, α-smooth muscle actin (α-SMA to detect myofibroblasts, and NG2 expression to detect pericytes. In unwounded mice, CTGF expression was absent in epidermis and was present in a few cells in the dermis. Upon wounding, CTGF expression was induced in the dermis. Double immunolabeling revealed that CTGF-expressing cells also expressed α-SMA, indicating the CTGF was expressed in myofibroblasts. A subset (~30% of myofibroblasts were also NG2 positive, indicating that pericytes significantly contributed to the number of myofibroblasts in the wound. Pericytes also expressed CTGF. Collectively, these results indicate that CTGF expression in skin correlates with myofibroblast induction, and that CTGF-expressing pericytes are significant contributors to myofibroblast activity during cutaneous tissue repair.

  3. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    Directory of Open Access Journals (Sweden)

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  4. PAX3 expression in normal skin melanocytes and melanocytic lesions (naevi and melanomas.

    Directory of Open Access Journals (Sweden)

    Sandra Medic

    Full Text Available BACKGROUND: Cutaneous Malignant Melanoma is an aggressive form of skin cancer, arising in cutaneous melanocytes. The transcription factor PAX3 regulates melanocyte specification from neural crest cells during development but expression in differentiated melanocytes is uncertain. By contrast it is frequently found in melanomas and naevi and is a marker for melanoma staging and detection. In this study we analysed the expression of PAX3 across the spectrum of melanocytic cells, from normal melanocytes to cells of benign and malignant lesions to better assess its function in these various tissues. Pax3 and PAX3 (italicized refer to the mouse and human gene, respectively; whereas Pax3 and PAX3 (non-italicized refer to the corresponding mouse and human protein. METHODOLOGY AND PRINCIPAL FINDINGS: PAX3 expression was analysed by immunohistochemistry and qRT-PCR. Immunofluorescence was used for co-expression with differentiation, migration and survival markers. As expected PAX3 expression was observed in naevi and melanoma cells. It was also found in melanocytes of normal skin where it co-expressed with melanocyte markers, MITF and MLANA. Co-expression with its downstream target, antiapoptotic factor BCL2L1 confirms PAX3 as a cell survival regulator. PAX3 was also co-expressed with melanoma cell migration marker MCAM in dermal naevi and melanoma cell nests, but this downstream target of PAX3 was not present in normal epidermal melanocytes, suggesting differential roles for PAX3 in normal epidermal melanocytes and melanoma cells. Most interestingly, a proportion of PAX3-positive epidermal melanocytes in normal skin show HES1 and Ki67 co-expression, indicating their less differentiated proliferative phenotype. CONCLUSIONS AND SIGNIFICANCE: Our results suggest that a previously identified role for PAX3, that of regulator of an undifferentiated plastic state, may operate in melanocytes of normal skin. This role, possibly required for cellular response to

  5. Are newly discovered drivers of immune-mediated skin disorders expressed in normal skin regenerating from standardized surface injury?

    NARCIS (Netherlands)

    Hendriks, A.G.M.; Keijsers, R.R.M.C.; Seyger, M.M.B.; Erp, P.E.J. van; Kerkhof, P.C.M. van de

    2014-01-01

    Background: In healthy skin, tape stripping induces a transient wave of histological changes resembling immune-mediated skin diseases, such as psoriasis. The response to surface trauma may harbor mechanisms which are also relevant to the development of Koebner-positive skin disorders. However, studi

  6. The early response of p53-dependent proteins during radiotherapy in human rectal carcinoma and in adjacent normal tissue

    NARCIS (Netherlands)

    Stift, A; Prager, G; Selzer, E; Widder, J; Kandioler, D; Friedl, J; Teleky, B; Herbst, F; Wrba, F; Bergmann, M

    2003-01-01

    The aim of this study was to investigate the activation of the p53 pathway and the induction of apoptosis during preoperative radiotherapy in normal human rectal tissue and in rectal carcinoma. Twelve patients with rectal cancer of the lower third were enrolled in this study. Tumor specimens and adj

  7. Elemental concentration in normal skin and fibroepithelial polip lesions by synchrotron radiation total reflection X-ray fluorescence technique

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T., E-mail: ricardo@lin.ufrj.br, E-mail: jcorsini@lin.ufrj.br [Nuclear Laboratory Instrumentation/COPPE, Federal University of Rio de Janeiro (UFRJ), Rio de Janeiro, RJ (Brazil); Anjos, Marcelino J., E-mail: marcelin@lin.ufrj.br [Physics Institute, State University of Rio de Janeiro (UERJ), Rio de Janeiro, RJ (Brazil)

    2011-07-01

    In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)

  8. Dynamic infrared imaging of cutaneous melanoma and normal skin in patients treated with BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Santa Cruz, G.A. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)], E-mail: santacr@cnea.gov.ar; Bertotti, J.; Marin, J. [Universidad Favaloro, Solis 453 (1078), Buenos Aires (Argentina); Gonzalez, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina); CONICET, Avda. Rivadavia 1917 (1033), Buenos Aires (Argentina); Gossio, S. [FCEyN, Pabellon II, Ciudad Universitaria (1428), Buenos Aires (Argentina); Alvarez, D. [Fundacion Favaloro, Av. Belgrano 1746 (1093), Buenos Aires (Argentina); Roth, B.M.C.; Menendez, P. [Instituto de Oncologia Angel H. Roffo, Av. San Martin 5481 (1417), Buenos Aires (Argentina); Pereira, M.D. [Agencia Nacional de Promocion Cientifica y Tecnologica, PAV 22393 (Argentina); Albero, M.; Cubau, L.; Orellano, P. [INVAP S.E., F.P. Moreno 1089 (R8400AMU), S.C. de Bariloche, Rio Negro (Argentina); Liberman, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)

    2009-07-15

    We recently initiated a program aimed to investigate the suitability of dynamic infrared imaging for following-up nodular melanoma patients treated with BNCT. The reason that makes infrared imaging attractive is the fact that it constitutes a functional and non-invasive imaging method, providing information on the normal and abnormal physiologic response of the nervous and vascular systems, as well as the local metabolic rate and inflammatory processes that ultimately appear as differences in the skin temperature. An infrared camera, with a focal plane array of 320x240 uncooled ferroelectric detectors is employed, which provides a video stream of the infrared emission in the 7-14 {mu}m wavelength band. A double blackbody is used as reference for absolute temperature calibration. After following a protocol for patient preparation and acclimatization, a basal study is performed. Subsequently, the anatomic region of interest is subjected to a provocation test (a cold stimulus), which induces an autonomic vasoconstriction reflex in normal structures, thus enhancing the thermal contrast due to the differences in the vasculature of the different skin regions. Radiation erythema reactions and melanoma nodules possess typically a faster temperature recovery than healthy, non-irradiated skin. However, some other non-pathological structures are also detectable by infrared imaging, (e.g. scars, vessels, arteriovenous anastomoses and injuries), thus requiring a multi-study comparison in order to discriminate the tumor signal. Besides the superficial nodules, which are readily noticeable by infrared imaging, we have detected thermal signals that are coincident with the location of non-palpable nodules, which are observable by CT and ultrasound. Diffuse regions of fast temperature recovery after a cold stimulus were observed between the third and sixth weeks post-BNCT, concurrent with the clinical manifestation of radiation erythema. The location of the erythematous visible and

  9. Dramatic Increase in Oxidative Stress in Carbon-Irradiated Normal Human Skin Fibroblasts

    Science.gov (United States)

    Laurent, Carine; Leduc, Alexandre; Pottier, Ivannah; Prévost, Virginie; Sichel, François; Lefaix, Jean-Louis

    2013-01-01

    Skin complications were recently reported after carbon-ion (C-ion) radiation therapy. Oxidative stress is considered an important pathway in the appearance of late skin reactions. We evaluated oxidative stress in normal human skin fibroblasts after carbon-ion vs. X-ray irradiation. Survival curves and radiobiological parameters were calculated. DNA damage was quantified, as were lipid peroxidation (LPO), protein carbonylation and antioxidant enzyme activities. Reduced and oxidized glutathione ratios (GSH/GSSG) were determined. Proinflammatory cytokine secretion in culture supernatants was evaluated. The relative biological effectiveness (RBE) of C-ions vs. X-rays was 4.8 at D0 (irradiation dose corresponding to a surviving fraction of 37%). Surviving fraction at 2 Gy (SF2) was 71.8% and 7.6% for X-rays and C-ions, respectively. Compared with X-rays, immediate DNA damage was increased less after C-ions, but a late increase was observed at D10% (irradiation dose corresponding to a surviving fraction of 10%). LPO products and protein carbonyls were only increased 24 hours after C-ions. After X-rays, superoxide dismutase (SOD) activity was strongly increased immediately and on day 14 at D0% (irradiation dose corresponding to a surviving fraction of around 0%), catalase activity was unchanged and glutathione peroxidase (GPx) activity was increased only on day 14. These activities were decreased after C-ions compared with X-rays. GSH/GSSG was unchanged after X-rays but was decreased immediately after C-ion irradiation before an increase from day 7. Secretion of IL-6 was increased at late times after X-ray irradiation. After C-ion irradiation, IL-6 concentration was increased on day 7 but was lower compared with X-rays at later times. C-ion effects on normal human skin fibroblasts seemed to be harmful in comparison with X-rays as they produce late DNA damage, LPO products and protein carbonyls, and as they decrease antioxidant defences. Mechanisms leading to this

  10. DNA methylation combinations in adjacent normal colon tissue predict cancer recurrence: evidence from a clinical cohort study.

    Directory of Open Access Journals (Sweden)

    Jen Chun Kuan

    Full Text Available Accumulating evidence has suggested the requirement for further stratification of patients in the same tumor stage according to molecular factors. We evaluate the combination of cancer stage and DNA methylation status as an indicator of the risk of recurrence and mortality among patients with colorectal cancer (CRC. A cohort study of 215 patients with CRC (mean age 64.32 years; 50.5% of men from Tri-Service General Hospital in Taiwan examined the association between cancer stage and risk of CRC recurrence and mortality. A Cox proportional hazard model was used to analyze patient methylation status and clinical information at study entry, and their associations with CRC recurrence and mortality during follow-up. The advanced stage patients with p16, hMLH1, and MGMT methylation were associated with higher risk of CRC recurrence compared with the local stage patients with unmethylation status in tumor tissues, with adjusted hazard ratios (HRs (95% confidence interval [CI] of 9.64 (2.92-31.81, 8.29 (3.40-20.22, and 11.83 (3.49-40.12, respectively. When analyzing normal tissues, we observed similar risk of CRC recurrence with adjusted HRs (95% CI of 10.85 (4.06-28.96, 9.04 (3.79-21.54, and 12.61 (4.90-32.44, respectively. For combined analyses, the risk of recurrence in the patients in advanced stage with DNA methylation in both normal and tumor tissues, compared with local stage with unmethylation, was increased with adjusted HR (95% CI of 9.37 (3.36-26.09. In the advanced stage patients, methylation status and tissue subtype were associated with increased risk of 5-year cumulative CRC recurrence (p < 0.001. This study demonstrates that clustering DNA methylation status according to cancer stage and tissue subtype is critical for the assessment of risk of recurrence in CRC patients and also indicated an underlying mechanism.

  11. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment.

    Science.gov (United States)

    Chen, Xinhua; James Swanson, R; Kolb, Juergen F; Nuccitelli, Richard; Schoenbach, Karl H

    2009-12-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pcell contraction and nuclear shrinkage while concurrently, but not permanently, damaging peripheral healthy skin tissue in the treated area, which we attribute to the highly localized electric fields surrounding the needle electrodes.

  12. Content of Androgen Receptor in Cultured Genital Skin Fibroblast From Different Ages of Chinese Normal Men

    Institute of Scientific and Technical Information of China (English)

    卢建; 何立敏; 张金山; 杨震; 周云

    1995-01-01

    A ratpid, simple, reliable method is described for assaying androgen receptor (AR) in dispersed, whole, cultured human genital skin fibroblasts (GSF) with a synthetic androgen, 3H-methyltrienolone (3H-R1881). Receptors for androgen in GSF exhiblt high affinity (Kd=3.0±0.1 nmol/L), low binding capacity and androgen specificity. The content of AR in cultured GSF from 40 normal men varying in age from 1.5—60 years u:as also investigated by this assay. Scatchard analysis and slngle plot revealed the presence of 4.500-8500 binding sites per cell, mean number of AR in GSF of these men is 6288±1082 binding sites/cell. No significant difference was observed in the content of AR in different age groups. This result showed that the content of AR in these ceils did not change with age.

  13. Transcriptome profiling of the cancer, adjacent non-tumor and distant normal tissues from a colorectal cancer patient by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Yan'an Wu

    Full Text Available Colorectal cancer (CRC is one of the most commonly diagnosed cancers in the world. A genome-wide screening of transcriptome dysregulation between cancer and normal tissue would provide insight into the molecular basis of CRC initiation and progression. Compared with microarray technology, which is commonly used to identify transcriptional changes, the recently developed RNA-seq technique has the ability to detect other abnormal regulations in the cancer transcriptome, such as alternative splicing, novel transcripts or gene fusion. In this study, we performed high-throughput transcriptome sequencing at ~50× coverage on CRC, adjacent non-tumor and distant normal tissue. The results revealed cancer-specific, differentially expressed genes and differential alternative splicing, suggesting that the extracellular matrix and metabolic pathways are activated and the genes related to cell homeostasis are suppressed in CRC. In addition, one tumor-restricted gene fusion, PRTEN-NOTCH2, was also detected and experimentally confirmed. This study reveals some common features in tumor invasion and provides a comprehensive survey of the CRC transcriptome, which provides better insight into the complexity of regulatory changes during tumorigenesis.

  14. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results of the determ...... the clinical score and the number of mast cell profiles per millimetre squared. Using stereological techniques, this study indicated that mast cells might participate in the inflammatory process in skin leading to atopic dermatitis.......Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...

  15. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  16. Photobiomodulation on the proliferation and collagen synthesis of normal human skin fibroblast cells

    Science.gov (United States)

    Cheng, Lei; Liu, Timon Cheng-Yi; Chi, Jin-Quan; Li, Yan; Jin, Hua

    2006-01-01

    Background and Objective: Cultured normal human skin fibroblast cells (HSFs) were once used to study the mechanism of the effects of low intensity He-Ne laser irradiation (LHNL) on wound healing. The proliferation and collagen synthesis of HFSs were modulated by LHNL in different papers, respectively, and both of them are studied in this paper. Study Design/Materials and Methods: The dosage was studied for the same radiation time 300s. The proliferation and collagen synthesis were measured by 3-[4,5-Dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay and the spectrophotometric method for the determination of hydroxyproline, respectively. Results: The dose zones were called dose 1, dose 2 and dose 3 from low dose on so that HSF proliferation was inhibited in dose 1 (16, 24 mJ/cm2), and promoted in dose 2 (298, 503, 597mJ/cm2), and the collagen synthesis was inhibited in dose 2 (401, 526 mJ/cm2), and promoted in dose 3 (714, 926, 1539, 1727mJ/cm2), which supports our biological model of photobiomodulation. It was found there is the linear relationship of the effect with dose with dose in each dose zone. Conclusions: The photobiomodulation on the proliferation and collagen synthesis of HSFs might be linearly dose-dependent in limited dosage with radiation time kept constant, which provides a foundation to discuss photobiomodulation on wound healing.

  17. Differences in collagen architecture between keloid, hypertrophic scar, normotrophic scar, and normal skin: An objective histopathological analysis.

    Science.gov (United States)

    Verhaegen, Pauline D H M; van Zuijlen, Paul P M; Pennings, Noor M; van Marle, Jan; Niessen, Frank B; van der Horst, Chantal M A M; Middelkoop, Esther

    2009-01-01

    Normotrophic, hypertrophic, and keloidal scars are different types of scar formation, which all need a different approach in treatment. Therefore, it is important to differentiate between these types of scar, not only clinically but also histopathologically. Differences were explored for collagen orientation and bundle thickness in 25 normal skin, 57 normotrophic scar, 56 hypertrophic scar, and 56 keloid biopsies, which were selected on clinical diagnosis. Image analysis was performed by fast fourier transformation. The calculated collagen orientation index ranged from 0 (random orientation) to 1 (parallel orientation). The bundle distance was calculated by the average distance between the centers of the collagen bundles. The results showed that compared with all three types of scars, the collagen orientation index was significantly lower in normal skin, which indicates that scars are organized in a more parallel manner. No differences were found between the different scars. Secondly, compared with normal skin, normotrophic scar, and hypertrophic scar, the bundle distance was significantly larger in keloidal scar, which suggests that thicker collagen bundles are present in keloidal scar. This first extensive histological study showed objective differences between normal skin, normotrophic, hypertrophic, and keloidal scar.

  18. CD3+ and BLA.36+ cells do not occur in the epidermis and adnexal epithelia of normal skin from the dorsolateral trunk of cats.

    Science.gov (United States)

    Tranchina, Michelle M; Scott, Danny W; McDonough, Sean P

    2010-10-01

    A small population of resident T-lymphocytes is present in the normal epidermis of humans, mice, and rats. However, resident epidermal lymphocytes have not been reported in the normal skin of the cat. Skin-biopsy specimens from the normal skin of the dorsolateral trunk from 30 cats were examined histologically and immunohistochemically for the presence of lymphocytes, CD3+ cells, and BLA.36+ cells in epidermis and adnexal epithelia. All examinations were negative. It appears that lymphocytes occur rarely, if at all, in the epidermis and adnexal epithelial of normal cat skin. Hence, the presence of lymphocytes in these structures should be considered abnormal.

  19. Analysis of differences of gene expressions in keloid and normal skin with the aid of cDNA microarray

    Institute of Scientific and Technical Information of China (English)

    Chen Wei; Fu Xiaobing; Sun Xiaoqing; Sun Tongzhu; Zhao Zhili; Yang Yinhui; Sheng Zhiyong

    2003-01-01

    Background: Microarray analysis is a popular tool to investigate the function of genes that are responsible for the phenotype of the disease. Keloid is a intricate lesion which is probably modulated by interplay of many genes. We ventured to study the differences of gene expressions between keloids and normal skins with the aid of cDNA microarray in order to explore the molecular mechanism underlying keloid formation. Methods: The PCR products of 8400 human genes were spotted on a chip in array. The DNAs were then fixed on the glass plate by a series of treatments. Total RNAs was isolated from freshly excised human keloids and normal skin, and then was purified to mRNA by Oligotex. Both the mRNA from keloids and normal skin was reversely transcribed to cDNAs with the incorporations of fluorescent dUTP, for preparing the hybridization probes. The mixed probes were then hybridized to the cDNA microarray. After highly stringent washing, the cDNA microarray was scanned for the fluorescent signals to display the differences between two kinds of tissues. Results: Among 8400 human genes, there were 402 genes (4.79%) with different expression levels between the keloids and normal skins in all cases, 250were up-regulated (2.98%) and 152 down-regulated (1.81%). Analyses of collagen, fibronectin, proteoglycan,growth factors and apoptosis related molecule gene expression confirmed that our molecular data obtained by cDNA microarray were consistent with published biochemical and clinical observations of keloids. Conclusions: DNA microarray technology is an effective technique in screening for differences in gene expression between keloid and normal skin. Many genes are involved in the formation of keloids. Further analysis of the obtained genes will help understand the molecular mechanism of keloid formation.

  20. Protoporphyrin IX formation and photobleaching in different layers of normal human skin: methyl- and hexylaminolevulinate and different light sources.

    Science.gov (United States)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A; Wulf, Hans Christian; Hædersdal, Merete

    2012-10-01

    Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18 and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than MAL-incubated skin (P dermis, fluorescence intensities were higher (37%) in HAL-treated skin than MAL-treated skin, although not significant (P = ns). At skin surface, photobleaching was significantly higher (90-98%) after LED illumination (18 and 37 J/cm²) than IPL (29-53%, 36 and 72 J/cm²) and LPDL (43-62%, 7 and 15 J/cm²) (P epidermis to deep dermis by LED illumination (37 J/cm², P = ns), but declined from epidermis to mid and deep dermis for IPL-treated skin and LPDL-treated skin (IPL 72 J/cm²: 26-15%; LPDL 15 J/cm²: 37-23%) (P < 0.04). Clinically, erythema correlated linearly with MAL and HAL-induced photobleaching (r² = 0.175, P < 0.001). In conclusion, selective PpIX accumulation indicates HAL as an alternative to MAL for epidermal-targeted PDT. In clinically relevant doses, PpIX photobleaching throughout the skin was more profound following LED than LPDL and IPL exposure.

  1. Differential gene expression profiling in aggressive bladder transitional cell carcinoma compared to the adjacent microscopically normal urothelium by microdissection-SMART cDNA PCR-SSH.

    Science.gov (United States)

    Wang, H T; Ma, F L; Ma, X B; Han, R F; Zhang, Y B; Chang, J W

    2006-01-01

    Identifying novel and known genes that are differentially expressed in aggressive bladder transitional cell carcinoma (BTCC) has important implications in understanding the biology of bladder tumorigenesis and developing new diagnostic and therapeutic agents. In this study we identified the differential gene expression profiles comparing tumor to the adjacent microscopically normal mucosa by manual microdissection on frozen sections. The RNAs extracted from microdissected tissues were amplified by SMART cDNA PCR technology to generate forward subtractive cDNA library by suppressive subtractive hybridization (SSH). We obtained 376 positive clones, one hundred clones of aggressive BTCC subtracted cDNA library were selected at random and inserts were reamplified by PCR. After differential screening by reverse dot blotting, 73 positive clones, that contend inserts putatively upregulated in aggressive BTCC, were further analysed by DNA sequencing, GenBank and EST database searching. Sequencing results showed that 66 clones stand for 23 known genes and 7 clones for three new EST (Genbank number: DN236875, DN236874 and DN236873). In conclusion, microdissection-SMART cDNA PCR-SSH allowed for an efficient way to identify aggressive BTCC-specific differential expressed genes that may potentially be involved in the carcinogenesis and/or progression of aggressive BTCC. These differentially expressed genes may be of potential utility as therapeutic and diagnostic targets for aggressive BTCC.

  2. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa.

    Science.gov (United States)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus; Miller, Iben M; Prens, Errol; Saunte, Ditte M; Bjarnsholt, Thomas; Jemec, Gregor B E

    2017-02-08

    Hidradenitis suppurativa (HS) is a chronic inflammatory skin disease defined by recurrent nodules, tunnels (sinus tracts) and scarring involving the intertriginous regions. The clinical course of HS is compatible with a biofilm-driven disease, and biofilm has been described in lesional HS skin. We therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid - fluorescence in situ hybridization probes were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease.

  3. Cultured skin keratinocytes from both normal individuals and basal cell naevus syndrome patients are more resistant to. gamma. -rays and UV light compared with cultured skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Stacey, M.; Thacker, S.; Taylor, A.M.R. (Birmingham Univ. (UK). Cancer Research Campaign Labs.)

    1989-07-01

    Measurement of colony-forming ability following exposure to {gamma}-rays was performed on cultured skin keratinocytes and skin fibroblasts from normal individuals, basal cell naevus syndrome patients (BCNS) and ataxia telangiectasia (A-T) patients. The most striking observation was the radiation resistance of 8/8 keratinocyte strains compared with fibroblasts whether from BCNS patients or normals. The single A-T keratinocyte cell strain showed the same radiosensitivity as A-T fibroblast cell strains. The differential survival of keratinocytes and fibroblasts was also observed following exposure to 254 nm UV light. Survival curves of SV40 immortalized keratinocytes and retinoblasts derived from normal individuals or BCNS patients showed large shoulder regions following exposure to {gamma}-rays or 254 nm UV light. An increased D{sub 37} rather than an increased D{sub o} was therefore the feature of such curves, contrasting with SV40 immortalized A-T keratinocytes or fibroblasts which showed a minimal shoulder effect and an increased D{sub o}. No difference in survival was observed between BCNS and normal cells following exposure to either UV or {gamma}-rays. (author).

  4. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....

  5. Subcellular Raman Microspectroscopy Imaging of Nucleic Acids and Tryptophan for Distinction of Normal Human Skin Cells and Tumorigenic Keratinocytes.

    Science.gov (United States)

    Piredda, Paola; Berning, Manuel; Boukamp, Petra; Volkmer, Andreas

    2015-07-07

    At present, tumor diagnostic imaging is commonly based on hematoxylin and eosin or immunohistochemical staining of biopsies, which requires tissue excision, fixation, and staining with exogenous marker molecules. Here, we report on label-free tumor imaging using confocal spontaneous Raman scattering microspectroscopy, which exploits the intrinsic vibrational contrast of endogenous biomolecular species. We present a chemically specific and quantitative approach to monitoring normal human skin cells (keratinocytes and fibroblasts) as well as the human HaCaT in vitro skin carcinogenesis model and the tumor-derived MET in vivo skin cancer progression model. Mapping the amplitudes of two spectrally well isolated Raman bands at 752 and 785 cm(-1) allowed for direct visualization of the distributions representative of tryptophan-rich proteins and nucleic acids, respectively, with subcellular spatial resolution. Using these Raman markers, it was feasible to discriminate between normal human epidermal keratinocytes (NHEK) and dermal fibroblasts (NHDF) and to confine all tumorigenic cells from both the NHEK and NHDF. First evidence for the successful application of the proposed intracellular nucleic acid and tryptophan Raman signatures for skin cancer diagnosis was further demonstrated in an organotypic cutaneous squamous cell carcinomas model, allowing for the identification of tumor cells and their surrounding stroma in the tissue context.

  6. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke;

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...... the diagnostic accuracy of OCT in differentiating NMSC from benign lesions and normal skin. METHODS AND MATERIALS OCT and polarization-sensitive (PS) OCT from 104 patients were studied. Observer-blinded evaluation of OCT images from 64 BCCs, 1 baso-squamous carcinoma, 39 AKs, two malignant melanomas, nine benign......-defined layering in OCT and PS-OCT images and dark lobules in BCC. Discrimination of AK from BCC had an error rate of 50% to 52%. CONCLUSION OCT features in NMSC are identified, but AK and BCC cannot be differentiated. OCT diagnosis is less accurate than clinical diagnosis, but high accuracy in distinguishing...

  7. Studies on 133Xe wash-out from human skin: quantitative measurements of blood flow in normal and corticosteroid-treated skin.

    Science.gov (United States)

    Kristensen, J K; Wadskov, S

    1977-04-01

    Blood flow was measured by the 133Xe technique in normal and corticosteroid-treated skin. Epicutaneous and intracutaneous methods of tracer application were compared in normal skin. The two labeling methods were equally suitable for measuring cutaneous blood flow provided calculations in both cases were based on a biexponential resolution of the wash-out curve in its cutaneous and subcutaneous components and provided the traumatic hyperemia phase was considered, when intracutaneous application of the tracer was used. Results were invalidated if calculations were based on initial slope of the wash-out curves.Topical application of beta-methasone valerate in a reduction in cutaneous blood flow as measured by the intracutaneous technique with curve resolution, whereas no effect could be demonstrated when calculations were based on the initial slopes of the curves. The 133Xe technique is a simple and reliable method for measuring cutaneous blood flow, which might prove useful in estimations of penetration ability and potency of topical corticosteroids.

  8. A study on electrical skin resistance in the lateral and medial forearm skin among normal skin cases%正常儿童和老年人前臂内外侧皮肤电阻值对比分析

    Institute of Scientific and Technical Information of China (English)

    许昌春; 张怀亮; 陈正琴

    2011-01-01

    目的 了解正常儿童皮肤与老年人光老化皮肤电阻值水平差异.方法 研制皮肤表面电阻值测定仪,对照检测41例12岁以下儿童与25例60岁以上的人群组前臂皮肤自然光暴露侧和非光暴露侧部位皮肤表面电阻值.结果 前臂光暴露部位皮肤电阻值显著高于非光暴露部位电阻值(P< 0.001),且老年组电阻值显著高于儿童组(P< 0.001).结论 不同部位不同年龄皮肤电阻值不同,皮肤电阻值与年龄的增加呈正相关.%Objective To study the electrical skin resistance between children's normal skin and the elderly photoagjng skin. Methods Using new developed electrical resistance value testers, the electrical resistance value of lateral and medial forearm skin were evaluated in groups of under 12 years old and above 60 years old. Results The electrical skin resistance of light exposured sites are significantly higher than that of non exposured sites (P<0.001). The electrical skin resistance of elder group is significantly higher than that of the children under 12 years old. (P<0.001). Conclusion Electrical skin resistance is changed with age and anatomy sites.

  9. Molecular pathway activation features linked with transition from normal skin to primary and metastatic melanomas in human.

    Science.gov (United States)

    Shepelin, Denis; Korzinkin, Mikhail; Vanyushina, Anna; Aliper, Alexander; Borisov, Nicolas; Vasilov, Raif; Zhukov, Nikolay; Sokov, Dmitry; Prassolov, Vladimir; Gaifullin, Nurshat; Zhavoronkov, Alex; Bhullar, Bhupinder; Buzdin, Anton

    2016-01-01

    Melanoma is the most aggressive and dangerous type of skin cancer, but its molecular mechanisms remain largely unclear. For transcriptomic data of 478 primary and metastatic melanoma, nevi and normal skin samples, we performed high-throughput analysis of intracellular molecular networks including 592 signaling and metabolic pathways. We showed that at the molecular pathway level, the formation of nevi largely resembles transition from normal skin to primary melanoma. Using a combination of bioinformatic machine learning algorithms, we identified 44 characteristic signaling and metabolic pathways connected with the formation of nevi, development of primary melanoma, and its metastases. We created a model describing formation and progression of melanoma at the level of molecular pathway activation. We discovered six novel associations between activation of metabolic molecular pathways and progression of melanoma: for allopregnanolone biosynthesis, L-carnitine biosynthesis, zymosterol biosynthesis (inhibited in melanoma), fructose 2, 6-bisphosphate synthesis and dephosphorylation, resolvin D biosynthesis (activated in melanoma), D-myo-inositol hexakisphosphate biosynthesis (activated in primary, inhibited in metastatic melanoma). Finally, we discovered fourteen tightly coordinated functional clusters of molecular pathways. This study helps to decode molecular mechanisms underlying the development of melanoma.

  10. Noninvasive evaluation of collagen and hemoglobin contents and scattering property of in vivo keloid scars and normal skin using diffuse reflectance spectroscopy: pilot study

    Science.gov (United States)

    Tseng, Sheng-Hao; Hsu, Chao-Kai; Yu-Yun Lee, Julia; Tzeng, Shih-Yu; Chen, Wan-Rung; Liaw, Yu-Kai

    2012-07-01

    Collagen is a rich component in skin that provides skin structure integrity; however, its contribution to the absorption and scattering properties of various types of skin has not been extensively studied. We considered the contribution of the collagen to the absorption spectrum of in vivo normal skin and keloids of 12 subjects derived from our diffuse reflectance spectroscopy (DRS) system in the wavelength range from 550 to 860 nm. It was found that the collagen concentration, the hemoglobin oxygen saturation, and the reduced scattering coefficient of keloids were remarkably different from that of normal skin. Our results suggest that our DRS system could assist clinicians in understanding the functional and structural condition of keloid scars. In the future, we will evaluate the accuracy of our system in the keloid diagnosis and investigate the applicability of our system for other skin-collagen-related studies.

  11. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    Goodwin. “ Anatomy and Physiology of the Skin”. Journal of the Dermatology Nurses ’ Association, 3(4):203–213, 2011. [22] Kou, Linhong, Daniel Labrie, and...Summary Four important topics were covered in this chapter that is essential to understanding this thesis. First, the anatomy and physiology of human skin...Hyperspectral remote sensing: principles and applications. Crc Press, 2010. [5] Boundless. Anatomy and Physiology . Boundless Learning, 2013. URL http://books

  12. Occurrence of vascular IgA deposits in clinically normal skin of patients with renal disease.

    Science.gov (United States)

    Faille-Kuyper, E H; Kater, L; Kuijten, R H; Kooiker, C J; Wagenaar, S S; van der Zouwen, P; Mees, E J

    1976-05-01

    Skin and kidney biopsies were performed on 262 patients with various nephropathies. In 45 skin biopsy specimens finely granular deposits of predominantly IgA and late-acting complement factors were detected in the walls of superficial capillaries, sometimes concomitantly with IgM, IgG, C4 or a combination of these proteins. Twelve of the 45 patients presented with anaphylactoid purpura and the majority of the other 33 patients had either recurrent macroscopic or microscopic hematuria. The renal lesions in 32 of these 45 patients consisted of focal segmental intracapillary proliferation. In 35 the kidney biopsy specimen showed mesangial deposits of IgA; in one case IgA was deposited along the glomerular basement membrane. In only three of the remaining 217 patients without cutaneous IgA deposits were typical mesangial IgA deposits found. The close correlation between IgA deposits in cutaneous vessels and focal segmental intracapillary proliferation with mesangial IgA deposits suggests that immunofluorescence examination of skin biopsy specimens could prove of diagnostic value. The results provide additional evidence for a close pathogenic relationship between IgA-associated glomerulonephritis and anaphylactoid purpura.

  13. Percutaneous absorption of estradiol and progesterone in normal and appendage-free skin of the hairless rat: lack of importance of nutritional blood flow.

    Science.gov (United States)

    Hueber, F; Besnard, M; Schaefer, H; Wepierre, J

    1994-01-01

    Percutaneous absorption occurs after passive diffusion through the different layers of the skin and its appendages. Thereafter, a resorption process into the cutaneous microcirculation brings the compounds into the systemic circulation. The objective of this in vivo study in the hairless rat was to compare the percutaneous absorption of two steroids on normal and appendage-free (scar) skin and to show if differences in absorption result only from the lack of hair follicles and sebaceous glands and/or from a modification of local blood flow. Percutaneous absorption was evaluated with estradiol and progesterone after 30 min, 2 and 6 h. Except after 30 min, the reservoir function of the stratum corneum of scar skin was approximately twice as high as in normal skin. Eighty to ninety percent of the estradiol and progesterone found in the stratum corneum were located in its superficial layers. Inversely, whatever the application time was, the concentrations of both steroids in the epidermis and dermis were significantly higher in normal skin than in scar skin with maximal difference between about 40 and 400 microns, the area of sebaceous gland localization. Cutaneous blood flow in full-thickness skin, assessed by the thallium-201 method, was globally identical in normal and in scar skin. In scar skin, at the level of papillary dermis, a decrease in blood flow due to the thicker viable epidermis and the flat dermoepidermal junction has been shown without implying an accumulation of drug in the epidermis and superficial dermis. Under these conditions, our results clearly demonstrate that the nutritional blood flow does not interfere with the percutaneous absorption of estradiol and progesterone in normal and scar skin. Thus, they confirm the significant contribution of hair follicles and sebaceous glands to drug penetration into the skin and subsequently the systemic circulation.

  14. Localization and activity of tissue bound cyclic nucleotide phosphodiesterase in normal and lack of changes in psoriatic human skin.

    Science.gov (United States)

    Mahrle, G; Organos, C E

    1976-12-01

    This study has been undertaken to elucidate the localization and the activity of cyclic nucleotide phosphodiesterase (PDE) in psoriatic epidermis compared to normal. The results showed that the evaluation of cytochemical methods may be difficult because of the various factors which interfere with the reaction and the considerable amount of background staining. Additionally, only the tissue bound particulate enzyme fraction may be demonstrated by cytochemical means. Nevertheless, the method did reveal that the activity of PDE, if any, is localized on the cytoplasmic membranes of the cells, independent of their origin, and not on the cell surface. Moreover, no differences were found between normal and psoriatic skin. It seems, therefore, that the intracellular degradation of cAMP remains unaltered in psoriasis.

  15. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Science.gov (United States)

    Netchareonsirisuk, Ponsawan; Puthong, Songchan; Dubas, Stephan; Palaga, Tanapat; Komolpis, Kittinan

    2016-11-01

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5-15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO3 alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC50), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84-90 %) than necrosis (8-12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  16. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  17. Characterisation of a behavioural protocol for the assessment of nociception in normal and inflamed porcine skin

    DEFF Research Database (Denmark)

    di Giminiani, Pierpaolo

    2012-01-01

    of behavioural cutaneous nociception was performed via the assessment of differences in cutaneous pain sensitivity as determined by the body size of the animals, the anatomical locations of interest and the sensory modalities involved. Consequently, this new protocol allowed measuring the change in cutaneous...... pain sensitivity following ultraviolet-B and capsaicin-induced inflammation in porcine skin. A series of experiments was performed to characterise the new experimental protocol, which included (1) the identification and quantification of reflexive behavioural responses indicative of the nociceptive...... pain sensitivity, although associated with high levels of individual variability. The nociceptive assays proved to be valuable in measuring the development of altered cutaneous pain sensitivity following two inflammatory challenges. Behavioural signs of hyperalgesia were recorded in pigs exposed...

  18. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  19. 超声生物显微镜在正常人及银屑病患者皮肤研究中的应用%Application of ultrasound biomicroscopy on skin assessment in normal adults and psoriasis patients

    Institute of Scientific and Technical Information of China (English)

    李硕; 梁晓宁; 张岩; 刘翠霞; 黄雅丽; 卢瑞刚; 郭瑞君

    2015-01-01

    ObjectiveTo investigate the features of normal and psoriasis skin on ultrasound biomicroscopy (UBM) and explore the method of thickness measurement.MethodsUsing 50 MHz ultrasound probe of biological microscope, ultrasonographic observation and ultrasonic thickness measurement were conducted in 90 normal adults and 40 psoriasis patients. Innormal patients, ultrasound evaluations were performed at 10 different parts of the body skin.ResultsOn sonogram, the normal skin showed a “sandwich” structure with two parallel hyperechoic bands and the middle isoechoic dots and short liens. The sonograms of the psoriasis skin showed obviously thickened epidermis and dermis, disordered internal structure and clear boundary from adjacent normal skin. The range of the epidermis’ thickness measurement was between the medial forearm (0.12±0.03) mm and the palm (0.29±0.15) mm. The range of dermal thickness measurement was between the back hand (1.18±0.32) mm and parasternal (1.55±0.21) mm. Psoriasis skin was thicker than the uninvolved skin (P<0.001). And the dermis’ thickness of uninvolved skin in psoriasis patients was thicker than that of the normal adults (P<0.001).ConclusionNormal adult’s epidermis, dermis and skin appendages can be shown clearly using 50 MHz ultrasound biomicroscopy. And ultrasound biomicroscopy canaccurately measure the thickness of dermis and epidermis, which provides the basis for the diagnosis and treatment of psoriasis.%目的探讨正常人皮肤及银屑病患者皮肤超声生物显微镜声像图特征及厚度测量方法。方法使用50 MHz探头的超声生物显微镜,对90例正常成人全身10个不同部位的皮肤以及40例银屑病患者皮肤进行声像观察及超声测厚。结果正常皮肤声像图表现为两条平行的强回声细带,中间为密集点状中等回声及稍强线样回声带。银屑病患者皮肤声像图表现为表皮、真皮明显增厚,结构紊乱,与正常皮肤界限清晰。测量

  20. Dermal fibroblast expression of stromal cell-derived factor-1 (SDF-1) promotes epidermal keratinocyte proliferation in normal and diseased skin.

    Science.gov (United States)

    Quan, Chunji; Cho, Moon Kyun; Shao, Yuan; Mianecki, Laurel E; Liao, Eric; Perry, Daniel; Quan, Taihao

    2015-12-01

    Stromal cells provide a crucial microenvironment for overlying epithelium. Here we investigated the expression and function of a stromal cell-specific protein, stromal cell-derived factor-1 (SDF-1), in normal human skin and in the tissues of diseased skin. Immunohistology and laser capture microdissection (LCM)-coupled quantitative real-time RT-PCR revealed that SDF-1 is constitutively and predominantly expressed in dermal stromal cells in normal human skin in vivo. To our surprise, an extremely high level of SDF-1 transcription was observed in the dermis of normal human skin in vivo, evidenced by much higher mRNA expression level than type I collagen, the most abundant and highly expressed protein in human skin. SDF-1 was also upregulated in the tissues of many human skin disorders including psoriasis, basal cell carcinoma (BCC), and squamous cell carcinoma (SCC). Double immunostaining for SDF-1 and HSP47 (heat shock protein 47), a marker of fibroblasts, revealed that fibroblasts were the major source of stroma-cell-derived SDF-1 in both normal and diseased skin. Functionally, SDF-1 activates the ERK (extracellular-signal-regulated kinases) pathway and functions as a mitogen to stimulate epidermal keratinocyte proliferation. Both overexpression of SDF-1 in dermal fibroblasts and treatment with rhSDF-1 to the skin equivalent cultures significantly increased the number of keratinocyte layers and epidermal thickness. Conversely, the stimulative function of SDF-1 on keratinocyte proliferation was nearly completely eliminated by interfering with CXCR4, a specific receptor of SDF-1, or by knock-down of SDF-1 in fibroblasts. Our data reveal that extremely high levels of SDF-1 provide a crucial microenvironment for epidermal keratinocyte proliferation in both physiologic and pathologic skin conditions.

  1. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Science.gov (United States)

    Ghita, Mihaela; Moraru, Liliana; Voiculescu, Suzana; Greabu, Maria

    2016-01-01

    Squamous cells carcinoma (SCC) is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides), and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies. PMID:27642215

  2. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Directory of Open Access Journals (Sweden)

    Vlad Voiculescu

    2016-01-01

    Full Text Available Squamous cells carcinoma (SCC is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides, and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies.

  3. Canine epidermal lipid sampling by skin scrub revealed variations between different body sites and normal and atopic dogs

    OpenAIRE

    Angelbeck-Schulze, Mandy; Mischke, Reinhard; Rohn, Karl; Hewicker-Trautwein, Marion; Naim, Hassan Y.; Bäumer, Wolfgang

    2014-01-01

    Background Previously, we evaluated a minimally invasive epidermal lipid sampling method called skin scrub, which achieved reproducible and comparable results to skin scraping. The present study aimed at investigating regional variations in canine epidermal lipid composition using the skin scrub technique and its suitability for collecting skin lipids in dogs suffering from certain skin diseases. Eight different body sites (5 highly and 3 lowly predisposed for atopic lesions) were sampled by ...

  4. Establishment of field change by expression of cytokeratins 8/18, 19, and MMP-9 in an apparently normal oral mucosa adjacent to squamous cell carcinoma: A immunohistochemical study

    Directory of Open Access Journals (Sweden)

    Alka D Kale

    2012-01-01

    Full Text Available Background: Squamous cell carcinoma is the most frequent malignancy of the oral cavity. The survival rate of this malignancy has not improved from past two decades. The major factors responsible for this could be due to loco regional and distant metastatic spread. However, the other important prognostic factor is concomitant occurrence and recurrence of multiple primary carcinomas in the head and neck region, which is explained as the concept of field cancerization. The evidence to support the field change in normal mucosa of Oral squamous cell carcinoma (OSCC through biological markers using immunohistochemistry has always been challenging. Aim: Hence, the aim of the present research is to identify changes in the expression of CK 8/18, 19, and MMP-9 to visualize field changes in the clinically normal mucosa adjacent to OSCC and compare with non neoplastic normal oral mucosa. Materials and Methods: 20 cases of OSCC with radical resection specimens were included in the study. Lesional tissue and adjacent normal looking mucosa were taken during grossing. Ten cases of non-neoplastic normal oral mucosa are also included in the study. Markers such as CK 8/18, CK 19, and MMP-9 are used by the immunohistochemical method in this present study. Result and Conclusion: The enhance expression of CK 8/18 (80%, CK 19 (70%, and MMP 9 (90% in ANM was noted and furthermore in six ANM showing severe dysplasia with enhance expression of CK 8/18, CK 19, and MMP 9 in the apparently normal oral mucosa can suggest a field cancerization.

  5. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  6. Validation of a diagnostic algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma by means of high-definition optical coherence tomography.

    Science.gov (United States)

    Marneffe, Alice; Suppa, Mariano; Miyamoto, Makiko; Del Marmol, Véronique; Boone, Marc

    2016-09-01

    Actinic keratoses (AKs) commonly arise on sun-damaged skin. Visible lesions are often associated with subclinical lesions on surrounding skin, giving rise to field cancerization. To avoid multiple biopsies to diagnose subclinical/early invasive lesions, there is an increasing interest in non-invasive diagnostic tools, such as high-definition optical coherence tomography (HD-OCT). We previously developed a HD-OCT-based diagnostic algorithm for the discrimination of AK from squamous cell carcinoma (SCC) and normal skin. The aim of this study was to test the applicability of HD-OCT for non-invasive discrimination of AK from SCC and normal skin using this algorithm. Three-dimensional (3D) HD-OCT images of histopathologically proven AKs and SCCs and images of normal skin were collected. All images were shown in a random sequence to three independent observers with different experience in HD-OCT, blinded to the clinical and histopathological data and with different experience with HD-OCT. Observers classified each image as AK, SCC or normal skin based on the diagnostic algorithm. A total of 106 (38 AKs, 16 SCCs and 52 normal skin sites) HD-OCT images from 71 patients were included. Sensitivity and specificity for the most experienced observer were 81.6% and 92.6% for AK diagnosis and 93.8% and 98.9% for SCC diagnosis. A moderate interobserver agreement was demonstrated. HD-OCT represents a promising technology for the non-invasive diagnosis of AKs. Thanks to its high potential in discriminating SCC from AK, HD-OCT could be used as a relevant tool for second-level examination, increasing diagnostic confidence and sparing patients unnecessary excisions.

  7. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  8. Selection of a set of reliable reference genes for quantitative real-time PCR in normal equine skin and in equine sarcoids

    Directory of Open Access Journals (Sweden)

    Gasthuys Frank

    2006-04-01

    Full Text Available Abstract Background Real-time quantitative PCR can be a very powerful and accurate technique to examine gene transcription patterns in different biological conditions. One of the critical steps in comparing transcription profiles is accurate normalisation. In most of the studies published on real-time PCR in horses, normalisation occurred against only one reference gene, usually GAPDH or ACTB, without validation of its expression stability. This might result in unreliable conclusions, because it has been demonstrated that the expression levels of so called "housekeeping genes" may vary considerably in different tissues, cell types or disease stages, particularly in clinical samples associated with malignant disease. The goal of this study was to establish a reliable set of reference genes for studies concerning normal equine skin and equine sarcoids, which are the most common skin tumour in horses. Results In the present study the gene transcription levels of 6 commonly used reference genes (ACTB, B2M, HPRT1, UBB, TUBA1 and RPL32 were determined in normal equine skin and in equine sarcoids. After applying the geNorm applet to this set of genes, TUBA1, ACTB and UBB were found to be most stable in normal skin and B2M, ACTB and UBB in equine sarcoids. Conclusion Based on these results, TUBA1, ACTB and UBB, respectively B2M, ACTB and UBB can be proposed as reference gene panels for accurate normalisation of quantitative data for normal equine skin, respectively equine sarcoids. When normal skin and equine sarcoids are compared, the use of the geometric mean of UBB, ACTB and B2M can be recommended as a reliable and accurate normalisation factor.

  9. Demonstration of characteristic skin surface contours of extramammary Paget's disease and parapsoriasis en plaque by image analysis of negative impression replicas.

    Science.gov (United States)

    Kikuchi, Katsuko; Aiba, Setsuya; O'Goshi, Ken-ichiro; Yanai, Motohiro; Takahashi, Motoji; Kasai, Hidefumi; Tagami, Hachiro

    2002-10-01

    The surface contours of lesional skin of certain skin diseases, such as parapsoriasis en plaque (PEP) and extramammary Paget's disease (EMPD), in which there is a massive infiltration by non-epidermal cells, looks somewhat different from that of the adjacent normal skin, needless to state that they are apparently different from that of ordinary chronic inflammatory dermatoses where we found acanthotic epidermis accompanied by hyperkeratosis. We attempted to objectively characterize these unique skin surface changes qualitatively and quantitatively using non-invasive methods. Negative impression replicas were taken from the lesional skin of patients with EMPD or PEP as well as from the adjacent uninvolved skin. The findings were confirmed histologically. The replicas were examined by using computerized image analysis. Several parameters were analyzed that correlate with the changes in the anisotropy of the skin furrows (VC1), average skin roughness (KSD), average length of skin furrows (LEN), and number of skin furrows (NUM). There were significant decreases in KSD and NUM in EMPD, indicating a smoother skin surface in the lesional skin than in the adjacent normal skin. In contrast, the PEP lesion had an increase in VC1 and LEN and a decrease in NUM, which suggests larger skin ridges in the lesional skin than in the uninvolved skin. Thus the unique skin surface of the cutaneous disorders accompanied by epidermal invasion by non-epidermal cells, such as EMPD and PEP, was characterized both qualitatively and quantitatively using computerized image analysis of negative impression replicas.

  10. Erythema persists longer than one year in split-thickness skin graft donor sites

    DEFF Research Database (Denmark)

    Danielsen, Patricia L; Jorgensen, Lars N; Jørgensen, Bo;

    2013-01-01

    The recovery of skin function and appearance after harvest of split-thickness skin autografts is incompletely described. We followed the kinetics of skin restoration after a partial-thickness skin excision relative to adjacent normal skin over 12 months. Standardized donor site wounds were made...... on the thigh using a pneumatic dermatome in 19 consecutive Caucasian patients, median age 70 years, age range 44-86 years, who were undergoing skin graft surgery for leg ulcers. Transepidermal water loss (TEWL), erythema and pigmentation were measured quantitatively using non-invasive devices....... The macroscopically healed wound was compared with adjacent normal skin at 1, 3 and 12 months. At 1 month postoperatively, TEWL was 108% (p = 0.003), erythema 145% (p ...

  11. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells.

  12. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  13. Skin fold thickness at abdomen: a simple anthropometric measurement may compliment metabolic syndrome definition in patients with normal waist circumference

    Institute of Scientific and Technical Information of China (English)

    Toan C Nguyen; Thai Q Ngo; Son V Nguyen; Hieu T Luong; Khoa TA Pham; Cong D Nguyen

    2006-01-01

    Backgroud and Objectives Previous studies have reported that skin fold thickness (SF) strongly correlated with insulin resistance in the metabolic syndrome (MetS). In this study, we developed a MetS definition by SF at A8 point (SFA8) on Erdheim diagram(MetSSFA8) in essential hypertensive patients. Subjects and Methods Medical records of 268 essential hypertensive patients (126males and 122 females) were analyzed, including 210 non-diabetic patients (NDM group) and 58 patients with diabetes (DM group).The mean age was 61.4 ± 9.9 and 59.0 ± 11.0 years, respectively. The control group consisted of 90 non-diabetic, non-hypertensive patients with a mean age of 58.0 ± 11.3 years. The proposed MetSSFA8 definition included SFA8 specific values ( ≥30 mm in female and ≥27 mm in male) and at least two of the following: raised triglyceride levels ( ≥1.7 mmol/L), or specific treatment for this lipid abnormality; raised blood pressure (SBP≥130 mmHg and/or DBP≥85 mmHg), or treatment of previously diagnosed hypertension;reduced HDL-cholesterol (< 1.03 mmol/L in men, <1.29 mmol/L in women), or specific treatment for this lipid abnormality; raised fasting plasma glucose (≥5.6 mmol/l), or previously diagnosed DM. Metabolic Syndrome by the National Cholesterol Education Program and International Diabetes Federation definitions were determined with abdominal obesity defined by Asia-Pacific criteria for waist circumference (NCEPA and IDFA). Results The percentage of MetS as defined by NCEPA, IDFA and MetSSFA8 in NDM group was lower than that of NCEPA, IDFA and MetSSFA8 in DM group [OR=7.7 (95%CI, 2.9-20.2) and 2.5 (95%CI, 1.4-4.8) and 2.7(95%CI, 1.3-5.6), respectively] and higher than that of the control group [OR=53.3 (95%CI, 16.7-170.6), 5.8 (95%CI, 2.6-13.2) and18.8 (95%CI, 7.3-48.7), respectively]. The percentage of MetS by NCEPA, IDFA and MetSSFA8 in males in NDM group was lower than the percentage of MetS by NCEPA, IDFA and MetSSFA8 in females in NDM group (50

  14. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  15. Role of transepidermal and transfollicular routes in percutaneous absorption of steroids: in vitro studies on human skin.

    Science.gov (United States)

    Hueber, F; Schaefer, H; Wepierre, J

    1994-01-01

    Percutaneous absorption theoretically comprises two components: the transepidermal and the transfollicular routes. The aim of the present work was to confirm this hypothesis in the human skin by comparing the in vitro percutaneous absorption of four steroids through scar skin without hair follicles and sebaceous glands and through normal adjacent skin from abdominal or mammary plasties. In all cases, the absorption of the four steroids was significantly higher in normal skin than in scar skin. The cumulative percentages of progesterone and testosterone after 8 h of application were, respectively, 3.1- and 2.4-fold higher in normal skin than in scar skin. After 24 h of application, the cumulative percentages of estradiol and hydrocortisone were 1.7- and 2.4-fold higher in normal skin than in scar skin. At the end of the experiments, the quantities of drugs remaining in the skin after 8 or 24 h of application were the same in normal skin and in scar skin except for progesterone for which they were 2-fold greater in normal than in scar skin. In each case, a histological characterization of the scar skin was made in comparison with the normal adjacent skin. The main modifications observed on scar skin were the following: absence of hair follicles and sebaceous glands, thinning of the collagenous fibers with parallel orientation to the dermoepidermal junction and decrease in the number or disappearance of the elastic fibers. These experiments confirmed that human skin appendages, hair follicles and sebaceous glands, constitute a route of penetration for steroids and thus probably for other chemicals of similar molecular weight and properties.

  16. Effects of dietary flax seed and sunflower seed supplementation on normal canine serum polyunsaturated fatty acids and skin and hair coat condition scores.

    Science.gov (United States)

    Rees, C A; Bauer, J E; Burkholder, W J; Kennis, R A; Dunbar, B L; Bigley, K E

    2001-04-01

    This prospective study involved supplementing 18 normal dogs with flax seed (FLX) and sunflower seed (SUN) and evaluating their effects on skin and hair coat condition scores and serum polyunsaturated fatty acids (PUFA) concentrations. Skin and hair coat were evaluated in a double-blinded fashion using a numeric scoring system and serum PUFA concentrations were determined. Our hypothesis was that changes in serum PUFA concentrations are associated with improvements in skin and hair coat and that serum PUFA would provide an objective method for making dietary fatty acid supplement recommendations. Although a numerical improvement was found in hair coat quality in both groups, this improvement was not sustained beyond 28 days. The relative per cent of 18:3n-3 concentrations in serum phospholipids increased in the FLX treated dogs but these concentrations remained unchanged in the SUN treated dogs. Also, elevations in relative per cent of 18:2n-6 concentrations in serum phospholipids were seen in the FLX group. The ratio of serum polyunsaturated to saturated fatty acids also showed a transient increase. These increases preceded the peak skin condition score peak value by approximately 14 days. It was concluded that a 1-month supplementation with either flax seed or sunflower seed in dogs provides temporary improvement in skin and hair coat. These changes appeared to be associated with increased serum 18 carbon PUFA.

  17. Expression and localization of peroxisome proliferator-activated receptors and nuclear factor kappaB in normal and lesional psoriatic skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology......-mediated transactivation was partially relieved by forced expression of the coactivators p300 or CBP. We suggest that deficient NF-kappaB activation in chronic psoriatic plaques permitting unabated PPARdelta-mediated transactivation contributes to the pathologic phenotype of psoriasis....

  18. Measurement of serum immunoglobulin E (IgE) specific for house dust mite antigens in normal cats and cats with allergic skin disease.

    Science.gov (United States)

    Taglinger, K; Helps, C R; Day, M J; Foster, A P

    2005-05-01

    The purpose of this study was to determine whether cats with allergic skin disease have significant concentrations of serum Immunoglobulin E (IgE) specific for antigens derived from the house dust mites (HDM) Dermatophagoides farinae (DF) and Dermatophagoides pteronyssinus (DP). Enzyme-linked immunosorbent assays (ELISA) were developed for this purpose. Binding of serum allergen-specific IgE was detected via the use of biotinylated Fc-epsilon receptor alpha chain protein (FcvarepsilonRIalpha). Following optimisation of the assay, serum samples from 59 cats with allergic skin disease and 54 clinically normal cats were screened. Results were expressed as ELISA units per ml (EU/ml) compared to a standard curve. Serological findings were correlated with the clinical presentation of affected cats. Cats with symptoms of feline allergic skin disease were grouped as follows: self-induced alopecia without lesions (group 1), papulocrusting dermatitis (group 2), eosinophilic granuloma complex (group 3), papular/ulcerative dermatitis of head and neck/facial dermatitis (group 4), and a combination of symptoms (group 5). Control normal cats comprised the final group (group 6). The Kruskal-Wallis test was used for statistical analysis. There was no significant difference between groups for DF- and DP-specific IgE concentrations with a p-value of 0.875 and 0.705, respectively. Although the FcvarepsilonRIalpha-based ELISA was able to detect house dust mite-specific feline IgE, the presence of this allergen-specific IgE correlates poorly with the presence of clinical manifestations of allergic skin disease. The results of this study question the clinical relevance of house dust mite-specific IgE in feline allergic skin disease.

  19. Loss of normal profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin disease ichthyosis vulgaris.

    Science.gov (United States)

    Presland, R B; Boggess, D; Lewis, S P; Hull, C; Fleckman, P; Sundberg, J P

    2000-12-01

    Flaky tail (gene symbol ft) is an autosomal recessive mutation in mice that results in a dry, flaky skin, and annular tail and paw constrictions in the neonatal period. Previous studies demonstrated that the ft mutation maps to the central region of mouse chromosome 3, in the vicinity of the epidermal differentiation complex, a gene locus that includes many nonkeratin genes expressed in epidermis. In this study we report a detailed characterization of the flaky tail mouse. Affected homozygous ft/ft mice exhibit large, disorganized scales on tail and paw skin, marked attenuation of the epidermal granular layer, mild acanthosis, and orthokeratotic hyperkeratosis. Biochemical analysis demonstrated that ft/ft mice lacked normal high molecular profilaggrin (approximately 500 kDa), and instead expressed a lower molecular weight form of profilaggrin (220 kDa) that is not proteolytically processed to profilaggrin intermediates or filaggrin. Mutant mice lacked the large, irregular F-type keratohyalin granules that contain profilaggrin, and filaggrin was absent from the cornified layers of ft/ft epidermis. The expression of epidermal keratins was unchanged, whereas the cornified envelope proteins involucrin and loricrin were increased in ft/ft epidermis. Cultured ft/ft keratinocytes also synthesized reduced amounts of profilaggrin mRNA and protein, demonstrating that the defect in profilaggrin expression is intrinsic to epidermal cells. These findings demonstrate that flaky tail mice express an abnormal profilaggrin polypeptide that does not form normal keratohyalin F-granules and is not proteolytically processed to filaggrin. We propose that the absence of filaggrin, and in particular the hygroscopic, filaggrin-derived amino acids that are thought to function in epidermal hydration, underlies the dry, scaly skin characteristic of ft/ft mice. This animal model provides a tool for understanding the role of filaggrin in normal epidermal function and may provide insight into

  20. Redox-dependent induction of antioxidant defenses by phenolic diterpenes confers stress tolerance in normal human skin fibroblasts: Insights on replicative senescence.

    Science.gov (United States)

    Carvalho, Ana C; Gomes, Andreia C; Pereira-Wilson, Cristina; Lima, Cristovao F

    2015-06-01

    Mild stress-induced hormesis represents a promising strategy for targeting the age-related accumulation of molecular damage and, therefore, for preventing diseases and achieving healthy aging. Fruits, vegetables, and spices contain a wide variety of hormetic phytochemicals, which may explain the beneficial health effects associated with the consumption of these dietary components. In the present study, the induction of cellular antioxidant defenses by the phenolic diterpenes carnosic acid (CA) and carnosol (CS) were studied in normal human skin fibroblasts, and insights into the aging process at the cellular level investigated. We observed that CA and CS induced several cytoprotective enzymes and antioxidant defenses in human fibroblasts, whose induction was dependent on the cellular redox state for CS and associated with Nrf2 signaling for both compounds. The stress response elicited by preincubation with CS conferred a cytoprotective action against a following oxidant challenge with tert-butyl hydroperoxide, confirming its hormetic effect. Preincubation of normal fibroblasts with CS also protected against hydrogen peroxide-induced premature senescence. Furthermore, cultivation of middle passage normal human skin fibroblasts in the presence of CS ameliorated the physiological state of cells during replicative senescence. Our results support the view that mild stress-induced antioxidant defenses by CS can confer stress tolerance in normal cells and may have important implications in the promotion of healthy aging.

  1. IgG and IgA with Potential Microbial-Binding Activity Are Expressed by Normal Human Skin Epidermal Cells

    Directory of Open Access Journals (Sweden)

    Dongyang Jiang

    2015-01-01

    Full Text Available The innate immune system of the skin is thought to depend largely on a multi-layered mechanical barrier supplemented by epidermis-derived antimicrobial peptides. To date, there are no reports of antimicrobial antibody secretion by the epidermis. In this study, we report the expression of functional immunoglobulin G (IgG and immunoglobulin A (IgA, previously thought to be only produced by B cells, in normal human epidermal cells and the human keratinocyte line HaCaT. While B cells express a fully diverse Ig, epidermal cell-expressed IgG or IgA showed one or two conservative VHDJH rearrangements in each individual. These unique VDJ rearrangements in epidermal cells were found neither in the B cell-derived Ig VDJ databases published by others nor in our positive controls. IgG and IgA from epidermal cells of the same individual had different VDJ rearrangement patterns. IgG was found primarily in prickle cells, and IgA was mainly detected in basal cells. Both epidermal cell-derived IgG and IgA showed potential antibody activity by binding pathogens like Staphylococcus aureus, the most common pathogenic skin bacteria, but the microbial-binding profile was different. Our data indicates that normal human epidermal cells spontaneously express IgG and IgA, and we speculate that these Igs participate in skin innate immunity.

  2. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  3. Pharmacokinetic/pharmacodynamic analysis to evaluate ceftaroline fosamil dosing regimens for the treatment of community-acquired bacterial pneumonia and complicated skin and skin-structure infections in patients with normal and impaired renal function.

    Science.gov (United States)

    Canut, A; Isla, A; Rodríguez-Gascón, A

    2015-04-01

    In this study, the probability of pharmacokinetic/pharmacodynamic target attainment (PTA) of ceftaroline against clinical isolates causing community-acquired bacterial pneumonia (CABP) and complicated skin and skin-structure infection (cSSSI) in Europe was evaluated. Three dosing regimens were assessed: 600 mg every 12 h (q12 h) as a 1-h infusion (standard dose) or 600 mg every 8 h (q8 h) as a 2-h infusion in virtual patients with normal renal function; and 400 mg q12 h as a 1-h infusion in patients with moderate renal impairment. Pharmacokinetic and microbiological data were obtained from the literature. The PTA and the cumulative fraction of response (CFR) were calculated by Monte Carlo simulation. In patients with normal renal function, the ceftaroline standard dose (600 mg q12 h as a 1-h infusion) can be sufficient to treat CABP due to ceftazidime-susceptible (CAZ-S) Escherichia coli, CAZ-S Klebsiella pneumoniae, meticillin-susceptible Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis (CFR>90%). However, against meticillin-resistant S. aureus (MRSA), the CFR was 72%. In cSSSI, the CFR was also <80% for MRSA. Administration of ceftaroline 600 mg q8 h as a 2-h infusion or 400 mg q12 h as a 1-h infusion in patients with moderate renal insufficiency provided a high probability of treatment success (CFR ca. 100%) for most micro-organisms causing CABP and cSSSI, including MRSA and penicillin-non-susceptible S. pneumoniae. These results suggest that in patients with normal renal function, ceftaroline 600 mg q8 h as a 2-h infusion may be a better option than the standard dose, especially if the MRSA rate is high.

  4. Adjacent segment disease.

    Science.gov (United States)

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  5. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception

    Science.gov (United States)

    Maté-Cid, Saúl; Fulford, Robert; Seiffert, Gary; Ginsborg, Jane

    2016-01-01

    Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception. PMID:27191400

  6. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception.

    Directory of Open Access Journals (Sweden)

    Carl Hopkins

    Full Text Available Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception.

  7. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  8. Frequent detection of papillomavirus DNA in clinically normal skin of cats infected and noninfected with feline immunodeficiency virus.

    Science.gov (United States)

    Munday, John S; Witham, Adrian I

    2010-06-01

    Feline cutaneous squamous cell carcinomas (SCCs) often contain felis domesticus papillomavirus type 2 (FdPV-2) DNA. While this may suggest FdPV-2 causes feline SCC development, the proportion of cats that are asymptomatically infected by this PV is unknown. Infection by feline immunodeficiency virus (FIV) is associated with high rates of cutaneous SCC development, possibly due to increased PV infection. This study examines the frequency of cutaneous asymptomatic FdPV-2 infections in cats and compares the rate of FdPV-2 infection in 22 FIV-positive cats with that in 22 FIV-negative cats. FdPV-2 sequences were detected in 39% of skin swabs. One or both swabs contained FdPV-2 DNA from 52% of the cats. FIV status, age or sex of the cat did not significantly influence FdPV-2 infection. Cats that shared a household with a PV-infected cat could remain uninfected suggesting infection depends more on host factors than exposure to the PV. These results indicate that asymptomatic FdPV-2 infections are common in cats, but do not provide evidence that FdPV-2 causes feline SCC development.

  9. Membrane expression of NK receptors CD160 and CD158k contributes to delineate a unique CD4+ T-lymphocyte subset in normal and mycosis fungoides skin.

    Science.gov (United States)

    Sako, Nouhoum; Schiavon, Valérie; Bounfour, Touda; Dessirier, Valérie; Ortonne, Nicolas; Olive, Daniel; Ram-Wolff, Caroline; Michel, Laurence; Sicard, Hélène; Marie-Cardine, Anne; Bagot, Martine; Bensussan, Armand; Schmitt, Christian

    2014-10-01

    CD160 is a GPI-anchored Ig-like receptor identified by the BY55 mAb on human circulating CD56dim+ NK cells and TCRγδ lymphocytes. In addition, while most intestinal T lymphocytes express it, only a minor circulating CD4+ or CD8+ T lymphocyte subset is CD160+. Here we describe a population of CD4+ CD160+ human blood T lymphocytes of circulating cutaneous T cells. These rare T lymphocytes represent 2.1 ± 1.9% of the circulating CD3+ CD4+ T cells, coexpress CD8αα, CD244, and perforin but lack CD28 expression, a phenotype corresponding to effector memory cytotoxic T-lymphocytes. Functional studies further confirmed their cytotoxic potential. These cells lack αEβ7 integrin and CCR7 expression but do express skin-addressing molecules CLA, and CCR4. In normal human skin, CD4+ CD160+ cells represent 34.6 ± 14.7% of the CD4+ T lymphocytes extracted by collagenase treatment. These T cells coexpress CLA (81 ± 13.6%), CCR4 (62.3 ± 15.9%), and some CD8αα (19.6 ± 13%) or CCR7 (24.4 ± 11.7%) expression. Cutaneous T-cell lymphoma cells express the natural killer receptor KIR3DL2 (CD158k) used as a tumor marker. Not only we confirmed the expression of this marker in the blood and/or skin of mycosis fungoides patients but we also show for the first time CD158k expression (often associated with CD160) on cutaneous CD4+ T cells from healthy individuals (25.3 ± 15%). Therefore, CD4+ CD160+ T cells expressing CD158k might represent specialized cutaneous lymphocytes devoted to immune surveillance, from which could originate cutaneous T-cell lymphomas such as mycosis fungoides.

  10. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  11. Thermal Imaging of Skin Changes on the Feet of Type II Diabetics

    Science.gov (United States)

    2007-11-02

    Austria Abstract – Skin changes such as callosities and mycosis may be regarded as a risk factor for severe structural impairments including...normal individuals in a survey conducted in Canada [10]. Most onychomycoses are secondary to a mycosis of the adjacent skin [11], which may lead to...Measure Intraclass Correlation (95 % confidence interval) callus mycosis Toe deformity Arch deformity Hot spot 1st right toe 0.23 (0.00

  12. Suitability of single tissue dielectric constant measurements to assess local tissue water in normal and lymphedematous skin.

    Science.gov (United States)

    Mayrovitz, Harvey N; Davey, Suzanne; Shapiro, Elizabeth

    2009-04-01

    Previous reports described the use of average tissue dielectric constant (TDC) measurements to assess local tissue water and its change. Our goal was to determine if a single TDC measurement could be used in place of the average of multiple measurements. The comparison criteria used to test this was the extent to which single and averaged measurements yielded similar TDC values in both normal and lymphedematous tissue. Measurements were made in two groups of women; a control group (n = 20) and a group with unilateral arm lymphedema (n = 10). In the control group, TDC was measured to multiple depths (0.5-5.0 mm) on both ventral forearms and to a depth of 2.5 mm on the lateral thorax on both body sides. In the lymphedematous group, TDC was measured on both ventral forearms to a depth of 2.5 mm. Results showed that the 95% confidence interval for differences between single and averaged TDC values was less than +/-1 TDC unit and that the limits of agreement between methods was less than +/-2.5 TDC units (+/-6.5%) for each condition, site and depth measured. This finding suggests that where this level of agreement is acceptable suitable clinical assessments can be made using a single TDC measurement.

  13. of the stomach (ID 345), neutralisation of gastric acid (ID 345), contribution to normal formation of collagen and connective tissue (ID 287, 288, 333, 334, 335, 1405, 1652, 1718, 1719, 1945), maintenance of normal bone (ID 287, 335, 1652, 1718, 1945), maintenance of normal joints (ID 1405, 1652, 1945, ), maintenance of normal appearance and elasticity of the skin (ID 288, 333), and contribution to normal formation of hair and nails (ID 334, 1652, 1719) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to silicon and protection against aluminium accumulation in the brain, cardiovascular health, forming a protective coat on the mucous membrane of the stomach, neutralisation of gastric acid, contribution to normal formation of collagen and connective tissue, maintenance of normal bone......, maintenance of normal joints, maintenance of normal appearance and elasticity of the skin, and contribution to normal formation of hair and nails. The scientific substantiation is based on the information provided by the Member States in the consolidated list of Article 13 health claims and references...

  14. Effects of sulfate deprivation on the production of chondroitin/dermatan sulfate by cultures of skin fibroblasts from normal and diabetic individuals

    Energy Technology Data Exchange (ETDEWEB)

    Silbert, C.K.; Humphries, D.E.; Palmer, M.E.; Silbert, J.E. (Veterans Administration Outpatient Clinic, Boston, MA (USA))

    1991-02-15

    Human skin fibroblast monolayer cultures from two normal men, three Type I diabetic men, and one Type I diabetic woman were incubated with (3H)glucosamine in the presence of diminished concentrations of sulfate. Although total synthesis of (3H)chondroitin/dermatan glycosaminoglycans varied somewhat between cell lines, glycosaminoglycan production was not affected within any line when sulfate levels were decreased from 0.3 mM to 0.06 mM to 0.01 mM to 0 added sulfate. Lowering of sulfate concentrations resulted in diminished sulfation of chondroitin/dermatan in a progressive manner, so that overall sulfation dropped to as low as 19% for one of the lines. Sulfation of chondroitin to form chondroitin 4-sulfate and chondroitin 6-sulfate was progressively and equally affected by decreasing the sulfate concentration in the culture medium. However, sulfation to form dermatan sulfate was preserved to a greater degree, so that the relative proportion of dermatan sulfate to chondroitin sulfate increased. Essentially all the nonsulfated residues were susceptible to chondroitin AC lyase, indicating that little epimerization of glucuronic acid residues to iduronic acid had occurred in the absence of sulfation. These results confirm the previously described dependency of glucuronic/iduronic epimerization on sulfation, and indicate that sulfation of the iduronic acid-containing disaccharide residues of dermatan can take place with sulfate concentrations lower than those needed for 6-sulfation and 4-sulfation of the glucuronic acid-containing disaccharide residues of chondroitin. There were considerable differences among the six fibroblast lines in susceptibility to low sulfate medium and in the proportion of chondroitin 6-sulfate, chondroitin 4-sulfate, and dermatan sulfate. However, there was no pattern of differences between normals and diabetics.

  15. Comprehensive two-dimensional normal-phase liquid chromatography × reversed-phase liquid chromatography for analysis of toad skin.

    Science.gov (United States)

    Li, Jia-Fu; Yan, Xia; Wu, Yun-Long; Fang, Mei-Juan; Wu, Zhen; Qiu, Ying-Kun

    2017-04-15

    An analytical two-dimensional normal-phase liquid chromatography × reversed-phase liquid chromatography (2D NPLC × RPLC) system was constructed with a newly developed thermal evaporation assisted adsorption (TEAA) interface. This novel TEAA interface with heating temperature above solvent boiling point allowed fast removal of organic NPLC solvent and successfully solved the solvent incompatibility problem between NPLC and RPLC. The system achieved rapid on-line solvent exchange between the two dimensions within a short modulation time of 190 s and was applied in the analysis of an extract from the skin of Bufo bufo gargarizans. This is the first time to realize the on-line comprehensive analysis of a moderate polar natural product by coupling NPLC with reversed phase ultra-high performance liquid chromatography (UHPLC). To be highlighted, with the TEAA interface, the 2D NPLC × RPLC system provided excellent resolution and orthogonality (75.2%), when compared with that of 2D RPLC × RPLC.

  16. Distinct profile of the mitochondrial DNA common deletion in benign skin lesions.

    Science.gov (United States)

    Hafner, Christian; Kamenisch, York; Landthaler, Michael; Berneburg, Mark

    2011-02-01

    Mutations of mitochondrial (mt) DNA, particularly the 4977 bp long common deletion, are increased in aging tissues and preferentially found in chronologically and photoaged skin. Mutations of human mitochondrial DNA (mtDNA) have also been identified in malignant tumors of the skin and of other organs. However, benign skin lesions have not yet been investigated. We analyzed the frequency of the common deletion in 27 benign skin lesions [8 seborrheic keratoses (SK), 5 epidermal nevi (EN), 14 solar lentigos (SL)] by quantitative real-time PCR, because SK and especially SL have been related to (photo)aged skin. All SK and four of five EN displayed reduced common deletion levels compared with adjacent normal skin. In contrast, 50% of SL revealed a higher percentage of the common deletion than the adjacent normal skin, and some SL showed very high absolute common deletion levels up to 14% of total mtDNA. Our results show that the amount of the common deletion is significantly different in benign skin lesions and raise further questions regarding the pathogenesis of SL and its possible role as a precursor lesion of SK.

  17. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  18. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17...

  19. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  20. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    proteins in alphabetical order), "basal cell markers", "differentiation markers", "proteins highly up-regulated in psoriatic skin", "microsequenced proteins" and "human autoantigens". For reference, we have also included 2-D gel (isoelectric focusing) patterns of cultured normal and psoriatic keratinocytes......A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved...

  1. Clinical analysis of adjacent skin flap in reconstruction of oral and maxillofacial soft tissue defects%邻位皮瓣修复口腔颌面部软组织缺损的临床分析

    Institute of Scientific and Technical Information of China (English)

    王仁欣; 王恒琨; 郑晓涛

    2013-01-01

    pedicle flap technology including maxillofacial and neck local advancement flaps,nasolabial flaps.Results All flaps of 30 patients survived after surgery:one case with the flaps area mild infection symptoms,II healing, and 29 patients with stage I healing;After at least six months of follow-up observation of facial morphology and function,it is found that:1 patient’s affected side numbness of the mouth was slightly askew and mouth slightly limited;cancer patients without recurrence;The flaps of all patients more matched with the surrounding skin tissue in terms of color, texture, contour, and incision scar tissue was soft;100%of facial morphology satisfaction,96.67%of the facial features satisfaction.Conclusion To the patients with maxillofacial soft tissue defects caused by trauma or surgical removal of the lesion,according to the principle of the nearest drawn ,taking ortho position flaps repair is worthy of clinical application,it has many advantages such as easy operating, easy mastering,the flaps convenient easy to survive,better blood supply,satisfactory facial morphology and function recovery,etc.

  2. 脂多糖对正常人皮肤成纤维细胞胶原合成的影响%Influence of lipopolysaccharide on the collagen synthesis of normal human skin fibroblasts

    Institute of Scientific and Technical Information of China (English)

    纪少军; 万立; 李凤玉; 贾国洪; 闫永宏; 石军

    2012-01-01

    Objective: To investigate the influence of lipopolysaccharide ( LPS ) on the collagen synthesis of normal human skin fibroblasts and its relation with wound healing. Methods: Normal skin fibroblasts were exposed to LPS for a certain period of time. Then the collagen synthesis of fibroblasts in culture medium was measured with the method of pepsin digestion after incorporation of H-proline into stable, single-layered, confluent fibroblasts. Results: Collagen synthesis of normal skin fibroblasts increased when challenged with LPS at the concentration of 0.005 μg·ml‐1 , and the increase showed a concentration dependent manner. However, when the concentration of LPS was 0. 5 μg·ml‐1 ,the influence of LPS on the collagen synthesis of normal skin fibroblasts began to decrease; when the concentration of LPS reached 1.0 μg·ml‐1 , collagen synthesis of fibroblasts were inhibited. Conclusion: LPS could promote collagen synthesis of normal human skin fibroblasts within a certain extent, suggesting that LPS might play an important role in wound healing.%目的:研究脂多糖(lipopolysaccharide,LPS)对正常人皮肤成纤维细胞胶原合成的影响,以阐明LPS在皮肤创伤愈合中的可能作用.方法:体外培养正常人皮肤成纤维细胞,采用3H-脯氨酸掺入法观察不同浓度(0、0.005、0.01、0.05、0.1、0.5和1.0 μg·ml-1)的LPS对成纤维细胞胶原合成的影响.结果:LPS刺激浓度在0.005 μg·ml-1时,皮肤成纤维细胞胶原蛋白合成增加;随着刺激浓度增加,刺激作用增强;但当LPS浓度为0.5 μg·ml-1时,促胶原合成作用开始降低;当浓度达到1.0 μg·ml-1时则呈现抑制效应.结论:在一定浓度范围内LPS促进成纤维细胞胶原合成,表明LPS在皮肤创伤愈合中可能具有重要作用.

  3. Expression of RANTES mRNA in skin lesions of feline eosinophilic plaque.

    Science.gov (United States)

    Kimura, Tomoe; Kano, Rui; Maeda, Sadatoshi; Tsujimoto, Hajime; Nagata, Masahiko; Hasegawa, Atsuhiko

    2003-10-01

    One of the mechanisms of eosinophil infiltration is its induction by chemoattractants such as regulated upon activation, normal T-expressed and secreted (RANTES) which is a cysteine-cysteine chemokine that mediates chemotaxis and activation of eosinophils in humans and mice. Skin lesions of feline eosinophilic plaque are characterized by a predominant infiltration of eosinophils. The mechanism(s) of eosinophilic infiltration in the skin and/or mucosa of cats is unknown. It is possible that RANTES is involved. To investigate the presence of RANTES in the skin of cats with eosinophilic plaques and nonaffected skin, we cloned and sequenced the full-length feline RANTES cDNA gene, in order to determine whether it is present in the skin of cats with eosinophilic plaques and/or if it is present in normal adjacent skin. We were able to document the the expression of RANTES mRNAs in skin with feline eosinophilic plaque as well as in normal cat skin. The full-length cDNA sequence of the RANTES gene (742 bp) contained a single open reading frame of 276 bp encoding a protein of 92 amino acids. The amino acid sequence of feline RANTES shared 67 and 74% sequence identity with that of bovine and mouse RANTES genes, respectively. RT-PCR analysis on RANTES mRNA in the skin of cats with eosinophilic plaque revealed that its expression was higher in the eosinophilic plaque skin lesions than in the normal skin. The result suggested that RANTES might play a role to induce eosinophil infiltration in feline eosinophilic plaque lesions.

  4. Relationship of p53 Mutations to Epidermal Cell Proliferation and Apoptosis in Human UV-Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Janine G. Einspahr

    1999-11-01

    Full Text Available Human skin is continually subjected to UV-irradiation with the p53 gene playing a pivotal role in repair of UV-induced DNA damage and apoptosis. Consequently, p53 alterations are early events in human UV-induced skin carcinogenesis. We studied 13 squamous cell carcinomas (SCC, 16 actinic keratoses (AK, 13 samples adjacent to an AK (chronically sun-damaged, and 14 normal-appearing skin samples for p53 mutation, p53 immunostaining (IHC, apoptosis (in situ TUNEL and morphology, and proliferation (PCNA. The frequency of p53 mutation increased from 14% in normal skin, to 38.5% in sun-damaged skin, 63% in AK, and 54% in SCC. p53 IHC increased similarly. Apoptosis (TUNEL increased from 0.06 ± 0.02%, to 0.1 ± 0.2, 0.3 ± 0.3, and 0.4 ± 0.3 in normal skin, sun-damaged skin, AK, and SCC, respectively. Apoptosis was strongly correlated with proliferation (i.e., TUNEL and PCNA, r = 0.7, P < 0.0001, and proliferation was significantly increased in the progression from normal skin to SCC. Bax was significantly increased in SCC compared to AK. These data imply that apoptosis in samples with a high frequency of p53 mutation may not necessarily be p53-dependent. We suggest that there is a mechanism for apoptosis in response to increased cellular proliferation that is p53-independent.

  5. Your Skin

    Science.gov (United States)

    ... Room? What Happens in the Operating Room? Your Skin KidsHealth > For Kids > Your Skin Print A A ... are really dead skin cells. continue Bye-Bye Skin Cells These old cells are tough and strong, ...

  6. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H;

    1994-01-01

    A total of 66 skin biopsies from persons with Alzheimer's disease (AD) or Down's syndrome (DS) and from persons without AD were used in this study. The age range was from 7 to 89 years. Positive immunoreactivity of skin biopsies to monoclonal antibody 4G8, which is reactive to amino acid residue 17....../38 (37%) non-AD control cases. The Fisher exact probability test revealed a significant difference (P = 0.0415 one-tailed) in immunoreactivity between AD and age-matched controls. There was also a significant difference (P = 0.0152 one-tailed; P = 0.0200 two-tailed) between DS and age-matched control...

  7. Fractionated illumination after topical application of 5-aminolevulinic acid on normal skin of hairless mice: the influence of the dark interval.

    Science.gov (United States)

    de Bruijn, H S; van der Ploeg-van den Heuvel, A; Sterenborg, H J C M; Robinson, D J

    2006-12-01

    We have previously shown that light fractionation during topical aminolevulinic acid based photodynamic therapy (ALA-PDT) with a dark interval of 2h leads to a significant increase in efficacy in both pre-clinical and clinical PDT. However this fractionated illumination scheme required an extended overall treatment time. Therefore we investigated the relationship between the dark interval and PDT response with the aim of reducing the overall treatment time without reducing the efficacy. Five groups of mice were treated with ALA-PDT using a single light fraction or the two-fold illumination scheme with a dark interval of 30 min, 1, 1.5 and 2h. Protoporphyrin IX fluorescence kinetics were monitored during illumination. Visual skin response was monitored in the first seven days after PDT and assessed as PDT response. The PDT response decreases with decreasing length of the dark interval. Only the dark interval of 2h showed significantly more damage compared to all the other dark intervals investigated (Pdark interval used. We conclude that in the skin of the hairless mouse the dark interval cannot be reduced below 2h without a significant reduction in PDT efficacy.

  8. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  9. The biochemical basis of changes in normal and mutant human skin fibroblasts during ageing in culture : an investigation into the free radical theory of ageing

    NARCIS (Netherlands)

    M. Poot

    1989-01-01

    textabstractFrom the pattern of inheritance of normal ageing, this process inevitably results from either abnormal aggregation of subunits of enzymes, abnormal feedback inhibition of enzymes, receptor mutations, membrane defects, or deposition of abnormal fibrillar proteins (Vogel and Motulsky, 1986

  10. Imaging of skin birefringence for human scar assessment using polarization-sensitive optical coherence tomography aided by vascular masking

    Science.gov (United States)

    Gong, Peijun; Chin, Lixin; Es'haghian, Shaghayegh; Liew, Yih Miin; Wood, Fiona M.; Sampson, David D.; McLaughlin, Robert A.

    2014-12-01

    We demonstrate the in vivo assessment of human scars by parametric imaging of birefringence using polarization-sensitive optical coherence tomography (PS-OCT). Such in vivo assessment is subject to artifacts in the detected birefringence caused by scattering from blood vessels. To reduce these artifacts, we preprocessed the PS-OCT data using a vascular masking technique. The birefringence of the remaining tissue regions was then automatically quantified. Results from the scars and contralateral or adjacent normal skin of 13 patients show a correspondence of birefringence with scar type: the ratio of birefringence of hypertrophic scars to corresponding normal skin is 2.2±0.2 (mean±standard deviation), while the ratio of birefringence of normotrophic scars to normal skin is 1.1±0.4. This method represents a new clinically applicable means for objective, quantitative human scar assessment.

  11. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to astaxanthin and protection of the skin from UV-induced damage (ID 1687, 1979), defence against Helicobacter pylori (ID 1686), contribution to normal spermatogenesis

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...

  12. Skin Infections

    Science.gov (United States)

    ... Old Feeding Your 8- to 12-Month-Old Feeding Your 1- to 2-Year-Old First Aid: Skin ... (bacterial infection of the deeper layers of the skin and tissues beneath) are typical childhood skin infections. The usual bacterial culprits in skin ...

  13. Skin Biomes.

    Science.gov (United States)

    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A

    2016-05-01

    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  14. Fluorescence photobleaching of ALA and ALA-heptyl ester induced protoporphyrin IX during photodynamic therapy of normal hairless mouse skin: a comparison of two light sources and different illumination schemes.

    Science.gov (United States)

    Pudroma, Xiao; Juzeniene, Asta; Ma, Li-Wei; Iani, Vladimir; Moan, Johan

    2011-01-01

    This study investigated photobleaching of protoporphyrin IX (PpIX) induced by 5-aminolevulinic acid (ALA) and ALA-heptyl ester during superficial photodynamic therapy (PDT) in normal skin of the female BALB/c-nu/nu athymic mouse. We examined the effects of two light sources (laser and broadband lamp) and two different illumination schemes (fractionated light and continuous irradiation) on the kinetics of photobleaching. Our results show that light exposure (0-30 minutes, 10 mW/cm2) of wavelengths of approximately 420 nm (blue light) and 635 nm (red light) induced time-dependent PpIX photobleaching for mouse skin of 2% ALA and ALA-heptyl ester. Blue light (10 mW/cm2) caused more rapid PpIX photobleaching than did red light (100 mW/cm2), which is attributed to stronger absorption at 407 nm than at 632 nm for PpIX. In the case of light fractionation, fractionated light induced faster photobleaching compared with continuous light exposure after topical application of 2% ALA and ALA-heptyl ester in vivo. These have been suggested to allow reoxygenation of the irradiated tissue, with a consequent enhancement of singlet oxygen production in the second and subsequent fractions.

  15. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  16. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (<40%), and that withstands elongations exceeding 250%, elastically recoiling with minimal strain-energy loss on repeated deformation. The application of XPL to the herniated lower eyelid fat pads of 12 subjects resulted in an average 2-grade decrease in herniation appearance in a 5-point severity scale. The XPL platform may offer advanced solutions to compromised skin barrier function, pharmaceutical delivery and wound dressings.

  17. 脂多糖干预后人皮肤成纤维细胞的胶原代谢%Influence of Lipopolysaccharide on Collagen Metabolism of Normal Skin Fibroblasts of Human

    Institute of Scientific and Technical Information of China (English)

    李凤玉; 王舒琦; 贾国洪; 万立; 杨红明

    2012-01-01

    目的 探讨脂多糖(lipopolysaccharide,LPS)对皮肤成纤维细胞胶原代谢的影响,以了解LPS在增生性瘢痕形成中的生物学作用.方法 取正常皮肤行成纤维细胞培养后,分为1个对照组及6个实验组.实验组终浓度分别为0.005、0.010、0.050、0.100、0.500和1.000 μg/ml大肠杆菌LPS(E.coli055:B5)培养,对照组为DMEM培养.用逆转录-聚合酶链反应(reverse transcription-polymerase chain reaction,RT-PCR)测定成纤维细胞Ⅰ、Ⅲ型前胶原mRNA及胶原酶mRNA的表达,并以同一个体相同代数的瘢痕组织成纤维细胞做对照.结果 与对照组比较,0.005~0.500μg/ml组促进细胞胶原合成,且0.100 μg/ml组作用达高峰(P<0.05),1.000μg/ml LPS抑制细胞胶原合成(P≮0.05).LPS刺激浓度在0.005 μg/ml~0.100μg/ml时,促进正常皮肤成纤维细胞I、Ⅲ型前胶原mRNA表达,抑制胶原酶mRNA表达,且呈一定的剂量依赖性;当LPS刺激浓度为0.500 μg/ml,上述作用下降;而当LPS刺激浓度到达1.000 μg/ml时,抑制正常皮肤成纤维细胞Ⅰ、Ⅲ型前胶原mRNA表达,促进胶原酶mRNA表达.LPS刺激浓度在0.100 μg/ml时,成纤维细胞Ⅰ、Ⅲ型前胶原mRNA和胶原酶mRNA表达与同一个体增生性瘢痕组织成纤维细胞近似.结论 LPS对人皮肤成纤维细胞Ⅰ、Ⅲ型前胶原mRNA和胶原酶mRNA表达的直接调节,可能是其参与增生性瘢痕形成的重要机制.%Objective To observe the influence of lipopolysaccharide (LPS) on collagen metabolism of normal human skin fibroblasts and its biological role in the formation of hypertrophic scar. Methods Fibroblasts were isolated and cultured in vitro, and then exposed to different doses of LPS (0. 005, 0. 010, 0. 050, 0. 100, 0. 500 and 1. 000 jug/ml) from E. coli055: B5 respectively. The expression of procollagen type I , HI and collagenase mRNAs was tested by reverse transcription-polymerase chain reaction (RT-PCR). The fibroblasts from hypertrophic scar tissue

  18. Adjacency-preserving spatial treemaps

    Directory of Open Access Journals (Sweden)

    Kevin Buchin

    2016-03-01

    Full Text Available Rectangular layouts, subdivisions of an outer rectangle into smaller rectangles, have many applications in visualizing spatial information, for instance in rectangular cartograms in which the rectangles represent geographic or political regions. A spatial treemap is a rectangular layout with a hierarchical structure: the outer rectangle is subdivided into rectangles that are in turn subdivided into smaller rectangles. We describe algorithms for transforming a rectangular layout that does not have this hierarchical structure, together with a clustering of the rectangles of the layout, into a spatial treemap that respects the clustering and also respects to the extent possible the adjacencies of the input layout.

  19. Skin Cancer

    Science.gov (United States)

    ... are round and lie directly under squamous cells. Melanocytes are specialized skin cells that produce pigment called melanin. The melanin pigment produced by melanocytes gives skin its color. It also protects the ...

  20. Skin Cancer

    Science.gov (United States)

    ... the head, face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ... cancer is found early. If not treated, some types of skin cancer cells can spread to other tissues and organs. ...

  1. Sagging Skin

    Science.gov (United States)

    ... Dermatologic Surgery Expertise for the life of your skin (TM) Public Resources Dermatologic Surgery Conditions Treatments and ... learn-more"> 3 million Americans are diagnosed with skin cancer every year Any suspicious new growths or ...

  2. Skin tears.

    Science.gov (United States)

    Baranoski, S

    2001-08-01

    Skin tears are a serious, painful problem for older patients. Find out how your staff can recognize patients at risk, what they can do to prevent skin tears, and how to manage them effectively if they occur.

  3. Skin turgor

    Science.gov (United States)

    ... arm or abdomen is checked. The skin is held for a few seconds then released. Skin with ... University of Washington, Seattle, WA. Also reviewed by David Zieve, MD, MHA, Isla Ogilvie, PhD, and the ...

  4. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  5. 脂多糖对人皮肤成纤维细胞胶原代谢的影响%Influence of lipopolysaccharide on collagen metabolism of normal skin fibroblasts of human

    Institute of Scientific and Technical Information of China (English)

    李凤玉; 王舒琦; 贾国洪; 万立; 杨红明

    2012-01-01

    Objective To observe the influence of lipopolysaccharide (LPS) on collagen metabolism of normal human skin fibroblasts and its biological role in the formation of hypertrophic scar.Methods Fibroblasts were isolated and cultured in vitro,and then exposed to different doses of LPS (0.005,0.01,0.05,0.1,0.5,1.0 μg/ml) from E.coli.055:B5 respectively.The expression of proccllagen type Ⅰ,Ⅲand collagenase mRNAs was tested by RT -PCR.Fibroblasts from hypertrophic scar tissue obtained from the same patients in the same culture passage were used as control.Results Compared with control group,the expression of procollagen type Ⅰ,Ⅲ mRNAs in normal skin fibroblasts increased (0.323 ± 0.041,0.303 ± 0.063,0.391 ± 0.071,0.344 ± 0.086,0.488 ± 0.059,0.401 ± 0.087,0.616 ± 0.107,0.434 ±0.084,0.823 ±0.092,0.542 ± 0.082),while the expression of collagenase mRNAs of normal skin fibroblasts depressed(0.598 ± 0.068,0.556 ± 0.049,0.441 ± 0.043,0.372 ± 0.083,0.260 ± 0.027 ).When LPS was set to the concentration of 0.005 μg/ml,it showed a concentration dependent manner.However,when the concentration of LPS was set to 0.5 μg/ml,the expression of procollagen type Ⅰ,Ⅲ and collagenase mRNAs of normal skin fibroblasts began to decrease (0.451 ± 0.063,0.374 ± 0.072,0.360 ± 0.062).When the concentration of LPS was set to 1.0 μg/ml,the expression of procollagen type Ⅰ,Ⅲ mRNAs (0.162 ± 0.025,0.171 ± 0.061 )were inhibited and the expression of collagenase mRNAs began to increase (0.444 ±0.114).When the concentration of LPS was set to 0.1 μg/ml,the expression of procollagen type Ⅰ,Ⅲ and collagenase mRNAs of normal skin fibroblasts(0.823 ±0.092,0.542 ±0.082,0.260 ±0.027)was similar to that of hypertrophic scar tissue fibroblasts(0.829 ±0.049,0.569 ±0.038,0.277 ±0.059).Conclusions This result supported that LPS may be an important factor in collagen metabolism of normal skin fibroblasts and it plays an important role in hypertrophic scar formation.%目

  6. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  7. Observation of roof of suction blister from normal skin of patients with vitiligo by Masson-Fontana stain%正常皮肤负压吸疱疱顶Masson Fontana染色分析

    Institute of Scientific and Technical Information of China (English)

    康尔恂; 毛玲娥; 罗邦国; 郑捷

    2001-01-01

    为研究负压吸疱法表皮移植治疗白癜风的机理,对16例来自白癜风病人色素正常部位皮肤负压吸引产生水疱的 疱顶组织进行HE和MassonFontana染色,观察水疱的位置及有无黑素细胞的存在。结果负压吸引产生的水疱位于棘细胞 层,无黑素细胞存在。治疗白癜风表皮移植的机理黑素细胞被移植这一假说不能成立。%To study the mechanism of treating vitiligo by epidermaltransplantation, the roof of suction blister from normal skin of 16 cases of vitiligo with HE and Masson-Fontana stain was observed to study the position of the vesicles and the presence of melanocytes in the roof of suction blisters、 The results showed that the vesicles were located in the spinous layer and no melanocytes were found. lt is concluded that the hypothesis that in epidermal transplantation melanocytes are transplanted is untenable.

  8. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studied......, as have many diseases. The method can provide accurate measures of epidermal and nail changes in normal tissue. Skin cancer and other tumors, as well as inflammatory diseases, have been studied and good agreement found between OCT images and histopathological architecture. OCT also allows noninvasive...... monitoring of morphologic changes in skin diseases and may have a particular role in the monitoring of medical treatment of nonmelanoma skin cancer. The technology is however still evolving and continued technological development will necessitate an ongoing evaluation of its diagnostic accuracy. Several...

  9. Fluorescence excitation-emission matrix spectroscopy of vitiligo skin in vivo (Conference Presentation)

    Science.gov (United States)

    Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey

    2016-02-01

    Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.

  10. Your Skin

    Science.gov (United States)

    ... your body. Without skin, people's muscles, bones, and organs would be hanging out all over the place. Skin holds everything together. It also: protects our bodies helps keep our bodies at just the right temperature allows us to have the sense of touch Don't Miss Your Epidermis The ...

  11. Oily skin

    Science.gov (United States)

    ... keep your skin clean using warm water and soap, or a soapless cleanser. Clean your face with astringent pads if frequent face washing causes irritation. Use only water-based or oil-free cosmetics if you have oily skin. Your ...

  12. Compressed Adjacency Matrices: Untangling Gene Regulatory Networks.

    Science.gov (United States)

    Dinkla, K; Westenberg, M A; van Wijk, J J

    2012-12-01

    We present a novel technique-Compressed Adjacency Matrices-for visualizing gene regulatory networks. These directed networks have strong structural characteristics: out-degrees with a scale-free distribution, in-degrees bound by a low maximum, and few and small cycles. Standard visualization techniques, such as node-link diagrams and adjacency matrices, are impeded by these network characteristics. The scale-free distribution of out-degrees causes a high number of intersecting edges in node-link diagrams. Adjacency matrices become space-inefficient due to the low in-degrees and the resulting sparse network. Compressed adjacency matrices, however, exploit these structural characteristics. By cutting open and rearranging an adjacency matrix, we achieve a compact and neatly-arranged visualization. Compressed adjacency matrices allow for easy detection of subnetworks with a specific structure, so-called motifs, which provide important knowledge about gene regulatory networks to domain experts. We summarize motifs commonly referred to in the literature, and relate them to network analysis tasks common to the visualization domain. We show that a user can easily find the important motifs in compressed adjacency matrices, and that this is hard in standard adjacency matrix and node-link diagrams. We also demonstrate that interaction techniques for standard adjacency matrices can be used for our compressed variant. These techniques include rearrangement clustering, highlighting, and filtering.

  13. Aging skin.

    Science.gov (United States)

    Bolognia, J L

    1995-01-16

    Aging of the skin is a composite of actinic damage, chronologic aging, and hormonal influences. The majority of changes associated with aging, such as wrinkles and solar lentigines ("liver spots"), are due to photoaging and reflect cumulative sun exposure as well as skin pigmentation. Classically, chronologic aging includes those cutaneous changes that occur in non-sun-exposed areas, such as the buttocks, and are observed in both men and women. A clinical example would be soft tissue sagging due to elastic fiber degeneration. In women, investigations into the effect of hormones on aging of the skin have concentrated on estrogens; in men, there have been a limited number of studies on the influence of testosterone. The latter have shown an age-dependent decrease in tissue androgens in pubic skin, but not scrotal or thigh skin. To date, age has not been shown to have an effect on androgen receptor binding, although a decrease in foreskin 5 alpha-reductase activity with increasing age has been described. In fibroblast cultures from foreskins, there have been conflicting results as to whether 5 alpha-reductase activity decreases in an age-dependent manner. Some of the skin changes that have been categorized as secondary to chronologic aging, such as decreased sebaceous gland activity and decreased hair growth, may actually represent a decline in the concentration of tissue androgens with increasing age. The influence of androgens on age-related changes in keratinocyte and fibroblast function remains speculative.

  14. Skin Cancer Prevention

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Prevention (PDQ®)–Patient Version What is prevention? ... prevent cancer are being studied. General Information About Skin Cancer Key Points Skin cancer is a disease ...

  15. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  16. Dry Skin (Xerosis)

    Science.gov (United States)

    ... Kids’ zone Video library Find a dermatologist Dry skin Overview Dry, ashy skin: People who had atopic ... often have very dry skin as adults. Dry skin: Overview Also called xerosis Dry skin is common. ...

  17. Migration of PCBs from Sealants to Adjacent Material

    DEFF Research Database (Denmark)

    Andersen, Helle Vibeke; Gunnarsen, Lars Bo; Kampmann, Kristoffer

    2015-01-01

    PCB in sealants can migrate into porous surfaces like concrete and brick and contaminate these materials. The study focuses on an analysis of concentration profiles in relation to alleviation of PCB contamination. The PCB content was determined in 20 samples of concrete and 6 samples of brick...... adjacent to outdoor PCB-containing sealants. The samples were submitted to the laboratory for normal commercial assessment of PCB content in relation to the handling of waste from renovation works in Denmark. The results showed that the PBC concentration in the sealant not necessarily relate...... to the concentration of the adjacent material. The profiles of PCB concentration into the materials showed some variation, though in general there is a tendency of relative higher concentration near the primary source in concrete and longer migration at low concentrations in brick. The concentration profiles seemed...

  18. β-内啡肽与μ-阿片受体在正常皮肤与增生性瘢痕组织中的分布特征与生物学意义%The significance and characteristics of distribution of β-endorphin and μ-opioid receptors in normal skin and hyperplastic scar

    Institute of Scientific and Technical Information of China (English)

    程飚; 刘宏伟; 李勤; 付小兵; 盛志勇; 曹荣

    2008-01-01

    Objective To detect the distribution of β-endorphin and mu-opioid receptors(MOR)in normal skin tissue and scar tissue from healthy volunteers and patients with hypertrophic scar.Methods Normal skin samples from 10 healthy individuals and 10 patients with hypertrophic scar,and scar samples from the same 10 patients were investigated.The β-endorphin and MOR pmtem in the samples were detected by immunofluorescence(IF).The reverse transeriptiOn polymerase chain reaction (RT-PCR)was used to detect MOB mRNA.Results β-endorphin and MOR protein were expressed in all samples.There were no significant differences in the expression of β-endorphin and MOB pmtem between normal skin from healthy volunteers and patients with hypertrophic scar(P>0.05).The expression of β-endorphin,MOR protein and mPNA in hyperplastic scar was significantly stronger than that in normal skin(P0.05);而增生性瘢痕患处组织真皮与表皮内β-内啡肽和MOR的表达明显强于其他两组(P<0.01).同时,PCR的结果显示,瘢痕组织中MORmRNA的含量也远远高于正常皮肤.结论 β-内啡肽和MOB在正常皮肤与增生性瘢痕组织中的分布存在差异,这可能是造成瘢痕愈合后感觉异常的重要因素.

  19. Preliminary correlation study of regional ventricular long-axis velocity and adjacent intraventricular flow velocity in normal cases using dual-pulse wave Doppler echocardiography%双脉冲波多普勒超声评价舒张期左心室节段心肌运动及其邻近心室腔内同步血流的耦合情况

    Institute of Scientific and Technical Information of China (English)

    沈玉萍; 尹立雪; 程重庆; 张丽娟

    2013-01-01

    Objective To investigate regional ventricular long-axis velocity and adjacent intraventricular flow velocity using dual-pulse wave(PW) Doppler echocardiography synchronously,and to analyze the coupling relationship between regional ventricular long-axis strain and adjacent intraventricular pressure gradients in normal cases using dual-PW Doppler echocardiography.Methods Eighty-six normal subjects aged 19~66 years [mean age (37.49 ± 11.97)years] underwent routine echocardiography and dualPW Doppler echocardiographic exam.Total 18 segments were sampled using dual-PW Doppler (PW/TDI mode) images at basal,mid and apical levels on three standard apical views,and electrocardiogram was recorded simultaneously.Peak early diastolic velocity (emax),peak late diastolic velocity (amax),peak early mitral diastolic inflow velocity (Emax),regional peak early diastolic velocity (Em),regional peak late diastolic velocity (Am) and regional peak early diastolic inflow velocity (E) were measured simultaneously in the same one cardiac cycle.Myocardial variations of left ventricular segments were observed.Em,Am and E of different levels from different ventricular wall were analyzed.The co-relationship between regional ventricular long-axis strain and adjacent intraventricular pressure gradients were calculated and analyzed.Results ①Regional myocardial velocity and regional peak early diastolic inflow velocity in normal subjects declined from basal to apical segments gradually at the same ventricular wall (P < 0.01).② Emax was correlated with emax(r =0.418,P <0.001),and E was correlated with Em (posterior septum,r =0.610,P <0.001 ;anterior wall,r =0.499,P <0.001).③There was a medium correlation between normal longaxis strain in segments and adjacent intraventricular pressure gradients (the global,r =0.412,P <0.001 ;posterior septum,r =0.319,P <0.005).Conclusions The acquirement of E and Em by dual-PW Doppler showed downtrend of segmental wall movement and

  20. Tactile perception of skin and skin cream by friction induced vibrations.

    Science.gov (United States)

    Ding, Shuyang; Bhushan, Bharat

    2016-11-01

    Skin cream smooths, softens, and moistens skin by altering surface roughness and tribological properties of skin. Sliding generates vibrations that activate mechanoreceptors located in skin. The brain interprets tactile information to identify skin feel. Understanding the tactile sensing mechanisms of skin with and without cream treatment is important to numerous applications including cosmetics, textiles, and robotics sensors. In this study, frequency spectra of friction force and friction induced vibration signals were carried out to investigate tactile perception by an artificial finger sliding on skin. The influence of normal load, velocity, and cream treatment time were studied. Coherence between friction force and vibration signals were found. The amplitude of vibration decreased after cream treatment, leading to smoother perception. Increasing normal load or velocity between contacting surfaces generated a smoother perception with cream treatment, but rougher perception without treatment. As cream treatment time increases, skin becomes smoother. The related mechanisms are discussed.

  1. The Aging Prostate Is Never "Normal"

    DEFF Research Database (Denmark)

    Schlomm, Thorsten; Weischenfeldt, Joachim; Korbel, Jan

    2015-01-01

    We argue against the recently published statement that tumor-specific molecular alterations found in "normal" prostate tissue from cancer patients challenge focal therapy approaches that only target a visible cancer lesion and not the adjacent molecular field.......We argue against the recently published statement that tumor-specific molecular alterations found in "normal" prostate tissue from cancer patients challenge focal therapy approaches that only target a visible cancer lesion and not the adjacent molecular field....

  2. Skin Cancer

    Science.gov (United States)

    ... you ever get a bad sunburn that caused blisters when you were a child?Does your skin ... Cancer InstituteMelanoma International FoundationAmerican Cancer Society ResourcesDiagnosis and Management of Malignant Melanoma by BG Goldstein, AO Goldstein( ...

  3. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  4. Immunopathology of skin lesions

    Directory of Open Access Journals (Sweden)

    Khan Nazoora

    2001-09-01

    Full Text Available A study was conducted on 130 patients suffering from skin lesions which included psoriasis, lichen planus, DLE, pemphigus, vitiligo and alopecia areata. Forty age-and-sex-matched healthy individuals served as control. Serum IgG, IgM, and circulating immune complexes (CIC were estimated. Significant increase in serum IgG (1937.2 ± 1030.43 mg% and IgM (232.12 ± 136.98 mg% was observed in all the skin lesions when compared with controls except in lichen planus where they were significantly lowered, values being 580.61± 77.35 mg% and 66.88 ± 6.59mg% respectively. CIC levels were significantly raised (P<0.00 1 in various skin lesions (40.49±23.29 when compared with controls (17.68± 3.21, but no significance was observed in lichen planus( 17.72 ± 4.28. Serum IgG, IgM and CIC were statistically significantly altered depending on the extent of the lesion and lowered significantly to almost normal values following treatment, thereby confirming the role of immunity in the pathogenesis of these skin disorders.

  5. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...

  6. Clarifying Normalization

    Science.gov (United States)

    Carpenter, Donald A.

    2008-01-01

    Confusion exists among database textbooks as to the goal of normalization as well as to which normal form a designer should aspire. This article discusses such discrepancies with the intention of simplifying normalization for both teacher and student. This author's industry and classroom experiences indicate such simplification yields quicker…

  7. Determinants of adjacency matrices of graphs

    Directory of Open Access Journals (Sweden)

    Alireza Abdollahi

    2012-12-01

    Full Text Available We study the set of all determinants of adjacency matrices of graphs with a given number of vertices. Using Brendan McKay's data base of small graphs, determinants of graphs with at most $9$ vertices are computed so that the number of non-isomorphic graphs with given vertices whose determinants are all equal to a number is exhibited in a table. Using an idea of M. Newman, it is proved that if $G$ is a graph with $n$ vertices and ${d_1,dots,d_n}$ is the set of vertex degrees of $G$, then $gcd(2m,d^2$ divides the determinant of the adjacency matrix of $G$, where $d=gcd(d_1,dots,d_n$. Possible determinants of adjacency matrices of graphs with exactly two cycles are obtained.

  8. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... A "Sunscreen Gene"? Skin Cancer Facts & Statistics The Skin Cancer Foundation's Champions for Change Gala 2016 Learn ...

  9. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  10. Skin Bleaching

    OpenAIRE

    Ahmed, Samira M.

    2015-01-01

    In this project, I aim to investigate the reasoning behind the practice of skin bleaching by analyzing the documentary ”Dark Girls”, to gain a better understanding of race and colorism issues. Also this project tries to see if there is a connection with history and if this has been a part of making the european beauty ideal determine the choices black’s make in regards to beauty.

  11. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  12. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker....... Skin from 12 individuals who served as controls and skin from 14 close relatives of the patients was negative for amyloid. Punch biopsy of the skin is a simple procedure which is of value for the diagnosis of HCCA, even before the appearance of clinical symptoms. This method might also be of use...

  13. 轻中度痤疮患者痤疮部位与正常部位皮肤生理参数的差异%Differences of physiological indicators between healthy normal skin and acne site of mild and moderateacne patients

    Institute of Scientific and Technical Information of China (English)

    陶宇; 王艳东; 李杰; 杨雪松

    2016-01-01

    目的:研究轻中度痤疮患者痤疮部位与健康正常皮肤部位生理指标的差异。方法选取75例痤疮患者检测痤疮部位皮脂分泌量、表皮含水量、皮肤pH值。另外检测63例轻中度痤疮患者痤疮部位与痤疮周围10 cm健康皮肤部位的皮脂分泌量、表皮含水量、皮肤pH值。结果根据每个痤疮患者痤疮部位皮脂分泌量增多、表皮含水量减少的程度不同,可分为轻中重度痤疮;轻中度痤疮患者痤疮部位与健康皮肤比较,痤疮部位皮脂分泌量显著高于周围健康皮肤(t=2.786,P=0.006<0.05),表皮角质层含水量明显低于皮肤健康部位(t=2.648,P=0.009<0.05),痤疮部位皮肤pH值与健康皮肤相比减小(t=3.028,P=0.003<0.05)。结论轻中度痤疮患者痤疮部位与其周围10 cm健康部位比较,皮脂分泌量显著增多、表皮含水量明显降低、皮肤pH值下降。%Objective To investigate the differences of physiological indicators between healthy normal skin and acne site of mild and moderate acne patients. Methods The 75 acne patients were enrolled in this study. Sebum secretion, moisture of skin, and skin PH value in acne site and the surrounding 10cm healthy skin of the 63 mild and moderate acne patients were tested. Results According to the different degree of an increase of sebum secretion, a reduction of skin moisture content in acne site of each acne patient, the acne were divided into the mild, moderate and severe acne. Sebum secretion of the mild and moderate acne was significantly higher than the healthy skin ( t=2.786,P=0.006,P<0.05) , moisture of skin was lower than the control ( t=2.648,P=0.009,P<0.05), skin PH value was decreased (t=3.028,P=0.003,P<0.05). Conclusions Compared the acne site with the surrounding 10cm healthy skin of the mild and moderate acne, we find the amount of sebum secretion increased significantly, the skin moisture content decreased, the skin pH value decreased.

  14. Microphthalmia with linear skin defects syndrome.

    Science.gov (United States)

    García-Rabasco, Ana; De-Unamuno, Blanca; Martínez, Francisco; Febrer-Bosch, Isabel; Alegre-de-Miquel, Víctor

    2013-01-01

    Microphthalmia with linear skin defects (MLS) or microcornea, dermal aplasia and sclerocornea (MIDAS) syndrome is a rare X-linked-dominant disorder. We present a patient with agenesis of corpus callosum, ocular abnormalities, and multiple skin defects. The cytogenetic studies of the MLS critical region (Xp22.2) were normal, but a skewed X-chromosome inactivation pattern (85:15) was observed.

  15. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  16. Preparation of Inactivated Human Skin Using High Hydrostatic Pressurization for Full-Thickness Skin Reconstruction.

    Directory of Open Access Journals (Sweden)

    Pham Hieu Liem

    Full Text Available We have reported that high-hydrostatic-pressure (HHP technology is safe and useful for producing various kinds of decellularized tissue. However, the preparation of decellularized or inactivated skin using HHP has not been reported. The objective of this study was thus to prepare inactivated skin from human skin using HHP, and to explore the appropriate conditions of pressurization to inactivate skin that can be used for skin reconstruction. Human skin samples of 8 mm in diameter were packed in bags filled with normal saline solution (NSS or distilled water (DW, and then pressurized at 0, 100, 150, 200 and 1000 MPa for 10 minutes. The viability of skin after HHP was evaluated using WST-8 assay. Outgrowth cells from pressurized skin and the viability of pressurized skin after cultivation for 14 days were also evaluated. The pressurized skin was subjected to histological evaluation using hematoxylin and eosin staining, scanning electron microscopy (SEM, immunohistochemical staining of type IV collagen for the basement membrane of epidermis and capillaries, and immunohistochemical staining of von Willebrand factor (vWF for capillaries. Then, human cultured epidermis (CE was applied on the pressurized skin and implanted into the subcutis of nude mice; specimens were subsequently obtained 14 days after implantation. Skin samples pressurized at more than 200 MPa were inactivated in both NSS and DW. The basement membrane and capillaries remained intact in all groups according to histological and immunohistological evaluations, and collagen fibers showed no apparent damage by SEM. CE took on skin pressurized at 150 and 200 MPa after implantation, whereas it did not take on skin pressurized at 1000 MPa. These results indicate that human skin could be inactivated after pressurization at more than 200 MPa, but skin pressurized at 1000 MPa had some damage to the dermis that prevented the taking of CE. Therefore, pressurization at 200 MPa is optimal for

  17. Birkhoff normalization

    NARCIS (Netherlands)

    Broer, H.; Hoveijn, I.; Lunter, G.; Vegter, G.

    2003-01-01

    The Birkhoff normal form procedure is a widely used tool for approximating a Hamiltonian systems by a simpler one. This chapter starts out with an introduction to Hamiltonian mechanics, followed by an explanation of the Birkhoff normal form procedure. Finally we discuss several algorithms for comput

  18. Skin Keratins.

    Science.gov (United States)

    Wang, Fengrong; Zieman, Abigail; Coulombe, Pierre A

    2016-01-01

    Keratins comprise the type I and type II intermediate filament-forming proteins and occur primarily in epithelial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type-, differentiation-, and context-dependent manner. Keratins serve multiple homeostatic and stress-enhanced mechanical and nonmechanical functions in epithelia, including the maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications as well as keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility and/or altered tissue homeostasis. Moreover, keratin mutation or misregulation represents risk factors or genetic modifiers for several acute and chronic diseases. This chapter focuses on keratins that are expressed in skin epithelia, and details a number of basic protocols and assays that have proven useful for analyses being carried out in skin.

  19. Skin changes in menopause.

    Science.gov (United States)

    Bolognia, J L; Braverman, I M; Rousseau, M E; Sarrel, P M

    1989-12-01

    Skin signs and symptoms were examined in 46 menopausal women prior to estrogen replacement therapy. Several symptoms such as pruritus, bruising, dryness and thinning were seen more frequently in sun-exposed skin emphasizing the contribution of photoaging. At the end of a 6-mth treatment period, no significant difference was observed in the prevalence or severity of the cutaneous signs and symptoms when patients receiving transdermal 17 beta-estradiol (Estraderm) were compared with controls (the only exception was cutaneous flushing). Elastic fibers from sun-protected (buttock) skin of menopausal women were studied by light and electron microscopy. In 3 women (ages 30-37) with a history of premature menopause, the elastic fibers had several degenerative changes including coalescence of cystic spaces into lacunae, peripheral fragmentation, granular degeneration and splitting of the fibers into strands. Similar age-related ultrastructural changes are normally found in individuals that are at least 20 yrs older than these patients. These findings are suggestive of a relationship between premature aging of the dermal elastic fibers and estrogen deprivation.

  20. A preliminary study of skin ultrasound in diffuse cutaneous systemic sclerosis: Does skin echogenicity matter?

    Science.gov (United States)

    Xu, Dong; Wang, Liang; Li, Jian-chu; Jiang, Yu-xin; Wang, Qian; Li, Meng-tao; Zhang, Feng-chun; Zeng, Xiao-feng

    2017-01-01

    Objective To evaluate the usefulness of skin ultrasound and acoustic radiation force impulse (ARFI) quantification in diffuse cutaneous systemic sclerosis (dcSSc). Patients and methods 28 patients with dcSSc, and 15 age gender matched normal controls were recruited. Skin echogenicity, thickness, and ARFI quantification were measured by ultrasound at 17 sites corresponding to the modified Rodnan skin score (mRSS) in each participant. Compared with controls, skin echogenicity of dcSSc patients was classified into isoechoic, hypoechoic, and hyperechoic. The skin thickness, ARFI quantification and mRSS were compared between isoechoic, hypoechoic, hyperechoic and controls. Results In patients with dcSSc, the skin thickness increased as the echogenicity changed on the order of isoechoic, hypoechoic and hyperechoic. ARFI quantification was significantly higher in hyperechoic than isoechoic (p<0.001). The mRSS were significantly higher in hyperechoic and/or hypoechoic than isoechoic. For isoechoic patients and healthy controls, the skin echogenicity or thickness was no significant different, however, the ARFI quantification was significantly higher in isoechoic than controls. Conclusion Skin ultrasound is feasible for assessing the skin involvement in dcSSc. Skin echogenicity correlates with skin thickness, stiffness, and mRSS. ARFI quantification may be more sensitive to detect skin changes, compared with skin echogenicity and thickness. PMID:28339492

  1. SKIN AND HAIR CHANGES AFTER FORTY

    Directory of Open Access Journals (Sweden)

    Manisha

    2014-04-01

    Full Text Available Aging is a continuous, dynamic, and an irreversible process. Direct exposure to ultra-violet radiations, skin is particularly prone to early aging, known as photo aging. Skin aging is particularly important because of its visibility and social impact. As women age we will notice changes to our skin and hair during the menopause. Dry, thinning, fragile, less tolerant and sagging skin are common complaints. The main reasons for the change in skin is the loss of estrogen, testosterone and dehydroepiandrosterone (DHEA etc, 1, 2, 3 from the age of 35 onwards up to menopause, the more we have had long-term exposure to the elements, such as sun and wind the more this becomes evident. Estrogen is very involved in the normal function of the skin. It directly affects the function of key cells in the skin, like the fibroblast (produces collagen and elastin, keratinocyte (closely involved in skin protection and melanocytes (involved in evenness of skin color, etc.. It also helps regulate hair follicle function (hair production as well as sebaceous gland activity (producing skin oils. After the age of forty most of women enters menopause, during which estrogens levels decreases, which leads to different types of hair and skin changes which has been described in this article.

  2. Adjacent Segment Pathology after Anterior Cervical Fusion.

    Science.gov (United States)

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-06-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion.

  3. Enteroenteroanastomosis near adjacent ileocecal valve in infants

    Institute of Scientific and Technical Information of China (English)

    Wei-Wei Jiang; Xiao-Qun Xu; Qi-Ming Geng; Jie Zhang; Huan Chen; Xiao-Feng Lv; Chang-Gui Lu

    2012-01-01

    AIM:To investigate the feasibility and the effectiveness of ileoileostomy in the region adjacent to the ileocecal valve,which can retain the ileocecal valve in infants.METHODS:This is a retrospective review of 48 patients who underwent ileoileostomy in the region adjacent to the ileocecal valve (group 1) and 34 patients who underwent ileocecal resections and ileotransversanastomosis (group 2).Patients were monitored for the time to flatus,resumption of eating,length of hospital stay after surgery,serum total bile acid,vitamin B12 and postoperative complications.RESULTS:The time to flatus,time until resumption of eating and post-operative length of hospital stay showed no statistically significant differences between the two groups.Serum total bile acid and vitamin B12 were not significantly different between the two groups at post-operative day 1 and day 3,but were significantly decreased at 1 wk after operation in group 2.None of the patients died or suffered from stomal leak in these two groups.However,the incidence of diarrhea,intestinal infection,disturbance of acid-base balance and water-electrolytes in group 1 was lower than in group 2.CONCLUSION:Ileoileostomy in the region adjacent to the ileocecal valve is safe and results in fewer complications than ileotransversanastomosis in infants.

  4. Biophysical characteristics of skin in mild to moderate acne%轻中度痤疮患者皮肤生理参数特征

    Institute of Scientific and Technical Information of China (English)

    吴琰瑜; 王学民; 程英; 谈益妹; 袁超

    2011-01-01

    Objective To assess the biophysical characteristics of normal skin and inflammatory skin lesions in mild and moderate acne. Methods Seventy-five mild and moderate acne vulgaris patients were included in the study. One inflammatory lesion measuring 2.0 to 5.0 mm in diameter which occurred within 48 hours prior to the measurement was selected as the target lesion. Trans-epidermis water loss (TEWL), capacitance and a* value were measured in target lesions and lesion-adjacent normal skin. Sebum content immediately,1 and 4 (saturated) hours after face washing was also determined on target lesions and central forehead between the eyebrows. Sebum secretion rate (SSR) was calculated. Results The TEWL and SSR significantly increased in the lesion-adjacent normal skin with the increment of inflammatory lesion number (both P < 0.05), and increased in target lesions with the elevation of a* value (both P < 0.05). The target lesions exhibited a significantly higher TEWL but a lower saturated sebum content and SSR than the adjacent normal skin did (all P <0.05). Conclusions The severity of inflammatory lesions is correlated with the impaired barrier function and increased SSR in facial skin. Compared with the adjacent normal skin, inflammatory skin lesions have a reduced skin barrier function and SSR.%目的 探讨轻中度痤疮患者正常部位皮肤及炎性皮疹部位生理参数的特征.方法 75例轻中度寻常痤疮受试者.每例受试者选择在48 h内出现,直径在2.0~5.0 mm之间的炎性皮疹作为靶皮疹.对靶皮疹及临近靶皮疹的正常部位皮肤进行经表皮失水率、表皮含水量及a*值的检测.洁面后即刻皮脂量、洁面后1 h皮脂量、皮脂饱和值在靶皮疹及双眉之间的额部进行检测并计算皮脂分泌速率.结果 随着患者面部炎性丘疹数量的增加,痤疮患者正常部位皮肤的经表皮失水率、皮脂分泌速率显著增高(P<0.05).随着皮疹a*值的增高,皮疹部位经表皮失水

  5. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  6. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  7. Severe combined immunodeficiency mouse and human psoriatic skin chimeras. Validation of a new animal model.

    OpenAIRE

    1995-01-01

    Research into the cause and pathophysiological mechanisms underlying expression of psoriatric skin lesions has been hampered by lack of an appropriate animal model for this common and enigmatic cutaneous disease. These studies characterize normal skin, pre-psoriatic skin, and psoriatic plaque skin samples transplanted onto severe combined immunodeficiency mice. In this report we document that 1), normal, prepsoriatic, and psoriatic plaque keratome skin samples can be transplanted onto severe ...

  8. Adjacent-level arthroplasty following cervical fusion.

    Science.gov (United States)

    Rajakumar, Deshpande V; Hari, Akshay; Krishna, Murali; Konar, Subhas; Sharma, Ankit

    2017-02-01

    OBJECTIVE Adjacent-level disc degeneration following cervical fusion has been well reported. This condition poses a major treatment dilemma when it becomes symptomatic. The potential application of cervical arthroplasty to preserve motion in the affected segment is not well documented, with few studies in the literature. The authors present their initial experience of analyzing clinical and radiological results in such patients who were treated with arthroplasty for new or persistent arm and/or neck symptoms related to neural compression due to adjacent-segment disease after anterior cervical discectomy and fusion (ACDF). METHODS During a 5-year period, 11 patients who had undergone ACDF anterior cervical discectomy and fusion (ACDF) and subsequently developed recurrent neck or arm pain related to adjacent-level cervical disc disease were treated with cervical arthroplasty at the authors' institution. A total of 15 devices were implanted (range of treated levels per patient: 1-3). Clinical evaluation was performed both before and after surgery, using a visual analog scale (VAS) for pain and the Neck Disability Index (NDI). Radiological outcomes were analyzed using pre- and postoperative flexion/extension lateral radiographs measuring Cobb angle (overall C2-7 sagittal alignment), functional spinal unit (FSU) angle, and range of motion (ROM). RESULTS There were no major perioperative complications or device-related failures. Statistically significant results, obtained in all cases, were reflected by an improvement in VAS scores for neck/arm pain and NDI scores for neck pain. Radiologically, statistically significant increases in the overall lordosis (as measured by Cobb angle) and ROM at the treated disc level were observed. Three patients were lost to follow-up within the first year after arthroplasty. In the remaining 8 cases, the duration of follow-up ranged from 1 to 3 years. None of these 8 patients required surgery for the same vertebral level during the follow

  9. Dupuytren Disease Infiltrating a Full-Thickness Skin Graft.

    Science.gov (United States)

    Wade, Ryckie George; Igali, Laszlo; Figus, Andrea

    2016-08-01

    Although the role of the skin in the development and propagation of Dupuytren disease remains unclear, dermofasciectomy and full-thickness skin grafting (FTSG) appears to delay recurrence. In 2011, a 71-year-old, left-handed man presented with recurrent Dupuytren disease in the dominant hand. In 1991, he originally underwent a primary dermofasciectomy and FTSG for Dupuytren disease involving the palmar skin. Twenty years later, the left middle finger was drawn into flexion by a recurrent cord, and the old graft and adjacent palmar skin were clinically involved by fibromatosis. We performed a revision dermofasciectomy and FTSG. Microscopic analysis of the excised graft demonstrated dense infiltration of the entire skin graft by Dupuytren disease, with areas of active and burnt-out fibromatosis distinct from hypertrophic scarring. This report of Dupuytren fibromatosis infiltrating a skin graft raises questions about the pathophysiology of Dupuytren disease.

  10. Animal models of skin regeneration.

    Science.gov (United States)

    Gawronska-Kozak, Barbara; Grabowska, Anna; Kopcewicz, Marta; Kur, Anna

    2014-03-01

    Cutaneous injury in the majority of vertebrate animals results in the formation of a scar in the post-injured area. Scar tissues, although beneficial for maintaining integrity of the post-wounded region often interferes with full recovery of injured tissues. The goal of wound-healing studies is to identify mechanisms to redirect reparative pathways from debilitating scar formation to regenerative pathways that lead to normal functionality. To perform such studies models of regeneration, which are rare in mammals, are required. In this review we discussed skin regenerative capabilities present in lower vertebrates and in models of skin scar-free healing in mammals, e.g. mammalian fetuses. However, we especially focused on the attributes of two unusual models of skin scar-free healing capabilities that occur in adult mammals, that is, those associated with nude, FOXN1-deficient mice and in wild-type African spiny mice.

  11. Kauffman's adjacent possible in word order evolution

    CERN Document Server

    Ferrer-i-Cancho, Ramon

    2015-01-01

    Word order evolution has been hypothesized to be constrained by a word order permutation ring: transitions involving orders that are closer in the permutation ring are more likely. The hypothesis can be seen as a particular case of Kauffman's adjacent possible in word order evolution. Here we consider the problem of the association of the six possible orders of S, V and O to yield a couple of primary alternating orders as a window to word order evolution. We evaluate the suitability of various competing hypotheses to predict one member of the couple from the other with the help of information theoretic model selection. Our ensemble of models includes a six-way model that is based on the word order permutation ring (Kauffman's adjacent possible) and another model based on the dual two-way of standard typology, that reduces word order to basic orders preferences (e.g., a preference for SV over VS and another for SO over OS). Our analysis indicates that the permutation ring yields the best model when favoring pa...

  12. Detecting Adjacent Relativity of Engineering Drawing Entities with Container Window

    Institute of Scientific and Technical Information of China (English)

    林福严; 邱友申; 秦吉胜

    2001-01-01

    Automatic recognition and interpretation of engineering drawing plays an important role in computer aided engineering. Detecting the positional relation between entities is an important topic in this research field. In this paper the concepts of adjacent relativity and container window of drawing entities were proposed. By means of container window, the adjacent irrelative entities can be detected quickly and effectively, which speeds up the process of adjacent relativity detection. Meanwhile, the algorithm of adjacent relativity detection was discussed.

  13. Rabbit IgG distribution in skin, spinal cord and DRG following systemic injection in rat.

    Science.gov (United States)

    Tonra, J R; Mendell, L M

    1997-12-01

    In order to determine the distribution of antibodies such as anti-NGF following systemic injection in neonates, immunocytochemical techniques were used to examine the localization of rabbit IgG in rat skin, DRG, and spinal cord after treatments with normal rabbit serum or purified rabbit IgG. Daily subcutaneous injections beginning on postnatal day 2 or on day 15 were given for three days. On the fourth day the animals were sacrificed and tissues were processed for rabbit IgG-IR. In the dorsal and ventral spinal cord, staining intensities suggest a substantial increase in the blood-brain barrier during the first two weeks after birth. Staining intensity in the epidermis of the glabrous skin from the hindpaw was substantially lower than in the adjacent dermis. In addition, IgG infrequently accumulated intracellularly in intensely stained patches in the epidermis. IgG was also able to reach relatively high intracellular concentrations in a small number of sensory neurons. The IgG staining pattern in the skin was similar when anti-NGF itself was administered to the animals. The results are discussed in the context of the effects of anti-NGF on the development of nociceptive afferents.

  14. Skin Care and Aging

    Science.gov (United States)

    ... version of this page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It becomes thinner, ... to make it feel and look better. Dry Skin and Itching Click for more information Many older ...

  15. Cellular Consequences of Telomere Shortening in Histologically Normal Breast Tissues

    Science.gov (United States)

    2013-09-01

    in Figure 1, telomere shortening occurs specifically in luminal epithelial cells, but not in myoepithelial cells, in histologically normal terminal...the adjacent myoepithelial cells (panel A). In contrast, some TDLUs demonstrate dim telomere signals in the luminal cells when compared to the...adjacent myoepithelial cells (panel B). Through digital image analysis, quantitative determination of the telomere FISH signals confirms this moderated

  16. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  17. Contents and ratios of type I and type III collagens in normal skin and hypertrophic scar in people of different ages%正常皮肤与增生性瘢痕中Ⅰ型和Ⅲ型胶原的含量与比例

    Institute of Scientific and Technical Information of China (English)

    王成; 荣艳华; 沈余明; 张国安

    2016-01-01

    Objective To quantify the contents of type I and III collagens and their ratios in normal skin and hyper-trophic scar in people of different ages,and to explore the rule and cause of changes.Methods Normal human skin specimens and hypertrophic scar specimens were obtained from spontaneously aborted fetus and people of different ages, including the children and adolescent group (≤18 years),adult group (19-50 years),elderly group (>50 years). The total collagen contents were determined by hydroxyproline method.The ratios of types I and III collagens were ex-amined by immunohistochemistry,and their contents were calculated.Results The difference of the contents of types I and III collagens and their ratios in normal skin were statistically significant among different age groups (P=0.01 ). Their ratios increased with the increase of age,and the differences were statistically significant among different age groups (P=0.02).The difference of contents of types I and III collagens and their ratios in hypertrophic scars were statistically significant among all groups,also between any two groups (P=0.03).In every age group,the difference of the contents of types I and III collagens and their ratios between normal skin and hypertrophic scar was statistically significant (P=0.02).Conclusion With age increasing,the changes of the ratios of types I and III collagens in the normal skin changes,which results in changes of the tension and elasticity of skin and the healing process after injury. The contents of types I and III collagens and their ratios significantly changes in hypertrophic scars,resulting in different structure of scar from normal skin.%目的:测定各年龄组人正常皮肤及增生性瘢痕中Ⅰ、Ⅲ型胶原的含量及比值,分析其变化规律和原因。方法采集流产胎儿的皮肤标本及儿童青少年组、成年组、老年组的正常皮肤标本和增生性瘢痕标本,采用免疫组织化学染色法测定Ⅰ、Ⅲ型胶原比值

  18. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, Flemming Brandt; Larsen, J O;

    2001-01-01

    Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  19. PIXE analysis in uninvolved skin of atopic patients and in aged skin

    Energy Technology Data Exchange (ETDEWEB)

    Bunse, T.; Steigleder, K. (Universitaets-Hautklinik, Koeln (Germany)); Hoefert, M.; Gonsior, B. (Institut fuer Experimentalphysik, Ruhr-Universitaet, Bochum (Germany))

    1991-01-01

    PIXE analysis was used to determine the elemental distribution in normal-appearing skin of patients suffering from atopic eczema and in the skin of elderly people. With this technique, elements with atomic numbers {>=} 14 can be detected simultaneously in cryosections of skin biopsies down to a concentration of 1 ppm. Compared with a control group, the epidermal concentrations of Zn and CU, which are constituent parts of a variety of enzymes, were increased in uninvolved skin of patients with atopic eczema. In the epidermis of elderly people the level of K was lower and that of Ca was higher than in the epidermis of a younger age group. (au).

  20. What Is Melanoma Skin Cancer?

    Science.gov (United States)

    ... Skin Cancer About Melanoma Skin Cancer What Is Melanoma Skin Cancer? Cancer starts when cells in the ... pigment, causing the skin to tan or darken. Melanoma skin cancers Melanoma is a cancer that begins ...

  1. Exchange coupling between laterally adjacent nanomagnets

    Science.gov (United States)

    Dey, H.; Csaba, G.; Bernstein, G. H.; Porod, W.

    2016-09-01

    We experimentally demonstrate exchange-coupling between laterally adjacent nanomagnets. Our results show that two neighboring nanomagnets that are each antiferromagnetically exchange-coupled to a common ferromagnetic bottom layer can be brought into strong ferromagnetic interaction. Simulations show that interlayer exchange coupling effectively promotes ferromagnetic alignment between the two nanomagnets, as opposed to antiferromagnetic alignment due to dipole-coupling. In order to experimentally demonstrate the proposed scheme, we fabricated arrays of pairs of elongated, single-domain nanomagnets. Magnetic force microscopy measurements show that most of the pairs are ferromagnetically ordered. The results are in agreement with micromagnetic simulations. The presented scheme can achieve coupling strengths that are significantly stronger than dipole coupling, potentially enabling far-reaching applications in Nanomagnet Logic, spin-wave devices and three-dimensional storage and computing.

  2. Preliminary experiments on quantification of skin condition

    Science.gov (United States)

    Kitajima, Kenzo; Iyatomi, Hitoshi

    2014-03-01

    In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.

  3. Conjunctival and cutaneous fungal flora in clinically normal dogs in southern France.

    Science.gov (United States)

    Verneuil, M; Durand, B; Marcon, C; Guillot, J

    2014-03-01

    The objectives of the present study were to describe the fungal flora of the conjunctiva in clinically normal dogs in southern France and to compare the fungal flora from the conjunctiva and that from adjacent skin areas (medial canthus and nose). Fifty dogs aged from 5 months to 13 years were investigated for conjunctival fungal flora. Specimens were obtained from both conjunctivae and the skin of the medial canthus and from the surface of the nose using sterile cotton-wool swabs and a piece of sterile carpet, respectively. Identification of fungal colonies was achieved recording the genus level on the basis of macro- and microscopic features. Fourteen fungal genera (most frequently Alternaria, Cladosporium, Penicillium and Aspergillus) were isolated from the conjunctival fornix of 7 dogs (14%). There was no significant effect of sex or age on frequency of fungal isolation. Eleven dogs (22%) had a positive mycological culture from at least one eye. Fungi found in the conjunctival fornix of dogs might represent transient seeding from the environment, as suspected in other animal species. The presence of conjunctival fungal organisms was correlated to the presence of fungi on the skin.

  4. Seismic Waves Scattering Impact through Tunnel Excavation on Adjacent Monuments Subjected to Far Field Earthquakes

    Directory of Open Access Journals (Sweden)

    Ghobakhloo E.

    2015-09-01

    Full Text Available The study of the effect of seismic wave scattering has attracted extensive attention in the past couple of decades especially in infrastructures like tunnels. A seismic wave, meeting the tunnel, can generate scattering which, in most cases, may incur damages in adjacent structures. In this study, using Finite Element Method (FEM, the effect of seismic wave scattering in far field has been investigated. The twin tunnels of Shiraz subway system are selected as the case study in this research and three far field seismic waves were chosen for time history analyses. Investigating the normal mode (before tunnel construction in comparison to the excavation mode (after tunnel construction enables calculation of the effect of displacement in adjacent structures. The analysis results indicate there is a significant difference between before and after tunnel construction (P-value<0.05. Accordingly, the influence of constructing a tunnel on adjacent surface structures is very important for tunnel design.

  5. Analysis of translucency of skin by volume reflection for color formulation of facial prostheses

    NARCIS (Netherlands)

    Korfage, Anke; Borsboom, Peter C. F.; Dijkstra, Pieter U.; van Oort, Robert P.

    2009-01-01

    Purpose: A facial prosthesis demands a good visual match with the adjacent skin. Skin color and translucency must be mimicked by the prosthesis. Translucency can be defined as allowing the passage of light, yet diffusing it so as not to render the bodies beyond clearly visible, therefore being semi-

  6. Electrochemical Skin Conductance Correlates with Skin Nerve Fiber Density

    Directory of Open Access Journals (Sweden)

    Peter Novak

    2016-08-01

    Full Text Available Purpose: Electrochemical skin conductance (ESC using reverse iontophoresis and chronoamperometry has been used to evaluate abnormal function of small fibers. How ESC correlates with loss of small fibers in skin is unclear.Methods: This was a prospective, blinded study. The primary outcome measure was the correlation between ESC at the feet and results of skin biopsies including epidermal nerve fiber density (ENFD and sweat gland nerve fiber density (SGNFD at the distal leg. ESC, ENFD and SGNFD data were normalized by adjusting for weight. The secondary outcome measures were the correlation between ESC and the following variables: quantitative sudomotor axon reflex test (QSART and symptom scales (neuropathy, pain and autonomic.Results: 81 patients ((mean±sd: age=53.3±17.3, men/women=25/56 were enrolled in the study. ESC was reduced in subjects with abnormally low ENFD (ENFD normal/abnormal, ESC = 1.17±0.27/0.87±0.34 µSiemens/kg, p<0.0008 and abnormally low SGNFD (SGNFD normal/abnormal ESC=1.09±0.34/,0.78±0.3 µSiemens/kg,p<0.0003. ESC correlated with ENFD (ρ=0.73, p=0.0001 and SGNFD (ρ=0.64, p=0.0001. ESC did not correlate with symptom scales. Conclusion: ESC is diminished in subjects who have a reduced number of small fibers in the skin and the ESC reduction is proportional to ENFD and SGNFD. ESC can be useful in detecting loss of small nerve fibers.

  7. Ribosomal protein s6-ps240 is expressed in lesional skin from patients with autoimmune skin blistering diseases

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-01-01

    Full Text Available Background: The in situ signaling transduction within skin biopsies from patients affected by autoimmune skin blistering diseases is not well-characterized. Aim : In autoimmune skin blistering diseases, autoantibodies seem to trigger several intracellular signaling pathways and we investigated the presence of the phosphorylated form of ribosomal protein S6-pS240 within autoimmune skin blistering diseases biopsies. Materials and Methods: We utilized immunohistochemistry to evaluate the presence of S6-pS240 in lesional skin biopsies of patients affected by autoimmune skin blistering diseases including patients with an endemic and nonendemic pemphigus foliaceus (non EPF, with bullous pemphigoid (BP, pemphigus vulgaris (PV, dermatitis herpetiformis (DH, and the respective controls. Results: Most autoimmune bullous skin diseases biopsies stained positive for S6-pS240 around lesional blisters, including adjacent areas of the epidermis; and within upper dermal inflammatory infiltrates, and/or mesenchymal-endothelial cell junctions within the dermis. Conclusions: We document that S6-pS240 is expressed in lesional areas of skin biopsies from patients with autoimmune skin blistering diseases, as well as on eccrine glands and piloerector muscles. Thus, the role of this molecule in autoimmune skin blistering diseases warrants further study.

  8. Remodeling in myocardium adjacent to an infarction in the pig left ventricle.

    Science.gov (United States)

    Zimmerman, Scott D; Criscione, John; Covell, James W

    2004-12-01

    Changes in the structure of the "normal" ventricular wall adjacent to an infarcted area involve all components of the myocardium (myocytes, fibroblasts and the extracellular matrix, and the coronary vasculature) and their three-dimensional structural relationship. Assessing changes in these components requires tracking material markers in the remodeling tissue over long periods of time with a three-dimensional approach as well as a detailed histological evaluation of the remodeled structure. The purpose of the present study was to examine the hypotheses that changes in the tissue adjacent to an infarct are related to myocyte elongation, myofiber rearrangement, and changes in the laminar architecture of the adjacent tissue. Three weeks after myocardial infarction, noninfarcted tissue adjacent to the infarct remodeled by expansion along the direction of the fibers and in the cross fiber direction. These changes are consistent with myocyte elongation and myofiber rearrangement (slippage), as well as a change in cell shape to a more elliptical cross section with the major axis in the epicardial tangent plane, and indicate that reorientation of fibers either via "cell slippage" or changes in orientation of the laminar structure of the ventricular wall are quantitatively important aspects of the remodeling of the normally perfused myocardium.

  9. [Sarcoidosis of the skin].

    Science.gov (United States)

    Suga, Y; Ogawa, H

    1994-06-01

    Sarcoidosis is characterized by formation of epithelioid-cell tubercules, without caseation, of the affected organ systems. The mediastinum, peripheral lymph nodes and eyes, in addition to the skin, are most frequently affected. Between 10% and 30% of patients with systemic sarcoidosis in Japan have skin lesions. Skin sarcoidosis is morphologically classified into three basic groups, erythema nodosum, scar sarcoidosis and skin sarcoid. Skin sarcoid is characterized by specific cutaneous lesions of sarcoidosis, and may take nodular, plaque, angiolupoid, subcutaneous and some other forms. Clinical manifestations of the cutaneous lesions are usually asymptomatic and polymorphous. Skin biopsy is, however, often highly useful for confirming a diagnosis of sarcoidosis.

  10. Interaction between Adjacent Lightning Discharges in Clouds

    Institute of Scientific and Technical Information of China (English)

    WANG Yanhui; ZHANG Guangshu; ZHANG Tong; LI Yajun; WU Bin; ZHANG Tinglong

    2013-01-01

    Using a 3D lightning radiation source locating system (LLS),three pairs of associated lightning discharges (two or more adjacent lightning discharges following an arbitrary rule that their space-gap was less than 10 km and their time-gap was less than 800 ms) were observed,and the interaction between associated lightning discharges was analyzed.All these three pairs of associated lightning discharges were found to involve three or more charge regions (the ground was considered as a special charge region).Moreover,at least one charge region involved two lightning discharges per pair of associated lightning discharges.Identified from electric field changes,the subsequent lightning discharges were suppressed by the prior lightning discharges.However,it is possible that the prior lightning discharge provided a remaining discharge channel to facilitate the subsequent lightning discharge.The third case provided evidence of this possibility.Together,the results suggested that,if the charges in the main negative charge region can be consumed using artificial lightning above the main negative charge regions,lightning accidents on the ground could be greatly reduced,on the condition that the height of the main negative charge region and the charge intensity of the lower positive charge region are suitable.

  11. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini;

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)...

  12. Deepening our understanding of immune sentinels in the skin.

    Science.gov (United States)

    Nestle, Frank O; Nickoloff, Brian J

    2007-09-01

    Advances in our understanding of the skin immune system have a major impact on studies of skin autoimmunity, graft-versus-host disease, inflammation, and cancer as well as on the development of novel vaccines and immunotherapy approaches. In this issue of the JCI, Zaba et al. carefully dissected the complex network of DCs and macrophages residing in normal human skin and defined novel phenotypic markers for these immunocytes (see the related article beginning on page 2517). These studies provide the basis for better insight into the role of important immune sentinels contributing to the maintenance of skin tissue homeostasis and lay the foundation for future studies of the skin immune system.

  13. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  14. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... video. UPDATED: November 23, 2016 Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ...

  15. Examine Your Skin

    Medline Plus

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  16. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... Dermatologic Surgery Expertise for the life of your skin (TM) Public Resources Dermatologic Surgery Conditions Treatments and ... learn-more"> 3 million Americans are diagnosed with skin cancer every year Any suspicious new growths or ...

  17. Can Breast Tumors Affect the Oxidative Status of the Surrounding Environment? A Comparative Analysis among Cancerous Breast, Mammary Adjacent Tissue, and Plasma.

    Science.gov (United States)

    Panis, C; Victorino, V J; Herrera, A C S A; Cecchini, A L; Simão, A N C; Tomita, L Y; Cecchini, R

    2015-01-01

    In this paper, we investigated the oxidative profile of breast tumors in comparison with their normal adjacent breast tissue. Our study indicates that breast tumors present enhanced oxidative/nitrosative stress, with concomitant augmented antioxidant capacity when compared to the adjacent normal breast. These data indicate that breast cancers may be responsible for the induction of a prooxidant environment in the mammary gland, in association with enhanced TNF-α and nitric oxide.

  18. Skin Cancer Trends

    Science.gov (United States)

    ... Trends Behavior Rates What CDC Is Doing Skin Cancer Prevention Progress Report The Burning Truth Initiative A Base Tan Is Not a Safe Tan Tanned Skin Is Not Healthy Skin Controlled Tanning Is Not Safe Tanning Guidelines for School ... Melanoma Surveillance in the U.S. Related Links ...

  19. On skin expansion.

    Science.gov (United States)

    Pamplona, Djenane C; Velloso, Raquel Q; Radwanski, Henrique N

    2014-01-01

    This article discusses skin expansion without considering cellular growth of the skin. An in vivo analysis was carried out that involved expansion at three different sites on one patient, allowing for the observation of the relaxation process. Those measurements were used to characterize the human skin of the thorax during the surgical process of skin expansion. A comparison between the in vivo results and the numerical finite elements model of the expansion was used to identify the material elastic parameters of the skin of the thorax of that patient. Delfino's constitutive equation was chosen to model the in vivo results. The skin is considered to be an isotropic, homogeneous, hyperelastic, and incompressible membrane. When the skin is extended, such as with expanders, the collagen fibers are also extended and cause stiffening in the skin, which results in increasing resistance to expansion or further stretching. We observed this phenomenon as an increase in the parameters as subsequent expansions continued. The number and shape of the skin expanders used in expansions were also studied, both mathematically and experimentally. The choice of the site where the expansion should be performed is discussed to enlighten problems that can lead to frustrated skin expansions. These results are very encouraging and provide insight into our understanding of the behavior of stretched skin by expansion. To our knowledge, this study has provided results that considerably improve our understanding of the behavior of human skin under expansion.

  20. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Experts do not agree on whether or not skin self-exams should be performed. So there is ...

  1. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.J.M.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    PURPOSE OF REVIEW: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. RECENT FINDINGS: Advances in computing and high-throughput sequencing technolog

  2. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    Purpose of review: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. Recent findings: Advances in computing and high-throughput sequencing technolog

  3. Ultrasound skin imaging.

    Science.gov (United States)

    Alfageme Roldán, F

    2014-12-01

    The interaction of high-frequency ultrasound waves with the skin provides the basis for noninvasive, fast, and accessible diagnostic imaging. This tool is increasingly used in skin cancer and inflammatory conditions as well as in cosmetic dermatology. This article reviews the basic principles of skin ultrasound and its applications in the different areas of dermatology.

  4. Analysis of adjacent segment reoperation after lumbar total disc replacement

    OpenAIRE

    Rainey, Scott; Blumenthal, Scott L.; Zigler, Jack E.; Guyer, Richard D.; Ohnmeiss, Donna D.

    2012-01-01

    Background Fusion has long been used for treating chronic back pain unresponsive to nonoperative care. However, potential development of adjacent segment degeneration resulting in reoperation is a concern. Total disc replacement (TDR) has been proposed as a method for addressing back pain and preventing or reducing adjacent segment degeneration. The purpose of the study was to determine the reoperation rate at the segment adjacent to a level implanted with a lumbar TDR and to analyze the pre-...

  5. PIV Measurements and Mechanisms of Adjacent Synthetic Jets Interactions

    Institute of Scientific and Technical Information of China (English)

    LUO Zhen-Bing; XIA Zhi-Xun

    2008-01-01

    Interactions of adjacent synthetic jet actuators with varying relative amplitude and the relative phase of driving voltage are measured using a particle image velocimetry(PIV).Varying relative amplitude or relative phase of driving voltage of the adjacent actuators vectors the direction of the ensuing merged jet of the adjacent synthetic jets.The vectoring mechanism of the adjacent vortex pairs,attract-impact causing deflection(AICD),is provided to explain why the merged jet is generally vectored to the side of the phase-leading synthetic jet or the synthetic jet with higher driving voltage.

  6. The proliferating ability of transitional mucosa adjacent to rectal carcinomaand its clinical significance in sphincter preserving operations

    Institute of Scientific and Technical Information of China (English)

    Qi Se; Yi Zhao; Cun Sheng Chen; En Qing Liu; Yong Feng; Wei Wang; Qun Li

    2000-01-01

    AIM To study the biopathologic characteristics of the transitional mucosa (TM) adjacent to rectalcarcinoma and the resecting length of bowel.METHODS Immunohistochemical and mucin histochemical methods were used in 81 cases to observe theexpression of PCNA and the changing regulations of TM adjacent to rectal carcinoma.RESULTS The PCNA expression rate was the highest in cancer and gradually decreased in atypicaldysplasia, TM and normal mucosa (P<0.01). The range of TM adjacent to the mucinous adenocarcinomawas more extensive than that to the papilla adenocarcinoma and the tubular adenocarcinoma (P< 0.01 ). Therange of TM adjacent to the rectal carcinoma in Dukes C stage was more extensive than that in stage A, B(P<0.01, P<0.05).CONCLUSION The TM of rectal carcinoma possesses certain potential of malignancy. The range of TMadjacent to rectal carcinoma is closely related to the pathological type and advancement of rectal carcinoma.

  7. 生理盐水联合酒精应用的不同方式对皮试消毒的效果分析%An Analysis on Effect of Different Application Ways of Normal Saline plus Alcohol on Skin Test

    Institute of Scientific and Technical Information of China (English)

    罗艳; 孔碧华; 李冬芬

    2015-01-01

    Objective:To study the sterilizing effect of different application ways of sodium chloride(0 .9% ) plus alcohol(75% ) in the area of skin test .Methods:Select a total of 600 cases of patients who were infused in clinic and has to have a allergy skin test of tetanus antitoxin in some hospital during the period from January 2013 to December , randomly divide them into wiping group and spraying group .The wiping group were wiped with sodium chloride (0 .9% ) firstly ,and then were sterilized with alcohol(75% ) in the same way ,finally took the skin test .The spraying group were sterilized with alcohol(75% ) in the same way above first ,and then were sprayed with the spray bottle containing sodium chloride(0 .9% ) towards the area wiped with alcohol ,dry the sterilized area with sterile swabs and take the skin test .20 minutes later ,Compare and observe the false positive rate after skin test ,infection rate ,the prev‐alence of anaphylactic reaction after medication in the two groups ,sterilizing quantity in sterilized area .Results:False positive rate of the wiping group and spraying group was 0 .7% and 3 .3 respectively (P< 0 .05) .None of them showed any skin infection and allergy in both group .As for the quantity of sterilized bacteria in the two groups after medicating ,the quantity of the wiping group was less than that of spraying group ,the difference was comparatively obvious (P<0 .05) .Conclusion:The safety application of the wipe and spray of normal saline plus and alcohol in the sterilization of skin test lower the false positive rate resulted from skin sanitizer ,alleviate patients'suffering and it is more effective ,saves health resources ,reduces the workload and improves clinical working efficiency .%目的:探讨运用0.9%氯化钠(即生理盐水)联合75%乙醇应用的不同方式对皮试区皮肤消毒效果的研究。方法:选取某院2013年1~12月的门诊输液需进行过伤风抗病毒素过敏皮试的患者共600

  8. Pursuing prosthetic electronic skin

    Science.gov (United States)

    Chortos, Alex; Liu, Jia; Bao, Zhenan

    2016-09-01

    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals.

  9. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  10. Skin manifestations in a case of trisomy 16 mosaicism

    DEFF Research Database (Denmark)

    Ousager, Lilian Bomme; Brandrup, Flemming; Andersen, Charlotte Brasch;

    2006-01-01

    We present a 48-year-old man with unilateral dermatological manifestations including hypertrichosis, telangiectasia, hyperkeratosis and hyperpigmentation. Additional findings included skeletal abnormalities and left-sided hearing loss. Skin biopsies showed changes characteristic of porokeratosis........ Fibroblast karyotyping from affected skin demonstrated trisomy 16 mosaicism, in contrast to the normal karyotype in unaffected skin and blood lymphocytes. The possible role of trisomy 16 in porokeratosis is discussed....

  11. Tactile-direction-sensitive and stretchable electronic skins based on human-skin-inspired interlocked microstructures.

    Science.gov (United States)

    Park, Jonghwa; Lee, Youngoh; Hong, Jaehyung; Lee, Youngsu; Ha, Minjeong; Jung, Youngdo; Lim, Hyuneui; Kim, Sung Youb; Ko, Hyunhyub

    2014-12-23

    Stretchable electronic skins with multidirectional force-sensing capabilities are of great importance in robotics, prosthetics, and rehabilitation devices. Inspired by the interlocked microstructures found in epidermal-dermal ridges in human skin, piezoresistive interlocked microdome arrays are employed for stress-direction-sensitive, stretchable electronic skins. Here we show that these arrays possess highly sensitive detection capability of various mechanical stimuli including normal, shear, stretching, bending, and twisting forces. Furthermore, the unique geometry of interlocked microdome arrays enables the differentiation of various mechanical stimuli because the arrays exhibit different levels of deformation depending on the direction of applied forces, thus providing different sensory output patterns. In addition, we show that the electronic skins attached on human skin in the arm and wrist areas are able to distinguish various mechanical stimuli applied in different directions and can selectively monitor different intensities and directions of air flows and vibrations.

  12. Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

    DEFF Research Database (Denmark)

    Philipsen, P A; Knudsen, L; Gniadecka, M

    2013-01-01

    and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...

  13. Consistent adjacency-spectral partitioning for the stochastic block model when the model parameters are unknown

    CERN Document Server

    Fishkind, Donniell E; Tang, Minh; Vogelstein, Joshua T; Priebe, Carey E

    2012-01-01

    A stochastic block model consists of a random partition of n vertices into blocks 1,2,...,K for which, conditioned on the partition, every pair of vertices has probability of adjacency entirely determined by the block membership of the two vertices. (The model parameters are K, the distribution of the random partition, and a communication probability matrix M in [0,1]^(K x K) listing the adjacency probabilities associated with all pairs of blocks.) Suppose a realization of the n x n vertex adjacency matrix is observed, but the underlying partition of the vertices into blocks is not observed; the main inferential task is to correctly partition the vertices into the blocks with only a negligible number of vertices misassigned. For this inferential task, Rohe et al. (2011) prove the consistency of spectral partitioning applied to the normalized Laplacian, and Sussman et al. (2011) extend this to prove consistency of spectral partitioning directly on the adjacency matrix; both procedures assume that K and rankM a...

  14. Immunohistochemical analysis of ras oncogene p21 product in human gastric carcinomas and their adjacent mucosas.

    Science.gov (United States)

    Carneiro, F; David, L; Sunkel, C; Lopes, C; Sobrinho-Simões, M

    1992-04-01

    In an attempt to clarify the relationship between ras oncogene expression and the clinico-pathological features of malignant and pre-malignant lesions of the stomach we undertook the immunohistochemical study of the expression of ras gene p21 product in a series of eighty gastric carcinomas and their respective adjacent mucosas. In two cases the mRNA of Ha-ras was also studied by in situ hybridization. The majority of gastric carcinomas as well as their adjacent non-neoplastic mucosas expressed ras gene product. There was a significant relationship between the expression of ras gene p21 product and the morphologic pattern of the tumours. An enhanced ras expression was found in several conditions regarded as precursor lesions of intestinal and/or diffuse types of gastric carcinoma (dysplasia, foveolar hyperplasia and even the neck zone of normal-appearing gastric glands, namely in the mucosa adjacent to diffuse carcinomas). Ras expression was actually more prominent in most of these conditions than in their respective adjacent carcinomas. No significant relationship was found between ras expression and invasiveness of the wall, nodal metastases and venous invasion.

  15. Study on Optimization of Phase Offset at Adjacent Intersections

    Directory of Open Access Journals (Sweden)

    Yuanli GU

    2010-11-01

    Full Text Available Optimization of the phase offset at adjacent intersections is the key parameter regarding coordinated control of traffic signal for adjacent intersections, which decides the effect of the coordinated control for adjacent intersections. According to characters of saturated traffic flow of Chinese urban road, this thesis establishes a model for optimization of phase offset for adjacent interactions and finds a solution from such model by adopting genetic algorithm. The model is verified by actual traffic flow datum of two adjacent signal intersections on Changan Avenue. Then a comparison is made between the optimization result of such model and that of the existing mathematical method and SYNCHRO model, which indicates that the model established by this thesis can reduce the delay suffered by vehicles at the intersections and increase the traffic efficiency of the intersections.

  16. Clinical efficacy of artificial skin combined with vacuum sealing drainage in treating large-area skin defects

    Institute of Scientific and Technical Information of China (English)

    TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao

    2010-01-01

    Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.

  17. Simultaneous spectrophotometric and mechanical property characterization of skin

    Science.gov (United States)

    Bunegin, Leonid; Moore, Jeffery B.

    2006-02-01

    Both reflectance spectroscopy and the determination Young's Modulus of skin have shown promise for identifying skin pathology. At present, these determinations are carried out using separate methodologies. This study demonstrates a new technology combining digital UV/VIS reflectance spectroscopy and vacuum aspiration for simultaneously determining the reflectance spectrum and mechanical properties of human skin tissue. A small hand held prototype device incorporating fiber-optic light guides into a vacuum channel was calibrated using various elastic materials subjected to increments of stress by vacuum from 0 to 25 in Hg. The intensity of a UV/VIS light beam reflected from the material at each vacuum increment was compared to the resulting material strain. The reflected beam was also spectrophotometrically analyzed. Skin types were similarly evaluated comparing normal and scar tissue and skin of various ages and coloration. An exponential relationship between reflected beam intensity and the amount of strain resulting from vacuum increments was observed. Young's Modulus (calculated from Aoki et. al equation) and spectra from normal skin and scar tissue were in agreement with previously published observations. Age related decreases in skin elasticity were also demonstrated. In the reflectance spectra, oxy and deoxy-hemoglobin absorbance bands were detected, becoming significantly enhanced at increased levels of vacuum. Melanin absorbance was also easily detected and appeared to correlate with skin coloration. Since superficial skin pathologies have characteristic spectroscopic and mechanical properties, this technique may provide a promising new approach for rapid, non-invasive method for the evaluation of skin lesions.

  18. Expression of human skin-specific genes defined by transcriptomics and antibody-based profiling.

    Science.gov (United States)

    Edqvist, Per-Henrik D; Fagerberg, Linn; Hallström, Björn M; Danielsson, Angelika; Edlund, Karolina; Uhlén, Mathias; Pontén, Fredrik

    2015-02-01

    To increase our understanding of skin, it is important to define the molecular constituents of the cell types and epidermal layers that signify normal skin. We have combined a genome-wide transcriptomics analysis, using deep sequencing of mRNA from skin biopsies, with immunohistochemistry-based protein profiling to characterize the landscape of gene and protein expression in normal human skin. The transcriptomics and protein expression data of skin were compared to 26 (RNA) and 44 (protein) other normal tissue types. All 20,050 putative protein-coding genes were classified into categories based on patterns of expression. We found that 417 genes showed elevated expression in skin, with 106 genes expressed at least five-fold higher than that in other tissues. The 106 genes categorized as skin enriched encoded for well-known proteins involved in epidermal differentiation and proteins with unknown functions and expression patterns in skin, including the C1orf68 protein, which showed the highest relative enrichment in skin. In conclusion, we have applied a genome-wide analysis to identify the human skin-specific proteome and map the precise localization of the corresponding proteins in different compartments of the skin, to facilitate further functional studies to explore the molecular repertoire of normal skin and to identify biomarkers related to various skin diseases.

  19. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  20. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  1. Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

    Institute of Scientific and Technical Information of China (English)

    CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

    2005-01-01

    Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

  2. Human papillomaviruses and skin cancer.

    Science.gov (United States)

    Smola, Sigrun

    2014-01-01

    Human papillomaviruses (HPVs) infect squamous epithelia and can induce hyperproliferative lesions. More than 120 different HPV types have been characterized and classified into five different genera. While mucosal high-risk HPVs have a well-established causal role in anogenital carcinogenesis, the biology of cutaneous HPVs is less well understood. The clinical relevance of genus beta-PV infection has clearly been demonstrated in patients suffering from epidermodysplasia verruciformis (EV), a rare inherited disease associated with ahigh rate of skin cancer. In the normal population genus beta-PV are suspected to have an etiologic role in skin carcinogenesis as well but this is still controversially discussed. Their oncogenic potency has been investigated in mouse models and in vitro. In 2009, the International Agency for Research on Cancer (IARC) classified the genus beta HPV types 5 and 8 as "possible carcinogenic" biological agents (group 2B) in EV disease. This chapter will give an overview on the knowns and unknowns of infections with genus beta-PV and discuss their potential impact on skin carcinogenesis in the general population.

  3. Basophils and skin disorders.

    Science.gov (United States)

    Borriello, Francesco; Granata, Francescopaolo; Marone, Gianni

    2014-05-01

    Since their discovery in 1879, basophils have been viewed as circulating blood granulocytes with limited immune function. New research tools for their functional analysis in vivo have revealed previously unrecognized roles for basophils in several skin disorders. Human basophils infiltrate different skin lesions and have been implicated in the pathogenesis of diseases ranging from chronic idiopathic urticaria to systemic lupus erythematosus. In mouse models, basophils participate in IgE-mediated chronic allergic inflammation of the skin and have a protective role in tick infestation. In this review, we discuss critical advances in our understanding of basophil biology and their roles in the pathophysiology of skin disorders.

  4. Skin Images Segmentation

    Directory of Open Access Journals (Sweden)

    Ali E. Zaart

    2010-01-01

    Full Text Available Problem statement: Image segmentation is a fundamental step in many applications of image processing. Skin cancer has been the most common of all new cancers detected each year. At early stage detection of skin cancer, simple and economic treatment can cure it mostly. An accurate segmentation of skin images can help the diagnosis to define well the region of the cancer. The principal approach of segmentation is based on thresholding (classification that is lied to the problem of the thresholds estimation. Approach: The objective of this study is to develop a method to segment the skin images based on a mixture of Beta distributions. We assume that the data in skin images can be modeled by a mixture of Beta distributions. We used an unsupervised learning technique with Beta distribution to estimate the statistical parameters of the data in skin image and then estimate the thresholds for segmentation. Results: The proposed method of skin images segmentation was implemented and tested on different skin images. We obtained very good results in comparing with the same techniques with Gamma distribution. Conclusion: The experiment showed that the proposed method obtained very good results but it requires more testing on different types of skin images.

  5. Characterization of hair follicle development in engineered skin substitutes.

    Directory of Open Access Journals (Sweden)

    Penkanok Sriwiriyanont

    Full Text Available Generation of skin appendages in engineered skin substitutes has been limited by lack of trichogenic potency in cultured postnatal cells. To investigate the feasibility and the limitation of hair regeneration, engineered skin substitutes were prepared with chimeric populations of cultured human keratinocytes from neonatal foreskins and cultured murine dermal papilla cells from adult GFP transgenic mice and grafted orthotopically to full-thickness wounds on athymic mice. Non-cultured dissociated neonatal murine-only skin cells, or cultured human-only skin keratinocytes and fibroblasts without dermal papilla cells served as positive and negative controls respectively. In this study, neonatal murine-only skin substitutes formed external hairs and sebaceous glands, chimeric skin substitutes formed pigmented hairs without sebaceous glands, and human-only skin substitutes formed no follicles or glands. Although chimeric hair cannot erupt readily, removal of upper skin layer exposed keratinized hair shafts at the skin surface. Development of incomplete pilosebaceous units in chimeric hair corresponded with upregulation of hair-related genes, LEF1 and WNT10B, and downregulation of a marker of sebaceous glands, Steroyl-CoA desaturase. Transepidermal water loss was normal in all conditions. This study demonstrated that while sebaceous glands may be involved in hair eruption, they are not required for hair development in engineered skin substitutes.

  6. Early Growth Response1and Fatty Acid Synthase Expression is Altered in Tumor Adjacent Prostate Tissue and Indicates Field Cancerization

    Science.gov (United States)

    Jones, Anna C.; Trujillo, Kristina A.; Phillips, Genevieve K.; Fleet, Trisha M.; Murton, Jaclyn K.; Severns, Virginia; Shah, Satyan K.; Davis, Michael S.; Smith, Anthony Y.; Griffith, Jeffrey K.; Fischer, Edgar G.; Bisoffi, Marco

    2011-01-01

    BACKGROUND Field cancerization denotes the occurrence of molecular alterations in histologically normal tissues adjacent to tumors. In prostate cancer, identification of field cancerization has several potential clinical applications. However, prostate field cancerization remains ill defined. Our previous work has shown up-regulated mRNA of the transcription factor early growth response 1 (EGR-1) and the lipogenic enzyme fatty acid synthase (FAS) in tissues adjacent to prostate cancer. METHODS Immunofluorescence data were analyzed quantitatively by spectral imaging and linear unmixing to determine the protein expression levels of EGR-1 and FAS in human cancerous, histologically normal adjacent, and disease-free prostate tissues. RESULTS EGR-1 expression was elevated in both structurally intact tumor adjacent (1.6× on average) and in tumor (3.0× on average) tissues compared to disease-free tissues. In addition, the ratio of cytoplasmic versus nuclear EGR-1 expression was elevated in both tumor adjacent and tumor tissues. Similarly, FAS expression was elevated in both tumor adjacent (2.7× on average) and in tumor (2.5× on average) compared to disease-free tissues. CONCLUSIONS EGR-1 and FAS expression is similarly deregulated in tumor and structurally intact adjacent prostate tissues and defines field cancerization. In cases with high suspicion of prostate cancer but negative biopsy, identification of field cancerization could help clinicians target areas for repeat biopsy. Field cancerization at surgical margins on prostatectomy specimen should also be looked at as a predictor of cancer recurrence. EGR-1 and FAS could also serve as molecular targets for chemoprevention. PMID:22127986

  7. Effect of Age on Tooth Shade, Skin Color and Skin-Tooth Color Interrelationship in Saudi Arabian Subpopulation

    Science.gov (United States)

    Haralur, Satheesh B

    2015-01-01

    Background: Dental restoration or prosthesis in harmony with adjacent natural teeth color is indispensable part for the successful esthetic outcome. The studies indicate is existence of correlation between teeth and skin color. Teeth and skin color are changed over the aging process. The aim of the study was to explore the role of age on the tooth and skin color parameters, and to investigate the effect of ageing on teeth-skin color correlation. Materials and Methods: Total of 225 Saudi Arabian ethnic subjects was divided into three groups of 75 each. The groups were divided according to participant’s age. The participant’s age for Group I, Group II, and Group III was 18-29 years, 30-50 years, and above 50 years, respectively. The tooth color was identified by spectrophotometer in CIE Lab parameters. The skin color was registered with skin surface photography. The data were statistically analyzed with one-way ANOVA and correlation tests with SPSS 18 software. Results: The Group I had the highest ‘L’ value of 80.26, Group III recorded the least value of 76.66. The Group III had highest yellow value ‘b’ at 22.72, while Group I had 19.19. The skin ‘L’ value was highest in the young population; the elder population had the increased red value ‘a’ in comparison to younger subjects. The ‘L’ tooth color parameter had a strong positive linear correlation with skin color in young and adult subjects. While Group III teeth showed the strong positive correlation with ‘b’ parameter at malar region. Conclusion: The elder subjects had darker and yellow teeth in comparison with younger subjects. The reddening of the skin was observed as age-related skin color change. The age had a strong influence on the teeth-skin color correlation. PMID:26464536

  8. Effects of basic fibroblast growth factor on expressions of collagen and fibronectin in normal skin and hypertrophic scar fibroblasts%碱性成纤维细胞生长因子对增生性瘢痕与正常皮肤成纤维细胞胶原、纤维连接蛋白表达的影响

    Institute of Scientific and Technical Information of China (English)

    宋瑞; 卞徽宁; 赖文; 陈德华; 赵克森

    2010-01-01

    背景:碱性成纤维细胞生长因子能促进愈合伤口产生胶原蛋白、纤维连接蛋白和基质酶的基质成分.然而,细胞增殖、细胞外基质及新生血管的形成或伤口基质重塑过程失调,会导致瘢痕组织过度增殖.目的:观察碱性成纤维细胞生长因子在正常皮肤创面愈合和增生性瘢痕形成中的作用.方法:从5例进行瘢痕修复手术患者身上同时取正常皮肤和增生性瘢痕组织,分离培养正常人皮肤成纤维细胞和增生性瘢痕成纤维细胞.应用RT-PCR和酶联免疫吸附法检测两种成纤维细胞胶原、纤维连接蛋白基因表达和蛋白合成.采用JC-1染色和流式细胞术测定成纤维细胞线粒体膜电位改变,采用化学发光法检测细胞内ATP水平改变.观察碱性成纤维细胞生长因子对两种细胞的上述指标的影响.结果与结论:不同浓度碱性成纤维细胞生长因子可减慢增生性瘢痕成纤维细胞生长,抑制增生性瘢痕成纤维细胞Ⅰ型胶原表达和合成(P<0.05).碱性成纤维细胞生长因子对正常皮肤和增生性瘢痕成纤维细胞Ⅲ型胶原表达和合成均无影响.然而可上调正常皮肤成纤维细胞表达纤维连接蛋白(P<0.05).此外,10,100 μg/L碱性成纤维细胞生长因子处理后增生性瘢痕成纤维细胞线粒体膜电位呈去极化趋势,正常皮肤成纤维细胞中ATP水平显著增高(P<0.05).结果表明,碱性成纤维细胞生长因子在正常皮肤创面愈合和增生性瘢痕形成中可能有不同的作用和机制.%BACKGROUND:Basic fibroblast growth factor(bFGF)can promote production of collagen,fibronectin and matrix enzyme in healing wounds.However,dysregulation of this process,such as the abnormal coordination of cell proliferation,extracellular.matrix and neovasculadzation formation,or remodeling of the wound matrix will lead to excess accumulation of scar tissues.OBJECTIVE:To investigate effects of bFGF on normal skin wound healing and

  9. Gas samples of Afghanistan and adjacent areas (gasafg.shp)

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This shapefile contains points that describe the location of gas samples collected in Afghanistan and adjacent areas and the results of organic geochemical analysis.

  10. Skin perfusion pressure on the legs measured as the external pressure required for skin reddening after blanching

    DEFF Research Database (Denmark)

    Holstein, P; Nielsen, P.E.; Lund, P

    1980-01-01

    The skin perfusion on the calf was measured photo-electrically and by isotope washout technique using external counter pressure by a blood pressure cuff. By the photocell the skin blanching threshold external pressure (BTEP) was recorded on histamine flared red skin. By isotope washout technique......Hg (SD 8.7). As compared to the intra-arterial blood pressure the BTEP was found to lie close to the mean blood pressure in normal subjects as well as in hypertensive subjects. The present data indicate that the skin perfusion pressure on the legs can be measured by the rapid photo-electric technique...

  11. Skin tribology: Science friction?

    NARCIS (Netherlands)

    Heide, van der E.; Zeng, X.; Masen, M.A.

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is fre

  12. Deformable skinning on bones

    DEFF Research Database (Denmark)

    Larsen, Bent Dalgaard; Petersen, Kim Steen; Jakobsen, Bjarke

    2001-01-01

    Applying skin to a model is a relatively simple task to implement. Nonetheless it seems that no good resource exists that describes both the concepts and math necessary to understand and implement skinning. The intention of this article is an attempt to give a thoroughly description of the theore...

  13. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  14. Effect of Systemic Antioxidant Allopurinol Therapy on Skin Flap Survival

    Science.gov (United States)

    Rasti Ardakani, Mehdi; Al-Dam, Ahmed; Rashad, Ashkan; Shayesteh Moghadam, Ali

    2017-01-01

    BACKGROUND It has been reported that systemic administration of allopurinol improves cell survival. This study was aimed to evaluate effects of allopurinol on skin flaps in dogs. METHODS Twenty dogs underwent one skin flap surgery with a 2-week interval. The first procedure was performed according to the standard protocols. The second phase was started by a 1-week pretreatment with allopurinol. Length of the necrotic zone was measured and recorded daily. At each phase, flaps were removed and sent for histopathological study after 1 week observation. RESULTS Mean length of the necrotic zone in allopurinol treated skin flaps has been significantly less than normal flaps over all 7 days of observation (p<0.0001). Histopathology study showed less inflammation and more normal tissue structure in the allopurinol treated skin flaps. CONCLUSION It was demonstrated that systemic administration of allopurinol significantly improved skin flap survival. PMID:28289614

  15. Immediate Changes to Skin and Subcutaneous Tissue Strains Following Manual Lymph Drainage in Legs with Lymphedema

    Science.gov (United States)

    Kakutani, Hiromi; Nakamura, Kaori; Morikage, Noriyasu; Yamashita, Osamu; Harada, Takasuke; Ueda, Koshiro; Samura, Makoto; Tanaka, Yuya; Takeuchi, Yuriko; Hamano, Kimikazu

    2016-01-01

    Objectives: To study the immediate impact of manual lymph drainage (MLD) on skin and subcutaneous tissue strains in legs with lymphedema using free-hand real-time tissue elastography (RTE). Methods: Skin and subcutaneous tissue strain measurements were taken at the middle of the inner thigh and calf by RTE in 20 legs with lymphedema of 18 patients (stage II: 11, late stage II: 7, stage III: 2) and in 70 legs of 35 normal subjects. In patients with lymphedema, the same measurements were repeated immediately following MLD. Results: Significant negative correlations were found between pre-MLD strains and the MLD-induced changes in thigh and calf skin strains (thigh skin: p <0.01, calf skin: p = 0.05), but not in subcutaneous tissue strains. Pre-MLD intercepts of these regression lines were closer to normal values as compared to mean pre-MLD values (normal thigh skin: 0.54% ± 0.30%, calf skin: 0.25% ± 0.18%, Pre-MLD thigh skin: 0.39% ± 0.20%, calf skin: 0.17% ± 0.12%, Pre-MLD intercept of thigh skin: 0.48%, Pre-MLD intercept of calf skin: 0.31%). Conclusions: It appears that MLD did not simply soften the skin, but rather normalized it in terms of strain. However, this was not confirmed in the subcutaneous tissue. PMID:27087870

  16. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard;

    2001-01-01

    with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  17. Use of previously burned skin as random cutaneous local flaps in pediatric burn reconstruction

    NARCIS (Netherlands)

    Barret, JP; Herndon, DN; McCauley, RL

    2002-01-01

    Reconstruction after post-burn scarring remains a challenge. It is especially true in the severely burned patient, who normally presents with a paucity of donor sites Healed skin from areas that had been burned and skin from grafted areas (termed as previously burned skin) have been occasionally use

  18. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  19. Hydromagnetic flow and heat transfer adjacent to a stretching vertical sheet in a micropolar fluid

    Directory of Open Access Journals (Sweden)

    Yacob Nor Azizah

    2013-01-01

    Full Text Available An analysis is carried out for the steady two-dimensional mixed convection flow adjacent to a stretching vertical sheet immersed in an incompressible electrically conducting micropolar fluid. The stretching velocity and the surface temperature are assumed to vary linearly with the distance from the leading edge. The governing partial differential equations are transformed into a system of ordinary differential equations, which is then solved numerically using a finite difference scheme known as the Keller box method. The effects of magnetic and material parameters on the flow and heat transfer characteristics are discussed. It is found that the magnetic field reduces both the skin friction coefficient and the heat transfer rate at the surface for any given K and λ. Conversely, both of them increase as the material parameter increases for fixed values of M and λ.

  20. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  1. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    DEFF Research Database (Denmark)

    Remvig, L; Duhn, Ph; Ullman, S

    2010-01-01

    The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibili....... The present study aimed to assess skin signs by means of clinical and para-clinical methods.......The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...

  2. Development of an Active Topical Skin Protectant (aTSP)

    Science.gov (United States)

    2016-02-01

    Stevenson, biologist  Robin Deckert, technician  SSG Christopher Maturey, technician  SSG James Mitchell, technician  Elizabeth Miller...detectable by touch. The first priority for skin application was to cover those areas adjacent to the closures of the individual protective ensemble (neck...negative results, the above procedure was repeated. Following the second round of testing for Nikolsky’s sign, results were recorded. Two modifications

  3. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  4. Analysis of effect of different construction methods of piles on the end effect on skin friction of piles

    Institute of Scientific and Technical Information of China (English)

    ZHOU Hongbo; CHEN Zhuchang

    2007-01-01

    Based on the comparative analysis of end effect on skin friction of displacement-pile (driven pile),the end effect on skin friction of bored pile is studied.The end effect on skin friction between driven pile and bored pile is different and the end effect on skin friction of bored pile is reduce of skin friction in the soil layer adjacent to the pile end.The degradation degree of skin friction is deduced with the increase of the distance from pile end.The concept of additional mud cake formed by the effect of cushion at the bottom of borehole during pouring concrete is introduced to explain the mechanism of end effect on skin friction of the bored pile.The test results of post-grouting piles indicate that the post-grouting technique is an effective way to improve the end effect on skin friction of bored pile.

  5. Tips for Relieving Dry Skin

    Science.gov (United States)

    ... skin is dry, stop using: Deodorant soaps Skin care products that contain alcohol, fragrance, retinoids, or alpha-hydroxy acid (AHA) Avoiding these products will help your skin retain its natural oils. 6. Wear gloves. Our hands are often ...

  6. 6 Common Cancers - Skin Cancer

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues 6 Common Cancers - Skin Cancer Past Issues / Spring 2007 Table of Contents For ... AP Photo/Herald-Mail, Kevin G. Gilbert Skin Cancer Skin cancer is the most common form of ...

  7. Effect observation on repairing of soft tissue defect with tissue skin flaps%组织皮瓣修复软组织缺损的效果观察

    Institute of Scientific and Technical Information of China (English)

    王占厚; 于晓姗; 王立明; 李格当

    2002-01-01

    @@ Backgroud: With the development of microsurgery and clinical applied anatomy, skin flaps and musculocutaneous flaps with vessel pedicles are primary choices in treatment of soft tissue defect. The transfer of skin flaps and muscular skin flaps with vessel pedicles is rather easy and need't special instruments. Because of utilization of adjacent tissue, the outline is good after operation.

  8. Archaea on human skin.

    Directory of Open Access Journals (Sweden)

    Alexander J Probst

    Full Text Available The recent era of exploring the human microbiome has provided valuable information on microbial inhabitants, beneficials and pathogens. Screening efforts based on DNA sequencing identified thousands of bacterial lineages associated with human skin but provided only incomplete and crude information on Archaea. Here, we report for the first time the quantification and visualization of Archaea from human skin. Based on 16 S rRNA gene copies Archaea comprised up to 4.2% of the prokaryotic skin microbiome. Most of the gene signatures analyzed belonged to the Thaumarchaeota, a group of Archaea we also found in hospitals and clean room facilities. The metabolic potential for ammonia oxidation of the skin-associated Archaea was supported by the successful detection of thaumarchaeal amoA genes in human skin samples. However, the activity and possible interaction with human epithelial cells of these associated Archaea remains an open question. Nevertheless, in this study we provide evidence that Archaea are part of the human skin microbiome and discuss their potential for ammonia turnover on human skin.

  9. Skin and antioxidants.

    Science.gov (United States)

    Poljsak, Borut; Dahmane, Raja; Godic, Aleksandar

    2013-04-01

    It is estimated that total sun exposure occurs non-intentionally in three quarters of our lifetimes. Our skin is exposed to majority of UV radiation during outdoor activities, e.g. walking, practicing sports, running, hiking, etc. and not when we are intentionally exposed to the sun on the beach. We rarely use sunscreens during those activities, or at least not as much and as regular as we should and are commonly prone to acute and chronic sun damage of the skin. The only protection of our skin is endogenous (synthesis of melanin and enzymatic antioxidants) and exogenous (antioxidants, which we consume from the food, like vitamins A, C, E, etc.). UV-induced photoaging of the skin becomes clinically evident with age, when endogenous antioxidative mechanisms and repair processes are not effective any more and actinic damage to the skin prevails. At this point it would be reasonable to ingest additional antioxidants and/or to apply them on the skin in topical preparations. We review endogenous and exogenous skin protection with antioxidants.

  10. EGFR-inhibitors, radiotherapy and normal tissue toxicity

    DEFF Research Database (Denmark)

    Eriksen, J. G.

    2015-01-01

    will be explained with references to the current knowledge of the biology of skin toxicity. Treatment options for acute side-effects in skin and mucosa after bio-radiotherapy is rarely causal. A few attempts have been done; some of them aiming to rephosphorylate the EGFreceptor in the skin with vitamin K3. The talk......EGFR-inhibitors have been used in several clinical settings during the last decade and side-effects related to normal tissues like the skin, mucosa and kidney has been well described. However, when EGFR-inhibitors are combined with radiotherapy, then different skin and mucosa toxicity profiles can...... will discuss the available data from these studies. Across several tumour sites and for different EGFR-inhibitors, a correlation between skin toxicity and tumour response has also been documented. The reason for this correlation is not obvious but probably related to genetic alterations or certain genetic...

  11. Mortality of passerines adjacent to a North Carolina corn field treated with granular carbofuran.

    Science.gov (United States)

    Augspurger, Tom; Smith, Milton R.; Meteyer, Carol U.; Converse, Kathryn A.

    1996-01-01

    Red-winged blackbirds (Agelaius phoeniceus) were collected during an epizootic in southeastern North Carolina (USA). Activity of brain cholinesterase (ChE) was inhibited by 14 to 48% in three of five specimens, and returned to normal levels after incubation. Gastrointestinal tracts were analyzed for 30 anti-ChE agents. Carbofuran, the only compound detected, was present in all specimens at levels from 5.44 to 72.7 μg/g wet weight. Application of granular carbofuran in an adjacent corn field, results of necropsy examinations, and chemical analyses are consistent with a diagnosis of carbofuran poisoning in these specimens.

  12. Immunoelectron microscopy study of superficial skin nerves in drug-induced acute urticaria

    OpenAIRE

    Criado, Paulo Ricardo; CRIADO, Roberta Fachini Jardim; TAKAKURA, CLEUSA F.H.; Pagliari, Carla; SOTTO, Mirian Nacagami; Cidia VASCONCELLOS

    2012-01-01

    BACKGROUND: Few studies have evaluated the ultrastructure of the superficial skin nerves in urticaria. OBJECTIVE: The objective of this study was to describe findings in superficial skin nerves in cases of drug-induced acute urticaria. METHODS: Seven patients with drug-induced acute urticaria were included in the study. Skin biopsies were obtained from the urticarial lesion and from the apparently normal skin. The 14 fragments collected were processed for immunogold electron microscopy using ...

  13. Leishmania Skin Test

    Science.gov (United States)

    2010-03-01

    2009, a dose of 50µg will be used in the design of a phase III clinical trial. 15. SUBJECT TERMS LtSTA = Leishmania tropica Skin Test Antigen 16...2010 on a Leishmania Skin Test (LtSTA) developed from the promastigotes of Leishmania tropica . During this period a phase IIB study was in progress...diluent. The final product is referred to as Leishmania tropica Skin Test Antigen (LtSTA). Figure 3 is a schematic diagram of the Drug Product

  14. Ultrasound skin tightening.

    Science.gov (United States)

    Minkis, Kira; Alam, Murad

    2014-01-01

    Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting.

  15. Eicosanoids in skin inflammation.

    Science.gov (United States)

    Nicolaou, Anna

    2013-01-01

    Eicosanoids play an integral part in homeostatic mechanisms related to skin health and structural integrity. They also mediate inflammatory events developed in response to environmental factors, such as exposure to ultraviolet radiation, and inflammatory and allergic disorders, including psoriasis and atopic dermatitis. This review article discusses biochemical aspects related to cutaneous eicosanoid metabolism, the contribution of these potent autacoids to skin inflammation and related conditions, and considers the importance of nutritional supplementation with bioactives such as omega-3 and omega-6 polyunsaturated fatty acids and plant-derived antioxidants as means of addressing skin health issues.

  16. Skin disease among farmers using wastewater in rice cultivation in Nam Dinh, Vietnam

    DEFF Research Database (Denmark)

    Do, Thuy Trang; van der Hoek, Wim; Nguyen, Dang Tuan;

    2007-01-01

    . In each commune, 200 households were randomly selected. RESULTS: Of the 1103 individuals aged > or =15 years, 381 reported a skin problem at baseline or at any of the monthly visits, primarily dermatitis (eczema) and superficial fungal infections. Among the 874 subjects who were free from skin disease......OBJECTIVE: To assess the risk of skin disease among farmers occupationally exposed to wastewater. METHODS: One-year follow-up study with monthly assessments of wastewater exposure and skin disease in Nam Dinh, northern Vietnam, in two adjacent communes with contrasting levels of wastewater use...... at baseline and who could be followed up > or =11 months, 183 developed a new skin disease (cumulative incidence 21%). Exposure to wastewater was a major risk factor for skin disease with a relative risk (RR) of 1.89 [95% confidence interval (CI) 1.39-2.57] in multivariable analysis. Other risk factors...

  17. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  18. Normalization: A Preprocessing Stage

    OpenAIRE

    Patro, S. Gopal Krishna; Sahu, Kishore Kumar

    2015-01-01

    As we know that the normalization is a pre-processing stage of any type problem statement. Especially normalization takes important role in the field of soft computing, cloud computing etc. for manipulation of data like scale down or scale up the range of data before it becomes used for further stage. There are so many normalization techniques are there namely Min-Max normalization, Z-score normalization and Decimal scaling normalization. So by referring these normalization techniques we are ...

  19. Changes of color coordinates of biological tissue with superficial skin damage due to mechanical trauma

    Science.gov (United States)

    Pteruk, Vail; Mokanyuk, Olexander; Kvaternuk, Olena; Yakenina, Lesya; Kotyra, Andrzej; Romaniuk, Ryszard S.; Dussembayeva, Shynar

    2015-12-01

    Change of color coordinates of normal and pathological biological tissues is based on calculated spectral diffuse reflection. The proposed color coordinates of normal and pathological biological tissues of skin provided using standard light sources, allowing accurately diagnose skin damage due to mechanical trauma with a blunt object for forensic problems.

  20. Fusion angle affects intervertebral adjacent spinal segment joint forces-Model-based analysis of patient specific alignment.

    Science.gov (United States)

    Senteler, Marco; Weisse, Bernhard; Rothenfluh, Dominique A; Farshad, Mazda T; Snedeker, Jess G

    2017-01-01

    This study addresses the hypothesis that adjacent segment intervertebral joint loads are sensitive to the degree of lordosis that is surgically imposed during vertebral fusion. Adjacent segment degeneration is often observed after lumbar fusion, but a causative mechanism is not yet clearly evident. Altered kinematics of the adjacent segments and potentially nonphysiological mechanical joint loads have been implicated in this process. However, little is known of how altered alignment and kinematics influence loading of the adjacent intervertebral joints under consideration of active muscle forces. This study investigated these effects by simulating L4/5 fusions using kinematics-driven musculoskeletal models of one generic and eight sagittal alignment-specific models. Models featured different spinopelvic configurations but were normalized by body height, masses, and muscle properties. Fusion of the L4/5 segment was implemented in an in situ (22°), hyperlordotic (32°), and hypolordotic (8°) fashion and kinematic input parameters were changed accordingly based on findings of an in vitro investigation. Bending motion from upright standing to 45° forward flexion and back was simulated for all models in intact and fused conditions. Joint loads at adjacent levels and moment arms of spinal muscles experienced changes after all types of fusion. Hypolordotic configuration led to an increase of adjacent segment (L3/4) shear forces of 29% on average, whereas hyperlordotic fusion reduced shear by 39%. Overall, L4/5 in situ fusion resulted in intervertebral joint forces closest to intact loading conditions. An artificial decrease in lumbar lordosis (minus 14° on average) caused by an L4/5 fusion lead to adverse loading conditions, particularly at the cranial adjacent levels, and altered muscle moment arms, in particular for muscles in the vicinity of the fusion. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:131-139, 2017.

  1. Aging changes in skin

    Science.gov (United States)

    ... Stress Other causes of skin changes: Allergies to plants and other substances Climate Clothing Exposures to industrial and household chemicals Indoor heating Sunlight can cause: Loss of elasticity (elastosis) ...

  2. [Skin-picking disorder].

    Science.gov (United States)

    Niemeier, V; Peters, E; Gieler, U

    2015-10-01

    The disorder is characterized by compulsive repetitive skin-picking (SP), resulting in skin lesions. The patients must have undertaken several attempts to reduce or stop SP. The disorder must have led to clinically significant limitations in social, professional, or other important areas of life. The symptoms cannot be better explained by another emotional disorder or any other dermatological disease. In the new DSM-V, skin-picking disorder has been included in the diagnostic system as an independent disorder and describes the self-injury of the skin by picking or scratching with an underlying emotional disorder. SP is classified among the impulse-control disorders and is, thus, differentiated from compulsive disorders as such. There are often emotional comorbidities. In cases of pronounced psychosocial limitation, interdisciplinary cooperation with a psychotherapist and/or psychiatrist is indicated.

  3. Skin picking disorder.

    Science.gov (United States)

    Grant, Jon E; Odlaug, Brian L; Chamberlain, Samuel R; Keuthen, Nancy J; Lochner, Christine; Stein, Dan J

    2012-11-01

    Although skin picking has been documented in the medical literature since the 19th century, only now is it receiving serious consideration as a DSM psychiatric disorder in discussions for DSM-5. Recent community prevalence studies suggest that skin picking disorder appears to be as common as many other psychiatric disorders, with reported prevalences ranging from 1.4% to 5.4%. Clinical evaluation of patients with skin picking disorder entails a broad physical and psychiatric examination, encouraging an interdisciplinary approach to evaluation and treatment. Approaches to treatment should include cognitive-behavioral therapy (including habit reversal or acceptance-enhanced behavior therapy) and medication (serotonin reuptake inhibitors, N-acetylcysteine, or naltrexone). Based on clinical experience and research findings, the authors recommend several management approaches to skin picking disorder.

  4. Designing pliable structural Skins

    DEFF Research Database (Denmark)

    Tamke, Martin; Peters, Brady; Nielsen, Stig Anton;

    2013-01-01

    Structural stability can be formed through structured or seemingly unstructured approaches to fold, plead or crumble paper. This paper reports on two projects that showcase how computational design approaches can help to widen the understanding and use of structural skins....

  5. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  6. Skin, Hair, and Nails

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... produce melanin, the pigment that gives skin its color. All people have roughly the same number of ...

  7. Radiation therapy -- skin care

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000735.htm Radiation therapy - skin care To use the sharing features ... this page, please enable JavaScript. When you have radiation treatment for cancer, you may have some changes ...

  8. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test; Allergic rhinitis - allergy testing; Asthma - allergy testing; Eczema - allergy testing; Hayfever - allergy testing; Dermatitis - allergy testing; Allergy testing; ...

  9. Scalded skin syndrome

    Science.gov (United States)

    ... Severe bloodstream infection ( septicemia ) Spread to deeper skin infection ( cellulitis ) When to Contact a Medical Professional Call your provider or go to the emergency room if you have symptoms of this disorder. Prevention ... Alternative Names Ritter disease; Staphylococcal ...

  10. Skin lesion biopsy

    Science.gov (United States)

    ... procedure will leave a small indented area. This type of biopsy is often done when a skin cancer is ... may have stitches to close the area. This type of biopsy is often done to diagnose rashes . EXCISIONAL BIOPSY ...

  11. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  12. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  13. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  14. Nicotinamide and the skin.

    Science.gov (United States)

    Chen, Andrew C; Damian, Diona L

    2014-08-01

    Nicotinamide, an amide form of vitamin B3, boosts cellular energy and regulates poly-ADP-ribose-polymerase 1, an enzyme with important roles in DNA repair and the expression of inflammatory cytokines. Nicotinamide shows promise for the treatment of a wide range of dermatological conditions, including autoimmune blistering disorders, acne, rosacea, ageing skin and atopic dermatitis. In particular, recent studies have also shown it to be a potential agent for reducing actinic keratoses and preventing skin cancers.

  15. Laplacian versus adjacency matrix in quantum walk search

    Science.gov (United States)

    Wong, Thomas G.; Tarrataca, Luís; Nahimov, Nikolay

    2016-10-01

    A quantum particle evolving by Schrödinger's equation contains, from the kinetic energy of the particle, a term in its Hamiltonian proportional to Laplace's operator. In discrete space, this is replaced by the discrete or graph Laplacian, which gives rise to a continuous-time quantum walk. Besides this natural definition, some quantum walk algorithms instead use the adjacency matrix to effect the walk. While this is equivalent to the Laplacian for regular graphs, it is different for non-regular graphs and is thus an inequivalent quantum walk. We algorithmically explore this distinction by analyzing search on the complete bipartite graph with multiple marked vertices, using both the Laplacian and adjacency matrix. The two walks differ qualitatively and quantitatively in their required jumping rate, runtime, sampling of marked vertices, and in what constitutes a natural initial state. Thus the choice of the Laplacian or adjacency matrix to effect the walk has important algorithmic consequences.

  16. DOSHIC PHYSIOLOGY OF SKIN

    Directory of Open Access Journals (Sweden)

    Shivprasad Chiplunkar

    2013-06-01

    Full Text Available The balance of dosha  represents the healthy state and imbalance will cause various diseases. In normalcy doshas will be performing their own functions and individual doshas will be having their own specific sites. By telling the various sthana of each dosha, different function that is taken up by individual dosha in different sites has been highlighted.By mentioning ‘sparshanendriyam’ as one of the sthana of vata dosha the sensory functions of skin to vata dosha has been emphasised. By mentioning ‘sparshanam’ as one of the sthana of pittadosha, the function of colouring/pigmentation of skin, which is majorly carried out  by melanocytes by secreting melanin pigment has been highlighted. Meda is one among the sthanas of kapha dosha; this can be considered as the adipose tissue of skin/below skin. Since sweda is mala of meda it can be also considered as the secretions from the eccrine glands.With respect to skin, sensory functions, both tactile and thermal is carried out by vata dosha more specifically vyana vata, pigmentation to the skin carried out by meloncytes by secreting melanin, it is nothing but function of pitta dosha more specifically brajaka pitta with the help of udana vata and finally production of sweat in sweat glands is the function of kapha. So there is the need for further study and research regarding the sthanas of all three doshas in different structures/organs in the body and its physiology.

  17. Ultraflexible organic photonic skin.

    Science.gov (United States)

    Yokota, Tomoyuki; Zalar, Peter; Kaltenbrunner, Martin; Jinno, Hiroaki; Matsuhisa, Naoji; Kitanosako, Hiroki; Tachibana, Yutaro; Yukita, Wakako; Koizumi, Mari; Someya, Takao

    2016-04-01

    Thin-film electronics intimately laminated onto the skin imperceptibly equip the human body with electronic components for health-monitoring and information technologies. When electronic devices are worn, the mechanical flexibility and/or stretchability of thin-film devices helps to minimize the stress and discomfort associated with wear because of their conformability and softness. For industrial applications, it is important to fabricate wearable devices using processing methods that maximize throughput and minimize cost. We demonstrate ultraflexible and conformable three-color, highly efficient polymer light-emitting diodes (PLEDs) and organic photodetectors (OPDs) to realize optoelectronic skins (oe-skins) that introduce multiple electronic functionalities such as sensing and displays on the surface of human skin. The total thickness of the devices, including the substrate and encapsulation layer, is only 3 μm, which is one order of magnitude thinner than the epidermal layer of human skin. By integrating green and red PLEDs with OPDs, we fabricate an ultraflexible reflective pulse oximeter. The device unobtrusively measures the oxygen concentration of blood when laminated on a finger. On-skin seven-segment digital displays and color indicators can visualize data directly on the body.

  18. Hyperspectral imaging of skin and lung cancers

    Science.gov (United States)

    Zherdeva, Larisa A.; Bratchenko, Ivan A.; Alonova, Marina V.; Myakinin, Oleg O.; Artemyev, Dmitry N.; Moryatov, Alexander A.; Kozlov, Sergey V.; Zakharov, Valery P.

    2016-04-01

    The problem of cancer control requires design of new approaches for instrumental diagnostics, as the accuracy of cancer detection on the first step of diagnostics in clinics is slightly more than 50%. In this study, we present a method of visualization and diagnostics of skin and lung tumours based on registration and processing of tissues hyperspectral images. In a series of experiments registration of hyperspectral images of skin and lung tissue samples is carried out. Melanoma, basal cell carcinoma, nevi and benign tumours are studied in skin ex vivo and in vivo experiments; adenocarcinomas and squamous cell carcinomas are studied in ex vivo lung experiments. In a series of experiments the typical features of diffuse reflection spectra for pathological and normal tissues were found. Changes in tissues morphology during the tumour growth lead to the changes of blood and pigments concentration, such as melanin in skin. That is why tumours and normal tissues maybe differentiated with information about spectral response in 500-600 nm and 600 - 670 nm areas. Thus, hyperspectral imaging in the visible region may be a useful tool for cancer detection as it helps to estimate spectral properties of tissues and determine malignant regions for precise resection of tumours.

  19. Emission of pesticides during drilling and deposition in adjacent areas

    Directory of Open Access Journals (Sweden)

    Heimbach, Udo

    2014-02-01

    Full Text Available In seven experiments seeds of maize, oil seed rape and barley, treated with neonicotinoids, were sown using pneumatic drilling equipment with deflectors attached in case of pneumatic suction systems. Directly adjacent to the drilled area of usually about 50 m width were replicated areas with bare soil as well as with crops. During maize (Zea mays drilling flowering oil seed rape (Brassica napus and during drilling of barley (Hordeum vulgare and oil seed rape flowering white mustard (Sinapis alba was adjacent. The amount of residues in the adjacent non crop areas in Petri dishes being distributed on the bare soil declined only slowly from 1 to 20 m distance from the area drilled. Seed batches with more abrasion and higher content of active substances in the dust resulted in higher residues off crop. After drilling of maize in four experiments in Petri dishes in adjacent non crop areas in 1-5 m distance between 0.02 and 0.40 g a.s./ha of neonicotinoids and in the adjacent oil seed rape a total of 0.05–0.80 g a.s./ha were detected. After drilling oil seed rape or barley these values were only 0.02–0.06 g a.s./ha in Petri dishes in non crop areas and 0.03-0.08 g a.s./ha in total in adjacent white mustard. In gauze net samplers installed vertically in 3 m distance in non crop areas up to seven times higher values were detected compared to Petri dishes.

  20. Disc height and anteroposterior translation in fused and adjacent segments after lumbar spine fusion

    Directory of Open Access Journals (Sweden)

    Frobin, Wolfgang

    2003-09-01

    Full Text Available In a series of 46 patients the effects of spinal fusion upon intervertebral height and sagittal alignment in operated and non-operated segments were retrospectively evaluated on digitized radiographs. Data was compared with age- and gender-normalized standard values. The objective was to evaluate the influence of different types of spine fusions primarily upon adjacent segments, particularly in terms of degeneration and sagittal profile of the lumbar spine. Incidence of adjacent segment degeneration (ASD is still highly controversial. However, not every degeneration adjacent to spinal fusion must be caused by the fusion and responsibility of the fusion for ASD may vary with its range and type. Distortion Corrected Roentgen Analysis (DCRA was utilized. DCRA is a proven valid, reliable, observer-independent, and accurate tool for assessment of these parameters over time and in comparison with "normal" cohorts. With this method the exact posture of the patients needs not to be known.There was little evidence for serious fusion-related ASD within an average of 40 months follow-up. No difference could be detected for rigid vs. non-rigid fusion and instrumented vs. non-instrumented techniques. Temporary postoperative distraction effects could be detected in operated and non-operated segments. Absolute preoperative values for intervertebral height and vertebral slip were age-related. Retrospectively, the choice of segments for fusion was clearly based upon radiological criteria. Thus we conclude that radiological parameters have an obvious clinical relevance for decision-making and need to be quantified. Within the limitations of this pilot study, true fusion related ASD seems to be infrequent.

  1. Skin impedance comparisons of electrodes for electro-oculography.

    Science.gov (United States)

    Lee, J B; Reinecke, R D

    1991-01-01

    In an effort to define the most comfortable electrode needing the simplest skin preparation with low and stable skin impedance, we compared the impedance between skin electrodes and Stat-Trace II St-102 EKG electrodes (Niko Med USA, New Brunswick, NJ)--the latter being renamed "dry electrodes" because they are used without electrolyte paste--on 12 normal subjects with two different skin preparations, with and without alcohol. The dry electrodes were found to have lower impedance than the skin electrodes. With each skin preparation the alcohol scored better, 7.2 kOhm vs 16.5 kOhm, respectively, and "no preparation" worse, 13.8 kOhm vs 22.7 kOhm, respectively, (but still acceptable when the dry electrode was used). The dry electrode's impedance was quite stable from the moment of application while the skin electrode's impedance drifted dramatically for 30 minutes. If the dry electrode was halved in area of skin contact, as often is necessary with the nasal electrode in children, the impedance rose proportionally but remained acceptable. We conclude that the new dry electrodes give us improved electro-oculography records and suggest their use, particularly for infants and young children where ease of application and simple skin preparation are particularly important.

  2. Investigation on Reflection of Tectonic Pattern in ASG EUPOS Data in the Sudetes and Adjacent Areas

    Directory of Open Access Journals (Sweden)

    Szczerbowski Zbigniew

    2016-12-01

    Full Text Available The GNSS data evaluated from on observation of ASG EUPOS stations in the Sudety Mts. and in adjacent areas is analyzed by the author in the scope of disturbances in daily solutions that can be induced by tectonics stress. The daily position changes derived from GNSS data demonstrate the long or short term trends, which are affected by offsets of different nature. Author presents an analysis based on frequency of parameter – displacement vector azimuth. The aim of the analysis is to show statistical significance of observed small values of temporal displacements, which values are not normally distributed. There are “outliers” of the normal distribution of displacement azimuths, which values show a certain reproducibility, which corresponds to orientations of tectonic lines. That suggests small, short time movements along boundaries of horsts and grabens – a crustal-extension structure of the area. However derived results (values of displacements are less than a limitation error, temporal distributions of coordinates are not random as usually data errors. So in author’s opinion the spatial-temporal evolution of horizontal displacements of ASG EUPOS stations in the Sudety Mts. and in adjacent areas are determined by expressions of underlying geological structures.

  3. Bathing in a magnesium-rich Dead Sea salt solution improves skin barrier function, enhances skin hydration, and reduces inflammation in atopic dry skin.

    Science.gov (United States)

    Proksch, Ehrhardt; Nissen, Hans-Peter; Bremgartner, Markus; Urquhart, Colin

    2005-02-01

    Magnesium salts, the prevalent minerals in Dead Sea water, are known to exhibit favorable effects in inflammatory diseases. We examined the efficacy of bathing atopic subjects in a salt rich in magnesium chloride from deep layers of the Dead Sea (Mavena(R) Dermaline Mg(46) Dead Sea salt, Mavena AG, Belp, Switzerland). Volunteers with atopic dry skin submerged one forearm for 15 min in a bath solution containing 5% Dead Sea salt. The second arm was submerged in tap water as control. Before the study and at weeks 1-6, transepidermal water loss (TEWL), skin hydration, skin roughness, and skin redness were determined. We found one subgroup with a normal and one subgroup with an elevated TEWL before the study. Bathing in the Dead Sea salt solution significantly improved skin barrier function compared with the tap water-treated control forearm in the subgroup with elevated basal TEWL. Skin hydration was enhanced on the forearm treated with the Dead Sea salt in each group, which means the treatment moisturized the skin. Skin roughness and redness of the skin as a marker for inflammation were significantly reduced after bathing in the salt solution. This demonstrates that bathing in the salt solution was well tolerated, improved skin barrier function, enhanced stratum corneum hydration, and reduced skin roughness and inflammation. We suggest that the favorable effects of bathing in the Dead Sea salt solution are most likely related to the high magnesium content. Magnesium salts are known to bind water, influence epidermal proliferation and differentiation, and enhance permeability barrier repair.

  4. Recent Progress in Electronic Skin

    OpenAIRE

    Wang, Xiandi; Dong, Lin; Zhang, Hanlu; Yu, Ruomeng; Pan, Caofeng; Wang, Zhong Lin

    2015-01-01

    The skin is the largest organ of the human body and can sense pressure, temperature, and other complex environmental stimuli or conditions. The mimicry of human skin's sensory ability via electronics is a topic of innovative research that could find broad applications in robotics, artificial intelligence, and human–machine interfaces, all of which promote the development of electronic skin (e‐skin). To imitate tactile sensing via e‐skins, flexible and stretchable pressure sensor arrays are co...

  5. Skin aging and oxidative stress

    OpenAIRE

    Sayeeda Ahsanuddin; Minh Lam; Baron, Elma D.

    2016-01-01

    Skin aging occurs through two main pathways, intrinsic and extrinsic. These pathways have significant interaction in contributing to the aging phenotype, which includes skin laxity, wrinkling, pigmentation irregularities, and the appearance of neoplastic skin lesions. Here, we review the critical role that oxidative stress plays in skin aging, including its effects on signaling pathways involved in skin matrix formation and degradation, proteasome activity, as well as DNA structure. Furthermo...

  6. Skin involvement in Dupuytren's disease.

    OpenAIRE

    Wade, R.; Igali, L; Figus, A

    2016-01-01

    Whether the palmar skin has a role in the development, propagation or recurrence of Dupuytren's disease remains unclear. Clinical assessment for skin involvement is difficult and its correlation with histology uncertain. We prospectively biopsied the palmar skin of consecutive patients undergoing single digit fasciectomy (for primary Dupuytren's disease without clinically involved skin) and dermofasciectomy (for clinically involved skin or recurrence) in order to investigate this relationship...

  7. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    R.J.W. Hoogendoorn; M.N. Helder; P.I.J.M. Wuisman; R.A. Bank; V. Everts; T.H. Smit

    2008-01-01

    Study Design. The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were com

  8. Flow and edge scour in current adjacent to stone covers

    DEFF Research Database (Denmark)

    Petersen, Thor U.; Sumer, B. Mutlu; Bøgelund, Jon;

    2015-01-01

    This paper presents the results of an experimental investigation on edge scour adjacent to a stone cover laid on a sandy bed. The three-dimensional flow over the edge of the stone layer has been investigated by the use of particle image velocimetry. The flow measurements show a significant amount...

  9. Measurement Methods to Determine Air Leakage Between Adjacent Zones

    Energy Technology Data Exchange (ETDEWEB)

    Hult, Erin L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Dickerhoff, Darryl J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Price, Phillip N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2012-09-01

    Air leakage between adjacent zones of a building can lead to indoor air quality and energy efficiency concerns, however there is no existing standard for measuring inter-zonal leakage. In this study, synthesized data and field measurements are analyzed in order to explore the uncertainty associated with different methods for collecting and analyzing fan pressurization measurements to calculate interzone leakage.

  10. Differential Inequalities, Normality and Quasi-Normality

    CERN Document Server

    Liu, Xiaojun; Pang, Xuecheng

    2011-01-01

    We prove that if D is a domain in C, alpha>1 and c>0, then the family F of functions meromorphic in D such that |f'(z)|/(1+|f(z)|^alpha)>c for every z in D is normalin D. For alpha=1, the same assumptions imply quasi-normality but not necessarily normality.

  11. Nerve conduction studies in upper extremities: skin temperature corrections.

    Science.gov (United States)

    Halar, E M; DeLisa, J A; Soine, T L

    1983-09-01

    The relationship of skin to near nerve (NN) temperature and to nerve conduction velocity (NCV) and distal latency (DL) was studied in 34 normal adult subjects before and after cooling both upper extremities. Median and ulnar motor and sensory NCV, DL, and NN temperature were determined at ambient temperature (mean X skin temp = 33 C) and after cooling, at approximately 26, 28, and 30 C of forearm skin temperature. Skin temperatures on the volar side of the forearm, wrist, palm, and fingers and NN temperature at the forearm, midpalm, and thenar or hypothenar eminence were compared with respective NCV and DL. Results showed a significant linear correlation between skin temperature and NN temperature at corresponding sites (r2 range, 0.4-0.84; p less than 0.005). Furthermore, both skin and NN temperatures correlated significantly with respective NCV and DL. Midline wrist skin temperature showed the best correlation to NCV and DL. Median motor and sensory NCV were altered 1.5 and 1.4m/sec/C degree and their DL 0.2 msec/C degree of wrist skin temperature change, respectively. Ulnar motor and sensory NCV were changed 2.1 and 1.6m/sec/C degree respectively, and 0.2 msec/C degree wrist temperature for motor and sensory DL. Average ambient skin temperature at the wrist (33 C) was used as a standard skin temperature in the temperature correction formula: NCV or DL(temp corrected) = CF(Tst degree - Tm degree) + obtained NCV or DL, where Tst = 33 C for wrist, Tm = the measured skin temperature, and CF = correction factor of tested nerve. Use of temperature correction formula for NCV and DL is suggested in patients with changed wrist skin temperature outside 29.6-36.4C temperature range.

  12. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  13. Spiritual and religious aspects of skin and skin disorders

    Science.gov (United States)

    Shenefelt, Philip D; Shenefelt, Debrah A

    2014-01-01

    Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, “goose bumps”, redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. PMID:25120377

  14. Melanocytes in the skin--comparative whole transcriptome analysis of main skin cell types.

    Science.gov (United States)

    Reemann, Paula; Reimann, Ene; Ilmjärv, Sten; Porosaar, Orm; Silm, Helgi; Jaks, Viljar; Vasar, Eero; Kingo, Külli; Kõks, Sulev

    2014-01-01

    Melanocytes possess several functions besides a role in pigment synthesis, but detailed characteristics of the cells are still unclear. We used whole transcriptome sequencing (RNA-Seq) to assess differential gene expression of cultivated normal human melanocytes with respect to keratinocytes, fibroblasts and whole skin. The present results reveal cultivated melanocytes as highly proliferative cells with possible stem cell-like properties. The enhanced readiness to regenerate makes melanocytes the most vulnerable cells in the skin and explains their high risk of developing into malignant melanoma.

  15. [The role of sonic hedgehog pathway in skin carcinogenesis].

    Science.gov (United States)

    Lesiak, Aleksandra; Sysa-Jedrzejowska, Anna; Narbutt, Joanna

    2010-08-01

    Non melanoma skin cancers (NMSC) involving basal (BCC)--and squamosus cell carcinomas (SCC) and are the most frequent skin cancers in Caucasians. Ultraviolet radiation is the main environmental risk factor for NMSC development. The aim of this paper is to review the latest opinions concerning the role of sonic hedgehog pathway in non-melanoma skin cancers development. Experimental data indicate that sonic hedgehog pathway might be involved in skin carcinogenesis. Under physiological conditions sonic hedgehog pathway is responsible for normal embryogenesis, regeneration of damaged tissues and for regulation of cell proliferation. It was revealed that UVR caused inactivated mutation in PATCHED gene encoding Ptch1 protein. These events lead to deregulation of sonic hedgehog pathway trough activation of Smo protein and Gli transcriptional factors what stimulates cell proliferation and in consequence NMSC development. Literature data indicate that understanding of molecular background of skin cancers might be a reason for introduction of new therapeutic approaches including sonic hedgehog pathway inhibitors.

  16. Sprayed skin turbine component

    Science.gov (United States)

    Allen, David B

    2013-06-04

    Fabricating a turbine component (50) by casting a core structure (30), forming an array of pits (24) in an outer surface (32) of the core structure, depositing a transient liquid phase (TLP) material (40) on the outer surface of the core structure, the TLP containing a melting-point depressant, depositing a skin (42) on the outer surface of the core structure over the TLP material, and heating the assembly, thus forming both a diffusion bond and a mechanical interlock between the skin and the core structure. The heating diffuses the melting-point depressant away from the interface. Subsurface cooling channels (35) may be formed by forming grooves (34) in the outer surface of the core structure, filling the grooves with a fugitive filler (36), depositing and bonding the skin (42), then removing the fugitive material.

  17. Extreme skin depth waveguides

    CERN Document Server

    Jahani, Saman

    2014-01-01

    Recently, we introduced a paradigm shift in light confinement strategy and introduced a class of extreme skin depth (e-skid) photonic structures (S. Jahani and Z. Jacob, "Transparent sub-diffraction optics: nanoscale light confinement without metal," Optica 1, 96-100 (2014)). Here, we analytically establish that figures of merit related to light confinement in dielectric waveguides are fundamentally tied to the skin depth of waves in the cladding. We contrast the propagation characteristics of the fundamental mode of e-skid waveguides and conventional waveguides to show that the decay constant in the cladding is dramatically larger in e-skid waveguides, which is the origin of sub-diffraction confinement. Finally, we propose an approach to verify the reduced skin depth in experiment using the decrease in the Goos-H\\"anchen phase shift.

  18. Skin Cancer Detection

    Directory of Open Access Journals (Sweden)

    N. Durga Rao

    2016-06-01

    Full Text Available : In recent days, skin cancer is seen as one of the most Hazardous form of the Cancers found in Humans. Skin cancer is found in various types such as Melanoma, Basal and Squamous cell Carcinoma among which Melanoma is the most unpredictable. The detection of Melanoma cancer in early stage can be helpful to cure it. Computer vision can play important role in Medical Image Diagnosis and it has been proved by many existing systems. In this paper, we present a survey on different steps which are being to detect the Melanoma Skin Cancer using Image Processing tools. In every step, what are the different methods are be included in our paper

  19. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  20. Traumatic degloving lesion of penile and scrotal skin

    Directory of Open Access Journals (Sweden)

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  1. Skin tears: prevention and treatment.

    Science.gov (United States)

    Wick, Jeannette Y; Zanni, Guido R

    2008-07-01

    While skin tears are common among the elderly in general, and residents of long-term care facilities in particular, there has been limited research into their treatment. Many facilities voluntarily track skin tears, and some states require facilities to report these events. Risk factors include age, xerosis (abnormal eye, skin, or mouth dryness), need for help in activities of daily living, presence of senile purpura, visual impairment, and poor nutrition. Plans to prevent skin tears that employ skin sleeves, padded side rails, gentle skin cleansers, moisturizing lotions, as well as staff education, can decrease by half the number of skin tears incurred in a long-term care facility. Although the treatment process seems simple, it is time consuming and can be painful for the patient. Residents with dementia or agitation often try to remove bulky dressings used to cover skin tears. Dressing changes may injure the fragile wound via skin stripping.

  2. Laser system for optical biopsy and in-vivo study of the human skin

    Science.gov (United States)

    Borisova, Ekaterina G.; Avramov, Lachezar A.

    2001-04-01

    The aim of this study was to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced autofluorescence spectroscopy (LIAFS) for human skin in vivo. The autofluorescence characterization of tissue relies on different spectral properties of tissue. It was demonstrated a differentiation between normal skin and skin with vitaligo. In our experimental investigation of the autofluorescence spectrum of human skin in vivo a nitrogen laser with excitation wavelength 337 nm was used. Two fluorescence bands were observed at 440 and 490 nm, these were attributed to reduced nicotinamide adenine dinucleotide (NADH) and collagen. The intensity of the NADH emission band was markedly reduced in the skin with vitaligo compared with the normal skin, which could indicate different redox conditions in skin with vitaligo. The autofluorescence spectrum of human skin depends on the main internal absorbers, which are blood and melanin. In this study was described the effect caused by melanin content on the shape of the autofluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. The goal of this work is optimization of detection and diagnosis of hollow organs and skin.

  3. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  4. Study of surfactant-skin interactions by skin impedance measurements.

    Science.gov (United States)

    Lu, Guojin; Moore, David J

    2012-02-01

    The stratum corneum (SC) plays a very critical physiological role as skin barrier in regulating water loss through the skin and protects the body from a wide range of physical and chemical exogenous insults. Surfactant-containing formulations can induce skin damage and irritation owing to surfactant absorption and penetration. It is generally accepted that reduction in skin barrier properties occurs only after surfactants have penetrated/permeated into the skin barrier. To mitigate the harshness of surfactant-based cleansing products, penetration/permeation of surfactants should be reduced. Skin impedance measurements have been taken in vitro on porcine skin using vertical Franz diffusion cells to investigate the impact of surfactants, temperature and pH on skin barrier integrity. These skin impedance results demonstrate excellent correlation with other published methods for assessing skin damage and irritation from different surfactant chemistry, concentration, pH, time of exposure and temperature. This study demonstrates that skin impedance can be utilized as a routine approach to screen surfactant-containing formulations for their propensity to compromise the skin barrier and hence likely lead to skin irritation.

  5. THE ROLE OF UDVARTHANA ON SKIN HEALTH

    Directory of Open Access Journals (Sweden)

    Shital O. Chavan

    2013-06-01

    Full Text Available Approaching towards modern life style, every person is conscious about his/her look and using number of cosmetics which are made up of chemicals and freely available in market to make their skin looks beautiful without knowing the consequence produced by chemical (Cosmetics on the skin. To prevent such complication and to increase the beauty of one’s facial look, we selected one of the ancient techniques of daily routine Udvarthana as a subject research to know the effect of Udwartana on skin health according to Samhita’s as per modern life. Face is mirror, which perhaps reflects our individuality from others. Our face is a part of attraction and gives the image of our fitness hence application of Udvartana is done only on face. The results were assessed on manifestation of improvement in skin health, such as symptomatic changes after application. 30 normal individuals of age group 16-30 years were recruited in trial. Sample were assessed and evaluated on the basis of subjective parameters at interval of 15 days for two months. Selection of drugs for Udvarthana was done from Varnadi Gana in Astanga Sangraha Sutrasthana 15/88. Fine powder of drug was mixed with plain water and applied on face till gets dried before bath. There were significant changes in symptomatically criteria when calculated by Willcoxan’s5 test. We got significant result in symptoms of facial skin in experimental group after two month i.e. p<0.05. The finding suggests that Udvarthana is an effective, safe, easy way for healthy skin.

  6. About Skin-to-Skin Care (Kangaroo Care)

    Science.gov (United States)

    ... Size Email Print Share About Skin-to-Skin Care Page Content Article Body You may be able ... care, also called kangaroo care. What is Kangaroo Care? Kangaroo care was developed in South America as ...

  7. CCR3 is essential for skin eosinophilia and airway hyperresponsiveness in a murine model of allergic skin inflammation.

    Science.gov (United States)

    Ma, Weilie; Bryce, Paul J; Humbles, Alison A; Laouini, Dhafer; Yalcindag, Ali; Alenius, Harri; Friend, Daniel S; Oettgen, Hans C; Gerard, Craig; Geha, Raif S

    2002-03-01

    The CC chemokine receptor 3 (CCR3) is expressed by eosinophils, mast cells, and Th2 cells. We used CCR3(-/-) mice to assess the role of CCR3 in a murine model of allergic skin inflammation induced by repeated epicutaneous sensitization with ovalbumin (OVA), and characterized by eosinophil skin infiltration, local expression of Th2 cytokines, and airway hyperresponsiveness (AHR) to inhaled antigen. Eosinophils and the eosinophil product major basic protein were absent from the skin of sham and OVA-sensitized CCR3(-/-) mice. Mast cell numbers and expression of IL-4 mRNA were normal in skin of CCR3(-/-) mice, suggesting that CCR3 is not important for infiltration of the skin by mast cells and Th2 cells. CCR3(-/-) mice produced normal levels of OVA-specific IgE, and their splenocytes secreted normal amounts of IL-4 and IL-5 following in vitro stimulation with OVA, indicating effective generation of systemic Th2 helper responses. Recruitment of eosinophils to lung parenchyma and bronchoalveolar lavage (BAL) fluid was severely impaired in CCR3(-/-) mice, which failed to develop AHR to methacholine following antigen inhalation. These results suggest that CCR3 plays an essential role in eosinophil recruitment to the skin and the lung and in the development of AHR.

  8. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  9. Cryoglobulin induced skin ulceration

    Directory of Open Access Journals (Sweden)

    Fatima Razvi

    2015-01-01

    Full Text Available Lupus Erythematosus (LE is a multi-organ auto-immune disease which results from complex interaction of genetic and environmental factors. The clinical spectrum ranges from minor cutaneous lesions to life threatening multi-organ dysfunction. The skin manifestations are variable and common and range from LE specific to LE non-specific cutaneous disease. Vasculitis is one of the most common non-specific skin lesion of Systemic lupus erythematosus (SLE and appears as purpuric lesions, infarcts along lateral nail folds, peripheral gangrene, sub-cutaneous nodules and ulcers. Mixed cryoglobulinaemia (type II is associated with connective tissue disorders including SLE. Skin manifestations are seen in 60-100% patients and are more common in females. The most common manifestation is palpable purpura of lower extremities seen in 30-100% which often is triggered in winter or on cold exposure. Skin infarction, hemorrhagic crusts and ulcers are seen in 25% of patients. Wide spread necrotic ulcers are seen in 10-25% of patients which are often exacerbated by cold.

  10. Tuberculin Skin Testing

    Science.gov (United States)

    ... the Facts Tuberculosis - The Connection between TB and HIV 12-Dose Regimen for Latent TB Infection-Patient Education Brochure Posters Mantoux Tuberculin Skin Test Wall Chart World TB Day Think TB Stop TB Reports & Articles Morbidity and Mortality Weekly Reports (MMWRs) DTBE Authored ...

  11. Resonance-like tunneling across a barrier with adjacent wells

    Indian Academy of Sciences (India)

    S Mahadevan; P Prema; S K Agarwalla; B Sahu; C S Shastry

    2006-09-01

    We examine the behavior of transmission coefficient across the rectangular barrier when attractive potential well is present on one or both sides and also the same is studied for a smoother barrier with smooth adjacent wells having Woods–Saxon shape. We find that presence of well with suitable width and depth can substantially alter at energies below the barrier height leading to resonant-like structures. In a sense, this work is complementary to the resonant tunneling of particles across two rectangular barriers, which is being studied in detail in recent years with possible applications in mind. We interpret our results as due to resonant-like positive energy states generated by the adjacent wells. We describe in detail the possible potential application of these results in electronic devices using n-type oxygen-doped gallium arsenide and silicon dioxide. It is envisaged that these results will have applications in the design of tunneling devices.

  12. Regional Fault Systems of Qaidam Basin and Adjacent Orogenic Belts

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The purpose of this paper is to analyze the regional fault systems of Qaidam basin and adjacent orogenic belts. Field investigation and seismic interpretation indicate that five regional fault systems occurred in the Qaidam and adjacent mountain belts, controlling the development and evolution of the Qaidam basin. These fault systems are: (1)north Qaidam-Qilian Mountain fault system; (2) south Qaidam-East Kunlun Mountain fault system; (3)Altun strike-slip fault system; (4)Elashan strike-slip fault system, and (5) Gansen-Xiaochaidan fault system. It is indicated that the fault systems controlled the orientation of the Qaidam basin, the formation and distribution of secondary faults within the basin,the migration of depocenters and the distribution of hydrocarbon accumulation belt.

  13. New adjacent Bis-tetrahydrofuran Annonaceous acetogenins from Annona muricata.

    Science.gov (United States)

    Chang, Fang-Rong; Liaw, Chih-Chuang; Lin, Chih-Yuan; Chou, Chi-Jung; Chiu, Hui-Fen; Wu, Yang-Chang

    2003-03-01

    Bioactivity-guided fractionation led to the isolation of two new Annonaceous acetogenins, annocatacin A ( 1). and annocatacin B ( 2). from the seeds and the leaves, respectively, of Annona muricata. Compounds 1 and 2 are the first examples where the adjacent bis-tetrahydrofuran ring system is located at C-15. The new structures were elucidated and characterized by spectral and chemical methods. Both Annonaceous acetogenins 1 and 2 showed significant in vitro cytotoxicity toward the human hepatoma cell lines, Hep G2 and 2,2,15, and were compared with the known adjacent bis-tetrahydrofuran acetogenins, neoannonin ( 3). desacetyluvaricin ( 4). bullatacin ( 5). asimicin ( 6). annoglaucin ( 7). squamocin ( 8). and rollimusin ( 9).

  14. Geodynamical features and geotectonic evolution of Kalimantan and adjacent areas

    Institute of Scientific and Technical Information of China (English)

    杨牧; 彭省临

    2004-01-01

    Kalimantan Island is located in the Southeast Asia continental marginal tectono-magmatic mobile zone in the West Pacific Ocean, where the lithosphere of Earth is one of the most complicated tectonic mobile regions on the Earth since Meso-Cenozoic. Based on the geophysical data of the basement and deep structures, the stress field of mantle flow, the maximum principal stress field and geothermal flux, the crustal nature and geodynamical features of Kalimantan Island and adjacent areas were analyzed. Researches on geotectonic movement and evolution of Kalimantan and adjacent areas show that Southeast Asia continental margin crustobody was formed at about middle-late Triassic. In addition, the geotectonic units of the Kalimantan area were subdivided, and characteristics of their geotectonic evolution were discussed.

  15. Improvement parameters in dynamic compaction adjacent to the slopes

    Institute of Scientific and Technical Information of China (English)

    Elham Ghanbari; Amir Hamidi

    2015-01-01

    Dynamic compaction is a cost-effective method commonly used for improvement of sandy soils. A number of researchers have investigated experimentally and numerically the improvement parameters of soils using dynamic compaction, such as crater depth, improvement depth, and radial improvement, however, these parameters are not studied for improvement adjacent to the slopes or trenches. In this research, four different slopes with different inclinations are modeled numerically using the finite element code ABAQUS, and impact loads of dynamic compaction are applied. The static factors of safety are kept similar for all trenches and determined numerically by application of gravity loads to the slope using strength reduction method (SRM). The analysis focuses on crater depth and improvement region which are compared to the state of flat ground. It can be observed that compacted area adjacent to the slopes is narrower and slightly away from the slope compared to the flat state. Moreover, crater depth increases with increase in slope inclination.

  16. Impact of prebiotics and probiotics on skin health.

    Science.gov (United States)

    Al-Ghazzewi, F H; Tester, R F

    2014-06-01

    This review discusses the role of pre- and probiotics with respect to improving skin health by modulating the cutaneous microbiota. The skin ecosystem is a complex environment covered with a diverse microbiota community. These are classified as either transient or resident, where some are considered as beneficial, some essentially neutral and others pathogenic or at least have the capacity to be pathogenic. Colonisation varies between different parts of the body due to different environmental factors. Pre- and probiotic beneficial effects can be delivered topically or systemically (by ingestion). The pre- and probiotics have the capacity to optimise, maintain and restore the microbiota of the skin in different ways. Topical applications of probiotic bacteria have a direct effect at the site of application by enhancing the skin natural defence barriers. Probiotics as well as resident bacteria can produce antimicrobial peptides that benefit cutaneous immune responses and eliminate pathogens. In cosmetic formulations, prebiotics can be applied to the skin microbiota directly and increase selectively the activity and growth of beneficial 'normal' skin microbiota. Little is known about the efficacy of topically applied prebiotics. Nutritional products containing prebiotics and/or probiotics have a positive effect on skin by modulating the immune system and by providing therapeutic benefits for atopic diseases. This review underlines the potential use of pre- and probiotics for skin health.

  17. Biophysical basis for noninvasive skin cancer detection using Raman spectroscopy

    Science.gov (United States)

    Feng, Xu; Moy, Austin J.; Markey, Mia K.; Fox, Matthew C.; Reichenberg, Jason S.; Tunnell, James W.

    2016-03-01

    Raman spectroscopy (RS) is proving to be a valuable tool for real time noninvasive skin cancer detection via optical fiber probe. However, current methods utilizing RS for skin cancer diagnosis rely on statistically based algorithms to provide tissue classification and do not elucidate the underlying biophysical changes of skin tissue. Therefore, we aim to use RS to explore skin biochemical and structural characteristics and then correlate the Raman spectrum of skin tissue with its disease state. We have built a custom confocal micro-Raman spectrometer system with an 830nm laser light. The high resolution capability of the system allows us to measure spectroscopic features from individual tissue components in situ. Raman images were collected from human skin samples from Mohs surgical biopsy, which were then compared with confocal laser scanning, two-photon fluorescence and hematoxylin and eosin-stained images to develop a linear model of skin tissue Raman spectra. In this model, macroscopic tissue spectra obtained from RS fiber probe were fit into a linear combination of individual basis spectra of primary skin constituents. The fit coefficient of the model explains the biophysical changes spanning a range of normal and various disease states. The model allows for determining parameters similar to that a pathologist is familiar reading and will be a significant guidance in developing RS diagnostic decision schemes.

  18. Haemodynamics and viability of skin and muscle flaps

    Energy Technology Data Exchange (ETDEWEB)

    Clarke, H.M.

    1985-01-01

    In reconstructive surgery, occasional free flap failures occur despite the clinical and technical advances in microsurgery of the past few years. To minimize these losses a better understanding of basic flap physiology must be achieved. The objectives of this work were the investigation of the haemodynamic characteristics of skin and muscle flaps in normal and compromised circumstances, the viability of skin and muscle flaps after pedicle ligation or ischaemia, and the possible interrelationship of haemodynamics and viability. A Wistar rat groin island skin flap model was used to assess flap survival following vascular compromise produced by vessel ligation. Survival was seen earliest following loss of the artery and was not dependent on circulation through the vascular pedicle after 5 days. A study using free groin flaps in rats gave similar results. Normal free groin flaps were then transferred to irradiated Fischer F344 rats. Delayed neovascularization was shown at a time corresponding to the onset of the late phase of the response to skin radiation. A canine inferior epigastric free skin flap model was established to determine the normal haemodynamic parameters during free flap transfer. A canine gracilis free muscle flap model was developed. Normal haemodynamic parameters are given. These parameters were examined after ischaemia. Survival of the muscle followed ischaemia of 4 hours or less. Flap survival is not dependent solely on arterial input or venous drainage. More complex phenomena such as the reactive hyperaemia following ischaemia are implicated in survival.

  19. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    OpenAIRE

    Ana Guadalupe Ramírez Olvera; Manuel Villarreal Arroyo; Luis Mario Hinojosa Martínez; Enrique Méndez Pérez; Luis Romeo Ramos Hinojosa

    2015-01-01

    OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, ...

  20. Processing multiple non-adjacent dependencies: evidence from sequence learning.

    Science.gov (United States)

    de Vries, Meinou H; Petersson, Karl Magnus; Geukes, Sebastian; Zwitserlood, Pienie; Christiansen, Morten H

    2012-07-19

    Processing non-adjacent dependencies is considered to be one of the hallmarks of human language. Assuming that sequence-learning tasks provide a useful way to tap natural-language-processing mechanisms, we cross-modally combined serial reaction time and artificial-grammar learning paradigms to investigate the processing of multiple nested (A(1)A(2)A(3)B(3)B(2)B(1)) and crossed dependencies (A(1)A(2)A(3)B(1)B(2)B(3)), containing either three or two dependencies. Both reaction times and prediction errors highlighted problems with processing the middle dependency in nested structures (A(1)A(2)A(3)B(3)_B(1)), reminiscent of the 'missing-verb effect' observed in English and French, but not with crossed structures (A(1)A(2)A(3)B(1)_B(3)). Prior linguistic experience did not play a major role: native speakers of German and Dutch-which permit nested and crossed dependencies, respectively-showed a similar pattern of results for sequences with three dependencies. As for sequences with two dependencies, reaction times and prediction errors were similar for both nested and crossed dependencies. The results suggest that constraints on the processing of multiple non-adjacent dependencies are determined by the specific ordering of the non-adjacent dependencies (i.e. nested or crossed), as well as the number of non-adjacent dependencies to be resolved (i.e. two or three). Furthermore, these constraints may not be specific to language but instead derive from limitations on structured sequence learning.

  1. Acyclic Edge Coloring of Planar Graphs without Adjacent Triangles

    Institute of Scientific and Technical Information of China (English)

    Dezheng XIE; Yanqing WU

    2012-01-01

    An acyclic edge coloring of a graph G is a proper edge coloring such that there are no bichromatic cycles.The acyclic edge chromatic number of a graph G is the minimum number k such that there exists an acyclic edge coloring using k colors and is denoted by x'a(G).In this paper we prove that x'a(G)≤ Δ(G)+ 5 for planar graphs G without adjacent triangles.

  2. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, E.; Chunmao, H.; Lutgers, H.L.; Links, T.P.; Smit, A.J.; Rakhorst, G.; de Graaff, R.

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to select

  3. OVERLOAD STUDY ON ADJACENT DISC AFTER ARTHRODESIS IN THORACOLUMBAR FRACTURES

    Directory of Open Access Journals (Sweden)

    GUSTAVO SERRA REINAS

    Full Text Available ABSTRACT Objective: To analyze the degeneration of the adjacent disc after arthrodesis due to thoracolumbar fractures. Methods: Eighty-three patients who underwent posterolateral arthrodesis in thoracolumbar levels had their x-rays analyzed for degeneration of adjacent discs to the arthrodesis. The disc spaces were classified by the UCLA scale. Results: Of the 83 patients evaluated, 66 were males (79% and 18 females (21%, with a mean age of 35.5 years. The mean follow-up period was 40 months. As the fractures 75% were between T12 and L2 (p<0.001, being of the A3 type in 65% of the cases (p<0.001. The most common mechanism of injury, accounting for 50% of the cases (p<0.001, was fall from height. Only 6% of the superior discs and 12% of the inferior ones showed some degree of degeneration. No patient underwent a new surgical approach. Conclusion: The incidence of degeneration on adjacent disc in patients after arthrodesis resulting from fractures ranged from 6% to 12% with an average follow-up of 40 months.

  4. Heat flow distribution in Chinese continent and its adjacent areas

    Institute of Scientific and Technical Information of China (English)

    Wei Tao; Zhengkang Shen

    2008-01-01

    Using a compilation of 6980 heat flow measurements, we produce a new heat flow map for the Chinese continent and its adjacent areas. We develop an objective and integrated method to interpolate the heat flow data, taking into account both the uniformity within geological units and coherency of regional heat flow. The geologic units are outlined based on Zhang et al.'s active tectonic block model.Our heat flow model is presented in two formats: a contour map and a heat flow dataset with values on a 1 × 1° grid for the Chinese continent and its adjacent areas, reflecting detailed variations in some regions. Also provided is a resolution map which helps understand the reliability of the heat flow model. Our results reveal that (1) Heat flows in the eastern part of the Chinese continent are relatively higher than those in the western part except that in the Tibetan Plateau area. (2) Heat flows in the Ordos and North China blocks are around 60 mW/m2, and are 50-55 mW/m2 in South China except for the continental marginal sea regions. (3) Heat flow is the lowest in the Jtmggar Basin, only 35-45 mW/m2, and is 45-55 mW/m2 in the Tarim Basin. The results of this study provide an important data-set for studies on thermal and rheological structures of the Chinese continent and its adjacent areas.

  5. SKIN DETECTION OF ANIMATION CHARACTERS

    Directory of Open Access Journals (Sweden)

    Kazi Tanvir Ahmed Siddiqui

    2015-02-01

    Full Text Available The increasing popularity of animes makes it vulnerable to unwanted usages like copyright violations and pornography. That’s why, we need to develop a method to detect and recognize animation characters. Skin detection is one of the most important steps in this way. Though there are some methods to detect human skin color, but those methods do not work properly for anime characters. Anime skin varies greatly from human skin in color, texture, tone and in different kinds of lighting. They also vary greatly among themselves. Moreover, many other things (for example leather, shirt, hair etc., which are not skin, can have color similar to skin. In this paper, we have proposed three methods that can identify an anime character’s skin more successfully as compared with Kovac, Swift, Saleh and Osman methods, which are primarily designed for human skin detection. Our methods are based on RGB values and their comparative relations.

  6. Tissue Engineered Human Skin Equivalents

    Directory of Open Access Journals (Sweden)

    Zheng Zhang

    2012-01-01

    Full Text Available Human skin not only serves as an important barrier against the penetration of exogenous substances into the body, but also provides a potential avenue for the transport of functional active drugs/reagents/ingredients into the skin (topical delivery and/or the body (transdermal delivery. In the past three decades, research and development in human skin equivalents have advanced in parallel with those in tissue engineering and regenerative medicine. The human skin equivalents are used commercially as clinical skin substitutes and as models for permeation and toxicity screening. Several academic laboratories have developed their own human skin equivalent models and applied these models for studying skin permeation, corrosivity and irritation, compound toxicity, biochemistry, metabolism and cellular pharmacology. Various aspects of the state of the art of human skin equivalents are reviewed and discussed.

  7. Eldercare at Home: Skin Problems

    Science.gov (United States)

    ... disorders that give rise to serious medical problems. Older skin is less oily, less elastic, and thinner. It ... of old age." Response Yes, it is true older skin is less oily and it is thinner than ...

  8. Skin - abnormally dark or light

    Science.gov (United States)

    ... ency/article/003242.htm Skin - abnormally dark or light To use the sharing features on this page, ... the hands. The bronze color can range from light to dark (in fair-skinned people) with the ...

  9. Maintaining Healthy Skin -- Part 2

    Science.gov (United States)

    ... from seams or elastic binding. Check also for blisters, bumps, insect bites, dry flaky skin or pimples. ... always check your skin carefully after wearing new shoes or clothing. Too loose — Loose clothing can form ...

  10. The management of skin tears.

    Science.gov (United States)

    Meuleneire, Frans

    During the ageing process the layers of the skin start to atrophy; the epidermis becomes thin and fragile, and dermal thickness decreases by 20 per cent (White et al, 1994). This makes skin tears a common problem among older people.

  11. Staining of skin with dihydroxyacetone.

    Science.gov (United States)

    WITTGENSTEIN, E; BERRY, H K

    1960-09-30

    The reaction of skin with dihydroxyacetone to produce a brown "artificial tan" appears to proceed through combination with free amino groups in skin proteins, and particularly by combination of dihydroxyacetone with the free guanido group in arginine.

  12. Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

    Institute of Scientific and Technical Information of China (English)

    WU Yan; LIU Houjun; LI Jiawen

    2007-01-01

    To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

  13. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  14. Nicotinamide for skin cancer chemoprevention.

    Science.gov (United States)

    Damian, Diona L

    2017-03-20

    Nicotinamide (vitamin B3 ) has a range of photoprotective effects in vitro and in vivo; it enhances DNA repair, reduces UV radiation-induced suppression of skin immune responses, modulates inflammatory cytokine production and skin barrier function and restores cellular energy levels after UV exposure. Pharmacological doses of nicotinamide have been shown to reduce actinic keratoses and nonmelanoma skin cancer incidence in high-risk individuals, making this a nontoxic and accessible option for skin cancer chemoprevention in this population.

  15. A REVIEW ON SKIN CANCER

    OpenAIRE

    S. Ramya Silpa; Chidvila V

    2013-01-01

    Skin cancer can be of 2 types mainly. They are malignant melanoma and non-malignant melanoma. Skin cancer mainly occurs due to exposure of sunlight. Ozone depletion and chemical exposures are other factors involved in precipitating skin cancer. Mutations of p53 gene are involved in UV- induced carcinogenesis. P53 gene acts vital in development of SCC. So, prevention of skin cancer is the main criteria. Regular application of sunscreens could be one of the primary prevention. The purpose of pr...

  16. Skin cancer: Etiology and management.

    Science.gov (United States)

    Qadir, Muhammad Imran

    2016-05-01

    Nowadays, occurrence of skin cancer is very common in humans. It is reported that the most common cause of the skin cancer is excessive exposure to sunlight as it contains harmful radiations; the ultra violet rays. Different management strategies are used for different types of skin cancers, which are chemotherapy, radiation therapy.

  17. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  18. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  19. Aging-like skin changes induced by ultraviolet irradiation in an animal model of metabolic syndrome.

    Science.gov (United States)

    Akase, Tomoko; Nagase, Takashi; Huang, Lijuan; Ibuki, Ai; Minematsu, Takeo; Nakagami, Gojiro; Ohta, Yasunori; Shimada, Tsutomu; Aburada, Masaki; Sugama, Junko; Sanada, Hiromi

    2012-04-01

    Both physiological skin aging and pathologic photo-aging caused by ultraviolet (UV) irradiation are mediated by latent inflammation and oxidative stress. Although numerous animal skin-aging models have used UV irradiation, most require massive doses or long-term irradiation. To establish a more refined skin-aging model, we focused on an animal model of metabolic syndrome (MS) because MS involves damage to various organs via oxidative stress or inflammation, similar to the changes associated with aging. We hypothesized that MS skin might exhibit more aging-like changes after milder, shorter-term UV irradiation than would normal animal skin under similar conditions, thus providing a useful model for skin aging. The authors therefore examined the skin from Tsumura Suzuki obese diabetic (TSOD) mice (MS model) and control Tsumura Suzuki non-obese (TSNO) mice before and after UV irradiation. Skin from TSOD mice had a thinner epidermis and dermis, a thicker fatty layer, reduced density and convolution of the fragmented collagen fibers, and upregulated expression of tumor necrosis factor (TNF)-α, a dual marker for inflammation and aging, compared to the skin from TSNO mice. UV irradiation affected TSOD skin more severely than TSNO skin, resulting in various changes resembling those in aged human skin, including damage to the dermis and subcutaneous fatty tissue, infiltration of inflammatory cells, and further upregulation of TNF-α expression. These results suggest that UV-irradiated TSOD mice may provide a new model of skin aging and imply that skin from humans with MS is more susceptible to UV- or aging-related damage than normal human skin.

  20. Serotonin in human skin

    Institute of Scientific and Technical Information of China (English)

    Jianguo Huang; Qiying Gong; Guiming Li

    2005-01-01

    In this review the authors summarize data of a potential role for serotonin in human skin physiology and pathology. The uncovering of endogenous serotonin synthesis and its transformation to melatonin underlines a putative important role of this pathway in melanocyte physiology and pathology. Pathways of the biosynthesis and biodegradation of serotonin have been characterized in human beings and its major cellular populations. Moreover, receptors of serotonin are expressed on keratinocytes, melanocytes, and fibroblasts and these mediate phenotypic actions on cellular proliferation and differentiation. And the widespread expression of a cutaneous seorotoninergic system indicates considerable selectivity of action to facilitate intra-, auto-, or paracrine mechanisms that define and influence skin function in a highly compartmentalized manner. Melatonin, in turn, can also act as a hormone, neurotransmitter, cytokine, biological modifier and immunomodulator. Thus, Serotonin local synthesis and cellular localization could thus become of great importance in the diagnosis and management of cutaneous pathology.

  1. Skin contamination dosimeter

    Science.gov (United States)

    Hamby, David M.; Farsoni, Abdollah T.; Cazalas, Edward

    2011-06-21

    A technique and device provides absolute skin dosimetry in real time at multiple tissue depths simultaneously. The device uses a phoswich detector which has multiple scintillators embedded at different depths within a non-scintillating material. A digital pulse processor connected to the phoswich detector measures a differential distribution (dN/dH) of count rate N as function of pulse height H for signals from each of the multiple scintillators. A digital processor computes in real time from the differential count-rate distribution for each of multiple scintillators an estimate of an ionizing radiation dose delivered to each of multiple depths of skin tissue corresponding to the multiple scintillators embedded at multiple corresponding depths within the non-scintillating material.

  2. Double-Skin Facade

    DEFF Research Database (Denmark)

    Kalyanova, Olena

    difficulties experienced by scientists when attempting to model DSF thermal and energy performance were examined. In addition, the lack of experimental studies and empirical validation of models was realized, many numerical models have not been empirically validated and most of them require an expert knowledge...... IEA Annex 34/43, subtask E "Double-Skin Facade". The results of empirical validation are discussed in this work. Discussion and analysis of experimental results is carried out. It has lead to hypothesis of recirculation flow phenomenon in the DSF cavity. Finally, a suggestion of a new numerical model......Double-Skin Facades (DSF) are gaining popularity that, in fact, appears to be independent from sturdy critics of the concept in the past years. DSF buildings are being built in Europe and worldwide, DSF concept is being taught at schools of architecture and fully glazed office buildings are being...

  3. Skin Cancer: Biology, Risk Factors & Treatment

    Science.gov (United States)

    ... turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer 2013 Table ... Articles Skin Cancer Can Strike Anyone / Skin Cancer: Biology, Risk Factors & Treatment / Timely Healthcare Checkup Catches Melanoma ...

  4. The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis

    Directory of Open Access Journals (Sweden)

    Cormac W. Joyce, MB BCh

    2014-12-01

    Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.

  5. SKIN RADIATION IN PANORAMIC

    Directory of Open Access Journals (Sweden)

    Herry Irawan

    2015-06-01

    Full Text Available Dental panoramic radiograph in Indonesia has been widely used. Modern diagnostic imaging equipment with minimum radiation is still very limited. One of the conditions in nuclear safety law, UU 10/1997, is an optimization of all radiation sources with DRL through skin dose measurements. In Indonesia, the national DRL has not been established yet, and there were no reports on the study of panoramic skin dose in Indonesia. The aim of this preliminary study was to obtain a panoramic skin dose radiation as reference to establish DRL in Indonesia. Panoramic radiographs of sixteen female and fifteen male patients, aged 4 – 48 years, were taken using the standard conventional method, with TLD chips attached in location groups. The chips were then read with the detector and integrator of BATAN, in high and low temperature condition at the same time. It was revealed that behind the right and left ear were the regions with the highest radiation dose received, followed by the back of the neck, left jaw, right jaw, and chin. The result of this study has shown the importance of DRL in Indonesia since the use of modern diagnostic imaging equipement that limits radiation dose to the minimum level is still very limited.

  6. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation p

  7. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

  8. Photothermal Radiometry for Skin Research

    Directory of Open Access Journals (Sweden)

    Perry Xiao

    2016-02-01

    Full Text Available Photothermal radiometry is an infrared remote sensing technique that has been used for skin and skin appendages research, in the areas of skin hydration, hydration gradient, skin hydration depth profiling, skin thickness measurements, skin pigmentation measurements, effect of topically applied substances, transdermal drug delivery, moisture content of bio-materials, membrane permeation, and nail and hair measurements. Compared with other technologies, photothermal radiometry has the advantages of non-contact, non-destructive, quick to make a measurement (a few seconds, and being spectroscopic in nature. It is also colour blind, and can work on any arbitrary sample surfaces. It has a unique depth profiling capability on a sample surface (typically the top 20 µm, which makes it particularly suitable for skin measurements. In this paper, we present a review of the photothermal radiometry work carried out in our research group. We will first introduce the theoretical background, then illustrate its applications with experimental results.

  9. An ElGamal Encryption Scheme of Adjacency Matrix and

    Directory of Open Access Journals (Sweden)

    B. Ravi Kumar

    2015-10-01

    Full Text Available  Cryptography is the combination of Mathematics and Computer science. Cryptography is used for encryption and decryption of data using mathematics. Cryptography transit the information in an illegible manner such that only intended recipient will be able to decrypt the information. In the recent years, researchers developed several new encryption methods. Among such ElGamal encryption is the one laid a concede platform for the researchers in Cryptography. Ever science several mathematical models were applied for encryption/decryption. In this paper, we introduced an ElGamal encryption, which uses points on the elliptic curve, and finite state machines and adjacency matrix.

  10. Experimental Tape Casting of Adjacently Graded Materials for Magnetic Refrigeration

    DEFF Research Database (Denmark)

    Bulatova, Regina

    graded thin films. The motivation to create such adjacently segmented structures stemmed from a search of material and a materials design alternative to the expensive rare earth element gadolinium which is widely used as a magnetic regenerator in the emerging magnetic refrigeration technology....... Conventional tape casting involves the preparation of specially formulated slurry, which is cast by a blade to a thin flat tape, then dried into flexible so-called green solid tape and can be subsequently sintered into a hard ceramic material. The principal difference and, at the same time, a challenge...

  11. Historical Earthquakes in the Yellow Sea and Its Adjacent Area

    Institute of Scientific and Technical Information of China (English)

    Wu Ge; Wang Andong; Wu Di

    2005-01-01

    As a result of sorting out, estimating and cataloging of historical earthquakes, from the year of 2 A.D. to Aug., 1949, we found that there were 2187 earthquakes with M≥3.0 in the area of the Yellow Sea and its adjacent area. Among the earthquakes, the number of earthquakes with M ≥ 5.0 is 209, and at least 43 of the earthquakes caused serious losses, 20 of the earthquakes caused human causalities. It is demonstrated that there were 3 areas of historical earthquake concentration and the earthquake activity was higher in the 16th century and the first half if the 20th century.

  12. Osteoid Osteoma of Cervical Spine in two adjacent Vertebrae

    Directory of Open Access Journals (Sweden)

    MR Etemadifar

    2005-09-01

    Full Text Available Osteoid osteoma is a benign bone tumor, mainly seen in 10-30 years male. Spine is a relatively common site and almost always, posterior elements are involved. Plain X-Ray-, CT scan and Isotope scan help to identify and localize spine lesions. We described one 18 years old boy with 3 years low neck pain. Isotope scan, MRI and CT scan showed two lesions in C7 and T1. Gross inspection and histopathology examination confirmed osteoid osteoma in two adjacent vertebrae which has not been reported elsewhere in the literature. Key words: Osteoid Osteoma, Spine, Multifocal

  13. Effects of radiation on levels of DNA damage in normal non-adjacent mucosa from colorectal cancer cases.

    LENUS (Irish Health Repository)

    Sheridan, Juliette

    2013-03-01

    Defects in DNA repair pathways have been linked with colorectal cancer (CRC). Adjuvant radiotherapy has become commonplace in the treatment of rectal cancer however it is associated with a higher rate of second cancer formation. It is known that radiation results in DNA damage directly or indirectly by radiation-induced bystander effect (RIBE) by causing double-strand breaks (DSBs). The majority of work in RIBE has been performed in cell lines and limited studies have been in or ex vivo.

  14. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular......Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  15. Effects of repeated skin exposure to low nickel concentrations

    DEFF Research Database (Denmark)

    Nielsen, N H; Menné, T; Kristiansen, J

    1999-01-01

    and nickel allergy, either on normal or on SLS-treated forearm skin. The present study strongly suggests that the changes observed were specific to nickel exposure. Standardized methods to assess trace to moderate nickel exposure on the hands, and the associated effects in nickel-sensitized subjects......We studied the effects of repeated daily exposure to low nickel concentrations on the hands of patients with hand eczema and nickel allergy. The concentrations used were chosen to represent the range of trace to moderate occupational nickel exposure. The study was double-blinded and placebo...... with a group of patients who immersed a finger into water. The nickel concentrations used also provoked significant inflammatory skin changes on sodium lauryl sulphate (SLS)-treated forearm skin of the patients, whereas inflammatory skin changes were not observed in healthy volunteers without hand eczema...

  16. Solid-armature railguns without the velocity-skin effect

    Energy Technology Data Exchange (ETDEWEB)

    Cowan, M.

    1991-12-31

    If the velocity-skin effect could be eliminated, solid-armature railguns might reach high velocity ({ge} 6 km/s) without forcing most of the armature current to pass through an arc. Even then, magnetic diffusion (the ``normal`` skin effect) will limit acceleration. In this paper, the performance limits for railguns which are free from the velocity-skin effect are investigated by deriving the upper limits for a specific kind of power supply. Previous performance estimates made for solid-armature railguns are examined in the light of these results and are found to be relatively very optimistic. A railgun design which limits the velocity-skin effect and which may allow improved performance for solid armatures is described. 6 refs.

  17. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    DEFF Research Database (Denmark)

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

    2010-01-01

    BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...... disruption [sodium lauryl sulphate (SLS) 0.25%]. RESULTS: Patients and controls had a highly significant increase in TEWL value in the peristomal area compared with nonperistomal contralateral abdominal skin (P

  18. Notch1 functions as a tumor suppressor in mouse skin.

    Science.gov (United States)

    Nicolas, Michael; Wolfer, Anita; Raj, Kenneth; Kummer, J Alain; Mill, Pleasantine; van Noort, Mascha; Hui, Chi-chung; Clevers, Hans; Dotto, G Paolo; Radtke, Freddy

    2003-03-01

    Notch proteins are important in binary cell-fate decisions and inhibiting differentiation in many developmental systems, and aberrant Notch signaling is associated with tumorigenesis. The role of Notch signaling in mammalian skin is less well characterized and is mainly based on in vitro studies, which suggest that Notch signaling induces differentiation in mammalian skin. Conventional gene targeting is not applicable to establishing the role of Notch receptors or ligands in the skin because Notch1-/- embryos die during gestation. Therefore, we used a tissue-specific inducible gene-targeting approach to study the physiological role of the Notch1 receptor in the mouse epidermis and the corneal epithelium of adult mice. Unexpectedly, ablation of Notch1 results in epidermal and corneal hyperplasia followed by the development of skin tumors and facilitated chemical-induced skin carcinogenesis. Notch1 deficiency in skin and in primary keratinocytes results in increased and sustained expression of Gli2, causing the development of basal-cell carcinoma-like tumors. Furthermore, Notch1 inactivation in the epidermis results in derepressed beta-catenin signaling in cells that should normally undergo differentiation. Enhanced beta-catenin signaling can be reversed by re-introduction of a dominant active form of the Notch1 receptor. This leads to a reduction in the signaling-competent pool of beta-catenin, indicating that Notch1 can inhibit beta-catenin-mediated signaling. Our results indicate that Notch1 functions as a tumor-suppressor gene in mammalian skin.

  19. Efficacy of frog skin lipids in wound healing

    Directory of Open Access Journals (Sweden)

    Rajaram Rama

    2010-07-01

    Full Text Available Abstract Background Frog skin has been sequentially and scientifically evaluated by our group for its wound healing efficiency. Owing to the complex structure of skin, attempts were being made to analyse the role of individual constituents in different phases of healing. Our earlier papers have shown the significance of frog skin not only in wound healing but also enhancing the proliferating activity of the epidermal and dermal cells which are instrumental for normal healing process. We also have identified for the first time novel antimicrobial peptides from the skin of Rana tigerina and thereby reduce the complications involved in the sepsis. Purpose of the study and Results The current study envisages the role of frog skin lipids in the inflammatory phase of wound healing. The lipid moiety of the frog skin dominated by phospholipids exhibited a dose dependent acceleration of healing irrespective of the mode of application. The efficiency of the extract is attributed partially to the anti-inflammatory activity as observed by the histochemical and immunostimulatory together with plethysmographic studies. Conclusions Thus, frog skin for the first time has been demonstrated to possess lipid components with pharmaceutical and therapeutic potential. The identification and characterization of such natural healing molecules and evaluating their mechanism of action would therefore provide basis for understanding the cues of Nature and hence can be used for application in medicine.

  20. Novel biodegradable porous scaffold applied to skin regeneration.

    Directory of Open Access Journals (Sweden)

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  1. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    OpenAIRE

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation plays a pivotal role in the development of epidermal and SC features of AD skin and that AD epidermal features can be maintained in vitro when AD skin biopsies are used to generate explant-HSEs. The...

  2. Normalization in econometrics

    OpenAIRE

    Hamilton, James D.; Daniel F. Waggoner; Zha, Tao

    2004-01-01

    The issue of normalization arises whenever two different values for a vector of unknown parameters imply the identical economic model. A normalization does not just imply a rule for selecting which point, among equivalent ones, to call the maximum likelihood estimator (MLE). It also governs the topography of the set of points that go into a small-sample confidence interval associated with that MLE. A poor normalization can lead to multimodal distributions, disjoint confidence intervals, and v...

  3. Normalizers of Irreducible Subfactors

    CERN Document Server

    Smith, Roger R; Wiggins, Alan D

    2007-01-01

    We consider normalizers of an irreducible inclusion $N\\subseteq M$ of $\\mathrm{II}_1$ factors. In the infinite index setting an inclusion $uNu^*\\subseteq N$ can be strict, forcing us to also investigate the semigroup of one-sided normalizers. We relate these normalizers of $N$ in $M$ to projections in the basic construction and show that every trace one projection in the relative commutant $N'\\cap $ is of the form $u^*e_Nu$ for some unitary $u\\in M$ with $uNu^*\\subseteq N$. This enables us to identify the normalizers and the algebras they generate in several situations. In particular each normalizer of a tensor product of irreducible subfactors is a tensor product of normalizers modulo a unitary. We also examine normalizers of irreducible subfactors arising from subgroup--group inclusions $H\\subseteq G$. Here the normalizers are the normalizing group elements modulo a unitary from $L(H)$. We are also able to identify the finite trace $L(H)$-bimodules in $\\ell^2(G)$ as double cosets which are also finite union...

  4. Normal cognitive aging.

    Science.gov (United States)

    Harada, Caroline N; Natelson Love, Marissa C; Triebel, Kristen L

    2013-11-01

    Even those who do not experience dementia or mild cognitive impairment may experience subtle cognitive changes associated with aging. Normal cognitive changes can affect an older adult's everyday function and quality of life, and a better understanding of this process may help clinicians distinguish normal from disease states. This article describes the neurocognitive changes observed in normal aging, followed by a description of the structural and functional alterations seen in aging brains. Practical implications of normal cognitive aging are then discussed, followed by a discussion of what is known about factors that may mitigate age-associated cognitive decline.

  5. Adjacent stage impurity ratio in rare earth countercurrent extraction process

    Institute of Scientific and Technical Information of China (English)

    CHENG Fuxiang; WU Sheng; LIAO Chunsheng; YAN Chunhua

    2013-01-01

    Impurity components decrease stage by stage in a cascade of rare earth (RE) extraction separation,and adjacent stage impurity ratio (ASIR) which is defined as the ratio of an impurity's contents in the aqueous/organic phase of two adjacent stages can be used to evaluate the capacity of impurity removal for the two stages.On the basis of extraction equilibrium and mass balance,the ASIR in a two-component extraction separation was deducted and its simplified expressions were given for different process sections according to reasonable assumptions.The calculation simulation was then carried out to obtain the ASIR distribution in the cascade.The results showed that in both the extraction and scrubbing sections the ASIR principally increased with the decrease of the molar proportion of the impurity but along with a flat appearing in the purification zone located in the middle of the cascade.The ASIR intuitively exhibits the nmning status of RE extraction separation and purification,which could provide a theoretic guide for investigating the influence factors of RE extraction separation process in practical industry.

  6. Seismic anisotropy of upper mantle in Sichuan and adjacent regions

    Institute of Scientific and Technical Information of China (English)

    CHANG LiJun; WANG ChunYong; DING ZhiFeng

    2008-01-01

    Based on the polarization analysis of teleseismic SKS waveform data recorded at 94 broadband seismic stations in Sichuan and adjacent regions, the SKS fast-wave direction and the delay time between the fast and slow shear waves were determined at each station using the grid searching method of minimum transverse energy and the stacking analysis method, and the image of upper mantle anisotropy was acquired. The fast-wave polarization directions are mainly NW-SE in the study area,NWW-SEE to its northeast and NS to its west. The delay time falls into the interval [0.47 s, 1.68 s]. The spatial variation of the fast-wave directions is similar to the variation of GPS velocity directions. The anisotropic image indicates that the regional tectonic stress field has resulted in deformation and flow of upper mantle material, and made the alignment of upper mantle peridotite lattice parallel to the direction of material deformation. The crust-upper mantle deformation in Sichuan and adjacent regions accords with the mode of vertically coherent deformation. In the eastern Tibetan Plateau, the crustal material was extruded to east or southeast clue to SE traction force of the upper mantle material. The extrusion might be obstructed by a rigid block under the Sichuan Basin and the crust has been deformed. After a long-term accumulation of tectonic strain energy, the accumulative energy suddenly released in Yingxiu town of the Longmenshan region, and Wenchuan Ms8.0 earthquake occurred.

  7. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Directory of Open Access Journals (Sweden)

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  8. Human skin transcriptome during superficial cutaneous wound healing.

    Science.gov (United States)

    Nuutila, Kristo; Siltanen, Antti; Peura, Matti; Bizik, Jozef; Kaartinen, Ilkka; Kuokkanen, Hannu; Nieminen, Tapio; Harjula, Ari; Aarnio, Pertti; Vuola, Jyrki; Kankuri, Esko

    2012-01-01

    Healing of the epidermis is a crucial process for maintaining the skin's defense integrity and its resistance to environmental threats. Compromised wound healing renders the individual readily vulnerable to infections and loss of body homeostasis. To clarify the human response of reepithelialization, we biopsied split-thickness skin graft donor site wounds immediately before and after harvesting, as well as during the healing process 3 and 7 days thereafter. In all, 25 biopsies from eight patients qualified for the study. All samples were analyzed by genome-wide microarrays. Here, we identified the genes associated with normal skin reepithelialization over time and organized them by similarities according to their induction or suppression patterns during wound healing. Our results provide the first elaborate insight into the transcriptome during normal human epidermal wound healing. The data not only reveal novel genes associated with epidermal wound healing but also provide a fundamental basis for the translational interpretation of data acquired from experimental models.

  9. Removal of heavy metal contamination from peanut skin extracts by waste biomass adsorption

    Science.gov (United States)

    Polyphenols are a rapidly increasing portion of the nutraceutical and functional food marketplace. Peanut skins are a waste product which have potential as a low-cost source of polyphenols. Extraction and concentration of peanut skin extracts can cause normally innocuous levels of the heavy metal co...

  10. Skin moisturization mechanisms: new data.

    Science.gov (United States)

    Bonté, F

    2011-05-01

    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials.

  11. Relationship between clinical features of facial dry skin and biophysical parameters in Asians.

    Science.gov (United States)

    Baek, J H; Lee, M Y; Koh, J S

    2011-06-01

    There have been few reports classifying the biophysical characteristics of Korean women with healthy skin. Consequently, the aim of this study was to find the most useful parameters for categorizing skin types based on a clinical assessment. One hundred and three female volunteers, aged 20-59, participated in this study. We conducted a self-evaluation questionnaire, a clinical assessment of the facial skin, and non-invasive measurements on the cheek under controlled environmental conditions. The questionnaire survey indicated that 72% of respondents had dry skin. However, results of the clinical assessment focusing on skin roughness and scaling of the cheek showed that 6 subjects had very dry skin (6%), 29 had dry skin (28%) and 68 had normal skin with sufficient moisture (66%). We analysed the correlation between the clinical assessment and biophysical parameters. As a result, we obtained six biophysical parameters that had relatively higher correlations with clinical assessment than other parameters. Our study provided general information about the physiological characteristics of normal skin in Korean women and suggested useful parameters for characterizing dry skin.

  12. One-sheet spiraling full thickness skin graft for penile resurfacing after paraffinoma excision

    Directory of Open Access Journals (Sweden)

    Theddeus O.H. Prasetyono

    2011-08-01

    Full Text Available In the midst of on-going non-illicit practice of silicone or paraffin injection to enlarge penis, the author reported 3 cases of surgical treatment to resurface the body of the penis after excision of the destructed penile skin using full thickness skin graft. The skin excision was performed technically through penile body degloving procedure. Full thickness skin graft was then applied as a single sheet donor tissue to cover the denuded penile body spirally. The full thickness graft, which is relatively easy to be performed, is no doubt much thinner than a skin flap, while it also bears a smaller degree of secondary contraction than split skin graft. The color of the skin is considerably matched as it comes from the groin, which is a nearby area of penis. The size and skin sensitization of the penis looks to be natural. The only disadvantage is the common possibility of either spiral or circular junctional scar in between graft edges and between the graft and the penile mucosa and skin to develop hypertrophic scar. However, this possible scar problem applies also to any other surgical scar with any donor tissue. Fortunately, the 3 cases posed no scar problem and normal appearance. All the patients have also regained their normal sexual function. (Med J Indones 2011; 20:222-5Keywords: full thickness skin graft, paraffinoma, siliconoma, sexual function

  13. Climate change and skin.

    Science.gov (United States)

    Balato, N; Ayala, F; Megna, M; Balato, A; Patruno, C

    2013-02-01

    Global climate appears to be changing at an unprecedented rate. Climate change can be caused by several factors that include variations in solar radiation received by earth, oceanic processes (such as oceanic circulation), plate tectonics, and volcanic eruptions, as well as human-induced alterations of the natural world. Many human activities, such as the use of fossil fuel and the consequent accumulation of greenhouse gases in the atmosphere, land consumption, deforestation, industrial processes, as well as some agriculture practices are contributing to global climate change. Indeed, many authors have reported on the current trend towards global warming (average surface temperature has augmented by 0.6 °C over the past 100 years), decreased precipitation, atmospheric humidity changes, and global rise in extreme climatic events. The magnitude and cause of these changes and their impact on human activity have become important matters of debate worldwide, representing climate change as one of the greatest challenges of the modern age. Although many articles have been written based on observations and various predictive models of how climate change could affect social, economic and health systems, only few studies exist about the effects of this change on skin physiology and diseases. However, the skin is the most exposed organ to environment; therefore, cutaneous diseases are inclined to have a high sensitivity to climate. For example, global warming, deforestation and changes in precipitation have been linked to variations in the geographical distribution of vectors of some infectious diseases (leishmaniasis, lyme disease, etc) by changing their spread, whereas warm and humid environment can also encourage the colonization of the skin by bacteria and fungi. The present review focuses on the wide and complex relationship between climate change and dermatology, showing the numerous factors that are contributing to modify the incidence and the clinical pattern of many

  14. Epidemiology of skin cancer.

    Science.gov (United States)

    Leiter, Ulrike; Eigentler, Thomas; Garbe, Claus

    2014-01-01

    Melanoma and nonmelanoma skin cancer (NMSC) are now the most common types of cancer in white populations. Both tumor entities show an increasing incidence rate worldwide but a stable or decreasing mortality rate. NMSC is the most common cancer in white-skinned individuals with a worldwide increasing incidence. NMSC is an increasing problem for health care services worldwide which causes significant morbidity. The rising incidence rates of NMSC are probably caused by a combination of increased exposure to ultraviolet (UV) or sun light, increased outdoor activities, changes in clothing style, increased longevity, ozone depletion, genetics and in some cases, immune suppression. An intensive UV exposure in childhood and adolescence was causative for the development of basal cell carcinoma (BCC) whereas for the etiology of SCC a chronic UV exposure in the earlier decades was accused. Cutaneous melanoma is the most rapidly increasing cancer in white populations, in the last 3 decades incidence rates have risen up to 5-fold. In 2008 melanoma was on place 5 in women and on place 8 in men of the most common solid tumor entities in Germany. The frequency of its occurrence is closely associated with the constitutive color of the skin, and the geographical zone. Changes in outdoor activities and exposure to sunlight during the past 50 years are an important factor for the increasing incidence of melanoma. Mortality rates of melanoma show a stabilization in the USA, Australia and also in European countries. In contrast to SCC, melanoma risk seems to be associated with an intermittent exposure to sunlight. Prevention campaigns aim on reducing incidence and achieving earlier diagnosis, which resulted in an ongoing trend toward thin melanoma since the last two decades. However, the impact of primary prevention measures on incidence rates of melanoma is unlikely to be seen in the near future, rather increasing incidence rates to 40-50/100,000 inhabitants/year should be expected in

  15. Mechanisms of Angiogenesis and Lymphangiogenesis in TSC Skin Tumors

    Science.gov (United States)

    2011-09-16

    penicillin (100U/ml) and streptomycin (100 µg/ml). Keratinocytes were isolated from foreskins of unidentified normal neonates (provided by Dr...Induction of cutaneous delayed-type hypersensitivity reactions in VEGF-A transgenic mice results in chronic skin inflammation associated with persistent

  16. Distribution and degradation of albumin in extensive skin disease

    DEFF Research Database (Denmark)

    Worm, Anne-Marie; Taaning, E; Rossing, N;

    1981-01-01

    The distribution and degradation of albumin were determined in twelve patients with extensive skin disease and in ten control subjects by measuring the metabolic turnover and transcapillary escape of 132 I-labelled albumin. The ratio of intravascular to total mass of albumin was normal. Thus the ...... catabolic rate of albumin supports the concept of a causal relationship between these parameters....

  17. Skin and bones. I.

    Science.gov (United States)

    Orlow, S J; Watsky, K L; Bolognia, J L

    1991-08-01

    Skin disorders in which a radiograph may detect associated bony changes or abnormalities of calcification are discussed. They are grouped into eight categories: (1) inherited diseases (e.g., alkaptonuria, neurofibromatosis); (2) congenital disorders (e.g., Sturge-Weber and Proteus syndromes); (3) inflammatory conditions (e.g., dermatomyositis, sarcoidosis); (4) infections (e.g., dental sinus, syphilis); (5) neoplasias (e.g., histiocytosis, mastocytosis); (6) drug- and environment-induced (e.g., acroosteolysis, retinoid toxicity); (7) calcinosis cutis; and (8) osteoma cutis. Part I of our review discusses the first two categories.

  18. Skin and bones. II.

    Science.gov (United States)

    Orlow, S J; Watsky, K L; Bolognia, J L

    1991-09-01

    Skin disorders in which a radiograph may detect associated bony changes or abnormalities of calcification are discussed. They are grouped into eight categories: (1) inherited diseases (e.g., alkaptonuria, neurofibromatosis); (2) congenital disorders (e.g., Sturge-Weber and Proteus syndromes); (3) inflammatory conditions (e.g., dermatomyositis, sarcoidosis); (4) infections (e.g., dental sinus, syphilis); (5) neoplasias (e.g., histiocytosis, mastocytosis); (6) drug- and environment-induced (e.g., acroosteolysis, retinoid toxicity); (7) calcinosis cutis; and (8) osteoma cutis. The first part of this review, published in the August 1991 issue of this JOURNAL, dealt with the first two categories; part II discusses categories 3 through 8.

  19. Shedding skin and tears.

    Science.gov (United States)

    Hammlerschlag, Carl A

    2007-06-01

    I am a purported expert in change and personal growth; that's the work I do with patients, and what I lecture and write about. I say that growth has nothing to do with adding on; it's always about letting go. Alas, it's always easier to tell others how to welcome shedding their skins than it is for me to do it myself. Letting go of the old and familiar is a necessary prerequisite for growth, but it's hard to do because no matter how much we may know, we have to move on. It always makes us feel vulnerable, which can inspire fear.

  20. Is skin penetration a determining factor in skin sensitization ...

    Science.gov (United States)

    Summary:Background. It is widely accepted that substances that cannot penetrate through the skin will not be sensitisers. Thresholds based on relevant physicochemical parameters such as a LogKow > 1 and a MW 1 is a true requirement for sensitisation.Methods. A large dataset of substances that had been evaluated for their skin sensitisation potential, together with measured LogKow values was compiled from the REACH database. The incidence of skin sensitisers relative to non-skin sensitisers below and above the LogKow = 1 threshold was evaluated. Results. 1482 substances with associated skin sensitisation outcomes and measured LogKow values were identified. 305 substances had a measured LogKow skin sensitisation above and below the LogKow = 1 threshold. Reaction chemistry considerations could explain the skin sensitisation observed for the 38 sensitisers with a LogKow skin sensitisation potential and potency. Using the REACH data extracted to test out the validity of common assumptions in the skin sensitization AOP. Builds on trying to develop a proof of concept IATA

  1. Histoplasma skin test

    Science.gov (United States)

    ... Histoplasma capsulatum. The fungus causes an infection called histoplasmosis. How the Test is Performed The health care ... have been exposed to the fungus that causes histoplasmosis . Normal Results No reaction (inflammation) at the site ...

  2. Expression of Bmi-1 and EZH2 in tissues adjacent to human epithelial ovarian cancer cells of orthotopic implantation in nude mice

    Institute of Scientific and Technical Information of China (English)

    Genhai Zhu; Lan Hong; Shengtan Wang; Zhaoxin Yang; Chunying Chen; Shixuan Wang

    2015-01-01

    Objective This study investigated the feasibility of screening residual normal ovarian tissues based on the expression of Bmi-1 and EZH2 in tissues adjacent to orthotopic ovarian carcinomas in nude mice. Methods The human epithelial ovarian cancer cel line OVCAR3 was grown in subcutaneous tissues and the tumor tissues were orthotopical y implanted. The expression levels of Bmi-1 and EZH2 were detected by immunohistochemical staining and RT-PCR in cancer tissues, proximal and remote tissues with respect to the cancer tissues, and normal ovarian tissues of nude mice. Results Thirty-five ovarian tissue samples with normal biopsy results were obtained from 40 cases of human epithelial ovarian cancer in the nude mice in which the tumor tissues were orthotopical y implanted. Bmi-1 and EZH2 expression levels were lower in proximal paraneoplastic tissue samples than in cancer tissue samples (P Conclusion The expression levels of Bmi-1 and EZH2 were reduced with increasing distance from the cancer tissues. Negative expression of these tumor-associated genes can be used as a standard for the screening of normal ovarian tissues adjacent to tumor tissues. Normal ovarian tissues can be obtained from the tissues adjacent to tumors.

  3. The 'beauty' of skin neurobiology.

    Science.gov (United States)

    Pincelli, C; Bonté, F

    2003-07-01

    The skin is the most densely innervated organ in the body and there is a close relationship between the skin and the nervous system. Most skin cells express receptors for neuromediators (NM) and skin cells themselves are an important source of NM. In particular, human keratinocytes synthesize neurotrophins and endorphins and express their receptors. In addition to neurotrophic activity, NM are involved in skin homeostasis, trophism and stress responses. NM released from keratinocytes also function in a paracrine fashion on other skin cells, such as Langerhans cells, melanocytes and fibroblasts. We discuss the influence of NM on these cells, which may be involved in major cosmetic problems like ageing, baldness and dyspigmentation. Based on this correlation, it seems reasonable to target neural factors for cosmetic purposes.

  4. Pathophysiological Study of Sensitive Skin.

    Science.gov (United States)

    Buhé, Virginie; Vié, Katell; Guéré, Christelle; Natalizio, Audrey; Lhéritier, Céline; Le Gall-Ianotto, Christelle; Huet, Flavien; Talagas, Matthieu; Lebonvallet, Nicolas; Marcorelles, Pascale; Carré, Jean-Luc; Misery, Laurent

    2016-03-01

    Sensitive skin is a clinical syndrome characterized by the occurrence of unpleasant sensations, such as pruritus, burning or pain, in response to various factors, including skincare products, water, cold, heat, or other physical and/or chemical factors. Although these symptoms suggest inflammation and the activation of peripheral innervation, the pathophysiogeny of sensitive skin remains unknown. We systematically analysed cutaneous biopsies from 50 healthy women with non-sensitive or sensitive skin and demonstrated that the intraepidermal nerve fibre density, especially that of peptidergic C-fibres, was lower in the sensitive skin group. These fibres are involved in pain, itching and temperature perception, and their degeneration may promote allodynia and similar symptoms. These results suggest that the pathophysiology of skin sensitivity resembles that of neuropathic pruritus within the context of small fibre neuropathy, and that environmental factors may alter skin innervation.

  5. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available BACKGROUND: Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test. METHODS: COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography. RESULTS: Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears. CONCLUSIONS: In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  6. Microscopic contact area and friction between medical textiles and skin.

    Science.gov (United States)

    Derler, S; Rotaru, G-M; Ke, W; El Issawi-Frischknecht, L; Kellenberger, P; Scheel-Sailer, A; Rossi, R M

    2014-10-01

    The mechanical contact between medical textiles and skin is relevant in the health care for patients with vulnerable skin or chronic wounds. In order to gain new insights into the skin-textile contact on the microscopic level, the 3D surface topography of a normal and a new hospital bed sheet with a regular surface structure was measured using a digital microscope. The topographic data was analysed concerning material distribution and real contact area against smooth surfaces as a function of surface deformations. For contact conditions that are relevant for the skin of patients lying in a hospital bed it was found that the order of magnitude of the ratio of real and apparent contact area between textiles and skin or a mechanical skin model lies between 0.02 and 0.1 and that surface deformations, i.e. penetration of the textile surface asperities into skin or a mechanical skin model, range from 10 to 50µm. The performed analyses of textile 3D surface topographies and comparisons with previous friction measurement results provided information on the relationship between microscopic surface properties and macroscopic friction behaviour of medical textiles. In particular, the new bed sheet was found to be characterised by a trend towards a smaller microscopic contact area (up to a factor of two) and by a larger free interfacial volume (more than a factor of two) in addition to a 1.5 times lower shear strength when in contact with counter-surfaces. The applied methods can be useful to develop improved and skin-adapted materials and surfaces for medical applications.

  7. Protecting the skin during thyroidectomy

    Directory of Open Access Journals (Sweden)

    Renan Bezerra Lira

    2014-01-01

    Full Text Available In this note we describe the standard technical maneuver used in our department to protect the skin during thyroidectomy in order to get the best aesthetic result. We use surgical gloves to protect the skin during these operations to reduce the negative impact of thermal trauma and mechanical retractors and energy delivery devices at the edges of the skin incised. This practice is effective, inexpensive, rapid, reproducible and showed no complication in our experience of over 2,500 thyroidectomies.

  8. Optical mapping of nonmelanoma skin cancer

    Science.gov (United States)

    Yaroslavsky, Anna N.; Neel, Victor; Anderson, Richard R.

    2004-07-01

    More than two million cases of nonmelanoma skin cancers are diagnosed every year. Therefore, there is a strong need for practical, reliable, rapid, and precise methods for tumor delineation, to guide surgery and other treatments of skin cancer. Once developed, such methods may be useful for squamous cell carcinomas of other organs. Non-invasive optical imaging techniques including polarization sensitive reflectance and fluorescence imaging were evaluated for the demarcation of nonmelanoma skin tumors. Thick freshly excised tumor specimens obtained from Mohs surgery were used for the experiments. Imaging was performed using linearly polarized incident light in the visible and near infrared spectral range from 577 nm to 750 nm. Non-toxic absorbing and fluorescent dyes (Toluidine Blue O, Methylene Blue) were employed to enhance tumor contrast in the images. The images were acquired using the remitted light polarized in the directions parallel and perpendicular to the polarization of incident light. Reflectance and fluorescence polarization images were evaluated. The data were processed and analyzed for dependence of the remitted light polarization on the tissue type (cancerous/normal). The data obtained so far from fresh tumor specimens in vitro using dye-enhanced polarized light reflectance, and exogenous fluorescence polarization imaging suggest that optical mapping can become a valuable guidance tool in nonmelanoma cancer surgery.

  9. Targeted Therapy in Nonmelanoma Skin Cancers

    Directory of Open Access Journals (Sweden)

    Giulia Spallone

    2011-05-01

    Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  10. Targeted Therapy in Nonmelanoma Skin Cancers

    Energy Technology Data Exchange (ETDEWEB)

    Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio, E-mail: antonio.costanzo@uniroma2.it [Department of Dermatology, University of Rome “Tor Vergata”, Via Montpellier 1, 00199, Rome (Italy)

    2011-05-03

    Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  11. YAP and TAZ regulate skin wound healing.

    Science.gov (United States)

    Lee, Min-Jung; Ran Byun, Mi; Furutani-Seiki, Makoto; Hong, Jeong-Ho; Jung, Han-Sung

    2014-02-01

    The Hippo signaling pathway regulates organ size, tissue regeneration, and stem cell self-renewal. The two key downstream transcription coactivators in this pathway, Yes-associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ), mediate the major gene regulation and biological functions of the Hippo pathway. The biological functions of YAP and TAZ in many tissues are known; however, their roles in skin wound healing remain unclear. To analyze whether YAP and/or TAZ are required for cutaneous wound healing, we performed small interfering RNA (siRNA)-mediated knockdown of YAP/TAZ in full-thickness skin wounds. YAP is strongly expressed in the nucleus and cytoplasm in the epidermis and hair follicle. Interestingly, YAP is expressed in the nucleus in the dermis at 2 and 7 days after wounding. TAZ normally localizes to the cytoplasm in the dermis but is distributed in both the nucleus and cytoplasm at 1 day after wounding. The knockdown of YAP and TAZ markedly delayed the rate of wound closure and reduced the transforming growth factor-β1 (TGF-β1) expression in the wound. YAP and TAZ also modulate the expression of TGF-β1 signaling pathway components such as Smad-2, p21, and Smad-7. These results suggest that YAP and TAZ localization to the nucleus is required for skin wound healing.

  12. Adjacent Vertex Distinguishing Incidence Coloring of the Cartesian Product of Some Graphs

    Institute of Scientific and Technical Information of China (English)

    Qian WANG; Shuang Liang TIAN

    2011-01-01

    An adjacent vertex distinguishing incidence coloring of graph G is an incidence coloring of G such that no pair of adjacent vertices meets the same set of colors. We obtain the adjacent vertex distinguishing incidence chromatic number of the Cartesian product of a path and a path, a path and a wheel, a path and a fan, and a path and a star.

  13. Wnt inhibitory factor (WIF)-1 promotes melanogenesis in normal human melanocytes.

    Science.gov (United States)

    Park, Tae Jun; Kim, Misun; Kim, Hyeran; Park, Sun Yi; Park, Kyoung-Chan; Ortonne, Jean-Paul; Kang, Hee Young

    2014-01-01

    Wnt signaling plays a role in the differentiation as well as the development of melanocytes. Using a microarray analysis, hyperpigmentary skin of melasma expressed high levels of Wnt inhibitory factor-1 (WIF-1) compared with perilesional normal skin. In this study, the expression and functional roles of WIF-1 on melanocytes were investigated. WIF-1 was expressed both in the melanocytes of normal human skin and in cultured melanocytes. The upregulation of WIF-1 on cultured normal human melanocytes significantly induced expressions of MITF and tyrosinase, which were associated with increased melanin content and tyrosinase activity. Consistent with the stimulatory effect of WIF-1, WIF-1 siRNA reduced melanogenesis in the cells. Moreover, WIF-1 increases pigmentation in melanocytes co-cultured with WIF-1-overexpressed fibroblasts and of organ-cultured human skin. These findings suggest that melanocytes express WIF-1 constitutively in vivo and in vitro and that WIF-1 promotes melanogenesis in normal human melanocytes.

  14. Skin decontamination: principles and perspectives.

    Science.gov (United States)

    Chan, Heidi P; Zhai, Hongbo; Hui, Xiaoying; Maibach, Howard I

    2013-11-01

    Skin decontamination is the primary intervention needed in chemical, biological and radiological exposures, involving immediate removal of the contaminant from the skin performed in the most efficient way. The most readily available decontamination system on a practical basis is washing with soap and water or water only. Timely use of flushing with copious amounts of water may physically remove the contaminant. However, this traditional method may not be completely effective, and contaminants left on the skin after traditional washing procedures can have toxic consequences. This article focuses on the principles and practices of skin decontamination.

  15. HOX genes in the skin

    Institute of Scientific and Technical Information of China (English)

    YANG Mei; LI Qing-feng; ZHANG Feng

    2010-01-01

    @@ Deep skin wounds heal by scar formation with a loss of its original appearance, structure and function.However, when the same damage occurs to the skin of an early gestational fetus, complete regeneration can be observed. Despite significant research in the field of skin regeneration, many mysteries remain, such as the loss of wound healing ability with maturity, the differences in healing at different parts of the body, and the presence of hypertrophic scars and keloids in some races but not in others. The finding of HOX genes in the skin provides new explanations to these conundrums.

  16. The future of skin metagenomics.

    Science.gov (United States)

    Mathieu, Alban; Vogel, Timothy M; Simonet, Pascal

    2014-01-01

    Metagenomics, the direct exploitation of environmental microbial DNA, is complementary to traditional culture-based approaches for deciphering taxonomic and functional microbial diversity in a plethora of ecosystems, including those related to the human body such as the mouth, saliva, teeth, gut or skin. DNA extracted from human skin analyzed by sequencing the PCR-amplified rrs gene has already revealed the taxonomic diversity of microbial communities colonizing the human skin ("skin microbiome"). Each individual possesses his/her own skin microbial community structure, with marked taxonomic differences between different parts of the body and temporal evolution depending on physical and chemical conditions (sweat, washing etc.). However, technical limitations due to the low bacterial density at the surface of the human skin or contamination by human DNA still has inhibited extended use of the metagenomic approach for investigating the skin microbiome at a functional level. These difficulties have been overcome in part by the new generation of sequencing platforms that now provide sequences describing the genes and functions carried out by skin bacteria. These methodological advances should help us understand the mechanisms by which these microorganisms adapt to the specific chemical composition of each skin and thereby lead to a better understanding of bacteria/human host interdependence. This knowledge will pave the way for more systemic and individualized pharmaceutical and cosmetic applications.

  17. Infrared sensing based sensitive skin

    Institute of Scientific and Technical Information of China (English)

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  18. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Directory of Open Access Journals (Sweden)

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  19. Analysis of blasting damage in adjacent mining excavations

    Directory of Open Access Journals (Sweden)

    Nick Yugo

    2015-06-01

    Full Text Available Following a small-scale wedge failure at Yukon Zinc's Wolverine Mine in Yukon, Canada, a vibration monitoring program was added to the existing rockbolt pull testing regime. The failure in the 1150 drift occurred after numerous successive blasts in an adjacent tunnel had loosened friction bolts passing through an unmapped fault. Analysis of blasting vibration revealed that support integrity is not compromised unless there is a geological structure to act as a failure plane. The peak particle velocity (PPV rarely exceeded 250 mm/s with a frequency larger than 50 Hz. As expected, blasting more competent rock resulted in higher PPVs. In such cases, reducing the round length from 3.5 m to 2.0 m was an effective means of limiting potential rock mass and support damage.

  20. Configuration optimization of dampers for adjacent buildings under seismic excitations

    Science.gov (United States)

    Bigdeli, Kasra; Hare, Warren; Tesfamariam, Solomon

    2012-12-01

    Passive coupling of adjacent structures is known to be an effective method to reduce undesirable vibrations and structural pounding effects. Past results have shown that reducing the number of dampers can considerably decrease the cost of implementation and does not significantly decrease the efficiency of the system. The main objective of this study was to find the optimal arrangement of a limited number of dampers to minimize interstorey drift. Five approaches to solving the resulting bi-level optimization problem are introduced and examined (exhaustive search, inserting dampers, inserting floors, locations of maximum relative velocity and a genetic algorithm) and the numerical efficiency of each method is examined. The results reveal that the inserting damper method is the most efficient and reliable method, particularly for tall structures. It was also found that increasing the number of dampers does not necessarily increase the efficiency of the system. In fact, increasing the number of dampers can exacerbate the dynamic response of the system.

  1. Acyclic 6-choosability of planar graphs without adjacent short cycles

    Institute of Scientific and Technical Information of China (English)

    WANG WeiFan; ZHANG Ge; CHEN Min

    2014-01-01

    A proper vertex coloring of a graph G is acyclic if G contains no bicolored cycles.Given a list assignment L={L(v)|v∈V}of G,we say that G is acyclically L-colorable if there exists a proper acyclic coloringπof G such thatπ(v)∈L(v)for all v∈V.If G is acyclically L-colorable for any list assignment L with|L(v)|k for all v∈V(G),then G is acyclically k-choosable.In this paper,we prove that every planar graph G is acyclically 6-choosable if G does not contain 4-cycles adjacent to i-cycles for each i∈{3,4,5,6}.This improves the result by Wang and Chen(2009).

  2. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Directory of Open Access Journals (Sweden)

    Mahmoud Yahyai

    2008-01-01

    Full Text Available In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance between the two buildings. Three types of soil such as soft clay, sandy gravel and compacted sandy gravel are considered for this study. The result obtained that the interaction effect increases time period of both buildings base shear and lateral displacement of the structures increases.

  3. ZOOGEOGRAPHICAL ZONING OF THE MEDITERRANEAN AND ADJACENT TERRITORIES

    Directory of Open Access Journals (Sweden)

    H. A. Ketenchiev

    2013-01-01

    Full Text Available Abstract. Aim. The article considers the zoogeographical zoning of the Mediterranean and adjacent territories with the purpose of specification of the scheme of zoogeographic zoning of land on the basis of the distribution of dragonflies.Methods. Use common methods of entomological research, mapping and analysis of the fauna.Results. On the based on our analysis of the composition and distribution of odonatofauna Mediterranean zoogeographical subregion is offered to divide into 5 provinces: Caucasian, South-European, Pyrenees, Asian and African. Analysis of the existing schemes zoning of land based on the distribution of taxa dragonflies, installed the advantages and disadvantages presented by different authors, the result of which is proposed to change the borders between the Holarctic and Subholarctic areas of the Boreal fauna Kingdom (BFK. It is connected with the fact that the dividing them into subdomains and evaluation role in the establishment of regional odonatofauna not always convincing. In this regard, the article proposed to abolish the Holarctic region sub-region: European and Mongolian-Kazakh, and in Subholarctic - add 1 sub-region of Central Asia. In a new form Subholarctic region becomes clear and logical configuration, but her name becomes inadequate, therefore, we re-name it in Paleosubtropical.The scope of the results. In fundamental research on systematics of animals, ecology and biogeography.Main conclusions. Based on the study of the composition and distribution of taxa of dragonflies in the Mediterranean and adjacent territories proposed the division of the Mediterranean subregion 5 provinces and refined scheme of zoogeographic zoning of land.

  4. DA 5505: a novel topical formulation of terbinafine that enhances skin penetration and retention.

    Science.gov (United States)

    Thapa, Raj Kumar; Han, Sang-Duk; Park, Hyoung Geun; Son, Miwon; Jun, Joon Ho; Kim, Jong Oh

    2015-01-01

    Topical fungal infections can become severe if left untreated. Efficient treatment modalities for topical fungal infections aid the penetration of antifungal agents deep into viable skin layers. Terbinafine is a fungicidal agent that inhibits ergosterol, an essential fungal component. The main objective of this study was to evaluate skin permeation and retention of a terbinafine-loaded solution containing chitosan as a film former. Comparative assessment of skin permeation and retention was performed using a prepared formulation (DA 5505) and marketed formulations of terbinafine in murine and porcine skin. To mimic fungal infection of skin, keratinized skin was induced in NC/Nga mice. In comparison with the marketed formulations, DA 5505 exhibited significantly better skin permeation. The flux, permeation coefficient, and enhancement ratio of terbinafine were remarkably increased by DA 5505 in comparison with the marketed formulations, and lag time was dramatically reduced. DA 5505 significantly increased cumulative terbinafine retention in viable skin layers in comparison with the marketed solution, suggesting enhanced efficacy. Furthermore, DA 5505 exhibited superior skin permeation in normal skin and keratinized skin. Thus, the DA 5505 formulation has the potential to effectively deliver terbinafine to superficial and deep cutaneous fungal infections.

  5. Shared values and normality

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-hua; PANG Xue-cheng

    2006-01-01

    This paper investigates the relationship between the normality and the shared values for a meromorphic function on the unit disc △.Based on Marty's normality criterion and through a detailed analysis of the meromorphic functions,it is shown that if for every f∈F,f and f(k) share a and b on △ and the zeros of f(z)-a are of multiplicity k≥3,then F is normal on △,where F is a family of meromorphic functions on the unit disc △,and a and b are distinct values.

  6. Flexible and fragmentable tandem photosensitive nanocrystal skins

    Science.gov (United States)

    Akhavan, S.; Uran, C.; Bozok, B.; Gungor, K.; Kelestemur, Y.; Lesnyak, V.; Gaponik, N.; Eychmüller, A.; Demir, H. V.

    2016-02-01

    We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion.We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of

  7. Trophic skin ulceration of leprosy: skin and serum zinc concentrations.

    Science.gov (United States)

    Oon, B B; Khong, K Y; Greaves, M W; Plummer, V M

    1974-06-08

    Skin and serum zinc measurements have been made in patients with leprosy with and without trophic skin ulceration and in several other groups. Serum zinc concentrations were decreased in leprosy irrespective of the presence or absence of skin ulceration. Serum zinc concentrations in leprosy were also unrelated to smears positive for Mycobacterium leprae and to the clinical type of leprosy. Since a decrease of the serum zinc was also found in patients with dermatitis herpetiformis and pulmonary tuberculosis it seems likely that the decreased serum zinc in leprosy is a nonspecific metabolic consequence of chronic skin and internal disease. The mean skin zinc concentration in leprosy did not differ significantly from the corresponding value in control subjects, the lack of agreement between serum and skin concentrations being possibly related to the presence of nonexchangeable keratin-bound zinc in skin. Though the clinical significance of lowered serum zinc concentrations in leprosy is uncertain therapeutic trials of zinc treatment in leprosy with trophic skin ulceration seem justifiable.

  8. Hospital celebrates skin to skin contact to raise awareness.

    Science.gov (United States)

    2013-06-01

    NEONATAL nurses at Birmingham's City Hospital have been celebrating the benefits of skin to skin contact with premature babies. They held a week of celebrations in the unit last month, in which they promoted the kangaroo care technique and breastfeeding to parents.

  9. Formation mechanism of carbonate cemented zones adjacent to the top overpressured surface in the central Junggar Basin,NW China

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Carbonate cemented zones are normally adjacent to the top overpressured surface in the central Junggar Basin,NW China.Stable carbon and oxygen isotopic compositions and petrological investigations of carbonate cements in the carbonate cemented zones indicate that:(1) carbonate cements are composed dominantly of ferrocalcite,ferroan dolomite,and ankerite;(2) carbonate cements are formed under a high temperature circumstance in the subsurface,and organic fluid migration has an important effect on the formation of them;and(3) carbon and oxygen ions in the carbonate cements migrate from the underlying overpressured system.This suggests that the occurrence of carbonate cemented zones in this region results from multiple phases of organic fluid expulsion out of the overpressure compartment through geological time.This study provides a plausible mechanism of the formation of carbonate cemented zones adjacent to the top overpressured surface in the clastic sedimentary basins,and has an important implication for understanding the internal correlation between the formation of carbonate cemented zones adjacent to top overpressured surface and geofluids expulsion out of overpressured system.

  10. Normality in analytical psychology.

    Science.gov (United States)

    Myers, Steve

    2013-12-01

    Although C.G. Jung's interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault's criticism, had Foucault chosen to review Jung's work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault's own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung's disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity.

  11. Normal pressure hydrocephalus

    Science.gov (United States)

    Hydrocephalus - occult; Hydrocephalus - idiopathic; Hydrocephalus - adult; Hydrocephalus - communicating; Dementia - hydrocephalus; NPH ... Ferri FF. Normal pressure hydrocephalus. In: Ferri FF, ed. ... Elsevier; 2016:chap 648. Rosenberg GA. Brain edema and disorders ...

  12. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  13. Monitoring the normal body

    DEFF Research Database (Denmark)

    Nissen, Nina Konstantin; Holm, Lotte; Baarts, Charlotte

    2015-01-01

    Introduction : An extensive body of literature is concerned with obese people, risk, and weight management. However, little is known about weight management among people not belonging to the extreme BMI categories. Management of weight among normal-weight and moderately overweight individuals...... provides us with knowledge about how to prevent future overweight or obesity. This paper investigates body size ideals and monitoring practices among normal-weight and moderately overweight people. Methods : The study is based on in-depth interviews combined with observations. 24 participants were...... recruited by strategic sampling based on self-reported BMI 18.5-29.9 kg/m2 and socio-demographic factors. Inductive analysis was conducted. Results : Normal-weight and moderately overweight people have clear ideals for their body size. Despite being normal weight or close to this, they construct a variety...

  14. Coronal MRI in the diagnosis of corona radiata infarcts adjacent to the lateral ventricles

    Energy Technology Data Exchange (ETDEWEB)

    Iwamoto, Toshihiko; Abe, Shin-e; Kanaya, Kiyoshi; Kubo, Hideki; Takasaki, Masaru (Tokyo Medical Coll. (Japan))

    1992-04-01

    To clarify pathophysiology of vascular lesions in corona radiata infarcts adjacent to the body of the lateral ventricle (CRILV), 17 patients with CRILV were studied by using magnetic resonance (MR) imaging. Based on the coronal MR images obtained between the anterior and posterior commissures, the patients were divided into two groups: (I) the group having infarcts below a line extending from the upper edge of the insular cistern to the external angle of the lateral ventricle adjacent to the corpus callosum (n=11); and (II) the group having lesions above the line towards the centrum semiovale (n=6). Most of the patients in both groups were male and had hypertension. Symptoms were gradually deteriorated and stroke in the morning was frequent in both groups, althrough the time from onset to completion was longer in Group II than Group I. In comparing clinical manifestations in Groups I and II, pure motor hemiparesis was found in 5 and 3 patients, and sensorimotor stroke in 2 and one patients, respectively. Drowsiness was found in 2 for Group I, while aphasia occurred in 2 for Group II. In addition, pseudobular and asymptomatic palsy occurred in each one patient for Group I. Prognosis was favorable in both groups, except for 2 who died of aspiration pneumonia. In Group I, 11 infarcts were well-defined, less than 15 mm in diameter on CT scans and were sclerotic in the main arteries without obstruction on angiograms. In contrast, Group II had ill-defined, larger low-density areas on CT scans and trunk obstruction of the internal carotid or middle cerebral arteries on angiograms. SPECT scans showed diffuse defect in Group II, in contrast to normal to diffuse or multiple defects in Group I. In Group I, lacunar lesions seemed to be caused by ischemia of the perforators, and in Group II, terminal zone infarcts in the territory of the cortical branches or watershed infarcts seemd to be caused by main trunk obstruction. (N.K.).

  15. How to Choose the Best Skin Care Products

    Science.gov (United States)

    ... Lines and Forehead Furrows Hair Loss Hyperpigmentation Melasma Sagging Skin Scars Skin Growths Skin Lesions Spider Veins ... Lines and Forehead Furrows Hair Loss Hyperpigmentation Melasma Sagging Skin Scars Skin Growths Skin Lesions Spider Veins ...

  16. Idiopathic Normal Pressure Hydrocephalus

    OpenAIRE

    2016-01-01

    Idiopathic normal pressure hydrocephalus (iNPH) is a potentially reversible neurodegenerative disease commonly characterized by a triad of dementia, gait, and urinary disturbance. Advancements in diagnosis and treatment have aided in properly identifying and improving symptoms in patients. However, a large proportion of iNPH patients remain either undiagnosed or misdiagnosed. Using PubMed search engine of keywords “normal pressure hydrocephalus,” “diagnosis,” “shunt treatment,” “biomarkers,” ...

  17. Pygmies, Giants, and Skins

    CERN Document Server

    Piekarewicz, J

    2012-01-01

    Understanding the equation of state (EOS) of neutron-rich matter is a central goal of nuclear physics that cuts across a variety of disciplines. Indeed, the limits of nuclear existence, the collision of energetic heavy ions, the structure of neutron stars, and the dynamics of core-collapse supernova all depend critically on the nuclear-matter EOS. In this contribution I focus on the EOS of cold baryonic matter with special emphasis on its impact on the structure, dynamics, and composition of neutron stars. In particular, I discuss how laboratory experiments on neutron skins as well as on Pygmy and Giant resonances can help us elucidate the structure of these fascinating objects.

  18. Spaceship with heat-isolating outer skin

    NARCIS (Netherlands)

    Van Baten, T.J.; Buursink, J.

    2002-01-01

    A spaceship provided with a skin layer and cooling member for the skin layer that comprises a liquid-holding layer provided behind the skin layer, with an empty space being present between the liquid holding layer and the skin layer, so as to prevent heat transfer due to conduction between the skin

  19. Imaging-guided two-photon excitation-emission-matrix measurements of human skin tissues

    Science.gov (United States)

    Yu, Yingqiu; Lee, Anthony M. D.; Wang, Hequn; Tang, Shuo; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

    2012-07-01

    There are increased interests on using multiphoton imaging and spectroscopy for skin tissue characterization and diagnosis. However, most studies have been done with just a few excitation wavelengths. Our objective is to perform a systematic study of the two-photon fluorescence (TPF) properties of skin fluorophores, normal skin, and diseased skin tissues. A nonlinear excitation-emission-matrix (EEM) spectroscopy system with multiphoton imaging guidance was constructed. A tunable femtosecond laser was used to vary excitation wavelengths from 730 to 920 nm for EEM data acquisition. EEM measurements were performed on excised fresh normal skin tissues, seborrheic keratosis tissue samples, and skin fluorophores including: NADH, FAD, keratin, melanin, collagen, and elastin. We found that in the stratum corneum and upper epidermis of normal skin, the cells have large sizes and the TPF originates from keratin. In the lower epidermis, cells are smaller and TPF is dominated by NADH contributions. In the dermis, TPF is dominated by elastin components. The depth resolved EEM measurements also demonstrated that keratin structure has intruded into the middle sublayers of the epidermal part of the seborrheic keratosis lesion. These results suggest that the imaging guided TPF EEM spectroscopy provides useful information for the development of multiphoton clinical devices for skin disease diagnosis.

  20. Expression of Apoptosis Related Protein in Skin Lesions of Lichen Planus and Its Implication

    Institute of Scientific and Technical Information of China (English)

    Xu'e CHEN; Yan WU; Jiawen LI; Zhixiang LIU; Qing YUE; Houjun LIU

    2008-01-01

    In order to investigate the role of Caspase-3 and Bax in the pathogenesis of lichen planus, immunohistochemistry was used to detect the expression of Caspase-3 and Bax in skin lesions of the patients with lichen planus and skin tissues of normal subjects. The results showed that positive rate of Caspase-3 and Bax expression in lichen planus were significantly higher than that in normal skins (both P<0.05). Meanwhile, there was a obvious correlation between the increase of Caspase-3 and that of Bax in lichen planus. The expression of Caspase-3 and Bax might play an important role in the development of lichen planus.

  1. A complex immune response in halo nevi correlates with immune reactivity on infiltrated melanocytes, adjacent hair follicles and blood vessels

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2014-10-01

    Full Text Available Introduction: A clinical “halo nevus” is a benign melanocytic-neoplasm, often exhibiting spontaneous involution. A characteristic clinical feature is depigmentation of the surrounding skin, and a centripetal progression of the tumor regression phenomenon. Case Report: An 18 year old male consulted the dermatologist for changes in color of an asymptomatic mole. Materials and Methods: A clinical evaluation was performed, and skin biopsies were obtained for hematoxylin and eosin (H&E review, and for immunohistochemical (IHC studies including CD3, CD4, CD8, CD20, CD68, CD99, myeloid/histiocyte antigen, S-100, PNL2 and SOX-10. Results: A neoplastic process was identified on H&E examination, located along the dermal/epidermal junction and within the dermis. The neoplasm was composed of nests, cords and strands of benign melanocytes, with infiltrating lymphocytes. IHC staining demonstrated a strong pattern of positivity with all of the IHC antibodies within, infiltrating and surrounding the primary neoplastic process. In addition, evidence of the primary tumor immune response was noted around surrounding blood vessels and hair follicles, and on adjacent epidermal melanocytes. Conclusions: In the present study, we demonstrate by histopathologic and immunologic evidence that lymphocytes are primarily responsible for halo nevus tumor regression. Moreover, the immune response involves not only CD8 positive T lymphocytes, but a larger spectrum of B and T lineage lymphocytes. Thus, the immunologic foundations of halo nevus regression are likely of greater complexity than previously determined..

  2. Gene Expression Profiling in Dermatitis Herpetiformis Skin Lesions

    Directory of Open Access Journals (Sweden)

    M. Dolcino

    2012-01-01

    Full Text Available Dermatitis herpetiformis (DH is an autoimmune blistering skin disease associated with gluten-sensitive enteropathy (CD. In order to investigate the pathogenesis of skin lesions at molecular level, we analysed the gene expression profiles in skin biopsies from 6 CD patients with DH and 6 healthy controls using Affymetrix HG-U133A 2.0 arrays. 486 genes were differentially expressed in DH skin compared to normal skin: 225 were upregulated and 261 were downregulated. Consistently with the autoimmune origin of DH, functional classification of the differentially expressed genes (DEGs indicates a B- and T-cell immune response (LAG3, TRAF5, DPP4, and NT5E. In addition, gene modulation provides evidence for a local inflammatory response (IL8, PTGFR, FSTL1, IFI16, BDKRD2, and NAMPT with concomitant leukocyte recruitment (CCL5, ENPP2, endothelial cell activation, and neutrophil extravasation (SELL, SELE. DEGs also indicate overproduction of matrix proteases (MMP9, ADAM9, and ADAM19 and proteolytic enzymes (CTSG, ELA2, CPA3, TPSB2, and CMA1 that may contribute to epidermal splitting and blister formation. Finally, we observed modulation of genes involved in cell growth inhibition (CGREF1, PA2G4, and PPP2R1B, increased apoptosis (FAS, TNFSF10, and BASP1, and reduced adhesion at the dermal epidermal junction (PLEC1, ITGB4, and LAMA5. In conclusion, our results identify genes that are involved in the pathogenesis of DH skin lesions.

  3. Skin models for the testing of transdermal drugs

    Science.gov (United States)

    Abd, Eman; Yousef, Shereen A; Pastore, Michael N; Telaprolu, Krishna; Mohammed, Yousuf H; Namjoshi, Sarika; Grice, Jeffrey E; Roberts, Michael S

    2016-01-01

    The assessment of percutaneous permeation of molecules is a key step in the evaluation of dermal or transdermal delivery systems. If the drugs are intended for delivery to humans, the most appropriate setting in which to do the assessment is the in vivo human. However, this may not be possible for ethical, practical, or economic reasons, particularly in the early phases of development. It is thus necessary to find alternative methods using accessible and reproducible surrogates for in vivo human skin. A range of models has been developed, including ex vivo human skin, usually obtained from cadavers or plastic surgery patients, ex vivo animal skin, and artificial or reconstructed skin models. Increasingly, largely driven by regulatory authorities and industry, there is a focus on developing standardized techniques and protocols. With this comes the need to demonstrate that the surrogate models produce results that correlate with those from in vivo human studies and that they can be used to show bioequivalence of different topical products. This review discusses the alternative skin models that have been developed as surrogates for normal and diseased skin and examines the concepts of using model systems for in vitro–in vivo correlation and the demonstration of bioequivalence. PMID:27799831

  4. State of hydration and electrical conductance of ichthyotic skin

    Directory of Open Access Journals (Sweden)

    Gupta A

    1990-01-01

    Full Text Available Dry skin of twelve subjects suffering from ichthyosis vulgaris and the efficacy of a moisturiser-Cotaryl were quantitatively assessed by measuring the skin surface hydration and high frequency (3.5 MHz electrical conductance of skin. The state of hydration and conductance of ichthyotic skin were 86.9 + 24.6 and 11.0 + 5.7 micro-mho respectively, being much less-compared to 132. 0 + 5.3 and 72.5 + 54.0 micro-mho ofnormal subjects. The moisturiser increased the state of hydration and also the electrical conductance of the stratum corneuni to near-normal values and maintained them as long as the application continued. However, both the hydration and the conductance fell sharply within a week of withrawal of the moisturiser. A moisturiser was thus undoubtedly efficacious in ichthyotic skin, but the effect was only temporary. The state of hydration was found, at all stages, to bear a strong positive correlation (r = 0.69 to 0.80 with the skin conductance.

  5. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Directory of Open Access Journals (Sweden)

    Olivia Pucci

    Full Text Available Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen or skin normoxia (with air. The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor.

  6. Pain-induced skin autoimmunity

    OpenAIRE

    Odoardi, Francesca; Neuhuber, Winfried; Flügel, Alexander

    2014-01-01

    A recent paper published in Nature reports sensory nerve fibers in the skin that give local immune cells important instructions for the organization of an immune response; in this particular case the cooperation between the nervous and immune systems had disastrous consequences, namely an auto-destruction of the skin.

  7. Hereditary skin diseases of hemidesmosomes

    NARCIS (Netherlands)

    Jonkman, MF

    1999-01-01

    Studies of hereditary blistering skin diseases (epidermolysis bullosa) and targeted gene mutation experiments in knockout mice have greatly improved our understanding of hemidesmosomes and their associated structures in the cytoskeleton and basement membrane of the skin and mucous membranes. At leas

  8. Successful closure of feline axillary wounds by reconstruction of the elbow skin fold.

    Science.gov (United States)

    Brinkley, C H

    2007-02-01

    This report describes the successful closure of five chronic feline axillary wounds. The aetiology was known to be forelimb entrapment in a neck collar in three cases and was suspected in the others. Each cat underwent a single surgical procedure during which the wound was debrided, the normal structure of the elbow skin fold was restored and the remaining skin defect was closed primarily. None of the cats had undergone any previous reconstruction attempts. No postoperative complications were observed and the wounds healed uneventfully. Cats have well-developed elbow skin folds, allowing a wide range of limb motion to occur. Having a forelimb trapped in a neck collar not only creates a wound in the axilla but also disrupts the normal anatomy of the skin fold. This report demonstrates that restoring the elbow skin fold before closing the wound may improve the chances of a successful reconstruction at the first surgical intervention.

  9. The Ventricular System of the Brain: Anatomy and Normal Variations.

    Science.gov (United States)

    Stratchko, Lindsay; Filatova, Irina; Agarwal, Amit; Kanekar, Sangam

    2016-04-01

    The cerebral ventricular system is intimately associated with the forebrain and brainstem. The ventricular system functions to produce and circulate cerebrospinal fluid, which plays an important role in mechanical protection and regulation of homeostasis in the central nervous system. This article discusses anatomy and neuroimaging of the ventricular system and highlights normal anatomical variations that may be mistaken for pathology. Applied surgical anatomy is reviewed with emphasis on operative approach and potential risk to adjacent central nervous system structures.

  10. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    DEFF Research Database (Denmark)

    Pedersen, C; Horn, T; Junge, Jette;

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... with AIDS related conditions. Biopsies from 5 asymptomatic HIV positive patients and the 6 control subjects were without ultrastructural alterations. The occurrence of TRI was related to low numbers of CD 4+ lymphocytes. 5/7 patients with TRI had elevated serum interferon activity, and in all...

  11. Collagen Content in Skin and Internal Organs of the Tight Skin Mouse: An Animal Model of Scleroderma

    Directory of Open Access Journals (Sweden)

    Jayanthi Manne

    2013-01-01

    Full Text Available The Tight Skin mouse is a genetically induced animal model of tissue fibrosis caused by a large in-frame mutation in the gene encoding fibrillin-1 (Fbn-1. We examined the influence of gender on the collagen content of tissues in C57BL/6J wild type (+/+ and mutant Tight Skin (Tsk/+ mice employing hydroxyproline assays. Tissue sections were stained with Masson’s trichrome to identify collagen in situ. Adult Tsk/+ mice skin contains ~15% more collagen, on average, than skin from +/+ mice of the same gender. The heart of Tsk/+ males had significantly more collagen than that of +/+ males. No significant gender differences were found in lungs and kidney collagen content. Overall, the collagen content of Tsk/+ males and +/+ males was higher than that of their Tsk/+ and +/+ female counterparts, respectively. Our data confirm increased deposition of collagen in skin and hearts of Tsk/+ mice; however, the effects of the Tsk mutation on collagen content are both tissue specific and gender specific. These results indicate that comparative studies of collagen content between normal and Tsk/+ mice skin and internal organs must take into account gender differences caused by expression of the androgen receptor.

  12. A study of skin diseases in dogs and cats. III. III. Microflora of the skin of dogs with chronic eczema.

    Science.gov (United States)

    Kristensen, S; Krogh, H V

    1978-01-01

    The microflora of the skin was studied in 10 dogs with chronic eczema without clinical signs of secondary infection (Table I). The skin surface was swabbed at 7 different sites, making a total of 70 swabs, 25 of which were taken from visibly inflamed areas and 45 from apparently unaffected skin (Table II). Staph. aureus, Staph. epidermidis, micrococci, alpha-hemolytic streptococci, and Acinetobacter spp. were found consistently. Ten different Gram-negative bacteria, 3 different Gram-positive bacteria, and 2 yeasts were found to occur sporadically (Table III). Compared to a group of 10 healthy dogs a more prolific growth of aerobic microorganisms, a greater number of sites carrying Staph. aureus, and a higher recovery of Gram-negative transients were found in dogs with eczema (Table IV--VII). Within the group of dogs with eczema the growth of Staph. aureus was significantly heavier from eczematous skin areas than from clinically normal skin (Table VIII). In dogs with non-infective dermatitides the colonization of the skin by potentially pathogenic microorganisms may have to be considered in the clinical handling of these diseases.

  13. Basal level of autophagy is increased in aging human skin fibroblasts in vitro, but not in old skin.

    Science.gov (United States)

    Demirovic, Dino; Nizard, Carine; Rattan, Suresh I S

    2015-01-01

    Intracellular autophagy (AP) is a stress response that is enhanced under conditions of limitation of amino acids, growth factors and other nutrients, and also when macromolecules become damaged, aggregated and fibrillated. Aging is generally accompanied by an increase in intracellular stress due to all the above factors. Therefore, we have compared the basal levels of AP in serially passaged human facial skin fibroblasts undergoing aging and replicative senescence in vitro, and ex vivo in the skin biopsies from the photo-protected and photo-exposed area of the arms of 20 healthy persons of young and old ages. Immunofluorescence microscopy, employing antibodies against a specific intracellular microtubule-associated protein-1 light chain-3 (LC3) as a well established marker of AP, showed a 5-fold increase in the basal level of LC3 in near senescent human skin fibroblasts. However, no such age-related increase in LC3 fluorescence and AP could be detected in full thickness skin sections from the biopsies obtained from 10 healthy young (age 25 to 30 yr) and 10 old (age 60 to 65 yr) donors. Furthermore, there was no difference in the basal level of LC3 in the skin sections from photo-protected and photo-exposed areas of the arm. Thus, in normal conditions, the aging phenotype of the skin cells in culture and in the body appears to be different in the case of AP.

  14. Expanded retroauricular skin and fascial flap in congenital microtia reconstruction.

    Science.gov (United States)

    Zhang, Qingguo; Quan, Yuzhu; Su, Yuanda; Shi, Lei; Xie, Yangchun; Liu, Xinhai

    2010-04-01

    The aim of this article is to report the application of expanding retroauricular skin fascia flap, and autogenous costal cartilage for congenital microtia reconstruction. Microtia reconstruction was generally completed in 3 surgical stages. In the first surgical stage, a 50 or 80 mL kidney-shaped tissue expander was inserted subcutaneously in the retroauricular mastoid region. Inflation of saline volume increased up to 60 to 80 mL, and skin flap was expanded for 2 to 3 months postoperatively. In the second surgical stage, removal of tissue expander, formation of retroauricular skin flap, elevation of retroauricular fascia flap, and pedicles of both flaps in remnant ear side were performed. Costal cartilage was harvested from ipsilateral side chest to the ear for reconstruction. The 3D ear framework was sculpted with stabilization of structure, contour and erection. Simultaneously, intermediate full thickness skin graft of 4 x 8 cm was obtained from previous incision site from where costal cartilage was harvested. Cartilage ear framework was anchored between skin flap and fascia flap, and fixed it symmetrically to the opposite normal ear, inferior portion of the ear framework was wrapped by remnant ear lobule, expanded skin flap covered the anterior portion of the framework, fascial flap was draped to the posterior side of framework and helical rim, then fascial flap was surfaced by intermediate full thickness skin graft. Suction drain was inserted and coated between skin flap and framework, drain was removed fifth postoperative day. Tragus construction and conchal excavation with skin graft was performed in the third stage of microtia reconstruction. Between October 2000 and October 2007, 426 cases were diagnosed as unilateral microtia patients and 22 cases were bilateral microtia patients. Therefore, 448 microtia ears were treated with tissue expander and autogenous costal cartilage. In 262 cases, structure of the helix, tragus, conchal excavation

  15. Dosimetry for Total Skin Electron Beam Therapy in Skin Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Sung Sil; Loh, John J. K.; Kim, Gwi Eon [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1992-06-15

    Increasing frequency of skin cancer, mycosis fungoides, Kaposi sarcoma etc, it need to treatment dose planning for total skin electron beam (TSEB) therapy. Appropriate treatment planning for TSEB therapy is needed to give homogeneous dose distribution throughout the entire skin surface. The energy of 6 MeV electron from the 18 MeV medical linear accelerator was adapted for superficial total skin electron beam therapy. The energy of the electron beam was reduced to 4.2 MeV by a 0.5cmx90cmx180cm acryl screen placed in a feet front of the patient. Six dual field beam was adapted for total skin irradiation to encompass the entire body surface from head to toe simultaneously. The patients were treated behind the acryl screen plate acted as a beam scatterer and contained a parallel-plate shallow ion chamber for dosimetry and beam monitoring. During treatment, the patient was placed in six different positions due to be homogeneous dose distribution for whole skin around the body. One treatment session delivered 400 cGy to the entire skin surface and patients were treated twice a week for eight consecutive weeks, which is equivalent to TDF value 57. Instrumentation and techniques developed in determining the depth dose, dose distribution and bremsstrahlung dose are discussed.

  16. Skin protection in the prevention of skin diseases.

    Science.gov (United States)

    Elsner, Peter

    2007-01-01

    Occupational skin diseases comprise a wide spectrum of conditions. Under epidemiological aspects, occupational contact dermatitis that is usually manifested on the hands is the most frequent occupational skin disease with an estimated average incidence rate of 0.7-1.5 cases per 1,000 workers per year. Irritant dermatitis is due to individual susceptibility and the exposure to irritants such as wet work combined with detergents or other hydrophilic irritants or solvents at the workplace. Chronic irritant dermatitis is a risk factor for delayed-type sensitization and subsequently allergic contact dermatitis. It is therefore the prevention of chronic or cumulative irritant dermatitis that is the decisive factor in the prevention of occupational skin disease. Within prevention programs at the workplace, skin protection plays an important, but limited role. Others are technical and organizational means to avoid or reduce skin exposure to irritants and allergens. Educational measures to increase the awareness of workers for workplace hazards and to motivate them to use skin protection measures appropriately are just as important as the careful selection of skin protection materials.

  17. Periostin in Skin Tissue Skin-Related Diseases

    Directory of Open Access Journals (Sweden)

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.

  18. Skin models for the testing of transdermal drugs

    Directory of Open Access Journals (Sweden)

    Abd E

    2016-10-01

    Full Text Available Eman Abd,1 Shereen A Yousef,1 Michael N Pastore,2 Krishna Telaprolu,1 Yousuf H Mohammed,1 Sarika Namjoshi,1 Jeffrey E Grice,1 Michael S Roberts1,2 1Translational Research Institute, School of Medicine, University of Queensland, Brisbane, 2School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, Australia Abstract: The assessment of percutaneous permeation of molecules is a key step in the evaluation of dermal or transdermal delivery systems. If the drugs are intended for delivery to humans, the most appropriate setting in which to do the assessment is the in vivo human. However, this may not be possible for ethical, practical, or economic reasons, particularly in the early phases of development. It is thus necessary to find alternative methods using accessible and reproducible surrogates for in vivo human skin. A range of models has been developed, including ex vivo human skin, usually obtained from cadavers or plastic surgery patients, ex vivo animal skin, and artificial or reconstructed skin models. Increasingly, largely driven by regulatory authorities and industry, there is a focus on developing standardized techniques and protocols. With this comes the need to demonstrate that the surrogate models produce results that correlate with those from in vivo human studies and that they can be used to show bioequivalence of different topical products. This review discusses the alternative skin models that have been developed as surrogates for normal and diseased skin and examines the concepts of using model systems for in vitro–in vivo correlation and the demonstration of bioequivalence. Keywords: percutaneous permeation, dermal delivery, transdermal, bioequivalence, ex vivo skin models, reconstructed skin

  19. Effect of a moisturizer on skin susceptibility to NiCl2

    DEFF Research Database (Denmark)

    Zachariae, Claus; Held, Elisabeth; Johansen, Jeanne Duus

    2003-01-01

    The aim of this study was to evaluate whether a moisturizer used on normal skin can increase skin response to allergens. Twelve nickel-allergic volunteers applied a lipid-rich moisturizer on the upper arm 3 times daily for 7 days, while the other upper arm served as a control. A control group...... followed the same treatment protocol. Following treatment with moisturizer, patch tests with 1% NiCl2 aqueous solution were applied on each upper arm. After 24 and 72 h, skin reactions were evaluated blinded by clinical scoring, and by bioengineering methods measuring transepidermal water loss, skin colour...... and skin thickness. In the nickel-allergic group the strength of patch-test reactions was increased on the moisturizer-treated arm as evaluated by clinical scoring after 24 h and by measurement of transepidermal water loss and skin thickness after 72 h. In the control group, no significant differences were...

  20. High correlation of double Debye model parameters in skin cancer detection.

    Science.gov (United States)

    Truong, Bao C Q; Tuan, H D; Fitzgerald, Anthony J; Wallace, Vincent P; Nguyen, H T

    2014-01-01

    The double Debye model can be used to capture the dielectric response of human skin in terahertz regime due to high water content in the tissue. The increased water proportion is widely considered as a biomarker of carcinogenesis, which gives rise of using this model in skin cancer detection. Therefore, the goal of this paper is to provide a specific analysis of the double Debye parameters in terms of non-melanoma skin cancer classification. Pearson correlation is applied to investigate the sensitivity of these parameters and their combinations to the variation in tumor percentage of skin samples. The most sensitive parameters are then assessed by using the receiver operating characteristic (ROC) plot to confirm their potential of classifying tumor from normal skin. Our positive outcomes support further steps to clinical application of terahertz imaging in skin cancer delineation.

  1. Ratios of Normal Variables

    Directory of Open Access Journals (Sweden)

    George Marsaglia

    2006-05-01

    Full Text Available This article extends and amplifies on results from a paper of over forty years ago. It provides software for evaluating the density and distribution functions of the ratio z/w for any two jointly normal variates z,w, and provides details on methods for transforming a general ratio z/w into a standard form, (a+x/(b+y , with x and y independent standard normal and a, b non-negative constants. It discusses handling general ratios when, in theory, none of the moments exist yet practical considerations suggest there should be approximations whose adequacy can be verified by means of the included software. These approximations show that many of the ratios of normal variates encountered in practice can themselves be taken as normally distributed. A practical rule is developed: If a < 2.256 and 4 < b then the ratio (a+x/(b+y is itself approximately normally distributed with mean μ = a/(1.01b − .2713 and variance 2 = (a2 + 1/(b2 + .108b − 3.795 − μ2.

  2. Ratios of Normal Variables

    Directory of Open Access Journals (Sweden)

    George Marsaglia

    2006-05-01

    Full Text Available This article extends and amplifies on results from a paper of over forty years ago. It provides software for evaluating the density and distribution functions of the ratio z/w for any two jointly normal variates z,w, and provides details on methods for transforming a general ratio z/w into a standard form, (a+x/(b+y , with x and y independent standard normal and a, b non-negative constants. It discusses handling general ratios when, in theory, none of the moments exist yet practical considerations suggest there should be approximations whose adequacy can be verified by means of the included software. These approximations show that many of the ratios of normal variates encountered in practice can themselves be taken as normally distributed. A practical rule is developed: If a < 2.256 and 4 < b then the ratio (a+x/(b+y is itself approximately normally distributed with mean μ = a/(1.01b - .2713 and variance σ2 = (a2 + 1/(b2 + .108b - 3.795 μ2.

  3. Differentiated Adipose-derived Stem Cells Promote Reinnervation of Rat Skin Flaps

    Directory of Open Access Journals (Sweden)

    Koichi Tomita, MD, PhD

    2013-06-01

    Conclusions: dASCs could improve flap reinnervation by 2 mechanisms: First, neurotrophic factors produced by dASCs facilitated regrowth of cutaneous axons from the surroundings of flap. Second, nerve growth factor released by dASCs induced the collateral sprouting of undamaged axons in adjacent tissues. In addition to the use of innervated flaps, dASC transplantation therapy could be a new approach to improve the sensory recovery of skin flaps.

  4. A new Eriosema (Leguminosae Papilionoideae) from Gabon and adjacent Congo.

    NARCIS (Netherlands)

    Maesen, van der L.J.G.; Walters, G.M.

    2011-01-01

    Background – On-going botanical research in Gabon continues to yield species new to science, in this case a new member of the leguminous genus Eriosema. Material and methods – Normal practices of herbarium taxonomy have been applied; material is present in LBV, MO, and WAG. Key results – A new speci

  5. Skin Exposures & Effects in the Workplace

    Science.gov (United States)

    ... Topics Publications and Products Programs Contact NIOSH NIOSH SKIN EXPOSURES & EFFECTS Recommend on Facebook Tweet Share Compartir ... currently lacking for measuring and assessing skin exposures. Skin Notation (SK) Profiles NIOSH has developed a strategy ...

  6. Stereotactic radiotherapy using Novalis for craniopharyngioma adjacent to optic pathways.

    Science.gov (United States)

    Hashizume, Chisa; Mori, Yoshimasa; Kobayashi, Tatsuya; Shibamoto, Yuta; Nagai, Aiko; Hayashi, Naoki

    2010-06-01

    Craniopharyngioma has benign histological character. However, because of proximity to optic pathways, pituitary gland, and hypothalamus, it may cause severe and permanent damage to such critical structures and can even be life threatening. Total surgical resection is often difficult. This study aims to evaluate treatment results of Novalis stereotactic radiotherapy (SRT) for craniopharyngioma adjacent to optic pathways. Ten patients (six men, four women) with craniopharyngioma and median age of 56.5 years (range 10-74 years) were treated by SRT using Novalis from July 2006 through March 2009. Median volume of tumor was 7.9 ml (range 1.1-21 ml). Three-dimensional noncoplanar five- or seven-beam SRT or coplanar five-beam SRT with intensity modulation was performed. Total dose of 30-39 Gy in 10-15 fractions (median 33 Gy) was delivered to the target. Ten patients were followed up for 9-36 months (median 25.5 months). Response rate was 80% (8/10), and control rate was 100%. Improvement of neurological symptoms was observed in five patients. No serious complications due to SRT were found. SRT for craniopharyngioma may be a safe and effective treatment. Longer follow-up is necessary to determine long-term tumor control or late complications.

  7. The Current Tectonics of the Yukon and Adjacent Area

    Science.gov (United States)

    Hyndman, R. D.; Leonard, L. J.

    2014-12-01

    The current tectonics across the Yukon and adjacent areas of western Northwest Territories (NWT) and northern British Columbia appear to be driven primarily by the Yakutat Terrane collision, an "indenter" in the corner of the Gulf of Alaska. GPS data show 1-10 mm/yr northward and eastward, decreasing inland. The rates from earthquake statistics are similar although there are important discrepancies. The eastern Cordillera earthquake mechanisms are mainly thrust in the Mackenzie Mountains of southwestern NWT where the Cordillera upper crust is overthrusting the craton. To the north, the mechanisms are mainly strike-slip in the Richardson Mountains that appear to lie along the edge of the craton. The deformation appears to be limited to the hot and weak Cordillera with the strong craton providing an irregular eastern boundary. For example, there is an eastward bow in the craton edge and the deformation in the Mackenzie Mountains. On the Beaufort Sea margin in the region of the Mackenzie Delta there appears to be a type of "subduction zone" with the continent very slowly overthrusting the oceanic plate, a process that has continued since at least the Cretaceous. A northward moving continental margin block is bounded by left lateral faulting in the west (Canning Displacement Zone of eastern Alaska) and right lateral faulting in the east (Richardson Mountains in eastern Yukon). There is almost no seismicity on this thrust belt but as for some other subduction zones such as Cascadia there is the potential for very infrequent great earthquakes.

  8. Seismic motion attenuation relations in Sichuan and adjacent areas

    Institute of Scientific and Technical Information of China (English)

    LEI Jian-cheng; GAO Meng-tan; YU Yan-xiang

    2007-01-01

    The Sichuan and adjacent areas is divided into southwest China region (SWCR) and Sichuan Basin region (SCBR) according to tectonic backgrounds and seismic damage distribution features. 96 modern destructive earthquakes in SWCR and 40 in SCBR are gathered respectively. All their magnitude parameters are checked. Based on the statistic relations between epicentral intensity and magnitude as well as relation between sensible radius and magnitude, the near and far field seismic intensity attenuation features are represented and controlled. And then the seismic intensity attenuation relations along major axis, minor axis and mean axis are established separately. The systematic deviations of surface wave magnitude between China seismograph network and U.S. seismograph network are considered in this paper. By making use of the new attenuation relations of bedrock horizontal ground acceleration response spectrum in west U.S., the attenuation relations of bedrock horizontal ground acceleration response spectrum in SWCR and SCBR are digital transformed based on the attenuation model considering acceleration saturation of distance and magnitude in near field.

  9. Repeated adjacent-segment degeneration after posterior lumbar interbody fusion.

    Science.gov (United States)

    Okuda, Shinya; Oda, Takenori; Yamasaki, Ryoji; Maeno, Takafumi; Iwasaki, Motoki

    2014-05-01

    One of the most important sequelae affecting long-term results is adjacent-segment degeneration (ASD) after posterior lumbar interbody fusion (PLIF). Although several reports have described the incidence rate, there have been no reports of repeated ASD. The purpose of this report was to describe 1 case of repeated ASD after PLIF. A 62-year-old woman with L-4 degenerative spondylolisthesis underwent PLIF at L4-5. At the second operation, L3-4 PLIF was performed for L-3 degenerative spondylolisthesis 6 years after the primary operation. At the third operation, L2-3 PLIF was performed for L-2 degenerative spondylolisthesis 1.5 years after the primary operation. Vertebral collapse of L-1 was detected 1 year after the third operation, and the collapse had progressed. At the fourth operation, 3 years after the third operation, vertebral column resection of L-1 and replacement of titanium mesh cages with pedicle screw fixation between T-4 and L-5 was performed. Although the patient's symptoms resolved after each operation, the time between surgeries shortened. The sacral slope decreased gradually although each PLIF achieved local lordosis at the fused segment.

  10. Hydrocarbon provinces and productive trends in Libya and adjacent areas

    Energy Technology Data Exchange (ETDEWEB)

    Missallati, A.A. (Agip (N.A.M.E.)Ltd., Tripoli (Libya))

    1988-08-01

    According to the age of major reservoirs, hydrocarbon occurrences in Libya and adjacent areas can be grouped into six major systems which, according to their geographic locations, can be classified into two major hydrocarbon provinces: (1) Sirte-Pelagian basins province, with major reservoirs ranging from middle-late Mesozoic to early Tertiary, and (2) Murzog-Ghadames basins province, with major reservoirs ranging from early Paleozoic to early Mesozoic. In the Sirte-Pelagian basins province, hydrocarbons have been trapped in structural highs or in stratigraphic wedge-out against structural highs and in carbonate buildups. Here, hydrocarbon generation is characterized by the combined effect of abundant structural relief and reservoir development in the same hydrocarbon systems of the same age, providing an excellent example of hydrocarbon traps in sedimentary basins that have undergone extensive tensional fracturing in a shallow marine environment. In the Murzog-Ghadames basins province, hydrocarbons have been trapped mainly in structural highs controlled by paleostructural trends as basement arches which acted as focal points for oil migration and accumulation.

  11. Adjacent level spondylodiscitis after anterior cervical decompression and fusion

    Directory of Open Access Journals (Sweden)

    Saumyajit Basu

    2012-01-01

    Full Text Available Postoperative spondylodiscitis after anterior cervical decompression and fusion (ACDF is rare, but the same occurring at adjacent levels without disturbing the operated level is very rare. We report a case, with 5 year followup, who underwent ACDF from C5 to C7 for cervical spondylotic myelopathy. He showed neurological improvement after surgery but developed discharging sinus after 2 weeks, which healed with antibiotics. He improved on his preoperative symptoms well for the first 2 months. He started developing progressive neck pain and myelopathy after 3 months and investigations revealed spondylodiscitis at C3 and C4 with erosion, collapse, and kyphosis, without any evidence of implant failure or graft rejection at the operated level. He underwent reexploration and implant removal at the operated level (there was good fusion from C5 to C7 followed by debridement/decompression at C3, C4 along with iliac crest bone grafting and stabilization with plate and screws after maximum correction of kyphosis. The biopsy specimen grew Pseudomonas aeruginosa and appropriate sensitive antibiotics (gentamycin and ciprofloxacin were given for 6 weeks. He was under regular followup for 5 years his myelopathy resolved completely and he is back to work. Complete decompression of the cord and fusion from C2 to C7 was demonstrable on postoperative imaging studies without any evidence of implant loosening or C1/C2 instability at the last followup.

  12. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer

    Directory of Open Access Journals (Sweden)

    David A. Quigley

    2016-07-01

    Full Text Available Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways. Gene networks related to specific cell types and signaling pathways, including sonic hedgehog (Shh, Wnt, Lgr family stem cell markers, and keratins, differed at these tissue sites, suggesting mechanisms for the differential susceptibility of dorsal and tail skin to development of skin diseases and tumorigenesis. The Pten tumor suppressor gene network is rewired in premalignant tumors compared to normal tissue, but this response to perturbation is lost during malignant progression. We present a software package for expression quantitative trait loci (eQTL network analysis and demonstrate how network analysis of whole tissues provides insights into interactions between cell compartments and signaling molecules.

  13. Normalized Information Distance

    CERN Document Server

    Vitanyi, Paul M B; Cilibrasi, Rudi L; Li, Ming

    2008-01-01

    The normalized information distance is a universal distance measure for objects of all kinds. It is based on Kolmogorov complexity and thus uncomputable, but there are ways to utilize it. First, compression algorithms can be used to approximate the Kolmogorov complexity if the objects have a string representation. Second, for names and abstract concepts, page count statistics from the World Wide Web can be used. These practical realizations of the normalized information distance can then be applied to machine learning tasks, expecially clustering, to perform feature-free and parameter-free data mining. This chapter discusses the theoretical foundations of the normalized information distance and both practical realizations. It presents numerous examples of successful real-world applications based on these distance measures, ranging from bioinformatics to music clustering to machine translation.

  14. Normalization of satellite imagery

    Science.gov (United States)

    Kim, Hongsuk H.; Elman, Gregory C.

    1990-01-01

    Sets of Thematic Mapper (TM) imagery taken over the Washington, DC metropolitan area during the months of November, March and May were converted into a form of ground reflectance imagery. This conversion was accomplished by adjusting the incident sunlight and view angles and by applying a pixel-by-pixel correction for atmospheric effects. Seasonal color changes of the area can be better observed when such normalization is applied to space imagery taken in time series. In normalized imagery, the grey scale depicts variations in surface reflectance and tonal signature of multi-band color imagery can be directly interpreted for quantitative information of the target.

  15. Mechanisms of carcinogenesis in human skin against the background of papillomavirus infection.

    Science.gov (United States)

    Reva, I V; Reva, G V; Yamamoto, T; Tolmachyov, V E

    2014-09-01

    The cells in the skin tumor developing under conditions of persisting papillomavirus infection are morphologically identical to blast cells in a blood smear from a leukemia patient. The cells filling the lesion focus are morphologically and immunohistochemically related to blood stem cells. A mechanism of epithelial layer modification under conditions of papillomavirus infection leading to carcinogenesis is proposed. The dynamics of structural changes in the skin is characterized by disturbed interactions between the epithelium and adjacent connective tissue, destruction of the basal membrane, disorders in the cambial keratinocyte differentiation, and absence of the spinous and granular layers. We conclude that detection of blast leukocytes in the human skin lesion can be explained by disorders in the cell-cell interactions in the epithelium-mesenchymal tissue system. High proliferative activity followed by death of cambial keratinocytes, migration of effector antigen-presenting CD68 cells to the adjacent connective tissue are the factors inducing migration of blast leukocytic forms to the focus. Not only keratinocyte restitution capacity, but also epithelium-dependent differentiation of young leukocytes disappeared. Undifferentiated cells are migrated from the blood to the epithelium alteration zone, but not in the reverse direction. The insufficiency or the absence of blood blast cell differentiation of the in the focus of epidermal injury and adjacent tissue triggers carcinogenesis. The authors suggest their model of carcinogenesis. The conclusions offer a new concept of cancer pathogenesis and suggest a new strategy in the search for methods for early diagnosis of carcinogenesis.

  16. Quantitative skin color measurements in acanthosis nigricans patients: colorimetry and diffuse reflectance spectroscopy.

    Science.gov (United States)

    Pattamadilok, Bensachee; Devpura, Suneetha; Syed, Zain U; Agbai, Oma N; Vemulapalli, Pranita; Henderson, Marsha; Rehse, Steven J; Mahmoud, Bassel H; Lim, Henry W; Naik, Ratna; Hamzavi, Iltefat H

    2012-08-01

    Tristimulus colorimetry and diffuse reflectance spectroscopy (DRS) are white-light skin reflectance techniques used to measure the intensity of skin pigmentation. The tristimulus colorimeter is an instrument that measures a perceived color and the DRS instrument measures biological chromophores of the skin, including oxy- and deoxyhemoglobin, melanin and scattering. Data gathered from these tools can be used to understand morphological changes induced in skin chromophores due to conditions of the skin or their treatments. The purpose of this study was to evaluate the use of these two instruments in color measurements of acanthosis nigricans (AN) lesions. Eight patients with hyperinsulinemia and clinically diagnosable AN were seen monthly. Skin pigmentation was measured at three sites: the inner forearm, the medial aspect of the posterior neck, and anterior neck unaffected by AN. Of the three, measured tristimulus L*a*b* color parameters, the luminosity parameter L* was found to most reliably distinguish lesion from normally pigmented skin. The DRS instrument was able to characterize a lesion on the basis of the calculated melanin concentration, though melanin is a weak indicator of skin change and not a reliable measure to be used independently. Calculated oxyhemoglobin and deoxyhemoglobin concentrations were not found to be reliable indicators of AN. Tristimulus colorimetry may provide reliable methods for respectively quantifying and characterizing the objective color change in AN, while DRS may be useful in characterizing changes in skin melanin content associated with this skin condition.

  17. Age-related skin changes

    Directory of Open Access Journals (Sweden)

    Božanić Snežana

    2012-01-01

    Full Text Available Age-related skin changes can be induced by chronological ageing, manifested in subcutaneous fat reduction, and photo-ageing eliciting increased elastotic substance in the upper dermis, destruction of its fibrilar structure, augmented intercellular substance and moderate inflammatory infiltrate. Forty-five biopsy skin samples of the sun-exposed and sun-protected skin were analyzed. The patients were both males and females, aged from 17 to 81 years. The thickness of the epidermal layers and the number of cellular living layers is greater in younger skin. The amount of keratohyaline granules is enlarged in older skin. Dermoepidermal junction is flattened and the presence of elastotic material in the dermis is pronounced with age. The amount of inflammatory infiltrate is increased, the fibrous trabeculae are thickened in older skin and the atrophy of the hypodermis is observed. Chronological ageing alters the fibroblasts metabolism by reducing their life span, capacity to divide and produce collagen. During ageing, the enlargement of collagen fibrils diminishes the skin elasticity.

  18. Biothermomechanical behavior of skin tissue

    Institute of Scientific and Technical Information of China (English)

    F.Xu; T.J.Lu; K.A.Seffen

    2008-01-01

    Advances in laser,microwave and similar tech nologies have led to recent developments of thermal treatments involving skin tissue.The effectiveness of these treatments is governed by the coupled thermal,mechanical,biological and neural responses of the affected tissue:a favorable interaction results in a procedure with relatively little pain and no lasting side effects.Currently,even though each behavioral facet is to a certain extent established and understood,none exists to date in the interdisciplinarv area.A highly interdisciplinary approach is required for studying the biothermomechanical behavior of skin,involving bioheat transfer.biomechanics and physiology.A comprehensive literature review penrtinent to the subject is presented in this paper,covering four subject areas:(a)skin structure,(b)skin bioheat transfer and thermal damage,(c)skin biomechanics,and(d)skin biothermomechanics.The major problems,issues,and topics for further studies are also outlined.This review finds that significant advances in each of these aspects have been achieved in recent years.Although focus is placed upon the biothermomechanical behavior of skin tissue,the fundamental concepts and methodologies reviewed in this paper may also be applicable for studying other soft tissues.

  19. Human skin volatiles: a review.

    Science.gov (United States)

    Dormont, Laurent; Bessière, Jean-Marie; Cohuet, Anna

    2013-05-01

    Odors emitted by human skin are of great interest to biologists in many fields; applications range from forensic studies to diagnostic tools, the design of perfumes and deodorants, and the ecology of blood-sucking insect vectors of human disease. Numerous studies have investigated the chemical composition of skin odors, and various sampling methods have been used for this purpose. The literature shows that the chemical profile of skin volatiles varies greatly among studies, and the use of different sampling procedures is probably responsible for some of these variations. To our knowledge, this is the first review focused on human skin volatile compounds. We detail the different sampling techniques, each with its own set of advantages and disadvantages, which have been used for the collection of skin odors from different parts of the human body. We present the main skin volatile compounds found in these studies, with particular emphasis on the most frequently studied body regions, axillae, hands, and feet. We propose future directions for promising experimental studies on odors from human skin, particularly in relation to the chemical ecology of blood-sucking insects.

  20. Filaggrin and Skin Barrier Function.

    Science.gov (United States)

    Kezic, Sanja; Jakasa, Ivone

    2016-01-01

    The skin barrier function is greatly dependent on the structure and composition of the uppermost layer of the epidermis, the stratum corneum (SC), which is made up of flattened anucleated cells surrounded by highly organized and continuous lipid matrix. The interior of the corneocytes consists mainly of keratin filaments aggregated by filaggrin (FLG) protein. Next, together with several other proteins, FLG is cross-linked into a mechanically robust cornified cell envelope providing a scaffold for the extracellular lipid matrix. In addition to its role for the SC structural and mechanical integrity, FLG degradation products account in part for the water-holding capacity and maintenance of acidic pH of the SC, both crucial for the epidermal barrier homoeostasis by regulating activity of multiple enzymes that control desquamation, lipid synthesis and inflammation. The major determinant of FLG expression in the skin are loss-of-function mutations in FLG, the strongest genetic risk factor for atopic dermatitis (AD), an inflammatory skin disease characterized by a reduced skin barrier function. The prevalence of FLG mutations varies greatly among different populations and ranges from about 10% in Northern Europeans to less than 1% in the African populations. An impaired skin barrier facilitates absorption of potentially hazardous chemicals, which might cause adverse effects in the skin, such as contact dermatitis, or systemic toxicity after their passage into blood. In another direction, a leaky epidermal barrier will lead to enhanced loss of water from the skin. A recent study has shown that even subtle increase in epidermal water loss in newborns increases the risk for AD. Although there are multiple modes of action by which FLG might affect skin barrier it is still unclear whether and how FLG deficiency leads to the reduced skin barrier function. This chapter summarizes the current knowledge in this field obtained from clinical studies, and animal and in vitro models

  1. Chemokines in the skin

    Directory of Open Access Journals (Sweden)

    Prasad D

    1998-01-01

    Full Text Available In last few years, focus has shifted from cytokines which have pleiotropic biologic properties to chemokines with target cell selective activity. The separation has led frequently espoused proposition that chemokines are involved in the pathogenesis of disease having specific infiltrates and point to possible role in Chronic skin diseases. Depending upon the structure these chemokines are divided into three subfamilies, two major subfamilies: CXC and CC, and one putative subfamily C with only one member known as lymphotactin. A recent insight into chemokine physiology comes from demonstration of interaction between chemokines and their cloned receptors. These chemokine receptors are members of the transmembrane spanning (7-TMS, G-protein- coupled receptor family. So far CXC chemokine receptors and seven CC receptors have been cloned. Recently, the importance of selective chemoattractant activity of chemokines has been overshadowed by chemokine receptors emerging as new targets for anti-HIV therapy as the connection between chemokines and HIV-I had been established. Among the CXC chemokine receptors, CXCR4, and among the CC chemokines receptors, CCRI, CCR2b, CCR3, and CCR5 have been implicated as HIV-1 coreceptors.

  2. Development of prosthetic skin

    Science.gov (United States)

    Kilaru, Rohit

    The objective of this research was to embed tactile sensors in polyimides. This novel method could be utilized to realize prosthetic skin for sensing different kinds of mechanical stimuli. Tactile sensors have an increasing demand in medical sectors: upper and lower-limb prosthetics and in the industrial sectors: robot end-effectors, grippers and manipulators. The sensors developed are targeted for prosthetic arm tactile sensing applications. Current work presents piezoresistive differential pressure sensors fabricated on flexible polyimide film or substrate. A unique technique to bond a flexible superstrate polyimide layer to a MEMS tactile sensor array is presented in this thesis. The sensor is made of aluminium oxide membrane layer with nichrome piezoresistors as the half-Wheatstone bridge elements. Four different types of sensor designs have been characterized to obtain gauge factor of thin film nichrome. The sensor arrays with and without the superstrate film were simulated for obtaining the maximum stress, average strain and deflection of the membrane. The maximum change in output voltage was 0.8 mV. The gauge factors calculated for tactile sensor with superstrate range between 2.2 to 7.8 and without superstrate range 1.5 to 5.7.

  3. Overexpression of galectin-7 in mouse epidermis leads to loss of cell junctions and defective skin repair.

    Directory of Open Access Journals (Sweden)

    Gaëlle Gendronneau

    Full Text Available The proteins of the galectin family are implicated in many cellular processes, including cell interactions, polarity, intracellular trafficking, and signal transduction. In human and mouse, galectin-7 is almost exclusively expressed in stratified epithelia, notably in the epidermis. Galectin-7 expression is also altered in several human tumors of epithelial origin. This study aimed at dissecting the consequences of galectin-7 overexpression on epidermis structure and functions in vivo.We established transgenic mice specifically overexpressing galectin-7 in the basal epidermal keratinocytes and analyzed the consequences on untreated skin and after UVB irradiation or mechanical injury.The intercellular cohesion of the epidermis is impaired in transgenic animals, with gaps developing between adjacent keratinocytes, associated with loss of adherens junctions. The epidermal architecture is aberrant with perturbations in the multilayered cellular organisation of the tissue, and structural defects in the basement membrane. These transgenic animals displayed a reduced re-epithelialisation potential following superficial wound, due to a defective collective migration of keratinocytes. Finally, a single mild dose of UVB induced an abnormal apoptotic response in the transgenic epidermis.These results indicate that an excess of galectin-7 leads to a destabilisation of adherens junctions associated with defects in epidermal repair. As this phenotype shares similarities with that of galectin-7 null mutant mice, we conclude that a critical level of this protein is required for maintaining proper epidermal homeostasis. This study brings new insight into the mode of action of galectins in normal and pathological situations.

  4. Normality in Analytical Psychology

    Directory of Open Access Journals (Sweden)

    Steve Myers

    2013-11-01

    Full Text Available Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity.

  5. Back to Normal

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Xinjiang officials speed up the investigation of July 5 riot suspects and restore social order Life in Urumqi has gone back to normal one month after the July 5 riot that killed nearly 200 people in the capital city of China’s northwestern

  6. Normalized information distance

    NARCIS (Netherlands)

    Vitányi, P.M.B.; Balbach, F.J.; Cilibrasi, R.L.; Li, M.; Emmert-Streib, F.; Dehmer, M.

    2009-01-01

    The normalized information distance is a universal distance measure for objects of all kinds. It is based on Kolmogorov complexity and thus uncomputable, but there are ways to utilize it. First, compression algorithms can be used to approximate the Kolmogorov complexity if the objects have a string

  7. Normalized information distance

    NARCIS (Netherlands)

    Vitányi, P.M.B.; Balbach, F.J.; Cilibrasi, R.L.; Li, M.

    2008-01-01

    The normalized information distance is a universal distance measure for objects of all kinds. It is based on Kolmogorov complexity and thus uncomputable, but there are ways to utilize it. First, compression algorithms can be used to approximate the Kolmogorov complexity if the objects have a string

  8. Revertant mosaicism in the skin.

    Science.gov (United States)

    Lai-Cheong, J E; McGrath, J A

    2013-02-01

    Revertant mosaicism is a naturally occurring phenomenon involving the spontaneous correction of a pathogenic mutation in a somatic cell. Revertant mosaicism is not a rare event and has been described in several inherited skin conditions, including various subtypes of epidermolysis bullosa. The recognition of revertant mosaicism paves the way for revertant therapy which represents a potentially exciting "natural gene therapy" option for genetic disorders. The skin provides a useful model for studying revertant mosaicism because it is readily accessible and easy to examine. In this paper, we provide an overview of revertant mosaicism and its relevance in genetic skin disorders.

  9. Skin-inspired electronic devices

    Directory of Open Access Journals (Sweden)

    Alex Chortos

    2014-09-01

    Full Text Available Electronic devices that mimic the properties of skin have potential important applications in advanced robotics, prosthetics, and health monitoring technologies. Methods for measuring tactile and temperature signals have progressed rapidly due to innovations in materials and processing methods. Imparting skin-like stretchability to electronic devices can be accomplished by patterning traditional electronic materials or developing new materials that are intrinsically stretchable. The incorporation of sensing methods with transistors facilitates large-area sensor arrays. While sensor arrays have surpassed the properties of human skin in terms of sensitivity, time response, and device density, many opportunities remain for future development.

  10. Sulfate transport in toad skin

    DEFF Research Database (Denmark)

    Larsen, Erik Hviid; Simonsen, K

    1988-01-01

    1. In short-circuited toad skin preparations exposed bilaterally to NaCl-Ringer's containing 1 mM SO2(-4), influx of sulfate was larger than efflux showing that the skin is capable of transporting sulfate actively in an inward direction. 2. This active transport was not abolished by substituting...... apical Na+ for K+. 3. Following voltage activation of the passive Cl- permeability of the mitochondria-rich (m.r.) cells sulfate flux-ratio increased to a value predicted from the Ussing flux-ratio equation for a monovalent anion. 4. In such skins, which were shown to exhibit vanishingly small leakage...

  11. [Non-irritating skin protector].

    Science.gov (United States)

    Gago Fornells, Manuel; García González, R Fernando; Gaztelu Valdés, Victoriana

    2002-05-01

    In this article, the authors describe the multiple uses a non irritating cutaneous protector has as an effective tool against the aggressions which peri-lesion skin and other at risk skins suffer when they are subject to constant and direct contact with secretions and liquids resulting from the use of dressings based on wet cures, or systems of continence related to ostomias, or in those patients who suffer mixed incontinence where diaper rash makes it difficult to maintain and care for the skin.

  12. Skin Treatments and Dermatological Procedures to Promote Youthful Skin

    OpenAIRE

    Sator, Paul G

    2006-01-01

    The skin, the largest organ of the body, is the organ in which changes associated with aging are most visible. With increasing frequency, patients are requesting information and treatments that improve the appearance of their skin. Corresponding to this trend, there is an increasing number of products and methods available that claim to aid this pursuit. First, a change of the patient's lifestyle (eg, sun behavior, nicotine abuse, and nutrition) must take place. Only then may other methods be...

  13. Mediators of increased blood flow in porcine skin

    Directory of Open Access Journals (Sweden)

    H. D. Moore

    1992-01-01

    Full Text Available Nicotinates and benzalkonium chloride (B.Cl cause inflammatory changes in human skin, thought to be dependent upon prostaglandin formation. This study has examined the effects of hexyl-nicotinate (HN and B.Cl on blood flow in porcine skin. The role of prostaglandins and interleukin (IL-1 in the blood flow response has been investigated. Blood flow was increased by both HN and B.Cl, the response to B.Cl being more protracted. Cyclooxygenase inhibitor pretreatment reduced these responses. IL-1-like biological activity was identified in normal porcine epidermis and the amounts recovered from inflamed skin were similar. Thus prostaglandin formation in HN or B.Cl-induced inflammation, if IL-1 dependent, is not associated with the loss of significant amounts of the cytokine from the epidermis.

  14. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    DEFF Research Database (Denmark)

    Pedersen, C; Horn, T; Junge, Jette;

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... with AIDS related conditions. Biopsies from 5 asymptomatic HIV positive patients and the 6 control subjects were without ultrastructural alterations. The occurrence of TRI was related to low numbers of CD 4+ lymphocytes. 5/7 patients with TRI had elevated serum interferon activity, and in all...... of the patients without TRI, interferon activity was below detection level. The occurrence of TRI was not dependent on the presence of free p24 antigen in serum. It is concluded that the occurrence of TRI in entothelial cells of skin capillaries is associated with late stages of HIV infection and this may...

  15. Selective use of radiation therapy for neoplasms of the skin

    Energy Technology Data Exchange (ETDEWEB)

    Parker, R.G.

    1980-07-01

    Radiation therapy is preferable treatment for a minority of basal cell and epidermoid carcinomas of the skin. Proper use exploits the inherent advantage of preservation of function and cosmesis. Therefore, many cancers involving the eyelid, canthus, nose, nasolabial fold, pinna, ear canal, vermilion surface of the lower lip and skin of the chin can be advantageously treated by radiation therapy as compared to surgery, if pretreatment destruction of normal tissue is minimal. Although irradiation is equally effective, surgery is more expeditious for small lesions and cancers at other sites, which can be excised and followed by primary closure, and for large lesions if reconstruction will be required after destruction of the tumor. Radiation therapy can be effective, and usually is preferable treatment, for several other primary neoplasms of skin such as mycosis fungoides and Kaposi's sarcoma.

  16. Photodamage in feline skin: clinical and histomorphometric analysis.

    Science.gov (United States)

    Almeida, E M P; Caraça, R A; Adam, R L; Souza, E M; Metze, K; Cintra, M L

    2008-05-01

    The purpose of this study was to investigate clinical and histomorphometric features of cat skin under long-term solar exposure. Ear skin of 34 Domestic Shorthair cats that were chronically exposed to sun was classified as follows: group 0, normal (n = 13); group 1, initial stage of photodamage (PD) (n = 10); group 2, advanced stage of PD (n = 11). Histologic sections were examined independently by 2 pathologists, and epidermal thickness, adnexal unit area, and dermal cellularity were assessed by morphometry. A positive correlation was obtained between age, degree of edema and sclerosis in the upper dermis, telangiectases, squamatization of basal keratinocytes, and epidermis thickness and the degree of PD. The area occupied by adnexal structures in the dermis diminished with increased PD. Dermal sclerosis and edema best separated the 3 groups. The results indicated a high level of skin hypersensitivity to sun rays in cats. The findings may be useful for clinical testing and in general veterinary pathology and dermatology.

  17. AUTOMATED DETECTION OF SKIN DISEASES USING TEXTURE FEATURES

    Directory of Open Access Journals (Sweden)

    DR.RANJAN PAREKH

    2011-06-01

    Full Text Available This paper proposes an automated system for recognizing disease conditions of human skin in context to health informatics. The disease conditions are recognized by analyzing skin texture images using a set of normalized symmetrical Grey Level Co-occurrence Matrices (GLCM. GLCM defines the probability of grey level i occurring in the neighborhood of another grey level j at a distance d in direction θ. Directional GLCMs are computed along four directions: horizontal (θ = 0º, vertical (θ = 90º, right diagonal (θ = 45º and left diagonal (θ= 135º, and a set of features computed from each, are averaged to provide an estimation of the texture class.The system is tested using 180 images pertaining to three dermatological skin conditions viz. Dermatitis, Eczema, Urticaria. An accuracy of 96.6% is obtained using a multilayer perceptron (MLP as a classifier.

  18. A propagating heat wave model of skin electroporation.

    Science.gov (United States)

    Pliquett, Uwe; Gusbeth, Ch; Nuccitelli, Richard

    2008-03-21

    The main barrier to transdermal drug delivery in human skin is the stratum corneum. Pulsed electric fields (PEFs) of sufficient amplitude can create new aqueous pathways across this barrier and enhance drug delivery through the skin. Here, we describe a model of pore formation between adjacent corneocytes that predicts the following sequence of events: (1) the PEF rapidly charges the stratum corneum near the electrode until the transepidermal potential difference is large enough to drive water into a small region of the stratum corneum, creating new aqueous pathways. (2) PEFs then drive a high current density through this newly created electropore to generate Joule heating that warms the pore perimeter. (3) This temperature rise at the perimeter increases the probability of further electroporation there as the local sphingolipids reach their phase transition temperature. (4) This heat-generated wave of further electroporation propagates outward until the surface area of the pore becomes so large that the reduced current density no longer generates sufficient heat to reach the phase transition temperature of the sphingolipids. (5) Cooling and partial recovery occurs after the field pulse. This process yields large, high permeability regions in the stratum corneum at which molecules can more readily cross this skin barrier. We present a model for this process that predicts that the initial radius of the first aqueous pathway is approximately 5nm for a transdermal voltage of 60V at room temperature.

  19. Skin temperature during sunbathing--relevance for skin cancer.

    Science.gov (United States)

    Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian

    2014-08-01

    It has been found that exposure to heat and infrared radiation (IR) can be carcinogenic, and that a combination of ultraviolet radiation (UVR) and IR possibly amplifies carcinogenesis. To investigate how the skin temperature is affected by sunbathing, we measured the skin temperature on 20 healthy volunteers over 6 days' sun holiday in Egypt. Temperatures were measured with an infrared thermometer gun at 8 skin sites on the volunteers while they were indoors in the morning and when sunbathing during the day. Skin temperatures were higher during sunbathing (33.5 °C ± 2.1 °C) (mean ± SD) than when indoors in the morning (32.6 °C ± 1.4 °C) (mean ± SD) (P < 0.0001). The average skin temperature for men was higher than for women by 0.40 °C in the morning (P = 0.02) and by 0.44 °C during sunbathing (P < 0.0001). Our results show that sunbathing has an impact on skin temperature, which possibly by activation of the heat shock response, is likely to contribute to the immediate and delayed effects of UV in a way that has to be found out in future studies.

  20. Skin temperature during sunbathing--relevance for skin cancer

    DEFF Research Database (Denmark)

    Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian

    2014-01-01

    It has been found that exposure to heat and infrared radiation (IR) can be carcinogenic, and that a combination of ultraviolet radiation (UVR) and IR possibly amplifies carcinogenesis. To investigate how the skin temperature is affected by sunbathing, we measured the skin temperature on 20 healthy...... volunteers over 6 days' sun holiday in Egypt. Temperatures were measured with an infrared thermometer gun at 8 skin sites on the volunteers while they were indoors in the morning and when sunbathing during the day. Skin temperatures were higher during sunbathing (33.5 °C ± 2.1 °C) (mean ± SD) than when...... indoors in the morning (32.6 °C ± 1.4 °C) (mean ± SD) (P skin temperature for men was higher than for women by 0.40 °C in the morning (P = 0.02) and by 0.44 °C during sunbathing (P skin temperature, which possibly...