WorldWideScience

Sample records for adjacent normal skin

  1. TP53 mutations in clinically normal mucosa adjacent to oral carcinomas

    DEFF Research Database (Denmark)

    Thode, C; Bilde, A; Von Buchwald, C;

    2010-01-01

    BACKGROUND: The tumour-suppressor protein p53 often accumulates in histologically normal epithelium adjacent to oral squamous cell carcinomas (OSCC). We investigated whether this was associated with mutations in TP53, the gene for p53, and might implicate impending malignancy. METHODS: Specimens...... from 18 human squamous cell carcinomas were stained with monoclonal p53 antibodies. Positive cells were microdissected with laser-captured microscopy from the tumour and adjacent normal and dysplastic epithelium. DNA was extracted, and exons 5-9 of the TP53 gene were amplified by PCR. Amplified...

  2. Preliminary Study of Oxidative Stress in Human Hepatocellular Carcinoma and Adjacent Normal Liver Tissues

    Institute of Scientific and Technical Information of China (English)

    Hongwei Yu; Chunying Chen; Jiangxue Wang; Yuxi Gao; Guilong Deng; Yingbin Liu; Shuyou Peng; Zhifang Chai

    2006-01-01

    OBJECTIVE The antioxidative system in human hepatocellular carcinoma was investigated.METHODS The activities of cytosolic catalase (CAT), superoxide dismutase, glutathione peroxidase (GSH-Px), glutathione S-tranferase and levels of reduced glutathione, total protein thiols and malondialdehyde were assayed in 10 cases of hepatocellular carcinoma and adjacent normal liver.RESULTS Hepatoma tissues showed higher activities of CAT, GSH-Px and lower content of total antioxidative capacity compared to adjacent normal liver tissue (P<0.05).CONCLUSION These findings suggest that the antioxidative defenserelated enzymes and antioxidants are largely regulated in hepatoma cells.However, the mechanism which is not clear requires further investigation.

  3. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  4. Melanocytic naevi clustered on normal background skin.

    Science.gov (United States)

    Torchia, D

    2015-04-01

    Several types of maculopapular melanocytic naevi can occur in a multiple form, and be arranged in a nonrandom fashion on the skin. The most frequently reported segmentally grouped naevi are lentigines. Two types of segmentally arranged lentigines probably exist. The first is associated with neurofibromatosis (NF)1 or NF1 signs, features scattered light-brown lesions and can be considered a type of mosaic NF1. By contrast, non-NF1 associated lesions are characterized by densely packed, dark lesions, and can be defined as 'non-NF1 checkerboard-arranged lentigines'. Blue naevi, Spitz naevi and common acquired melanocytic naevi can occur, clustered in an agminated (or cannonball) shape. However, if large enough, they always follow a checkerboard pattern. Hence, such mosaic conditions should be termed 'checkerboard-arranged blue naevi', 'checkerboard-arranged Spitz naevi' and 'checkerboard-arranged common acquired melanocytic naevi'. Segmentally arranged dysplastic melanocytic naevi probably represent a mosaic form of dysplastic naevus syndrome. Dysplastic melanocytic naevi confined to a cutaneous segment could be defined as 'isolated segmental dysplastic naevus syndrome', while segmentally arranged dysplastic melanocytic naevi co-occurring with widespread, nonsegmental dysplastic melanocytic naevi might configure a 'superimposed segmental dysplastic naevus syndrome'. Small congenital melanocytic naevi are always grouped along Blaschko lines. The only other instances following Blaschko lines are the so-called 'linear lentiginous naevus' and a unique case of multiple deep penetrating naevi. PMID:25703021

  5. Using infrared and Raman microspectroscopies to compare ex vivo involved psoriatic skin with normal human skin

    Science.gov (United States)

    Leroy, Marie; Lefèvre, Thierry; Pouliot, Roxane; Auger, Michèle; Laroche, Gaétan

    2015-06-01

    Psoriasis is a chronic dermatosis that affects around 3% of the world's population. The etiology of this autoimmune pathology is not completely understood. The barrier function of psoriatic skin is known to be strongly altered, but the structural modifications at the origin of this dysfunction are not clear. To develop strategies to reduce symptoms of psoriasis or adequate substitutes for modeling, a deep understanding of the organization of psoriatic skin at a molecular level is required. Infrared and Raman microspectroscopies have been used to obtain direct molecular-level information on psoriatic and healthy human skin biopsies. From the intensities and positions of specific vibrational bands, the lipid and protein distribution and the lipid order have been mapped in the different layers of the skin. Results showed a similar distribution of lipids and collagen for normal and psoriatic human skin. However, psoriatic skin is characterized by heterogeneity in lipid/protein composition at the micrometer scale, a reduction in the definition of skin layer boundaries and a decrease in lipid chain order in the stratum corneum as compared to normal skin. A global decrease of the structural organization is exhibited in psoriatic skin that is compatible with an alteration of its barrier properties.

  6. Three-dimensional imaging of normal skin and nonmelanoma skin cancer with cellular resolution using Gabor domain optical coherence microscopy

    OpenAIRE

    Lee, Kye-Sung; Zhao, Huimin; Ibrahim, Sherrif F; Meemon, Natthani; Khoudeir, Laura; Rolland, Jannick P.

    2012-01-01

    Abstract. We investigate morphological differences in three-dimensional (3-D) images with cellular resolution between nonmelanoma skin cancer and normal skin using Gabor domain optical coherence microscopy. As a result, we show for the first time cellular optical coherence images of 3-D features differentiating cancerous skin from normal skin. In addition, in vivo volumetric images of normal skin from different anatomic locations are shown and compared.

  7. Stress interactions between normal faults and adjacent strike-slip faults of 1997 Jiashi earthquake swarm

    Institute of Scientific and Technical Information of China (English)

    ZHANG ZhuQi; CHEN John YongShun; LIN Jian

    2008-01-01

    During a 4-month period starting from 21 January, 1997, an earthquake swarm of seven major events (Ms≥6.0) struck the Jiashi region at the northwestern corner of the Tarim Basin in Xinjiang,, China.Previous relocation studies suggested that these strong earthquakes had occurred along at least two parallel rupture zones. According to the relocated hypocenters and focal mechanisms of the events, we have constructed fault models for these seven earthquakes to calculate the Coulomb stress changes produced by each of these events. Furthermore, we extended our model calculations to include an adjacent 1996 Ms=6.9 Artushi earthquake, which occurred one year before the Jiashi earthquake swarm.Our calculations show that the Coulomb stress change caused by the preceding events was around 0.05 MPa at the hypocenter of the 4th event, and higher than 0.08 MPa at the hypocenters of the 2nd,3rd, 5th and 6th events. Our results reveal a Coulomb stress interactive cycle of earthquake triggering between two adjacent normal and strike-slip faults.

  8. Comparative Proteome Analysis of Breast Cancer and Adjacent Normal Breast Tissues in Human

    Institute of Scientific and Technical Information of China (English)

    Shi-Shan Deng; Tian-Yong Xing; Hong-Ying Zhou; Ruo-Hong Xiong; You-Guang Lu; Bin Wen; Shang-Qing Liu; Hui-Jun Yang

    2006-01-01

    Two-dimensional polyacryiamide gel electrophoresis (2D-PAGE) and matrixassisted laser desorption/ionization tandem time-of-flight mass spectrometry (MALDI-TOF/TOF-MS), incorporated with online database searching, were performed to investigate differential proteins of breast cancer and adjacent normal breast tissues. Considering that serum albumin is abundantly presented in normal control samples, 15 differential spots detected in 11 out of 12 (91.7%) breast cancer samples were identified by online SIENA-2DPAGE database searching and MALDI-TOF/TOF-MS analysis. The results indicate that pathological changes of breast cancer are concerned with augmentation of substance metabolism, promotion of proteolytic activity, decline of activity of some inhibitors of enzymes, and so on. Some important proteins involved in the pathological process of breast cancer with changed expression may be useful biomarkers, such as alpha-1-antitrypsin, EF1-beta, cathepsin D, TCTP, SMT3A, RPS12, and PSMA1, among which SMT3A,RPS12, and PSMA1 were first reported for breast cancer in this study.

  9. Stress interactions between normal faults and adjacent strike-slip faults of 1997 Jiashi earthquake swarm

    Institute of Scientific and Technical Information of China (English)

    CHEN; John; YongShun

    2008-01-01

    During a 4-month period starting from 21 January, 1997, an earthquake swarm of seven major events (Ms≥6.0) struck the Jiashi region at the northwestern corner of the Tarim Basin in Xinjiang,, China. Previous relocation studies suggested that these strong earthquakes had occurred along at least two parallel rupture zones. According to the relocated hypocenters and focal mechanisms of the events, we have constructed fault models for these seven earthquakes to calculate the Coulomb stress changes produced by each of these events. Furthermore, we extended our model calculations to include an ad- jacent 1996 Ms=6.9 Artushi earthquake, which occurred one year before the Jiashi earthquake swarm. Our calculations show that the Coulomb stress change caused by the preceding events was around 0.05 MPa at the hypocenter of the 4th event, and higher than 0.08 MPa at the hypocenters of the 2nd, 3rd, 5th and 6th events. Our results reveal a Coulomb stress interactive cycle of earthquake triggering between two adjacent normal and strike-slip faults.

  10. Mast Cells in Adjacent Normal Colon Mucosa rather than Those in Invasive Margin are Related to Progression of Colon Cancer

    Institute of Scientific and Technical Information of China (English)

    Qing Xia; Xiao-shi Zhang; Ying-bo Chen; Ya Ding; Xiao-jun Wu; Rui-qing Peng; Qiang Zhou; Jing Zeng; Jing-hui Hou; Xing Zhang; Yi-xin Zeng

    2011-01-01

    Objective:Mast cells (MC) reside in the mucosa of the digestive tract as the first line against bacteria and toxins.Clinical evidence has implied that the infiltration of mast cells in colorectal cancers is related to malignant phenotypes and a poor prognosis.This study compared the role of mast cells in adjacent normal colon mucosa and in the invasive margin during the progression of colon cancer.Methods:Specimens were obtained from 39 patients with colon adenomas and 155 patients with colon cancers treated at the Sun Yat-sen University Cancer Center between January 1999 and July 2004.The density of mast cells was scored by an immunohistochemical assay.The pattern of mast cell distribution and its relationship with dinicopathologic parameters and 5-year survival were analyzed.Results:The majority of mast cells were located in the adjacent normal colon mucosa,followed by the invasive margin and least in the cancer stroma.Mast cell count in adjacent normal colon mucosa (MCCadjacent) was associated with pathologic classification,distant metastases and hepatic metastases,although it was not a prognostic factor.In contrast,mast cell count in the invasive margin (MCCinvasive) was associated with neither the clinicopathlogic parameters nor overall survival.Conclusion:Mast cells in the adjacent normal colon mucosa were related to the progression of colon cancer,suggesting that mast cells might modulate tumor progression via a long-distance mechanism.

  11. Distinctive Glycerophospholipid Profiles of Human Seminoma and Adjacent Normal Tissues by Desorption Electrospray Ionization Imaging Mass Spectrometry

    Science.gov (United States)

    Masterson, Timothy A.; Dill, Allison L.; Eberlin, Livia S.; Mattarozzi, Monica; Cheng, Liang; Beck, Stephen D. W.; Bianchi, Federica; Cooks, R. Graham

    2011-08-01

    Desorption electrospray ionization mass spectrometry (DESI-MS) has been successfully used to discriminate between normal and cancerous human tissue from different anatomical sites. On the basis of this, DESI-MS imaging was used to characterize human seminoma and adjacent normal tissue. Seminoma and adjacent normal paired human tissue sections (40 tissues) from 15 patients undergoing radical orchiectomy were flash frozen in liquid nitrogen and sectioned to 15 μm thickness and thaw mounted to glass slides. The entire sample was two-dimensionally analyzed by the charged solvent spray to form a molecular image of the biological tissue. DESI-MS images were compared with formalin-fixed, hematoxylin and eosin (H&E) stained slides of the same material. Increased signal intensity was detected for two seminolipids [seminolipid (16:0/16:0) and seminolipid (30:0)] in the normal tubule testis tissue; these compounds were undetectable in seminoma tissue, as well as from the surrounding fat, muscle, and blood vessels. A glycerophosphoinositol [PI(18:0/20:4)] was also found at increased intensity in the normal testes tubule tissue when compared with seminoma tissue. Ascorbic acid (i.e., vitamin C) was found at increased amounts in seminoma tissue when compared with normal tissue. DESI-MS analysis was successfully used to visualize the location of several types of molecules across human seminoma and normal tissues. Discrimination between seminoma and adjacent normal testes tubules was achieved on the basis of the spatial distributions and varying intensities of particular lipid species as well as ascorbic acid. The increased presence of ascorbic acid within seminoma compared with normal seminiferous tubules was previously unknown.

  12. Collagen IV in normal skin and in pathological processes

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu-Velez

    2012-01-01

    Full Text Available Context: Type IV collagen is a type of collagen found primarily in the skin within the basement membrane zone. The type IV collagen C4 domain at the C-terminus is not removed in post-translational processing, and the fibers are thus link head-to-head, rather than in a parallel fashion. Also, type IV collagen lacks a glycine in every third amino-acid residue necessary for the tight collagen helix. Thus, the overall collagen-IV conformation is structurally more pliable and kinked, relative to other collagen subtypes. These structural features allow collagen IV to form sheets, which is the primary structural form found in the cutaneous basal lamina. There are six human genes associated with collagen IV, specifically COL4A1, COL4A2, COL4A3, COL4A4, COL4A5 and COL4A6. The aim of this review is to highlight the significance of this protein in normal skin, and in selected diseases. Results: The alpha 3 protein constituent of type IV collagen is thought to be the antigen implicated in Goodpasture′s syndrome, wherein the immune system attacks the basement membranes of the renal glomeruli and pulmonary alveoli. In addition, mutations to the genes coding for type IV collagen lead to the Alport syndrome. Furthermore, autoantibodies directed against denatured human type IV collagen have been described in rheumatoid arthritis, scleroderma, and SLE. Structural studies of collagen IV have been utilized to differentiate between subepidermal blistering diseases, including bullous pemphigoid, acquired epidermolysis bullosa, anti-epiligrin cicatricial pemphigoid, and bullous lupus erythematosus. Collagen IV is also of importance in wound healing and in embryogenesis. Conclusions: Pathological studies have demonstrated that minor structural differences in collagen IV can lead to distinct, clinically different diseases.

  13. Characterising the biophysical properties of normal and hyperkeratotic foot skin

    OpenAIRE

    Hashmi, Farina; Nester, Christopher; Wright, Ciaran; Newton, Veronica; Lam, Sharon

    2015-01-01

    Background Plantar foot skin exhibits unique biophysical properties that are distinct from skin on other areas of the body. This paper characterises, using non-invasive methods, the biophysical properties of foot skin in healthy and pathological states including xerosis, heel fissures, calluses and corns. Methods Ninety three people participated. Skin hydration, elasticity, collagen and elastin fibre organisation and surface texture was measured from plantar calluses, corns, fissured heel ski...

  14. Reactive molecule species and antioxidative mechanisms in normal skin and skin aging.

    Science.gov (United States)

    Wölfle, Ute; Seelinger, Günter; Bauer, Georg; Meinke, Martina C; Lademann, Jürgen; Schempp, Christoph M

    2014-01-01

    Reactive oxygen and nitrogen species (ROS/RNS) which may exist as radicals or nonradicals, as well as reactive sulfur species and reactive carbon species, play a major role in aging processes and in carcinogenesis. These reactive molecule species (RMS), often referred to as 'free radicals' or oxidants, are partly by-products of the physiological metabolism. When RMS concentrations exceed a certain threshold, cell compartments and cells are injured and destroyed. Endogenous physiological mechanisms are able to neutralize RMS to some extent, thereby limiting damage. In the skin, however, pollutants and particularly UV irradiation are able to produce additional oxidants which overload the endogenous protection system and cause early aging, debilitation of immune functions, and skin cancer. The application of antioxidants from various sources in skin care products and food supplements is therefore widespread, with increasingly effective formulations being introduced. The harmful effects of RMS (aside from impaired structure and function of DNA, proteins, and lipids) are: interference with specific regulatory mechanisms and signaling pathways in cell metabolism, resulting in chronic inflammation, weakening of immune functions, and degradation of tissue. Important control mechanisms are: MAP-kinases, the aryl-hydrocarbon receptor (AhR), the antagonistic transcription factors nuclear factor-κB and Nrf2 (nuclear factor erythroid 2-related factor 2), and, especially important, the induction of matrix metalloproteinases which degrade dermal connective tissue. Recent research, however, has revealed that RMS and in particular ROS/RNS are apparently also produced by specific enzyme reactions in an evolutionarily adapted manner. They may fulfill important physiologic functions such as the activation of specific signaling chains in the cell metabolism, defense against infectious pathogens, and regulation of the immune system. Normal physiological conditions are characterized by

  15. Differences in gene expression in prostate cancer, normal appearing prostate tissue adjacent to cancer and prostate tissue from cancer free organ donors

    International Nuclear Information System (INIS)

    Typical high throughput microarrays experiments compare gene expression across two specimen classes – an experimental class and baseline (or comparison) class. The choice of specimen classes is a major factor in the differential gene expression patterns revealed by these experiments. In most studies of prostate cancer, histologically malignant tissue is chosen as the experimental class while normal appearing prostate tissue adjacent to the tumor (adjacent normal) is chosen as the baseline against which comparison is made. However, normal appearing prostate tissue from tumor free organ donors represents an alterative source of baseline tissue for differential expression studies. To examine the effect of using donor normal tissue as opposed to adjacent normal tissue as a baseline for prostate cancer expression studies, we compared, using oligonucleotide microarrays, the expression profiles of primary prostate cancer (tumor), adjacent normal tissue and normal tissue from tumor free donors. Statistical analysis using Significance Analysis of Microarrays (SAM) demonstrates the presence of unique gene expression profiles for each of these specimen classes. The tumor v donor expression profile was more extensive that the tumor v adjacent normal profile. The differentially expressed gene lists from tumor v donor, tumor v adjacent normal and adjacent normal v donor comparisons were examined to identify regulated genes. When donors were used as the baseline, similar genes are highly regulated in both tumor and adjacent normal tissue. Significantly, both tumor and adjacent normal tissue exhibit significant up regulation of proliferation related genes including transcription factors, signal transducers and growth regulators compared to donor tissue. These genes were not picked up in a direct comparison of tumor and adjacent normal tissues. The up-regulation of these gene types in both tissue types is an unexpected finding and suggests that normal appearing prostate tissue

  16. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  17. Asiaticoside enhances normal human skin cell migration, attachment and growth in vitro wound healing model.

    Science.gov (United States)

    Lee, Jeong-Hyun; Kim, Hye-Lee; Lee, Mi Hee; You, Kyung Eun; Kwon, Byeong-Ju; Seo, Hyok Jin; Park, Jong-Chul

    2012-10-15

    Wound healing proceeds through a complex collaborative process involving many types of cells. Keratinocytes and fibroblasts of epidermal and dermal layers of the skin play prominent roles in this process. Asiaticoside, an active component of Centella asiatica, is known for beneficial effects on keloid and hypertrophic scar. However, the effects of this compound on normal human skin cells are not well known. Using in vitro systems, we observed the effects of asiaticoside on normal human skin cell behaviors related to healing. In a wound closure seeding model, asiaticoside increased migration rates of skin cells. By observing the numbers of cells attached and the area occupied by the cells, we concluded that asiaticoside also enhanced the initial skin cell adhesion. In cell proliferation assays, asiaticoside induced an increase in the number of normal human dermal fibroblasts. In conclusion, asiaticoside promotes skin cell behaviors involved in wound healing; and as a bioactive component of an artificial skin, may have therapeutic value.

  18. Analysis of normal-tumour tissue interaction in tumours: prediction of prostate cancer features from the molecular profile of adjacent normal cells.

    Directory of Open Access Journals (Sweden)

    Victor Trevino

    Full Text Available Statistical modelling, in combination with genome-wide expression profiling techniques, has demonstrated that the molecular state of the tumour is sufficient to infer its pathological state. These studies have been extremely important in diagnostics and have contributed to improving our understanding of tumour biology. However, their importance in in-depth understanding of cancer patho-physiology may be limited since they do not explicitly take into consideration the fundamental role of the tissue microenvironment in specifying tumour physiology. Because of the importance of normal cells in shaping the tissue microenvironment we formulate the hypothesis that molecular components of the profile of normal epithelial cells adjacent the tumour are predictive of tumour physiology. We addressed this hypothesis by developing statistical models that link gene expression profiles representing the molecular state of adjacent normal epithelial cells to tumour features in prostate cancer. Furthermore, network analysis showed that predictive genes are linked to the activity of important secreted factors, which have the potential to influence tumor biology, such as IL1, IGF1, PDGF BB, AGT, and TGFβ.

  19. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars;

    2008-01-01

    is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...

  20. Modulation of pro-inflammatory cytokines in normal and inflamed skin

    NARCIS (Netherlands)

    A.R. Companjen (Arjen)

    2001-01-01

    textabstractThis thesis describes the expression and modulation of pro-inflammatory cytokines in normal and inflamed skin. During the last few decades it has become clear that the skin comprises a complex network of interacting cells including keratinocytes (KC). dendritic cells (such as Langerhans

  1. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.;

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  2. Reflectance spectrometry of normal and bruised human skins: experiments and modeling

    International Nuclear Information System (INIS)

    A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)

  3. Spectral analysis of blood perfusion in the free latissimus dorsi myocutaneous flap and in normal skin

    International Nuclear Information System (INIS)

    To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable

  4. IgG subclass switching and clonal expansion in cutaneous melanoma and normal skin.

    Science.gov (United States)

    Saul, Louise; Ilieva, Kristina M; Bax, Heather J; Karagiannis, Panagiotis; Correa, Isabel; Rodriguez-Hernandez, Irene; Josephs, Debra H; Tosi, Isabella; Egbuniwe, Isioma U; Lombardi, Sara; Crescioli, Silvia; Hobbs, Carl; Villanova, Federica; Cheung, Anthony; Geh, Jenny L C; Healy, Ciaran; Harries, Mark; Sanz-Moreno, Victoria; Fear, David J; Spicer, James F; Lacy, Katie E; Nestle, Frank O; Karagiannis, Sophia N

    2016-01-01

    B cells participate in immune surveillance in human circulation and tissues, including tumors such as melanoma. By contrast, the role of humoral responses in cutaneous immunity is underappreciated. We report circulating skin-homing CD22+CLA+B cells in healthy volunteers and melanoma patients (n = 73) and CD22+ cells in melanoma and normal skin samples (n = 189). Normal and malignant skin featured mature IgG and CD22 mRNA, alongside mRNA for the transiently-expressed enzyme Activation-induced cytidine Deaminase (AID). Gene expression analyses of publically-available data (n = 234 GEO, n = 384 TCGA) confirmed heightened humoral responses (CD20, CD22, AID) in melanoma. Analyses of 51 melanoma-associated and 29 normal skin-derived IgG sequence repertoires revealed lower IgG1/IgGtotal representation compared with antibodies from circulating B cells. Consistent with AID, comparable somatic hypermutation frequencies and class-switching indicated affinity-matured antibodies in normal and malignant skin. A melanoma-associated antibody subset featured shorter complementarity-determining (CDR3) regions relative to those from circulating B cells. Clonal amplification in melanoma-associated antibodies and homology modeling indicated differential potential antigen recognition profiles between normal skin and melanoma sequences, suggesting distinct antibody repertoires. Evidence for IgG-expressing B cells, class switching and antibody maturation in normal and malignant skin and clonally-expanded antibodies in melanoma, support the involvement of mature B cells in cutaneous immunity. PMID:27411958

  5. Diaper area skin microflora of normal children and children with atopic dermatitis.

    OpenAIRE

    Keswick, B H; Seymour, J L; Milligan, M C

    1987-01-01

    In vitro studies established that neither cloth nor disposable diapers demonstrably contributed to the growth of Escherichia coli, Proteus vulgaris, Staphylococcus aureus, or Candida albicans when urine was present as a growth medium. In a clinical study of 166 children, the microbial skin flora of children with atopic dermatitis was compared with the flora of children with normal skin to determine the influence of diaper type. No biologically significant differences were detected between gro...

  6. The Influence of Normal Load and Sliding Speed on Frictional Properties of Skin

    Institute of Scientific and Technical Information of China (English)

    Wei Tang; Shi-rong Ge; Hua Zhu; Xi-chuan Cao; Ning Li

    2008-01-01

    The study of frictional properties of human skin is important for medical research, skin care products and textile exploitation. In order to investigate the influence of normal load and sliding speed on the frictional properties of skin and its possible mechanism, tests were carried out on a multi-specimen friction tester. When the normal load increases from 0.1 N to 0.9 N,normal displacement and the friction coefficient of skin increase. The friction coefficient is dependent on the load, indicating that both adhesion and deformation contribute to the friction behaviour. The deformation friction was interpreted using the plough model of fiiction. When sliding speed increases from 0.5 mm·s-1 to 4 mm·s-1,the friction coefficient increases and "stick-slip" phenomena increase, indicating that hysteretic friction contributes to the friction. The hysteretic friction was interpreted using schematic of energy translation during the rigid spherical probe sliding on the soft skin surface, which provides an explanation for the influence of the sliding speed on the frictional characteristics of the skin.

  7. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    Energy Technology Data Exchange (ETDEWEB)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-07-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure.

  8. Skin-pass rolling II - Studies of roughness transfer under combined normal and tangential loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness on roughness transfer in skin-pass or temper rolling of steel strip is investigated, focusing on loading under combined normal and tangential displacement of tool relative to the workpiece. The calculated roughness transfer by an elasto-plastic finite element (FE......) simulation of plane strain indentation in authors’ previous paper [H. Kijima, N. Bay, Skin-pass rolling I—studies on roughness transfer and elongation under pure normal loading, International Journal of Machine Tools and Manufacture, May 2008, accepted for publication] is verified by experimental...

  9. Normal range and lateral symmetry in the skin temperature profile of pregnant women

    Science.gov (United States)

    Pereira, Tânia; Nogueira-Silva, Cristina; Simoes, Ricardo

    2016-09-01

    Body skin temperature is a useful parameter for diagnosing diseases and infrared thermography can be a powerful tool in providing important information to detect body temperature changes in a noninvasive way. The aim of this work was to study the pattern of skin temperature during pregnancy, to establish skin temperature reference values and to find correlations between these and the pregnant population characteristics. Sixty-one healthy pregnant women (mean age 30.6 ± 5.1 years) in the 8th-40th gestational week with normal pregnancies were examined in 31 regions of interest (ROI). The ROIs were defined all over the body in order to determine the most influenced by factors such as age or body mass index (BMI). The results obtained in this work highlight that in normal pregnant women the skin temperature is symmetrically distributed, with the symmetrical areas differing less than 0.5 °C , with a mean value of 0.25 ± 0.23 °C . This study identified a significant negative correlation between the BMI and temperature. Age has been shown to have great influence on the skin temperature, with a significant increase of temperature observed with age. This work explores a novel medical application of infrared thermography and provides a characterization of thermal skin profile in human pregnancy for a large set of ROIs while also evaluating the effects of age and BMI.

  10. High-resolution magnetic resonance imaging in study of the skin: Normal patterns

    Energy Technology Data Exchange (ETDEWEB)

    Sans, Nicolas, E-mail: sans.n@chu-toulouse.fr [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Faruch, Marie; Chiavassa-Gandois, Helene; Ribes, Catherine Lalande Champetier de [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France); Paul, Carle [Service de Dermatologie, Centre Hospitalier Universitaire Larrey, Toulouse (France); Railhac, Jean-Jacques [Service de Radiologie et Imagerie Medicale, Centre Hospitalier Universitaire Purpan, Place du Dr Baylac, TSA 40031, 31059 Toulouse Cedex 9 (France)

    2011-11-15

    Purpose: To validate quantitative and qualitative criteria of normal healthy skin using high-resolution MR imaging. Materials and methods: FIESTA and spin echo sequences of the skin of the heel, back and calf were obtained in 31 healthy volunteers. A dedicated 3-in. coil for study of the skin was used to optimize reception sensitivity. Quantitative analysis was performed to measure skin thickness in these three sites and qualititative analysis aimed to differentiate the various skin layers. Results: With both sequences, the stratum corneum appeared as a hyperintense layer. The epidermis was visualized appeared as a fine, homogeneous, hyperintense line. The dermoepidermal junction was clearer particularly in the calf. The dermis was also identified in each sequence and in each anatomic site. The signal was hypointense in both sequences, homogeneous with spin echo and more heterogeneous with FIESTA. Moreover the interface between the papillary and the reticular dermis could be distinguished. The hypodermis was visualized in both sequences and in all sites and hypodermal inclusions in the dermis were seen particularly in the back and calf. Lastly, the pilosebaceous follicles and the deep vascular network of the reticular dermis were more clearly seen with FIESTA sequence. Measures of overall skin thickness and for each layer according to site, sex and MRI sequence were performed. Statistical analysis was then performed to seek significant differences between the results according to these parameters. Conclusion: MR imaging provides global analysis with high resolution of the various skin layers down to the hypodermis and the muscular fascia.

  11. Reflectance Confocal Mıcroscopy; Morphology of Normal Skin and The Use in Melanocytic Lesions

    Directory of Open Access Journals (Sweden)

    Aslı Vefa Turgut Erdemir

    2013-09-01

    Full Text Available In vivo reflectance confocal microscopy (RCM is a noninvasive method that allows imaging of cells and structures in living skin with resolution close to the histological analysis. RCM allows the assessment of dynamic events in the epidermis, papillary dermis and superficial reticular dermis. From the stratum corneum to a depth of a maximum of 350 μm can be analysed. The noninvasive feature of this technique, allows repetitive imaging without any damage to the affected area and to evaluate the response to the treatment. RCM, provides great convenience in assesment of normal skin and particularly in the evaluation of melanocytic lesions due to high contrast features of melanin and melanosomes. In this article morphology of normal skin and features of melanocytic lesions is described with RCM.

  12. Skin-pass rolling I – Studies on roughness transfer and elongation under pure normal loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness in skin-pass or temper rolling of steel strip is investigated focusing on roughness transfer and strip elongation under pure normal loading, i.e. with no tangential shear between tool and workpiece. The process is simulated by an elasto-plastic FE simulation of plane...

  13. Development of gene microarray in screening differently expressed genes in keloid and normal-control skin

    Institute of Scientific and Technical Information of China (English)

    陈伟; 付小兵; 葛世丽; 孙晓庆; 周岗; 赵志力; 盛志勇

    2004-01-01

    Background Keloid is an intricate lesion that is probably regulated by many genes. In this study, the authors used the technique of complementary DNA (cDNA) microarray to analyse abnormal gene expression in keloids and normal control skins. Methods The polymerase chain reaction (PCR) products of 8400 genes were spotted in an array on chemical-material-coated-glass plates. The DNAs were fixed on the glass plates. The total RNAs were isolated from freshly excised human keloid and normal control skins, and the mRNAs were then purified. The mRNA from both keloid and normal control skins were reversely transcribed to cDNAs, with the incorporation of fluorescent dUTP, for preparing the hybridisation probes. The mixed probes were then hybridised to the cDNA microarray. After thorough washing, the cDNA microarray was scanned for differing fluorescent signals from two types of tissues. Gene expression of tissue growth factor-β1 (TGF-β1) and of c-myc was detected with both RT-PCR and Northern blot hybridisation to confirm the effectiveness of cDNA microarray. Results Among the 8400 human genes, 402 were detected with different expression levels between keloid and normal control skins. Two hundred and fifty genes, including TGF-β1 and c-myc, were up-regulated and 152 genes were down-regulated. Higher expressions of TGF-β1 and c-myc in keloid were also revealed using RT-PCR and Northern blot methods. Conclusion cDNA microarray analysis provides a powerful tool for investigating differential gene expression in keloid and normal control skins. Keloid is a complicated lesion with many genes involved.

  14. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt;

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results of the...... determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out at the...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found in...

  15. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania – cross sectional study

    Directory of Open Access Journals (Sweden)

    Kiprono Samson K

    2012-07-01

    Full Text Available Abstract Background Skin flora varies from one site of the body to another. Individual’s health, age and gender determine the type and the density of skin flora. Methods A 1 cm2 of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35°C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. Results The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9 years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680 CFU per cm2 as compared with 453.5 CFU per cm2 in those with normally pigmented skin (p = 0.023. The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038. Conclusion Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  16. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke;

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...... the diagnostic accuracy of OCT in differentiating NMSC from benign lesions and normal skin. METHODS AND MATERIALS OCT and polarization-sensitive (PS) OCT from 104 patients were studied. Observer-blinded evaluation of OCT images from 64 BCCs, 1 baso-squamous carcinoma, 39 AKs, two malignant melanomas, nine benign...... lesions, and 105 OCT images from perilesional skin was performed; 50 OCT images of NMSC and 50 PS-OCT images of normal skin were evaluated twice. RESULTS Sensitivity was 79% to 94% and specificity 85% to 96% in differentiating normal skin from lesions. Important features were absence of well...

  17. Upregulation of hypoxia-inducible factors in normal and psoriatic skin.

    Science.gov (United States)

    Rosenberger, Christian; Solovan, Caius; Rosenberger, Alina D; Jinping, Li; Treudler, Regina; Frei, Ulrich; Eckardt, Kai-Uwe; Brown, Lawrence F

    2007-10-01

    Angiogenesis induced by vascular endothelial growth factor (VEGF) plays an important role in psoriasis. Hypoxic adaptation is conferred through hypoxia-inducible transcription factors (HIFs). VEGF and its receptor Flt-1 are HIF target genes. Growth factors and inflammatory cytokines activate the phosphoinositol-3 kinase pathway, and via activated protein kinase B (phospho-Akt) augment HIF activity. Here, we demonstrate that the major oxygen-dependent HIF isoforms are strongly upregulated in psoriatic skin: HIF-1alpha mainly in the epidermis, in an expression pattern similar to VEGF mRNA; HIF-2alpha in both the epidermis and in capillary endothelial cells of the dermis. In contrast, normal human skin shows low expression of HIF-alpha proteins, with the exception of hair follicles, and glands, which strongly express HIF-1alpha. In normal human skin, phospho-Akt appeared in the basal epidermal layer, in hair follicles, and in dermal glands. In contrast, in psoriasis, phospho-Akt expression was low in the epidermis, but markedly enhanced in the dermal capillaries and in surrounding interstitial/inflammatory cells. Our data suggest that hypoxia initiates a potentially self-perpetuating cycle involving HIF, VEGF, and Akt activation, which could drive physiologic growth of hair follicles and skin glands. Furthermore, such a cycle may exist in psoriasis in dermal capillaries and contribute to disease progression. PMID:17495954

  18. Absorption spectra and light penetration depth of normal and pathologically altered human skin

    Science.gov (United States)

    Barun, V. V.; Ivanov, A. P.; Volotovskaya, A. V.; Ulashchik, V. S.

    2007-05-01

    A three-layered skin model (stratum corneum, epidermis, and dermis) and engineering formulas for radiative transfer theory are used to study absorption spectra and light penetration depths of normal and pathologically altered skin. The formulas include small-angle and asymptotic approximations and a layer-addition method. These characteristics are calculated for wavelengths used for low-intensity laser therapy. We examined several pathologies such as vitiligo, edema, erythematosus lupus, and subcutaneous wound, for which the bulk concentrations of melanin and blood vessels or tissue structure (for subcutaneous wound) change compared with normal skin. The penetration depth spectrum is very similar to the inverted blood absorption spectrum. In other words, the depth is minimal at blood absorption maxima. The calculated absorption spectra enable the power and irradiation wavelength providing the required light effect to be selected. Relationships between the penetration depth and the diffuse reflectance coefficient of skin (unambiguously expressed through the absorption coefficient) are analyzed at different wavelengths. This makes it possible to find relationships between the light fields inside and outside the tissue.

  19. Protoporphyrin IX formation and photobleaching in different layers of normal human skin

    DEFF Research Database (Denmark)

    Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A;

    2012-01-01

    human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18 and......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...

  20. Incorporation of 14C-linoleic acid in cerebrosides of psoriatic and normal human skin

    International Nuclear Information System (INIS)

    It was shown that the incorporation of 14C-linoleic acid in cerebrosides of normal and psoriatic human skin is different. In psoriatic epidermis and corium the turnover of this fatty acid is significantly elevated. It is suggested that in psoriasis the epidermal cell is not able to build up a regular carbohydrate sequences of lipids because the false carbohydrate chain activates the degradation of glycolipids and in compensating for the increased degradation raises the synthesis rate of glycolipids. (orig./MG)

  1. CD133 Expression in Normal Skin and in Epithelial Cutaneous Tumors

    Directory of Open Access Journals (Sweden)

    S. H. Nam-Cha

    2013-01-01

    Full Text Available Background. Expression of human CD133 (human prominin-1 in cancer cells has been postulated to be a marker of stemness and is considered as a putative marker of cancer stem cells (CSCs. We designed a study to describe the expression pattern of CD133 in normal skin and in epithelial cutaneous neoplasms. Methods. The CD133 immunohistochemical expression of forty-three eccrine and apocrine tumors was compared to that observed in other epithelial tumors of the skin. In addition, flow cytometry was used to detect the CD133 expression of four epithelial skin neoplasms, including one porocarcinoma. Results. CD133 immunoreactivity at the apical or at the apicolateral surface of cells forming glandular structures was observed. Cells from solid areas of benign or malignant tumors were not stained. The porocarcinoma derived culture cells showed a 22% of CD133 positive cells using flow cytometry, while squamous cell carcinoma cultures contained less than 0.1%. Conclusions. These observations indicate that CD133 is a specific marker of glandular differentiation that could be included in the diagnostic panel of cutaneous tumors with possible eccrine or apocrine differentiation. However, the use of CD133 expression as a marker of CSCs should be interpreted with caution in experiments of skin.

  2. Are newly discovered drivers of immune-mediated skin disorders expressed in normal skin regenerating from standardized surface injury?

    NARCIS (Netherlands)

    Hendriks, A.G.M.; Keijsers, R.R.M.C.; Seyger, M.M.B.; Erp, P.E.J. van; Kerkhof, P.C.M. van de

    2014-01-01

    Background: In healthy skin, tape stripping induces a transient wave of histological changes resembling immune-mediated skin diseases, such as psoriasis. The response to surface trauma may harbor mechanisms which are also relevant to the development of Koebner-positive skin disorders. However, studi

  3. The early response of p53-dependent proteins during radiotherapy in human rectal carcinoma and in adjacent normal tissue

    NARCIS (Netherlands)

    Stift, A; Prager, G; Selzer, E; Widder, J; Kandioler, D; Friedl, J; Teleky, B; Herbst, F; Wrba, F; Bergmann, M

    2003-01-01

    The aim of this study was to investigate the activation of the p53 pathway and the induction of apoptosis during preoperative radiotherapy in normal human rectal tissue and in rectal carcinoma. Twelve patients with rectal cancer of the lower third were enrolled in this study. Tumor specimens and adj

  4. Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

    International Nuclear Information System (INIS)

    Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

  5. cdk4 Deficiency Inhibits Skin Tumor Development but Does Not Affect Normal Keratinocyte Proliferation

    Science.gov (United States)

    Rodriguez-Puebla, Marcelo L.; Miliani de Marval, Paula L.; LaCava, Margaret; Moons, David S.; Kiyokawa, Hiroaki; Conti, Claudio J.

    2002-01-01

    Most human tumors have mutations that result in deregulation of the cdk4/cyclin-Ink4-Rb pathway. Overexpression of D-type cyclins or cdk4 and inactivation of Ink4 inhibitors are common in human tumors. Conversely, lack of cyclin D1 expression results in significant reduction in mouse skin and mammary tumor development. However, complete elimination of tumor development was not observed in these models, suggesting that other cyclin/cdk complexes play an important role in tumorigenesis. Here we described the effects of cdk4 deficiency on mouse skin proliferation and tumor development. Cdk4 deficiency resulted in a 98% reduction in the number of tumors generated through the two-stage carcinogenesis model. The absence of cdk4 did not affect normal keratinocyte proliferation and both wild-type and cdk4 knockout epidermis are equally affected after topical treatment with the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA), resulting in epidermal hyperplasia. In similar fashion, cdk4 knockout keratinocytes proliferated well in an in vivo model of wound-induced proliferation. Biochemical studies in mouse epidermis showed that cdk6 activity increased twofold in cdk4-deficient mice compared to wild-type siblings. These results suggest that therapeutic approaches to inhibit cdk4 activity could provide a target to inhibit tumor development with minimal or no effect in normal tissue. PMID:12163365

  6. Minimal erythema response (MED to solar simulated irradiation in normal Indian skin

    Directory of Open Access Journals (Sweden)

    Mehta Rai Vandana

    2004-09-01

    Full Text Available BACKGROUND: Phototesting is an essential tool in the investigation of photodermatoses. AIMS: The main aim was to study the cutaneous response to UVR in terms of minimal erythema dose (MED to both UVA and UVB in normal Indian subjects with a solar simulator and to study the relationship of skin type to MED. METHODS: One hundred healthy volunteers not on any medication and without any history of photodermatoses were phototested using a solar simulator with whole spectrum irradiation (UVA, UVB and visible light and only visible and UVA radiation. The tested areas were marked with gentian violet and readings were taken after 24 hrs. RESULTS: Of the 100 volunteers, 48% were males and 52% were females, with a mean age of 36.6 ± 11.6 yrs. The most common skin type among Indians was type 5 (46% followed by type 4 (41%. The mean MED for UVB was 61.5 ± 17.25J/cm2. The MED for UVA could not be determined as none of the patients showed any erythema after irradiation for 45 minutes. CONCLUSIONS: As the MED is found to be low in idiopathic acquired photodermatoses, the MED in the normal population could serve as a baseline data in the investigation.

  7. Laser-induced fluorescence and reflectance spectroscopy for the discrimination of basal cell carcinoma from the surrounding normal skin tissue.

    Science.gov (United States)

    Drakaki, E; Kaselouris, E; Makropoulou, M; Serafetinides, A A; Tsenga, A; Stratigos, A J; Katsambas, A D; Antoniou, C

    2009-01-01

    The object of this study was to investigate whether laser-induced skin autofluorescence (LIF) and/or light reflectance spectra could provide a useful contrast between basal cell carcinoma (BCC) tissues and the surrounding healthy skin. Unstained human skin samples, excised from humans undergoing biopsy examination, were irradiated with a nitrogen laser (lambda = 337 nm) for excitation of autofluorescence and a tungsten halogen lamp for the reflectance measurements. The ex vivo spectroscopic results were correlated with the histopathology images to distinguish the areas of BCC from those of the surrounding health skin. A simple spectral analysis technique was also applied for better skin diagnosis. In conclusion, it seems that LIF and reflectance spectra could be used to differentiate neoplastic from normal skin tissue using an appropriate classification model analysis. PMID:19365155

  8. Dramatic increase in oxidative stress in carbon-irradiated normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Skin complications were recently reported after carbon-ion (C-ion) radiation therapy. Oxidative stress is considered an important pathway in the appearance of late skin reactions. We evaluated oxidative stress in normal human skin fibroblasts after carbon-ion vs. X-ray irradiation. Survival curves and radiobiological parameters were calculated. DNA damage was quantified, as were lipid peroxidation (LPO), protein carbonylation and antioxidant enzyme activities. Reduced and oxidized glutathione ratios (GSH/GSSG) were determined. Pro-inflammatory cytokine secretion in culture supernatants was evaluated. The relative biological effectiveness (RBE) of C-ions vs. X-rays was 4.8 at D0 (irradiation dose corresponding to a surviving fraction of 37%). Surviving fraction at 2 Gy (SF2) was 71.8% and 7.6% for X-rays and C-ions, respectively. Compared with X-rays, immediate DNA damage was increased less after C-ions, but a late increase was observed at D10% (irradiation dose corresponding to a surviving fraction of 10%). LPO products and protein carbonyls were only increased 24 hours after C-ions. After X-rays, superoxide dismutase (SOD) activity was strongly increased immediately and on day 14 at D0% (irradiation dose corresponding to a surviving fraction of around 0%), catalase activity was unchanged and glutathione peroxidase (GPx) activity was increased only on day 14. These activities were decreased after C-ions compared with X-rays. GSH/GSSG was unchanged after X-rays but was decreased immediately after C-ion irradiation before an increase from day 7. Secretion of IL-6 was increased at late times after X-ray irradiation. After C-ion irradiation, IL-6 concentration was increased on day 7 but was lower compared with X-rays at later times. C-ion effects on normal human skin fibroblasts seemed to be harmful in comparison with X-rays as they produce late DNA damage, LPO products and protein carbonyls, and as they decrease antioxidant defences. Mechanisms leading to this

  9. Site-specific keloid fibroblasts alter the behaviour of normal skin and normal scar fibroblasts through paracrine signalling.

    Directory of Open Access Journals (Sweden)

    Kevin J Ashcroft

    Full Text Available Keloid disease (KD is an abnormal cutaneous fibroproliferative disorder of unknown aetiopathogenesis. Keloid fibroblasts (KF are implicated as mediators of elevated extracellular matrix deposition. Aberrant secretory behaviour by KF relative to normal skin fibroblasts (NF may influence the disease state. To date, no previous reports exist on the ability of site-specific KF to induce fibrotic-like phenotypic changes in NF or normal scar fibroblasts (NS by paracrine mechanisms. Therefore, the aim of this study was to investigate the influence of conditioned media from site-specific KF on the cellular and molecular behaviour of both NF and NS enabled by paracrine mechanisms. Conditioned media was collected from cultured primary fibroblasts during a proliferative log phase of growth including: NF, NS, peri-lesional keloid fibroblasts (PKF and intra-lesional keloid fibroblasts (IKF. Conditioned media was used to grow NF, NS, PKF and IKF cells over 240 hrs. Cellular behavior was monitored through real time cell analysis (RTCA, proliferation rates and migration in a scratch wound assay. Fibrosis-associated marker expression was determined at both protein and gene level. PKF conditioned media treatment of both NF and NS elicited enhanced cell proliferation, spreading and viability as measured in real time over 240 hrs versus control conditioned media. Following PKF and IKF media treatments up to 240 hrs, both NF and NS showed significantly elevated proliferation rates (p<0.03 and migration in a scratch wound assay (p<0.04. Concomitant up-regulation of collagen I, fibronectin, α-SMA, PAI-1, TGF-β and CTGF (p<0.03 protein expression were also observed. Corresponding qRT-PCR analysis supported these findings (P<0.03. In all cases, conditioned media from growing marginal PKF elicited the strongest effects. In conclusion, primary NF and NS cells treated with PKF or IKF conditioned media exhibit enhanced expression of fibrosis-associated molecular markers

  10. Content of Androgen Receptor in Cultured Genital Skin Fibroblast From Different Ages of Chinese Normal Men

    Institute of Scientific and Technical Information of China (English)

    卢建; 何立敏; 张金山; 杨震; 周云

    1995-01-01

    A ratpid, simple, reliable method is described for assaying androgen receptor (AR) in dispersed, whole, cultured human genital skin fibroblasts (GSF) with a synthetic androgen, 3H-methyltrienolone (3H-R1881). Receptors for androgen in GSF exhiblt high affinity (Kd=3.0±0.1 nmol/L), low binding capacity and androgen specificity. The content of AR in cultured GSF from 40 normal men varying in age from 1.5—60 years u:as also investigated by this assay. Scatchard analysis and slngle plot revealed the presence of 4.500-8500 binding sites per cell, mean number of AR in GSF of these men is 6288±1082 binding sites/cell. No significant difference was observed in the content of AR in different age groups. This result showed that the content of AR in these ceils did not change with age.

  11. Multiphoton imaging of excised normal skin and keloid scar: preliminary investigations

    Science.gov (United States)

    Brewer, Michael B.; Yeh, Alvin T.; Torkian, Behrooz; Sun, Chung-Ho; Tromberg, Bruce J.; Wong, Brian J.

    2004-07-01

    Wound healing is a physiologic process that acts to repair disruptions in the continuity of tissue caused by injury or surgical incision. Keloids and hypertrophic scars are forms of aberrant wound healing, which are characterized by the overproduction of collagen, resulting in an excessive amount of scar tissue. Keloid tumors, by definition, grow outside the boundary of the original tissue damage. Multiphoton microscopy (MPM) is an imaging technique which allows imaging of living specimens, without the use of fixation or stains. Images of collagen fibers are produced by the second harmonic signal intensity generated by endogenous fluorescence through excitation by infrared laser light. A postauricular keloid tumor was excised from a patient. The tissue was dissected, and a portion was imaged using MPM. Normal skin tissue was isolated from a patient undergoing a facelift. A portion of this tissue was also dissected and imaged using MPM. MPM images were taken using a 63X water immersion objective lens on a two-photon microscope and a titanium-sapphire laser. Images were taken beginning at the surface of the tissue and moving in at intervals of 200 nm to a final depth of 30 μm. The two-photon images were used to reconstruct three-dimensional representations of the collagen matrix within the tissues, which are readily contrasted. Density of the collagen within each tissue was also ascertained using depth dependant decay of the image intensity. Multiphoton imaging was successfully used to image the collagen matrix of normal skin and a keloid scar, demonstrating differences in their microstructures.

  12. Distribution and ultrastructure of pigment cells in the skins of normal and albino adult turbot, Scophthalmus Maximus

    Institute of Scientific and Technical Information of China (English)

    GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui

    2007-01-01

    The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.

  13. Studies on 133Xe wash-out from human skin: quantitative measurements of blood flow in normal and corticosteroid-treated skin

    International Nuclear Information System (INIS)

    Blood flow was measured by the 133Xe technique in normal and corticosteroid-treated skin. Epicutaneous and intracutaneous methods of tracer application were compared in normal skin. The two labeling methods were equally suitable for measuring cutaneous blood flow provided calculations in both cases were based on a biexponential resolution of the wash-out curve in its cutaneous and subcutaneous components and provided the traumatic hyperemia phase was considered, when intracutaneous application of the tracer was used. Results were invalidated if calculations were based on initial slope of the washout curves. Topical application of beta-methasone valerate resulted in a reduction in cutaneous blood flow as measured by the intracutaneous technique with curve resolution, whereas no effect could be demonstrated when calculations were based on the initial slopes of the curves. The 133Xe technique is a simple and reliable method for measuring cutaneous blood flow, which might prove useful in estimations of penetration ability and potency of topical corticosteroids

  14. DNA-protein crosslinking in normal human skin fibroblasts exposed to ultraviolet radiation

    International Nuclear Information System (INIS)

    Cultured normal human skin fibroblasts were exposed to different fluences of 254 nm UV and the levels of DNA-protein crosslinks (DPC) measured with alkaline elution immediately after irradiation or following a 24-hour incubation (370C). For cells exposed to 10J/m/sup 2/ and then incubated, the level of DPC decreased to that of unexposed cells. When the fluences increased, the levels of DPC measured following a 24-hour incubation increased as compared with non-incubated cells. At fluences higher than 100J/m/sup 2/, the DPC levels of incubated cells exceeded the DPC levels of non-incubated cells. When the single strand breaks (SSB) and double strand breaks (DSB) were measured under a deproteinized condition with alkaline elution and neutral elution, respectively, the levels of SSB and DSB were higher for cells with than for cells without post-irradiation incubation. The simultaneous increase of DPC and proteinase-sensitive SSB and DSB for cells given post-irradiation incubation suggests that a significant part of the DPC observed during post-UV-irradiation incubation were the DNA strand breaks that were tightly associated with proteins. A potential role for type II DNA topoisomerase in the formation of these DPC resulting from either the change in conformational structure caused by the presence of a high level of dimers or an involvement of this enzyme in dimer excision repair will be discussed

  15. DNA-protein crosslinking in normal human skin fibroblasts exposed to solar ultraviolet wavelengths

    International Nuclear Information System (INIS)

    Three normal human skin fibroblast cell lines were exposed to the simulated solar UV radiation produced by a fluorescent sunlamp (wavelength components shorter than either 295, 305 or 315 nm were excluded). The level of DNA-protein crosslinks (DPC) was then measured in those cells either immediately after irradiation or following a 24 h incubation. Cells were exposed to fluences that induce similar levels of DPC. For cells exposed to 10 kJ m-2 of sunlamp UV>295 nm, the level of DPC exhibited a 2-5-fold increase following incubation. In contrast, 40-100% of the DPC were removed upon incubation of cells irradiated with either 10 kJ m-2 of sunlamp UV>305 nm or 150 kJ m-2 of sunlamp UV>315 nm. A major difference between the effects induced by these wavelength regions is that, in addition to DPC, a very high level of pyrimidine dimers is also produced by sunlamp UV>295 nm, whereas much lower dimer yields result from treatment with either sunlamp UV>305 nm or sunlamp UV>315 nm. A potential role for type II DNA topoisomerase in the formation of these DPC resulting from either the change in conformational structure caused by the presence of a high level of dimers or an involvement of this enzyme in dimer excision repair is discussed. (author)

  16. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  17. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture

    DEFF Research Database (Denmark)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh

    2016-01-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts ...

  18. Analysis of differences of gene expressions in keloid and normal skin with the aid of cDNA microarray

    Institute of Scientific and Technical Information of China (English)

    Chen Wei; Fu Xiaobing; Sun Xiaoqing; Sun Tongzhu; Zhao Zhili; Yang Yinhui; Sheng Zhiyong

    2003-01-01

    Background: Microarray analysis is a popular tool to investigate the function of genes that are responsible for the phenotype of the disease. Keloid is a intricate lesion which is probably modulated by interplay of many genes. We ventured to study the differences of gene expressions between keloids and normal skins with the aid of cDNA microarray in order to explore the molecular mechanism underlying keloid formation. Methods: The PCR products of 8400 human genes were spotted on a chip in array. The DNAs were then fixed on the glass plate by a series of treatments. Total RNAs was isolated from freshly excised human keloids and normal skin, and then was purified to mRNA by Oligotex. Both the mRNA from keloids and normal skin was reversely transcribed to cDNAs with the incorporations of fluorescent dUTP, for preparing the hybridization probes. The mixed probes were then hybridized to the cDNA microarray. After highly stringent washing, the cDNA microarray was scanned for the fluorescent signals to display the differences between two kinds of tissues. Results: Among 8400 human genes, there were 402 genes (4.79%) with different expression levels between the keloids and normal skins in all cases, 250were up-regulated (2.98%) and 152 down-regulated (1.81%). Analyses of collagen, fibronectin, proteoglycan,growth factors and apoptosis related molecule gene expression confirmed that our molecular data obtained by cDNA microarray were consistent with published biochemical and clinical observations of keloids. Conclusions: DNA microarray technology is an effective technique in screening for differences in gene expression between keloid and normal skin. Many genes are involved in the formation of keloids. Further analysis of the obtained genes will help understand the molecular mechanism of keloid formation.

  19. Studies on 133Xe wash-out from human skin: quantitative measurements of blood flow in normal and corticosteroid-treated skin.

    Science.gov (United States)

    Kristensen, J K; Wadskov, S

    1977-04-01

    Blood flow was measured by the 133Xe technique in normal and corticosteroid-treated skin. Epicutaneous and intracutaneous methods of tracer application were compared in normal skin. The two labeling methods were equally suitable for measuring cutaneous blood flow provided calculations in both cases were based on a biexponential resolution of the wash-out curve in its cutaneous and subcutaneous components and provided the traumatic hyperemia phase was considered, when intracutaneous application of the tracer was used. Results were invalidated if calculations were based on initial slope of the wash-out curves.Topical application of beta-methasone valerate in a reduction in cutaneous blood flow as measured by the intracutaneous technique with curve resolution, whereas no effect could be demonstrated when calculations were based on the initial slopes of the curves. The 133Xe technique is a simple and reliable method for measuring cutaneous blood flow, which might prove useful in estimations of penetration ability and potency of topical corticosteroids.

  20. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise;

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...

  1. Molecular pathway activation features linked with transition from normal skin to primary and metastatic melanomas in human.

    Science.gov (United States)

    Shepelin, Denis; Korzinkin, Mikhail; Vanyushina, Anna; Aliper, Alexander; Borisov, Nicolas; Vasilov, Raif; Zhukov, Nikolay; Sokov, Dmitry; Prassolov, Vladimir; Gaifullin, Nurshat; Zhavoronkov, Alex; Bhullar, Bhupinder; Buzdin, Anton

    2016-01-01

    Melanoma is the most aggressive and dangerous type of skin cancer, but its molecular mechanisms remain largely unclear. For transcriptomic data of 478 primary and metastatic melanoma, nevi and normal skin samples, we performed high-throughput analysis of intracellular molecular networks including 592 signaling and metabolic pathways. We showed that at the molecular pathway level, the formation of nevi largely resembles transition from normal skin to primary melanoma. Using a combination of bioinformatic machine learning algorithms, we identified 44 characteristic signaling and metabolic pathways connected with the formation of nevi, development of primary melanoma, and its metastases. We created a model describing formation and progression of melanoma at the level of molecular pathway activation. We discovered six novel associations between activation of metabolic molecular pathways and progression of melanoma: for allopregnanolone biosynthesis, L-carnitine biosynthesis, zymosterol biosynthesis (inhibited in melanoma), fructose 2, 6-bisphosphate synthesis and dephosphorylation, resolvin D biosynthesis (activated in melanoma), D-myo-inositol hexakisphosphate biosynthesis (activated in primary, inhibited in metastatic melanoma). Finally, we discovered fourteen tightly coordinated functional clusters of molecular pathways. This study helps to decode molecular mechanisms underlying the development of melanoma.

  2. Noninvasive evaluation of collagen and hemoglobin contents and scattering property of in vivo keloid scars and normal skin using diffuse reflectance spectroscopy: pilot study

    Science.gov (United States)

    Tseng, Sheng-Hao; Hsu, Chao-Kai; Yu-Yun Lee, Julia; Tzeng, Shih-Yu; Chen, Wan-Rung; Liaw, Yu-Kai

    2012-07-01

    Collagen is a rich component in skin that provides skin structure integrity; however, its contribution to the absorption and scattering properties of various types of skin has not been extensively studied. We considered the contribution of the collagen to the absorption spectrum of in vivo normal skin and keloids of 12 subjects derived from our diffuse reflectance spectroscopy (DRS) system in the wavelength range from 550 to 860 nm. It was found that the collagen concentration, the hemoglobin oxygen saturation, and the reduced scattering coefficient of keloids were remarkably different from that of normal skin. Our results suggest that our DRS system could assist clinicians in understanding the functional and structural condition of keloid scars. In the future, we will evaluate the accuracy of our system in the keloid diagnosis and investigate the applicability of our system for other skin-collagen-related studies.

  3. Identification and distribution of a novel Malassezia species yeast on normal equine skin.

    Science.gov (United States)

    Nell, A; James, S A; Bond, C J; Hunt, B; Herrtage, M E

    2002-03-30

    This study aimed to investigate the distribution of Malassezia species yeasts on the skin of healthy horses. Acetate tape samples were obtained from the lip, axilla, interbulbar region, groin and anus of 12 healthy horses. The samples were stained and examined microscopically and sites harbouring yeast-like organisms were identified. Contact plates were applied to the skin at these sites and cultured at 26 degrees C and 32 degrees C. No growth was obtained on horse blood, Sabouraud's dextrose or modified Dixon's agar. A pure growth of a Malassezia-type organism was obtained on Sabouraud's dextrose agar enriched with oleic acid when it was incubated at 30 degrees C. It was identified by 26S ribosomal DNA D1/D2 sequence analysis as a member of the genus Malassezia, and most closely related to Malassezia sympodialis. However, the level of sequence divergence indicated that it was a novel species. PMID:11999275

  4. Reflectance Confocal Mıcroscopy; Morphology of Normal Skin and The Use in Melanocytic Lesions

    OpenAIRE

    Aslı Vefa Turgut Erdemir; Ayşe Esra Koku Aksu

    2013-01-01

    In vivo reflectance confocal microscopy (RCM) is a noninvasive method that allows imaging of cells and structures in living skin with resolution close to the histological analysis. RCM allows the assessment of dynamic events in the epidermis, papillary dermis and superficial reticular dermis. From the stratum corneum to a depth of a maximum of 350 μm can be analysed. The noninvasive feature of this technique, allows repetitive imaging without any damage to the affected area and to evaluate th...

  5. Collagen Content and Electrophoretic Analysis of Type I Collagen in Breast Skin of Heterozygous Naked Neck and Normally Feathered Commercial Broilers

    OpenAIRE

    BİLGEN, Güldehen

    1999-01-01

    This study was conducted to evaluate the breast skin collagen content and electrophoretic analyses of type I collagen in heterozygous naked neck and normally feathered commercial chicks. A total of 72 birds from each genotype were randomly selected at 7 weeks and slaughtered. Breast skin was separated from each carcass and was analysed for collagen content and gel electrophopresis of type I collagen was performed. Males had significantly higher level of skin collagen content than females i...

  6. Percutaneous absorption of estradiol and progesterone in normal and appendage-free skin of the hairless rat: lack of importance of nutritional blood flow.

    Science.gov (United States)

    Hueber, F; Besnard, M; Schaefer, H; Wepierre, J

    1994-01-01

    Percutaneous absorption occurs after passive diffusion through the different layers of the skin and its appendages. Thereafter, a resorption process into the cutaneous microcirculation brings the compounds into the systemic circulation. The objective of this in vivo study in the hairless rat was to compare the percutaneous absorption of two steroids on normal and appendage-free (scar) skin and to show if differences in absorption result only from the lack of hair follicles and sebaceous glands and/or from a modification of local blood flow. Percutaneous absorption was evaluated with estradiol and progesterone after 30 min, 2 and 6 h. Except after 30 min, the reservoir function of the stratum corneum of scar skin was approximately twice as high as in normal skin. Eighty to ninety percent of the estradiol and progesterone found in the stratum corneum were located in its superficial layers. Inversely, whatever the application time was, the concentrations of both steroids in the epidermis and dermis were significantly higher in normal skin than in scar skin with maximal difference between about 40 and 400 microns, the area of sebaceous gland localization. Cutaneous blood flow in full-thickness skin, assessed by the thallium-201 method, was globally identical in normal and in scar skin. In scar skin, at the level of papillary dermis, a decrease in blood flow due to the thicker viable epidermis and the flat dermoepidermal junction has been shown without implying an accumulation of drug in the epidermis and superficial dermis. Under these conditions, our results clearly demonstrate that the nutritional blood flow does not interfere with the percutaneous absorption of estradiol and progesterone in normal and scar skin. Thus, they confirm the significant contribution of hair follicles and sebaceous glands to drug penetration into the skin and subsequently the systemic circulation.

  7. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin.

    Science.gov (United States)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-03-01

    Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes. PMID:23376073

  8. In vivo study for the discrimination of cancerous and normal skin using fibre probe-based Raman spectroscopy.

    Science.gov (United States)

    Schleusener, Johannes; Gluszczynska, Patrycja; Reble, Carina; Gersonde, Ingo; Helfmann, Jürgen; Fluhr, Joachim W; Lademann, Jürgen; Röwert-Huber, Joachim; Patzelt, Alexa; Meinke, Martina C

    2015-10-01

    Raman spectroscopy has proved its capability as an objective, non-invasive tool for the detection of various melanoma and non-melanoma skin cancers (NMSC) in a number of studies. Most publications are based on a Raman microspectroscopic ex vivo approach. In this in vivo clinical evaluation, we apply Raman spectroscopy using a fibre-coupled probe that allows access to a multitude of affected body sites. The probe design is optimized for epithelial sensitivity, whereby a large part of the detected signal originates from within the epidermal layer's depth down to the basal membrane where early stages of skin cancer develop. Data analysis was performed on measurements of 104 subjects scheduled for excision of lesions suspected of being malignant melanoma (MM) (n = 36), basal cell carcinoma (BCC) (n = 39) and squamous cell carcinoma (SCC) (n = 29). NMSC were discriminated from normal skin with a balanced accuracy of 73% (BCC) and 85% (SCC) using partial least squares discriminant analysis (PLS-DA). Discriminating MM and pigmented nevi (PN) resulted in a balanced accuracy of 91%. These results lie within the range of comparable in vivo studies and the accuracies achieved by trained dermatologists using dermoscopy. Discrimination proved to be unsuccessful between cancerous lesions and suspicious lesions that had been histopathologically verified as benign by dermoscopy. PMID:26010742

  9. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  10. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  11. Skin.

    Science.gov (United States)

    Mancini, Anthony J

    2004-04-01

    Human skin provides a barrier between the host and the physical, chemical, and biological environment. It is also a potential portal of entry for hazardous or infectious agents and a potential target of environmental toxins. Cutaneous vulnerability may take on many forms in the embryo, infant, child, and adolescent. Teratogenic agents may occasionally target skin, as appreciated in the proposed association of the antithyroid medication methimazole, with the congenital malformation known as aplasia cutis congenita. Percutaneous absorption of topically applied substances and the potential for resultant drug toxicities are important considerations in the child. Many topical agents have been associated with systemic toxicity, including alcohol, hexachlorophene, iodine-containing compounds, eutectic mixture of local anesthetics, and lindane. Percutaneous toxicity is of greatest concern in the premature infant, in whom immaturity of the epidermal permeability barrier results in disproportionately increased absorption. Immature drug metabolism capabilities may further contribute to the increased risk in this population. Ultraviolet (UV) radiation exposure, which increases an individual's risk of cutaneous carcinogenesis, may be a particularly significant risk factor when it occurs during childhood. The "critical period hypothesis" suggests that UV exposure early in life increases the risk of eventual development of malignant melanoma. Other risk factors for malignant melanoma may include severe sunburns during childhood, intense intermittent UV exposure, and increased susceptibility of pediatric melanocytes to UV-induced DNA damage. Last, percutaneous exposure to environmental toxins and chemicals, such as insecticides and polychlorinated biphenyls, may differ between children and adults for several reasons, including behavioral patterns, anatomic and physiologic variations, and developmental differences of vital organs. PMID:15060207

  12. Exploring the spatial dimension of estrogen and progesterone signaling: detection of nuclear labeling in lobular epithelial cells in normal mammary glands adjacent to breast cancer

    OpenAIRE

    Grote, Anne; Abbas, Mahmoud; Linder, Nina; Kreipe, Hans H.; Lundin, Johan; Feuerhake, Friedrich

    2014-01-01

    Abstract Background Comprehensive spatial assessment of hormone receptor immunohistochemistry staining in digital whole slide images of breast cancer requires accurate detection of positive nuclei within biologically relevant regions of interest. Herein, we propose a combination of automated region labeling at low resolution and subsequent detailed tissue evaluation of subcellular structures in lobular structures adjacent to breast cancer, as a proof of concept for the approach to analy...

  13. Characterisation of a behavioural protocol for the assessment of nociception in normal and inflamed porcine skin

    DEFF Research Database (Denmark)

    di Giminiani, Pierpaolo

    2012-01-01

    pain sensitivity following ultraviolet-B and capsaicin-induced inflammation in porcine skin. A series of experiments was performed to characterise the new experimental protocol, which included (1) the identification and quantification of reflexive behavioural responses indicative of the nociceptive......The study of pain has been historically based on the investigation of human clinical conditions with the purpose of identifying the direct causes of pain to develop suitable analgesic treatments. The need to comprehend the mechanisms behind the processes of pain ignited the rapid development of pre......-clinical research, based on the investigation of experimental models designed to reproduce painful conditions or parts thereof. Animals play a fundamental role, since they provide the platform to reproduce human conditions in order to study the mechanisms behind pain processes, and during the last three decades...

  14. Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus

    Institute of Scientific and Technical Information of China (English)

    ZHU Jie; ZHANG Xiumei; GAO Tianxiang

    2005-01-01

    Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.

  15. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m2. At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  16. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers.

    Science.gov (United States)

    Voiculescu, Vlad; Calenic, Bogdan; Ghita, Mihaela; Lupu, Mihai; Caruntu, Ana; Moraru, Liliana; Voiculescu, Suzana; Ion, Alexandra; Greabu, Maria; Ishkitiev, Nikolay; Caruntu, Constantin

    2016-01-01

    Squamous cells carcinoma (SCC) is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides), and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies. PMID:27642215

  17. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Directory of Open Access Journals (Sweden)

    Vlad Voiculescu

    2016-01-01

    Full Text Available Squamous cells carcinoma (SCC is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides, and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies.

  18. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Science.gov (United States)

    Ghita, Mihaela; Moraru, Liliana; Voiculescu, Suzana; Greabu, Maria

    2016-01-01

    Squamous cells carcinoma (SCC) is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides), and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies. PMID:27642215

  19. Validity of bioeffect dose response models for normal tissue early and late complications of the skin

    International Nuclear Information System (INIS)

    Background: The bioeffect of a physical dose depends on the nature of the tissue, fractionation scheme, dose rate and treatment time. Certainly, experienced radiotherapists are convinced of the existence of patient-to-patient variability in normal tissue response to radiotherapy for malignant tumours. The absorbed dose needs to be translated into a bioeffect dose, which takes into account treatment variables and the radiobiological characteristics of the relevant tissue. Various bioeffect models such as NSD, CRE, TDF and BED have been proposed to predict the biological effect of radiotherapy treatments. Aim: This study was aimed at deriving tolerance bioeffect dose values for normal tissue complication rate. Materials/Methods: Compiled clinical data of time dose fractionation schedules and incidence of erythema, desquamation and telangiectasia were used for the present analysis. Results: For erythema and desquamation the radiation dose varied from 23.9 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .1 at 3 years) the radiation dose varied from 25.8 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .2 at 5 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 68 days. For telangiectasia (score .1, .2, .3, .4 at 10 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 35 fractions (dose per fraction 1.7 to 7.3 Gy) in 22 to 68 days. TDF and LQF values for erythema, desquamation and telangiectasia were evaluated with a/b values of 7.5 Gy, 11.2 Gy and 2.8 Gy respectively. TDF and LQF had a statistically significant correlation with probability of erythema, desquamation and telangiectasia (p<0.001). Conclusions: TDF and LQF values should be limited to 60 and 86 Gy in order to limit the probability of telangiectasia. (authors)

  20. Establishment of field change by expression of cytokeratins 8/18, 19, and MMP-9 in an apparently normal oral mucosa adjacent to squamous cell carcinoma: A immunohistochemical study

    Directory of Open Access Journals (Sweden)

    Alka D Kale

    2012-01-01

    Full Text Available Background: Squamous cell carcinoma is the most frequent malignancy of the oral cavity. The survival rate of this malignancy has not improved from past two decades. The major factors responsible for this could be due to loco regional and distant metastatic spread. However, the other important prognostic factor is concomitant occurrence and recurrence of multiple primary carcinomas in the head and neck region, which is explained as the concept of field cancerization. The evidence to support the field change in normal mucosa of Oral squamous cell carcinoma (OSCC through biological markers using immunohistochemistry has always been challenging. Aim: Hence, the aim of the present research is to identify changes in the expression of CK 8/18, 19, and MMP-9 to visualize field changes in the clinically normal mucosa adjacent to OSCC and compare with non neoplastic normal oral mucosa. Materials and Methods: 20 cases of OSCC with radical resection specimens were included in the study. Lesional tissue and adjacent normal looking mucosa were taken during grossing. Ten cases of non-neoplastic normal oral mucosa are also included in the study. Markers such as CK 8/18, CK 19, and MMP-9 are used by the immunohistochemical method in this present study. Result and Conclusion: The enhance expression of CK 8/18 (80%, CK 19 (70%, and MMP 9 (90% in ANM was noted and furthermore in six ANM showing severe dysplasia with enhance expression of CK 8/18, CK 19, and MMP 9 in the apparently normal oral mucosa can suggest a field cancerization.

  1. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  2. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells.

  3. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  4. Skin fold thickness at abdomen: a simple anthropometric measurement may compliment metabolic syndrome definition in patients with normal waist circumference

    Institute of Scientific and Technical Information of China (English)

    Toan C Nguyen; Thai Q Ngo; Son V Nguyen; Hieu T Luong; Khoa TA Pham; Cong D Nguyen

    2006-01-01

    Backgroud and Objectives Previous studies have reported that skin fold thickness (SF) strongly correlated with insulin resistance in the metabolic syndrome (MetS). In this study, we developed a MetS definition by SF at A8 point (SFA8) on Erdheim diagram(MetSSFA8) in essential hypertensive patients. Subjects and Methods Medical records of 268 essential hypertensive patients (126males and 122 females) were analyzed, including 210 non-diabetic patients (NDM group) and 58 patients with diabetes (DM group).The mean age was 61.4 ± 9.9 and 59.0 ± 11.0 years, respectively. The control group consisted of 90 non-diabetic, non-hypertensive patients with a mean age of 58.0 ± 11.3 years. The proposed MetSSFA8 definition included SFA8 specific values ( ≥30 mm in female and ≥27 mm in male) and at least two of the following: raised triglyceride levels ( ≥1.7 mmol/L), or specific treatment for this lipid abnormality; raised blood pressure (SBP≥130 mmHg and/or DBP≥85 mmHg), or treatment of previously diagnosed hypertension;reduced HDL-cholesterol (< 1.03 mmol/L in men, <1.29 mmol/L in women), or specific treatment for this lipid abnormality; raised fasting plasma glucose (≥5.6 mmol/l), or previously diagnosed DM. Metabolic Syndrome by the National Cholesterol Education Program and International Diabetes Federation definitions were determined with abdominal obesity defined by Asia-Pacific criteria for waist circumference (NCEPA and IDFA). Results The percentage of MetS as defined by NCEPA, IDFA and MetSSFA8 in NDM group was lower than that of NCEPA, IDFA and MetSSFA8 in DM group [OR=7.7 (95%CI, 2.9-20.2) and 2.5 (95%CI, 1.4-4.8) and 2.7(95%CI, 1.3-5.6), respectively] and higher than that of the control group [OR=53.3 (95%CI, 16.7-170.6), 5.8 (95%CI, 2.6-13.2) and18.8 (95%CI, 7.3-48.7), respectively]. The percentage of MetS by NCEPA, IDFA and MetSSFA8 in males in NDM group was lower than the percentage of MetS by NCEPA, IDFA and MetSSFA8 in females in NDM group (50

  5. Host-cell reactivation of UV-irradiated and chemically-treated herpes simplex virus-1 by xeroderma pigmentosum, xp heterozygotes and normal skin fibroblasts

    International Nuclear Information System (INIS)

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)

  6. Effects of dietary flax seed and sunflower seed supplementation on normal canine serum polyunsaturated fatty acids and skin and hair coat condition scores.

    Science.gov (United States)

    Rees, C A; Bauer, J E; Burkholder, W J; Kennis, R A; Dunbar, B L; Bigley, K E

    2001-04-01

    This prospective study involved supplementing 18 normal dogs with flax seed (FLX) and sunflower seed (SUN) and evaluating their effects on skin and hair coat condition scores and serum polyunsaturated fatty acids (PUFA) concentrations. Skin and hair coat were evaluated in a double-blinded fashion using a numeric scoring system and serum PUFA concentrations were determined. Our hypothesis was that changes in serum PUFA concentrations are associated with improvements in skin and hair coat and that serum PUFA would provide an objective method for making dietary fatty acid supplement recommendations. Although a numerical improvement was found in hair coat quality in both groups, this improvement was not sustained beyond 28 days. The relative per cent of 18:3n-3 concentrations in serum phospholipids increased in the FLX treated dogs but these concentrations remained unchanged in the SUN treated dogs. Also, elevations in relative per cent of 18:2n-6 concentrations in serum phospholipids were seen in the FLX group. The ratio of serum polyunsaturated to saturated fatty acids also showed a transient increase. These increases preceded the peak skin condition score peak value by approximately 14 days. It was concluded that a 1-month supplementation with either flax seed or sunflower seed in dogs provides temporary improvement in skin and hair coat. These changes appeared to be associated with increased serum 18 carbon PUFA.

  7. Host-cell reactivation of uv-irradiated and chemically treated Herpes simplex virus type 1 strain MP in normal and xeroderma pigmentosum skin fibroblasts

    International Nuclear Information System (INIS)

    The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants

  8. Role of transepidermal and transfollicular routes in percutaneous absorption of steroids: in vitro studies on human skin.

    Science.gov (United States)

    Hueber, F; Schaefer, H; Wepierre, J

    1994-01-01

    Percutaneous absorption theoretically comprises two components: the transepidermal and the transfollicular routes. The aim of the present work was to confirm this hypothesis in the human skin by comparing the in vitro percutaneous absorption of four steroids through scar skin without hair follicles and sebaceous glands and through normal adjacent skin from abdominal or mammary plasties. In all cases, the absorption of the four steroids was significantly higher in normal skin than in scar skin. The cumulative percentages of progesterone and testosterone after 8 h of application were, respectively, 3.1- and 2.4-fold higher in normal skin than in scar skin. After 24 h of application, the cumulative percentages of estradiol and hydrocortisone were 1.7- and 2.4-fold higher in normal skin than in scar skin. At the end of the experiments, the quantities of drugs remaining in the skin after 8 or 24 h of application were the same in normal skin and in scar skin except for progesterone for which they were 2-fold greater in normal than in scar skin. In each case, a histological characterization of the scar skin was made in comparison with the normal adjacent skin. The main modifications observed on scar skin were the following: absence of hair follicles and sebaceous glands, thinning of the collagenous fibers with parallel orientation to the dermoepidermal junction and decrease in the number or disappearance of the elastic fibers. These experiments confirmed that human skin appendages, hair follicles and sebaceous glands, constitute a route of penetration for steroids and thus probably for other chemicals of similar molecular weight and properties.

  9. Hyperpigmentation of the skin associated with minocycline therapy

    Energy Technology Data Exchange (ETDEWEB)

    Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.

    1985-05-01

    Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients.

  10. Measurement of serum immunoglobulin E (IgE) specific for house dust mite antigens in normal cats and cats with allergic skin disease.

    Science.gov (United States)

    Taglinger, K; Helps, C R; Day, M J; Foster, A P

    2005-05-01

    The purpose of this study was to determine whether cats with allergic skin disease have significant concentrations of serum Immunoglobulin E (IgE) specific for antigens derived from the house dust mites (HDM) Dermatophagoides farinae (DF) and Dermatophagoides pteronyssinus (DP). Enzyme-linked immunosorbent assays (ELISA) were developed for this purpose. Binding of serum allergen-specific IgE was detected via the use of biotinylated Fc-epsilon receptor alpha chain protein (FcvarepsilonRIalpha). Following optimisation of the assay, serum samples from 59 cats with allergic skin disease and 54 clinically normal cats were screened. Results were expressed as ELISA units per ml (EU/ml) compared to a standard curve. Serological findings were correlated with the clinical presentation of affected cats. Cats with symptoms of feline allergic skin disease were grouped as follows: self-induced alopecia without lesions (group 1), papulocrusting dermatitis (group 2), eosinophilic granuloma complex (group 3), papular/ulcerative dermatitis of head and neck/facial dermatitis (group 4), and a combination of symptoms (group 5). Control normal cats comprised the final group (group 6). The Kruskal-Wallis test was used for statistical analysis. There was no significant difference between groups for DF- and DP-specific IgE concentrations with a p-value of 0.875 and 0.705, respectively. Although the FcvarepsilonRIalpha-based ELISA was able to detect house dust mite-specific feline IgE, the presence of this allergen-specific IgE correlates poorly with the presence of clinical manifestations of allergic skin disease. The results of this study question the clinical relevance of house dust mite-specific IgE in feline allergic skin disease.

  11. Loss of normal profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin disease ichthyosis vulgaris.

    Science.gov (United States)

    Presland, R B; Boggess, D; Lewis, S P; Hull, C; Fleckman, P; Sundberg, J P

    2000-12-01

    Flaky tail (gene symbol ft) is an autosomal recessive mutation in mice that results in a dry, flaky skin, and annular tail and paw constrictions in the neonatal period. Previous studies demonstrated that the ft mutation maps to the central region of mouse chromosome 3, in the vicinity of the epidermal differentiation complex, a gene locus that includes many nonkeratin genes expressed in epidermis. In this study we report a detailed characterization of the flaky tail mouse. Affected homozygous ft/ft mice exhibit large, disorganized scales on tail and paw skin, marked attenuation of the epidermal granular layer, mild acanthosis, and orthokeratotic hyperkeratosis. Biochemical analysis demonstrated that ft/ft mice lacked normal high molecular profilaggrin (approximately 500 kDa), and instead expressed a lower molecular weight form of profilaggrin (220 kDa) that is not proteolytically processed to profilaggrin intermediates or filaggrin. Mutant mice lacked the large, irregular F-type keratohyalin granules that contain profilaggrin, and filaggrin was absent from the cornified layers of ft/ft epidermis. The expression of epidermal keratins was unchanged, whereas the cornified envelope proteins involucrin and loricrin were increased in ft/ft epidermis. Cultured ft/ft keratinocytes also synthesized reduced amounts of profilaggrin mRNA and protein, demonstrating that the defect in profilaggrin expression is intrinsic to epidermal cells. These findings demonstrate that flaky tail mice express an abnormal profilaggrin polypeptide that does not form normal keratohyalin F-granules and is not proteolytically processed to filaggrin. We propose that the absence of filaggrin, and in particular the hygroscopic, filaggrin-derived amino acids that are thought to function in epidermal hydration, underlies the dry, scaly skin characteristic of ft/ft mice. This animal model provides a tool for understanding the role of filaggrin in normal epidermal function and may provide insight into

  12. Redox-dependent induction of antioxidant defenses by phenolic diterpenes confers stress tolerance in normal human skin fibroblasts: Insights on replicative senescence.

    Science.gov (United States)

    Carvalho, Ana C; Gomes, Andreia C; Pereira-Wilson, Cristina; Lima, Cristovao F

    2015-06-01

    Mild stress-induced hormesis represents a promising strategy for targeting the age-related accumulation of molecular damage and, therefore, for preventing diseases and achieving healthy aging. Fruits, vegetables, and spices contain a wide variety of hormetic phytochemicals, which may explain the beneficial health effects associated with the consumption of these dietary components. In the present study, the induction of cellular antioxidant defenses by the phenolic diterpenes carnosic acid (CA) and carnosol (CS) were studied in normal human skin fibroblasts, and insights into the aging process at the cellular level investigated. We observed that CA and CS induced several cytoprotective enzymes and antioxidant defenses in human fibroblasts, whose induction was dependent on the cellular redox state for CS and associated with Nrf2 signaling for both compounds. The stress response elicited by preincubation with CS conferred a cytoprotective action against a following oxidant challenge with tert-butyl hydroperoxide, confirming its hormetic effect. Preincubation of normal fibroblasts with CS also protected against hydrogen peroxide-induced premature senescence. Furthermore, cultivation of middle passage normal human skin fibroblasts in the presence of CS ameliorated the physiological state of cells during replicative senescence. Our results support the view that mild stress-induced antioxidant defenses by CS can confer stress tolerance in normal cells and may have important implications in the promotion of healthy aging.

  13. 毛细管电泳检测肺癌及癌旁正常组织蛋白质混合物差异%Capillary Electrophoresis Detection of Lung Cancer and Adjacent Normal Tissue Differences in Protein Mixture

    Institute of Scientific and Technical Information of China (English)

    刘勇; 王荣; 高岚; 贾正平; 谢华; 张军莉; 马骏; 张爱梅; 谢希晖

    2011-01-01

    以建立的毛细管电泳(CE)-激光诱导荧光(LIF)检测蛋白质的方法对提取肺癌及癌旁正常组织蛋白质混合物(变性/活性)差异进行检测.采用异硫氰酸荧光素(FITC)为衍生剂,电泳缓冲液为1×TBE(TBE为Tris-硼酸-EDTA,变性电泳pH 10.0,活性电泳为pH 8.3且含有2 mg/L考马斯亮蓝),分离电压15 kV,柱温15℃,电动进样(10 kV×10 s),激发波长/发射波长=488/520 nm检测时,肺癌及癌旁正常组织蛋白质混合物样品得到较好分离且有明显差异.与目前常用蛋白分析方法:变性SDS-聚丙烯酰胺凝胶电泳(SDS-PAGE)以及活性蓝绿温和胶电泳(BN-PAGE)进行比较.BN-PAGE结果显示肺癌组织相比正常组织有较明显蛋白种类差异;SDS-PAGE结果表明一些蛋白质表达量差异也是肺癌及癌旁正常组织的显著差别,且主要集中在20~116 kDa.CE-LIF检测结果与PAGE结果大致相同,且CE-LIF检测蛋白质的灵敏度高于PAGE,能更准确反映肺癌及癌旁正常组织的蛋白质差异.结论是CE-LIF可用于蛋白质差异检测,时间短,效果较好,对活性蛋白质进行分析体现了其优点:可提供较强的动力--电压,及强动力下良好的温度稳定性.%Protein mixture (denatured and native) differences of extracted from lung cancer and adjacent normal tissue by established method of capillary electrophoresis (CE)-laser-induced fluorescence (LIF) detection of protein was detected using the fluorescein isothiocyanate (FITC) as a derivative agent. When detected by the 1 × TBE electrophoresis buffer solution (pH 10.0 of denaturing gel electrophoresis and pH 8.3of native gel electrophoresis containing 2 mg/L Coomassie brilliant blue), separation voltage of 15 kV, column temperature of 15 ℃, electric injection (10 kV × 10 s), and excitation wavelength/emission wavelength of 488/520 nm, lung cancer and adjacent normal tissue protein mixture samples obtained a better separation and there was significant difference

  14. IgG and IgA with Potential Microbial-Binding Activity Are Expressed by Normal Human Skin Epidermal Cells

    Directory of Open Access Journals (Sweden)

    Dongyang Jiang

    2015-01-01

    Full Text Available The innate immune system of the skin is thought to depend largely on a multi-layered mechanical barrier supplemented by epidermis-derived antimicrobial peptides. To date, there are no reports of antimicrobial antibody secretion by the epidermis. In this study, we report the expression of functional immunoglobulin G (IgG and immunoglobulin A (IgA, previously thought to be only produced by B cells, in normal human epidermal cells and the human keratinocyte line HaCaT. While B cells express a fully diverse Ig, epidermal cell-expressed IgG or IgA showed one or two conservative VHDJH rearrangements in each individual. These unique VDJ rearrangements in epidermal cells were found neither in the B cell-derived Ig VDJ databases published by others nor in our positive controls. IgG and IgA from epidermal cells of the same individual had different VDJ rearrangement patterns. IgG was found primarily in prickle cells, and IgA was mainly detected in basal cells. Both epidermal cell-derived IgG and IgA showed potential antibody activity by binding pathogens like Staphylococcus aureus, the most common pathogenic skin bacteria, but the microbial-binding profile was different. Our data indicates that normal human epidermal cells spontaneously express IgG and IgA, and we speculate that these Igs participate in skin innate immunity.

  15. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  16. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with [1-14C]propionate

    International Nuclear Information System (INIS)

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1-14C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines

  17. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception

    Science.gov (United States)

    Maté-Cid, Saúl; Fulford, Robert; Seiffert, Gary; Ginsborg, Jane

    2016-01-01

    Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception. PMID:27191400

  18. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception.

    Directory of Open Access Journals (Sweden)

    Carl Hopkins

    Full Text Available Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception.

  19. Adjacent segment disease.

    Science.gov (United States)

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  20. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  1. Membrane expression of NK receptors CD160 and CD158k contributes to delineate a unique CD4+ T-lymphocyte subset in normal and mycosis fungoides skin.

    Science.gov (United States)

    Sako, Nouhoum; Schiavon, Valérie; Bounfour, Touda; Dessirier, Valérie; Ortonne, Nicolas; Olive, Daniel; Ram-Wolff, Caroline; Michel, Laurence; Sicard, Hélène; Marie-Cardine, Anne; Bagot, Martine; Bensussan, Armand; Schmitt, Christian

    2014-10-01

    CD160 is a GPI-anchored Ig-like receptor identified by the BY55 mAb on human circulating CD56dim+ NK cells and TCRγδ lymphocytes. In addition, while most intestinal T lymphocytes express it, only a minor circulating CD4+ or CD8+ T lymphocyte subset is CD160+. Here we describe a population of CD4+ CD160+ human blood T lymphocytes of circulating cutaneous T cells. These rare T lymphocytes represent 2.1 ± 1.9% of the circulating CD3+ CD4+ T cells, coexpress CD8αα, CD244, and perforin but lack CD28 expression, a phenotype corresponding to effector memory cytotoxic T-lymphocytes. Functional studies further confirmed their cytotoxic potential. These cells lack αEβ7 integrin and CCR7 expression but do express skin-addressing molecules CLA, and CCR4. In normal human skin, CD4+ CD160+ cells represent 34.6 ± 14.7% of the CD4+ T lymphocytes extracted by collagenase treatment. These T cells coexpress CLA (81 ± 13.6%), CCR4 (62.3 ± 15.9%), and some CD8αα (19.6 ± 13%) or CCR7 (24.4 ± 11.7%) expression. Cutaneous T-cell lymphoma cells express the natural killer receptor KIR3DL2 (CD158k) used as a tumor marker. Not only we confirmed the expression of this marker in the blood and/or skin of mycosis fungoides patients but we also show for the first time CD158k expression (often associated with CD160) on cutaneous CD4+ T cells from healthy individuals (25.3 ± 15%). Therefore, CD4+ CD160+ T cells expressing CD158k might represent specialized cutaneous lymphocytes devoted to immune surveillance, from which could originate cutaneous T-cell lymphomas such as mycosis fungoides.

  2. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  3. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase;

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...

  4. Skin lesion KOH exam

    Science.gov (United States)

    ... KOH exam is a test to diagnose a fungal infection of the skin . How the Test is Performed ... Performed This test is done to diagnose a fungal infection of the skin. Normal Results No fungus is ...

  5. Stages of Skin Cancer

    Science.gov (United States)

    ... cells than in normal cells. For skin cancer, laser light is shined onto the skin and the drug becomes active and kills the cancer cells. Photodynamic therapy causes little damage to healthy tissue. Biologic therapy ...

  6. Skin Cancer Treatment

    Science.gov (United States)

    ... cells than in normal cells. For skin cancer, laser light is shined onto the skin and the drug becomes active and kills the cancer cells. Photodynamic therapy causes little damage to healthy tissue. Biologic therapy ...

  7. of the stomach (ID 345), neutralisation of gastric acid (ID 345), contribution to normal formation of collagen and connective tissue (ID 287, 288, 333, 334, 335, 1405, 1652, 1718, 1719, 1945), maintenance of normal bone (ID 287, 335, 1652, 1718, 1945), maintenance of normal joints (ID 1405, 1652, 1945, ), maintenance of normal appearance and elasticity of the skin (ID 288, 333), and contribution to normal formation of hair and nails (ID 334, 1652, 1719) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to silicon and protection against aluminium accumulation in the brain, cardiovascular health, forming a protective coat on the mucous membrane of the stomach, neutralisation of gastric acid, contribution to normal formation of collagen and connective tissue, maintenance of normal bone......, maintenance of normal joints, maintenance of normal appearance and elasticity of the skin, and contribution to normal formation of hair and nails. The scientific substantiation is based on the information provided by the Member States in the consolidated list of Article 13 health claims and references...

  8. A screening of skin changes, with special emphasis on neurochemical marker antibody evaluation, in patients claiming to suffer from "screen dermatitis" as compared to normal healthy controls.

    Science.gov (United States)

    Johansson, O; Hilliges, M; Han, S W

    1996-10-01

    In the present study, facial skin from so-called "screen dermatitis" patients were compared with corresponding material from normal healthy volunteers. The aim of the study was to evaluate possible markers to be used for future double-blind or blind provocation investigations. Differences were found for the biological markers calcitonin gene-related peptide (CGRP), somatostatin (SOM), vasoactive intestinal polypeptide (VIP), peptide histidine isoleucine amide (PHI), neuropeptide tyrosine (NPY), protein S-100 (S-100), neuron-specific enolase (NSE), protein gene product (PGP) 9.5 and phenylethanolamine N-methyltransferase (PNMT). The overall impression in the blind-coded material was such that it turned out easy to blindly separate the two groups from each other. However, no single marker was 100% able to pin-point the difference, although some were quite powerful in doing so (CGRP, SOM, S-100). However, it has to be pointed out that we cannot, based upon the present results, draw any definitive conclusions about the cause of the changes observed. Whether this is due to electric or magnetic fields, a surrounding airborne chemical, humidity, heating, stress factors, or something else, still remains an open question. Blind or double-blind provocations in a controlled environment are necessary to elucidate possible underlying causes for the changes reported in this investigation. PMID:8981027

  9. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  10. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    International Nuclear Information System (INIS)

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  11. Determination of minimal erythema dose of normal skin to ultraviolet rays%正常人紫外线最小红斑量的测定与分析

    Institute of Scientific and Technical Information of China (English)

    叶聪秀; 万苗坚; 易金铃; 尹颂超; 李美荣; 赖维

    2013-01-01

    目的 探讨广州地区正常人紫外线最小红斑量(MED)的范围及其与性别、年龄、皮肤光生物学分型、季节和在广州地区生活时间长短的关系.方法 以GS2004型日光紫外模拟系统为光源,测定621例健康志愿者背部正常皮肤的MED值,在照射后(24±2)h由两位经验丰富的观察者同时评定.结果 621例受试者的MED均值为(1170.2±333.2)mJ/cm2,男性MED均值为(1132.8±339.4) mJ/cm2,女性MED均值为(1182.1±330.7) mJ/cm2,两者之间差异无统计学意义(P=0.20);30~50岁年龄组的MED值(1014.7±359.7)mJ/cm2,显著低于20~29岁年龄组(1222.9±304.3) mJ/cm2和50岁以上年龄组(1179.0±374.3) mJ/cm2的MED值(P<0.01);Ⅱ型光生物学皮肤MED值(673.5±228.3) mJ/cm2,显著低于Ⅲ型(1224.3±254.2) mJ/cm2和Ⅳ型皮肤(1363.1±278.5) mJ/cm2的MED值(P<0.01);不同季节测定的MED值差异有统计学意义(P<0.01),春季(969.2±355.8) mJ/cm2最低,夏季(969.24±355.8) mJ/cm2次之,但是秋季与冬季之间则差异无统计学意义(P>0.05);在广州地区生活5~10年组的MED值(1104.9±377.7) mJ/cm2,显著低于1~4年组和10年以上组(P<0.0l).结论 广州地区正常人紫外线MED值范围与中国其他地区正常人MEI)值有一定差异,陈与性别无明显关系外,与年龄、皮肤光生物学分型、季节和在广州地区生活时间长短均有关.%Objective To investigate the minimal erythema does (MED) of normal skin to UV in Guangzhou city,and to observe its relationship to sex,age,skin type,seasons and the years lived in Guangzhou.Methods 621 healthy subjects were exposed to Solar Simulator (GS2004) and the MED was measured and observed by two professional technicians after (24±2) hours.Results The average MED value of all subjects was (1170.2±333.2) mJ/cm2.In male and female group,the average MED values were (1132.8-339.4) mJ/cm2 and (1182.1 ± 330.7) mJ/cm2,respectively,and there was no significant difference between male and

  12. Expression and localization of peroxisome proliferator-activated receptors and nuclear factor kappaB in normal and lesional psoriatic skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus;

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...

  13. 脂多糖对正常人皮肤成纤维细胞胶原合成的影响%Influence of lipopolysaccharide on the collagen synthesis of normal human skin fibroblasts

    Institute of Scientific and Technical Information of China (English)

    纪少军; 万立; 李凤玉; 贾国洪; 闫永宏; 石军

    2012-01-01

    Objective: To investigate the influence of lipopolysaccharide ( LPS ) on the collagen synthesis of normal human skin fibroblasts and its relation with wound healing. Methods: Normal skin fibroblasts were exposed to LPS for a certain period of time. Then the collagen synthesis of fibroblasts in culture medium was measured with the method of pepsin digestion after incorporation of H-proline into stable, single-layered, confluent fibroblasts. Results: Collagen synthesis of normal skin fibroblasts increased when challenged with LPS at the concentration of 0.005 μg·ml‐1 , and the increase showed a concentration dependent manner. However, when the concentration of LPS was 0. 5 μg·ml‐1 ,the influence of LPS on the collagen synthesis of normal skin fibroblasts began to decrease; when the concentration of LPS reached 1.0 μg·ml‐1 , collagen synthesis of fibroblasts were inhibited. Conclusion: LPS could promote collagen synthesis of normal human skin fibroblasts within a certain extent, suggesting that LPS might play an important role in wound healing.%目的:研究脂多糖(lipopolysaccharide,LPS)对正常人皮肤成纤维细胞胶原合成的影响,以阐明LPS在皮肤创伤愈合中的可能作用.方法:体外培养正常人皮肤成纤维细胞,采用3H-脯氨酸掺入法观察不同浓度(0、0.005、0.01、0.05、0.1、0.5和1.0 μg·ml-1)的LPS对成纤维细胞胶原合成的影响.结果:LPS刺激浓度在0.005 μg·ml-1时,皮肤成纤维细胞胶原蛋白合成增加;随着刺激浓度增加,刺激作用增强;但当LPS浓度为0.5 μg·ml-1时,促胶原合成作用开始降低;当浓度达到1.0 μg·ml-1时则呈现抑制效应.结论:在一定浓度范围内LPS促进成纤维细胞胶原合成,表明LPS在皮肤创伤愈合中可能具有重要作用.

  14. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (skin barrier function, pharmaceutical delivery and wound dressings.

  15. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  16. Relationship of p53 Mutations to Epidermal Cell Proliferation and Apoptosis in Human UV-Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Janine G. Einspahr

    1999-11-01

    Full Text Available Human skin is continually subjected to UV-irradiation with the p53 gene playing a pivotal role in repair of UV-induced DNA damage and apoptosis. Consequently, p53 alterations are early events in human UV-induced skin carcinogenesis. We studied 13 squamous cell carcinomas (SCC, 16 actinic keratoses (AK, 13 samples adjacent to an AK (chronically sun-damaged, and 14 normal-appearing skin samples for p53 mutation, p53 immunostaining (IHC, apoptosis (in situ TUNEL and morphology, and proliferation (PCNA. The frequency of p53 mutation increased from 14% in normal skin, to 38.5% in sun-damaged skin, 63% in AK, and 54% in SCC. p53 IHC increased similarly. Apoptosis (TUNEL increased from 0.06 ± 0.02%, to 0.1 ± 0.2, 0.3 ± 0.3, and 0.4 ± 0.3 in normal skin, sun-damaged skin, AK, and SCC, respectively. Apoptosis was strongly correlated with proliferation (i.e., TUNEL and PCNA, r = 0.7, P < 0.0001, and proliferation was significantly increased in the progression from normal skin to SCC. Bax was significantly increased in SCC compared to AK. These data imply that apoptosis in samples with a high frequency of p53 mutation may not necessarily be p53-dependent. We suggest that there is a mechanism for apoptosis in response to increased cellular proliferation that is p53-independent.

  17. Cytotoxic and mutagenic effects of carcinogenic aromatic amides and polycyclic hydrocarbons and ultraviolet irradiation in normally repairing and repair-deficient (xeroderma pigmentosum) diploid human skin fibroblasts

    International Nuclear Information System (INIS)

    The cloning ability of fibroblasts taken from a xeroderma pigmentosum patient proved 2.5 to 3.5 times more sensitive to the cytotoxic effect of active derivatives of carcinogens or to uv irradiation than that of normal cells. They also exhibited a corresponding 2.5- to 3.5-fold greater increase in the frequency of induced mutations to 8-azaguanine resistance per survivor, which might have been expected since these XP cells exhibit less than 20 percent of the DNA-repairing capacity of the normal cells following exposure to such DNA-damaging agents

  18. Presence of non-fibrillar amyloid beta protein in skin biopsies of Alzheimer's disease (AD), Down's syndrome and non-AD normal persons

    DEFF Research Database (Denmark)

    Wen, G Y; Wisniewski, H M; Blondal, H;

    1994-01-01

    -24 of synthetic amyloid beta protein (A beta), and 4G8-Fab (the antigen-binding fragment of 4G8 IgG, reactive only to amyloid plaque) was observed in the epidermis-dermis junction or the basement membrane of the epidermis and in some blood vessels of the biopsy skins of 13/18 (72%) AD, 9/10 (90%) DS, and 14....../38 (37%) non-AD control cases. The Fisher exact probability test revealed a significant difference (P = 0.0415 one-tailed) in immunoreactivity between AD and age-matched controls. There was also a significant difference (P = 0.0152 one-tailed; P = 0.0200 two-tailed) between DS and age-matched control...

  19. 中国首例可视化人体与正常人腰神经根的椎间行程及其毗邻关系%Intervertebral route of lumbar nerve root in relation to adjacent tissues in the first Chinese visible human and normal human

    Institute of Scientific and Technical Information of China (English)

    游箭; 张绍祥; 邱明国; 李七渝; 陈伟; 陆明

    2005-01-01

    disk herniation recently. Posterior lateral route is often employed. Puncture route was investigated by the application of anatomic methods previously. However, there are relative fewer reports regarding the observation of the route of lumbar nerve root in intervertebral plane and triangle working area from thin section anatomy and CT section anatomy.OBJECTIVE: To clarify the intervertebral route and its adjacent relationship of lumbar nerve root on thin section and CT section to provide a anatomic gist for puncture route in PLDD.DESIGN: An observational study based on corpus and normal individual.SETTING: Department of radiology of a military medical university of Chinese PLA affiliated hospital and the department of anatomy of a military medical university of Chinese PLA.PARTICIPANTS: The collection of the first Chinese visible human was completed in the Department of Anatomy(laboratory of computer medicine) the Faculty of Medicine, Third Military Medical University of Chinese PLA in October 2002. Totally 53 subjects without confirmed vertebral and intervertebral disc diseases and other diseases of the adjacent organs received CT examination and measurement in the Department of Radiology of the Third Military Medical University of Chinese PLA Affiliated Southwest Hospital between january and March 2000.INTERVENTIONS: The intervertebral route of lumbar nerve root in the first Chinese visible human was observed descriptively. The route, morphology, size, adjacent structure, and the distance between puncture line and lumbar nerve in 53 normal individuals were observed and measured by CT.MAIN OUTCOME MEASURES: To describe the intervertebral route of lumbar nerve root in the first CVH and normal individual, to measure the intervertebral length and width of lumbar nerve, and the distance between puncture line and lumbar nerve.RESULTS: The first Chinese visible human lumbar has 48 layers of intervertebral space with a thickness of each layer of 1.0 mm. The route and

  20. The biochemical basis of changes in normal and mutant human skin fibroblasts during ageing in culture : an investigation into the free radical theory of ageing

    NARCIS (Netherlands)

    M. Poot

    1989-01-01

    textabstractFrom the pattern of inheritance of normal ageing, this process inevitably results from either abnormal aggregation of subunits of enzymes, abnormal feedback inhibition of enzymes, receptor mutations, membrane defects, or deposition of abnormal fibrillar proteins (Vogel and Motulsky, 1986

  1. Aging Skin

    Science.gov (United States)

    ... email address Submit Home > Healthy Aging > Wellness Healthy Aging Aging skin More information on aging skin When it ... treated early. Return to top More information on Aging skin Read more from womenshealth.gov Varicose Veins ...

  2. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  3. 正常耳外耳轮到乳突距离的测量与分析%Measurement of the Distance from Helix to Mastoid Skin in Normal Ears

    Institute of Scientific and Technical Information of China (English)

    唐新杰; 许枫; 孙楠; 张如鸿; 张群

    2015-01-01

    目的:为了使再造耳的颅耳角更稳定和更对称,测量正常耳外耳轮到乳突的距离并加以分析。方法选取100个正常耳分别测量耳上、中、下3点到乳突的距离并分析。同时选取5例正常耳进行三维测量。结果正常耳上、中、下3点到乳突的距离分别是(1.41±0.18) cm、(1.98±0.26) cm和(1.66±0.26) cm。通过以上数据分析,外耳轮到乳突的垂直距离的最远点在中间点,与1968年McDowell报道的外耳轮到乳突距离最远点在下1/3不符。三维测量结果与上述结果相符。结论国人外耳轮到乳突的距离,距离最大的点在中间点,应在此基础上定制二期耳支撑材料的形态与高度。%Objective To measure the distance from helix to mastoid skin, in order to achieve an acceptable projection of the ear and be symmetrical with the normal contralateral ear if present. Methods The distance from the upper, middle, and lower third of helix to mastoid skin of 100 healthy normal ears were measured. Meanwhile three-dimensional measurement models were made in 5 normal ears. Results The distance from helix to mastoid skin were (1.41±0.18) cm in upper third, (1.98± 0.26) cm in mid-portion and (1.66±0.26) cm in lower third. It was interesting that the distance from helix to mastoid skin of mid-dle third was higher than that of upper and lower third in Chinese population, not in accordance with McDowell's standard, in which the distance of lower third was higher than that of upper and middle. The software analysis result of the 5 3-dimensional measurement models was in accordance with manually measurements above. Conclusion In normal ears, the distance from the middle third of helix to mastoid skin is higher than that of upper and lower third in Chinese population, the shape and height of support material in the second stage of ear reconstruction should be made based on the above measurements.

  4. Texture analysis of collagen second-harmonic generation images based on local difference local binary pattern and wavelets differentiates human skin abnormal scars from normal scars

    Science.gov (United States)

    Liu, Yao; Zhu, Xiaoqin; Huang, Zufang; Cai, Jianyong; Chen, Rong; Xiong, Shuyuan; Chen, Guannan; Zeng, Haishan

    2015-01-01

    Quantitative methods for noninvasive diagnosis of scars are a challenging issue in medicine. This work aims to implement a texture analysis method for quantitatively discriminating abnormal scars from normal scars based on second-harmonic generation (SHG) images. A local difference local binary pattern (LD-LBP) operator combined with a wavelet transform was explored to extract diagnosis features from scar SHG images that were related to the alteration in collagen morphology. Based on the quantitative parameters including the homogeneity, directional and coarse features in SHG images, the scar collagen SHG images were classified into normal or abnormal scars by a support vector machine classifier in a leave-one-out cross-validation procedure. Our experiments and data analyses demonstrated apparent differences between normal and abnormal scars in terms of their morphological structure of collagen. By comparing with gray level co-occurrence matrix, wavelet transform, and combined basic local binary pattern and wavelet transform with respect to the accuracy and receiver operating characteristic analysis, the method proposed herein was demonstrated to achieve higher accuracy and more reliable classification of SHG images. This result indicated that the extracted texture features with the proposed method were effective in the classification of scars. It could provide assistance for physicians in the diagnostic process.

  5. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  6. Fluorescence photobleaching of ALA and ALA-heptyl ester induced protoporphyrin IX during photodynamic therapy of normal hairless mouse skin: a comparison of two light sources and different illumination schemes.

    Science.gov (United States)

    Pudroma, Xiao; Juzeniene, Asta; Ma, Li-Wei; Iani, Vladimir; Moan, Johan

    2011-01-01

    This study investigated photobleaching of protoporphyrin IX (PpIX) induced by 5-aminolevulinic acid (ALA) and ALA-heptyl ester during superficial photodynamic therapy (PDT) in normal skin of the female BALB/c-nu/nu athymic mouse. We examined the effects of two light sources (laser and broadband lamp) and two different illumination schemes (fractionated light and continuous irradiation) on the kinetics of photobleaching. Our results show that light exposure (0-30 minutes, 10 mW/cm2) of wavelengths of approximately 420 nm (blue light) and 635 nm (red light) induced time-dependent PpIX photobleaching for mouse skin of 2% ALA and ALA-heptyl ester. Blue light (10 mW/cm2) caused more rapid PpIX photobleaching than did red light (100 mW/cm2), which is attributed to stronger absorption at 407 nm than at 632 nm for PpIX. In the case of light fractionation, fractionated light induced faster photobleaching compared with continuous light exposure after topical application of 2% ALA and ALA-heptyl ester in vivo. These have been suggested to allow reoxygenation of the irradiated tissue, with a consequent enhancement of singlet oxygen production in the second and subsequent fractions.

  7. Skin Biomes.

    Science.gov (United States)

    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A

    2016-05-01

    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  8. 脂多糖干预后人皮肤成纤维细胞的胶原代谢%Influence of Lipopolysaccharide on Collagen Metabolism of Normal Skin Fibroblasts of Human

    Institute of Scientific and Technical Information of China (English)

    李凤玉; 王舒琦; 贾国洪; 万立; 杨红明

    2012-01-01

    目的 探讨脂多糖(lipopolysaccharide,LPS)对皮肤成纤维细胞胶原代谢的影响,以了解LPS在增生性瘢痕形成中的生物学作用.方法 取正常皮肤行成纤维细胞培养后,分为1个对照组及6个实验组.实验组终浓度分别为0.005、0.010、0.050、0.100、0.500和1.000 μg/ml大肠杆菌LPS(E.coli055:B5)培养,对照组为DMEM培养.用逆转录-聚合酶链反应(reverse transcription-polymerase chain reaction,RT-PCR)测定成纤维细胞Ⅰ、Ⅲ型前胶原mRNA及胶原酶mRNA的表达,并以同一个体相同代数的瘢痕组织成纤维细胞做对照.结果 与对照组比较,0.005~0.500μg/ml组促进细胞胶原合成,且0.100 μg/ml组作用达高峰(P<0.05),1.000μg/ml LPS抑制细胞胶原合成(P≮0.05).LPS刺激浓度在0.005 μg/ml~0.100μg/ml时,促进正常皮肤成纤维细胞I、Ⅲ型前胶原mRNA表达,抑制胶原酶mRNA表达,且呈一定的剂量依赖性;当LPS刺激浓度为0.500 μg/ml,上述作用下降;而当LPS刺激浓度到达1.000 μg/ml时,抑制正常皮肤成纤维细胞Ⅰ、Ⅲ型前胶原mRNA表达,促进胶原酶mRNA表达.LPS刺激浓度在0.100 μg/ml时,成纤维细胞Ⅰ、Ⅲ型前胶原mRNA和胶原酶mRNA表达与同一个体增生性瘢痕组织成纤维细胞近似.结论 LPS对人皮肤成纤维细胞Ⅰ、Ⅲ型前胶原mRNA和胶原酶mRNA表达的直接调节,可能是其参与增生性瘢痕形成的重要机制.%Objective To observe the influence of lipopolysaccharide (LPS) on collagen metabolism of normal human skin fibroblasts and its biological role in the formation of hypertrophic scar. Methods Fibroblasts were isolated and cultured in vitro, and then exposed to different doses of LPS (0. 005, 0. 010, 0. 050, 0. 100, 0. 500 and 1. 000 jug/ml) from E. coli055: B5 respectively. The expression of procollagen type I , HI and collagenase mRNAs was tested by reverse transcription-polymerase chain reaction (RT-PCR). The fibroblasts from hypertrophic scar tissue

  9. Treatment Options for Nonmelanoma Skin Cancer

    Science.gov (United States)

    ... cells than in normal cells. For skin cancer, laser light is shined onto the skin and the drug becomes active and kills the cancer cells. Photodynamic therapy causes little damage to healthy tissue. Biologic therapy ...

  10. Cytokines and the Skin Barrier

    Directory of Open Access Journals (Sweden)

    Jens Malte Baron

    2013-03-01

    Full Text Available The skin is the largest organ of the human body and builds a barrier to protect us from the harmful environment and also from unregulated loss of water. Keratinocytes form the skin barrier by undergoing a highly complex differentiation process that involves changing their morphology and structural integrity, a process referred to as cornification. Alterations in the epidermal cornification process affect the formation of the skin barrier. Typically, this results in a disturbed barrier, which allows the entry of substances into the skin that are immunologically reactive. This contributes to and promotes inflammatory processes in the skin but also affects other organs. In many common skin diseases, including atopic dermatitis and psoriasis, a defect in the formation of the skin barrier is observed. In these diseases the cytokine composition within the skin is different compared to normal human skin. This is the result of resident skin cells that produce cytokines, but also because additional immune cells are recruited. Many of the cytokines found in defective skin are able to influence various processes of differentiation and cornification. Here we summarize the current knowledge on cytokines and their functions in healthy skin and their contributions to inflammatory skin diseases.

  11. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  12. Skin Dictionary

    Science.gov (United States)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  13. Skin Biopsy

    Science.gov (United States)

    ... skin condition cannot be diagnosed by the patient's history and what the physician finds on examination alone. Confirming a clinical diagnosis may also be necessary prior to starting therapy. Skin biopsy types are as follows: Shave biopsies Punch biopsies ...

  14. Skin tears.

    Science.gov (United States)

    Baranoski, S

    2001-08-01

    Skin tears are a serious, painful problem for older patients. Find out how your staff can recognize patients at risk, what they can do to prevent skin tears, and how to manage them effectively if they occur.

  15. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  16. SKIN CANCER

    OpenAIRE

    Made Putri Hendaria; AAGN Asmarajaya; Sri Maliawan

    2013-01-01

    Skin is an organ which protect the human body from the environment. It was build by milion cells. According to the changes in human lifestyle which tends to unhealthy life, increasing ultraviolet radiation, toxins, and genetics makes the cells who build the skin do the abnormal growth being cancer cells. Classification of skin cancer is according the most common three types, they are Basal Cell Carcinoma, Squamous Cell Carcinoma, and Malignant Melanoma. More than 3,5 milion skin cancer cases ...

  17. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  18. Determination of minimal erythema does of normal skin to ultraviolet rays among 621 healthy volunteers%广州地区正常人紫外线最小红斑量的测定

    Institute of Scientific and Technical Information of China (English)

    叶聪秀; 万苗坚; 易金玲; 赖维

    2012-01-01

    目的:探讨广州地区正常人紫外线最小红斑量(minimal erythema does,MED)的范围及其与性别的关系.方法:以GS2004型日光紫外模拟系统为光源,测定330名健康志愿者背部正常皮肤的MED值.结果:330名受试者的MED均值为(1176.1±322.90)mJ/cm2,男性MED均值为(1132.8±339.38)mJ/cm2,女性MED均值为(1212.2±304.76)mJ/cm2,两者之间无统计学差异(P=0.12); Ⅱ型皮肤男性MED值显著低于女性(P=0.02);大于30岁男性MED值显著低于女性(P<0.05).结论:广州地区正常人紫外线MED值范围与中国其他地区正常人MED值有一定差异,其与性别关系不能笼统地分析,必须考虑年龄及皮肤光生物学分型的影响.%Objective To investigate the minimal erythema does (MED) of normal skin to UV in Guangzhou city, and observe its relationship to sex. Methods 330 healthy subjects were exposed to Solar Simulator (GS2004), and the MED was measured. Results The average MED value of all subjects was (1176.1 ±322.90) mJ/cm2. In male and female group, the average MED value were (1132.8±339.38) mJ/cm2 and (1212.2±304.76)mJ/cm2 respectively, and there was no significant difference between male and female (P =0.12). However, the male MED value in skin type II was significantly lower than those in female (P=0.02) ,and the male MED value in subjects aged over 30 was significantly lower than those in female (P<0.05). Conclusion The MED value of the subjects in Guangzhou was quite different from other cities according to the previous reports and related to gender while considering the skin types and age.

  19. 脂多糖对人皮肤成纤维细胞胶原代谢的影响%Influence of lipopolysaccharide on collagen metabolism of normal skin fibroblasts of human

    Institute of Scientific and Technical Information of China (English)

    李凤玉; 王舒琦; 贾国洪; 万立; 杨红明

    2012-01-01

    Objective To observe the influence of lipopolysaccharide (LPS) on collagen metabolism of normal human skin fibroblasts and its biological role in the formation of hypertrophic scar.Methods Fibroblasts were isolated and cultured in vitro,and then exposed to different doses of LPS (0.005,0.01,0.05,0.1,0.5,1.0 μg/ml) from E.coli.055:B5 respectively.The expression of proccllagen type Ⅰ,Ⅲand collagenase mRNAs was tested by RT -PCR.Fibroblasts from hypertrophic scar tissue obtained from the same patients in the same culture passage were used as control.Results Compared with control group,the expression of procollagen type Ⅰ,Ⅲ mRNAs in normal skin fibroblasts increased (0.323 ± 0.041,0.303 ± 0.063,0.391 ± 0.071,0.344 ± 0.086,0.488 ± 0.059,0.401 ± 0.087,0.616 ± 0.107,0.434 ±0.084,0.823 ±0.092,0.542 ± 0.082),while the expression of collagenase mRNAs of normal skin fibroblasts depressed(0.598 ± 0.068,0.556 ± 0.049,0.441 ± 0.043,0.372 ± 0.083,0.260 ± 0.027 ).When LPS was set to the concentration of 0.005 μg/ml,it showed a concentration dependent manner.However,when the concentration of LPS was set to 0.5 μg/ml,the expression of procollagen type Ⅰ,Ⅲ and collagenase mRNAs of normal skin fibroblasts began to decrease (0.451 ± 0.063,0.374 ± 0.072,0.360 ± 0.062).When the concentration of LPS was set to 1.0 μg/ml,the expression of procollagen type Ⅰ,Ⅲ mRNAs (0.162 ± 0.025,0.171 ± 0.061 )were inhibited and the expression of collagenase mRNAs began to increase (0.444 ±0.114).When the concentration of LPS was set to 0.1 μg/ml,the expression of procollagen type Ⅰ,Ⅲ and collagenase mRNAs of normal skin fibroblasts(0.823 ±0.092,0.542 ±0.082,0.260 ±0.027)was similar to that of hypertrophic scar tissue fibroblasts(0.829 ±0.049,0.569 ±0.038,0.277 ±0.059).Conclusions This result supported that LPS may be an important factor in collagen metabolism of normal skin fibroblasts and it plays an important role in hypertrophic scar formation.%目

  20. Effect of normal human skin-derived mesenchymal stem cells on HaCaT cell proliferation%健康人皮肤间充质干细胞对HaCaT细胞增殖作用的研究

    Institute of Scientific and Technical Information of China (English)

    王建华; 张开明; 刘瑞风; 甄莉

    2015-01-01

    Objective To investigate the effect of normal human skin-mesenchymal stem cells (S-MSCs) on HaCaT cell proliferation, so as to provide a theoretical basis for the role of S-MSCs in pathologic status. Methods Twenty cases of normal skin were harvested from surgically removed fresh redundant skin by courtesy of cosmetics and urology departments in our hospital. Under sterile conditions, the epidermal and dermal layers were separated, and the dermal MSCs were isolated and cultured. Flow cytometry was used to identify the MSCs and the multi-direc-tional differentiation and differentiated cells. The fifth passage of S-MSCs was co-cultured with HaCaT cells, and com-pared with the naturally proliferating S-MSCs. Real-time cell analysis system was employed to examine the HaCaT cell proliferation. At 72h after culture, the number of HaCaT cells was observed by cell counting. Results Under inverted phase contrast microscope, the normal human S-MSCs was slender and spindle cells with high expression of surface antigens CD29, CD44, CD73, CD90, and CD105, and negative expression of CD34, CD45 and HLA-DR. The S-MSCs could be induced to differentiate into adipocytes, osteoblasts and chondroblasts. The number of naturally cultured Ha-CaT cells was (2.74±0.36)×105, compared with (2.24±0.28)×105 for the number of HaCaT cells co-cultured with normal human S-MSCs. The difference was statistically significant (P<0.001). Conclusion Normal human skin-derived MSCs could inhibit the proliferation of HaCaT cells in vitro.%目的:探讨健康人皮肤间充质干细胞(S-MSCs)对HaCaT细胞增殖的作用,为研究S-MSCs在病理状态下的作用提供理论依据。方法健康人皮肤20份,均取自我院整形和泌尿外科手术切除的多余新鲜皮肤组织。在体外无菌条件下进行真表皮分离、培养真皮MSCs,流式细胞术进行细胞鉴定,多向诱导分化及分化细胞的鉴定,将培养至第5代的S-MSCs与HaCaT细胞共培养,并与

  1. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  2. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    ... Usually the cause is staphylococcal (staph), but sometimes streptococcus (strep) can cause it, too. It is most ... color or outline, or in any other way. Psoriasis © 2008 Logical Images, Inc. Psoriasis —A skin disease ...

  3. Curious Skin

    OpenAIRE

    Angel, G.

    2010-01-01

    Some of Henry Wellcome’s collection of tattoos on human skin will be on display in our forthcoming Skin exhibition. But how did the Parisian doctor from whom they were acquired come by his macabre collection of tattoos in the first place, and what did they mean to those whose skin they were on? It’s Gemma Angel‘s job to find out…

  4. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini;

    2009-01-01

    , as have many diseases. The method can provide accurate measures of epidermal and nail changes in normal tissue. Skin cancer and other tumors, as well as inflammatory diseases, have been studied and good agreement found between OCT images and histopathological architecture. OCT also allows noninvasive......Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studied...... monitoring of morphologic changes in skin diseases and may have a particular role in the monitoring of medical treatment of nonmelanoma skin cancer. The technology is however still evolving and continued technological development will necessitate an ongoing evaluation of its diagnostic accuracy. Several...

  5. Fluorescence excitation-emission matrix spectroscopy of vitiligo skin in vivo (Conference Presentation)

    Science.gov (United States)

    Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey

    2016-02-01

    Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.

  6. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun’s ultraviolet rays, which can burn the skin, and ...

  7. Oily skin

    Science.gov (United States)

    ... keep your skin clean using warm water and soap, or a soapless cleanser. Clean your face with astringent pads if frequent face washing causes irritation. Use only water-based or oil-free cosmetics if you have oily skin. Your ...

  8. Combined normal-phase and reversed-phase liquid chromatography/ESI-MS as a tool to determine the molecular diversity of A-type procyanidins in peanut skins

    NARCIS (Netherlands)

    Appeldoorn, M.M.; Vincken, J.P.; Sanders, M.B.; Hollman, P.C.H.; Gruppen, H.

    2009-01-01

    Peanut skins, a byproduct of the peanut butter industry, are a rich source of proanthocyanidins, which might be used in food supplements. Data on the molecular diversity of proanthocyanidins in peanut skins is limited and conflicting with respect to the ratio of double- (A-type) versus single-linked

  9. Skin Cancer in Skin of Color

    OpenAIRE

    Bradford, Porcia T.

    2009-01-01

    Skin cancers in skin of color often present atypically or with advanced stage in comparison to Caucasian patients. Health care providers must maintain a high index of suspicion when examining skin lesions in skin of color.

  10. Skin abscess

    Science.gov (United States)

    ... infection (often staphylococcus) A minor wound or injury Boils Folliculitis (infection in a hair follicle) A skin ... Elsevier Churchill Livingstone; 2009:chap 90. Read More Boils Endocarditis Folliculitis MRSA Osteomyelitis Update Date 11/12/ ...

  11. Skin graft

    Science.gov (United States)

    ... caused a large amount of skin loss Burns Cosmetic reasons or reconstructive surgeries where there has been ... Smoking increases your chance of problems such as slow healing. Ask your doctor or nurse for help ...

  12. Skin Pigment

    Science.gov (United States)

    ... This Article Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Overview of ... Version Pigment Disorders Overview of Skin Pigment Albinism Vitiligo Hyperpigmentation Melasma Melanin is the brown pigment that ...

  13. Development of an improved method for quantitative analysis of skin blotting: Increasing reliability and applicability for skin assessment

    OpenAIRE

    Ogai, Kazuhiro; Matsumoto, Masaru; Minematsu, T; Kitamura, Keiichiro; Kobayashi, M.; Sugama, Junko; Sanada, Hiromi

    2015-01-01

    Objective A novel skin assessment tool named 'skin blotting' has been recently developed, which can easily predict the skin status to avoid its deterioration. The aim of this study was to propose a normalization method for skin blotting to compensate for individual differences that can hamper the quantitative comparisons and clinical applications. Methods To normalize individual differences, we utilized a total protein as a 'normalizer' with calibration curves. For evaluation, we performed a ...

  14. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease in ...

  15. The Aging Prostate Is Never "Normal"

    DEFF Research Database (Denmark)

    Schlomm, Thorsten; Weischenfeldt, Joachim; Korbel, Jan;

    2015-01-01

    We argue against the recently published statement that tumor-specific molecular alterations found in "normal" prostate tissue from cancer patients challenge focal therapy approaches that only target a visible cancer lesion and not the adjacent molecular field....

  16. Tactile perception of skin and skin cream by friction induced vibrations.

    Science.gov (United States)

    Ding, Shuyang; Bhushan, Bharat

    2016-11-01

    Skin cream smooths, softens, and moistens skin by altering surface roughness and tribological properties of skin. Sliding generates vibrations that activate mechanoreceptors located in skin. The brain interprets tactile information to identify skin feel. Understanding the tactile sensing mechanisms of skin with and without cream treatment is important to numerous applications including cosmetics, textiles, and robotics sensors. In this study, frequency spectra of friction force and friction induced vibration signals were carried out to investigate tactile perception by an artificial finger sliding on skin. The influence of normal load, velocity, and cream treatment time were studied. Coherence between friction force and vibration signals were found. The amplitude of vibration decreased after cream treatment, leading to smoother perception. Increasing normal load or velocity between contacting surfaces generated a smoother perception with cream treatment, but rougher perception without treatment. As cream treatment time increases, skin becomes smoother. The related mechanisms are discussed. PMID:27474814

  17. Tactile perception of skin and skin cream by friction induced vibrations.

    Science.gov (United States)

    Ding, Shuyang; Bhushan, Bharat

    2016-11-01

    Skin cream smooths, softens, and moistens skin by altering surface roughness and tribological properties of skin. Sliding generates vibrations that activate mechanoreceptors located in skin. The brain interprets tactile information to identify skin feel. Understanding the tactile sensing mechanisms of skin with and without cream treatment is important to numerous applications including cosmetics, textiles, and robotics sensors. In this study, frequency spectra of friction force and friction induced vibration signals were carried out to investigate tactile perception by an artificial finger sliding on skin. The influence of normal load, velocity, and cream treatment time were studied. Coherence between friction force and vibration signals were found. The amplitude of vibration decreased after cream treatment, leading to smoother perception. Increasing normal load or velocity between contacting surfaces generated a smoother perception with cream treatment, but rougher perception without treatment. As cream treatment time increases, skin becomes smoother. The related mechanisms are discussed.

  18. Do We Know What Causes Melanoma Skin Cancer?

    Science.gov (United States)

    ... melanoma skin cancer be prevented? What causes melanoma skin cancer? Many risk factors for melanoma have been found, ... such as CDKN2A (also known as p16 ) and CDK4 that prevent them from doing their normal job ...

  19. Pathological skin picking: case presentation and review of the literature

    OpenAIRE

    Maria Isabela Sarbu; Mircea Tampa; Diana Leahu; Cristina Raileanu; Vasile Benea; Simona Roxana Georgescu

    2015-01-01

    Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD), anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disord...

  20. Skin Care and Aging

    Science.gov (United States)

    ... page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It ... if they bother you. See additional resources on aging skin, including information on treatment options, specific conditions, ...

  1. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... A "Sunscreen Gene"? Skin Cancer Facts & Statistics The Skin Cancer Foundation's Champions for Change Gala 2016 Learn ...

  2. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  3. Does the sailfish skin reduce the skin friction like the shark skin?

    Science.gov (United States)

    Sagong, Woong; Kim, Chulkyu; Choi, Sangho; Jeon, Woo-Pyung; Choi, Haecheon

    2008-10-01

    The sailfish is the fastest sea animal, reaching its maximum speed of 110 km/h. On its skin, a number of V-shaped protrusions pointing downstream exist. Thus, in the present study, the possibility of reducing the skin friction using its shape is investigated in a turbulent boundary layer. We perform a parametric study by varying the height and width of the protrusion, the spanwise and streamwise spacings between adjacent ones, and their overall distribution pattern, respectively. Each protrusion induces a pair of streamwise vortices, producing low and high shear stresses at its center and side locations, respectively. These vortices also interact with those induced from adjacent protrusions. As a result, the drag is either increased or unchanged for most of the cases considered. Some of these cases show that the skin friction itself is reduced but the total drag including the form drag on the protrusion is larger than that of a smooth surface. In a few cases, the drag is decreased only slightly (˜1%) but this amount is within the experimental uncertainty. Since the shape of present protrusions is similar to that used by Sirovich and Karlsson [Nature (London) 388, 753 (1997)] where V-shaped protrusions pointing upstream were considered, we perform another set of experiments following their study. However, we do not obtain any drag reduction even with random distribution of those V-shaped protrusions.

  4. Determinants of adjacency matrices of graphs

    Directory of Open Access Journals (Sweden)

    Alireza Abdollahi

    2012-12-01

    Full Text Available We study the set of all determinants of adjacency matrices of graphs with a given number of vertices. Using Brendan McKay's data base of small graphs, determinants of graphs with at most $9$ vertices are computed so that the number of non-isomorphic graphs with given vertices whose determinants are all equal to a number is exhibited in a table. Using an idea of M. Newman, it is proved that if $G$ is a graph with $n$ vertices and ${d_1,dots,d_n}$ is the set of vertex degrees of $G$, then $gcd(2m,d^2$ divides the determinant of the adjacency matrix of $G$, where $d=gcd(d_1,dots,d_n$. Possible determinants of adjacency matrices of graphs with exactly two cycles are obtained.

  5. Skin Substitutes

    OpenAIRE

    Zavan, Barbara; Vindigni, Vincenzo; Cortivo, Roberta; Abatangelo, Giovanni

    2010-01-01

    The many studies conducted so far reveal that Tissue Engineering of the skin is only at the beginning of its use in human applications. Burns patients were the first targets for such tissue substitutes, then chronic diseases, such as venous ulcers, have followed. The more experience is gained from the surgeon, the more feedback for the basic scientist to improve the product and to broaden clinical indications. Nowadays, progress in cell culture and biomedical material technologies have added ...

  6. Skin aging:

    OpenAIRE

    Puizina-Ivić, Neira

    2008-01-01

    There are two main processes that induce skin aging: intrinsic and extrinsic. A stochastic process that implies random cell damage as a result of mutations during metabolic processes due to the production of free radicals is also implicated. Extrinsic aging is caused by environmental factors such as sun exposure, air pollution, smoking, alcohol abuse, and poor nutrition. Intrinsicaging reflects the genetic background and depends on time. Various expressions of intrinsic aging include smooth, ...

  7. On the complexity of adjacent resource scheduling

    OpenAIRE

    Duin, C.W.; Sluis, van, P.

    2004-01-01

    We study the problem of scheduling resource(s) for jobs in an adjacent manner (ARS). The problem relates to fixed interval scheduling on the one hand, and to the problem of two-dimensional strip packing on the other hand. Further, there is a close relation with multiprocessor scheduling. A distinguishing characteristic is the constraint of resource-adjacency. As an application of ARS, consider an airport where passengers check in for their flight, joining lines before one or more desks; at th...

  8. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  9. 轻中度痤疮患者痤疮部位与正常部位皮肤生理参数的差异%Differences of physiological indicators between healthy normal skin and acne site of mild and moderateacne patients

    Institute of Scientific and Technical Information of China (English)

    陶宇; 王艳东; 李杰; 杨雪松

    2016-01-01

    目的:研究轻中度痤疮患者痤疮部位与健康正常皮肤部位生理指标的差异。方法选取75例痤疮患者检测痤疮部位皮脂分泌量、表皮含水量、皮肤pH值。另外检测63例轻中度痤疮患者痤疮部位与痤疮周围10 cm健康皮肤部位的皮脂分泌量、表皮含水量、皮肤pH值。结果根据每个痤疮患者痤疮部位皮脂分泌量增多、表皮含水量减少的程度不同,可分为轻中重度痤疮;轻中度痤疮患者痤疮部位与健康皮肤比较,痤疮部位皮脂分泌量显著高于周围健康皮肤(t=2.786,P=0.006<0.05),表皮角质层含水量明显低于皮肤健康部位(t=2.648,P=0.009<0.05),痤疮部位皮肤pH值与健康皮肤相比减小(t=3.028,P=0.003<0.05)。结论轻中度痤疮患者痤疮部位与其周围10 cm健康部位比较,皮脂分泌量显著增多、表皮含水量明显降低、皮肤pH值下降。%Objective To investigate the differences of physiological indicators between healthy normal skin and acne site of mild and moderate acne patients. Methods The 75 acne patients were enrolled in this study. Sebum secretion, moisture of skin, and skin PH value in acne site and the surrounding 10cm healthy skin of the 63 mild and moderate acne patients were tested. Results According to the different degree of an increase of sebum secretion, a reduction of skin moisture content in acne site of each acne patient, the acne were divided into the mild, moderate and severe acne. Sebum secretion of the mild and moderate acne was significantly higher than the healthy skin ( t=2.786,P=0.006,P<0.05) , moisture of skin was lower than the control ( t=2.648,P=0.009,P<0.05), skin PH value was decreased (t=3.028,P=0.003,P<0.05). Conclusions Compared the acne site with the surrounding 10cm healthy skin of the mild and moderate acne, we find the amount of sebum secretion increased significantly, the skin moisture content decreased, the skin pH value decreased.

  10. Microphthalmia with linear skin defects syndrome.

    Science.gov (United States)

    García-Rabasco, Ana; De-Unamuno, Blanca; Martínez, Francisco; Febrer-Bosch, Isabel; Alegre-de-Miquel, Víctor

    2013-01-01

    Microphthalmia with linear skin defects (MLS) or microcornea, dermal aplasia and sclerocornea (MIDAS) syndrome is a rare X-linked-dominant disorder. We present a patient with agenesis of corpus callosum, ocular abnormalities, and multiple skin defects. The cytogenetic studies of the MLS critical region (Xp22.2) were normal, but a skewed X-chromosome inactivation pattern (85:15) was observed.

  11. MINARETS WILDERNESS AND ADJACENT AREAS, CALIFORNIA.

    Science.gov (United States)

    Huber, N. King; Thurber, Horace K.

    1984-01-01

    A mineral survey of the Minarets Wilderness and adjacent areas in the central Sierra Nevada, California was conducted. The results of the survey indicate that the study area has a substantiated resource potential for small deposits of copper, silver, zinc, lead, and iron, and a probable mineral-resource potential for molybdenum. No energy-resource potential was identified in the study.

  12. Skin and hair changes during pregnancy

    Science.gov (United States)

    Kroumpouzos G. Skin disease in pregnancy and puerperium. In: Gabbe SG, Niebyl JR, Simpson JL, et al, eds. Obstetrics: Normal and Problem Pregnancies . 6th ed. Philadelphia, PA: Elsevier Saunders; 2012:chap ...

  13. Focal skin defect, limb anomalies and microphthalmia.

    NARCIS (Netherlands)

    Jackson, K.E.; Andersson, H.C.

    2004-01-01

    We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and

  14. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation (ID 1669) and protection, of the skin from UV-induced damage (ID 1669) pursuant to Article 13(1) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claims in relation to a combination of lycopene, proanthocyanidins, vitamin C, vitamin E, selenium and beta-carotene and contribution to normal collagen formation and protection of the skin from UV-induced damage. The scientific substantiation is based on the information provided by the Member States...

  15. An atlas of normal skeletal scintigraphy

    International Nuclear Information System (INIS)

    This atlas was compiled to provide the neophyte as well as the experienced radiologist and the nuclear medicine physician with a reference on normal skeletal scintigraphy as an aid in distinguishing normal variations in skeletal uptake from abnormal findings. Each skeletal scintigraph is labeled, and utilizing an identical scale, a relevant skeletal photograph and radiograph are placed adjacent to the scintigraph

  16. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    OpenAIRE

    Anjanappa; Arjun

    2015-01-01

    BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganism...

  17. Skin Keratins.

    Science.gov (United States)

    Wang, Fengrong; Zieman, Abigail; Coulombe, Pierre A

    2016-01-01

    Keratins comprise the type I and type II intermediate filament-forming proteins and occur primarily in epithelial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type-, differentiation-, and context-dependent manner. Keratins serve multiple homeostatic and stress-enhanced mechanical and nonmechanical functions in epithelia, including the maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications as well as keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility and/or altered tissue homeostasis. Moreover, keratin mutation or misregulation represents risk factors or genetic modifiers for several acute and chronic diseases. This chapter focuses on keratins that are expressed in skin epithelia, and details a number of basic protocols and assays that have proven useful for analyses being carried out in skin.

  18. The Thermomagnetic Instability in Superconducting Films with Adjacent Metal Layer

    Science.gov (United States)

    Vestgården, J. I.; Galperin, Y. M.; Johansen, T. H.

    2013-12-01

    Dendritic flux avalanches is a frequently encountered consequence of the thermomagnetic instability in type-II superconducting films. The avalanches, which are potentially harmful for superconductor-based devices, can be suppressed by an adjacent normal metal layer, even when the two layers are not in thermal contact. The suppression of the avalanches in this case is due to so-called magnetic braking, caused by eddy currents generated in the metal layer by propagating magnetic flux. We develop a theory of magnetic braking by analyzing coupled electrodynamics and heat flow in a superconductor-normal metal bilayer. The equations are solved by linearization and by numerical simulation of the avalanche dynamics. We find that in an uncoated superconductor, even a uniform thermomagnetic instability can develop into a dendritic flux avalanche. The mechanism is that a small non-uniformity caused by the electromagnetic non-locality induces a flux-flow hot spot at a random position. The hot spot quickly develops into a finger, which at high speeds penetrates into the superconductor, forming a branching structure. Magnetic braking slows the avalanches, and if the normal metal conductivity is sufficiently high, it can suppress the formation of the dendritic structure. During avalanches, the braking by the normal metal layer prevents the temperature from exceeding the transition temperature of the superconductor. Analytical criteria for the instability threshold are developed using the linear stability analysis. The criteria are found to match quantitatively the instability onsets obtained in simulations.

  19. Sustained Impairments in Cutaneous Vasodilation and Sweating in Grafted Skin Following Long-Term Recovery

    OpenAIRE

    Davis, Scott L.; Shibasaki, Manabu; David A Low; Cui, Jian; Keller, David M.; Wingo, Jonathan E.; Purdue, Gary F.; Hunt, John L.; Arnoldo, Brett D.; Kowalske, Karen J.; Crandall, Craig G.

    2009-01-01

    We previously identified impaired cutaneous vasodilation and sweating in grafted skin 5 to 9 months postsurgery. The aim of this investigation was to test the hypothesis that cutaneous vasodilation, but not sweating, is restored as the graft heals. Skin blood flow and sweat rate were assessed from grafted skin and adjacent noninjured skin in three groups of subjects: 5 to 9 months postsurgery (n = 13), 2 to 3 years postsurgery (n = 13), and 4 to 8 years postsurgery (n = 13) during three separ...

  20. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  1. Adjacent Segment Pathology after Lumbar Spinal Fusion.

    Science.gov (United States)

    Lee, Jae Chul; Choi, Sung-Woo

    2015-10-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  2. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can Get Skin Cancer ... true that only people with light skin get skin cancer? No. Anyone can get skin cancer. It's more ...

  3. Nonequilibrium phenomena in adjacent electrically isolated nanostructures

    OpenAIRE

    Khrapai, V. S.; Ludwig, S.; Kotthaus, J. P.; Tranitz, H. P.; Wegscheider, W.

    2008-01-01

    We report on nonequilibrium interaction phenomena between adjacent but electrostatically separated nanostructures in GaAs. A current flowing in one externally biased nanostructure causes an excitation of electrons in a circuit of a second nanostructure. As a result we observe a dc current generated in the unbiased second nanostructure. The results can be qualitatively explained in terms of acoustic phonon based energy transfer between the two mutually isolated circuits.

  4. Enteroenteroanastomosis near adjacent ileocecal valve in infants

    Institute of Scientific and Technical Information of China (English)

    Wei-Wei Jiang; Xiao-Qun Xu; Qi-Ming Geng; Jie Zhang; Huan Chen; Xiao-Feng Lv; Chang-Gui Lu

    2012-01-01

    AIM:To investigate the feasibility and the effectiveness of ileoileostomy in the region adjacent to the ileocecal valve,which can retain the ileocecal valve in infants.METHODS:This is a retrospective review of 48 patients who underwent ileoileostomy in the region adjacent to the ileocecal valve (group 1) and 34 patients who underwent ileocecal resections and ileotransversanastomosis (group 2).Patients were monitored for the time to flatus,resumption of eating,length of hospital stay after surgery,serum total bile acid,vitamin B12 and postoperative complications.RESULTS:The time to flatus,time until resumption of eating and post-operative length of hospital stay showed no statistically significant differences between the two groups.Serum total bile acid and vitamin B12 were not significantly different between the two groups at post-operative day 1 and day 3,but were significantly decreased at 1 wk after operation in group 2.None of the patients died or suffered from stomal leak in these two groups.However,the incidence of diarrhea,intestinal infection,disturbance of acid-base balance and water-electrolytes in group 1 was lower than in group 2.CONCLUSION:Ileoileostomy in the region adjacent to the ileocecal valve is safe and results in fewer complications than ileotransversanastomosis in infants.

  5. Adjacent Segment Pathology after Anterior Cervical Fusion.

    Science.gov (United States)

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-06-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion.

  6. Biophysical characteristics of skin in mild to moderate acne%轻中度痤疮患者皮肤生理参数特征

    Institute of Scientific and Technical Information of China (English)

    吴琰瑜; 王学民; 程英; 谈益妹; 袁超

    2011-01-01

    Objective To assess the biophysical characteristics of normal skin and inflammatory skin lesions in mild and moderate acne. Methods Seventy-five mild and moderate acne vulgaris patients were included in the study. One inflammatory lesion measuring 2.0 to 5.0 mm in diameter which occurred within 48 hours prior to the measurement was selected as the target lesion. Trans-epidermis water loss (TEWL), capacitance and a* value were measured in target lesions and lesion-adjacent normal skin. Sebum content immediately,1 and 4 (saturated) hours after face washing was also determined on target lesions and central forehead between the eyebrows. Sebum secretion rate (SSR) was calculated. Results The TEWL and SSR significantly increased in the lesion-adjacent normal skin with the increment of inflammatory lesion number (both P < 0.05), and increased in target lesions with the elevation of a* value (both P < 0.05). The target lesions exhibited a significantly higher TEWL but a lower saturated sebum content and SSR than the adjacent normal skin did (all P <0.05). Conclusions The severity of inflammatory lesions is correlated with the impaired barrier function and increased SSR in facial skin. Compared with the adjacent normal skin, inflammatory skin lesions have a reduced skin barrier function and SSR.%目的 探讨轻中度痤疮患者正常部位皮肤及炎性皮疹部位生理参数的特征.方法 75例轻中度寻常痤疮受试者.每例受试者选择在48 h内出现,直径在2.0~5.0 mm之间的炎性皮疹作为靶皮疹.对靶皮疹及临近靶皮疹的正常部位皮肤进行经表皮失水率、表皮含水量及a*值的检测.洁面后即刻皮脂量、洁面后1 h皮脂量、皮脂饱和值在靶皮疹及双眉之间的额部进行检测并计算皮脂分泌速率.结果 随着患者面部炎性丘疹数量的增加,痤疮患者正常部位皮肤的经表皮失水率、皮脂分泌速率显著增高(P<0.05).随着皮疹a*值的增高,皮疹部位经表皮失水

  7. Learning about Skin Cancer

    Science.gov (United States)

    ... Why Deadly Skin Cancers Spread 2000 News Release Learning About Skin Cancer What are the most common ... skin surface. When a melanoma becomes thick and deep, the disease often spreads to other parts of ...

  8. Skin care and incontinence

    Science.gov (United States)

    Incontinence - skin care ... or bowels (called incontinence) are at risk of skin problems around the buttocks, hips, genitals, and the ... rectum (perineum). Excess moisture in these areas makes skin problems such as redness, peeling, irritation, and yeast ...

  9. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H;

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved......, melanocytes, fibroblasts, dermal microvascular endothelial cells, peripheral blood mononuclear cells and sweat duct cells. The keratinocyte 2-D gel protein database will be updated yearly in the November issue of Electrophoresis. Udgivelsesdato: 1991-Nov...

  10. Animal models of skin regeneration.

    Science.gov (United States)

    Gawronska-Kozak, Barbara; Grabowska, Anna; Kopcewicz, Marta; Kur, Anna

    2014-03-01

    Cutaneous injury in the majority of vertebrate animals results in the formation of a scar in the post-injured area. Scar tissues, although beneficial for maintaining integrity of the post-wounded region often interferes with full recovery of injured tissues. The goal of wound-healing studies is to identify mechanisms to redirect reparative pathways from debilitating scar formation to regenerative pathways that lead to normal functionality. To perform such studies models of regeneration, which are rare in mammals, are required. In this review we discussed skin regenerative capabilities present in lower vertebrates and in models of skin scar-free healing in mammals, e.g. mammalian fetuses. However, we especially focused on the attributes of two unusual models of skin scar-free healing capabilities that occur in adult mammals, that is, those associated with nude, FOXN1-deficient mice and in wild-type African spiny mice.

  11. Kauffman's adjacent possible in word order evolution

    CERN Document Server

    Ferrer-i-Cancho, Ramon

    2015-01-01

    Word order evolution has been hypothesized to be constrained by a word order permutation ring: transitions involving orders that are closer in the permutation ring are more likely. The hypothesis can be seen as a particular case of Kauffman's adjacent possible in word order evolution. Here we consider the problem of the association of the six possible orders of S, V and O to yield a couple of primary alternating orders as a window to word order evolution. We evaluate the suitability of various competing hypotheses to predict one member of the couple from the other with the help of information theoretic model selection. Our ensemble of models includes a six-way model that is based on the word order permutation ring (Kauffman's adjacent possible) and another model based on the dual two-way of standard typology, that reduces word order to basic orders preferences (e.g., a preference for SV over VS and another for SO over OS). Our analysis indicates that the permutation ring yields the best model when favoring pa...

  12. Hyperspectral imaging of bruised skin

    Science.gov (United States)

    Randeberg, Lise L.; Baarstad, Ivar; Løke, Trond; Kaspersen, Peter; Svaasand, Lars O.

    2006-02-01

    Bruises can be important evidence in legal medicine, for example in cases of child abuse. Optical techniques can be used to discriminate and quantify the chromophores present in bruised skin, and thereby aid dating of an injury. However, spectroscopic techniques provide only average chromophore concentrations for the sampled volume, and contain little information about the spatial chromophore distribution in the bruise. Hyperspectral imaging combines the power of imaging and spectroscopy, and can provide both spectroscopic and spatial information. In this study a hyperspectral imaging system developed by Norsk Elektro Optikk AS was used to measure the temporal development of bruised skin in a human volunteer. The bruises were inflicted by paintball bullets. The wavelength ranges used were 400 - 1000 nm (VNIR) and 900 - 1700 nm (SWIR), and the spectral sampling intervals were 3.7 and 5 nm, respectively. Preliminary results show good spatial discrimination of the bruised areas compared to normal skin. Development of a white spot can be seen in the central zone of the bruises. This central white zone was found to resemble the shape of the object hitting the skin, and is believed to develop in areas where the impact caused vessel damage. These results show that hyperspectral imaging is a promising technique to evaluate the temporal and spatial development of bruises on human skin.

  13. Malassezia skin diseases in humans.

    Science.gov (United States)

    Difonzo, E M; Faggi, E; Bassi, A; Campisi, E; Arunachalam, M; Pini, G; Scarfì, F; Galeone, M

    2013-12-01

    Although Malassezia yeasts are a part of the normal microflora, under certain conditions they can cause superficial skin infection, such as pityriasis versicolor (PV) and Malassezia folliculitis. Moreover the yeasts of the genus Malassezia have been associated with seborrheic dermatitis and dandruff, atopic dermatitis, psoriasis, and, less commonly, with confluent and reticulated papillomatosis, onychomycosis, and transient acantholytic dermatosis. The study of the clinical role of Malassezia species has been surrounded by controversy due to the relative difficulty in isolation, cultivation, and identification. This review focuses on the clinical, mycologic, and immunologic aspects of the various skin diseases associated with Malassezia. Moreover, since there exists little information about the epidemiology and ecology of Malassezia species in the Italian population and the clinical significance of these species is not fully distinguished, we will report data about a study we carried out. The aim of our study was the isolation and the identification of Malassezia species in PV-affected skin and non-affected skin in patients with PV and in clinically healthy individuals without any Malassezia associated skin disease. PMID:24442041

  14. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  15. Dry Skin (Xerosis)

    Science.gov (United States)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases ... Dry skin public SPOT Skin Cancer™ Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases ...

  16. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  17. Skin Cancer Prevention

    Science.gov (United States)

    ... the lower part of the epidermis. They make melanin , the pigment that gives skin its natural color. When skin is exposed to the sun, melanocytes make more pigment, causing the skin to tan, or darken. The dermis contains blood and lymph vessels , hair follicles , and glands . Enlarge Anatomy of the skin, ...

  18. Stiff skin syndrome.

    Science.gov (United States)

    Geng, S; Lei, X; Toyohara, J P; Zhan, P; Wang, J; Tan, S

    2006-07-01

    Stiff skin syndrome is a rare disorder characterized by pronounced skin induration, mild hypertrichosis and limited joint mobility, predominantly on the buttocks and thighs. Many heterogeneous cases have been reported under the name of stiff skin syndrome. We present a case of stiff skin syndrome from China, the diagnosis based on the patient's typical clinical and histopathological features. PMID:16836505

  19. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test ... There are three common methods of allergy skin testing. The skin prick test involves: Placing a small amount of substances that may be causing your symptoms on the skin, most often ...

  20. Risks of Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease in ...

  1. Detecting Adjacent Relativity of Engineering Drawing Entities with Container Window

    Institute of Scientific and Technical Information of China (English)

    林福严; 邱友申; 秦吉胜

    2001-01-01

    Automatic recognition and interpretation of engineering drawing plays an important role in computer aided engineering. Detecting the positional relation between entities is an important topic in this research field. In this paper the concepts of adjacent relativity and container window of drawing entities were proposed. By means of container window, the adjacent irrelative entities can be detected quickly and effectively, which speeds up the process of adjacent relativity detection. Meanwhile, the algorithm of adjacent relativity detection was discussed.

  2. Conjunctival and cutaneous fungal flora in clinically normal dogs in southern France.

    Science.gov (United States)

    Verneuil, M; Durand, B; Marcon, C; Guillot, J

    2014-03-01

    The objectives of the present study were to describe the fungal flora of the conjunctiva in clinically normal dogs in southern France and to compare the fungal flora from the conjunctiva and that from adjacent skin areas (medial canthus and nose). Fifty dogs aged from 5 months to 13 years were investigated for conjunctival fungal flora. Specimens were obtained from both conjunctivae and the skin of the medial canthus and from the surface of the nose using sterile cotton-wool swabs and a piece of sterile carpet, respectively. Identification of fungal colonies was achieved recording the genus level on the basis of macro- and microscopic features. Fourteen fungal genera (most frequently Alternaria, Cladosporium, Penicillium and Aspergillus) were isolated from the conjunctival fornix of 7 dogs (14%). There was no significant effect of sex or age on frequency of fungal isolation. Eleven dogs (22%) had a positive mycological culture from at least one eye. Fungi found in the conjunctival fornix of dogs might represent transient seeding from the environment, as suspected in other animal species. The presence of conjunctival fungal organisms was correlated to the presence of fungi on the skin.

  3. Seismicity in Azerbaijan and Adjacent Caspian Sea

    International Nuclear Information System (INIS)

    So far no general view on the geodynamic evolution of the Black Sea to the Caspian Sea region is elaborated. This is associated with the geological and structural complexities of the region revealed by geophysical, geochemical, petrologic, structural, and other studies. A clash of opinions on geodynamic conditions of the Caucasus region, sometimes mutually exclusive, can be explained by a simplified interpretation of the seismic data. In this paper I analyze available data on earthquake occurrences in Azerbaijan and the adjacent Caspian Sea region. The results of the analysis of macroseismic and instrumental data, seismic regime, and earthquake reoccurrence indicate that a level of seismicity in the region is moderate, and seismic event are concentrated in the shallow part of the lithosphere. Seismicity is mostly intra-plate, and spatial distribution of earthquake epicenters does not correlate with the plate boundaries

  4. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    International Nuclear Information System (INIS)

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  5. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    Energy Technology Data Exchange (ETDEWEB)

    Woodward, Ruth M [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom); Cole, Bryan E [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Wallace, Vincent P [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Pye, Richard J [Department of Dermatology, Addenbrooke' s Hospital, Cambridge (United Kingdom); Arnone, Donald D [TeraView Limited, 302/304 Cambridge Science Park, Milton Road, Cambridge (United Kingdom); Linfield, Edmund H [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom); Pepper, Michael [Cavendish Laboratory, University of Cambridge, Madingley Road, Cambridge (United Kingdom)

    2002-11-07

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo.

  6. Electrochemical Skin Conductance Correlates with Skin Nerve Fiber Density

    Directory of Open Access Journals (Sweden)

    Peter Novak

    2016-08-01

    Full Text Available Purpose: Electrochemical skin conductance (ESC using reverse iontophoresis and chronoamperometry has been used to evaluate abnormal function of small fibers. How ESC correlates with loss of small fibers in skin is unclear.Methods: This was a prospective, blinded study. The primary outcome measure was the correlation between ESC at the feet and results of skin biopsies including epidermal nerve fiber density (ENFD and sweat gland nerve fiber density (SGNFD at the distal leg. ESC, ENFD and SGNFD data were normalized by adjusting for weight. The secondary outcome measures were the correlation between ESC and the following variables: quantitative sudomotor axon reflex test (QSART and symptom scales (neuropathy, pain and autonomic.Results: 81 patients ((mean±sd: age=53.3±17.3, men/women=25/56 were enrolled in the study. ESC was reduced in subjects with abnormally low ENFD (ENFD normal/abnormal, ESC = 1.17±0.27/0.87±0.34 µSiemens/kg, p<0.0008 and abnormally low SGNFD (SGNFD normal/abnormal ESC=1.09±0.34/,0.78±0.3 µSiemens/kg,p<0.0003. ESC correlated with ENFD (ρ=0.73, p=0.0001 and SGNFD (ρ=0.64, p=0.0001. ESC did not correlate with symptom scales. Conclusion: ESC is diminished in subjects who have a reduced number of small fibers in the skin and the ESC reduction is proportional to ENFD and SGNFD. ESC can be useful in detecting loss of small nerve fibers.

  7. Electrochemical Skin Conductance Correlates with Skin Nerve Fiber Density

    Science.gov (United States)

    Novak, Peter

    2016-01-01

    Purpose: Electrochemical skin conductance (ESC) using reverse iontophoresis and chronoamperometry has been used to evaluate abnormal function of small fibers. How ESC correlates with loss of small fibers in skin is unclear. Methods: This was a prospective, blinded study. The primary outcome measure was the correlation between ESC at the feet and results of skin biopsies including epidermal nerve fiber density (ENFD) and sweat gland nerve fiber density (SGNFD) at the distal leg. ESC, ENFD, and SGNFD data were normalized by adjusting for weight. The secondary outcome measures were the correlation between ESC and the following variables: quantitative sudomotor axon reflex test (QSART) and symptom scales (neuropathy, pain and autonomic). Results: Eighty-one patients (mean ± sd): age = 53.3 ± 17.3, men/women = 25/56 were enrolled in the study. ESC was reduced in subjects with abnormally low ENFD (ENFD normal/abnormal, ESC = 1.17 ± 0.27/0.87 ± 0.34 μSiemens/kg, p < 0.0008) and abnormally low SGNFD (SGNFD normal/abnormal ESC = 1.09 ± 0.34/0.78 ± 0.3 μSiemens/kg, p < 0.0003). ESC correlated with ENFD (ρ = 0.73, p = 0.0001) and SGNFD (ρ = 0.64, p = 0.0001). ESC did not correlate with symptom scales. Conclusion: ESC is diminished in subjects who have a reduced number of small fibers in the skin and the ESC reduction is proportional to ENFD and SGNFD. ESC can be useful in detecting loss of small nerve fibers. PMID:27605912

  8. Brown bullhead (Ameiurus nebulosus) skin carcinogenesis.

    Science.gov (United States)

    Bunton, T E

    2000-06-01

    Alternative models using fish species have been tested in liver toxicity and carcinogenesis bioassays. Similar models have not been developed for skin. The brown bullhead (Ameiurus nebulosus) has shown potential as a model for skin carcinogenesis studies due to its sensitivity to environmental chemical pollutants. The present study is an initial morphologic and biochemical characterization of the normal and neoplastic brown bullhead skin to assess its suitability as a model of skin carcinogenesis. Brown bullhead were removed from Back River in the Chesapeake Bay region, an area historically polluted with heavy metals and polycyclic aromatic hydrocarbons. Histology, histochemistry, and electron microscopy were used to stage the morphologic development and progression of neoplasia in skin. The distribution of keratin, a family of structural proteins with altered expression in mammalian tumorigenesis, was analyzed with one and two dimensional gel electrophoresis and nitrocellulose blots of extracts from normal skin. Keratin expression in skin and other organs was also assessed with immunohistochemistry using AE1, AE3, and PCK 26 antibodies, and the proliferation index in skin and neoplasms with PCNA antibody. Skin lesions appeared to progress from hyperplasia through carcinoma, and the proliferation index was increased in papilloma. Also in papilloma, intercellular interdigitations appeared increased and desmosomes decreased which may in future studies correlate with changes in expression of other molecular markers of neoplastic progression. Both Type I and Type II keratin subfamilies were detected in skin using gel electrophoresis with the complimentary keratin blot-binding assay. For further development of the brown bullhead model, future studies can compare and relate these baseline data to alterations in expression of keratin and other markers in fish neoplasms and to molecular events which occur in man. PMID:10930121

  9. Ribosomal protein s6-ps240 is expressed in lesional skin from patients with autoimmune skin blistering diseases

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-01-01

    Full Text Available Background: The in situ signaling transduction within skin biopsies from patients affected by autoimmune skin blistering diseases is not well-characterized. Aim : In autoimmune skin blistering diseases, autoantibodies seem to trigger several intracellular signaling pathways and we investigated the presence of the phosphorylated form of ribosomal protein S6-pS240 within autoimmune skin blistering diseases biopsies. Materials and Methods: We utilized immunohistochemistry to evaluate the presence of S6-pS240 in lesional skin biopsies of patients affected by autoimmune skin blistering diseases including patients with an endemic and nonendemic pemphigus foliaceus (non EPF, with bullous pemphigoid (BP, pemphigus vulgaris (PV, dermatitis herpetiformis (DH, and the respective controls. Results: Most autoimmune bullous skin diseases biopsies stained positive for S6-pS240 around lesional blisters, including adjacent areas of the epidermis; and within upper dermal inflammatory infiltrates, and/or mesenchymal-endothelial cell junctions within the dermis. Conclusions: We document that S6-pS240 is expressed in lesional areas of skin biopsies from patients with autoimmune skin blistering diseases, as well as on eccrine glands and piloerector muscles. Thus, the role of this molecule in autoimmune skin blistering diseases warrants further study.

  10. [Sarcoidosis of the skin].

    Science.gov (United States)

    Suga, Y; Ogawa, H

    1994-06-01

    Sarcoidosis is characterized by formation of epithelioid-cell tubercules, without caseation, of the affected organ systems. The mediastinum, peripheral lymph nodes and eyes, in addition to the skin, are most frequently affected. Between 10% and 30% of patients with systemic sarcoidosis in Japan have skin lesions. Skin sarcoidosis is morphologically classified into three basic groups, erythema nodosum, scar sarcoidosis and skin sarcoid. Skin sarcoid is characterized by specific cutaneous lesions of sarcoidosis, and may take nodular, plaque, angiolupoid, subcutaneous and some other forms. Clinical manifestations of the cutaneous lesions are usually asymptomatic and polymorphous. Skin biopsy is, however, often highly useful for confirming a diagnosis of sarcoidosis.

  11. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini;

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)...

  12. EGFR-inhibitors, radiotherapy and normal tissue toxicity

    DEFF Research Database (Denmark)

    Eriksen, J. G.

    2015-01-01

    EGFR-inhibitors have been used in several clinical settings during the last decade and side-effects related to normal tissues like the skin, mucosa and kidney has been well described. However, when EGFR-inhibitors are combined with radiotherapy, then different skin and mucosa toxicity profiles can...... variations that are shared between tumour and normal tissue like skin and mucosa. At present, it is not possible to predict which patients that will develop severe skin toxicity and thereby potentially benefit from EGFRinhibition in terms of tumour response. However, emerging data suggests that certain...

  13. Interaction between Adjacent Lightning Discharges in Clouds

    Institute of Scientific and Technical Information of China (English)

    WANG Yanhui; ZHANG Guangshu; ZHANG Tong; LI Yajun; WU Bin; ZHANG Tinglong

    2013-01-01

    Using a 3D lightning radiation source locating system (LLS),three pairs of associated lightning discharges (two or more adjacent lightning discharges following an arbitrary rule that their space-gap was less than 10 km and their time-gap was less than 800 ms) were observed,and the interaction between associated lightning discharges was analyzed.All these three pairs of associated lightning discharges were found to involve three or more charge regions (the ground was considered as a special charge region).Moreover,at least one charge region involved two lightning discharges per pair of associated lightning discharges.Identified from electric field changes,the subsequent lightning discharges were suppressed by the prior lightning discharges.However,it is possible that the prior lightning discharge provided a remaining discharge channel to facilitate the subsequent lightning discharge.The third case provided evidence of this possibility.Together,the results suggested that,if the charges in the main negative charge region can be consumed using artificial lightning above the main negative charge regions,lightning accidents on the ground could be greatly reduced,on the condition that the height of the main negative charge region and the charge intensity of the lower positive charge region are suitable.

  14. Remodeling in myocardium adjacent to an infarction in the pig left ventricle.

    Science.gov (United States)

    Zimmerman, Scott D; Criscione, John; Covell, James W

    2004-12-01

    Changes in the structure of the "normal" ventricular wall adjacent to an infarcted area involve all components of the myocardium (myocytes, fibroblasts and the extracellular matrix, and the coronary vasculature) and their three-dimensional structural relationship. Assessing changes in these components requires tracking material markers in the remodeling tissue over long periods of time with a three-dimensional approach as well as a detailed histological evaluation of the remodeled structure. The purpose of the present study was to examine the hypotheses that changes in the tissue adjacent to an infarct are related to myocyte elongation, myofiber rearrangement, and changes in the laminar architecture of the adjacent tissue. Three weeks after myocardial infarction, noninfarcted tissue adjacent to the infarct remodeled by expansion along the direction of the fibers and in the cross fiber direction. These changes are consistent with myocyte elongation and myofiber rearrangement (slippage), as well as a change in cell shape to a more elliptical cross section with the major axis in the epicardial tangent plane, and indicate that reorientation of fibers either via "cell slippage" or changes in orientation of the laminar structure of the ventricular wall are quantitatively important aspects of the remodeling of the normally perfused myocardium.

  15. Healthy Skin Matters

    Science.gov (United States)

    ... your health, talk to your doctor or a physical therapist to find out what kinds of activities are ... the treatment of diseases of the skin. Follicle (FALL-lick-el). The opening in the skin where ...

  16. Dry Skin Relief

    Science.gov (United States)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  17. CSD skin test

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003385.htm CSD skin test To use the sharing features on this page, please enable JavaScript. The cat scratch disease (CSD) skin test was once used to help ...

  18. Squamous cell skin cancer

    Science.gov (United States)

    ... earliest form of squamous cell cancer is called Bowen disease (or squamous cell carcinoma in situ). This type ... cancer; Squamous cell carcinoma of the skin Images Bowen's disease on the hand Keratoacanthoma Keratoacanthoma Skin cancer, squamous ...

  19. Skin Cancer Trends

    Science.gov (United States)

    ... Search The CDC Cancel Submit Search The CDC Skin Cancer Note: Javascript is disabled or is not supported ... Cervical Colorectal (Colon) Lung Ovarian Prostate Cancer Home Skin Cancer Trends Language: English Español (Spanish) Recommend on Facebook ...

  20. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    Purpose of review: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. Recent findings: Advances in computing and high-throughput sequencing technolog

  1. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.J.M.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    PURPOSE OF REVIEW: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. RECENT FINDINGS: Advances in computing and high-throughput sequencing technolog

  2. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Experts do not agree on whether or not skin self-exams should be performed. So there is ...

  3. Skin as a potential source of infectious foot and mouth disease aerosols

    OpenAIRE

    Dillon, Michael B.

    2011-01-01

    This review examines whether exfoliated, virus-infected animal skin cells could be an important source of infectious foot and mouth disease virus (FMDV) aerosols. Infectious material rafting on skin cell aerosols is an established means of transmitting other diseases. The evidence for a similar mechanism for FMDV is: (i) FMDV is trophic for animal skin and FMDV epidermis titres are high, even in macroscopically normal skin; (ii) estimates for FMDV skin cell aerosol emissions appear consistent...

  4. Large field of view multiphoton microscopy of human skin

    Science.gov (United States)

    Balu, Mihaela; Mikami, Hideharu; Hou, Jue; Potma, Eric O.; Tromberg, Bruce J.

    2016-03-01

    Clinical examination crucially relies on the ability to quickly examine large tissue areas and rapidly zoom in to regions of interest. Skin lesions often show irregularity in color and appearance in general, especially when they start to progress towards malignancy. Large field of view (FOV) and automatic translation of the imaging area are critical in the assessment of the entire lesion. Imaging of limited FOVs of the lesion can easily result in false negative diagnosis. We present a multiphoton microscope based on two-photon excited fluorescence and second-harmonic generation that images FOVs of about 0.8 mm2 (without stitching adjacent FOVs) at speeds of 10 frames/second (800 x 800 pixels) with lateral and axial resolutions of 0.5 μm and 2.5 μm, respectively. The main novelty of this instrument is the design of the scan head, which includes a fast galvanometric scanner, relay optics, a beam expander and a high NA objective lens. We optimized the system based on the Olympus 25x, 1.05NA water immersion lens, that features a long working distance of 1 mm. Proper tailoring of the beam expander, which consists of the scan and tube lens elements, enables scaling of the FOV. The design criteria include a flat wavefront of the beam, minimum field curvature, and suppressed spherical aberrations. All aberrations in focus are below the Marechal criterion of 0.07λ rms for diffraction-limited performance. We demonstrate the practical utility of this microscope by ex-vivo imaging of wide FOVs in normal human skin.

  5. Mycologic disorders of the skin.

    Science.gov (United States)

    Outerbridge, Catherine A

    2006-08-01

    Cutaneous tissue can become infected when fungal organisms contaminate or colonize the epidermal surface or hair follicles. The skin can be a portal of entry for fungal infection when the epithelial barrier is breached or it can be a site for disseminated, systemic fungal disease. The two most common cutaneous fungal infections in small animals are dermatophytosis and Malassezia dermatitis. Dermatophytosis is a superficial cutaneous infection with one or more of the fungal species in the keratinophilic genera Microsporum, Trichophyton, or Epidermophyton. Malassezia pachydermatis is a nonlipid dependent fungal species that is a normal commensal inhabitant of the skin and external ear canal in dogs and cats. Malassezia pachydermatis is the most common cause of Malassezia dermatitis. The diagnosis and treatment of these cutaneous fungal infections will be discussed. PMID:16933479

  6. Analysis of adjacent segment reoperation after lumbar total disc replacement

    OpenAIRE

    Rainey, Scott; Blumenthal, Scott L.; Zigler, Jack E.; Guyer, Richard D.; Ohnmeiss, Donna D.

    2012-01-01

    Background Fusion has long been used for treating chronic back pain unresponsive to nonoperative care. However, potential development of adjacent segment degeneration resulting in reoperation is a concern. Total disc replacement (TDR) has been proposed as a method for addressing back pain and preventing or reducing adjacent segment degeneration. The purpose of the study was to determine the reoperation rate at the segment adjacent to a level implanted with a lumbar TDR and to analyze the pre-...

  7. 生理盐水联合酒精应用的不同方式对皮试消毒的效果分析%An Analysis on Effect of Different Application Ways of Normal Saline plus Alcohol on Skin Test

    Institute of Scientific and Technical Information of China (English)

    罗艳; 孔碧华; 李冬芬

    2015-01-01

    Objective:To study the sterilizing effect of different application ways of sodium chloride(0 .9% ) plus alcohol(75% ) in the area of skin test .Methods:Select a total of 600 cases of patients who were infused in clinic and has to have a allergy skin test of tetanus antitoxin in some hospital during the period from January 2013 to December , randomly divide them into wiping group and spraying group .The wiping group were wiped with sodium chloride (0 .9% ) firstly ,and then were sterilized with alcohol(75% ) in the same way ,finally took the skin test .The spraying group were sterilized with alcohol(75% ) in the same way above first ,and then were sprayed with the spray bottle containing sodium chloride(0 .9% ) towards the area wiped with alcohol ,dry the sterilized area with sterile swabs and take the skin test .20 minutes later ,Compare and observe the false positive rate after skin test ,infection rate ,the prev‐alence of anaphylactic reaction after medication in the two groups ,sterilizing quantity in sterilized area .Results:False positive rate of the wiping group and spraying group was 0 .7% and 3 .3 respectively (P< 0 .05) .None of them showed any skin infection and allergy in both group .As for the quantity of sterilized bacteria in the two groups after medicating ,the quantity of the wiping group was less than that of spraying group ,the difference was comparatively obvious (P<0 .05) .Conclusion:The safety application of the wipe and spray of normal saline plus and alcohol in the sterilization of skin test lower the false positive rate resulted from skin sanitizer ,alleviate patients'suffering and it is more effective ,saves health resources ,reduces the workload and improves clinical working efficiency .%目的:探讨运用0.9%氯化钠(即生理盐水)联合75%乙醇应用的不同方式对皮试区皮肤消毒效果的研究。方法:选取某院2013年1~12月的门诊输液需进行过伤风抗病毒素过敏皮试的患者共600

  8. Anyone Can Get Skin Cancer

    Science.gov (United States)

    No matter if your skin is light, dark, or somewhere in between, everyone is at risk for skin cancer. Learn what skin cancer looks like, how to find it early, and how to lower the chance of skin cancer.

  9. What Is Melanoma Skin Cancer?

    Science.gov (United States)

    ... statistics for melanoma skin cancer What is melanoma skin cancer? Cancer starts when cells in the body begin ... causing the skin to tan or darken. Melanoma skin cancers Melanoma is a cancer that begins in the ...

  10. PIV Measurements and Mechanisms of Adjacent Synthetic Jets Interactions

    Institute of Scientific and Technical Information of China (English)

    LUO Zhen-Bing; XIA Zhi-Xun

    2008-01-01

    Interactions of adjacent synthetic jet actuators with varying relative amplitude and the relative phase of driving voltage are measured using a particle image velocimetry(PIV).Varying relative amplitude or relative phase of driving voltage of the adjacent actuators vectors the direction of the ensuing merged jet of the adjacent synthetic jets.The vectoring mechanism of the adjacent vortex pairs,attract-impact causing deflection(AICD),is provided to explain why the merged jet is generally vectored to the side of the phase-leading synthetic jet or the synthetic jet with higher driving voltage.

  11. Impact of electromechanical parameter variations in treatment volume doses and adjacent structures

    International Nuclear Information System (INIS)

    ICRU Report 62 recommends that radiotherapy treatment dose should be prescribed in such a way that the dose to the target volume varies no more than 10%. In order to keep this goal, a very important role is played by the quality assurance (QA) of the treatment unit associated to the high level work of the personnel involved in planning and patient treatment. This paper shows the influence of the main electrical and mechanical linear accelerator parameters: field size, source-skin distance, gantry angle and light x radiation field coincidence in tumor volume and adjacent organ doses. We simulated a cubic tumor and a cubic adjacent critical organ in a cubic phantom and used a 3D Prowess system for planning. The treatment has been simulated for a 6 MV linear accelerator. We simulated two treatment planning: one using all the parameters inside their tolerance limits and another doubling these limits. The final results have show that, if the irradiation machine operates out of the tolerance limits, the dose variation in the planning target volume (PTV) can goes till ± 5,8% and in the critical adjacent organ till ± 7,7%. Therefore we concluded that, according to the complexity of the treatment, it can be necessary to reduce the tolerance levels advised by the IAEA/TECDOC - 1151. (author)

  12. Normal saline wound dressing--is it really normal?

    Science.gov (United States)

    Lim, J K; Saliba, L; Smith, M J; McTavish, J; Raine, C; Curtin, P

    2000-01-01

    Gauze swabs soaked in normal saline are frequently used as dressing on open wounds. Their exact mechanism of action is not known. This study was designed to assess the hypothesis that normal saline dressings act in part as an osmotic dressing. Ten patients had skin ulcers (n = 10) dressed with normal saline soaked sponges. Acting as controls (n = 10) identical sponges were placed upon intact skin. The sponge fluid osmolarity and electrolyte concentrations were serially assayed to test our hypothesis. In the control group, the osmolarity, sodium and chloride concentrations increased with time as a result of evaporation, altering it from an isotonic to a hypertonic dressing. However, in the ulcer group, the osmolarity, sodium and chloride concentrations in the sponge fluid remained relatively isotonic with time. This result is statistically significant (Pisotonicity. The dressing remains functional provided that the wound fluid is absorbed freely from the wound. This process is terminated when either the dressing completely absorbs the wound fluid or the dressing dries out. The latter often occurs prematurely in a contaminated wound or in a wound where exudate forms a non-permeable barrier which prevents osmosis and allows the remaining water in the dressing to evaporate completely. This correlates with the observation in clinical practice that for maximum efficacy the dressing should be changed regularly. PMID:10657448

  13. Pursuing prosthetic electronic skin.

    Science.gov (United States)

    Chortos, Alex; Liu, Jia; Bao, Zhenan

    2016-09-01

    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals. PMID:27376685

  14. Pursuing prosthetic electronic skin

    Science.gov (United States)

    Chortos, Alex; Liu, Jia; Bao, Zhenan

    2016-09-01

    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals.

  15. Skin manifestations in a case of trisomy 16 mosaicism

    DEFF Research Database (Denmark)

    Ousager, Lilian Bomme; Brandrup, Flemming; Andersen, Charlotte Brasch;

    2006-01-01

    We present a 48-year-old man with unilateral dermatological manifestations including hypertrichosis, telangiectasia, hyperkeratosis and hyperpigmentation. Additional findings included skeletal abnormalities and left-sided hearing loss. Skin biopsies showed changes characteristic of porokeratosis........ Fibroblast karyotyping from affected skin demonstrated trisomy 16 mosaicism, in contrast to the normal karyotype in unaffected skin and blood lymphocytes. The possible role of trisomy 16 in porokeratosis is discussed....

  16. Development of a Vascularized Skin Construct Using Adipose-Derived Stem Cells from Debrided Burned Skin

    OpenAIRE

    Chan, Rodney K.; Zamora, David O.; Wrice, Nicole L.; Baer, David G.; Renz, Evan M.; Christy, Robert J.; Shanmugasundaram Natesan

    2012-01-01

    Large body surface area burns pose significant therapeutic challenges. Clinically, the extent and depth of burn injury may mandate the use of allograft for temporary wound coverage while autografts are serially harvested from the same donor areas. The paucity of donor sites in patients with burns involving large surface areas highlights the need for better skin substitutes that can achieve early and complete coverage and retain normal skin durability with minimal donor requirements. We have i...

  17. Clinical efficacy of artificial skin combined with vacuum sealing drainage in treating large-area skin defects

    Institute of Scientific and Technical Information of China (English)

    TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao

    2010-01-01

    Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.

  18. On spectral hypergraph theory of the adjacency tensor

    OpenAIRE

    Pearson, Kelly J.; Zhang, Tan

    2012-01-01

    We study both $H$ and $E/Z$-eigenvalues of the adjacency tensor of a uniform multi-hypergraph and give conditions for which the largest positive $H$ or $Z$-eigenvalue corresponds to a strictly positive eigenvector. We also investigate when the $E$-spectrum of the adjacency tensor is symmetric.

  19. A semiconductor silicon PIN diode matrix detector for measurement of 133Xe washout in small regional skin areas.

    Science.gov (United States)

    Jensen, J H; Sørensen, J L; Hauge, E N; Sejrsen, P; Bojsen, J

    1993-05-01

    Local variations in microvascularization are expected in lesions and lesion-free skin of patients with pressure sores. To investigate these variations, methods for studies of the regional blood flow rate within small skin areas are needed. Regional blood flow can be estimated by measuring the washout of 133Xe from the tissue. This study describes a 2 x 12 Si PIN diode matrix detector capable of 133Xe detection, and equipped with a collimator to improve the spatial resolution. Thus the regional blood flow in subcutaneous skin areas down to about 2 cm2 can be investigated when the atraumatic epicutaneous labelling technique is used. The capability of the matrix detector and its collimator is described by laboratory investigations. In pilot investigations three normal subjects and three paraplegics with pressure sores were studied. In each individual study the detector matrix was divided into six square areas containing four diode detectors each. Thus six 133Xe disappearance rate constants from adjacent subcutaneous tissue could be determined simultaneously. PMID:8334415

  20. Simultaneous spectrophotometric and mechanical property characterization of skin

    Science.gov (United States)

    Bunegin, Leonid; Moore, Jeffery B.

    2006-02-01

    Both reflectance spectroscopy and the determination Young's Modulus of skin have shown promise for identifying skin pathology. At present, these determinations are carried out using separate methodologies. This study demonstrates a new technology combining digital UV/VIS reflectance spectroscopy and vacuum aspiration for simultaneously determining the reflectance spectrum and mechanical properties of human skin tissue. A small hand held prototype device incorporating fiber-optic light guides into a vacuum channel was calibrated using various elastic materials subjected to increments of stress by vacuum from 0 to 25 in Hg. The intensity of a UV/VIS light beam reflected from the material at each vacuum increment was compared to the resulting material strain. The reflected beam was also spectrophotometrically analyzed. Skin types were similarly evaluated comparing normal and scar tissue and skin of various ages and coloration. An exponential relationship between reflected beam intensity and the amount of strain resulting from vacuum increments was observed. Young's Modulus (calculated from Aoki et. al equation) and spectra from normal skin and scar tissue were in agreement with previously published observations. Age related decreases in skin elasticity were also demonstrated. In the reflectance spectra, oxy and deoxy-hemoglobin absorbance bands were detected, becoming significantly enhanced at increased levels of vacuum. Melanin absorbance was also easily detected and appeared to correlate with skin coloration. Since superficial skin pathologies have characteristic spectroscopic and mechanical properties, this technique may provide a promising new approach for rapid, non-invasive method for the evaluation of skin lesions.

  1. Study on Optimization of Phase Offset at Adjacent Intersections

    Directory of Open Access Journals (Sweden)

    Yuanli GU

    2010-11-01

    Full Text Available Optimization of the phase offset at adjacent intersections is the key parameter regarding coordinated control of traffic signal for adjacent intersections, which decides the effect of the coordinated control for adjacent intersections. According to characters of saturated traffic flow of Chinese urban road, this thesis establishes a model for optimization of phase offset for adjacent interactions and finds a solution from such model by adopting genetic algorithm. The model is verified by actual traffic flow datum of two adjacent signal intersections on Changan Avenue. Then a comparison is made between the optimization result of such model and that of the existing mathematical method and SYNCHRO model, which indicates that the model established by this thesis can reduce the delay suffered by vehicles at the intersections and increase the traffic efficiency of the intersections.

  2. In vivo study of human skin using pulsed terahertz radiation

    Energy Technology Data Exchange (ETDEWEB)

    Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)

    2004-05-07

    Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.

  3. Use of autologous tissue engineered skin to treat porcine full-thickness skin defects

    Institute of Scientific and Technical Information of China (English)

    CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang

    2005-01-01

    Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.

  4. Archaea on human skin

    OpenAIRE

    Alexander J Probst; Auerbach, Anna K.; Christine Moissl-Eichinger

    2013-01-01

    The recent era of exploring the human microbiome has provided valuable information on microbial inhabitants, beneficials and pathogens. Screening efforts based on DNA sequencing identified thousands of bacterial lineages associated with human skin but provided only incomplete and crude information on Archaea. Here, we report for the first time the quantification and visualization of Archaea from human skin. Based on 16 S rRNA gene copies Archaea comprised up to 4.2% of the prokaryotic skin mi...

  5. Skin tribology: Science friction?

    OpenAIRE

    Heide, van der, M.; X. Zeng; Masen, M.A.

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is frequently one of the interacting surfaces in relative motion. People seem to solve these problems related to skin friction based upon a trial-and-error strategy and based upon on our sense for touch....

  6. Skin Images Segmentation

    Directory of Open Access Journals (Sweden)

    Ali E. Zaart

    2010-01-01

    Full Text Available Problem statement: Image segmentation is a fundamental step in many applications of image processing. Skin cancer has been the most common of all new cancers detected each year. At early stage detection of skin cancer, simple and economic treatment can cure it mostly. An accurate segmentation of skin images can help the diagnosis to define well the region of the cancer. The principal approach of segmentation is based on thresholding (classification that is lied to the problem of the thresholds estimation. Approach: The objective of this study is to develop a method to segment the skin images based on a mixture of Beta distributions. We assume that the data in skin images can be modeled by a mixture of Beta distributions. We used an unsupervised learning technique with Beta distribution to estimate the statistical parameters of the data in skin image and then estimate the thresholds for segmentation. Results: The proposed method of skin images segmentation was implemented and tested on different skin images. We obtained very good results in comparing with the same techniques with Gamma distribution. Conclusion: The experiment showed that the proposed method obtained very good results but it requires more testing on different types of skin images.

  7. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... Skin Rejuvenation Soft-tissue Fillers Combination: Soft-tissue Fillers and Neuromodulators Neuromodulators – wrinkle-relaxing injections of botulinum toxin commercially known as Botox, Dysport ...

  8. Interactions of adjacent pulsating, erupting and creeping solitons

    Institute of Scientific and Technical Information of China (English)

    Song Li-Jun; Li Lu; Zhou Guo-Sheng

    2007-01-01

    This paper investigates the adjacent interactions of three novel solitons for the quintic complex Ginzburg-Landau equation, which are plain pulsating, erupting and creeping solitons. It is found that different performances are presented for different solitons due to isolated regions of the parameter space where they exist. For example, plain pulsating and erupting solitons exhibit mutual annihilation during collisions with the decrease of total energy, but for creeping soliton,the two adjacent pulses present soliton fusion without any loss of energy. Otherwise, the method for restraining the interactions is also found and it can suppress interacions between these two adjacent pulses effectively.

  9. Effect of Age on Tooth Shade, Skin Color and Skin-Tooth Color Interrelationship in Saudi Arabian Subpopulation

    Science.gov (United States)

    Haralur, Satheesh B

    2015-01-01

    Background: Dental restoration or prosthesis in harmony with adjacent natural teeth color is indispensable part for the successful esthetic outcome. The studies indicate is existence of correlation between teeth and skin color. Teeth and skin color are changed over the aging process. The aim of the study was to explore the role of age on the tooth and skin color parameters, and to investigate the effect of ageing on teeth-skin color correlation. Materials and Methods: Total of 225 Saudi Arabian ethnic subjects was divided into three groups of 75 each. The groups were divided according to participant’s age. The participant’s age for Group I, Group II, and Group III was 18-29 years, 30-50 years, and above 50 years, respectively. The tooth color was identified by spectrophotometer in CIE Lab parameters. The skin color was registered with skin surface photography. The data were statistically analyzed with one-way ANOVA and correlation tests with SPSS 18 software. Results: The Group I had the highest ‘L’ value of 80.26, Group III recorded the least value of 76.66. The Group III had highest yellow value ‘b’ at 22.72, while Group I had 19.19. The skin ‘L’ value was highest in the young population; the elder population had the increased red value ‘a’ in comparison to younger subjects. The ‘L’ tooth color parameter had a strong positive linear correlation with skin color in young and adult subjects. While Group III teeth showed the strong positive correlation with ‘b’ parameter at malar region. Conclusion: The elder subjects had darker and yellow teeth in comparison with younger subjects. The reddening of the skin was observed as age-related skin color change. The age had a strong influence on the teeth-skin color correlation. PMID:26464536

  10. Shark skin: function in locomotion.

    Science.gov (United States)

    Wainwright, S A; Vosburgh, F; Hebrank, J H

    1978-11-17

    Hydrostatic pressure under the skin of sharks varies with swimming speed. Stress in the skin varies with the internal pressure, and the skin stress controls skin stiffness. Locomotory muscles attach to the skin which is thus a whole-body exotendon whose mechanical advantage in transmitting muscular contraction is greater than that of the endoskeleton. PMID:17807247

  11. Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients

    DEFF Research Database (Denmark)

    Ellingsen, A R; Sørensen, Flemming Brandt; Larsen, J O;

    2001-01-01

    with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...

  12. Use of previously burned skin as random cutaneous local flaps in pediatric burn reconstruction

    NARCIS (Netherlands)

    Barret, JP; Herndon, DN; McCauley, RL

    2002-01-01

    Reconstruction after post-burn scarring remains a challenge. It is especially true in the severely burned patient, who normally presents with a paucity of donor sites Healed skin from areas that had been burned and skin from grafted areas (termed as previously burned skin) have been occasionally use

  13. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  14. Deformable skinning on bones

    DEFF Research Database (Denmark)

    Larsen, Bent Dalgaard; Petersen, Kim Steen; Jakobsen, Bjarke

    2001-01-01

    Applying skin to a model is a relatively simple task to implement. Nonetheless it seems that no good resource exists that describes both the concepts and math necessary to understand and implement skinning. The intention of this article is an attempt to give a thoroughly description of the theore...

  15. Prevalence of Common Skin Diseases and Their Associated Factors among Military Personnel in Korea: A Cross-sectional Study

    OpenAIRE

    Bae, Jung Min; Ha, Beomman; Lee, Hongsun; Park, Chang Keun; Kim, Hyun Joon; Park, Young Min

    2012-01-01

    This study was conducted to clarify the prevalence of common skin diseases and their associated factors among military personnel in Korea. Four dermatologists visited adjacent military units and examined soldiers. A structured questionnaire that included questions about known skin diseases, demographic information, and questions for the Perceived Stress Index was completed for each participant. The soldiers that had been diagnosed with a skin disease answered one additional questionnaire (Ski...

  16. Systems of pillarless working of adjacent, sloped and inclined seams

    Energy Technology Data Exchange (ETDEWEB)

    Batmanov, Yu.K.; Bakhtin, A.F.; Bulavka, E.I.

    1979-01-01

    An analysis is made (advantages and disadvantages) of existing and recommended (pillarless) systems of working adjacent, sloped, and inclined seams. The economic benefits, area and extent of those systems are indicated. 8 references, 4 figures.

  17. Gas samples of Afghanistan and adjacent areas (gasafg.shp)

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — This shapefile contains points that describe the location of gas samples collected in Afghanistan and adjacent areas and the results of organic geochemical analysis.

  18. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  19. Pathological skin picking: case presentation and review of the literature

    Directory of Open Access Journals (Sweden)

    Maria Isabela Sarbu

    2015-04-01

    Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

  20. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  1. Hydromagnetic flow and heat transfer adjacent to a stretching vertical sheet in a micropolar fluid

    Directory of Open Access Journals (Sweden)

    Yacob Nor Azizah

    2013-01-01

    Full Text Available An analysis is carried out for the steady two-dimensional mixed convection flow adjacent to a stretching vertical sheet immersed in an incompressible electrically conducting micropolar fluid. The stretching velocity and the surface temperature are assumed to vary linearly with the distance from the leading edge. The governing partial differential equations are transformed into a system of ordinary differential equations, which is then solved numerically using a finite difference scheme known as the Keller box method. The effects of magnetic and material parameters on the flow and heat transfer characteristics are discussed. It is found that the magnetic field reduces both the skin friction coefficient and the heat transfer rate at the surface for any given K and λ. Conversely, both of them increase as the material parameter increases for fixed values of M and λ.

  2. 6 Common Cancers - Skin Cancer

    Science.gov (United States)

    ... Home Current Issue Past Issues 6 Common Cancers - Skin Cancer Past Issues / Spring 2007 Table of Contents For ... Photo: AP Photo/Herald-Mail, Kevin G. Gilbert Skin Cancer Skin cancer is the most common form of ...

  3. Skin perfusion pressure on the legs measured as the external pressure required for skin reddening after blanching

    DEFF Research Database (Denmark)

    Holstein, P; Nielsen, P.E.; Lund, P;

    1980-01-01

    The skin perfusion on the calf was measured photo-electrically and by isotope washout technique using external counter pressure by a blood pressure cuff. By the photocell the skin blanching threshold external pressure (BTEP) was recorded on histamine flared red skin. By isotope washout technique...... the skin blood flow cessation external pressure (FCEP) was recorded using intra-dermal [131I-]-antipyrine mixed with histamine in estimating the skin blood flow. The external pressure was measured with an airfilled plastic cushion connected to a mercury manometer. Over a wide range of pressures as obtained......Hg (SD 8.7). As compared to the intra-arterial blood pressure the BTEP was found to lie close to the mean blood pressure in normal subjects as well as in hypertensive subjects. The present data indicate that the skin perfusion pressure on the legs can be measured by the rapid photo-electric technique...

  4. Analysis of effect of different construction methods of piles on the end effect on skin friction of piles

    Institute of Scientific and Technical Information of China (English)

    ZHOU Hongbo; CHEN Zhuchang

    2007-01-01

    Based on the comparative analysis of end effect on skin friction of displacement-pile (driven pile),the end effect on skin friction of bored pile is studied.The end effect on skin friction between driven pile and bored pile is different and the end effect on skin friction of bored pile is reduce of skin friction in the soil layer adjacent to the pile end.The degradation degree of skin friction is deduced with the increase of the distance from pile end.The concept of additional mud cake formed by the effect of cushion at the bottom of borehole during pouring concrete is introduced to explain the mechanism of end effect on skin friction of the bored pile.The test results of post-grouting piles indicate that the post-grouting technique is an effective way to improve the end effect on skin friction of bored pile.

  5. Skin and Psyche : Diversionary Symbiosis

    OpenAIRE

    Sharma, YK; Sudarsanan, S.; Bhatnagar, A

    2005-01-01

    A significant proportion of patients with skin diseases have associated psychosocial factors. Not only does psychopathology manifest on the skin in absence of any real skin disease, primary skin disorders can also be exacerbated by emotional stress adversely influencing the homeostasis of immunological and inflammatory processes in deeper layers of the skin. Furthermore, many patients develop emotional problems as a result of having disfiguring skin diseases. In addition, some patients having...

  6. Effect observation on repairing of soft tissue defect with tissue skin flaps%组织皮瓣修复软组织缺损的效果观察

    Institute of Scientific and Technical Information of China (English)

    王占厚; 于晓姗; 王立明; 李格当

    2002-01-01

    @@ Backgroud: With the development of microsurgery and clinical applied anatomy, skin flaps and musculocutaneous flaps with vessel pedicles are primary choices in treatment of soft tissue defect. The transfer of skin flaps and muscular skin flaps with vessel pedicles is rather easy and need't special instruments. Because of utilization of adjacent tissue, the outline is good after operation.

  7. Skin and antioxidants.

    Science.gov (United States)

    Poljsak, Borut; Dahmane, Raja; Godic, Aleksandar

    2013-04-01

    It is estimated that total sun exposure occurs non-intentionally in three quarters of our lifetimes. Our skin is exposed to majority of UV radiation during outdoor activities, e.g. walking, practicing sports, running, hiking, etc. and not when we are intentionally exposed to the sun on the beach. We rarely use sunscreens during those activities, or at least not as much and as regular as we should and are commonly prone to acute and chronic sun damage of the skin. The only protection of our skin is endogenous (synthesis of melanin and enzymatic antioxidants) and exogenous (antioxidants, which we consume from the food, like vitamins A, C, E, etc.). UV-induced photoaging of the skin becomes clinically evident with age, when endogenous antioxidative mechanisms and repair processes are not effective any more and actinic damage to the skin prevails. At this point it would be reasonable to ingest additional antioxidants and/or to apply them on the skin in topical preparations. We review endogenous and exogenous skin protection with antioxidants.

  8. Archaea on human skin.

    Directory of Open Access Journals (Sweden)

    Alexander J Probst

    Full Text Available The recent era of exploring the human microbiome has provided valuable information on microbial inhabitants, beneficials and pathogens. Screening efforts based on DNA sequencing identified thousands of bacterial lineages associated with human skin but provided only incomplete and crude information on Archaea. Here, we report for the first time the quantification and visualization of Archaea from human skin. Based on 16 S rRNA gene copies Archaea comprised up to 4.2% of the prokaryotic skin microbiome. Most of the gene signatures analyzed belonged to the Thaumarchaeota, a group of Archaea we also found in hospitals and clean room facilities. The metabolic potential for ammonia oxidation of the skin-associated Archaea was supported by the successful detection of thaumarchaeal amoA genes in human skin samples. However, the activity and possible interaction with human epithelial cells of these associated Archaea remains an open question. Nevertheless, in this study we provide evidence that Archaea are part of the human skin microbiome and discuss their potential for ammonia turnover on human skin.

  9. Occupational skin cancers

    Energy Technology Data Exchange (ETDEWEB)

    Gawkrodger, D.J. [Royal Hallamshire Hospital, Sheffield (United Kingdom). Dept. of Dermatology

    2004-10-01

    Skin cancer due to occupation is more common than is generally recognized, although it is difficult to obtain an accurate estimate of its prevalence. Over the past two centuries, occupational skin cancers have particularly been due to industrial exposure of men (it seems more so than women) to chemical carcinogens such as polycyclic hydrocarbons (e.g. from coal tar products) or to arsenic. Industrial processes have improved in most Western countries to limit this type of exposure, but those with outdoor occupations are still exposed to solar ultraviolet irradiation without this being widely recognized as an industrial hazard. Ionizing radiation such as X-rays can also cause skin cancer. Occupational skin cancers often resemble skin tumours found in non-occupational subjects, e.g. basal cell carcinoma, squamous cell carcinoma and malignant melanoma, but some pre-malignant lesions can be more specific and point to an occupational origin, e.g. tar keratoses or arsenical keratoses. An uncommon but well-recognized cause of occupational skin cancer is that which results from scar formation following an industrial burn. In the future it will be necessary to focus on preventative measures, e.g. for outdoor workers, the need to cover up in the sun and use sun protective creams and a campaign for earlier recognition of skin cancers, which are usually curable if treated in their early stages.

  10. Ultrasound skin tightening.

    Science.gov (United States)

    Minkis, Kira; Alam, Murad

    2014-01-01

    Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting.

  11. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  12. In vivo multiphoton tomography of skin cancer

    Science.gov (United States)

    König, Karsten; Riemann, Iris; Ehlers, Alexander; Buckle, Rainer; Dimitrow, Enrico; Kaatz, Martin; Fluhr, Joachim; Elsner, Peter

    2006-02-01

    The multiphoton tomograph DermaInspect was used to perform first clinical studies on the early non-invasive detection of skin cancer based on non-invasive optical sectioning of skin by two-photon autofluorescence and second harmonic generation. In particular, deep-tissue pigmented lesions -nevi- have been imaged with intracellular resolution using near infrared (NIR) femtosecond laser radiation. So far, more than 250 patients have been investigated. Cancerous tissues showed significant morphological differences compared to normal skin layers. In the case of malignant melanoma, the occurrence of luminescent melanocytes has been detected. Multiphoton tomography will become a novel non-invasive method to obtain high-resolution 3D optical biopsies for early cancer detection, treatment control, and in situ drug screening.

  13. Mortality of passerines adjacent to a North Carolina corn field treated with granular carbofuran.

    Science.gov (United States)

    Augspurger, Tom; Smith, Milton R.; Meteyer, Carol U.; Converse, Kathryn A.

    1996-01-01

    Red-winged blackbirds (Agelaius phoeniceus) were collected during an epizootic in southeastern North Carolina (USA). Activity of brain cholinesterase (ChE) was inhibited by 14 to 48% in three of five specimens, and returned to normal levels after incubation. Gastrointestinal tracts were analyzed for 30 anti-ChE agents. Carbofuran, the only compound detected, was present in all specimens at levels from 5.44 to 72.7 μg/g wet weight. Application of granular carbofuran in an adjacent corn field, results of necropsy examinations, and chemical analyses are consistent with a diagnosis of carbofuran poisoning in these specimens.

  14. Genetic indicators of radiotherapy normal tissue response

    International Nuclear Information System (INIS)

    Full text: The aims of this study are to identify a genetic signature for adverse normal tissue damage from clinical radiotherapy (RT) in breast cancer patients, and to characterize the differentially-regulated genes involved. We have chosen to use skin expression profiling for four main reasons; (1) skin is the tissue that expresses the damage and so is directly relevant to the investigation, (2) skin biopsies can be snap frozen to preserve and maintain the in vivo expression profile of the patient, (3) skin punch biopsies are minimally invasive which equates to a high participation rate from RT patients (4) radiosensitivity testing and similar assays of cultured cells have only a low correlation with clinical adverse reaction. We expect our molecular profiling approach will give insight into the inherent genetic status of the patient that has not been demonstrated in cellular assays. We have begun collecting and processing skin punch biopsies from unirradiated sites from informed, consenting patients with adverse (severe acute or late) reaction to the skin or subcutaneous tissue following a standard course of RT, and normal controls. We have profiled biopsies from 7 adverse normal tissue reaction patients and 4 controls. Analyses of this data has identified 202 differentially expressed genes (p<0.01) and a class prediction algorithm correctly identified as adverse reaction or normal reaction 6/7 (86%) of our test samples that it could predict. We plan to focus on the function of some of these genes to determine their biological and clinical relevance. This will include detailed analysis of several of the gene products in an effort to address why these genes are associated with clinical reaction and what signaling pathways are involved. We plan to expand our sample number to 50 severe normal tissue late reaction (RTOG Grade 3 or 4), 50 severe acute normal tissue reaction and 50 no late or acute reaction to RT (RTOG 0) patients. An expected outcome is to fabricate

  15. Changes of color coordinates of biological tissue with superficial skin damage due to mechanical trauma

    Science.gov (United States)

    Pteruk, Vail; Mokanyuk, Olexander; Kvaternuk, Olena; Yakenina, Lesya; Kotyra, Andrzej; Romaniuk, Ryszard S.; Dussembayeva, Shynar

    2015-12-01

    Change of color coordinates of normal and pathological biological tissues is based on calculated spectral diffuse reflection. The proposed color coordinates of normal and pathological biological tissues of skin provided using standard light sources, allowing accurately diagnose skin damage due to mechanical trauma with a blunt object for forensic problems.

  16. Skin disease among farmers using wastewater in rice cultivation in Nam Dinh, Vietnam

    DEFF Research Database (Denmark)

    Do, Thuy Trang; van der Hoek, Wim; Nguyen, Dang Tuan;

    2007-01-01

    . In each commune, 200 households were randomly selected. RESULTS: Of the 1103 individuals aged > or =15 years, 381 reported a skin problem at baseline or at any of the monthly visits, primarily dermatitis (eczema) and superficial fungal infections. Among the 874 subjects who were free from skin disease......OBJECTIVE: To assess the risk of skin disease among farmers occupationally exposed to wastewater. METHODS: One-year follow-up study with monthly assessments of wastewater exposure and skin disease in Nam Dinh, northern Vietnam, in two adjacent communes with contrasting levels of wastewater use...... at baseline and who could be followed up > or =11 months, 183 developed a new skin disease (cumulative incidence 21%). Exposure to wastewater was a major risk factor for skin disease with a relative risk (RR) of 1.89 [95% confidence interval (CI) 1.39-2.57] in multivariable analysis. Other risk factors...

  17. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Directory of Open Access Journals (Sweden)

    Anjanappa

    2015-01-01

    Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

  18. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Directory of Open Access Journals (Sweden)

    Hamed Reyhani Kermani

    2013-12-01

    Full Text Available   Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE and T2 MRI (long TR/TE.   Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%. However, patients with protruded discs showed less changes (30.9%. It showed that the difference was statistically significant (P

  19. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Directory of Open Access Journals (Sweden)

    Hamed Reyhani Kermani

    2013-12-01

    Full Text Available Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE and T2 MRI (long TR/TE.   Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%. However, patients with protruded discs showed less changes (30.9%. It showed that the difference was statistically significant (P

  20. Comparison of xenobiotic metabolizing enzyme activities in ex vivo human skin and reconstructed human skin models from SkinEthic.

    Science.gov (United States)

    Eilstein, Joan; Léreaux, Guillaume; Budimir, Natali; Hussler, Georges; Wilkinson, Simon; Duché, Daniel

    2014-09-01

    Skin function is not limited to a physical barrier. According to its total surface area, it is also considered as an extra-hepatic metabolizing organ. In vitro engineered human skins have been developed to replace limited ex vivo normal human skin samples (NHS). Thus, assessing and comparing skin models from SkinEthic [Episkin™, RHE™ and the full thickness model (FTM)] with NHS in terms of metabolic capability are essential. The apparent activities of main cutaneous isoforms of cytochrome P450-dependent monooxygenases (CYP1A1/1B1, 2B6/2C18/2E1, 3A5/3A7), esterase, glutathione-S-[(GST), A, M, P, T], N-acetyl-(NAT1), uridinyl-diphosphate glucuronyl-(UDPGT 1A family) and sulfo-(SULT1A1) transferases were determined using probe substrates. Mean activities indicative of CYP1A1/1B1 (expressed as pmol/mg protein/6 h) in RHE™ (2.8) and FTM (2.6) were very similar to NHS (3.0) while Episkin™ showed a higher activity (9.1). Activities of CYP3A5/3A7 in FTM (3.3) and Episkin™ (3.6) were similar to NHS (3.8) while activity in RHE™ (13.3) was higher. CYP2B6/2C18/2E1 activity was below LOQ (0.5) in all skin models and NHS. Comparable intrinsic metabolic clearances were measured between NHS and skin models for esterase, UDPGT, GST and NAT1 activities. SULT1A1 activity toward probe substrates was not detected in skin models and observed at the limit of detection in NHS. Weak cytochrome P450-dependent monooxygenases, high esterase and transferase activities suggested that NHS and skin models exhibited limited functionalization and much greater detoxification (hydrolytic and conjugating) capacities. These results demonstrate that skin models are similar to NHS in terms of metabolic functionality toward xenobiotics investigated and useful tools to assess both the local efficiency and safety of cosmetics. PMID:24658324

  1. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  2. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  3. Skin Allergy Quiz

    Science.gov (United States)

    ... Training Grants & Awards Program Directors Practice Resources ASTHMA IQ Consultation and Referral Guidelines Practice Financial Survey Practice ... Your local allergist can do a skin prick test or blood test to find out if you ...

  4. Laser Skin Renewal

    Science.gov (United States)

    ... rashes clinical tools newsletter | contact Share | Skin Renewal, Laser A A A BEFORE: This patient wanted the appearance of his acne scars minimized by laser treatment. Procedure Overview Photorejuvenation, simply put, is the ...

  5. Aging changes in skin

    Science.gov (United States)

    ... areas. Changes in the connective tissue reduce the skin's strength and elasticity. This is known as elastosis. It is more ... chemicals Indoor heating Sunlight can cause: Loss of elasticity ... growths (keratoacanthomas) Pigment changes such as liver spots ...

  6. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  7. Skin color - patchy

    Science.gov (United States)

    ... such as from the sun) Exposure to heavy metals Changes in hormone levels Exposure to sun or ultraviolet (UV) light, especially after taking a medicine called psoralens, may increase skin color (pigmentation). Increased ...

  8. Layers of the Skin

    Science.gov (United States)

    ... Review Abstracting, Coding, & Staging ICD-O Site Codes Morphology & Grade Extent of Disease Evaluation Physical Exam Lab ... the majority of the structure of the skin, hair, and nails. The squamous cell layer is the ...

  9. Necrotizing Skin Infections

    Science.gov (United States)

    ... and Treatment Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Necrotizing Skin ... Professional Version Also of Interest Test your knowledge Vitiligo is a loss of melanocytes (cells that produce ...

  10. Fungal Skin Infections

    Science.gov (United States)

    ... Skin Infections Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Overview of ... Professional Version Also of Interest Test your knowledge Vitiligo is a loss of melanocytes (cells that produce ...

  11. Human Skin Fungal Diversity

    OpenAIRE

    Findley, Keisha; OH, JULIA; Yang, Joy; Conlan, Sean; Deming, Clayton; Meyer, Jennifer A.; Schoenfeld, Deborah; Nomicos, Effie; Park, Morgan; ,; Kong, Heidi H.; Segre, Julia A

    2013-01-01

    Traditional culture-based methods have incompletely defined the etiology of common recalcitrant human fungal skin diseases including athlete’s foot and toenail infections. Skin protects humans from invasion by pathogenic microorganisms, while providing a home for diverse commensal microbiota 1 . Bacterial genomic sequence data have generated novel hypotheses about species and community structures underlying human disorders 2,3,4 . However, microbial diversity is not limited to bacteria; micro...

  12. Nicotinamide and the skin.

    Science.gov (United States)

    Chen, Andrew C; Damian, Diona L

    2014-08-01

    Nicotinamide, an amide form of vitamin B3, boosts cellular energy and regulates poly-ADP-ribose-polymerase 1, an enzyme with important roles in DNA repair and the expression of inflammatory cytokines. Nicotinamide shows promise for the treatment of a wide range of dermatological conditions, including autoimmune blistering disorders, acne, rosacea, ageing skin and atopic dermatitis. In particular, recent studies have also shown it to be a potential agent for reducing actinic keratoses and preventing skin cancers.

  13. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  14. Nicotinamide and the skin.

    Science.gov (United States)

    Chen, Andrew C; Damian, Diona L

    2014-08-01

    Nicotinamide, an amide form of vitamin B3, boosts cellular energy and regulates poly-ADP-ribose-polymerase 1, an enzyme with important roles in DNA repair and the expression of inflammatory cytokines. Nicotinamide shows promise for the treatment of a wide range of dermatological conditions, including autoimmune blistering disorders, acne, rosacea, ageing skin and atopic dermatitis. In particular, recent studies have also shown it to be a potential agent for reducing actinic keratoses and preventing skin cancers. PMID:24635573

  15. Biomechanics of Artificial Disc Replacements Adjacent to a 2-Level Fusion in 4-Level Hybrid Constructs: An In Vitro Investigation.

    Science.gov (United States)

    Liao, Zhenhua; Fogel, Guy R; Wei, Na; Gu, Hongsheng; Liu, Weiqiang

    2015-01-01

    BACKGROUND The ideal procedure for multilevel cervical degenerative disc diseases remains controversial. Recent studies on hybrid surgery combining anterior cervical discectomy and fusion (ACDF) and artificial cervical disc replacement (ACDR) for 2-level and 3-level constructs have been reported in the literature. The purpose of this study was to estimate the biomechanics of 3 kinds of 4-level hybrid constructs, which are more likely to be used clinically compared to 4-level arthrodesis. MATERIAL AND METHODS Eighteen human cadaveric spines (C2-T1) were evaluated in different testing conditions: intact, with 3 kinds of 4-level hybrid constructs (hybrid C3-4 ACDR+C4-6 ACDF+C6-7ACDR; hybrid C3-5ACDF+C5-6ACDR+C6-7ACDR; hybrid C3-4ACDR+C4-5ACDR+C5-7ACDF); and 4-level fusion. RESULTS Four-level fusion resulted in significant decrease in the C3-C7 ROM compared with the intact spine. The 3 different 4-level hybrid treatment groups caused only slight change at the instrumented levels compared to intact except for flexion. At the adjacent levels, 4-level fusion resulted in significant increase of contribution of both upper and lower adjacent levels. However, for the 3 hybrid constructs, significant changes of motion increase far lower than 4P at adjacent levels were only noted in partial loading conditions. No destabilizing effect or hypermobility were observed in any 4-level hybrid construct. CONCLUSIONS Four-level fusion significantly eliminated motion within the construct and increased motion at the adjacent segments. For all 3 different 4-level hybrid constructs, ACDR normalized motion of the index segment and adjacent segments with no significant hypermobility. Compared with the 4-level ACDF condition, the artificial discs in 4-level hybrid constructs had biomechanical advantages compared to fusion in normalizing adjacent level motion. PMID:26694835

  16. Hyperspectral imaging of skin and lung cancers

    Science.gov (United States)

    Zherdeva, Larisa A.; Bratchenko, Ivan A.; Alonova, Marina V.; Myakinin, Oleg O.; Artemyev, Dmitry N.; Moryatov, Alexander A.; Kozlov, Sergey V.; Zakharov, Valery P.

    2016-04-01

    The problem of cancer control requires design of new approaches for instrumental diagnostics, as the accuracy of cancer detection on the first step of diagnostics in clinics is slightly more than 50%. In this study, we present a method of visualization and diagnostics of skin and lung tumours based on registration and processing of tissues hyperspectral images. In a series of experiments registration of hyperspectral images of skin and lung tissue samples is carried out. Melanoma, basal cell carcinoma, nevi and benign tumours are studied in skin ex vivo and in vivo experiments; adenocarcinomas and squamous cell carcinomas are studied in ex vivo lung experiments. In a series of experiments the typical features of diffuse reflection spectra for pathological and normal tissues were found. Changes in tissues morphology during the tumour growth lead to the changes of blood and pigments concentration, such as melanin in skin. That is why tumours and normal tissues maybe differentiated with information about spectral response in 500-600 nm and 600 - 670 nm areas. Thus, hyperspectral imaging in the visible region may be a useful tool for cancer detection as it helps to estimate spectral properties of tissues and determine malignant regions for precise resection of tumours.

  17. Ultraflexible organic photonic skin.

    Science.gov (United States)

    Yokota, Tomoyuki; Zalar, Peter; Kaltenbrunner, Martin; Jinno, Hiroaki; Matsuhisa, Naoji; Kitanosako, Hiroki; Tachibana, Yutaro; Yukita, Wakako; Koizumi, Mari; Someya, Takao

    2016-04-01

    Thin-film electronics intimately laminated onto the skin imperceptibly equip the human body with electronic components for health-monitoring and information technologies. When electronic devices are worn, the mechanical flexibility and/or stretchability of thin-film devices helps to minimize the stress and discomfort associated with wear because of their conformability and softness. For industrial applications, it is important to fabricate wearable devices using processing methods that maximize throughput and minimize cost. We demonstrate ultraflexible and conformable three-color, highly efficient polymer light-emitting diodes (PLEDs) and organic photodetectors (OPDs) to realize optoelectronic skins (oe-skins) that introduce multiple electronic functionalities such as sensing and displays on the surface of human skin. The total thickness of the devices, including the substrate and encapsulation layer, is only 3 μm, which is one order of magnitude thinner than the epidermal layer of human skin. By integrating green and red PLEDs with OPDs, we fabricate an ultraflexible reflective pulse oximeter. The device unobtrusively measures the oxygen concentration of blood when laminated on a finger. On-skin seven-segment digital displays and color indicators can visualize data directly on the body.

  18. DOSHIC PHYSIOLOGY OF SKIN

    Directory of Open Access Journals (Sweden)

    Shivprasad Chiplunkar

    2013-06-01

    Full Text Available The balance of dosha  represents the healthy state and imbalance will cause various diseases. In normalcy doshas will be performing their own functions and individual doshas will be having their own specific sites. By telling the various sthana of each dosha, different function that is taken up by individual dosha in different sites has been highlighted.By mentioning ‘sparshanendriyam’ as one of the sthana of vata dosha the sensory functions of skin to vata dosha has been emphasised. By mentioning ‘sparshanam’ as one of the sthana of pittadosha, the function of colouring/pigmentation of skin, which is majorly carried out  by melanocytes by secreting melanin pigment has been highlighted. Meda is one among the sthanas of kapha dosha; this can be considered as the adipose tissue of skin/below skin. Since sweda is mala of meda it can be also considered as the secretions from the eccrine glands.With respect to skin, sensory functions, both tactile and thermal is carried out by vata dosha more specifically vyana vata, pigmentation to the skin carried out by meloncytes by secreting melanin, it is nothing but function of pitta dosha more specifically brajaka pitta with the help of udana vata and finally production of sweat in sweat glands is the function of kapha. So there is the need for further study and research regarding the sthanas of all three doshas in different structures/organs in the body and its physiology.

  19. Best Merge Region Growing Segmentation with Integrated Non-Adjacent Region Object Aggregation

    Science.gov (United States)

    Tilton, James C.; Tarabalka, Yuliya; Montesano, Paul M.; Gofman, Emanuel

    2012-01-01

    Best merge region growing normally produces segmentations with closed connected region objects. Recognizing that spectrally similar objects often appear in spatially separate locations, we present an approach for tightly integrating best merge region growing with non-adjacent region object aggregation, which we call Hierarchical Segmentation or HSeg. However, the original implementation of non-adjacent region object aggregation in HSeg required excessive computing time even for moderately sized images because of the required intercomparison of each region with all other regions. This problem was previously addressed by a recursive approximation of HSeg, called RHSeg. In this paper we introduce a refined implementation of non-adjacent region object aggregation in HSeg that reduces the computational requirements of HSeg without resorting to the recursive approximation. In this refinement, HSeg s region inter-comparisons among non-adjacent regions are limited to regions of a dynamically determined minimum size. We show that this refined version of HSeg can process moderately sized images in about the same amount of time as RHSeg incorporating the original HSeg. Nonetheless, RHSeg is still required for processing very large images due to its lower computer memory requirements and amenability to parallel processing. We then note a limitation of RHSeg with the original HSeg for high spatial resolution images, and show how incorporating the refined HSeg into RHSeg overcomes this limitation. The quality of the image segmentations produced by the refined HSeg is then compared with other available best merge segmentation approaches. Finally, we comment on the unique nature of the hierarchical segmentations produced by HSeg.

  20. Laplacian versus adjacency matrix in quantum walk search

    Science.gov (United States)

    Wong, Thomas G.; Tarrataca, Luís; Nahimov, Nikolay

    2016-06-01

    A quantum particle evolving by Schrödinger's equation contains, from the kinetic energy of the particle, a term in its Hamiltonian proportional to Laplace's operator. In discrete space, this is replaced by the discrete or graph Laplacian, which gives rise to a continuous-time quantum walk. Besides this natural definition, some quantum walk algorithms instead use the adjacency matrix to effect the walk. While this is equivalent to the Laplacian for regular graphs, it is different for non-regular graphs and is thus an inequivalent quantum walk. We algorithmically explore this distinction by analyzing search on the complete bipartite graph with multiple marked vertices, using both the Laplacian and adjacency matrix. The two walks differ qualitatively and quantitatively in their required jumping rate, runtime, sampling of marked vertices, and in what constitutes a natural initial state. Thus the choice of the Laplacian or adjacency matrix to effect the walk has important algorithmic consequences.

  1. Laplacian versus adjacency matrix in quantum walk search

    Science.gov (United States)

    Wong, Thomas G.; Tarrataca, Luís; Nahimov, Nikolay

    2016-10-01

    A quantum particle evolving by Schrödinger's equation contains, from the kinetic energy of the particle, a term in its Hamiltonian proportional to Laplace's operator. In discrete space, this is replaced by the discrete or graph Laplacian, which gives rise to a continuous-time quantum walk. Besides this natural definition, some quantum walk algorithms instead use the adjacency matrix to effect the walk. While this is equivalent to the Laplacian for regular graphs, it is different for non-regular graphs and is thus an inequivalent quantum walk. We algorithmically explore this distinction by analyzing search on the complete bipartite graph with multiple marked vertices, using both the Laplacian and adjacency matrix. The two walks differ qualitatively and quantitatively in their required jumping rate, runtime, sampling of marked vertices, and in what constitutes a natural initial state. Thus the choice of the Laplacian or adjacency matrix to effect the walk has important algorithmic consequences.

  2. Emission of pesticides during drilling and deposition in adjacent areas

    Directory of Open Access Journals (Sweden)

    Heimbach, Udo

    2014-02-01

    Full Text Available In seven experiments seeds of maize, oil seed rape and barley, treated with neonicotinoids, were sown using pneumatic drilling equipment with deflectors attached in case of pneumatic suction systems. Directly adjacent to the drilled area of usually about 50 m width were replicated areas with bare soil as well as with crops. During maize (Zea mays drilling flowering oil seed rape (Brassica napus and during drilling of barley (Hordeum vulgare and oil seed rape flowering white mustard (Sinapis alba was adjacent. The amount of residues in the adjacent non crop areas in Petri dishes being distributed on the bare soil declined only slowly from 1 to 20 m distance from the area drilled. Seed batches with more abrasion and higher content of active substances in the dust resulted in higher residues off crop. After drilling of maize in four experiments in Petri dishes in adjacent non crop areas in 1-5 m distance between 0.02 and 0.40 g a.s./ha of neonicotinoids and in the adjacent oil seed rape a total of 0.05–0.80 g a.s./ha were detected. After drilling oil seed rape or barley these values were only 0.02–0.06 g a.s./ha in Petri dishes in non crop areas and 0.03-0.08 g a.s./ha in total in adjacent white mustard. In gauze net samplers installed vertically in 3 m distance in non crop areas up to seven times higher values were detected compared to Petri dishes.

  3. Skin impedance comparisons of electrodes for electro-oculography.

    Science.gov (United States)

    Lee, J B; Reinecke, R D

    1991-01-01

    In an effort to define the most comfortable electrode needing the simplest skin preparation with low and stable skin impedance, we compared the impedance between skin electrodes and Stat-Trace II St-102 EKG electrodes (Niko Med USA, New Brunswick, NJ)--the latter being renamed "dry electrodes" because they are used without electrolyte paste--on 12 normal subjects with two different skin preparations, with and without alcohol. The dry electrodes were found to have lower impedance than the skin electrodes. With each skin preparation the alcohol scored better, 7.2 kOhm vs 16.5 kOhm, respectively, and "no preparation" worse, 13.8 kOhm vs 22.7 kOhm, respectively, (but still acceptable when the dry electrode was used). The dry electrode's impedance was quite stable from the moment of application while the skin electrode's impedance drifted dramatically for 30 minutes. If the dry electrode was halved in area of skin contact, as often is necessary with the nasal electrode in children, the impedance rose proportionally but remained acceptable. We conclude that the new dry electrodes give us improved electro-oculography records and suggest their use, particularly for infants and young children where ease of application and simple skin preparation are particularly important.

  4. Bathing in a magnesium-rich Dead Sea salt solution improves skin barrier function, enhances skin hydration, and reduces inflammation in atopic dry skin.

    Science.gov (United States)

    Proksch, Ehrhardt; Nissen, Hans-Peter; Bremgartner, Markus; Urquhart, Colin

    2005-02-01

    Magnesium salts, the prevalent minerals in Dead Sea water, are known to exhibit favorable effects in inflammatory diseases. We examined the efficacy of bathing atopic subjects in a salt rich in magnesium chloride from deep layers of the Dead Sea (Mavena(R) Dermaline Mg(46) Dead Sea salt, Mavena AG, Belp, Switzerland). Volunteers with atopic dry skin submerged one forearm for 15 min in a bath solution containing 5% Dead Sea salt. The second arm was submerged in tap water as control. Before the study and at weeks 1-6, transepidermal water loss (TEWL), skin hydration, skin roughness, and skin redness were determined. We found one subgroup with a normal and one subgroup with an elevated TEWL before the study. Bathing in the Dead Sea salt solution significantly improved skin barrier function compared with the tap water-treated control forearm in the subgroup with elevated basal TEWL. Skin hydration was enhanced on the forearm treated with the Dead Sea salt in each group, which means the treatment moisturized the skin. Skin roughness and redness of the skin as a marker for inflammation were significantly reduced after bathing in the salt solution. This demonstrates that bathing in the salt solution was well tolerated, improved skin barrier function, enhanced stratum corneum hydration, and reduced skin roughness and inflammation. We suggest that the favorable effects of bathing in the Dead Sea salt solution are most likely related to the high magnesium content. Magnesium salts are known to bind water, influence epidermal proliferation and differentiation, and enhance permeability barrier repair. PMID:15689218

  5. Self-normalized processes

    CERN Document Server

    Heyde, C C

    2008-01-01

    Self-normalized processes are of common occurrence in probabilistic and statistical studies. This volume covers developments in the area, including self-normalized large and moderate deviations, and laws of the iterated logarithms for self-normalized martingales. It treats the theory and applications of self-normalization.

  6. Disc height and anteroposterior translation in fused and adjacent segments after lumbar spine fusion

    Directory of Open Access Journals (Sweden)

    Frobin, Wolfgang

    2003-09-01

    Full Text Available In a series of 46 patients the effects of spinal fusion upon intervertebral height and sagittal alignment in operated and non-operated segments were retrospectively evaluated on digitized radiographs. Data was compared with age- and gender-normalized standard values. The objective was to evaluate the influence of different types of spine fusions primarily upon adjacent segments, particularly in terms of degeneration and sagittal profile of the lumbar spine. Incidence of adjacent segment degeneration (ASD is still highly controversial. However, not every degeneration adjacent to spinal fusion must be caused by the fusion and responsibility of the fusion for ASD may vary with its range and type. Distortion Corrected Roentgen Analysis (DCRA was utilized. DCRA is a proven valid, reliable, observer-independent, and accurate tool for assessment of these parameters over time and in comparison with "normal" cohorts. With this method the exact posture of the patients needs not to be known.There was little evidence for serious fusion-related ASD within an average of 40 months follow-up. No difference could be detected for rigid vs. non-rigid fusion and instrumented vs. non-instrumented techniques. Temporary postoperative distraction effects could be detected in operated and non-operated segments. Absolute preoperative values for intervertebral height and vertebral slip were age-related. Retrospectively, the choice of segments for fusion was clearly based upon radiological criteria. Thus we conclude that radiological parameters have an obvious clinical relevance for decision-making and need to be quantified. Within the limitations of this pilot study, true fusion related ASD seems to be infrequent.

  7. Skin aging and oxidative stress

    OpenAIRE

    Sayeeda Ahsanuddin; Minh Lam; Baron, Elma D.

    2016-01-01

    Skin aging occurs through two main pathways, intrinsic and extrinsic. These pathways have significant interaction in contributing to the aging phenotype, which includes skin laxity, wrinkling, pigmentation irregularities, and the appearance of neoplastic skin lesions. Here, we review the critical role that oxidative stress plays in skin aging, including its effects on signaling pathways involved in skin matrix formation and degradation, proteasome activity, as well as DNA structure. Furthermo...

  8. Spiritual and religious aspects of skin and skin disorders

    Science.gov (United States)

    Shenefelt, Philip D; Shenefelt, Debrah A

    2014-01-01

    Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, “goose bumps”, redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. PMID:25120377

  9. Applications of positron annihilation to dermatology and skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)

    2007-07-01

    Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Flow and edge scour in current adjacent to stone covers

    DEFF Research Database (Denmark)

    Petersen, Thor U.; Sumer, B. Mutlu; Bøgelund, Jon;

    2015-01-01

    This paper presents the results of an experimental investigation on edge scour adjacent to a stone cover laid on a sandy bed. The three-dimensional flow over the edge of the stone layer has been investigated by the use of particle image velocimetry. The flow measurements show a significant amount...

  11. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    R.J.W. Hoogendoorn; M.N. Helder; P.I.J.M. Wuisman; R.A. Bank; V. Everts; T.H. Smit

    2008-01-01

    Study Design. The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were com

  12. Experimental Tape Casting of Adjacently Graded Materials for Magnetic Refrigeration

    DEFF Research Database (Denmark)

    Bulatova, Regina

    graded thin films. The motivation to create such adjacently segmented structures stemmed from a search of material and a materials design alternative to the expensive rare earth element gadolinium which is widely used as a magnetic regenerator in the emerging magnetic refrigeration technology...

  13. Group edge choosability of planar graphs without adjacent short cycles

    OpenAIRE

    Xin ZHANG; Liu, Guizhen

    2011-01-01

    In this paper, we aim to introduce the group version of edge coloring and list edge coloring, and prove that all 2-degenerate graphs along with some planar graphs without adjacent short cycles is group $(\\Delta(G)+1)$-edge-choosable while some planar graphs with large girth and maximum degree is group $\\Delta(G)$-edge-choosable.

  14. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  15. Traumatic degloving lesion of penile and scrotal skin

    Directory of Open Access Journals (Sweden)

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  16. Extreme skin depth waveguides

    CERN Document Server

    Jahani, Saman

    2014-01-01

    Recently, we introduced a paradigm shift in light confinement strategy and introduced a class of extreme skin depth (e-skid) photonic structures (S. Jahani and Z. Jacob, "Transparent sub-diffraction optics: nanoscale light confinement without metal," Optica 1, 96-100 (2014)). Here, we analytically establish that figures of merit related to light confinement in dielectric waveguides are fundamentally tied to the skin depth of waves in the cladding. We contrast the propagation characteristics of the fundamental mode of e-skid waveguides and conventional waveguides to show that the decay constant in the cladding is dramatically larger in e-skid waveguides, which is the origin of sub-diffraction confinement. Finally, we propose an approach to verify the reduced skin depth in experiment using the decrease in the Goos-H\\"anchen phase shift.

  17. Epidermal skin grafting.

    Science.gov (United States)

    Herskovitz, Ingrid; Hughes, Olivia B; Macquhae, Flor; Rakosi, Adele; Kirsner, Robert

    2016-09-01

    Autologous skin grafts, such as full- and split-thickness, have long been part of the reconstructive ladder as an option to close skin defects. Although they are effective in providing coverage, they require the need for a trained surgeon, use of anaesthesia and operating room and creation of a wound at the donor site. These drawbacks can be overcome with the use of epidermal skin grafts (ESGs), which can be harvested without the use of anaesthesia in an office setting and with minimal to no scarring at the donor site. ESGs consist only of the epidermal layer and have emerged as an appealing alternative to other autologous grafts for the treatment of acute and chronic wounds. In this article, we provide an overview of epidermal grafting and its role in wound management. PMID:27547964

  18. Thyroid and skin

    Directory of Open Access Journals (Sweden)

    Dogra Alka

    2006-01-01

    Full Text Available The association of thyroid disorders with skin manifestations is complex. Both hypothryoidism and hyperthyroidism are known to cause these changes. In order to study this association of skin changes in relation to hypothyroidism, a study was carried out in the outpatients department of Dermatology of Dayanand Medical College and Hospital, Ludhiana, over a period of 3 months from Jan-March 2005. Thirty two patients were enrolled in the study and parameters were noted regarding history, general symptoms, cutaneous signs and associated diseases. We found gain in weight (71.85% and lethargy (65.62% to be the most common complaints. On cutaneous examination, dry, coarse texture of the skin (56%, pigmentary disorders (37.5% and telogen effluvium (40.62% were the most common findings. Other associated disorders were vitiligo, melasma, pemphigus, alopecia areata, xanthelasma palpebrarum, etc.

  19. Sprayed skin turbine component

    Science.gov (United States)

    Allen, David B

    2013-06-04

    Fabricating a turbine component (50) by casting a core structure (30), forming an array of pits (24) in an outer surface (32) of the core structure, depositing a transient liquid phase (TLP) material (40) on the outer surface of the core structure, the TLP containing a melting-point depressant, depositing a skin (42) on the outer surface of the core structure over the TLP material, and heating the assembly, thus forming both a diffusion bond and a mechanical interlock between the skin and the core structure. The heating diffuses the melting-point depressant away from the interface. Subsurface cooling channels (35) may be formed by forming grooves (34) in the outer surface of the core structure, filling the grooves with a fugitive filler (36), depositing and bonding the skin (42), then removing the fugitive material.

  20. Laser system for optical biopsy and in-vivo study of the human skin

    Science.gov (United States)

    Borisova, Ekaterina G.; Avramov, Lachezar A.

    2001-04-01

    The aim of this study was to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced autofluorescence spectroscopy (LIAFS) for human skin in vivo. The autofluorescence characterization of tissue relies on different spectral properties of tissue. It was demonstrated a differentiation between normal skin and skin with vitaligo. In our experimental investigation of the autofluorescence spectrum of human skin in vivo a nitrogen laser with excitation wavelength 337 nm was used. Two fluorescence bands were observed at 440 and 490 nm, these were attributed to reduced nicotinamide adenine dinucleotide (NADH) and collagen. The intensity of the NADH emission band was markedly reduced in the skin with vitaligo compared with the normal skin, which could indicate different redox conditions in skin with vitaligo. The autofluorescence spectrum of human skin depends on the main internal absorbers, which are blood and melanin. In this study was described the effect caused by melanin content on the shape of the autofluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. The goal of this work is optimization of detection and diagnosis of hollow organs and skin.

  1. Limitations of skin protection.

    Science.gov (United States)

    Schliemann, Sibylle

    2007-01-01

    Skin protection products and gloves are essential constituents of personal protective equipment at workplaces, which can be used in a complementary way, each offering particular benefits and disadvantages. In many workplace situations, both measures are being used either in an alternating or in a combined manner, typically in professions with exposures to mild irritants and a high wet-work load, such as hairdressers, healthcare workers or employees in the food-processing industry. Skin protection creams can be used to reduce unnecessarily long glove usage in order to reduce occlusion-related effects on the skin barrier. Whenever rotating machines are used, these products are the only option due to safety regulations. However, some particular requirements can be postulated for skin-protective products claimed especially to be used in combination with gloves. Reduction of glove-induced perspiration, of stratum corneum swelling, and postocclusive barrier impairment are intended attributes of such products, which have been already successfully implemented in some commercially available products. On the other hand it has to be proven that the ingredients do not interfere with the glove material, neither in the way of degrading the material, thus making it permeable for harmful substances, nor by enhancing the potential release of rubber allergens. Examples out of the literature are reviewed showing that skin products can exhibit unpredictable effects on the allergen release of rubber materials, if not thoroughly tested for this purpose beforehand. Some raw materials should be avoided in protection products, though they are of established value when used in afterwork emollients to accelerate barrier recovery. Usage of moisturizers, in contrast to special barrier products, at the workplace together or even under gloves is therefore judged critically, although selected products showed beneficial effects in particular experimental settings. Another future option is the

  2. Stiff skin syndrome versus scleroderma: a report of two cases.

    Science.gov (United States)

    Azevedo, V F; Serafini, S Z; Werner, B; Müller, C S; Franchini, C F M; Morais, R L S L

    2009-09-01

    Stiff skin syndrome is a rare cutaneous disease, scleroderma-like disorder that presents in infancy or early childhood with rock-hard skin, limited joint mobility, and mild hypertrichosis. Normally, it occurs in the absence of visceral or muscle involvement. Patients do not present immunologic abnormalities or vascular hyperactivity. We describe two adults who initially were diagnosed suffering from scleroderma but fit criteria for stiff skin syndrome. A review of the clinical range of this disorder and discussion of the differential diagnosis with scleroderma is presented. PMID:19415378

  3. Skin tears: prevention and treatment.

    Science.gov (United States)

    Wick, Jeannette Y; Zanni, Guido R

    2008-07-01

    While skin tears are common among the elderly in general, and residents of long-term care facilities in particular, there has been limited research into their treatment. Many facilities voluntarily track skin tears, and some states require facilities to report these events. Risk factors include age, xerosis (abnormal eye, skin, or mouth dryness), need for help in activities of daily living, presence of senile purpura, visual impairment, and poor nutrition. Plans to prevent skin tears that employ skin sleeves, padded side rails, gentle skin cleansers, moisturizing lotions, as well as staff education, can decrease by half the number of skin tears incurred in a long-term care facility. Although the treatment process seems simple, it is time consuming and can be painful for the patient. Residents with dementia or agitation often try to remove bulky dressings used to cover skin tears. Dressing changes may injure the fragile wound via skin stripping.

  4. Intelligent skin: Real virtual

    OpenAIRE

    Bühlmann, Vera

    2006-01-01

    What will it feel like to live in a city, where houses court each other in springtime? The 'intelligent-skin' project investigates the potential of media-façades in terms of corporate communication: what does it mean to build houses out of bricks of mediality? What does it imply to say that communication literally takes place? The virtualization of housing through large sized media skins will introduce medial milieus into our urban spheres to come – they might seize to function as add-ons...

  5. Effect of lipopolysaccharide on the biological characteristics of human skin fibroblasts and hypertrophic scar tissue formation.

    Science.gov (United States)

    Yang, Hongming; Hu, Chao; Li, Fengyu; Liang, Liming; Liu, Lingying

    2013-06-01

    Burn injury-mediated destruction of the skin barrier normally induces microbial invasion, in turn leading to the development of systemic infection and occasional septic shock by the release of endotoxins. The objective of this work was to study the influence of lipopolysaccharide (LPS) on the biological characteristics of normal skin fibroblasts and to elucidate the influence of LPS in the initial stage of skin wound healing. Twenty patients with hypertrophic scar in proliferative stage were selected randomly and primary cultures were established from fibroblasts derived from their hypertrophic scar tissue and normal skin. Normal skin fibroblasts of passage 3 were stimulated with different concentrations of LPS. LPS stimulated the proliferation and collagen synthesis of fibroblasts within a certain extent of concentrations (0.005-0.5 μg/mL) (P effect on normal skin fibroblasts-continuous passage of these fibroblasts resulted in ultrastructural pattern similar to fibroblasts derived from hypertrophic scar tissue, and the findings was substantiated by hematoxylin and eosin staining and immunohistochemistry detection of proliferation cell nuclear antigen, type I procollagen and α-smooth muscle actin. Our results suggest that LPS might convert normal skin fibroblasts to hypertrophic scar tissue fibroblasts and participate in the formation of hypertrophic scar; hence, appropriate concentration of LPS may have no effect or be beneficial to skin wound healing, whereas excessive concentration of LPS may delay the time of wound healing. PMID:23653386

  6. Study of surfactant-skin interactions by skin impedance measurements.

    Science.gov (United States)

    Lu, Guojin; Moore, David J

    2012-02-01

    The stratum corneum (SC) plays a very critical physiological role as skin barrier in regulating water loss through the skin and protects the body from a wide range of physical and chemical exogenous insults. Surfactant-containing formulations can induce skin damage and irritation owing to surfactant absorption and penetration. It is generally accepted that reduction in skin barrier properties occurs only after surfactants have penetrated/permeated into the skin barrier. To mitigate the harshness of surfactant-based cleansing products, penetration/permeation of surfactants should be reduced. Skin impedance measurements have been taken in vitro on porcine skin using vertical Franz diffusion cells to investigate the impact of surfactants, temperature and pH on skin barrier integrity. These skin impedance results demonstrate excellent correlation with other published methods for assessing skin damage and irritation from different surfactant chemistry, concentration, pH, time of exposure and temperature. This study demonstrates that skin impedance can be utilized as a routine approach to screen surfactant-containing formulations for their propensity to compromise the skin barrier and hence likely lead to skin irritation. PMID:21923733

  7. Study of surfactant-skin interactions by skin impedance measurements.

    Science.gov (United States)

    Lu, Guojin; Moore, David J

    2012-02-01

    The stratum corneum (SC) plays a very critical physiological role as skin barrier in regulating water loss through the skin and protects the body from a wide range of physical and chemical exogenous insults. Surfactant-containing formulations can induce skin damage and irritation owing to surfactant absorption and penetration. It is generally accepted that reduction in skin barrier properties occurs only after surfactants have penetrated/permeated into the skin barrier. To mitigate the harshness of surfactant-based cleansing products, penetration/permeation of surfactants should be reduced. Skin impedance measurements have been taken in vitro on porcine skin using vertical Franz diffusion cells to investigate the impact of surfactants, temperature and pH on skin barrier integrity. These skin impedance results demonstrate excellent correlation with other published methods for assessing skin damage and irritation from different surfactant chemistry, concentration, pH, time of exposure and temperature. This study demonstrates that skin impedance can be utilized as a routine approach to screen surfactant-containing formulations for their propensity to compromise the skin barrier and hence likely lead to skin irritation.

  8. THE ROLE OF UDVARTHANA ON SKIN HEALTH

    Directory of Open Access Journals (Sweden)

    Shital O. Chavan

    2013-06-01

    Full Text Available Approaching towards modern life style, every person is conscious about his/her look and using number of cosmetics which are made up of chemicals and freely available in market to make their skin looks beautiful without knowing the consequence produced by chemical (Cosmetics on the skin. To prevent such complication and to increase the beauty of one’s facial look, we selected one of the ancient techniques of daily routine Udvarthana as a subject research to know the effect of Udwartana on skin health according to Samhita’s as per modern life. Face is mirror, which perhaps reflects our individuality from others. Our face is a part of attraction and gives the image of our fitness hence application of Udvartana is done only on face. The results were assessed on manifestation of improvement in skin health, such as symptomatic changes after application. 30 normal individuals of age group 16-30 years were recruited in trial. Sample were assessed and evaluated on the basis of subjective parameters at interval of 15 days for two months. Selection of drugs for Udvarthana was done from Varnadi Gana in Astanga Sangraha Sutrasthana 15/88. Fine powder of drug was mixed with plain water and applied on face till gets dried before bath. There were significant changes in symptomatically criteria when calculated by Willcoxan’s5 test. We got significant result in symptoms of facial skin in experimental group after two month i.e. p<0.05. The finding suggests that Udvarthana is an effective, safe, easy way for healthy skin.

  9. Normal Pressure Hydrocephalus

    Science.gov (United States)

    ... involves surgical placement of a shunt in the brain to drain excess CSF into the abdomen where it can be absorbed as part of the normal circulatory process. This allows the brain ventricles to return to their normal size. Regular ...

  10. About Skin-to-Skin Care (Kangaroo Care)

    Science.gov (United States)

    ... Prenatal Baby Bathing & Skin Care Breastfeeding Crying & Colic Diapers & Clothing Feeding & Nutrition Preemie Sleep Teething & Tooth Care Toddler Preschool Gradeschool Teen Young Adult Healthy Children > Ages & Stages > Baby > Preemie > About Skin- ...

  11. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  12. Impact of prebiotics and probiotics on skin health.

    Science.gov (United States)

    Al-Ghazzewi, F H; Tester, R F

    2014-06-01

    This review discusses the role of pre- and probiotics with respect to improving skin health by modulating the cutaneous microbiota. The skin ecosystem is a complex environment covered with a diverse microbiota community. These are classified as either transient or resident, where some are considered as beneficial, some essentially neutral and others pathogenic or at least have the capacity to be pathogenic. Colonisation varies between different parts of the body due to different environmental factors. Pre- and probiotic beneficial effects can be delivered topically or systemically (by ingestion). The pre- and probiotics have the capacity to optimise, maintain and restore the microbiota of the skin in different ways. Topical applications of probiotic bacteria have a direct effect at the site of application by enhancing the skin natural defence barriers. Probiotics as well as resident bacteria can produce antimicrobial peptides that benefit cutaneous immune responses and eliminate pathogens. In cosmetic formulations, prebiotics can be applied to the skin microbiota directly and increase selectively the activity and growth of beneficial 'normal' skin microbiota. Little is known about the efficacy of topically applied prebiotics. Nutritional products containing prebiotics and/or probiotics have a positive effect on skin by modulating the immune system and by providing therapeutic benefits for atopic diseases. This review underlines the potential use of pre- and probiotics for skin health.

  13. Impact of prebiotics and probiotics on skin health.

    Science.gov (United States)

    Al-Ghazzewi, F H; Tester, R F

    2014-06-01

    This review discusses the role of pre- and probiotics with respect to improving skin health by modulating the cutaneous microbiota. The skin ecosystem is a complex environment covered with a diverse microbiota community. These are classified as either transient or resident, where some are considered as beneficial, some essentially neutral and others pathogenic or at least have the capacity to be pathogenic. Colonisation varies between different parts of the body due to different environmental factors. Pre- and probiotic beneficial effects can be delivered topically or systemically (by ingestion). The pre- and probiotics have the capacity to optimise, maintain and restore the microbiota of the skin in different ways. Topical applications of probiotic bacteria have a direct effect at the site of application by enhancing the skin natural defence barriers. Probiotics as well as resident bacteria can produce antimicrobial peptides that benefit cutaneous immune responses and eliminate pathogens. In cosmetic formulations, prebiotics can be applied to the skin microbiota directly and increase selectively the activity and growth of beneficial 'normal' skin microbiota. Little is known about the efficacy of topically applied prebiotics. Nutritional products containing prebiotics and/or probiotics have a positive effect on skin by modulating the immune system and by providing therapeutic benefits for atopic diseases. This review underlines the potential use of pre- and probiotics for skin health. PMID:24583611

  14. Biophysical basis for noninvasive skin cancer detection using Raman spectroscopy

    Science.gov (United States)

    Feng, Xu; Moy, Austin J.; Markey, Mia K.; Fox, Matthew C.; Reichenberg, Jason S.; Tunnell, James W.

    2016-03-01

    Raman spectroscopy (RS) is proving to be a valuable tool for real time noninvasive skin cancer detection via optical fiber probe. However, current methods utilizing RS for skin cancer diagnosis rely on statistically based algorithms to provide tissue classification and do not elucidate the underlying biophysical changes of skin tissue. Therefore, we aim to use RS to explore skin biochemical and structural characteristics and then correlate the Raman spectrum of skin tissue with its disease state. We have built a custom confocal micro-Raman spectrometer system with an 830nm laser light. The high resolution capability of the system allows us to measure spectroscopic features from individual tissue components in situ. Raman images were collected from human skin samples from Mohs surgical biopsy, which were then compared with confocal laser scanning, two-photon fluorescence and hematoxylin and eosin-stained images to develop a linear model of skin tissue Raman spectra. In this model, macroscopic tissue spectra obtained from RS fiber probe were fit into a linear combination of individual basis spectra of primary skin constituents. The fit coefficient of the model explains the biophysical changes spanning a range of normal and various disease states. The model allows for determining parameters similar to that a pathologist is familiar reading and will be a significant guidance in developing RS diagnostic decision schemes.

  15. Immunity and skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Smith, E.B.; Brysk, M.M.

    1981-01-01

    Observations in humans and animal studies support the theory that immunologic surveillance plays an important role in limiting the development of skin malignancies. These immune responses undergo progressive diminution with age. In addition, other factors, such as bereavement, poor nutrition, and acute and chronic exposure to ultraviolet light, can further diminish immune mechanisms.

  16. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  17. Skin Conditions during Pregnancy

    Science.gov (United States)

    ... line that runs from the navel to the pubic hair • Stretch marks •Acne • Spider veins • Varicose veins • Changes ... Nigra: A line running from the navel to pubic hair that darkens during pregnancy. Melasma: A common skin ...

  18. Light and skin disease

    International Nuclear Information System (INIS)

    Because of the depletion of ozone in the stratosphere due to chlorofluorocarbons, the screening effect of this ozone layer on ultraviolet radiation (especially the so-called UV-B component) is reduced. This paper describes the impact of increased UV radiation on the human skin. Because of the 'ozone-hole', a distinct increase in the rate of skin cancer is to be expected which will affect all living beings but most of all man - an indirect consequence of the climate development. What makes the increased intensity of UV-B radiation so harmful is the fact that light-induced skin damage accumulates for the period of the life-time of the individual and cannot be reversed. A further thinning of stratospheric ozone would let through, in addition, the more short-waved ('harder') UV-C radiation. The latter, though clinically not significant currently, would then account for a further increase in the rate of malignant skin disease world-wide. (orig.)

  19. Slicing, skinning, and grafting

    OpenAIRE

    Dumas, David; Kent IV, Richard P.

    2007-01-01

    We prove that a Bers slice is never algebraic, meaning that its Zariski closure in the character variety has strictly larger dimension. A corollary is that skinning maps are never constant. The proof uses grafting and the theory of complex projective structures.

  20. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... wounds. Most likely, alteration of inflammatory cell function and extracellular matrix turnover caused by smoking-induced oxidative stress are involved in the pathophysiologic mechanisms....

  1. Is My Penis Normal?

    Science.gov (United States)

    ... I Help a Friend Who Cuts? Is My Penis Normal? KidsHealth > For Teens > Is My Penis Normal? Print A A A Text Size en ... any guy who's ever worried about whether his penis is a normal size. There's a fairly wide ...

  2. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    M. Koetsier; E. Nur; H. Chunmao; H.L. Lutgers; T.P. Links; A.J. Smit; G. Rakhorst; R. de Graaff

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to select

  3. Acetylcysteine in random skin flap in rats

    Directory of Open Access Journals (Sweden)

    Abla Luiz Eduardo Felipe

    2005-01-01

    Full Text Available PURPOSE: Analyze the ability of Acetylcysteine to reduce distal necrosis in a random skin flap, in the rat. METHODS: The present study utilized 28 adult male Wistar-EPM rats distributed, at random, in two groups of 14 animals. Control group rats (CG received distilled water and Acetylcysteine group animals (NACG received NAC (300 mg/kg by oral infusion, 15 minutes before flap elevation. On the seventh postoperative day, percentage of distal necrosis was determined and skin samples collected in order to allow determination of MDA levels. RESULTS: The mean necrotic area in CG group (control was 66 % and in NACG group (Acetylcysteine 52 %, a statistically significant difference according to the Mann-Whitney test (U calc = 25; U crit = 45. MDA levels were lower in the CG flap skin samples than in the NACG samples (U calc = 24; U crit = 45, the oposite being true in the normal skin samples (U calc = 10; U crit = 45. CONCLUSION: Acetylcysteine was effective, according to the model used, reducing the percentage of distal necrosis in NACG rats.

  4. Improvement parameters in dynamic compaction adjacent to the slopes

    Directory of Open Access Journals (Sweden)

    Elham Ghanbari

    2015-04-01

    Full Text Available Dynamic compaction is a cost-effective method commonly used for improvement of sandy soils. A number of researchers have investigated experimentally and numerically the improvement parameters of soils using dynamic compaction, such as crater depth, improvement depth, and radial improvement, however, these parameters are not studied for improvement adjacent to the slopes or trenches. In this research, four different slopes with different inclinations are modeled numerically using the finite element code ABAQUS, and impact loads of dynamic compaction are applied. The static factors of safety are kept similar for all trenches and determined numerically by application of gravity loads to the slope using strength reduction method (SRM. The analysis focuses on crater depth and improvement region which are compared to the state of flat ground. It can be observed that compacted area adjacent to the slopes is narrower and slightly away from the slope compared to the flat state. Moreover, crater depth increases with increase in slope inclination.

  5. Regional Fault Systems of Qaidam Basin and Adjacent Orogenic Belts

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The purpose of this paper is to analyze the regional fault systems of Qaidam basin and adjacent orogenic belts. Field investigation and seismic interpretation indicate that five regional fault systems occurred in the Qaidam and adjacent mountain belts, controlling the development and evolution of the Qaidam basin. These fault systems are: (1)north Qaidam-Qilian Mountain fault system; (2) south Qaidam-East Kunlun Mountain fault system; (3)Altun strike-slip fault system; (4)Elashan strike-slip fault system, and (5) Gansen-Xiaochaidan fault system. It is indicated that the fault systems controlled the orientation of the Qaidam basin, the formation and distribution of secondary faults within the basin,the migration of depocenters and the distribution of hydrocarbon accumulation belt.

  6. Resonance-like tunneling across a barrier with adjacent wells

    Indian Academy of Sciences (India)

    S Mahadevan; P Prema; S K Agarwalla; B Sahu; C S Shastry

    2006-09-01

    We examine the behavior of transmission coefficient across the rectangular barrier when attractive potential well is present on one or both sides and also the same is studied for a smoother barrier with smooth adjacent wells having Woods–Saxon shape. We find that presence of well with suitable width and depth can substantially alter at energies below the barrier height leading to resonant-like structures. In a sense, this work is complementary to the resonant tunneling of particles across two rectangular barriers, which is being studied in detail in recent years with possible applications in mind. We interpret our results as due to resonant-like positive energy states generated by the adjacent wells. We describe in detail the possible potential application of these results in electronic devices using n-type oxygen-doped gallium arsenide and silicon dioxide. It is envisaged that these results will have applications in the design of tunneling devices.

  7. New adjacent Bis-tetrahydrofuran Annonaceous acetogenins from Annona muricata.

    Science.gov (United States)

    Chang, Fang-Rong; Liaw, Chih-Chuang; Lin, Chih-Yuan; Chou, Chi-Jung; Chiu, Hui-Fen; Wu, Yang-Chang

    2003-03-01

    Bioactivity-guided fractionation led to the isolation of two new Annonaceous acetogenins, annocatacin A ( 1). and annocatacin B ( 2). from the seeds and the leaves, respectively, of Annona muricata. Compounds 1 and 2 are the first examples where the adjacent bis-tetrahydrofuran ring system is located at C-15. The new structures were elucidated and characterized by spectral and chemical methods. Both Annonaceous acetogenins 1 and 2 showed significant in vitro cytotoxicity toward the human hepatoma cell lines, Hep G2 and 2,2,15, and were compared with the known adjacent bis-tetrahydrofuran acetogenins, neoannonin ( 3). desacetyluvaricin ( 4). bullatacin ( 5). asimicin ( 6). annoglaucin ( 7). squamocin ( 8). and rollimusin ( 9).

  8. Improvement parameters in dynamic compaction adjacent to the slopes

    Institute of Scientific and Technical Information of China (English)

    Elham Ghanbari; Amir Hamidi

    2015-01-01

    Dynamic compaction is a cost-effective method commonly used for improvement of sandy soils. A number of researchers have investigated experimentally and numerically the improvement parameters of soils using dynamic compaction, such as crater depth, improvement depth, and radial improvement, however, these parameters are not studied for improvement adjacent to the slopes or trenches. In this research, four different slopes with different inclinations are modeled numerically using the finite element code ABAQUS, and impact loads of dynamic compaction are applied. The static factors of safety are kept similar for all trenches and determined numerically by application of gravity loads to the slope using strength reduction method (SRM). The analysis focuses on crater depth and improvement region which are compared to the state of flat ground. It can be observed that compacted area adjacent to the slopes is narrower and slightly away from the slope compared to the flat state. Moreover, crater depth increases with increase in slope inclination.

  9. A Note on Markov Normalized Magnetic Eigenmaps

    CERN Document Server

    Cloninger, Alexander

    2016-01-01

    We note that building a magnetic Laplacian from the Markov transition matrix, rather than the graph adjacency matrix, yields several benefits for the magnetic eigenmaps algorithm. The two largest benefits are that the embedding becomes more stable as a function of the rotation parameter g, and the principal eigenvector of the magnetic Laplacian now converges to the page rank of the network as a function of diffusion time. We show empirically that this normalization improves the phase and real/imaginary embeddings of the low-frequency eigenvectors of the magnetic Laplacian.

  10. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    OpenAIRE

    Mahmoud Yahyai; Masoud Mirtaheri; Mehrab Mahoutian; Amir S. Daryan

    2008-01-01

    In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI) on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance bet...

  11. Acyclic Edge Coloring of Planar Graphs without Adjacent Triangles

    Institute of Scientific and Technical Information of China (English)

    Dezheng XIE; Yanqing WU

    2012-01-01

    An acyclic edge coloring of a graph G is a proper edge coloring such that there are no bichromatic cycles.The acyclic edge chromatic number of a graph G is the minimum number k such that there exists an acyclic edge coloring using k colors and is denoted by x'a(G).In this paper we prove that x'a(G)≤ Δ(G)+ 5 for planar graphs G without adjacent triangles.

  12. Disrupted Turn Adjacency and Coherence Maintenance in Instant Messaging Conversations

    OpenAIRE

    Berglund, Therese Örnberg

    2009-01-01

    This article reports on a study of coherence in text-based log files from 120 two-party Instant Messaging (IM) conversations among a group of international students at a design school. The goals of the study were to investigate whether disrupted turn adjacency was an obstacle to coherence and to identify the linguistic strategies employed to maintain coherence. Additional signs of problematic coherence creation were also investigated, focusing on explicit signs of miscommunication. In this pa...

  13. Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors

    Institute of Scientific and Technical Information of China (English)

    WU Yan; LIU Houjun; LI Jiawen

    2007-01-01

    To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.

  14. Do normal hips dislocate?

    Science.gov (United States)

    Alshameeri, Zeiad; Rehm, Andreas

    2014-11-01

    There have been a small number of case reports describing late normal-hip dislocations in children who were later diagnosed with developmental dysplasia of the hip. Here, we contest the assumption that normal hips can dislocate. We argue that (as in our case) the ultrasound scans in all published case reports on late dislocated normal hips did not show results that were entirely normal and therefore, so far, there has been no convincing evidence of a dislocation of a normal hip. We also want to highlight the importance of meticulous ultrasound and clinical assessments of high-risk children by an experienced orthopaedic surgeon. PMID:25144883

  15. Staining of skin with dihydroxyacetone.

    Science.gov (United States)

    WITTGENSTEIN, E; BERRY, H K

    1960-09-30

    The reaction of skin with dihydroxyacetone to produce a brown "artificial tan" appears to proceed through combination with free amino groups in skin proteins, and particularly by combination of dihydroxyacetone with the free guanido group in arginine.

  16. Tips for Relieving Dry Skin

    Science.gov (United States)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  17. Skin lesion removal-aftercare

    Science.gov (United States)

    ... aftercare; Nevi - removal aftercare; Scissor excision aftercare; Skin tag removal aftercare; Mole removal aftercare; Skin cancer removal ... to the principles of the Health on the Net Foundation (www.hon.ch). The information provided herein ...

  18. The management of skin tears.

    Science.gov (United States)

    Meuleneire, Frans

    During the ageing process the layers of the skin start to atrophy; the epidermis becomes thin and fragile, and dermal thickness decreases by 20 per cent (White et al, 1994). This makes skin tears a common problem among older people.

  19. Radiation Therapy for Skin Cancer

    Science.gov (United States)

    ... skin cells called melanocytes that produce skin color ( melanin ). Radiation therapy is used mostly for melanomas that ... in addition to surgery, chemotherapy or biologic therapy. Hair Epidermis Dermis Subcutaneous Hair Follicle Vein Artery © ASTRO ...

  20. Skin - abnormally dark or light

    Science.gov (United States)

    ... ency/article/003242.htm Skin - abnormally dark or light To use the sharing features on this page, ... the hands. The bronze color can range from light to dark (in fair-skinned people) with the ...

  1. SKIN DETECTION OF ANIMATION CHARACTERS

    Directory of Open Access Journals (Sweden)

    Kazi Tanvir Ahmed Siddiqui

    2015-02-01

    Full Text Available The increasing popularity of animes makes it vulnerable to unwanted usages like copyright violations and pornography. That’s why, we need to develop a method to detect and recognize animation characters. Skin detection is one of the most important steps in this way. Though there are some methods to detect human skin color, but those methods do not work properly for anime characters. Anime skin varies greatly from human skin in color, texture, tone and in different kinds of lighting. They also vary greatly among themselves. Moreover, many other things (for example leather, shirt, hair etc., which are not skin, can have color similar to skin. In this paper, we have proposed three methods that can identify an anime character’s skin more successfully as compared with Kovac, Swift, Saleh and Osman methods, which are primarily designed for human skin detection. Our methods are based on RGB values and their comparative relations.

  2. Drugs Approved for Skin Cancer

    Science.gov (United States)

    ... Ask about Your Treatment Research Drugs Approved for Skin Cancer This page lists cancer drugs approved by the Food and Drug Administration (FDA) for skin cancer, including drugs for basal cell carcinoma and melanoma. ...

  3. FMRI evidence of acupoints specificity in two adjacent acupoints.

    Science.gov (United States)

    Liu, Hua; Xu, Jian-Yang; Li, Lin; Shan, Bao-Ci; Nie, Bin-Bin; Xue, Jing-Quan

    2013-01-01

    Objectives. Acupoint specificity is the foundation of acupuncture treatment. The aim of this study is to investigate whether the acupoint specificity exists in two adjacent acupoints. Design and Setting. Two adjacent real acupoints, LR3 (Taichong) and ST44 (Neiting), and a nearby nonacupoint were selected. Thirty-three health volunteers were divided into three groups in random order, and each group only received acupuncture at one of the three points. While they received acupuncture, fMRI scan was performed. Results. The common cerebral activated areas responding to LR3 and ST44 included the contralateral primary somatosensory area (SI) and ipsilateral cerebellum. Acupuncture at LR3 specifically activated contralateral middle occipital gyrus, ipsilateral medial frontal gyrus, superior parietal lobe, middle temporal gyrus, rostral anterior cingulate cortex (rACC), lentiform nucleus, insula, and contralateral thalamus. Stimulation at ST44 selectively activated ipsilateral secondary somatosensory area (SII), contralateral middle frontal gyrus, inferior frontal gyrus, lingual gyrus, lentiform nucleus, and bilateral posterior cingulate cortex (PCC). Conclusions. Acupuncture at adjacent acupoints elicits distinct cerebral activation patterns, and those specific patterns might be involved in the mechanism of the specific therapeutic effects of different acupoints. PMID:23762172

  4. Predicting Agenesis of the Mandibular Second Premolar from Adjacent Teeth.

    Directory of Open Access Journals (Sweden)

    Geetanjali Sharma

    Full Text Available Early diagnosis of agenesis of the mandibular second premolar (P2 enhances management of the dental arch in the growing child. The aim of this study was to explore the relationship in the development of the mandibular first molar (M1 and first premolar (P1 at early stages of P2 (second premolar. Specifically, we ask if the likelihood of P2 agenesis can be predicted from adjacent developing teeth. We selected archived dental panoramic radiographs with P2 at crown formation stages (N = 212 and calculated the likelihood of P2 at initial mineralisation stage 'Ci' given the tooth stage of adjacent teeth. Our results show that the probability of observing mandibular P2 at initial mineralisation stage 'Ci' decreased as both the adjacent P1 and M1 matured. The modal stage at P2 'Ci' was P1 'Coc' (cusp outline complete and M1 'Crc' (crown complete. Initial mineralisation of P2 was observed up to P1 'Crc' and M1 stage 'R½' (root half. The chance of observing P2 at least 'Coc' (coalescence of cusps was considerably greater prior to these threshold stages compared to later stages of P1 and M1. These findings suggest that P2 is highly unlikely to develop if P1 is beyond 'Crc' and M1 is beyond 'R½'.

  5. Tissue Engineered Human Skin Equivalents

    OpenAIRE

    Zheng Zhang; Michniak-Kohn, Bozena B.

    2012-01-01

    Human skin not only serves as an important barrier against the penetration of exogenous substances into the body, but also provides a potential avenue for the transport of functional active drugs/reagents/ingredients into the skin (topical delivery) and/or the body (transdermal delivery). In the past three decades, research and development in human skin equivalents have advanced in parallel with those in tissue engineering and regenerative medicine. The human skin equivalents are used commerc...

  6. A REVIEW ON SKIN CANCER

    OpenAIRE

    S. Ramya Silpa; Chidvila V

    2013-01-01

    Skin cancer can be of 2 types mainly. They are malignant melanoma and non-malignant melanoma. Skin cancer mainly occurs due to exposure of sunlight. Ozone depletion and chemical exposures are other factors involved in precipitating skin cancer. Mutations of p53 gene are involved in UV- induced carcinogenesis. P53 gene acts vital in development of SCC. So, prevention of skin cancer is the main criteria. Regular application of sunscreens could be one of the primary prevention. The purpose of pr...

  7. Development of a Vascularized Skin Construct Using Adipose-Derived Stem Cells from Debrided Burned Skin

    Directory of Open Access Journals (Sweden)

    Rodney K. Chan

    2012-01-01

    Full Text Available Large body surface area burns pose significant therapeutic challenges. Clinically, the extent and depth of burn injury may mandate the use of allograft for temporary wound coverage while autografts are serially harvested from the same donor areas. The paucity of donor sites in patients with burns involving large surface areas highlights the need for better skin substitutes that can achieve early and complete coverage and retain normal skin durability with minimal donor requirements. We have isolated autologous stem cells from the adipose layer of surgically debrided burned skin (dsASCs, using a point-of-care stem cell isolation device. These cells, in a collagen—polyethylene glycol fibrin-based bilayer hydrogel, differentiate into an epithelial layer, a vascularized dermal layer, and a hypodermal layer. All-trans-retinoic acid and fenofibrate were used to differentiate dsASCs into epithelial-like cells. Immunocytochemical analysis showed a matrix- and time-dependent change in the expression of stromal, vascular, and epithelial cell markers. These results indicate that stem cells isolated from debrided skin can be used as a single autologous cell source to develop a vascularized skin construct without culture expansion or addition of exogenous growth factors. This technique may provide an alternative approach for cutaneous coverage after extensive burn injuries.

  8. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  9. Functional angiocoupling between follicles and adjacent corpus luteum in heifers.

    Science.gov (United States)

    Ginther, O J; Siddiqui, M A R; Baldrighi, J M

    2016-07-15

    In single ovulating cattle, ipsilateral versus contralateral interovarian relationships refer to a dominant follicle (DF) and CL in the same versus opposite ovaries. The ipsilateral relationship consists of the DF-CL and the devoid (no DF or CL) intraovarian pattern, and the contralateral relationship consists of the DF pattern and the CL pattern. The DF-CL pattern involves positive effects on both the DF and CL when adjacent (≤3-mm apart) versus separated as follows: greater diameter of DF (e.g., 10.5 ± 0.4 vs. 9.0 ± 0.4 mm), greater percentage of the DF wall with color Doppler signals of blood flow (40.2% ± 2.0% vs. 24.5% ± 1.9%), greater cross-sectional area of the CL (2.2 ± 0.1 vs. 1.8 ± 0.2 cm(2)), and greater percentage of the entire CL with blood flow signals (51.8% ± 1.2% vs. 42.5% ± 3.1%). Additional examples of positive coupling are (1) future DF on Day 0 (day of ovulation) is closer to the CL than the future largest subordinate and (2) diameter of growing follicles on Day 0 and the growth rate on Days 0 to 2 are greater for follicles that are adjacent than separated from the CL. An example of a negative intraovarian effect is decreasing diameter and loss of future DF status of a largest follicle when adjacent to a regressing CL. The impact of the continuity of ovarian angioarchitecture during the periovulatory follicular wave was exemplified in 17 of 18 waves by conversion of an ovary with only the preovulatory follicle to the postovulatory DF-CL pattern. Functional angiocoupling from commonality in angioarchitecture of the DF and adjacent CL would account for both the positive two-way coupling between DF and CL during the luteal phase and the negative effect of a regressing CL on an adjacent follicle during luteolysis. PMID:27056414

  10. Skin Cancers of the Feet

    Science.gov (United States)

    ... skin of the lower legs and feet. Skin cancers affecting the feet may have a very different appearance from those arising on the rest of the body. For this reason, a podiatrist's knowledge and clinical training is of ... and malignant skin tumors. Learn the ABCDs of melanoma. If you notice ...

  11. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  12. Skin contamination dosimeter

    Science.gov (United States)

    Hamby, David M.; Farsoni, Abdollah T.; Cazalas, Edward

    2011-06-21

    A technique and device provides absolute skin dosimetry in real time at multiple tissue depths simultaneously. The device uses a phoswich detector which has multiple scintillators embedded at different depths within a non-scintillating material. A digital pulse processor connected to the phoswich detector measures a differential distribution (dN/dH) of count rate N as function of pulse height H for signals from each of the multiple scintillators. A digital processor computes in real time from the differential count-rate distribution for each of multiple scintillators an estimate of an ionizing radiation dose delivered to each of multiple depths of skin tissue corresponding to the multiple scintillators embedded at multiple corresponding depths within the non-scintillating material.

  13. Skin barrier in rosacea.

    Science.gov (United States)

    Addor, Flavia Alvim Sant'Anna

    2016-01-01

    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  14. Serotonin in human skin

    Institute of Scientific and Technical Information of China (English)

    Jianguo Huang; Qiying Gong; Guiming Li

    2005-01-01

    In this review the authors summarize data of a potential role for serotonin in human skin physiology and pathology. The uncovering of endogenous serotonin synthesis and its transformation to melatonin underlines a putative important role of this pathway in melanocyte physiology and pathology. Pathways of the biosynthesis and biodegradation of serotonin have been characterized in human beings and its major cellular populations. Moreover, receptors of serotonin are expressed on keratinocytes, melanocytes, and fibroblasts and these mediate phenotypic actions on cellular proliferation and differentiation. And the widespread expression of a cutaneous seorotoninergic system indicates considerable selectivity of action to facilitate intra-, auto-, or paracrine mechanisms that define and influence skin function in a highly compartmentalized manner. Melatonin, in turn, can also act as a hormone, neurotransmitter, cytokine, biological modifier and immunomodulator. Thus, Serotonin local synthesis and cellular localization could thus become of great importance in the diagnosis and management of cutaneous pathology.

  15. Skin metastases of lung cancer:

    OpenAIRE

    Kecelj, Peter; Košnik, Mitja; Požek, Igor; Triller Vadnal, Katja; Triller, Nadja

    2008-01-01

    Skin metastases of lung cancer are rare. In over a 3-year period we found only14 cases of skin metastases among 1,614 patients with lung cancer admittedto the University Clinic of Respiratory and Allergic Diseases in Golnik. The metastases are usually manifested on the skin of the chest. Skin metastases are symptoms of progressive disease, and usually a sign of a poor prognosis. The median survival time of lung cancer patients with skin metastases was 85 days from the time of detection of the...

  16. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation p

  17. SKIN RADIATION IN PANORAMIC

    Directory of Open Access Journals (Sweden)

    Herry Irawan

    2015-06-01

    Full Text Available Dental panoramic radiograph in Indonesia has been widely used. Modern diagnostic imaging equipment with minimum radiation is still very limited. One of the conditions in nuclear safety law, UU 10/1997, is an optimization of all radiation sources with DRL through skin dose measurements. In Indonesia, the national DRL has not been established yet, and there were no reports on the study of panoramic skin dose in Indonesia. The aim of this preliminary study was to obtain a panoramic skin dose radiation as reference to establish DRL in Indonesia. Panoramic radiographs of sixteen female and fifteen male patients, aged 4 – 48 years, were taken using the standard conventional method, with TLD chips attached in location groups. The chips were then read with the detector and integrator of BATAN, in high and low temperature condition at the same time. It was revealed that behind the right and left ear were the regions with the highest radiation dose received, followed by the back of the neck, left jaw, right jaw, and chin. The result of this study has shown the importance of DRL in Indonesia since the use of modern diagnostic imaging equipement that limits radiation dose to the minimum level is still very limited.

  18. Skin-sparing mastectomy.

    Science.gov (United States)

    Simmons, Rache M; Adamovich, Tara L

    2003-08-01

    The cosmetic appearance of the reconstructed breast is largely dependent upon the quantity of breast skin which remains after mastectomy. Leaving behind as much skin as is possible significantly improves the natural appearance of the reconstruction and reduces procedures required on the contralateral breast to achieve symmetry. SSM with immediate reconstruction offers superior aesthetic results to NSSM, with similar LR rates. As most recurrences will occur in chest wall skin, the ability to detect local recurrence is not impaired. The incidence of local wound complications with SSM is comparable to NSSM. It has been demonstrated that sentinel lymph node biopsy and axillary dissection can be performed adequately in SSM. There is no contraindication to postoperative adjuvant chemotherapy and radiation therapy. There are some groups of patients for whom SSM is not indicated, such as patients with inflammatory carcinoma. SSM should be considered for selected patients with breast cancer in conjunction with all types of immediate reconstruction. In conclusion, numerous studies support the use of SSM on selected patients as an oncologically acceptable procedure with superior cosmetic results when compared with traditional NSSM. PMID:12875600

  19. Effects of radiation on levels of DNA damage in normal non-adjacent mucosa from colorectal cancer cases.

    LENUS (Irish Health Repository)

    Sheridan, Juliette

    2013-03-01

    Defects in DNA repair pathways have been linked with colorectal cancer (CRC). Adjuvant radiotherapy has become commonplace in the treatment of rectal cancer however it is associated with a higher rate of second cancer formation. It is known that radiation results in DNA damage directly or indirectly by radiation-induced bystander effect (RIBE) by causing double-strand breaks (DSBs). The majority of work in RIBE has been performed in cell lines and limited studies have been in or ex vivo.

  20. Photothermal Radiometry for Skin Research

    Directory of Open Access Journals (Sweden)

    Perry Xiao

    2016-02-01

    Full Text Available Photothermal radiometry is an infrared remote sensing technique that has been used for skin and skin appendages research, in the areas of skin hydration, hydration gradient, skin hydration depth profiling, skin thickness measurements, skin pigmentation measurements, effect of topically applied substances, transdermal drug delivery, moisture content of bio-materials, membrane permeation, and nail and hair measurements. Compared with other technologies, photothermal radiometry has the advantages of non-contact, non-destructive, quick to make a measurement (a few seconds, and being spectroscopic in nature. It is also colour blind, and can work on any arbitrary sample surfaces. It has a unique depth profiling capability on a sample surface (typically the top 20 µm, which makes it particularly suitable for skin measurements. In this paper, we present a review of the photothermal radiometry work carried out in our research group. We will first introduce the theoretical background, then illustrate its applications with experimental results.

  1. Epithelial cell cultures from normal and cancerous human tissues.

    Science.gov (United States)

    Owens, R B; Smith, H S; Nelson-Rees, W A; Springer, E L

    1976-04-01

    Thirty epithelial cell strains were isolated from human carcinomas and normal epithelial tissues by collagenase digestion and selective removal of fibroblasts with trypsin-Versene. Most strains were obtained from metastatic carcinomas or epithelia of the urinary and intestinal tracts. The success rate for growth of both neoplastic and normal tissues (excluding skin) was 38%. Six of these strains showed gross morphologic and chromosome changes typical of malignant cells. Nine resembled normal epithelium. The other 15 exhibited some degree of morphologic change from normal. PMID:176412

  2. Exploration and Study of Deep Crustal Structure in the Quanzhou Basin and Its Adjacent Area

    Institute of Scientific and Technical Information of China (English)

    Zhu Jinfang; Fang Shengming; Zhang Xiankang; Qu Guosheng; Huang Zonglin; Hong Xing; Liu Baojin; Yang Zhuoxin; Duan Yonghong

    2006-01-01

    The Quanzhou basin and its adjacent areas locate in the middle of the southeastern coast seismic belt on the Chinese mainland. The very fine geometry structure of this area from near ground to Moho interface and the relationship between the deep and shallow faults are obtained based on deep seismic reflection profiling. This profile is the first deep seismic reflection profile in this area and it indicates that the crust can be divided into the upper crust and the lower crust and the thickness of crust is from 29.5 km to 31 km in this area. The upper crust and the lower crust can be also divided into two layers. There are shallow normal faults developed in the upper crust and extending to the depth from 6 km to 12 km. The angle of those listric faults decreases with depth and the faults joint into the C1 interface (detachment surface). There is a high angle fault under the Yong'an-Jinjiang fault belt which cuts off the interface of the upper crust and the lower crust and the Moho interface. Although there is no connection between the shallow and the deep faults, it offers deep structural environment for moderate and strong earthquake because of the deep high angle fault. This exploration result improves the reliability and precision of explanation of deep crustal structure in this area. The pull-apart and listric normal fault model indicates that the upper crust structure accords to the dynamic process of Taiwan Straits. This is helpful for seismicity estimation of Quanzhou and its adjacent area and important for obtaining more of the dynamic process of the southeast coast seismic belt.

  3. Three-dimensional visualization of intracranial vessels and adjacent structures

    International Nuclear Information System (INIS)

    MR three-dimensional-Fourier-transform, gradient-echo sequences are available that allow the acquisition of high-quality data sets, suitable for three- dimensional image processing. Most recently, flow- compensated measurement sequences are used to achieve a three-dimensional perspective of the vascular anatomy. Spatial relationships between vessels and adjacent structures can be revealed by three-dimensional displays, showing both vessels and tissue surfaces (brain, tumor) in a three- dimensional manner. The image-processing techniques are based on the ray-tracing principle. The method can be used for the optimization of neurosurgical planning in the sellar region

  4. Seismic Response of Adjacent Structures Connected by Linear Viscous Dampers

    Directory of Open Access Journals (Sweden)

    Pulido-Delgado J.L.

    2012-04-01

    Full Text Available This study shows the seismic response of two adjacent structures connected by linear viscous dampers (5% damped SDOF systems linked to one another by a passive viscous damper was comprehensively evaluated trough time history analysis. The seismic excitation was modelled as a non stationary random process, and the response of the structures was obtained by Monte Carlo simulations. It was found that existing approximate expressions to evaluate the seismic response are qualitatively correct in the sense that they rightly indicate in which cases the coupling control approach is indeed convenient.

  5. An ElGamal Encryption Scheme of Adjacency Matrix and

    Directory of Open Access Journals (Sweden)

    B. Ravi Kumar

    2015-10-01

    Full Text Available  Cryptography is the combination of Mathematics and Computer science. Cryptography is used for encryption and decryption of data using mathematics. Cryptography transit the information in an illegible manner such that only intended recipient will be able to decrypt the information. In the recent years, researchers developed several new encryption methods. Among such ElGamal encryption is the one laid a concede platform for the researchers in Cryptography. Ever science several mathematical models were applied for encryption/decryption. In this paper, we introduced an ElGamal encryption, which uses points on the elliptic curve, and finite state machines and adjacency matrix.

  6. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    OpenAIRE

    Koshi Ninomiya; Koichi Iwatsuki; Yu-ichiro Ohnishi; Toshika Ohkawa; Toshiki Yoshimine

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  7. The formation of adjacent triplex-duplex domainsin DNA.

    OpenAIRE

    Nam, K. H.; Abhiraman, S; Wartell, R M

    1999-01-01

    The ability of single-stranded DNA oligomers to form adjacent triplex and duplex domains with two DNA structural motifs was examined. Helix-coil transition curves and a gel mobility shift assay were used to characterize the interaction of single-stranded oligomers 12-20 nt in length with a DNA hairpin and with a DNA duplex that has a dangling end. The 12 nt on the 5'-ends of the oligomers could form a triplex structure with the 12 bp stem of the hairpin or the duplex portion of the DNA with a...

  8. The kernel of the adjacency matrix of a rectangular mesh

    OpenAIRE

    Tomei, Carlos; Vieira, Tania

    2002-01-01

    Given an m x n rectangular mesh, its adjacency matrix A, having only integer entries, may be interpreted as a map between vector spaces over an arbitrary field K. We describe the kernel of A: it is a direct sum of two natural subspaces whose dimensions are equal to $\\lceil c/2 \\rceil$ and $\\lfloor c/2 \\rfloor$, where c = gcd (m+1,n+1) - 1. We show that there are bases to both vector spaces, with entries equal to 0, 1 and -1. When K = Z/(2), the kernel elements of these subspaces are described...

  9. Osteoid Osteoma of Cervical Spine in two adjacent Vertebrae

    Directory of Open Access Journals (Sweden)

    MR Etemadifar

    2005-09-01

    Full Text Available Osteoid osteoma is a benign bone tumor, mainly seen in 10-30 years male. Spine is a relatively common site and almost always, posterior elements are involved. Plain X-Ray-, CT scan and Isotope scan help to identify and localize spine lesions. We described one 18 years old boy with 3 years low neck pain. Isotope scan, MRI and CT scan showed two lesions in C7 and T1. Gross inspection and histopathology examination confirmed osteoid osteoma in two adjacent vertebrae which has not been reported elsewhere in the literature. Key words: Osteoid Osteoma, Spine, Multifocal

  10. Historical Earthquakes in the Yellow Sea and Its Adjacent Area

    Institute of Scientific and Technical Information of China (English)

    Wu Ge; Wang Andong; Wu Di

    2005-01-01

    As a result of sorting out, estimating and cataloging of historical earthquakes, from the year of 2 A.D. to Aug., 1949, we found that there were 2187 earthquakes with M≥3.0 in the area of the Yellow Sea and its adjacent area. Among the earthquakes, the number of earthquakes with M ≥ 5.0 is 209, and at least 43 of the earthquakes caused serious losses, 20 of the earthquakes caused human causalities. It is demonstrated that there were 3 areas of historical earthquake concentration and the earthquake activity was higher in the 16th century and the first half if the 20th century.

  11. Novel biodegradable porous scaffold applied to skin regeneration.

    Directory of Open Access Journals (Sweden)

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  12. Analysis of Normal-Tumour Tissue Interaction in Tumours: Prediction of Prostate Cancer Features from the Molecular Profile of Adjacent Normal Cells

    OpenAIRE

    Trevino, Victor; Tadesse, Mahlet G.; Vannucci, Marina; Al-Shahrour, Fatima; Antczak, Philipp; Durant, Sarah; Bikfalvi, Andreas; Dopazo, Joaquin; Campbell, Moray J.; Falciani, Francesco

    2011-01-01

    Statistical modelling, in combination with genome-wide expression profiling techniques, has demonstrated that the molecular state of the tumour is sufficient to infer its pathological state. These studies have been extremely important in diagnostics and have contributed to improving our understanding of tumour biology. However, their importance in in-depth understanding of cancer patho-physiology may be limited since they do not explicitly take into consideration the fundamental role of the t...

  13. Removal of heavy metal contamination from peanut skin extracts by waste biomass adsorption

    Science.gov (United States)

    Polyphenols are a rapidly increasing portion of the nutraceutical and functional food marketplace. Peanut skins are a waste product which have potential as a low-cost source of polyphenols. Extraction and concentration of peanut skin extracts can cause normally innocuous levels of the heavy metal co...

  14. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    DEFF Research Database (Denmark)

    Remvig, L; Duhn, Ph; Ullman, S;

    2010-01-01

    The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...

  15. Fluorescence Measurement of Burned Skin Tissues

    Science.gov (United States)

    de Pedro, Hector Michael; Chang, Chuan-I.; Nguyen, Hue; Malko, Anton; Zarnani, Faranak; Glosser, Robert; Maas, D.; Idris, A.

    2011-03-01

    Early removal of affected tissues from burn patients can significantly increase the success of their recovery, since burns continue to spread and damage surrounding tissues after hours of injury. The rationale behind this procedure is that burns trigger the body's immune system to overreact, causing additional damage. Therefore it is important to locate and identify the burn (area and thickness) so that it can be removed as quickly as possible. Our project explores the use of autofluorescence as a tool to identify the burned tissues from healthy ones. Here we present that our fluorescence results show differences between burned and normal skin in both its spectra and lifetime.

  16. In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy

    International Nuclear Information System (INIS)

    The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)

  17. One-sheet spiraling full thickness skin graft for penile resurfacing after paraffinoma excision

    Directory of Open Access Journals (Sweden)

    Theddeus O.H. Prasetyono

    2011-08-01

    Full Text Available In the midst of on-going non-illicit practice of silicone or paraffin injection to enlarge penis, the author reported 3 cases of surgical treatment to resurface the body of the penis after excision of the destructed penile skin using full thickness skin graft. The skin excision was performed technically through penile body degloving procedure. Full thickness skin graft was then applied as a single sheet donor tissue to cover the denuded penile body spirally. The full thickness graft, which is relatively easy to be performed, is no doubt much thinner than a skin flap, while it also bears a smaller degree of secondary contraction than split skin graft. The color of the skin is considerably matched as it comes from the groin, which is a nearby area of penis. The size and skin sensitization of the penis looks to be natural. The only disadvantage is the common possibility of either spiral or circular junctional scar in between graft edges and between the graft and the penile mucosa and skin to develop hypertrophic scar. However, this possible scar problem applies also to any other surgical scar with any donor tissue. Fortunately, the 3 cases posed no scar problem and normal appearance. All the patients have also regained their normal sexual function. (Med J Indones 2011; 20:222-5Keywords: full thickness skin graft, paraffinoma, siliconoma, sexual function

  18. Stress Wave Interaction Between Two Adjacent Blast Holes

    Science.gov (United States)

    Yi, Changping; Johansson, Daniel; Nyberg, Ulf; Beyglou, Ali

    2016-05-01

    Rock fragmentation by blasting is determined by the level and state of stress in the rock mass subjected to blasting. With the application of electronic detonators, some researchers stated that it is possible to achieve improved fragmentation through stress wave superposition with very short delay times. This hypothesis was studied through theoretical analysis in the paper. First, the stress in rock mass induced by a single-hole shot was analyzed with the assumptions of infinite velocity of detonation and infinite charge length. Based on the stress analysis of a single-hole shot, the stress history and tensile stress distribution between two adjacent holes were presented for cases of simultaneous initiation and 1 ms delayed initiation via stress superposition. The results indicated that the stress wave interaction is local around the collision point. Then, the tensile stress distribution at the extended line of two adjacent blast holes was analyzed for a case of 2 ms delay. The analytical results showed that the tensile stress on the extended line increases due to the stress wave superposition under the assumption that the influence of neighboring blast hole on the stress wave propagation can be neglected. However, the numerical results indicated that this assumption is unreasonable and yields contrary results. The feasibility of improving fragmentation via stress wave interaction with precise initiation was also discussed. The analysis in this paper does not support that the interaction of stress waves improves the fragmentation.

  19. Adjacent flaps for lower lip reconstruction after mucocele resection.

    Science.gov (United States)

    Ying, Binbin

    2012-03-01

    Mucocele forms because of salivary gland mucous extravasation or retention and is usually related to trauma in the area of the lower lip. It is a common benign lesion in the oral region. Although there are many conservative treatments such as the creation of a pouch (marsupialization), freezing (cryosurgery), micromarsupialization, and CO2 laser vaporization, surgical resection is the most commonly used means. Generally speaking, an elliptic incision was made to fully enucleate the lesion along with the overlying mucosa and the affected glands, then direct suturing is adequate. However, in some cases, direct suturing could cause lower lip deformity, and adjacent flaps for lower lip reconstruction after mucocele resection might be quite necessary. Based on our experience, adjacent mucosal flaps could be used when lesions were close to or even break through the vermilion border or their diameters were much more than 1 cm. A-T advancement flaps and transposition flaps were the mostly applied ones. Follow-up showed that all patients realized primary healing after 1 week postoperatively with satisfactory lower lip appearance, and there was no sign of increasing incidence of relapse. PMID:22421867

  20. Adjacent stage impurity ratio in rare earth countercurrent extraction process

    Institute of Scientific and Technical Information of China (English)

    CHENG Fuxiang; WU Sheng; LIAO Chunsheng; YAN Chunhua

    2013-01-01

    Impurity components decrease stage by stage in a cascade of rare earth (RE) extraction separation,and adjacent stage impurity ratio (ASIR) which is defined as the ratio of an impurity's contents in the aqueous/organic phase of two adjacent stages can be used to evaluate the capacity of impurity removal for the two stages.On the basis of extraction equilibrium and mass balance,the ASIR in a two-component extraction separation was deducted and its simplified expressions were given for different process sections according to reasonable assumptions.The calculation simulation was then carried out to obtain the ASIR distribution in the cascade.The results showed that in both the extraction and scrubbing sections the ASIR principally increased with the decrease of the molar proportion of the impurity but along with a flat appearing in the purification zone located in the middle of the cascade.The ASIR intuitively exhibits the nmning status of RE extraction separation and purification,which could provide a theoretic guide for investigating the influence factors of RE extraction separation process in practical industry.

  1. Seismic anisotropy of upper mantle in Sichuan and adjacent regions

    Institute of Scientific and Technical Information of China (English)

    CHANG LiJun; WANG ChunYong; DING ZhiFeng

    2008-01-01

    Based on the polarization analysis of teleseismic SKS waveform data recorded at 94 broadband seismic stations in Sichuan and adjacent regions, the SKS fast-wave direction and the delay time between the fast and slow shear waves were determined at each station using the grid searching method of minimum transverse energy and the stacking analysis method, and the image of upper mantle anisotropy was acquired. The fast-wave polarization directions are mainly NW-SE in the study area,NWW-SEE to its northeast and NS to its west. The delay time falls into the interval [0.47 s, 1.68 s]. The spatial variation of the fast-wave directions is similar to the variation of GPS velocity directions. The anisotropic image indicates that the regional tectonic stress field has resulted in deformation and flow of upper mantle material, and made the alignment of upper mantle peridotite lattice parallel to the direction of material deformation. The crust-upper mantle deformation in Sichuan and adjacent regions accords with the mode of vertically coherent deformation. In the eastern Tibetan Plateau, the crustal material was extruded to east or southeast clue to SE traction force of the upper mantle material. The extrusion might be obstructed by a rigid block under the Sichuan Basin and the crust has been deformed. After a long-term accumulation of tectonic strain energy, the accumulative energy suddenly released in Yingxiu town of the Longmenshan region, and Wenchuan Ms8.0 earthquake occurred.

  2. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Directory of Open Access Journals (Sweden)

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  3. Making nuclear 'normal'

    International Nuclear Information System (INIS)

    The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

  4. [Merkel cell skin carcinoma].

    Science.gov (United States)

    Krejcí, K; Zadrazil, J; Tichý, T; Horák, P; Ciferská, H; Hodulová, M; Zezulová, M; Zlevorová, M

    2010-01-01

    Merkel cell carcinoma is a rare tumour of the skin. It affects predominantly elderly Caucasian males on sun-exposed areas of the skin. Distinctively more frequent and at significantly lower age, its incidence is higher in immunocompromised patients. In these patients we often observe the highly aggressive course of Merkel cell carcinoma and a fatal outcome. The incidence of Merkel cell carcinoma has been rising in recent years and is more dramatic than the increased incidence of cutaneous melanoma. More than one-third of Merkel cell carcinoma patients will die from this cancer, making it twice as lethal as melanoma. The malignant transformation of Merkel cells is currently thought to be related to an infection with Merkel cell polyomavirus. In the early stage the discreet clinical picture may be contrary to extensive microscopic invasion and this seemingly benign appearance can delay diagnosis or increase the risk of insufficient tumour excision. The diagnosis is definitely confirmed by histological evaluation and immunohistochemical tests. A typical feature is the tendency of Merkel cell carcinoma to frequent local recurrence and early metastasizing into regional lymph nodes with subsequent tumour generalization. The mainstay of therapy is radical excision of the tumour and adjuvant radiotherapy targeted at the site of primary incidence and local draining lymph nodes. The efficacy of different chemotherapy protocols in Merkel cell carcinoma is limited and the median survival rate is measured in months. In the future, prophylaxis with vaccination against Merkel cell polyomavirus will hopefully be possible in high-risk patients, as well as therapeutic usage of antisense oligonucleotides or microRNAs, eventually complete Merkel cell carcinoma elimination by affecting the tumour suppressor gene Atonal homolog 1 expression. The staging of the tumour at time of diagnosis is the most important prognostic factor. In this respect, the importance of preventative skin

  5. Epidemiology of skin cancer.

    Science.gov (United States)

    Leiter, Ulrike; Eigentler, Thomas; Garbe, Claus

    2014-01-01

    Melanoma and nonmelanoma skin cancer (NMSC) are now the most common types of cancer in white populations. Both tumor entities show an increasing incidence rate worldwide but a stable or decreasing mortality rate. NMSC is the most common cancer in white-skinned individuals with a worldwide increasing incidence. NMSC is an increasing problem for health care services worldwide which causes significant morbidity. The rising incidence rates of NMSC are probably caused by a combination of increased exposure to ultraviolet (UV) or sun light, increased outdoor activities, changes in clothing style, increased longevity, ozone depletion, genetics and in some cases, immune suppression. An intensive UV exposure in childhood and adolescence was causative for the development of basal cell carcinoma (BCC) whereas for the etiology of SCC a chronic UV exposure in the earlier decades was accused. Cutaneous melanoma is the most rapidly increasing cancer in white populations, in the last 3 decades incidence rates have risen up to 5-fold. In 2008 melanoma was on place 5 in women and on place 8 in men of the most common solid tumor entities in Germany. The frequency of its occurrence is closely associated with the constitutive color of the skin, and the geographical zone. Changes in outdoor activities and exposure to sunlight during the past 50 years are an important factor for the increasing incidence of melanoma. Mortality rates of melanoma show a stabilization in the USA, Australia and also in European countries. In contrast to SCC, melanoma risk seems to be associated with an intermittent exposure to sunlight. Prevention campaigns aim on reducing incidence and achieving earlier diagnosis, which resulted in an ongoing trend toward thin melanoma since the last two decades. However, the impact of primary prevention measures on incidence rates of melanoma is unlikely to be seen in the near future, rather increasing incidence rates to 40-50/100,000 inhabitants/year should be expected in

  6. Shedding skin and tears.

    Science.gov (United States)

    Hammlerschlag, Carl A

    2007-06-01

    I am a purported expert in change and personal growth; that's the work I do with patients, and what I lecture and write about. I say that growth has nothing to do with adding on; it's always about letting go. Alas, it's always easier to tell others how to welcome shedding their skins than it is for me to do it myself. Letting go of the old and familiar is a necessary prerequisite for growth, but it's hard to do because no matter how much we may know, we have to move on. It always makes us feel vulnerable, which can inspire fear.

  7. Wnt inhibitory factor (WIF)-1 promotes melanogenesis in normal human melanocytes.

    Science.gov (United States)

    Park, Tae Jun; Kim, Misun; Kim, Hyeran; Park, Sun Yi; Park, Kyoung-Chan; Ortonne, Jean-Paul; Kang, Hee Young

    2014-01-01

    Wnt signaling plays a role in the differentiation as well as the development of melanocytes. Using a microarray analysis, hyperpigmentary skin of melasma expressed high levels of Wnt inhibitory factor-1 (WIF-1) compared with perilesional normal skin. In this study, the expression and functional roles of WIF-1 on melanocytes were investigated. WIF-1 was expressed both in the melanocytes of normal human skin and in cultured melanocytes. The upregulation of WIF-1 on cultured normal human melanocytes significantly induced expressions of MITF and tyrosinase, which were associated with increased melanin content and tyrosinase activity. Consistent with the stimulatory effect of WIF-1, WIF-1 siRNA reduced melanogenesis in the cells. Moreover, WIF-1 increases pigmentation in melanocytes co-cultured with WIF-1-overexpressed fibroblasts and of organ-cultured human skin. These findings suggest that melanocytes express WIF-1 constitutively in vivo and in vitro and that WIF-1 promotes melanogenesis in normal human melanocytes. PMID:24131586

  8. Shared values and normality

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wen-hua; PANG Xue-cheng

    2006-01-01

    This paper investigates the relationship between the normality and the shared values for a meromorphic function on the unit disc △.Based on Marty's normality criterion and through a detailed analysis of the meromorphic functions,it is shown that if for every f∈F,f and f(k) share a and b on △ and the zeros of f(z)-a are of multiplicity k≥3,then F is normal on △,where F is a family of meromorphic functions on the unit disc △,and a and b are distinct values.

  9. Normality in Analytical Psychology

    OpenAIRE

    Steve Myers(CERN)

    2013-01-01

    Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by c...

  10. Normalizers of Irreducible Subfactors

    OpenAIRE

    Smith, Roger R.; White, Stuart A.; Wiggins, Alan D.

    2007-01-01

    We consider normalizers of an irreducible inclusion $N\\subseteq M$ of $\\mathrm{II}_1$ factors. In the infinite index setting an inclusion $uNu^*\\subseteq N$ can be strict, forcing us to also investigate the semigroup of one-sided normalizers. We relate these normalizers of $N$ in $M$ to projections in the basic construction and show that every trace one projection in the relative commutant $N'\\cap $ is of the form $u^*e_Nu$ for some unitary $u\\in M$ with $uNu^*\\subseteq N$. This enabl...

  11. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available BACKGROUND: Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test. METHODS: COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography. RESULTS: Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears. CONCLUSIONS: In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  12. Pathophysiological Study of Sensitive Skin.

    Science.gov (United States)

    Buhé, Virginie; Vié, Katell; Guéré, Christelle; Natalizio, Audrey; Lhéritier, Céline; Le Gall-Ianotto, Christelle; Huet, Flavien; Talagas, Matthieu; Lebonvallet, Nicolas; Marcorelles, Pascale; Carré, Jean-Luc; Misery, Laurent

    2016-03-01

    Sensitive skin is a clinical syndrome characterized by the occurrence of unpleasant sensations, such as pruritus, burning or pain, in response to various factors, including skincare products, water, cold, heat, or other physical and/or chemical factors. Although these symptoms suggest inflammation and the activation of peripheral innervation, the pathophysiogeny of sensitive skin remains unknown. We systematically analysed cutaneous biopsies from 50 healthy women with non-sensitive or sensitive skin and demonstrated that the intraepidermal nerve fibre density, especially that of peptidergic C-fibres, was lower in the sensitive skin group. These fibres are involved in pain, itching and temperature perception, and their degeneration may promote allodynia and similar symptoms. These results suggest that the pathophysiology of skin sensitivity resembles that of neuropathic pruritus within the context of small fibre neuropathy, and that environmental factors may alter skin innervation.

  13. Pathophysiological Study of Sensitive Skin.

    Science.gov (United States)

    Buhé, Virginie; Vié, Katell; Guéré, Christelle; Natalizio, Audrey; Lhéritier, Céline; Le Gall-Ianotto, Christelle; Huet, Flavien; Talagas, Matthieu; Lebonvallet, Nicolas; Marcorelles, Pascale; Carré, Jean-Luc; Misery, Laurent

    2016-03-01

    Sensitive skin is a clinical syndrome characterized by the occurrence of unpleasant sensations, such as pruritus, burning or pain, in response to various factors, including skincare products, water, cold, heat, or other physical and/or chemical factors. Although these symptoms suggest inflammation and the activation of peripheral innervation, the pathophysiogeny of sensitive skin remains unknown. We systematically analysed cutaneous biopsies from 50 healthy women with non-sensitive or sensitive skin and demonstrated that the intraepidermal nerve fibre density, especially that of peptidergic C-fibres, was lower in the sensitive skin group. These fibres are involved in pain, itching and temperature perception, and their degeneration may promote allodynia and similar symptoms. These results suggest that the pathophysiology of skin sensitivity resembles that of neuropathic pruritus within the context of small fibre neuropathy, and that environmental factors may alter skin innervation. PMID:26337000

  14. Targeted Therapy in Nonmelanoma Skin Cancers

    Directory of Open Access Journals (Sweden)

    Giulia Spallone

    2011-05-01

    Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  15. Optical mapping of nonmelanoma skin cancer

    Science.gov (United States)

    Yaroslavsky, Anna N.; Neel, Victor; Anderson, Richard R.

    2004-07-01

    More than two million cases of nonmelanoma skin cancers are diagnosed every year. Therefore, there is a strong need for practical, reliable, rapid, and precise methods for tumor delineation, to guide surgery and other treatments of skin cancer. Once developed, such methods may be useful for squamous cell carcinomas of other organs. Non-invasive optical imaging techniques including polarization sensitive reflectance and fluorescence imaging were evaluated for the demarcation of nonmelanoma skin tumors. Thick freshly excised tumor specimens obtained from Mohs surgery were used for the experiments. Imaging was performed using linearly polarized incident light in the visible and near infrared spectral range from 577 nm to 750 nm. Non-toxic absorbing and fluorescent dyes (Toluidine Blue O, Methylene Blue) were employed to enhance tumor contrast in the images. The images were acquired using the remitted light polarized in the directions parallel and perpendicular to the polarization of incident light. Reflectance and fluorescence polarization images were evaluated. The data were processed and analyzed for dependence of the remitted light polarization on the tissue type (cancerous/normal). The data obtained so far from fresh tumor specimens in vitro using dye-enhanced polarized light reflectance, and exogenous fluorescence polarization imaging suggest that optical mapping can become a valuable guidance tool in nonmelanoma cancer surgery.

  16. Targeted Therapy in Nonmelanoma Skin Cancers

    Energy Technology Data Exchange (ETDEWEB)

    Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio, E-mail: antonio.costanzo@uniroma2.it [Department of Dermatology, University of Rome “Tor Vergata”, Via Montpellier 1, 00199, Rome (Italy)

    2011-05-03

    Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  17. Normal Child Behavior

    Science.gov (United States)

    ... in Action Medical Editor & Editorial Advisory Board Sponsors Sponsorship Opporunities Spread the Word Shop AAP Find a ... is "normal" depends upon the child's level of development, which can vary greatly among children of the ...

  18. The amazing normal forces

    CERN Document Server

    Petrache, Horia I

    2012-01-01

    This manuscript is written for students in introductory physics classes to address some of the common difficulties and misconceptions of the normal force, especially the relationship between normal and friction forces. Accordingly, it is intentionally informal and conversational in tone to teach students how to build an intuition to complement mathematical formalism. This is accomplished by beginning with common and everyday experience and then guiding students toward two realizations: (i) That real objects are deformable even when deformations are not easily visible, and (ii) that the relation between friction and normal forces follows from the action-reaction principle. The traditional formulae under static and kinetic conditions are then analyzed to show that peculiarity of the normal-friction relationship follows readily from observations and knowledge of physics principles.

  19. Normality in analytical psychology.

    Science.gov (United States)

    Myers, Steve

    2013-12-01

    Although C.G. Jung's interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault's criticism, had Foucault chosen to review Jung's work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault's own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung's disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity.

  20. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  1. Normal pressure hydrocephalus

    Science.gov (United States)

    Hydrocephalus - occult; Hydrocephalus - idiopathic; Hydrocephalus - adult; Hydrocephalus - communicating; Dementia - hydrocephalus; NPH ... Ferri FF. Normal pressure hydrocephalus. In: Ferri FF, ed. ... Elsevier; 2016:chap 648. Rosenberg GA. Brain edema and disorders ...

  2. Neutron Skins and Neutron Stars

    OpenAIRE

    Piekarewicz, J

    2013-01-01

    The neutron-skin thickness of heavy nuclei provides a fundamental link to the equation of state of neutron-rich matter, and hence to the properties of neutron stars. The Lead Radius Experiment ("PREX") at Jefferson Laboratory has recently provided the first model-independence evidence on the existence of a neutron-rich skin in 208Pb. In this contribution we examine how the increased accuracy in the determination of neutron skins expected from the commissioning of intense polarized electron be...

  3. Skin Infections Due to Corynebacterium

    OpenAIRE

    Meltem Türkmen; Derya Aytimur

    2010-01-01

    Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen mor...

  4. Protecting the skin during thyroidectomy

    Directory of Open Access Journals (Sweden)

    Renan Bezerra Lira

    2014-01-01

    Full Text Available In this note we describe the standard technical maneuver used in our department to protect the skin during thyroidectomy in order to get the best aesthetic result. We use surgical gloves to protect the skin during these operations to reduce the negative impact of thermal trauma and mechanical retractors and energy delivery devices at the edges of the skin incised. This practice is effective, inexpensive, rapid, reproducible and showed no complication in our experience of over 2,500 thyroidectomies.

  5. [Radiotherapy of skin cancers].

    Science.gov (United States)

    Hennequin, C; Rio, E; Mahé, M-A

    2016-09-01

    The indications of radiotherapy for skin cancers are not clearly defined because of the lack of randomised trials or prospective studies. For basal cell carcinomas, radiotherapy frequently offers a good local control, but a randomized trial showed that surgery is more efficient and less toxic. Indications of radiotherapy are contra-indications of surgery for patients older than 60, non-sclerodermiform histology and occurring in non-sensitive areas. Adjuvant radiotherapy could be proposed to squamous cell carcinomas, in case of poor prognostic factors. Dose of 60 to 70Gy are usually required, and must be modulated to the size of the lesions. Adjuvant radiotherapy seems beneficial for desmoplastic melanomas but not for the other histological types. Prophylactic nodal irradiation (45 to 50Gy), for locally advanced tumours (massive nodal involvement), decreases the locoregional failure rate but do not increase survival. Adjuvant radiotherapy (50 to 56Gy) for Merckel cell carcinomas increases also the local control rate, as demonstrated by meta-analysis and a large epidemiological study. Nodal areas must be included, if there is no surgical exploration (sentinel lymph node dissection). Kaposi sarcomas are radiosensitive and could be treated with relatively low doses (24 to 30Gy). Also, cutaneous lymphomas are good indications for radiotherapy: B lymphomas are electively treated with limited fields. The role of total skin electron therapy for T-lymphomas is still discussed; but palliative radiotherapy is very efficient in case of cutaneous nodules. PMID:27522189

  6. Normalized information distance

    OpenAIRE

    Vitányi, P.M.B.; Balbach, F.J.; Cilibrasi, R.L.; M. Li

    2008-01-01

    The normalized information distance is a universal distance measure for objects of all kinds. It is based on Kolmogorov complexity and thus uncomputable, but there are ways to utilize it. First, compression algorithms can be used to approximate the Kolmogorov complexity if the objects have a string representation. Second, for names and abstract concepts, page count statistics from the World Wide Web can be used. These practical realizations of the normalized information distance can then be a...

  7. SKIN KINETICS AND DERMAL CLEARANCE

    Directory of Open Access Journals (Sweden)

    Prakash Shashi

    2012-08-01

    Full Text Available Availability of several therapeutic and cosmetic formulations for topical application has made the research on skin kinetics as a topic of current interest. Topical formulations are typically meant for local effect although there is always a chance that the low molecular weight chemicals are easily transported across the skin layer and make it available in the systemic circulation. Thus there is a major concern about the transport of chemical moieties following the topical application of cosmetics and therapeutic formulations and the real time measurement of the molecules in the skin layer has become obligatory. It is well known that the properties of both drug and the excipients have identical role in determining the skin permeability of chemical moieties. In the last decade several investigations have been carried out in this filed using several in vitro and in vivo models. This review provides a brief account on the basics of skin kinetics, parameters assessed, various techniques and methods adapted in skin kinetic studies. Moreover, we have also discussed about the micro-environment inside the skin layer and the possible mechanism of drug depot formation, skin metabolism and clearance of molecules from the skin layers.

  8. Skin Infections Due to Corynebacterium

    Directory of Open Access Journals (Sweden)

    Meltem Türkmen

    2010-03-01

    Full Text Available Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen more frequently, they usually mistaken for a mycotic infection by general practitioners, with subsequent antimycotic treatment. Here skin diseases compromised with Corynebacterium are presented with their demographic features and discussed on the basis of a literature review.

  9. The future of skin metagenomics.

    Science.gov (United States)

    Mathieu, Alban; Vogel, Timothy M; Simonet, Pascal

    2014-01-01

    Metagenomics, the direct exploitation of environmental microbial DNA, is complementary to traditional culture-based approaches for deciphering taxonomic and functional microbial diversity in a plethora of ecosystems, including those related to the human body such as the mouth, saliva, teeth, gut or skin. DNA extracted from human skin analyzed by sequencing the PCR-amplified rrs gene has already revealed the taxonomic diversity of microbial communities colonizing the human skin ("skin microbiome"). Each individual possesses his/her own skin microbial community structure, with marked taxonomic differences between different parts of the body and temporal evolution depending on physical and chemical conditions (sweat, washing etc.). However, technical limitations due to the low bacterial density at the surface of the human skin or contamination by human DNA still has inhibited extended use of the metagenomic approach for investigating the skin microbiome at a functional level. These difficulties have been overcome in part by the new generation of sequencing platforms that now provide sequences describing the genes and functions carried out by skin bacteria. These methodological advances should help us understand the mechanisms by which these microorganisms adapt to the specific chemical composition of each skin and thereby lead to a better understanding of bacteria/human host interdependence. This knowledge will pave the way for more systemic and individualized pharmaceutical and cosmetic applications.

  10. HOX genes in the skin

    Institute of Scientific and Technical Information of China (English)

    YANG Mei; LI Qing-feng; ZHANG Feng

    2010-01-01

    @@ Deep skin wounds heal by scar formation with a loss of its original appearance, structure and function.However, when the same damage occurs to the skin of an early gestational fetus, complete regeneration can be observed. Despite significant research in the field of skin regeneration, many mysteries remain, such as the loss of wound healing ability with maturity, the differences in healing at different parts of the body, and the presence of hypertrophic scars and keloids in some races but not in others. The finding of HOX genes in the skin provides new explanations to these conundrums.

  11. Infrared sensing based sensitive skin

    Institute of Scientific and Technical Information of China (English)

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  12. DA 5505: a novel topical formulation of terbinafine that enhances skin penetration and retention.

    Science.gov (United States)

    Thapa, Raj Kumar; Han, Sang-Duk; Park, Hyoung Geun; Son, Miwon; Jun, Joon Ho; Kim, Jong Oh

    2015-01-01

    Topical fungal infections can become severe if left untreated. Efficient treatment modalities for topical fungal infections aid the penetration of antifungal agents deep into viable skin layers. Terbinafine is a fungicidal agent that inhibits ergosterol, an essential fungal component. The main objective of this study was to evaluate skin permeation and retention of a terbinafine-loaded solution containing chitosan as a film former. Comparative assessment of skin permeation and retention was performed using a prepared formulation (DA 5505) and marketed formulations of terbinafine in murine and porcine skin. To mimic fungal infection of skin, keratinized skin was induced in NC/Nga mice. In comparison with the marketed formulations, DA 5505 exhibited significantly better skin permeation. The flux, permeation coefficient, and enhancement ratio of terbinafine were remarkably increased by DA 5505 in comparison with the marketed formulations, and lag time was dramatically reduced. DA 5505 significantly increased cumulative terbinafine retention in viable skin layers in comparison with the marketed solution, suggesting enhanced efficacy. Furthermore, DA 5505 exhibited superior skin permeation in normal skin and keratinized skin. Thus, the DA 5505 formulation has the potential to effectively deliver terbinafine to superficial and deep cutaneous fungal infections.

  13. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Directory of Open Access Journals (Sweden)

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  14. Analysis of blasting damage in adjacent mining excavations

    Directory of Open Access Journals (Sweden)

    Nick Yugo

    2015-06-01

    Full Text Available Following a small-scale wedge failure at Yukon Zinc's Wolverine Mine in Yukon, Canada, a vibration monitoring program was added to the existing rockbolt pull testing regime. The failure in the 1150 drift occurred after numerous successive blasts in an adjacent tunnel had loosened friction bolts passing through an unmapped fault. Analysis of blasting vibration revealed that support integrity is not compromised unless there is a geological structure to act as a failure plane. The peak particle velocity (PPV rarely exceeded 250 mm/s with a frequency larger than 50 Hz. As expected, blasting more competent rock resulted in higher PPVs. In such cases, reducing the round length from 3.5 m to 2.0 m was an effective means of limiting potential rock mass and support damage.

  15. Configuration optimization of dampers for adjacent buildings under seismic excitations

    Science.gov (United States)

    Bigdeli, Kasra; Hare, Warren; Tesfamariam, Solomon

    2012-12-01

    Passive coupling of adjacent structures is known to be an effective method to reduce undesirable vibrations and structural pounding effects. Past results have shown that reducing the number of dampers can considerably decrease the cost of implementation and does not significantly decrease the efficiency of the system. The main objective of this study was to find the optimal arrangement of a limited number of dampers to minimize interstorey drift. Five approaches to solving the resulting bi-level optimization problem are introduced and examined (exhaustive search, inserting dampers, inserting floors, locations of maximum relative velocity and a genetic algorithm) and the numerical efficiency of each method is examined. The results reveal that the inserting damper method is the most efficient and reliable method, particularly for tall structures. It was also found that increasing the number of dampers does not necessarily increase the efficiency of the system. In fact, increasing the number of dampers can exacerbate the dynamic response of the system.

  16. Acyclic 6-choosability of planar graphs without adjacent short cycles

    Institute of Scientific and Technical Information of China (English)

    WANG WeiFan; ZHANG Ge; CHEN Min

    2014-01-01

    A proper vertex coloring of a graph G is acyclic if G contains no bicolored cycles.Given a list assignment L={L(v)|v∈V}of G,we say that G is acyclically L-colorable if there exists a proper acyclic coloringπof G such thatπ(v)∈L(v)for all v∈V.If G is acyclically L-colorable for any list assignment L with|L(v)|k for all v∈V(G),then G is acyclically k-choosable.In this paper,we prove that every planar graph G is acyclically 6-choosable if G does not contain 4-cycles adjacent to i-cycles for each i∈{3,4,5,6}.This improves the result by Wang and Chen(2009).

  17. Soil Structure Interaction between Two Adjacent Buildings under Earthquake Load

    Directory of Open Access Journals (Sweden)

    Mahmoud Yahyai

    2008-01-01

    Full Text Available In some cases, tall buildings are located in geotechnically unsuitable places, due to their high ratio of height to width; there is risk of uplift and other effects such as overturning and reduction structure serviceability during earthquake. This research is aimed to evaluate the effect of Soil-Structure Interaction (SSI on seismic behavior of two adjacent 32 story buildings such as time period, base shear and displacements. The interaction effects are investigated for variable distance between the two buildings. Three types of soil such as soft clay, sandy gravel and compacted sandy gravel are considered for this study. The result obtained that the interaction effect increases time period of both buildings base shear and lateral displacement of the structures increases.

  18. Classical Hodgkin Lymphoma Arising Adjacent to a Breast Implant.

    Science.gov (United States)

    Ryan, Ciara; Ged, Yasser; Quinn, Fiona; Walker, Jan; Kennedy, John; Gillham, Charles; Pittaluga, Stefania; McDermott, Ronan; Vandenberghe, Elisabeth; Grant, Cliona; Flavin, Richard

    2016-08-01

    Breast implant-associated lymphoma has recently gained wide recognition. Anaplastic large cell lymphoma (ALCL) is the most frequently diagnosed subtype in this setting but the spectrum is broadening. A 66-year-old woman developed swelling and itch around her saline implant 6 years after its insertion. Imaging revealed a fluid collection surrounding the implant with an adjacent mass. Microscopy showed sclerotic tissue punctuated by discrete cellular nodules comprising small lymphocytes, eosinophils and interspersed large atypical Hodgkin Reed-Sternberg (HRS)-like cells. The HRS-like cells stained positively for CD30 and CD15 by immunohistochemistry. Small T-lymphocytes formed rosettes around HRS-like cells. Appearances were consistent with classical Hodgkin lymphoma (HL). Multiplex polymerase chain reaction demonstrated no clonal rearrangements of immunoglobulin or T-cell receptor genes, however, a t(14;18)(q32;q21)BCL2-JH translocation involving the major breakpoint region of the bcl2 gene was present. Staging positron emission tomography-computed tomography scan revealed FDG-avid masses in the right axilla and pelvis. Subsequent pathological examination identified low-grade follicular lymphoma (FL) with a t(14;18) translocation at these sites. To our knowledge, this is the first case of HL arising adjacent to a breast implant. An awareness of this diagnosis is important as classical HL, with its prominent mixed inflammatory background, may be overlooked as a reactive process when histologically assessing capsulectomy specimens. It is also important in the differential diagnosis for implant-associated ALCL as both contain large atypical CD30-positive cells highlighting the need for full immunohistochemical and molecular workup in such cases. This case also adds to the large body of literature regarding the association between HL and FL. PMID:26888955

  19. Adjacent Vertex Distinguishing Incidence Coloring of the Cartesian Product of Some Graphs

    Institute of Scientific and Technical Information of China (English)

    Qian WANG; Shuang Liang TIAN

    2011-01-01

    An adjacent vertex distinguishing incidence coloring of graph G is an incidence coloring of G such that no pair of adjacent vertices meets the same set of colors. We obtain the adjacent vertex distinguishing incidence chromatic number of the Cartesian product of a path and a path, a path and a wheel, a path and a fan, and a path and a star.

  20. Functioning of catfish electroreceptors: Influence of calcium and sodium concentration on the skin potential

    OpenAIRE

    Schouten, V.J.A.; Bretschneider, F.

    1980-01-01

    1. 1. The skin potential of catfish was measured in order to test the hypothesis that it controls electroreceptor sensitivity. 2. 2. The skin potential depends on the “milieu extérieur” in the same way as reported lor goldfish (Fig. 2). 3. 3. The variation of the skin potential is very large compared with the normal stimulus range of electroreceptors. 4. 4. Calcium strongly influences the skin potential, but the latter “adapts” to calcium concentrations of 0.3-3.0 mM (Fig. 3). 5. 5. Ion-depen...

  1. The Nemean Lion’s Skin in Athenian Art1 (Pl. ΧI-XVII)

    OpenAIRE

    Cohen, Beth

    2013-01-01

    Herakles’ lion skin, was by no means a gift from the gods; the young hero produced it with his own hands – supposedly resourcefully skinning the corpse of the invulnerable Nemean lion with its own claws, after strangling the beast to death in his first labor. Although in daily life skinning an animal may normally have required two men, on an Athenian black-figure cup in Munich the young hero toils alone to skin the dead cat, which lies belly up with its tail tied to a tree. Save for this late...

  2. Skin temperature during sunbathing--relevance for skin cancer

    DEFF Research Database (Denmark)

    Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian

    2014-01-01

    volunteers over 6 days' sun holiday in Egypt. Temperatures were measured with an infrared thermometer gun at 8 skin sites on the volunteers while they were indoors in the morning and when sunbathing during the day. Skin temperatures were higher during sunbathing (33.5 °C ± 2.1 °C) (mean ± SD) than when...

  3. Flexible and fragmentable tandem photosensitive nanocrystal skins

    Science.gov (United States)

    Akhavan, S.; Uran, C.; Bozok, B.; Gungor, K.; Kelestemur, Y.; Lesnyak, V.; Gaponik, N.; Eychmüller, A.; Demir, H. V.

    2016-02-01

    We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion.We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of

  4. The effects of mucopolysaccharide polysulphate on hydration and elasticity of human skin.

    Science.gov (United States)

    Wanitphakdeedecha, Rungsima; Eimpunth, Sasima; Manuskiatti, Woraphong

    2011-01-01

    Background. Mucopolysaccharide polysulphate (MPS) has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS) completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P = 0.47). Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P = 0.01). Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P < 0.01, and MPS, P < 0.01). However, no significant

  5. The Effects of Mucopolysaccharide Polysulphate on Hydration and Elasticity of Human Skin

    Directory of Open Access Journals (Sweden)

    Rungsima Wanitphakdeedecha

    2011-01-01

    Full Text Available Background. Mucopolysaccharide polysulphate (MPS has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30–45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30–45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P=0.47. Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P=0.01. Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P<0.01, and MPS, P<0.01. However, no

  6. Expression of Apoptosis Related Protein in Skin Lesions of Lichen Planus and Its Implication

    Institute of Scientific and Technical Information of China (English)

    Xu'e CHEN; Yan WU; Jiawen LI; Zhixiang LIU; Qing YUE; Houjun LIU

    2008-01-01

    In order to investigate the role of Caspase-3 and Bax in the pathogenesis of lichen planus, immunohistochemistry was used to detect the expression of Caspase-3 and Bax in skin lesions of the patients with lichen planus and skin tissues of normal subjects. The results showed that positive rate of Caspase-3 and Bax expression in lichen planus were significantly higher than that in normal skins (both P<0.05). Meanwhile, there was a obvious correlation between the increase of Caspase-3 and that of Bax in lichen planus. The expression of Caspase-3 and Bax might play an important role in the development of lichen planus.

  7. Imaging-guided two-photon excitation-emission-matrix measurements of human skin tissues

    Science.gov (United States)

    Yu, Yingqiu; Lee, Anthony M. D.; Wang, Hequn; Tang, Shuo; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

    2012-07-01

    There are increased interests on using multiphoton imaging and spectroscopy for skin tissue characterization and diagnosis. However, most studies have been done with just a few excitation wavelengths. Our objective is to perform a systematic study of the two-photon fluorescence (TPF) properties of skin fluorophores, normal skin, and diseased skin tissues. A nonlinear excitation-emission-matrix (EEM) spectroscopy system with multiphoton imaging guidance was constructed. A tunable femtosecond laser was used to vary excitation wavelengths from 730 to 920 nm for EEM data acquisition. EEM measurements were performed on excised fresh normal skin tissues, seborrheic keratosis tissue samples, and skin fluorophores including: NADH, FAD, keratin, melanin, collagen, and elastin. We found that in the stratum corneum and upper epidermis of normal skin, the cells have large sizes and the TPF originates from keratin. In the lower epidermis, cells are smaller and TPF is dominated by NADH contributions. In the dermis, TPF is dominated by elastin components. The depth resolved EEM measurements also demonstrated that keratin structure has intruded into the middle sublayers of the epidermal part of the seborrheic keratosis lesion. These results suggest that the imaging guided TPF EEM spectroscopy provides useful information for the development of multiphoton clinical devices for skin disease diagnosis.

  8. The thyroid hormone receptors modulate the skin response to retinoids.

    Directory of Open Access Journals (Sweden)

    Laura García-Serrano

    Full Text Available BACKGROUND: Retinoids play an important role in skin homeostasis and when administered topically cause skin hyperplasia, abnormal epidermal differentiation and inflammation. Thyroidal status in humans also influences skin morphology and function and we have recently shown that the thyroid hormone receptors (TRs are required for a normal proliferative response to 12-O-tetradecanolyphorbol-13-acetate (TPA in mice. METHODOLOGY/PRINCIPAL FINDINGS: We have compared the epidermal response of mice lacking the thyroid hormone receptor binding isoforms TRα1 and TRβ to retinoids and TPA. Reduced hyperplasia and a decreased number of proliferating cells in the basal layer in response to 9-cis-RA and TPA were found in the epidermis of TR-deficient mice. Nuclear levels of proteins important for cell proliferation were altered, and expression of keratins 5 and 6 was also reduced, concomitantly with the decreased number of epidermal cell layers. In control mice the retinoid (but not TPA induced parakeratosis and diminished expression of keratin 10 and loricrin, markers of early and terminal epidermal differentiation, respectively. This reduction was more accentuated in the TR deficient animals, whereas they did not present parakeratosis. Therefore, TRs modulate both the proliferative response to retinoids and their inhibitory effects on skin differentiation. Reduced proliferation, which was reversed upon thyroxine treatment, was also found in hypothyroid mice, demonstrating that thyroid hormone binding to TRs is required for the normal response to retinoids. In addition, the mRNA levels of the pro-inflammatory cytokines TNFα and IL-6 and the chemotactic proteins S1008A and S1008B were significantly elevated in the skin of TR knock-out mice after TPA or 9-cis-RA treatment and immune cell infiltration was also enhanced. CONCLUSIONS/SIGNIFICANCE: Since retinoids are commonly used for the treatment of skin disorders, these results demonstrating that TRs

  9. Reliability of skin testing as a measure of nutritional state

    International Nuclear Information System (INIS)

    The reliability of skin testing to assess the nutritional state was evaluated in 257 patients who received total parenteral nutrition (TPN). The nutritional state was assessed by determining body composition, by multiple-isotope dilution. Immunocompetence was simultaneously evaluated by skin testing with five recall antigens. These measurements were carried out before and at two-week intervals during TPN. A statistically significant relationship existed between the response to skin testing and the nutritional state. A body composition consistent with malnutrition was present in the anergic patients, while body composition was normal in the patients who reacted normally to skin testing. However, a considerable overlap existed as 43% of the reactive patients were malnourished, and 21% of the anergic patients were normally nourished. Thirty-seven (43%) of the 86 anergic patients converted and became reactive during TPN, and their body composition improved significantly. The remaining 49 anergic patients (57%) did not convert, and their body composition did not change despite similar nutritional support. The principal difference between the two groups of anergic patients was the nature of the therapy administered. In the anergic patients who converted, therapy was aggressive and appropriate, and clinical improvement occurred in 23 (62.2%) of the patients, with a mortality of 5.4%. In the 49 patients who remained anergic, therapy was often inappropriate or unsuccessful, with clinical improvement in only three (6.1%) of the patients and a mortality of 42.8%. The data demonstrated a significant relationship between the response to skin testing and the nutritional state. However, because of the wide overlap, skin testing does not accurately assess a person's nutritional state. The persistence of the anergic state is indicative of a lack of response to therapy

  10. Pygmies, Giants, and Skins

    Science.gov (United States)

    Piekarewicz, J.

    2013-03-01

    Understanding the equation of state (EOS) of neutron-rich matter is a central goal of nuclear physics that cuts across a variety of disciplines. Indeed, the limits of nuclear existence, the collision of energetic heavy ions, the structure of neutron stars, and the dynamics of core-collapse supernova all depend critically on the nuclear-matter EOS. In this contribution I focus on the EOS of cold baryonic matter with special emphasis on its impact on the structure, dynamics, and composition of neutron stars. In particular, I discuss how laboratory experiments on neutron skins as well as on Pygmy and Giant resonances can help us elucidate the structure of these fascinating objects.

  11. Pygmies, Giants, and Skins

    CERN Document Server

    Piekarewicz, J

    2012-01-01

    Understanding the equation of state (EOS) of neutron-rich matter is a central goal of nuclear physics that cuts across a variety of disciplines. Indeed, the limits of nuclear existence, the collision of energetic heavy ions, the structure of neutron stars, and the dynamics of core-collapse supernova all depend critically on the nuclear-matter EOS. In this contribution I focus on the EOS of cold baryonic matter with special emphasis on its impact on the structure, dynamics, and composition of neutron stars. In particular, I discuss how laboratory experiments on neutron skins as well as on Pygmy and Giant resonances can help us elucidate the structure of these fascinating objects.

  12. Double-Skin Facade

    DEFF Research Database (Denmark)

    Kalyanova, Olena

    difficulties experienced by scientists when attempting to model DSF thermal and energy performance were examined. In addition, the lack of experimental studies and empirical validation of models was realized, many numerical models have not been empirically validated and most of them require an expert knowledge...... to perform the simulations. To fill in the gap of lacking experimental data a range of measurements was carried out in an outdoor, double-skin façade full-scale test facility ‘The Cube'. As a result, three complete sets of experimental data were composed. These are available for external air curtain......, transparent insulation and preheating operation modes of DSF cavity. The data sets include measurements of naturally induced air flow, temperature gradients, velocity profiles, climate data, etc. Two data sets were used for further empirical validation of building simulation software for DSF modelling within...

  13. State of hydration and electrical conductance of ichthyotic skin

    Directory of Open Access Journals (Sweden)

    Gupta A

    1990-01-01

    Full Text Available Dry skin of twelve subjects suffering from ichthyosis vulgaris and the efficacy of a moisturiser-Cotaryl were quantitatively assessed by measuring the skin surface hydration and high frequency (3.5 MHz electrical conductance of skin. The state of hydration and conductance of ichthyotic skin were 86.9 + 24.6 and 11.0 + 5.7 micro-mho respectively, being much less-compared to 132. 0 + 5.3 and 72.5 + 54.0 micro-mho ofnormal subjects. The moisturiser increased the state of hydration and also the electrical conductance of the stratum corneuni to near-normal values and maintained them as long as the application continued. However, both the hydration and the conductance fell sharply within a week of withrawal of the moisturiser. A moisturiser was thus undoubtedly efficacious in ichthyotic skin, but the effect was only temporary. The state of hydration was found, at all stages, to bear a strong positive correlation (r = 0.69 to 0.80 with the skin conductance.

  14. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Directory of Open Access Journals (Sweden)

    Olivia Pucci

    Full Text Available Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen or skin normoxia (with air. The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor.

  15. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Science.gov (United States)

    Pucci, Olivia; Qualls, Clifford; Battisti-Charbonney, Anne; Balaban, Dahlia Y; Fisher, Joe A; Duffin, Jim; Appenzeller, Otto

    2012-01-01

    Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS) function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen) or skin normoxia (with air). The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor. PMID:23056597

  16. Formation mechanism of carbonate cemented zones adjacent to the top overpressured surface in the central Junggar Basin,NW China

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Carbonate cemented zones are normally adjacent to the top overpressured surface in the central Junggar Basin,NW China.Stable carbon and oxygen isotopic compositions and petrological investigations of carbonate cements in the carbonate cemented zones indicate that:(1) carbonate cements are composed dominantly of ferrocalcite,ferroan dolomite,and ankerite;(2) carbonate cements are formed under a high temperature circumstance in the subsurface,and organic fluid migration has an important effect on the formation of them;and(3) carbon and oxygen ions in the carbonate cements migrate from the underlying overpressured system.This suggests that the occurrence of carbonate cemented zones in this region results from multiple phases of organic fluid expulsion out of the overpressure compartment through geological time.This study provides a plausible mechanism of the formation of carbonate cemented zones adjacent to the top overpressured surface in the clastic sedimentary basins,and has an important implication for understanding the internal correlation between the formation of carbonate cemented zones adjacent to top overpressured surface and geofluids expulsion out of overpressured system.

  17. Coronal MRI in the diagnosis of corona radiata infarcts adjacent to the lateral ventricles

    International Nuclear Information System (INIS)

    To clarify pathophysiology of vascular lesions in corona radiata infarcts adjacent to the body of the lateral ventricle (CRILV), 17 patients with CRILV were studied by using magnetic resonance (MR) imaging. Based on the coronal MR images obtained between the anterior and posterior commissures, the patients were divided into two groups: (I) the group having infarcts below a line extending from the upper edge of the insular cistern to the external angle of the lateral ventricle adjacent to the corpus callosum (n=11); and (II) the group having lesions above the line towards the centrum semiovale (n=6). Most of the patients in both groups were male and had hypertension. Symptoms were gradually deteriorated and stroke in the morning was frequent in both groups, althrough the time from onset to completion was longer in Group II than Group I. In comparing clinical manifestations in Groups I and II, pure motor hemiparesis was found in 5 and 3 patients, and sensorimotor stroke in 2 and one patients, respectively. Drowsiness was found in 2 for Group I, while aphasia occurred in 2 for Group II. In addition, pseudobular and asymptomatic palsy occurred in each one patient for Group I. Prognosis was favorable in both groups, except for 2 who died of aspiration pneumonia. In Group I, 11 infarcts were well-defined, less than 15 mm in diameter on CT scans and were sclerotic in the main arteries without obstruction on angiograms. In contrast, Group II had ill-defined, larger low-density areas on CT scans and trunk obstruction of the internal carotid or middle cerebral arteries on angiograms. SPECT scans showed diffuse defect in Group II, in contrast to normal to diffuse or multiple defects in Group I. In Group I, lacunar lesions seemed to be caused by ischemia of the perforators, and in Group II, terminal zone infarcts in the territory of the cortical branches or watershed infarcts seemd to be caused by main trunk obstruction. (N.K.)

  18. Coronal MRI in the diagnosis of corona radiata infarcts adjacent to the lateral ventricles

    Energy Technology Data Exchange (ETDEWEB)

    Iwamoto, Toshihiko; Abe, Shin-e; Kanaya, Kiyoshi; Kubo, Hideki; Takasaki, Masaru (Tokyo Medical Coll. (Japan))

    1992-04-01

    To clarify pathophysiology of vascular lesions in corona radiata infarcts adjacent to the body of the lateral ventricle (CRILV), 17 patients with CRILV were studied by using magnetic resonance (MR) imaging. Based on the coronal MR images obtained between the anterior and posterior commissures, the patients were divided into two groups: (I) the group having infarcts below a line extending from the upper edge of the insular cistern to the external angle of the lateral ventricle adjacent to the corpus callosum (n=11); and (II) the group having lesions above the line towards the centrum semiovale (n=6). Most of the patients in both groups were male and had hypertension. Symptoms were gradually deteriorated and stroke in the morning was frequent in both groups, althrough the time from onset to completion was longer in Group II than Group I. In comparing clinical manifestations in Groups I and II, pure motor hemiparesis was found in 5 and 3 patients, and sensorimotor stroke in 2 and one patients, respectively. Drowsiness was found in 2 for Group I, while aphasia occurred in 2 for Group II. In addition, pseudobular and asymptomatic palsy occurred in each one patient for Group I. Prognosis was favorable in both groups, except for 2 who died of aspiration pneumonia. In Group I, 11 infarcts were well-defined, less than 15 mm in diameter on CT scans and were sclerotic in the main arteries without obstruction on angiograms. In contrast, Group II had ill-defined, larger low-density areas on CT scans and trunk obstruction of the internal carotid or middle cerebral arteries on angiograms. SPECT scans showed diffuse defect in Group II, in contrast to normal to diffuse or multiple defects in Group I. In Group I, lacunar lesions seemed to be caused by ischemia of the perforators, and in Group II, terminal zone infarcts in the territory of the cortical branches or watershed infarcts seemd to be caused by main trunk obstruction. (N.K.).

  19. Evidence for a thick oceanic crust adjacent to the Norwegian Margin

    Science.gov (United States)

    Mutter, John C.; Talwani, Manik; Stoffa, Paul L.

    1984-01-01

    The oceanic crust created during this first few million years of accretion in the Norwegian-Greenland Sea lies at an unusually shallow depth for its age, has a smooth upper surface, and in many places the results of multichannel seismic reflection profiling reveal that its upper layers comprise a remarkable sequence of arcuate, seaward-dipping reflectors. These have been attributed to lava flows generated during a brief period of subaerial seafloor spreading. We describe the results of inversions of digitally recorded sonobuoy measurements and two-ship expanded spread profiles collected over the oceanic crust adjacent to the Norwegian passive margin. We find that the crust of the deep Lofoten Basin is indistinguishable from normal oceanic crust in thickness and structure. Closer to the margin we observe up to a four times expansion in thickness of layers with velocities equal to those of oceanic layer 2, while the layer 3 region retains approximately the same thickness. The area over which the seaward-dipping reflectors can be observed on reflection profiles corresponds to the region of greatest expansion in "Layer 2" thickness. In the very oldest crust immediately adjacent to an escarpment that probably marks the continent-ocean boundary, we see evidence for a low velocity zone overlying an indistinct reflector that may mark the dyke-lava interface in the thick crust. Comparing the structure of the thick crust to that of eastern Iceland, we find a strong resemblance, especially in the expansion in thickness of material with layer 2 velocities. These results support the suggestion that during the earliest stages of spreading extrusive volcanism at the ridge crest was unusually voluminous, building a thick pile of lavas erupted from a subaerial spreading center.

  20. Urostomy - stoma and skin care

    Science.gov (United States)

    ... your skin and kidneys. About your stoma Your stoma is made from the part of your small intestine called the ileum. Your ureter is attached to a small piece of your ileum and pulled through the skin of your abdomen. A stoma is very delicate. A healthy stoma is pinkish- ...

  1. Aging Differences in Ethnic Skin.

    Science.gov (United States)

    Vashi, Neelam A; de Castro Maymone, Mayra Buainain; Kundu, Roopal V

    2016-01-01

    Aging is an inevitable and complex process that can be described clinically as features of wrinkles, sunspots, uneven skin color, and sagging skin. These cutaneous effects are influenced by both intrinsic and extrinsic factors and often are varied based on ethnic origin given underlying structural and functional differences. The authors sought to provide updated information on facets of aging and how it relates to ethnic variation given innate differences in skin structure and function. Publications describing structural and functional principles of ethnic and aging skin were primarily found through a PubMed literature search and supplemented with a review of textbook chapters. The most common signs of skin aging despite skin type are dark spots, loss of elasticity, loss of volume, and rhytides. Skin of color has many characteristics that make its aging process unique. Those of Asian, Hispanic, and African American descent have distinct facial structures. Differences in the concentration of epidermal melanin makes darkly pigmented persons more vulnerable to dyspigmentation, while a thicker and more compact dermis makes facial lines less noticeable. Ethnic skin comprises a large portion of the world population. Therefore, it is important to understand the unique structural and functional differences among ethnicities to adequately treat the signs of aging. PMID:26962390

  2. Dry skin - self-care

    Science.gov (United States)

    ... scrubbing your skin. Shave right after bathing, when hair is soft. Wear soft, comfortable clothing next to your skin. Avoid rough fabrics like wool. Wash clothes with detergents that are free of dyes or fragrances. Drink plenty of water. Ease itchy ...

  3. Air Pollution and the skin

    Directory of Open Access Journals (Sweden)

    Eleni eDrakaki

    2014-05-01

    Full Text Available The increase of air pollution over the years has major effects on the human skin. The skin is exposed to ultraviolet radiation (UVR and environmental air pollutants such as polycyclic aromatic hydrocarbons (PAHs, volatile organic compounds (VOCs, oxides, particulate matter (PM, ozone (O3 and cigarette smoke. Although human skin acts as a biological shield against pro-oxidative chemical and physical air pollutants, the prolonged or repetitive exposure to high levels of these pollutants may have profound negative effects on the skin. Exposure of the skin to air pollutants has been associated with skin aging and inflammatory or allergic skin conditions such as atopic dermatitis, eczema, psoriasis or acne, while skin cancer is among the most serious effects. On the other hand, some air pollutants (ie, ozone, nitrogen dioxide, and sulfur dioxide and scattering particulates (clouds and soot in the troposphere reduce the effects of shorter wavelength UVR and significant reductions in UV irradiance have been observed in polluted urban areas.

  4. Pain-induced skin autoimmunity

    OpenAIRE

    Odoardi, Francesca; Neuhuber, Winfried; Flügel, Alexander

    2014-01-01

    A recent paper published in Nature reports sensory nerve fibers in the skin that give local immune cells important instructions for the organization of an immune response; in this particular case the cooperation between the nervous and immune systems had disastrous consequences, namely an auto-destruction of the skin.

  5. A complex immune response in halo nevi correlates with immune reactivity on infiltrated melanocytes, adjacent hair follicles and blood vessels

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2014-10-01

    Full Text Available Introduction: A clinical “halo nevus” is a benign melanocytic-neoplasm, often exhibiting spontaneous involution. A characteristic clinical feature is depigmentation of the surrounding skin, and a centripetal progression of the tumor regression phenomenon. Case Report: An 18 year old male consulted the dermatologist for changes in color of an asymptomatic mole. Materials and Methods: A clinical evaluation was performed, and skin biopsies were obtained for hematoxylin and eosin (H&E review, and for immunohistochemical (IHC studies including CD3, CD4, CD8, CD20, CD68, CD99, myeloid/histiocyte antigen, S-100, PNL2 and SOX-10. Results: A neoplastic process was identified on H&E examination, located along the dermal/epidermal junction and within the dermis. The neoplasm was composed of nests, cords and strands of benign melanocytes, with infiltrating lymphocytes. IHC staining demonstrated a strong pattern of positivity with all of the IHC antibodies within, infiltrating and surrounding the primary neoplastic process. In addition, evidence of the primary tumor immune response was noted around surrounding blood vessels and hair follicles, and on adjacent epidermal melanocytes. Conclusions: In the present study, we demonstrate by histopathologic and immunologic evidence that lymphocytes are primarily responsible for halo nevus tumor regression. Moreover, the immune response involves not only CD8 positive T lymphocytes, but a larger spectrum of B and T lineage lymphocytes. Thus, the immunologic foundations of halo nevus regression are likely of greater complexity than previously determined..

  6. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    DEFF Research Database (Denmark)

    Pedersen, C; Horn, T; Junge, Jette;

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients with...... AIDS related conditions. Biopsies from 5 asymptomatic HIV positive patients and the 6 control subjects were without ultrastructural alterations. The occurrence of TRI was related to low numbers of CD 4+ lymphocytes. 5/7 patients with TRI had elevated serum interferon activity, and in all of the...

  7. Distribution and degradation of albumin in extensive skin disease

    DEFF Research Database (Denmark)

    Worm, Anne-Marie; Taaning, E; Rossing, N;

    1981-01-01

    The distribution and degradation of albumin were determined in twelve patients with extensive skin disease and in ten control subjects by measuring the metabolic turnover and transcapillary escape of 132 I-labelled albumin. The ratio of intravascular to total mass of albumin was normal. Thus...... in the patients than in the controls (P less than 0.001). It is concluded that the hypoalbuminaemia in these patients is the result of an increased endogenous catabolism of albumin without significant loss via urine, stools or skin. A positive correlation between the transcapillary escape rate and fractional...... catabolic rate of albumin supports the concept of a causal relationship between these parameters....

  8. Basal level of autophagy is increased in aging human skin fibroblasts in vitro, but not in old skin.

    Science.gov (United States)

    Demirovic, Dino; Nizard, Carine; Rattan, Suresh I S

    2015-01-01

    Intracellular autophagy (AP) is a stress response that is enhanced under conditions of limitation of amino acids, growth factors and other nutrients, and also when macromolecules become damaged, aggregated and fibrillated. Aging is generally accompanied by an increase in intracellular stress due to all the above factors. Therefore, we have compared the basal levels of AP in serially passaged human facial skin fibroblasts undergoing aging and replicative senescence in vitro, and ex vivo in the skin biopsies from the photo-protected and photo-exposed area of the arms of 20 healthy persons of young and old ages. Immunofluorescence microscopy, employing antibodies against a specific intracellular microtubule-associated protein-1 light chain-3 (LC3) as a well established marker of AP, showed a 5-fold increase in the basal level of LC3 in near senescent human skin fibroblasts. However, no such age-related increase in LC3 fluorescence and AP could be detected in full thickness skin sections from the biopsies obtained from 10 healthy young (age 25 to 30 yr) and 10 old (age 60 to 65 yr) donors. Furthermore, there was no difference in the basal level of LC3 in the skin sections from photo-protected and photo-exposed areas of the arm. Thus, in normal conditions, the aging phenotype of the skin cells in culture and in the body appears to be different in the case of AP.

  9. Collagen Content in Skin and Internal Organs of the Tight Skin Mouse: An Animal Model of Scleroderma

    Directory of Open Access Journals (Sweden)

    Jayanthi Manne

    2013-01-01

    Full Text Available The Tight Skin mouse is a genetically induced animal model of tissue fibrosis caused by a large in-frame mutation in the gene encoding fibrillin-1 (Fbn-1. We examined the influence of gender on the collagen content of tissues in C57BL/6J wild type (+/+ and mutant Tight Skin (Tsk/+ mice employing hydroxyproline assays. Tissue sections were stained with Masson’s trichrome to identify collagen in situ. Adult Tsk/+ mice skin contains ~15% more collagen, on average, than skin from +/+ mice of the same gender. The heart of Tsk/+ males had significantly more collagen than that of +/+ males. No significant gender differences were found in lungs and kidney collagen content. Overall, the collagen content of Tsk/+ males and +/+ males was higher than that of their Tsk/+ and +/+ female counterparts, respectively. Our data confirm increased deposition of collagen in skin and hearts of Tsk/+ mice; however, the effects of the Tsk mutation on collagen content are both tissue specific and gender specific. These results indicate that comparative studies of collagen content between normal and Tsk/+ mice skin and internal organs must take into account gender differences caused by expression of the androgen receptor.

  10. Hypo-osmotic shock-induced subclinical inflammation of skin in a rat model of disrupted skin barrier function.

    Science.gov (United States)

    Kishi, Chihiro; Minematsu, Takeo; Huang, Lijuan; Mugita, Yuko; Kitamura, Aya; Nakagami, Gojiro; Yamane, Takumi; Yoshida, Mikako; Noguchi, Hiroshi; Funakubo, Megumi; Mori, Taketoshi; Sanada, Hiromi

    2015-03-01

    Aging disrupts skin barrier function and induces xerosis accompanied by pruritus. In many cases, elderly patients complain of pruritus during skin hygiene care, a condition called aquagenic pruritus of the elderly (APE). To date, the pathophysiology and mechanism of action of APE have not been elucidated. We conducted the present study to test the hypothesis that hypo-osmotic shock of epidermal cells induces skin inflammation and elongation of C-fibers by nerve growth factor β (NGFβ) as a basic mechanism of APE. The dorsal skin of HWY rats, which are a model for disrupted skin barrier function, was treated with distilled water (hypotonic treatment [Hypo] group) or normal saline (isotonic treatment [Iso] group) by applying soaked gauze for 7 days. Untreated rats were used as a control (no-treatment [NT] group). Histochemical and immunohistochemical analyses revealed inflammatory responses in the epidermis and the dermal papillary layer in the Hypo group, while no alterations were observed in the Iso or NT groups. Induction of expression and secretion of NGFβ and elongation of C-fibers into the epidermis were found in the Hypo group. In contrast, secretion of NGFβ was significantly lower and elongation of C-fibers was not observed in the Iso group. These results suggest that hypo-osmotic shock-induced inflammatory reactions promote hypersensitivity to pruritus in skin with disrupted barrier function. PMID:25681269

  11. Skin decontamination of glyphosate from human skin in vitro.

    Science.gov (United States)

    Zhai, H; Chan, H P; Hui, X; Maibach, H I

    2008-06-01

    This study compared three model decontaminant solutions (tap water, isotonic saline, and hypertonic saline) for their ability to remove a model herbicide (glyphosate) from an in vitro human skin model. Human cadaver skin was dosed (approximately 375microg) of [14C]-glyphosate on 3cm2 per skin. After each exposure time (1, 3, and 30min post-dosing, respectively), the surface skin was washed three times (4ml per time) with each solution. After washing, the skin was stripped twice with tape discs. Lastly, the wash solutions, strippings, receptor fluid, and remainder of skin were liquid scintillation analyzer counted to determine the amount of glyphosate. There were no statistical differences among these groups at any time points. The total mass balance recovery at three time exposure points was between 94.8% and 102.4%. The wash off rates (glyphosate in wash solutions) at three different exposure times is 79-101.2%. Thus the three tested decontaminants possess similar effectiveness in removing glyphosate from skin. This in vitro model is not only economic and rapid, but also provides quantitative data that may aid screening for optimal decontaminants. PMID:18407393

  12. Periostin in Skin Tissue Skin-Related Diseases

    Directory of Open Access Journals (Sweden)

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.

  13. Dosimetry for Total Skin Electron Beam Therapy in Skin Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Sung Sil; Loh, John J. K.; Kim, Gwi Eon [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1992-06-15

    Increasing frequency of skin cancer, mycosis fungoides, Kaposi sarcoma etc, it need to treatment dose planning for total skin electron beam (TSEB) therapy. Appropriate treatment planning for TSEB therapy is needed to give homogeneous dose distribution throughout the entire skin surface. The energy of 6 MeV electron from the 18 MeV medical linear accelerator was adapted for superficial total skin electron beam therapy. The energy of the electron beam was reduced to 4.2 MeV by a 0.5cmx90cmx180cm acryl screen placed in a feet front of the patient. Six dual field beam was adapted for total skin irradiation to encompass the entire body surface from head to toe simultaneously. The patients were treated behind the acryl screen plate acted as a beam scatterer and contained a parallel-plate shallow ion chamber for dosimetry and beam monitoring. During treatment, the patient was placed in six different positions due to be homogeneous dose distribution for whole skin around the body. One treatment session delivered 400 cGy to the entire skin surface and patients were treated twice a week for eight consecutive weeks, which is equivalent to TDF value 57. Instrumentation and techniques developed in determining the depth dose, dose distribution and bremsstrahlung dose are discussed.

  14. SU-E-J-273: Skin Temperature Recovery Rate as a Potential Predictor for Radiation-Induced Skin Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Biswal, N C; Wu, Z; Chu, J [Rush University Medical Center, Chicago, IL (United States); Sun, J [Argonne National Laboratory, Lemont, IL (United States)

    2015-06-15

    Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy.

  15. Normality in Analytical Psychology

    Directory of Open Access Journals (Sweden)

    Steve Myers

    2013-11-01

    Full Text Available Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity.

  16. Normalized information distance

    NARCIS (Netherlands)

    P.M.B. Vitányi; F.J. Balbach; R.L. Cilibrasi; M. Li

    2008-01-01

    The normalized information distance is a universal distance measure for objects of all kinds. It is based on Kolmogorov complexity and thus uncomputable, but there are ways to utilize it. First, compression algorithms can be used to approximate the Kolmogorov complexity if the objects have a string

  17. Back to Normal

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Xinjiang officials speed up the investigation of July 5 riot suspects and restore social order Life in Urumqi has gone back to normal one month after the July 5 riot that killed nearly 200 people in the capital city of China’s northwestern

  18. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer

    Directory of Open Access Journals (Sweden)

    David A. Quigley

    2016-07-01

    Full Text Available Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways. Gene networks related to specific cell types and signaling pathways, including sonic hedgehog (Shh, Wnt, Lgr family stem cell markers, and keratins, differed at these tissue sites, suggesting mechanisms for the differential susceptibility of dorsal and tail skin to development of skin diseases and tumorigenesis. The Pten tumor suppressor gene network is rewired in premalignant tumors compared to normal tissue, but this response to perturbation is lost during malignant progression. We present a software package for expression quantitative trait loci (eQTL network analysis and demonstrate how network analysis of whole tissues provides insights into interactions between cell compartments and signaling molecules.

  19. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer.

    Science.gov (United States)

    Quigley, David A; Kandyba, Eve; Huang, Phillips; Halliwill, Kyle D; Sjölund, Jonas; Pelorosso, Facundo; Wong, Christine E; Hirst, Gillian L; Wu, Di; Delrosario, Reyno; Kumar, Atul; Balmain, Allan

    2016-07-26

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways. Gene networks related to specific cell types and signaling pathways, including sonic hedgehog (Shh), Wnt, Lgr family stem cell markers, and keratins, differed at these tissue sites, suggesting mechanisms for the differential susceptibility of dorsal and tail skin to development of skin diseases and tumorigenesis. The Pten tumor suppressor gene network is rewired in premalignant tumors compared to normal tissue, but this response to perturbation is lost during malignant progression. We present a software package for expression quantitative trait loci (eQTL) network analysis and demonstrate how network analysis of whole tissues provides insights into interactions between cell compartments and signaling molecules. PMID:27425619

  20. Usefulness of rat skin as a substitute for human skin in the in vitro skin permeation study.

    Science.gov (United States)

    Takeuchi, Hiroyuki; Mano, Yoko; Terasaka, Shuichi; Sakurai, Takanobu; Furuya, Atsushi; Urano, Hidetoshi; Sugibayashi, Kenji

    2011-01-01

    Sprague-Dawley (SD) rats are broadly used in preclinical studies for drug development, so a lot of information for the rats can be obtained especially from pharmacokinetic, pharmacological and toxicological studies. The purpose of this study was to clarify whether SD rat skin can be used to predict human skin permeability. In vitro permeation studies of the three model drugs, nicorandil, isosorbide dinitrate, and flurbiprofen, through human skin and SD rat skin were performed using Franz-type diffusion cells. The permeation rates of the three model drugs through human skin and SD rat skin were determined, and their variations were evaluated. The inter-individual variations in SD rat skin permeability of the three model drugs were much lower than that in human skin permeability, although the permeation rates of the three model drugs through the SD rat skin were about twice those through human skin. In addition, no difference in the skin permeability coefficients of the three model drugs was obtained between fresh SD rat skin and frozen SD rat skin. The markedly smaller variation in the permeability through SD rat skin compared with that through human skin indicated that in vitro permeation studies using SD rat skin would be especially useful for evaluating differences in the skin permeability of the three model drugs as well as for predicting human skin permeability.

  1. Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

    DEFF Research Database (Denmark)

    Philipsen, P A; Knudsen, L; Gniadecka, M;

    2013-01-01

    There is a general need for methods to obtain fast in vivo diagnosis of skin tumours. Raman spectroscopy measures molecular structure and may thus have potential as a tool for skin tumour diagnosis. The purpose of this study was to investigate how skin pigmentation influenced the Raman spectra...... and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...... in a higher spectral background caused by fluorescence, which could be removed by background correction. After background correction, we found only a negligible effect of pigmentation on the major spectral bands, and the comparison of the intensity of these bands allowed us to differentiate between normal...

  2. Itchy, Scaly Skin? Living with Psoriasis

    Science.gov (United States)

    ... exit disclaimer . Subscribe Itchy, Scaly Skin? Living With Psoriasis The thick, red, scaly skin of psoriasis can ... Diet Itchy, Scaly Skin? Wise Choices Links Treating Psoriasis Doctors often use a trial-and-error approach ...

  3. Seismic motion attenuation relations in Sichuan and adjacent areas

    Institute of Scientific and Technical Information of China (English)

    LEI Jian-cheng; GAO Meng-tan; YU Yan-xiang

    2007-01-01

    The Sichuan and adjacent areas is divided into southwest China region (SWCR) and Sichuan Basin region (SCBR) according to tectonic backgrounds and seismic damage distribution features. 96 modern destructive earthquakes in SWCR and 40 in SCBR are gathered respectively. All their magnitude parameters are checked. Based on the statistic relations between epicentral intensity and magnitude as well as relation between sensible radius and magnitude, the near and far field seismic intensity attenuation features are represented and controlled. And then the seismic intensity attenuation relations along major axis, minor axis and mean axis are established separately. The systematic deviations of surface wave magnitude between China seismograph network and U.S. seismograph network are considered in this paper. By making use of the new attenuation relations of bedrock horizontal ground acceleration response spectrum in west U.S., the attenuation relations of bedrock horizontal ground acceleration response spectrum in SWCR and SCBR are digital transformed based on the attenuation model considering acceleration saturation of distance and magnitude in near field.

  4. Repeated adjacent-segment degeneration after posterior lumbar interbody fusion.

    Science.gov (United States)

    Okuda, Shinya; Oda, Takenori; Yamasaki, Ryoji; Maeno, Takafumi; Iwasaki, Motoki

    2014-05-01

    One of the most important sequelae affecting long-term results is adjacent-segment degeneration (ASD) after posterior lumbar interbody fusion (PLIF). Although several reports have described the incidence rate, there have been no reports of repeated ASD. The purpose of this report was to describe 1 case of repeated ASD after PLIF. A 62-year-old woman with L-4 degenerative spondylolisthesis underwent PLIF at L4-5. At the second operation, L3-4 PLIF was performed for L-3 degenerative spondylolisthesis 6 years after the primary operation. At the third operation, L2-3 PLIF was performed for L-2 degenerative spondylolisthesis 1.5 years after the primary operation. Vertebral collapse of L-1 was detected 1 year after the third operation, and the collapse had progressed. At the fourth operation, 3 years after the third operation, vertebral column resection of L-1 and replacement of titanium mesh cages with pedicle screw fixation between T-4 and L-5 was performed. Although the patient's symptoms resolved after each operation, the time between surgeries shortened. The sacral slope decreased gradually although each PLIF achieved local lordosis at the fused segment.

  5. Hydrocarbon provinces and productive trends in Libya and adjacent areas

    Energy Technology Data Exchange (ETDEWEB)

    Missallati, A.A. (Agip (N.A.M.E.)Ltd., Tripoli (Libya))

    1988-08-01

    According to the age of major reservoirs, hydrocarbon occurrences in Libya and adjacent areas can be grouped into six major systems which, according to their geographic locations, can be classified into two major hydrocarbon provinces: (1) Sirte-Pelagian basins province, with major reservoirs ranging from middle-late Mesozoic to early Tertiary, and (2) Murzog-Ghadames basins province, with major reservoirs ranging from early Paleozoic to early Mesozoic. In the Sirte-Pelagian basins province, hydrocarbons have been trapped in structural highs or in stratigraphic wedge-out against structural highs and in carbonate buildups. Here, hydrocarbon generation is characterized by the combined effect of abundant structural relief and reservoir development in the same hydrocarbon systems of the same age, providing an excellent example of hydrocarbon traps in sedimentary basins that have undergone extensive tensional fracturing in a shallow marine environment. In the Murzog-Ghadames basins province, hydrocarbons have been trapped mainly in structural highs controlled by paleostructural trends as basement arches which acted as focal points for oil migration and accumulation.

  6. Particulate Matter Levels in Ambient Air Adjacent to Industrial Area

    Science.gov (United States)

    Mohamed, R. M. S. R.; Nizam, N. M. S.; Al-Gheethi, A. A.; Lajis, A.; Kassim, A. H. M.

    2016-07-01

    Air quality in the residential areas adjacent to the industrial regions is of great concern due to the association with human health risks. In this work, the concentrations of particulate matter (PM10) in the ambient air of UTHM campus was investigated tostudy the air qualityand their compliance to the Malaysian Ambient Air Quality Guidelines (AAQG). The PM10 samples were taken over 24 hours from the most significant area at UTHM including Stadium, KolejKediamanTunDr. Ismail (KKTDI) and MakmalBahan. The meteorological parameters; temperature, relative humidity, wind speed and wind direction as well as particulate matterwere estimated by using E-Sampler Particulate Matter (PM10) Collector. The highest concentrations of PM10 (55.56 µg/m3) was recorded at MakmalBahan during the working and weekend days. However, these concentrations are less than 150 pg/m3. It can be concluded that although UTHM is surrounded by the industrial area, the air quality in the campus still within the standards limits.

  7. The Current Tectonics of the Yukon and Adjacent Area

    Science.gov (United States)

    Hyndman, R. D.; Leonard, L. J.

    2014-12-01

    The current tectonics across the Yukon and adjacent areas of western Northwest Territories (NWT) and northern British Columbia appear to be driven primarily by the Yakutat Terrane collision, an "indenter" in the corner of the Gulf of Alaska. GPS data show 1-10 mm/yr northward and eastward, decreasing inland. The rates from earthquake statistics are similar although there are important discrepancies. The eastern Cordillera earthquake mechanisms are mainly thrust in the Mackenzie Mountains of southwestern NWT where the Cordillera upper crust is overthrusting the craton. To the north, the mechanisms are mainly strike-slip in the Richardson Mountains that appear to lie along the edge of the craton. The deformation appears to be limited to the hot and weak Cordillera with the strong craton providing an irregular eastern boundary. For example, there is an eastward bow in the craton edge and the deformation in the Mackenzie Mountains. On the Beaufort Sea margin in the region of the Mackenzie Delta there appears to be a type of "subduction zone" with the continent very slowly overthrusting the oceanic plate, a process that has continued since at least the Cretaceous. A northward moving continental margin block is bounded by left lateral faulting in the west (Canning Displacement Zone of eastern Alaska) and right lateral faulting in the east (Richardson Mountains in eastern Yukon). There is almost no seismicity on this thrust belt but as for some other subduction zones such as Cascadia there is the potential for very infrequent great earthquakes.

  8. Characterization of adjacent breast tumors using oligonucleotide microarrays

    International Nuclear Information System (INIS)

    Current methodology often cannot distinguish second primary breast cancers from multifocal disease, a potentially important distinction for clinical management. In the present study we evaluated the use of oligonucleotide-based microarray analysis in determining the clonality of tumors by comparing gene expression profiles. Total RNA was extracted from two tumors with no apparent physical connection that were located in the right breast of an 87-year-old woman diagnosed with invasive ductal carcinoma (IDC). The RNA was hybridized to the Affymetrix Human Genome U95A Gene Chip® (12,500 known human genes) and analyzed using the Gene Chip Analysis Suite® 3.3 (Affymetrix, Inc, Santa Clara, CA, USA) and JMPIN® 3.2.6 (SAS Institute, Inc, Cary, NC, USA). Gene expression profiles of tumors from five additional patients were compared in order to evaluate the heterogeneity in gene expression between tumors with similar clinical characteristics. The adjacent breast tumors had a pairwise correlation coefficient of 0.987, and were essentially indistinguishable by microarray analysis. Analysis of gene expression profiles from different individuals, however, generated a pairwise correlation coefficient of 0.710. Transcriptional profiling may be a useful diagnostic tool for determining tumor clonality and heterogeneity, and may ultimately impact on therapeutic decision making

  9. Concentric network symmetry grasps authors' styles in word adjacency networks

    Science.gov (United States)

    Amancio, Diego R.; Silva, Filipi N.; Costa, Luciano da F.

    2015-06-01

    Several characteristics of written texts have been inferred from statistical analysis derived from networked models. Even though many network measurements have been adapted to study textual properties at several levels of complexity, some textual aspects have been disregarded. In this paper, we study the symmetry of word adjacency networks, a well-known representation of text as a graph. A statistical analysis of the symmetry distribution performed in several novels showed that most of the words do not display symmetric patterns of connectivity. More specifically, the merged symmetry displayed a distribution similar to the ubiquitous power-law distribution. Our experiments also revealed that the studied metrics do not correlate with other traditional network measurements, such as the degree or the betweenness centrality. The discriminability power of the symmetry measurements was verified in the authorship attribution task. Interestingly, we found that specific authors prefer particular types of symmetric motifs. As a consequence, the authorship of books could be accurately identified in 82.5% of the cases, in a dataset comprising books written by 8 authors. Because the proposed measurements for text analysis are complementary to the traditional approach, they can be used to improve the characterization of text networks, which might be useful for applications based on stylistic classification.

  10. Can Logging in Equatorial Africa Affect Adjacent Parks?

    Directory of Open Access Journals (Sweden)

    Jeremy W. Lichstein

    2005-06-01

    Full Text Available Tropical deforestation can cause fundamental regional-scale shifts in vegetation structure and diversity. This is particularly true in Africa. Although national parks are being established to protect areas from deforestation and to conserve biodiversity, these parks are not immune to disturbances outside their boundaries. We used regional-scale atmospheric simulation experiments to investigate how deforestation in timber concessions might affect precipitation inside adjacent, undisturbed national parks in the equatorial African countries of Gabon and the Republic of Congo. The experiments revealed a complex response. Some parks showed rainfall reduced as much as 15%, while others showed slight increases. Rainfall inside parks was particularly sensitive to upwind deforestation along the path of airborne moisture traveling inland from the ocean. A variety of shortcomings in the current modeling procedures limit the ability to extrapolate from experiments such as ours to provide spatially explicit, long-term forecasts of climate. We describe what advances in modeling are needed to produce regional-scale predictions that are robust enough to be useful to managers and policy makers.

  11. Seismic responses of two adjacent buildings. II. Interaction

    Science.gov (United States)

    Celebi, Mehmet

    1993-01-01

    Presented in this part of the two-part paper is a study of the relations between earthquake motions recorded from two, adjacent, seven-story buildings, from a downhole below the foundation of one of the buildings and from three free-field sites, all within one city block. This unique data set was obtained during the Whittier-Narrows, Calif. earthquake of Oct. 1, 1987, Part I includes background information on the two buildings, the site, and the data set. Building response characteristics of a code-type instrumented building (A) and an extensively instrumented building (B) are also studied. In this part, spectral analysis techniques are used to study the relationships between the motions of the roofs and basements, the downhole and the free-field sites. It is asserted that there is building-soil-building interaction between the two buildings at a frequency of 2.35 Hz. Furthermore, the free-field motions are shown to be influenced by the presence of the buildings.

  12. The Effects of Mucopolysaccharide Polysulphate on Hydration and Elasticity of Human Skin

    OpenAIRE

    Rungsima Wanitphakdeedecha; Sasima Eimpunth; Woraphong Manuskiatti

    2011-01-01

    Background. Mucopolysaccharide polysulphate (MPS) has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydr...

  13. Immunohistochemical localization of fibronectin as a tool for the age determination of human skin wounds

    OpenAIRE

    Betz, P.; Nerlich, A; Wilske, J.; Tübel, J.; Wiest, I.; Penning, R.; Eisenmenger, Wolfgang

    1992-01-01

    We analyzed the distribution of fibronectin in routinely embedded tissue specimens from 53 skin wounds and 6 postmortem wounds. In postmortem wounds a faint but focal positive staining was exclusively found at the margin of the specimens which dit not extend into the adjacent stroma. Vital wounds were classified into 3 groups. The first comprising lesions with wound ages ranging from a few seconds to 30 min, the second comprising those with wound ages upt to 3 weeks, and the third group with ...

  14. Epigenetic alterations of the SERPINE1 gene in oral squamous cell carcinomas and normal oral mucosa

    DEFF Research Database (Denmark)

    Gao, Shan; Nielsen, Boye Schnack; Krogdahl, Annelise;

    2010-01-01

    A high level of plasminogen activator inhibitor-1 (PAI-1 or SERPINE1) in tumor extracts is a marker of a poor prognosis in human cancers, including oral carcinomas. However, the mechanisms responsible for the upregulation of PAI-1 in cancers remain unclear. Investigating specific PAI-1 expressing...... cells in oral carcinomas by immunohistochemistry, we found that PAI-1 was expressed in 18 of the 20 patients, mainly by cancer cells. Two showed PAI-1 positive stromal cells surrounding the tumor areas and five showed PAI-1 positive cells in tumor-adjacent normal epithelium. By real-time RT-PCR analysis......, 17 of 20 patients with oral carcinoma were found to have between 2.5- and 50-fold increased tumor PAI-1 mRNA level, as compared with the matched tumor-adjacent normal tissues. The PAI-1 mRNA level in connective tissues from 15 healthy volunteers was similar to the level in tumor-adjacent normal...

  15. Color Constancy For Improving Skin Detection

    OpenAIRE

    A. Nadian-Ghomsheh

    2014-01-01

    Skin detection is a preliminary step in many human related recognition systems. Most skin detection systems suffer from high false detection rate, resulting from low variance between the skin and non-skin color distributions. This paper proposes the use of simple color correction algorithms with low computation complexity to obtain a corrected version of the skin color distribution, which could lead to more accurate skin detection. White patch retinex, Grey world assumption and several improv...

  16. Ultraviolet Light and Skin Cancer in Athletes

    OpenAIRE

    Harrison, Shannon C.; Bergfeld, Wilma F.

    2009-01-01

    The incidence of melanoma and nonmelanoma skin cancers is increasing worldwide. Ultraviolet light exposure is the most important risk factor for cutaneous melanoma and nonmelanoma skin cancers. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Constitutive skin color and genetic factors, as well as immunological factors, play a role in the development of skin cancer. Ultraviolet light also causes sunburn and photoaging damage to the skin.

  17. THERAPEUTIC OF SKIN AGING WITH CARBON DIOXIDE LASER SKIN RESURFACING AND COMBINATION WITH AIR COOLING

    Directory of Open Access Journals (Sweden)

    NKA Maya Damayanti

    2013-12-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 So far, a lot of people who want their face skin always looks young though age continued to grow. It cannot be denied that aging will occur in everyone although some faster or later occur. Various ways were developed by scientists to fix this issue. Laser Skin Resurfacing (LSR technique to tighten facial skin is a procedure that is popular among the public and the practice of medicine. CO2 LSR technique is still a gold standard was used. Pain during surgery can be reduced when this technique was combined with air cooling. In addition, the adverse effects of post-operative might be tolerated.   /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  18. Prevalence of Common Skin Diseases and Their Associated Factors among Military Personnel in Korea: A Cross-sectional Study

    Science.gov (United States)

    Bae, Jung Min; Ha, Beomman; Lee, Hongsun; Park, Chang Keun; Kim, Hyun Joon

    2012-01-01

    This study was conducted to clarify the prevalence of common skin diseases and their associated factors among military personnel in Korea. Four dermatologists visited adjacent military units and examined soldiers. A structured questionnaire that included questions about known skin diseases, demographic information, and questions for the Perceived Stress Index was completed for each participant. The soldiers that had been diagnosed with a skin disease answered one additional questionnaire (Skindex-29) which assess the influence of an individual's skin disease on daily life. Of 1,321 soldiers examined, 798 (60.4%) had one or more skin diseases. The three most common skin problems were acne (35.6%), tinea pedis (15.2%) and atopic dermatitis (5.1%). The diseases closely related to the period of military service were acne, tinea pedis, viral warts and corns. The diseases related to the amount of stress were atopic dermatitis, seborrheic dermatitis, and acne. The most troublesome skin diseases were atopic dermatitis, tinea cruris, and seborrheic dermatitis. These results demonstrated that the prevalence of skin disease among military personnel in Korea is very high, and that some of the skin disorders may have a significant influence on their daily lives. PMID:23091325

  19. Age-related skin changes

    Directory of Open Access Journals (Sweden)

    Božanić Snežana

    2012-01-01

    Full Text Available Age-related skin changes can be induced by chronological ageing, manifested in subcutaneous fat reduction, and photo-ageing eliciting increased elastotic substance in the upper dermis, destruction of its fibrilar structure, augmented intercellular substance and moderate inflammatory infiltrate. Forty-five biopsy skin samples of the sun-exposed and sun-protected skin were analyzed. The patients were both males and females, aged from 17 to 81 years. The thickness of the epidermal layers and the number of cellular living layers is greater in younger skin. The amount of keratohyaline granules is enlarged in older skin. Dermoepidermal junction is flattened and the presence of elastotic material in the dermis is pronounced with age. The amount of inflammatory infiltrate is increased, the fibrous trabeculae are thickened in older skin and the atrophy of the hypodermis is observed. Chronological ageing alters the fibroblasts metabolism by reducing their life span, capacity to divide and produce collagen. During ageing, the enlargement of collagen fibrils diminishes the skin elasticity.

  20. Biothermomechanical behavior of skin tissue

    Institute of Scientific and Technical Information of China (English)

    F.Xu; T.J.Lu; K.A.Seffen

    2008-01-01

    Advances in laser,microwave and similar tech nologies have led to recent developments of thermal treatments involving skin tissue.The effectiveness of these treatments is governed by the coupled thermal,mechanical,biological and neural responses of the affected tissue:a favorable interaction results in a procedure with relatively little pain and no lasting side effects.Currently,even though each behavioral facet is to a certain extent established and understood,none exists to date in the interdisciplinarv area.A highly interdisciplinary approach is required for studying the biothermomechanical behavior of skin,involving bioheat transfer.biomechanics and physiology.A comprehensive literature review penrtinent to the subject is presented in this paper,covering four subject areas:(a)skin structure,(b)skin bioheat transfer and thermal damage,(c)skin biomechanics,and(d)skin biothermomechanics.The major problems,issues,and topics for further studies are also outlined.This review finds that significant advances in each of these aspects have been achieved in recent years.Although focus is placed upon the biothermomechanical behavior of skin tissue,the fundamental concepts and methodologies reviewed in this paper may also be applicable for studying other soft tissues.