WorldWideScience

Sample records for adjacent normal skin

  1. Mast cell distribution in normal adult skin

    NARCIS (Netherlands)

    A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)

    2005-01-01

    markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.

  2. Mast cell distribution in normal adult skin.

    Science.gov (United States)

    Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P

    2005-03-01

    To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.

  3. Metallothionein 3 expression in normal skin and malignant skin lesions.

    Science.gov (United States)

    Pula, Bartosz; Tazbierski, Tadeusz; Zamirska, Aleksandra; Werynska, Bozena; Bieniek, Andrzej; Szepietowski, Jacek; Rys, Janusz; Dziegiel, Piotr; Podhorska-Okolow, Marzena

    2015-01-01

    Metallothionein-3 (MT-3) has been shown to be expressed in several malignancies and to have an impact on patients' survival in breast and urinary bladder cancer cases. However, its expression has not been determined in normal skin or in its malignant lesions. MT-3 expression was studied using immunohistochemistry in 17 cases of normal skin, 18 of actinic keratosis (AK), 39 of squamous cell carcinoma (SCC), and 23 of basal cell carcinoma (BCC). Low MT-3 expression was observed in normal skin epidermis with faint or no expression in the epidermis basal layer. Significantly higher MT-3 expression was noted in AK (P=0.007) and SCC (P<0.0001), as compared with normal skin epidermis. BCC cases were characterized by the lowest MT-3 expression of all the examined groups, which was significantly lower in comparison to normal skin epidermis, AK, and SCC (P=0.009;P<0.0001 and P<0.0001, respectively). In conclusion, MT-3 may be involved in the development of SCC.

  4. Normal variants of skin in neonates

    Directory of Open Access Journals (Sweden)

    Kulkarni M

    1996-01-01

    Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.

  5. TP53 mutations in clinically normal mucosa adjacent to oral carcinomas

    DEFF Research Database (Denmark)

    Thode, C; Bilde, A; Von Buchwald, C

    2010-01-01

    products were separated by denatured gradient gel electrophoresis. Fragments with a deviant DGEE pattern were sequenced. RESULTS: TP53 mutations were found in six of 18 tumours. Fourteen specimens contained histologically normal mucosa adjacent to the tumour; 13 of these showed small clusters of p53...

  6. Screening of the residual normal ovarian tissue adjacent to orthotopic epithelial ovarian carcinomas in nude mice.

    Science.gov (United States)

    Zhu, G H; Wang, S T; Yao, M Z; Cai, J H; Chen, C Y; Yang, Z X; Hong, L; Yang, S Y

    2014-04-16

    The objective of this study was to explore the feasibility and methods of screening the residual normal ovarian tissue adjacent to orthotopic ovarian carcinomas in nude mice. Human epithelial ovarian cancer cells (OVCAR3) were subcutaneously implanted for a tumor source and ovarian orthotopic transplantation. The cancer tissue, proximal paraneoplastic tissue, middle paraneoplastic tissue, remote paraneoplastic tissue, and normal ovarian tissue were removed. CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was detected by reverse transcription polymerase chain reaction. We obtained 35 paraneoplastic residual ovarian tissues with normal biopsies from 40 cases of an orthotopic epithelial ovarian carcinoma model (87.5%). CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was lower in proximal paraneoplastic tissue than in cancer tissue (P tissue (P tissue as well as among residual normal ovarian tissues with different severity (P > 0.05). In ovarian tissues of 20 normal nude mice, the expression of CK- 7, CA125, p53, survivin, MMP-2, and TIMP-2 was negative. Overall, the expression levels of CK-7, CA125, p53, survivin, MMP-2, TIMP-2, and other molecular markers showed a decreasing trend in the non-cancer tissue direction. The expression levels can be used as standards to screen residual normal ovarian tissue. We can obtain relatively safe normal ovarian tissues adjacent to epithelial ovarian cancer.

  7. Clinical and histological effects of blue light on normal skin.

    NARCIS (Netherlands)

    Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.

    2010-01-01

    INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and

  8. Reproducible pattern of microRNA in normal human skin

    DEFF Research Database (Denmark)

    Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert

    2010-01-01

    MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi......RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....

  9. Normal histology structure of dog's skin (art state

    Directory of Open Access Journals (Sweden)

    Giovanna Clarena Castellanos I.

    2005-12-01

    Full Text Available The skin is one of the largest organs of the body, and it has multiple functions: metabolic, temperature regulator, sensibility, and protection. The skin is formed by three layers: epidermis, dermis and hypodermis; the annexed ones are found in the dermis: hair follicles, sebaceous glands, sweat glands; the nails are found in the appendix. Although the skin structure in domestic animals is similar, there are variations among species and even in a single specie related to epidermal thickness, dermal thickness, types and arrangements of hair follicles, and annexed structures. Knowing that Skin’s diseases are common in clinic practices in small animals, this article will review the normal histology structure of dog’s skin in order to know the changes in skin’s diseases in this specie.

  10. Modeling Electronic Skin Response to Normal Distributed Force

    Directory of Open Access Journals (Sweden)

    Lucia Seminara

    2018-02-01

    Full Text Available The reference electronic skin is a sensor array based on PVDF (Polyvinylidene fluoride piezoelectric polymers, coupled to a rigid substrate and covered by an elastomer layer. It is first evaluated how a distributed normal force (Hertzian distribution is transmitted to an extended PVDF sensor through the elastomer layer. A simplified approach based on Boussinesq’s half-space assumption is used to get a qualitative picture and extensive FEM simulations allow determination of the quantitative response for the actual finite elastomer layer. The ultimate use of the present model is to estimate the electrical sensor output from a measure of a basic mechanical action at the skin surface. However this requires that the PVDF piezoelectric coefficient be known a-priori. This was not the case in the present investigation. However, the numerical model has been used to fit experimental data from a real skin prototype and to estimate the sensor piezoelectric coefficient. It turned out that this value depends on the preload and decreases as a result of PVDF aging and fatigue. This framework contains all the fundamental ingredients of a fully predictive model, suggesting a number of future developments potentially useful for skin design and validation of the fabrication technology.

  11. Skin flora: Differences between people affected by Albinism and those with normally pigmented skin in Northern Tanzania - cross sectional study.

    Science.gov (United States)

    Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard

    2012-07-30

    Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1  cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680  CFU per cm²) as compared with 453.5  CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.

  12. Normal histology structure of dog's skin (art state)

    OpenAIRE

    Giovanna Clarena Castellanos I.; Gersain Rodríguez T.; Carlos Arturo Iregui C.

    2005-01-01

    The skin is one of the largest organs of the body, and it has multiple functions: metabolic, temperature regulator, sensibility, and protection. The skin is formed by three layers: epidermis, dermis and hypodermis; the annexed ones are found in the dermis: hair follicles, sebaceous glands, sweat glands; the nails are found in the appendix. Although the skin structure in domestic animals is similar, there are variations among species and even in a single specie related to epidermal thickness, ...

  13. Normal tissue tolerance to external beam radiation therapy: Skin

    International Nuclear Information System (INIS)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.

    2010-01-01

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  14. Morphology and epidermal thickness of normal skin imaged by optical coherence tomography

    DEFF Research Database (Denmark)

    Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars

    2008-01-01

    is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...... colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults....... In glabrous skin the stratum corneum is visible. Children had larger ET (p gender- or skin-type-related differences in ET were found. Conclusion: This study contributes to understanding OCT and PS-OCT images of normal skin and indicates that OCT...

  15. Cold urticaria patients exhibit normal skin levels of functional mast cells and histamine after tolerance induction

    DEFF Research Database (Denmark)

    Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise

    2012-01-01

    Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...... to cold can be beneficial. The aim was to investigate whether desensitization can lower temperature thresholds and reduce release of histamine in the skin. Cold urticaria patients were subjected to desensitization and assessed for skin responses to cold stimulation and codeine before and after. Histamine...... prevented histamine release after skin exposure to cold. Surprisingly, skin histamine levels and release after codeine injection were found to be normal in desensitized patients....

  16. cis-Expression QTL analysis of established colorectal cancer risk variants in colon tumors and adjacent normal tissue.

    Directory of Open Access Journals (Sweden)

    Lenora W M Loo

    Full Text Available Genome-wide association studies (GWAS have identified 19 risk variants associated with colorectal cancer. As most of these risk variants reside outside the coding regions of genes, we conducted cis-expression quantitative trait loci (cis-eQTL analyses to investigate possible regulatory functions on the expression of neighboring genes. Forty microsatellite stable and CpG island methylator phenotype-negative colorectal tumors and paired adjacent normal colon tissues were used for genome-wide SNP and gene expression profiling. We found that three risk variants (rs10795668, rs4444235 and rs9929218, using near perfect proxies rs706771, rs11623717 and rs2059252, respectively were significantly associated (FDR q-value ≤0.05 with expression levels of nearby genes (<2 Mb up- or down-stream. We observed an association between the low colorectal cancer risk allele (A for rs10795668 at 10p14 and increased expression of ATP5C1 (q = 0.024 and between the colorectal cancer high risk allele (C for rs4444235 at 14q22.2 and increased expression of DLGAP5 (q = 0.041, both in tumor samples. The colorectal cancer low risk allele (A for rs9929218 at 16q22.1 was associated with a significant decrease in expression of both NOL3 (q = 0.017 and DDX28 (q = 0.046 in the adjacent normal colon tissue samples. Of the four genes, DLGAP5 and NOL3 have been previously reported to play a role in colon carcinogenesis and ATP5C1 and DDX28 are mitochondrial proteins involved in cellular metabolism and division, respectively. The combination of GWAS findings, prior functional studies, and the cis-eQTL analyses described here suggest putative functional activities for three of the colorectal cancer GWAS identified risk loci as regulating the expression of neighboring genes.

  17. Viscoelastic properties of normal and cancerous human breast cells are affected differently by contact to adjacent cells.

    Science.gov (United States)

    Schierbaum, Nicolas; Rheinlaender, Johannes; Schäffer, Tilman E

    2017-06-01

    Malignant transformation drastically alters the mechanical properties of the cell and its response to the surrounding cellular environment. We studied the influence of the physical contact between adjacent cells in an epithelial monolayer on the viscoelastic behavior of normal MCF10A, non-invasive cancerous MCF7, and invasive cancerous MDA-MB-231 human breast cells. Using an atomic force microscopy (AFM) imaging technique termed force clamp force mapping (FCFM) to record images of the viscoelastic material properties, we found that normal MCF10A cells are stiffer and have a lower fluidity at confluent than at sparse density. Contrarily, cancerous MCF7 and MDA-MB-231 cells do not stiffen and do not decrease their fluidity when progressing from sparse to confluent density. The behavior of normal MCF10A cells appears to be governed by the formation of stable cell-cell contacts, because their disruption with a calcium-chelator (EGTA) causes the stiffness and fluidity values to return to those at sparse density. In contrast, EGTA-treatment of MCF7 and MDA-MB-231 cells does not change their viscoelastic properties. Confocal fluorescence microscopy showed that the change of the viscoelastic behavior in MCF10A cells when going from sparse to confluent density is accompanied by a remodeling of the actin cytoskeleton into thick stress fiber bundles, while in MCF7 and MDA-MB-231 cells the actin cytoskeleton is only composed of thin and short fibers, regardless of cell density. While the observed behavior of normal MCF10A cells might be crucial for providing mechanical stability and thus in turn integrity of the epithelial monolayer, the dysregulation of this behavior in cancerous MCF7 and MDA-MB-231 cells is possibly a central aspect of cancer progression in the epithelium. We measured the viscoelastic properties of normal and cancerous human breast epithelial cells in different states of confluency using atomic force microscopy. We found that confluent normal cells are

  18. Skin innervation: important roles during normal and pathological cutaneous repair.

    Science.gov (United States)

    Laverdet, Betty; Danigo, Aurore; Girard, Dorothée; Magy, Laurent; Demiot, Claire; Desmoulière, Alexis

    2015-08-01

    The skin is a highly sensitive organ. It is densely innervated with different types of sensory nerve endings, which discriminate between pain, temperature and touch. Autonomic nerve fibres which completely derive from sympathetic (cholinergic) neurons are also present. During all the phases of skin wound healing (inflammatory, proliferative and remodelling phases), neuromediators are involved. Several clinical observations indicate that damage to the peripheral nervous system influences wound healing, resulting in chronic wounds within the affected area. Patients with cutaneous sensory defects due to lepromatous leprosy, spinal cord injury and diabetic neuropathy develop ulcers that fail to heal. In addition, numerous experimental observations suggest that neurogenic stimuli profoundly affect wound repair after injury and that delayed wound healing is observed in animal models after surgical resection of cutaneous nerves. All these observations clearly suggest that innervation and neuromediators play a major role in wound healing. Interactions between neuromediators and different skin cells are certainly crucial in the healing process and ultimately the restoration of pain, temperature, and touch perceptions is a major challenge to solve in order to improve patients' quality of life.

  19. Markers of fibrosis and epithelial to mesenchymal transition demonstrate field cancerization in histologically normal tissue adjacent to breast tumors

    Science.gov (United States)

    Trujillo, Kristina A.; Heaphy, Christopher M.; Mai, Minh; Vargas, Keith M.; Jones, Anna C.; Vo, Phung; Butler, Kimberly S.; Joste, Nancy E.; Bisoffi, Marco; Griffith, Jeffrey K

    2011-01-01

    Previous studies have shown that a field of genetically altered but histologically normal tissue extends 1 cm or more from the margins of human breast tumors. The extent, composition and biological significance of this field are only partially understood, but the molecular alterations in affected cells could provide mechanisms for limitless replicative capacity, genomic instability and a microenvironment that supports tumor initiation and progression. We demonstrate by microarray, qRT-PCR and immunohistochemistry a signature of differential gene expression that discriminates between patient-matched, tumor-adjacent histologically normal breast tissues located 1 cm and 5 cm from the margins of breast adenocarcinomas (TAHN-1 and TAHN-5, respectively). The signature includes genes involved in extracellular matrix remodeling, wound healing, fibrosis and epithelial to mesenchymal transition (EMT). Myofibroblasts, which are mediators of wound healing and fibrosis, and intra-lobular fibroblasts expressing MMP2, SPARC, TGF-β3, which are inducers of EMT, were both prevalent in TAHN-1 tissues, sparse in TAHN-5 tissues, and absent in normal tissues from reduction mammoplasty. Accordingly, EMT markers S100A4 and vimentin were elevated in both luminal and myoepithelial cells, and EMT markers α-smooth muscle actin and SNAIL were elevated in luminal epithelial cells of TAHN-1 tissues. These results identify cellular processes that are differentially activated between TAHN-1 and TAHN-5 breast tissues, implicate myofibroblasts as likely mediators of these processes, provide evidence that EMT is occurring in histologically normal tissues within the affected field and identify candidate biomarkers to investigate whether or how field cancerization contributes to the development of primary or recurrent breast tumors. PMID:21105047

  20. ACE and ACE2 expression in normal and malignant skin lesions.

    Science.gov (United States)

    Grzegrzolka, Jedrzej; Swiatko, Katarzyna; Pula, Bartosz; Zamirska, Aleksandra; Olbromski, Mateusz; Bieniek, Andrzej; Szepietowski, Jacek; Rys, Janusz; Dziegiel, Piotr; Podhorska-Okolow, Marzenna

    2013-01-01

    The renin-angiotensin system (RAS) is known mainly as a regulator of cardiovascular homeostasis. However, it has also been shown to mediate processes such as proliferation, apoptosis, angiogenesis, and carcinogenesis. Nonmelanoma skin cancers (NMSC) - including basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) - are among the most common cancers. The aim of the present study was to determine the immunohistochemical expression of angiotensin-converting enzyme (ACE), angiotensin-converting enzyme 2 (ACE2), and Ki-67 antigen in archival samples of normal skin, actinic keratosis, and malignant skin lesions. Cytoplasmic-nuclear ACE immunoreactivity was observed in 99% of examined cases of both normal skin and cancers. Significantly higher ACE immunoreactivity occurred in normal skin, as compared with BCC and SCC (p < 0.01, p < 0.0001, respectively). Additionally, ACE immunoreactivity was also significantly higher in BCC, compared with SCC (p < 0.05). ACE2 immunoreactivity was noted in basal epidermal layers and in sebaceous gland cells in normal skin, though not in NMSC. These novel observations suggest that ACE and skin RAS may be involved in the pathogenesis of malignant skin lesions.

  1. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  2. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  3. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...... in the basal layer of the interfollicular epidermis and in the bulge region of the hair follicle play a critical role for normal tissue maintenance. In wound healing, multipotent epidermal stem cells contribute to re-epithelization. It is possible that defects in growth control of either epidermal stem cells...

  4. [Comparison of biological characteristics and quantity of epidermal stem cells from hypertrophic scar skin and normal skin of human beings].

    Science.gov (United States)

    Zhou, Shuping; Cai, Jinglong; Niu, Fuyou; Zong, Xianlei; Xu, Jingjing; Du, Le; Chen, Guangyu

    2014-04-15

    To compare the biological characteristics of epidermal stem cells (ESCs) from hypertrophic scar and normal skin. Epidermal stem cells were separated, enriched and adhered from 20 hypertrophic scars (scar group) and 20 normal skins (control group). The morphology and growth characteristics of primary epidermal stem cells were observed. The absorbance (A) values of expression of Keratin 19, nucleoprotein p63 and integrin β1 were tested by Western blot. And the genes of Oct-4 and Nanog were tested by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Flow cytometry was used to examine the markers of integrin CD29, integrin CD49f and Keratin 19 of ESCs. The primary cultured cells showed the similar shape and growth curve. By comparing the epidermal stem cells from scar groups and control groups, the absorbance values of the expression of Keratin 19, nucleoprotein p63 and integrin β1 were 860 ± 4, 712 ± 3, 422 ± 6 and 862 ± 3, 707 ± 9, 413 ± 6 (all P > 0.05). The expression values of Oct-4, Nanog were (7.79 ± 0.44)×10(-4), (5.96 ± 0.36)×10(-4) and (7.93 ± 0.29)×10(-4), (6.06 ± 0.35)×10(-4) (all P > 0.05). Percentages of positive cells expressing CD29, CD49f and Keratin 19 were (97.3 ± 0.7)%, (94.6 ± 1.1)%, (92.5 ± 0.8)% and (98.8 ± 4.6)%, (98.9 ± 0.4)%, (94.4 ± 0.7)% respectively (all P < 0.05). The ESCs in hypertrophic scar have the same characteristics with ESCs in normal skin. However, the ESCs from hypertrophic scar are lower than that from normal skin.

  5. Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis

    International Nuclear Information System (INIS)

    Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.

    1982-01-01

    The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)

  6. Normal range and lateral symmetry in the skin temperature profile of pregnant women

    Science.gov (United States)

    Pereira, Tânia; Nogueira-Silva, Cristina; Simoes, Ricardo

    2016-09-01

    Body skin temperature is a useful parameter for diagnosing diseases and infrared thermography can be a powerful tool in providing important information to detect body temperature changes in a noninvasive way. The aim of this work was to study the pattern of skin temperature during pregnancy, to establish skin temperature reference values and to find correlations between these and the pregnant population characteristics. Sixty-one healthy pregnant women (mean age 30.6 ± 5.1 years) in the 8th-40th gestational week with normal pregnancies were examined in 31 regions of interest (ROI). The ROIs were defined all over the body in order to determine the most influenced by factors such as age or body mass index (BMI). The results obtained in this work highlight that in normal pregnant women the skin temperature is symmetrically distributed, with the symmetrical areas differing less than 0.5 °C , with a mean value of 0.25 ± 0.23 °C . This study identified a significant negative correlation between the BMI and temperature. Age has been shown to have great influence on the skin temperature, with a significant increase of temperature observed with age. This work explores a novel medical application of infrared thermography and provides a characterization of thermal skin profile in human pregnancy for a large set of ROIs while also evaluating the effects of age and BMI.

  7. Reflectance Confocal Mıcroscopy; Morphology of Normal Skin and The Use in Melanocytic Lesions

    Directory of Open Access Journals (Sweden)

    Aslı Vefa Turgut Erdemir

    2013-09-01

    Full Text Available In vivo reflectance confocal microscopy (RCM is a noninvasive method that allows imaging of cells and structures in living skin with resolution close to the histological analysis. RCM allows the assessment of dynamic events in the epidermis, papillary dermis and superficial reticular dermis. From the stratum corneum to a depth of a maximum of 350 μm can be analysed. The noninvasive feature of this technique, allows repetitive imaging without any damage to the affected area and to evaluate the response to the treatment. RCM, provides great convenience in assesment of normal skin and particularly in the evaluation of melanocytic lesions due to high contrast features of melanin and melanosomes. In this article morphology of normal skin and features of melanocytic lesions is described with RCM.

  8. Skin-pass rolling I – Studies on roughness transfer and elongation under pure normal loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    The influence of tool roughness in skin-pass or temper rolling of steel strip is investigated focusing on roughness transfer and strip elongation under pure normal loading, i.e. with no tangential shear between tool and workpiece. The process is simulated by an elasto-plastic FE simulation of pla...

  9. Skin-pass rolling II - Studies of roughness transfer under combined normal and tangential loading

    DEFF Research Database (Denmark)

    Kijima, Hideo; Bay, Niels

    2008-01-01

    ) simulation of plane strain indentation in authors’ previous paper [H. Kijima, N. Bay, Skin-pass rolling I—studies on roughness transfer and elongation under pure normal loading, International Journal of Machine Tools and Manufacture, May 2008, accepted for publication] is verified by experimental...

  10. PAX3 expression in normal skin melanocytes and melanocytic lesions (naevi and melanomas.

    Directory of Open Access Journals (Sweden)

    Sandra Medic

    2010-04-01

    Full Text Available Cutaneous Malignant Melanoma is an aggressive form of skin cancer, arising in cutaneous melanocytes. The transcription factor PAX3 regulates melanocyte specification from neural crest cells during development but expression in differentiated melanocytes is uncertain. By contrast it is frequently found in melanomas and naevi and is a marker for melanoma staging and detection. In this study we analysed the expression of PAX3 across the spectrum of melanocytic cells, from normal melanocytes to cells of benign and malignant lesions to better assess its function in these various tissues. Pax3 and PAX3 (italicized refer to the mouse and human gene, respectively; whereas Pax3 and PAX3 (non-italicized refer to the corresponding mouse and human protein.PAX3 expression was analysed by immunohistochemistry and qRT-PCR. Immunofluorescence was used for co-expression with differentiation, migration and survival markers. As expected PAX3 expression was observed in naevi and melanoma cells. It was also found in melanocytes of normal skin where it co-expressed with melanocyte markers, MITF and MLANA. Co-expression with its downstream target, antiapoptotic factor BCL2L1 confirms PAX3 as a cell survival regulator. PAX3 was also co-expressed with melanoma cell migration marker MCAM in dermal naevi and melanoma cell nests, but this downstream target of PAX3 was not present in normal epidermal melanocytes, suggesting differential roles for PAX3 in normal epidermal melanocytes and melanoma cells. Most interestingly, a proportion of PAX3-positive epidermal melanocytes in normal skin show HES1 and Ki67 co-expression, indicating their less differentiated proliferative phenotype.Our results suggest that a previously identified role for PAX3, that of regulator of an undifferentiated plastic state, may operate in melanocytes of normal skin. This role, possibly required for cellular response to environmental stimuli, may contribute to formation and development of melanocytic

  11. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...

  12. Initial comparative response to peak pions and x-rays of normal skin and underlying tissue surrounding superficial metastatic nodules

    Energy Technology Data Exchange (ETDEWEB)

    Kligerman, M.M.; West, G.; Dicello, J.F.

    1976-01-01

    Given the limitations of available material and methods for measuring skin response, the relative biological effectiveness (RBE) for the development and healing of skin reaction to pions in this experiment is 1.43. This is based on data obtained from a patient with malignant melanoma, in whom multiple skin nodules and the surrounding normal skin were randomized into three dose levels for pions and x rays. The RBE for skin reaction was obtained while the skin tumor nodules appeared to regress at least as rapidly with pion therapy as with x rays. Without benefit of adequate observation of time required for nodule regrowth, any estimate of tumor RBE is speculative.

  13. Noncanonical microRNAs and endogenous siRNAs in normal and psoriatic human skin.

    Science.gov (United States)

    Xia, Jing; Joyce, Cailin E; Bowcock, Anne M; Zhang, Weixiong

    2013-02-15

    Noncanonical microRNAs (miRNAs) and endogenous small interfering RNAs (endo-siRNAs) are key gene regulators in eukaryotes. Noncanonical miRNAs, which bypass part of the canonical miRNA biogenesis pathway, can originate from a variety of genomic loci, which include small nucleolar RNAs (snoRNAs), transfer RNAs (tRNAs) and introns, whereas endo-siRNAs can arise from repetitive elements, some of which are transposable. The roles of noncanonical miRNAs and endo-siRNAs in complex diseases have yet to be characterized. To investigate their potential expression and function in psoriasis, we carried out a comprehensive, genome-wide search for noncanonical miRNAs and endo-siRNAs in small RNA deep-sequencing data sets from normal and psoriatic human skin. By analyzing more than 670 million qualified reads from 67 small RNA libraries, we identified 21 novel, noncanonical miRNAs (3 snoRNA-derived and 2 tRNA-derived miRNAs and 16 miRtrons) and 39 novel endo-siRNAs that were expressed in skin. The expression of four novel small RNAs was validated by qRT-PCR in human skin, and their Argonaute association was confirmed by co-immunoprecipitation of ectopic small RNAs in HEK293 cells. Fifteen noncanonical miRNAs or endo-siRNAs were significantly differentially expressed in psoriatic-involved versus normal skin, including an Alu-short interspersed element-derived siRNA which was 17-fold up-regulated in psoriatic-involved skin. These and other differentially expressed small noncoding RNAs may function as regulators of gene expression in skin and potentially play a role in psoriasis pathogenesis.

  14. Assessment of Optical Coherence Tomography Imaging in the Diagnosis of Non-Melanoma Skin Cancer and Benign Lesions Versus Normal Skin:

    DEFF Research Database (Denmark)

    Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke

    2009-01-01

    BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...... the diagnostic accuracy of OCT in differentiating NMSC from benign lesions and normal skin. METHODS AND MATERIALS OCT and polarization-sensitive (PS) OCT from 104 patients were studied. Observer-blinded evaluation of OCT images from 64 BCCs, 1 baso-squamous carcinoma, 39 AKs, two malignant melanomas, nine benign...... lesions, and 105 OCT images from perilesional skin was performed; 50 OCT images of NMSC and 50 PS-OCT images of normal skin were evaluated twice. RESULTS Sensitivity was 79% to 94% and specificity 85% to 96% in differentiating normal skin from lesions. Important features were absence of well...

  15. Upregulation of hypoxia-inducible factors in normal and psoriatic skin.

    Science.gov (United States)

    Rosenberger, Christian; Solovan, Caius; Rosenberger, Alina D; Jinping, Li; Treudler, Regina; Frei, Ulrich; Eckardt, Kai-Uwe; Brown, Lawrence F

    2007-10-01

    Angiogenesis induced by vascular endothelial growth factor (VEGF) plays an important role in psoriasis. Hypoxic adaptation is conferred through hypoxia-inducible transcription factors (HIFs). VEGF and its receptor Flt-1 are HIF target genes. Growth factors and inflammatory cytokines activate the phosphoinositol-3 kinase pathway, and via activated protein kinase B (phospho-Akt) augment HIF activity. Here, we demonstrate that the major oxygen-dependent HIF isoforms are strongly upregulated in psoriatic skin: HIF-1alpha mainly in the epidermis, in an expression pattern similar to VEGF mRNA; HIF-2alpha in both the epidermis and in capillary endothelial cells of the dermis. In contrast, normal human skin shows low expression of HIF-alpha proteins, with the exception of hair follicles, and glands, which strongly express HIF-1alpha. In normal human skin, phospho-Akt appeared in the basal epidermal layer, in hair follicles, and in dermal glands. In contrast, in psoriasis, phospho-Akt expression was low in the epidermis, but markedly enhanced in the dermal capillaries and in surrounding interstitial/inflammatory cells. Our data suggest that hypoxia initiates a potentially self-perpetuating cycle involving HIF, VEGF, and Akt activation, which could drive physiologic growth of hair follicles and skin glands. Furthermore, such a cycle may exist in psoriasis in dermal capillaries and contribute to disease progression.

  16. Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

    Science.gov (United States)

    Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

    1991-12-01

    The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

  17. Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin

    International Nuclear Information System (INIS)

    Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.

    1980-01-01

    The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)

  18. Microbiome: a new era in normal and pathological changes skin studies

    Directory of Open Access Journals (Sweden)

    E. R. Araviiskaia

    2016-01-01

    Full Text Available The paper contains review of studies on microbiota and cutaneous microbiome using modern techniques of methagenomic analysis. The existing data on microflora of normal skin and among the patients with acne, seborrhoeic dermatitis, rosacea atopic dermatitis are consequently analyzed. The interaction between microbiome and innate/adaptive immunity is presented The perspectives of knowledge on microbiome both in dermatology and cosmetology are pointed out.

  19. Canine epidermal lipid sampling by skin scrub revealed variations between different body sites and normal and atopic dogs.

    Science.gov (United States)

    Angelbeck-Schulze, Mandy; Mischke, Reinhard; Rohn, Karl; Hewicker-Trautwein, Marion; Naim, Hassan Y; Bäumer, Wolfgang

    2014-07-10

    Previously, we evaluated a minimally invasive epidermal lipid sampling method called skin scrub, which achieved reproducible and comparable results to skin scraping. The present study aimed at investigating regional variations in canine epidermal lipid composition using the skin scrub technique and its suitability for collecting skin lipids in dogs suffering from certain skin diseases. Eight different body sites (5 highly and 3 lowly predisposed for atopic lesions) were sampled by skin scrub in 8 control dogs with normal skin. Additionally, lesional and non-lesional skin was sampled from 12 atopic dogs and 4 dogs with other skin diseases by skin scrub. Lipid fractions were separated by high performance thin layer chromatography and analysed densitometrically. No significant differences in total lipid content were found among the body sites tested in the control dogs. However, the pinna, lip and caudal back contained significantly lower concentrations of ceramides, whereas the palmar metacarpus and the axillary region contained significantly higher amounts of ceramides and cholesterol than most other body sites. The amount of total lipids and ceramides including all ceramide classes were significantly lower in both lesional and non-lesional skin of atopic dogs compared to normal skin, with the reduction being more pronounced in lesional skin. The sampling by skin scrub was relatively painless and caused only slight erythema at the sampled areas but no oedema. Histological examinations of skin biopsies at 2 skin scrubbed areas revealed a potential lipid extraction from the transition zone between stratum corneum and granulosum. The present study revealed regional variations in the epidermal lipid and ceramide composition in dogs without skin abnormalities but no connection between lipid composition and predilection sites for canine atopic dermatitis lesions. The skin scrub technique proved to be a practicable sampling method for canine epidermal lipids, revealed

  20. Expression of S100 protein family members in normal skin and sweat gland tumors.

    Science.gov (United States)

    Zhu, Li; Okano, Shinji; Takahara, Masakazu; Chiba, Takahito; Tu, Yating; Oda, Yoshinao; Furue, Masutaka

    2013-06-01

    Despite our growing knowledge regarding the biology of S100 family proteins in cancers and internal diseases, limited data are available with their distribution in normal skin and in sweat gland tumors. To study the expression and distribution pattern of multiple S100 proteins in normal skin and in the tumors of sweat glands. Immunohistological staining was performed using S100A2, S100A4, S100A6, S100A7, S100A8/9, S100A11, and S100P in 41 cases of various kinds of sweat gland tumors and in 13 cases of normal skin. In normal skin, S100A2, S100A6, S100A7, and S100P staining were observed in the sweat glands. S100A2 positively stained in the outer layer of the eccrine duct. S100A6 immunolabeling was observed in the secretory portion of the eccrine gland. Myoepithelial cells of the apocrine gland were positive for S100A2 and S100A6. S100A7 was positive in the acrosyringium, ductal, and secretory portions of the eccrine gland and in the inner layer of the apocrine gland. Intense S100P staining was detected in the inner layer of the acrosyringium and eccrine ducts. Langerhans cells and melanocytes showed strong immunoreactivity to S100A4. Extramammary Paget's disease (EMPD) expressed S100A7 and S100P with partial S100A6 and S1004 staining. Eccrine poroma expressed S100A2 and S100A7 with partial labeling with S100A6. Syringoma expressed S100A2, S1007, and S100P. Apocrine hidrocystoma expressed S100A2 with partial S100A6 and S100A7 immunoreactivity. Syringocystadenoma papilliferum expressed S100A2, S100A6, S100A7, and S100P. S100A2, S100A6, S100A7, and S100P proteins are specifically involved in structure-related distribution and are potentially useful for differential diagnoses of sweat gland tumors. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  1. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  2. Minimal erythema response (MED to solar simulated irradiation in normal Indian skin

    Directory of Open Access Journals (Sweden)

    Mehta Rai Vandana

    2004-09-01

    Full Text Available BACKGROUND: Phototesting is an essential tool in the investigation of photodermatoses. AIMS: The main aim was to study the cutaneous response to UVR in terms of minimal erythema dose (MED to both UVA and UVB in normal Indian subjects with a solar simulator and to study the relationship of skin type to MED. METHODS: One hundred healthy volunteers not on any medication and without any history of photodermatoses were phototested using a solar simulator with whole spectrum irradiation (UVA, UVB and visible light and only visible and UVA radiation. The tested areas were marked with gentian violet and readings were taken after 24 hrs. RESULTS: Of the 100 volunteers, 48% were males and 52% were females, with a mean age of 36.6 ± 11.6 yrs. The most common skin type among Indians was type 5 (46% followed by type 4 (41%. The mean MED for UVB was 61.5 ± 17.25J/cm2. The MED for UVA could not be determined as none of the patients showed any erythema after irradiation for 45 minutes. CONCLUSIONS: As the MED is found to be low in idiopathic acquired photodermatoses, the MED in the normal population could serve as a baseline data in the investigation.

  3. Dynamic infrared imaging of cutaneous melanoma and normal skin in patients treated with BNCT

    Energy Technology Data Exchange (ETDEWEB)

    Santa Cruz, G.A. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)], E-mail: santacr@cnea.gov.ar; Bertotti, J.; Marin, J. [Universidad Favaloro, Solis 453 (1078), Buenos Aires (Argentina); Gonzalez, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina); CONICET, Avda. Rivadavia 1917 (1033), Buenos Aires (Argentina); Gossio, S. [FCEyN, Pabellon II, Ciudad Universitaria (1428), Buenos Aires (Argentina); Alvarez, D. [Fundacion Favaloro, Av. Belgrano 1746 (1093), Buenos Aires (Argentina); Roth, B.M.C.; Menendez, P. [Instituto de Oncologia Angel H. Roffo, Av. San Martin 5481 (1417), Buenos Aires (Argentina); Pereira, M.D. [Agencia Nacional de Promocion Cientifica y Tecnologica, PAV 22393 (Argentina); Albero, M.; Cubau, L.; Orellano, P. [INVAP S.E., F.P. Moreno 1089 (R8400AMU), S.C. de Bariloche, Rio Negro (Argentina); Liberman, S.J. [Dpto. de Instrumentacion y Control, Comision Nacional de Energia Atomica, Av. del Libertador 8250 (1429), Buenos Aires (Argentina)

    2009-07-15

    We recently initiated a program aimed to investigate the suitability of dynamic infrared imaging for following-up nodular melanoma patients treated with BNCT. The reason that makes infrared imaging attractive is the fact that it constitutes a functional and non-invasive imaging method, providing information on the normal and abnormal physiologic response of the nervous and vascular systems, as well as the local metabolic rate and inflammatory processes that ultimately appear as differences in the skin temperature. An infrared camera, with a focal plane array of 320x240 uncooled ferroelectric detectors is employed, which provides a video stream of the infrared emission in the 7-14 {mu}m wavelength band. A double blackbody is used as reference for absolute temperature calibration. After following a protocol for patient preparation and acclimatization, a basal study is performed. Subsequently, the anatomic region of interest is subjected to a provocation test (a cold stimulus), which induces an autonomic vasoconstriction reflex in normal structures, thus enhancing the thermal contrast due to the differences in the vasculature of the different skin regions. Radiation erythema reactions and melanoma nodules possess typically a faster temperature recovery than healthy, non-irradiated skin. However, some other non-pathological structures are also detectable by infrared imaging, (e.g. scars, vessels, arteriovenous anastomoses and injuries), thus requiring a multi-study comparison in order to discriminate the tumor signal. Besides the superficial nodules, which are readily noticeable by infrared imaging, we have detected thermal signals that are coincident with the location of non-palpable nodules, which are observable by CT and ultrasound. Diffuse regions of fast temperature recovery after a cold stimulus were observed between the third and sixth weeks post-BNCT, concurrent with the clinical manifestation of radiation erythema. The location of the erythematous visible and

  4. Dynamic infrared imaging of cutaneous melanoma and normal skin in patients treated with BNCT

    International Nuclear Information System (INIS)

    Santa Cruz, G.A.; Bertotti, J.; Marin, J.; Gonzalez, S.J.; Gossio, S.; Alvarez, D.; Roth, B.M.C.; Menendez, P.; Pereira, M.D.; Albero, M.; Cubau, L.; Orellano, P.; Liberman, S.J.

    2009-01-01

    We recently initiated a program aimed to investigate the suitability of dynamic infrared imaging for following-up nodular melanoma patients treated with BNCT. The reason that makes infrared imaging attractive is the fact that it constitutes a functional and non-invasive imaging method, providing information on the normal and abnormal physiologic response of the nervous and vascular systems, as well as the local metabolic rate and inflammatory processes that ultimately appear as differences in the skin temperature. An infrared camera, with a focal plane array of 320x240 uncooled ferroelectric detectors is employed, which provides a video stream of the infrared emission in the 7-14 μm wavelength band. A double blackbody is used as reference for absolute temperature calibration. After following a protocol for patient preparation and acclimatization, a basal study is performed. Subsequently, the anatomic region of interest is subjected to a provocation test (a cold stimulus), which induces an autonomic vasoconstriction reflex in normal structures, thus enhancing the thermal contrast due to the differences in the vasculature of the different skin regions. Radiation erythema reactions and melanoma nodules possess typically a faster temperature recovery than healthy, non-irradiated skin. However, some other non-pathological structures are also detectable by infrared imaging, (e.g. scars, vessels, arteriovenous anastomoses and injuries), thus requiring a multi-study comparison in order to discriminate the tumor signal. Besides the superficial nodules, which are readily noticeable by infrared imaging, we have detected thermal signals that are coincident with the location of non-palpable nodules, which are observable by CT and ultrasound. Diffuse regions of fast temperature recovery after a cold stimulus were observed between the third and sixth weeks post-BNCT, concurrent with the clinical manifestation of radiation erythema. The location of the erythematous visible and

  5. DNA methylation combinations in adjacent normal colon tissue predict cancer recurrence: evidence from a clinical cohort study.

    Directory of Open Access Journals (Sweden)

    Jen Chun Kuan

    Full Text Available Accumulating evidence has suggested the requirement for further stratification of patients in the same tumor stage according to molecular factors. We evaluate the combination of cancer stage and DNA methylation status as an indicator of the risk of recurrence and mortality among patients with colorectal cancer (CRC. A cohort study of 215 patients with CRC (mean age 64.32 years; 50.5% of men from Tri-Service General Hospital in Taiwan examined the association between cancer stage and risk of CRC recurrence and mortality. A Cox proportional hazard model was used to analyze patient methylation status and clinical information at study entry, and their associations with CRC recurrence and mortality during follow-up. The advanced stage patients with p16, hMLH1, and MGMT methylation were associated with higher risk of CRC recurrence compared with the local stage patients with unmethylation status in tumor tissues, with adjusted hazard ratios (HRs (95% confidence interval [CI] of 9.64 (2.92-31.81, 8.29 (3.40-20.22, and 11.83 (3.49-40.12, respectively. When analyzing normal tissues, we observed similar risk of CRC recurrence with adjusted HRs (95% CI of 10.85 (4.06-28.96, 9.04 (3.79-21.54, and 12.61 (4.90-32.44, respectively. For combined analyses, the risk of recurrence in the patients in advanced stage with DNA methylation in both normal and tumor tissues, compared with local stage with unmethylation, was increased with adjusted HR (95% CI of 9.37 (3.36-26.09. In the advanced stage patients, methylation status and tissue subtype were associated with increased risk of 5-year cumulative CRC recurrence (p < 0.001. This study demonstrates that clustering DNA methylation status according to cancer stage and tissue subtype is critical for the assessment of risk of recurrence in CRC patients and also indicated an underlying mechanism.

  6. Gene expression in normal-appearing tissue adjacent to prostate cancers are predictive of clinical outcome: evidence for a biologically meaningful field effect

    Science.gov (United States)

    Magi-Galluzzi, Cristina; Maddala, Tara; Falzarano, Sara Moscovita; Cherbavaz, Diana B.; Zhang, Nan; Knezevic, Dejan; Febbo, Phillip G.; Lee, Mark; Lawrence, Hugh Jeffrey; Klein, Eric A.

    2016-01-01

    Purpose We evaluated gene expression in histologically normal-appearing tissue (NT) adjacent to prostate tumor in radical prostatectomy specimens, assessing for biological significance based on prediction of clinical recurrence (cR - metastatic disease or local recurrence). Results A total of 410 evaluable patients had paired tumor and NT. Fortysix genes, representing diverse biological pathways (androgen signaling, stromal response, stress response, cellular organization, proliferation, cell adhesion, and chromatin remodeling) were associated with cR in NT (FDR < 20%), of which 39 concordantly predicted cR in tumor (FDR < 20%). Overall GPS and its stromal response and androgen-signaling gene group components also significantly predicted time to cR in NT (RM-corrected HR/20 units = 1.25; 95% CI: 1.01-1.56; P = 0.024). Experimental Design Expression of 732 genes was measured by quantitative reverse transcriptase polymerase chain reaction (RT-PCR) separately in tumor and adjacent NT specimens from 127 patients with and 374 without cR following radical prostatectomy for T1/T2 prostate cancer. A 17-gene expression signature (Genomic Prostate Score [GPS]), previously validated to predict aggressive prostate cancer when measured in tumor tissue, was also assessed using pre-specified genes and algorithms. Analysis used Cox proportional hazards models, Storey's false discovery rate (FDR) control, and regression to the mean (RM) correction. Conclusions Gene expression profiles, including GPS, from NT adjacent to tumor can predict prostate cancer outcome. These findings suggest that there is a biologically significant field effect in primary prostate cancer that is a marker for aggressive disease. PMID:27121323

  7. Site-specific keloid fibroblasts alter the behaviour of normal skin and normal scar fibroblasts through paracrine signalling.

    Directory of Open Access Journals (Sweden)

    Kevin J Ashcroft

    Full Text Available Keloid disease (KD is an abnormal cutaneous fibroproliferative disorder of unknown aetiopathogenesis. Keloid fibroblasts (KF are implicated as mediators of elevated extracellular matrix deposition. Aberrant secretory behaviour by KF relative to normal skin fibroblasts (NF may influence the disease state. To date, no previous reports exist on the ability of site-specific KF to induce fibrotic-like phenotypic changes in NF or normal scar fibroblasts (NS by paracrine mechanisms. Therefore, the aim of this study was to investigate the influence of conditioned media from site-specific KF on the cellular and molecular behaviour of both NF and NS enabled by paracrine mechanisms. Conditioned media was collected from cultured primary fibroblasts during a proliferative log phase of growth including: NF, NS, peri-lesional keloid fibroblasts (PKF and intra-lesional keloid fibroblasts (IKF. Conditioned media was used to grow NF, NS, PKF and IKF cells over 240 hrs. Cellular behavior was monitored through real time cell analysis (RTCA, proliferation rates and migration in a scratch wound assay. Fibrosis-associated marker expression was determined at both protein and gene level. PKF conditioned media treatment of both NF and NS elicited enhanced cell proliferation, spreading and viability as measured in real time over 240 hrs versus control conditioned media. Following PKF and IKF media treatments up to 240 hrs, both NF and NS showed significantly elevated proliferation rates (p<0.03 and migration in a scratch wound assay (p<0.04. Concomitant up-regulation of collagen I, fibronectin, α-SMA, PAI-1, TGF-β and CTGF (p<0.03 protein expression were also observed. Corresponding qRT-PCR analysis supported these findings (P<0.03. In all cases, conditioned media from growing marginal PKF elicited the strongest effects. In conclusion, primary NF and NS cells treated with PKF or IKF conditioned media exhibit enhanced expression of fibrosis-associated molecular markers

  8. Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.

    Science.gov (United States)

    Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan

    2003-12-01

    Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.

  9. Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment

    Science.gov (United States)

    Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.

    2011-01-01

    Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404

  10. Angiogenic response pattern during normal and impaired skin flap re-integration in mice: a comparative study.

    Science.gov (United States)

    Schürmann, Christoph; Schmidt, Nadine; Seitz, Oliver; Pfeilschifter, Josef; Frank, Stefan

    2014-12-01

    Distal skin flap necrosis represents a severe complication in surgery. This study investigated angiogenic responses in healthy and impaired pedicled skin flap tissue in normal and diabetic mice. Histologic, qRT-PCR, ELISA and immunoblot techniques determined expression and localization of angiogenesis-related growth factors, receptors and cell types upon skin flap re-integration. Skin flap tissue re-integration was severely disturbed in diabetic mice. Impaired skin flap tissue lost early VEGF expression from wound margin keratinocytes and markedly reduced expression of endothelium-specific receptors Tie-2 and FLT-1. Numbers of blood vessels were reduced in impaired flaps. In addition, HIF-1α protein was absent from disturbed skin flap tissue. Reduced VEGF expression and the loss of epithelium in disturbed skin flaps were paralleled by the appearance of VEGF expressing inflammatory infiltrate. In summary, our data show a dysregulated spatial and temporal pattern of angiogenic processes during skin flap re-integration in diabetic mice. Our data suggest that reduced expression of angiogenic receptors in skin flap tissue might contribute to a loss of VEGF function in impaired tissue. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  11. Ki-67 Expression in Sclerosing Adenosis and Adjacent Normal Breast Terminal Ductal Lobular Units: A Nested Case-Control Study from the Mayo Benign Breast Disease Cohort

    Science.gov (United States)

    Nassar, Aziza; Hoskin, Tanya L.; Stallings-Mann, Melody L.; Degnim, Amy C.; Radisky, Derek C.; Frost, Marlene H.; Vierkant, Robert A.; Hartmann, Lynn C.; Visscher, Daniel W.

    2015-01-01

    Purpose Sclerosing adenosis (SA) increases risk for invasive breast cancer (BC) 2.1 times relative to that in the general population. Here, we sought to evaluate whether the proliferation marker Ki-67 stratifies risk among women with SA. Methods A nested case-control sample of patients with SA was obtained from the Mayo Clinic Benign Breast Disease Cohort. Ki-67 expression was evaluated in SA lesions and in the adjacent normal terminal duct lobular units (TDLU) in women who did (cases, n =133) or did not (controls, n =239) develop BC. Ki67 was scored by intensity and number of positively stained cells per one high-power field (magnification, ×40) (40×HPF) for both SA and normal TDLU. Associations of Ki-67 expression with case-control status were assessed using conditional logistic regression. Results Higher Ki-67 expression was significantly associated with case-control status in both SA (P=.03) and normal background TDLU (P=.006). For the SA lesion, >2 average positively stained cells/40×HPF showed an adjusted odds ratio (OR) of 1.9 (95% CI, 1.1–3.4) compared to samples with an average of ≤2 positively stained cells. For background TDLU, lobules with >2 but ≤6 average positively stained cells showed an adjusted OR of 1.3 to 1.5, whereas those with an average of >6 positively stained cells had an OR of 2.4 (95% CI, 1.1–5.3) compared to those with an average of <2 positively stained cells. Conclusions Among women with SA, increased Ki-67 expression in either the SA lesion or the normal background TDLU carried an approximately 2-fold increased odds of subsequent BC as compared to lower Ki-67 expression. PMID:25863475

  12. Spectrophotometer is useful for assessing vitiligo and chemical leukoderma severity by quantifying color difference with surrounding normally pigmented skin.

    Science.gov (United States)

    Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T

    2017-10-22

    Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Differential expression of cyclin D1, Ki‑67, pRb, and p53 in psoriatic skin lesions and normal skin.

    Science.gov (United States)

    Kim, Sung Ae; Ryu, Young Wook; Kwon, Jun Il; Choe, Mi Sun; Jung, Jin Woong; Cho, Jae We

    2018-01-01

    Psoriasis is a hyperproliferative inflammatory skin disease; therefore, it is highly likely that psoriatic skin lesions may transform into malignancies. However, malignant transformation is not common. We performed immunohistochemical studies using anti‑cyclin D1, anti‑cyclin E, anti‑pRb, anti‑p53, anti‑p16INK4a, and anti‑Ki‑67 antibodies in normal skin, psoriatic epidermal tissue, and squamous cell carcinoma (SCC) tissue. Furthermore, western blot analysis and immunohistochemical staining were performed to ascertain differences in cyclin D1, cyclin E, pRb, and Ki‑67 expression before and after treatment for psoriasis. Cyclin D1 expression was higher in chronic psoriatic lesions than that in normal epidermis. Psoriasis lesions showed a strong intensity of positive nuclear staining for cyclin D1 among several normally stained nuclei in the basal layer. Cyclin E expression in psoriasis was stronger in the granular and spinous layer than in the normal epidermis. Expression levels of pRb and p53 were found to be higher in the psoriasis group compared with the normal epidermis. Total basal layer cell counts for p53WT expression were found to be significantly higher in the psoriasis group compared with the normal group. However, p16 expression was very weak in the normal and psoriasis groups compared with that in the SCC group. Ki‑67 immunoreactivity was significantly higher in psoriasis compared with normal epidermis and was similar with that in the SCC group. According to immunohistochemistry and immunoblot analysis, the expression levels of cyclin D1, cyclin E, pRb, and Ki‑67 in psoriasis lesions decreased after treatment and were similar with those in the normal group. Thus, increased expression of cyclin D1 and cyclin E may be involved in cell cycle progression in psoriatic epidermis, and pRb and p53 may play important roles in the prevention of malignant transformation under the hyperproliferative state in psoriasis.

  14. Genetic deletion of amphiregulin restores the normal skin phenotype in a mouse model of the human skin disease tylosis

    Directory of Open Access Journals (Sweden)

    Vishnu Hosur

    2017-08-01

    Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.

  15. Characterization of skin friction coefficient, and relationship to stratum corneum hydration in a normal Chinese population.

    Science.gov (United States)

    Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q

    2011-01-01

    Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.

  16. Differential gene expression profiling in aggressive bladder transitional cell carcinoma compared to the adjacent microscopically normal urothelium by microdissection-SMART cDNA PCR-SSH.

    Science.gov (United States)

    Wang, H T; Ma, F L; Ma, X B; Han, R F; Zhang, Y B; Chang, J W

    2006-01-01

    Identifying novel and known genes that are differentially expressed in aggressive bladder transitional cell carcinoma (BTCC) has important implications in understanding the biology of bladder tumorigenesis and developing new diagnostic and therapeutic agents. In this study we identified the differential gene expression profiles comparing tumor to the adjacent microscopically normal mucosa by manual microdissection on frozen sections. The RNAs extracted from microdissected tissues were amplified by SMART cDNA PCR technology to generate forward subtractive cDNA library by suppressive subtractive hybridization (SSH). We obtained 376 positive clones, one hundred clones of aggressive BTCC subtracted cDNA library were selected at random and inserts were reamplified by PCR. After differential screening by reverse dot blotting, 73 positive clones, that contend inserts putatively upregulated in aggressive BTCC, were further analysed by DNA sequencing, GenBank and EST database searching. Sequencing results showed that 66 clones stand for 23 known genes and 7 clones for three new EST (Genbank number: DN236875, DN236874 and DN236873). In conclusion, microdissection-SMART cDNA PCR-SSH allowed for an efficient way to identify aggressive BTCC-specific differential expressed genes that may potentially be involved in the carcinogenesis and/or progression of aggressive BTCC. These differentially expressed genes may be of potential utility as therapeutic and diagnostic targets for aggressive BTCC.

  17. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  18. Exploring the spatial dimension of estrogen and progesterone signaling: detection of nuclear labeling in lobular epithelial cells in normal mammary glands adjacent to breast cancer.

    Science.gov (United States)

    Grote, Anne; Abbas, Mahmoud; Linder, Nina; Kreipe, Hans H; Lundin, Johan; Feuerhake, Friedrich

    2014-01-01

    Comprehensive spatial assessment of hormone receptor immunohistochemistry staining in digital whole slide images of breast cancer requires accurate detection of positive nuclei within biologically relevant regions of interest. Herein, we propose a combination of automated region labeling at low resolution and subsequent detailed tissue evaluation of subcellular structures in lobular structures adjacent to breast cancer, as a proof of concept for the approach to analyze estrogen and progesterone receptor expression in the spatial context of surrounding tissue. Routinely processed paraffin sections of hormone receptor-negative ductal invasive breast cancer were stained for estrogen and progesterone receptor by immunohistochemistry. Digital whole slides were analyzed using commercially available image analysis software for advanced object-based analysis, applying textural, relational, and geometrical features. Mammary gland lobules were targeted as regions of interest for analysis at subcellular level in relation to their distance from coherent tumor as neighboring relevant tissue compartment. Lobule detection quality was evaluated visually by a pathologist. After rule set optimization in an estrogen receptor-stained training set, independent test sets (progesterone and estrogen receptor) showed acceptable detection quality in 33% of cases. Presence of disrupted lobular structures, either by brisk inflammatory infiltrate, or diffuse tumor infiltration, was common in cases with lower detection accuracy. Hormone receptor detection tended towards higher percentage of positively stained nuclei in lobules distant from the tumor border as compared to areas adjacent to the tumor. After adaptations of image analysis, corresponding evaluations were also feasible in hormone receptor positive breast cancer, with some limitations of automated separation of mammary epithelial cells from hormone receptor-positive tumor cells. As a proof of concept for object-oriented detection of

  19. Mast cells and atopic dermatitis. Stereological quantification of mast cells in atopic dermatitis and normal human skin

    DEFF Research Database (Denmark)

    Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt

    1997-01-01

    at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... the clinical score and the number of mast cell profiles per millimetre squared. Using stereological techniques, this study indicated that mast cells might participate in the inflammatory process in skin leading to atopic dermatitis....

  20. Normalization.

    Science.gov (United States)

    Cuevas, Eduardo J.

    1997-01-01

    Discusses cornerstone of Montessori theory, normalization, which asserts that if a child is placed in an optimum prepared environment where inner impulses match external opportunities, the undeviated self emerges, a being totally in harmony with its surroundings. Makes distinctions regarding normalization, normalized, and normality, indicating how…

  1. An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments

    Science.gov (United States)

    2014-03-27

    sensors, and magnetic sensors, placed along the US border. The system was implemented as a force-multiplication measure; with over 6000 miles to cover...Distributed spacing stochastic feature selection and its application to textile classification [7], • Dismount threat recognition through automatic pose...to Textile Classification”. 2011. [8] Costin, Gertrude-E and Vincent J. Hearing. “Human skin pigmentation: melanocytes modulate skin color in

  2. Full-field electroretinogram recorded with skin electrodes in normal adults

    Directory of Open Access Journals (Sweden)

    Arthur Gustavo Fernandes

    Full Text Available ABSTRACT Purpose: Alternative recording methods have been tested to allow the electroretinogram (ERG recording in uncooperative patients and/or patients with palpebral alterations, including recordings with skin electrodes. The purpose of this study was to compare ERG recorded with skin electrodes and well-established microfiber electrodes and to determine normative values of ERG parameters for recording with skin electrodes. Methods: Fifty healthy volunteers (17-26 years; mean 20.63 ± 2.01 years participated in the study. A gold disk skin electrode was placed on the lower orbital rim of a randomly chosen eye. On the contralateral eye, a microfiber electrode was positioned in the lower conjunctival sac. Gold disc electrodes were positioned at the ipsilateral outer canthus of both eyes acting as reference electrodes for the creation of a potential difference. Two ground electrodes were placed on the lobe of each ear. ERGs were recorded according to the International Society of Clinical Electrophysiology Visual (ISCEV protocol using the VERIS 5.1.9 system for data acquisition and analysis. Results: Both types of electrodes showed similar wave response morphologies. The implicit time of responses between the two electrodes was comparable. On peak-to-peak amplitude, skin electrode recordings showed an amplitude reduction of 61.4% for rod responses, 61.5% for maximal responses, 46.2% for oscillatory potentials, 57.4% for cone responses, and 54.4% for 30Hz-flicker responses, when compared with microfiber electrode recordings. Based on these findings, normative values for peak-to-peak amplitude and implicit time to be used as a reference for ERGs recorded with skin electrodes were determined. Conclusions: ERGs recorded with skin electrodes presented lower peak-to-peak amplitude compared with microfiber electrodes. However, using appropriate normative values, skin electrodes may be useful for specific target populations such as uncooperative infants

  3. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  4. Macro-environment of breast carcinoma: frequent genetic alterations in the normal appearing skins of patients with breast cancer.

    Science.gov (United States)

    Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A

    2008-05-01

    Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.

  5. Characteristic differences in barrier and hygroscopic properties between normal and cosmetic dry skin. II. Depth profile of natural moisturizing factor and cohesivity.

    Science.gov (United States)

    Feng, L; Chandar, P; Lu, N; Vincent, C; Bajor, J; McGuiness, H

    2014-06-01

    In a previous paper (Lu et al., International Journal of Cosmetic Science, in press), we reported that in comparison with normal skin, cosmetic dry skin characteristically has a thicker stratum corneum (SC) with weaker barrier quality. Our goal here was to obtain a more complete picture of the difference between normal and cosmetic dry skin, by further analysing the data collected from the same clinical study to address two additional aspects of skin: the amount and depth profile of natural moisturizing factor (NMF) and the cohesivity of the SC. The SC samples were collected by sequential tape stripping in a clinical study consisting of 64 healthy Caucasian female subjects with either normal or cosmetic dry skin. Protein and free amino acids (FAA) on tape strips were extracted and analysed using high-throughput methods. The level of pyrrolidone carboxylic acid (PCA), the prominent component of NMF, was detected using HPLC analysis. It was found that dry skin had significantly lower ratios of FAA/protein and PCA/protein across the stripped SC depth, corresponding to a lower hydration level compared with the normal skin. Our results indicated that filaggrin to FAA hydrolysis occurred deeper in dry skin and at a lower level compared with normal skin. In addition, the mass of proteins stripped from dry skin subjects was significantly higher than that from the normal skin counterpart, especially for the first 10-12 tape strips. Our results showed that, compared with normal skin, cosmetic dry skin had a lower NMF level across the SC depth and a lower cohesivity. Such results suggested that NMF levels are critical for cosmetic skin conditions, and lower NMF production may be associated with dry skin. In addition, the NMF level and its depth profile and the SC cohesivity are useful clinical end points for assessing the efficacy of dry skin treatments such as skin moisturizers. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  6. A reliable, non-invasive measurement tool for anisotropy in normal skin and scar tissue

    NARCIS (Netherlands)

    Verhaegen, Pauline D. H. M.; Res, Evelien M.; van Engelen, Arna; Middelkoop, Esther; van Zuijlen, Paul P. M.

    2010-01-01

    Anisotropy of the skin varies depending on different locations and pathological conditions. Currently, no reliable non-invasive measurement tool is available for tissue anisotropy. The Reviscometer is an anisotropy measurement tool that measures the resonance running time (RRT) of a shock wave. This

  7. T-cell receptor gamma delta bearing cells in normal human skin

    NARCIS (Netherlands)

    Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.

    1990-01-01

    T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+

  8. Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa

    DEFF Research Database (Denmark)

    Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus

    2017-01-01

    were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...

  9. Discrimination of basal cell carcinoma and melanoma from normal skin biopsies in vitro through Raman spectroscopy and principal component analysis.

    Science.gov (United States)

    Bodanese, Benito; Silveira, Fabrício Luiz; Zângaro, Renato Amaro; Pacheco, Marcos Tadeu T; Pasqualucci, Carlos Augusto; Silveira, Landulfo

    2012-07-01

    Raman spectroscopy has been employed to discriminate between malignant (basal cell carcinoma [BCC] and melanoma [MEL]) and normal (N) skin tissues in vitro, aimed at developing a method for cancer diagnosis. Raman spectroscopy is an analytical tool that could be used to diagnose skin cancer rapidly and noninvasively. Skin biopsy fragments of ≈ 2 mm(2) from excisional surgeries were scanned through a Raman spectrometer (830 nm excitation wavelength, 50 to 200 mW of power, and 20 sec exposure time) coupled to a fiber optic Raman probe. Principal component analysis (PCA) and Euclidean distance were employed to develop a discrimination model to classify samples according to histopathology. In this model, we used a set of 145 spectra from N (30 spectra), BCC (96 spectra), and MEL (19 spectra) skin tissues. We demonstrated that principal components (PCs) 1 to 4 accounted for 95.4% of all spectral variation. These PCs have been spectrally correlated to the biochemicals present in tissues, such as proteins, lipids, and melanin. The scores of PC2 and PC3 revealed statistically significant differences among N, BCC, and MEL (ANOVA, p<0.05) and were used in the discrimination model. A total of 28 out of 30 spectra were correctly diagnosed as N, 93 out of 96 as BCC, and 13 out of 19 as MEL, with an overall accuracy of 92.4%. This discrimination model based on PCA and Euclidean distance could differentiate N from malignant (BCC and MEL) with high sensitivity and specificity.

  10. Percutaneous absorption of salicylic acid after repeated (14-day) in vivo administration to normal, acnegenic or aged human skin.

    Science.gov (United States)

    Davis, D A; Kraus, A L; Thompson, G A; Olerich, M; Odio, M R

    1997-08-01

    The objective of the present work was to determine the relative bioavailability of salicylic acid (SA) after repeated (14-day) topical application to subjects who presented normal, acnegenic, or photodamaged facial skin. To emulate exposure characteristics likely to be encountered by subjects in these two subpopulations, individuals presenting facial acne were treated with 2% SA in a hydroalcoholic vehicle, and volunteers with aged or photodamaged skin received a comparable topical dose of SA in a cream (moisturizer-like) vehicle. Plasma concentration-time profiles and cumulative urinary excretion of SA were measured after the last dose in subjects who had received 15 consecutive daily topical applications of 27 mg of SA or oral doses of 81 mg of acetylsalicylic acid (ASA). The rate and extent of percutaneous absorption of SA were not affected by facial skin condition. Faster rates of absorption (Cmax) were obtained with a hydroalcoholic compared with a cream vehicle. Systemic SA exposures were at least five-fold higher with oral ASA than topical SA. Based on systemic salicylate concentrations resulting from ingestion of 81 mg of ASA, these results support that patients without gross skin disorders are at minimal risk of adverse systemic effects from routine use of topical products containing 2% SA.

  11. Topical apigenin improves epidermal permeability barrier homoeostasis in normal murine skin by divergent mechanisms.

    Science.gov (United States)

    Hou, Maihua; Sun, Richard; Hupe, Melanie; Kim, Peggy L; Park, Kyungho; Crumrine, Debra; Lin, Tzu-Kai; Santiago, Juan Luis; Mauro, Theodora M; Elias, Peter M; Man, Mao-Qiang

    2013-03-01

    The beneficial effects of certain herbal medicines on cutaneous function have been appreciated for centuries. Among these agents, chrysanthemum extract, apigenin, has been used for skin care, particularly in China, for millennia. However, the underlying mechanisms by which apigenin benefits the skin are not known. In this study, we first determined whether topical apigenin positively influences permeability barrier homoeostasis, and then the basis thereof. Hairless mice were treated topically with either 0.1% apigenin or vehicle alone twice daily for 9 days. At the end of the treatments, permeability barrier function was assessed with either an electrolytic water analyzer or a Tewameter. Our results show that topical apigenin significantly enhanced permeability barrier homoeostasis after tape stripping, although basal permeability barrier function remained unchanged. Improved barrier function correlated with enhanced filaggrin expression and lamellar body production, which was paralleled by elevated mRNA levels for the epidermal ABCA12. The mRNA levels for key lipid synthetic enzymes also were upregulated by apigenin. Finally, both cathelicidin-related peptide and mouse beta-defensin 3 immunostaining were increased by apigenin. We conclude that topical apigenin improves epidermal permeability barrier function by stimulating epidermal differentiation, lipid synthesis and secretion, as well as cutaneous antimicrobial peptide production. Apigenin could be useful for the prevention and treatment of skin disorders characterized by permeability barrier dysfunction, associated with reduced filaggrin levels and impaired antimicrobial defenses, such as atopic dermatitis. © 2013 John Wiley & Sons A/S.

  12. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  13. Temporal localization of immunoreactive transforming growth factor beta1 in normal equine skin and in full-thickness dermal wounds.

    Science.gov (United States)

    Theoret, Christine L; Barber, Spencer M; Gordon, John R

    2002-01-01

    To describe the localization of immunoreactive transforming growth factor (TGF)-beta1 in both normal skin and full-thickness dermal wounds of the limb and the thorax of the horse. Six full-thickness excisional wounds were created on the lateral aspect of one metacarpal region and on the midthoracic area of each horse. Sequentially collected tissue specimens from wound margins were assessed for TGF-beta1 expression by immunohistochemistry. Four horses (2 to 4 years of age). A neutralizing monoclonal anti-human TGF-beta1 antibody was used to detect the spatial expression of TGF-beta1 protein by immunohistochemical localization in biopsies obtained before wounding and at 12 and 24 hours, and 5, 10, and 14 days. No differences in localization of immunoreactive TGF-beta1 were detected between limb and thorax, for either intact skin or wounds. Unwounded epidermis stained moderately for TGF-beta1 protein throughout all layers, whereas the dermis was relatively devoid of immunoreactivity. During the acute stage of repair, migrating epithelium lost its stain, whereas cells of epidermal appendages remained strongly immunoreactive. The epithelium recovered its TGF-beta1 immunoreactivity during wound remodeling, although cells of the stratum corneum remained negative. Macrophages of the inflammatory exudate had positive cytoplasmic staining that diminished with time. Immunoreactivity of granulation tissue fibroblasts was evident early on and increased throughout the repair process. TGF-beta1 is constitutively expressed in normal, unwounded equine epithelium. Its expression is upregulated within the skin on injury and is associated with the cells involved in wound repair. A more precise understanding of the temporal and spatial expression of TGF-beta1 during wound repair in horses should provide the groundwork for possible future manipulations of both normal and aberrant tissue repair. Copyright 2002 by The American College of Veterinary Surgeons

  14. Research surface resistance of copper normal and abnormal skin-effects depending on the frequency of electromagnetic field

    International Nuclear Information System (INIS)

    Kutovyi, V.A.; Komir, A.I.

    2013-01-01

    The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz

  15. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin

    National Research Council Canada - National Science Library

    Chang, Howard Y

    2008-01-01

    The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...

  16. Impact of overweight on the normal physiology of human in vivo skin

    Directory of Open Access Journals (Sweden)

    Liliana Tavares

    2013-06-01

    Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.

  17. Effect of capping agents on the cytotoxicity of silver nanoparticles in human normal and cancer skin cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)

    2016-11-15

    Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.

  18. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  19. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  20. The Effect of Phototherapy on Cancer Predisposition Genes of Diabetic and Normal Human Skin Fibroblasts

    OpenAIRE

    Chotikasemsri, Pongsathorn; Tangtrakulwanich, Boonsin; Sangkhathat, Surasak

    2017-01-01

    The purpose of this study was to investigate whether LED light at different wavelengths affects the expression profile of 143 cancer predisposition genes in both diabetic and normal human fibroblasts. In this study, both diabetic and normal fibroblast cell lines were cultured and irradiated with red (635 nm), green (520 nm), and blue (465 nm) LED light for 10 minutes at 0.67 J/cm2 each. After that, mRNA from all cell lines was extracted for microarray analysis. We found that green light activ...

  1. Discrimination of Basal Cell Carcinoma from Normal Skin Tissue Using High-Resolution Magic Angle Spinning 1H NMR Spectroscopy.

    Science.gov (United States)

    Mun, Je-Ho; Lee, Heonho; Yoon, Dahye; Kim, Byung-Soo; Kim, Moon-Bum; Kim, Shukmann

    2016-01-01

    High-resolution magic angle spinning nuclear magnetic resonance (HR-MAS NMR) spectroscopy is a useful tool for investigating the metabolism of various cancers. Basal cell carcinoma (BCC) is the most common skin cancer. However, to our knowledge, data on metabolic profiling of BCC have not been reported in the literature. The objective of the present study was to investigate the metabolic profiling of cutaneous BCC using HR-MAS (1)H NMR spectroscopy. HR-MAS (1)H NMR spectroscopy was used to analyze the metabolite profile and metabolite intensity of histopathologically confirmed BCC tissues and normal skin tissue (NST) samples. The metabolic intensity normalized to the total spectral intensities in BCC and NST was compared, and multivariate analysis was performed with orthogonal partial least-squares discriminant analysis (OPLS-DA). P values analysis revealed 9 metabolites that showed statistically significant difference between BCC and NST. In multivariate analysis, the OPLS-DA models built with the HR-MAS NMR metabolic profiles revealed a clear separation of BCC from NST. The receiver operating characteristic curve generated from the results revealed an excellent discrimination of BCC from NST with an area under the curve (AUC) value of 0.961. The present study demonstrated that the metabolite profile and metabolite intensity differ between BCC and NST, and that HR-MAS (1)H NMR spectroscopy can be a valuable tool in the diagnosis of BCC.

  2. The Effect of Phototherapy on Cancer Predisposition Genes of Diabetic and Normal Human Skin Fibroblasts

    Directory of Open Access Journals (Sweden)

    Pongsathorn Chotikasemsri

    2017-01-01

    Full Text Available The purpose of this study was to investigate whether LED light at different wavelengths affects the expression profile of 143 cancer predisposition genes in both diabetic and normal human fibroblasts. In this study, both diabetic and normal fibroblast cell lines were cultured and irradiated with red (635 nm, green (520 nm, and blue (465 nm LED light for 10 minutes at 0.67 J/cm2 each. After that, mRNA from all cell lines was extracted for microarray analysis. We found that green light activates EPHB2, KIT, ANTXR2, ESCO2, MSR1, EXT1, TSC1, KIT, NF1, BUB1B, FANCD2, EPCAM, FANCD2, NF, DIS3L2, and RET in normal fibroblast cells, while blue and red light can upregulate RUNX1, PDGFRA, EHBP1, GPC3, AXIN2, KDR, GLMN, MSMB, EPHB2, MSR1, KIT, FANCD2, BMPR1A, BUB1B, PDE11A, and RET. Therefore, genetic screening before phototherapy treatment may be required.

  3. The Effect of Phototherapy on Cancer Predisposition Genes of Diabetic and Normal Human Skin Fibroblasts.

    Science.gov (United States)

    Chotikasemsri, Pongsathorn; Tangtrakulwanich, Boonsin; Sangkhathat, Surasak

    2017-01-01

    The purpose of this study was to investigate whether LED light at different wavelengths affects the expression profile of 143 cancer predisposition genes in both diabetic and normal human fibroblasts. In this study, both diabetic and normal fibroblast cell lines were cultured and irradiated with red (635 nm), green (520 nm), and blue (465 nm) LED light for 10 minutes at 0.67 J/cm 2 each. After that, mRNA from all cell lines was extracted for microarray analysis. We found that green light activates EPHB2, KIT, ANTXR2, ESCO2, MSR1, EXT1, TSC1, KIT, NF1, BUB1B, FANCD2, EPCAM, FANCD2, NF, DIS3L2, and RET in normal fibroblast cells, while blue and red light can upregulate RUNX1, PDGFRA, EHBP1, GPC3, AXIN2, KDR, GLMN, MSMB, EPHB2, MSR1, KIT, FANCD2, BMPR1A, BUB1B, PDE11A, and RET. Therefore, genetic screening before phototherapy treatment may be required.

  4. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    International Nuclear Information System (INIS)

    Rude, J.M.; Friedberg, E.C.

    1977-01-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity

  5. Semi-conservative deoxyribonucleic acid synthesis in unirradiated and ultraviolet-irradiated xeroderma pigmentosum and normal human skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Rude' e, J.M.; Friedberg, E.C.

    1977-03-01

    Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.

  6. Dermal fibroblast expression of stromal cell-derived factor-1 (SDF-1) promotes epidermal keratinocyte proliferation in normal and diseased skin.

    Science.gov (United States)

    Quan, Chunji; Cho, Moon Kyun; Shao, Yuan; Mianecki, Laurel E; Liao, Eric; Perry, Daniel; Quan, Taihao

    2015-12-01

    Stromal cells provide a crucial microenvironment for overlying epithelium. Here we investigated the expression and function of a stromal cell-specific protein, stromal cell-derived factor-1 (SDF-1), in normal human skin and in the tissues of diseased skin. Immunohistology and laser capture microdissection (LCM)-coupled quantitative real-time RT-PCR revealed that SDF-1 is constitutively and predominantly expressed in dermal stromal cells in normal human skin in vivo. To our surprise, an extremely high level of SDF-1 transcription was observed in the dermis of normal human skin in vivo, evidenced by much higher mRNA expression level than type I collagen, the most abundant and highly expressed protein in human skin. SDF-1 was also upregulated in the tissues of many human skin disorders including psoriasis, basal cell carcinoma (BCC), and squamous cell carcinoma (SCC). Double immunostaining for SDF-1 and HSP47 (heat shock protein 47), a marker of fibroblasts, revealed that fibroblasts were the major source of stroma-cell-derived SDF-1 in both normal and diseased skin. Functionally, SDF-1 activates the ERK (extracellular-signal-regulated kinases) pathway and functions as a mitogen to stimulate epidermal keratinocyte proliferation. Both overexpression of SDF-1 in dermal fibroblasts and treatment with rhSDF-1 to the skin equivalent cultures significantly increased the number of keratinocyte layers and epidermal thickness. Conversely, the stimulative function of SDF-1 on keratinocyte proliferation was nearly completely eliminated by interfering with CXCR4, a specific receptor of SDF-1, or by knock-down of SDF-1 in fibroblasts. Our data reveal that extremely high levels of SDF-1 provide a crucial microenvironment for epidermal keratinocyte proliferation in both physiologic and pathologic skin conditions.

  7. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.

    1987-01-01

    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  8. From Normal Skin to Squamous Cell Carcinoma: A Quest for Novel Biomarkers

    Directory of Open Access Journals (Sweden)

    Vlad Voiculescu

    2016-01-01

    Full Text Available Squamous cells carcinoma (SCC is the second most frequent of the keratinocyte-derived malignancies after basal cell carcinoma and is associated with a significant psychosocial and economic burden for both the patient himself and society. Reported risk factors for the malignant transformation of keratinocytes and development of SCC include ultraviolet light exposure, followed by chronic scarring and inflammation, exposure to chemical compounds (arsenic, insecticides, and pesticides, and immune-suppression. Despite various available treatment methods and recent advances in noninvasive or minimal invasive diagnostic techniques, the risk recurrence and metastasis are far from being negligible, even in patients with negative histological margins and lymph nodes. Analyzing normal, dysplastic, and malignant keratinocyte proteome holds special promise for novel biomarker discovery in SCC that could be used in the future for early detection, risk assessment, tumor monitoring, and development of targeted therapeutic strategies.

  9. p53 induction in normal human skin in vitro following exposure to solar simulated UV and UV-B irradiation.

    Science.gov (United States)

    Davenport, V; Morris, J F; Motazed, R; Chu, A C

    1999-04-01

    Exposure of normal human breast skin ex vivo to physiological levels of UV-B and solar simulated UV results in a UV dose- and time-dependent increase in epidermal p53, as determined by PAGE analysis. Peak p53 levels are detected 12 to 24 h post irradiation with UV-B (470-1410 mJ cm-2) and solar simulated UV (5-12 minimal erythema dose (MED) equivalents). Irradiation with an FS20 UV-B lamp, contaminated with UV-A and UV-C (74-1111 mJ cm-2), also induces peak levels after 12 h incubation at 37 degrees C but these levels persist to 36 h post UV irradiation. In all cases p53 levels start to return to normal by 48 h culture. A significant positive correlation is demonstrated between UV-B dose (47-1645 mJ cm-2) and p53 level (p 0.977) in explants cultured for 24 h at 37 degrees C post irradiation. The FS20 induces a 'UV-B' dose-dependent increase in p53 to a maximum from 370 to 1111 mJ cm-2. Similarly, solar simulated UV induces a plateau of peak p53 induction between 5 and 15 MED equivalents. Immunohistochemical analysis using microwave retrieval on 5 microns sections shows the same pattern of p53 staining with UV-B and solar UV insult, but proves unreliable as a method of quantification. These results suggest that the skin explant model may be a useful tool in the evaluation of UV-induced epidermal cell damage, providing a valuable alternative to in vivo studies.

  10. Whole genome sequencing of matched tumor, adjacent non-tumor tissues and corresponding normal blood samples of hepatocellular carcinoma patients revealed dynamic changes of the mutations profiles during hepatocarcinogenesis.

    Science.gov (United States)

    Mao, Ruifang; Liu, Jie; Liu, Guanfeng; Jin, Shanshan; Xue, Qingzhong; Ma, Liang; Fu, Yan; Zhao, Na; Xing, Jinliang; Li, Lanjuan; Qiu, Yunqing; Lin, Biaoyang

    2017-04-18

    Hepatocellular carcinoma (HCC) has become the third most deadly disease worldwide and HBV is the major factor in Asia and Africa. We conducted 9 WGS (whole genome sequencing) analyses for matched samples of tumor, adjacent non-tumor tissues and normal blood samples of HCC patients from three HBV positive patients. We then validated the mutations identified in a larger cohort of 177 HCC patients. We found that the number of the unique somatic mutations (average of 59,136) in tumor samples is significantly less than that in adjacent non-tumor tissues (average 83, 633). We discovered that the TP53 R249S mutation occurred in 7.7% of the HCC patients, and it was significantly associated with poor diagnosis. In addition, we found that the L104P mutation in the VCX gene (Variable charge, X-linked) was absent in white blood cell samples, but present at 11.1% frequency in the adjacent tissues and increased to 14.6% in HCC tissues, suggesting that this mutation might be a tumor driver gene driving HCC carcinogenesis. Finally, we identified a TK1-RNU7 fusion, which would result in a deletion of 103 amino acids from its C-terminal. The frequencies of this fusion event decreased from the adjacent tissues (29.2%) to the tumors (16.7%), suggesting that a truncated thymidine Kinase1 (TK1) caused by the fusion event might be deleterious and be selected against during tumor progression. The three-way comparisons allow the identification of potential driver mutations of carcinogenesis. Furthermore, our dataset provides the research community a valuable dataset for identifying dynamic changes of mutation profiles and driver mutations for HCC.

  11. Raman spectroscopy differentiates squamous cell carcinoma (SCC) from normal skin following treatment with a high-powered CO2 laser.

    Science.gov (United States)

    Fox, Sara A; Shanblatt, Ashley A; Beckman, Hugh; Strasswimmer, John; Terentis, Andrew C

    2014-12-01

    The number of cases of non-melanoma skin cancer (NMSC), which include squamous cell carcinoma (SCC) and basal cell carcinoma (BCC), continues to rise as the aging population grows. Mohs micrographic surgery has become the treatment of choice in many cases but is not always necessary or feasible. Ablation with a high-powered CO2 laser offers the advantage of highly precise, hemostatic tissue removal. However, confirmation of complete cancer removal following ablation is difficult. In this study we tested for the first time the feasibility of using Raman spectroscopy as an in situ diagnostic method to differentiate NMSC from normal tissue following partial ablation with a high-powered CO2 laser. Twenty-five tissue samples were obtained from eleven patients undergoing Mohs micrographic surgery to remove NMSC tumors. Laser treatment was performed with a SmartXide DOT Fractional CO2 Laser (DEKA Laser Technologies, Inc.) emitting a wavelength of 10.6 μm. Treatment levels ranged from 20 mJ to 1200 mJ total energy delivered per laser treatment spot (350 μm spot size). Raman spectra were collected from both untreated and CO2 laser-treated samples using a 785 nm diode laser. Principal Component Analysis (PCA) and Binary Logistic Regression (LR) were used to classify spectra as originating from either normal or NMSC tissue, and from treated or untreated tissue. Partial laser ablation did not adversely affect the ability of Raman spectroscopy to differentiate normal from cancerous residual tissue, with the spectral classification model correctly identifying SCC tissue with 95% sensitivity and 100% specificity following partial laser ablation, compared with 92% sensitivity and 60% selectivity for untreated NMSC tissue. The main biochemical difference identified between normal and NMSC tissue was high levels of collagen in the normal tissue, which was lacking in the NMSC tissue. The feasibility of a combined high-powered CO2 laser ablation, Raman diagnostic procedure for the

  12. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?.

    Science.gov (United States)

    Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana

    2016-11-01

    Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  13. Alp Rose stem cells, olive oil squalene and a natural alkyl polyglucoside emulsifier: Are they appropriate ingredients of skin moisturizers - in vivo efficacy on normal and sodium lauryl sulfate - irritated skin?

    Directory of Open Access Journals (Sweden)

    Filipović Mila

    2016-01-01

    Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031

  14. Nonlinear spectral imaging of human normal skin, basal cell carcinoma and squamous cell carcinoma based on two-photon excited fluorescence and second-harmonic generation

    Science.gov (United States)

    Xiong, S. Y.; Yang, J. G.; Zhuang, J.

    2011-10-01

    In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.

  15. Distribution of myofibroblast cells and microvessels around invasive ductal carcinoma of the breast and comparing with the adjacent range of their normal-to-DCIS zones.

    Science.gov (United States)

    Dabiri, Shahriar; Talebi, Amin; Shahryari, Jahanbanoo; Meymandi, Manzoumeh Shamsi; Safizadeh, Hossein

    2013-02-01

    This study seeks to determine the relationships between manifestation of myofibroblasts in the stroma tissue of hyperplastic pre-invasive breast lesions to invasive cancer by investigating clinicopathological data of patients, their effect on steroid receptor expression and HER2, and angiogenesis according to CD34 antigen expression. 100 cases of invasive ductal carcinoma were immunohistochemically investigated for the presence of smooth muscle actin (SMA), ER/PR, HER2, anti-CD34 antibody and microvessel count (MVC). Patients were scored in four different zones of invasive areas: invasive cancer, DCIS, fibrocystic disease ± ductal intraepithelial neoplasia (FCD ± DIN), and normal tissue.  There was a significant difference in stromal myofibroblasts between all areas except for the stroma of DCIS and FCD ± DIN (P normal areas (P = 0.054). There was a significant difference in MVC observed in all areas except for DCIS and FCD ± DIN (P < 0.001). We noted significant inverse correlations between MVC, HER2 expression, and the numbers of involved lymph nodes in invasive cancer and DCIS (P < 0.001). Most MVC were present in grade I, with the least frequent observed in grade III cases in the stroma of invasive cancer, DCIS and FCD ± DIN (P < 0.001).  Angiogenesis can be observed before any significant myofibroblastic changes in the pre-invasive breast lesions. The elevated content of myofibroblasts in stroma of tumor; probably may be a worse prognostic factor  and the steps from atypical epithelial hyperplasia to DCIS and then to the invasive carcinoma do not appear to be always part of a linear progression.

  16. Erythema persists longer than one year in split-thickness skin graft donor sites

    DEFF Research Database (Denmark)

    Danielsen, Patricia L; Jorgensen, Lars N; Jørgensen, Bo

    2013-01-01

    The recovery of skin function and appearance after harvest of split-thickness skin autografts is incompletely described. We followed the kinetics of skin restoration after a partial-thickness skin excision relative to adjacent normal skin over 12 months. Standardized donor site wounds were made o....... The macroscopically healed wound was compared with adjacent normal skin at 1, 3 and 12 months. At 1 month postoperatively, TEWL was 108% (p = 0.003), erythema 145% (p ......The recovery of skin function and appearance after harvest of split-thickness skin autografts is incompletely described. We followed the kinetics of skin restoration after a partial-thickness skin excision relative to adjacent normal skin over 12 months. Standardized donor site wounds were made...... on the thigh using a pneumatic dermatome in 19 consecutive Caucasian patients, median age 70 years, age range 44-86 years, who were undergoing skin graft surgery for leg ulcers. Transepidermal water loss (TEWL), erythema and pigmentation were measured quantitatively using non-invasive devices...

  17. Enhanced DNA double-strand break repair of microbeam targeted A549 lung carcinoma cells by adjacent WI38 normal lung fibroblast cells via bi-directional signaling.

    Science.gov (United States)

    Kobayashi, Alisa; Tengku Ahmad, Tengku Ahbrizal Farizal; Autsavapromporn, Narongchai; Oikawa, Masakazu; Homma-Takeda, Shino; Furusawa, Yoshiya; Wang, Jun; Konishi, Teruaki

    2017-10-01

    Understanding the mechanisms underlying the radiation-induced bystander effect (RIBE) and bi-directional signaling between irradiated carcinoma cells and their surrounding non-irradiated normal cells is relevant to cancer radiotherapy. The present study investigated propagation of RIBE signals between human lung carcinoma A549 cells and normal lung fibroblast WI38 cells in bystander cells, either directly or indirectly contacting irradiated A549 cells. We prepared A549-GFP/WI38 co-cultures and A549-GFP/A549 co-cultures, in which A549-GFP cells stably expressing H2BGFP were co-cultured with either A549 cells or WI38 cells, respectively. Using the SPICE-NIRS microbeam, only the A549-GFP cells were irradiated with 500 protons per cell. The level of γ-H2AX, a marker for DNA double-strand breaks (DSB), was subsequently measured for up to 24h post-irradiation in three categories of cells: (1) "targeted"/irradiated A549-GFP cells; (2) "neighboring"/non-irradiated cells directly contacting the "targeted" cells; and (3) "distant"/non-irradiated cells, which were not in direct contact with the "targeted" cells. We found that DSB repair in targeted A549-GFP cells was enhanced by co-cultured WI38 cells. The bystander response in A549-GFP/A549 cell co-cultures, as marked by γ-H2AX levels at 8h post-irradiation, showed a decrease to non-irradiated control level when approaching 24h, while the neighboring/distant bystander WI38 cells in A549-GFP/WI38 co-cultures was maintained at a similar level until 24h post-irradiation. Surprisingly, distant A549-GFP cells in A549-GFP/WI38 co-cultures showed time dependency similar to bystander WI38 cells, but not to distant cells in A549-GFP/A549 co-cultures. These observations indicate that γ-H2AX was induced in WI38 cells as a result of RIBE. WI38 cells were not only involved in rescue of targeted A549, but also in the modification of RIBE against distant A549-GFP cells. The present results demonstrate that radiation-induced bi

  18. Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor.

    Science.gov (United States)

    Song, Rui; Bian, Hui-Ning; Lai, Wen; Chen, Hua-De; Zhao, Ke-Seng

    2011-05-01

    Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-induced effects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P fibroblasts (P fibroblasts following treatment with bFGF (P fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

  19. Effect of early skin-to-skin contact following normal delivery on incidence of hypothermia in neonates more than 1800 g: randomized control trial.

    Science.gov (United States)

    Nimbalkar, S M; Patel, V K; Patel, D V; Nimbalkar, A S; Sethi, A; Phatak, A

    2014-05-01

    To investigate the impact of early skin-to-skin contact (SSC) provided for first 24 h on incidence of hypothermia in stable newborns weighing 1800 g or more during first 48 h of life. Stable newborns (term and late preterm: Mean gestational age 37.7 (1.35) weeks, range 34-40 weeks) having birth weight 1800 g or more (Mean weight 2605.6 (419.8) grams) were enrolled after approval from Institutional Human Research Ethics Committee (CTRI/2013/06/003790) and randomized into early SSC (intervention group) and conventional care (control group). Initial care in the delivery room for few minutes immediately after birth in both the groups was given under radiant warmer. In the intervention group, newborns were provided SSC by their mother started between 30 min and 1 h after birth for first 24 h with minimal interruption and were provided conventional care other than SSC for next 24 h of life. In the control group, newborns were kept with their mother and received conventional care other than SSC for first 48 h. Temperature and heart rate of newborns were recorded at 30 min, 1, 2, 3, 4, 5, 6, 12, 24 and at 48 h of life in both the groups. Independent Samples t-Test and relative risk were used to analyze the data. Both groups had 50 neonates each with similar baseline characteristics. Heart rates were in normal range in both the groups. The intervention group provided an average (s.d.) of 16.98 (0.28) h of SSC over the first 24 h period. The mean temperature was significantly high in the SSC group at all time intervals starting from 1 to 48 h (Ptemperature<36.5 °C) during first 48 h of life. Of them, 11 newborns had single episode, 4 newborns had two episodes and one newborn had three episodes of hypothermia. Of these 22 hypothermic episodes, 20 occurred in the first 6 h of life and 2 episodes occurred at 48 h of life. Moderate hypothermia was seen in two newborns, whereas rest had mild hypothermia. The relative risk of developing

  20. Demonstration of characteristic skin surface contours of extramammary Paget's disease and parapsoriasis en plaque by image analysis of negative impression replicas.

    Science.gov (United States)

    Kikuchi, Katsuko; Aiba, Setsuya; O'Goshi, Ken-ichiro; Yanai, Motohiro; Takahashi, Motoji; Kasai, Hidefumi; Tagami, Hachiro

    2002-10-01

    The surface contours of lesional skin of certain skin diseases, such as parapsoriasis en plaque (PEP) and extramammary Paget's disease (EMPD), in which there is a massive infiltration by non-epidermal cells, looks somewhat different from that of the adjacent normal skin, needless to state that they are apparently different from that of ordinary chronic inflammatory dermatoses where we found acanthotic epidermis accompanied by hyperkeratosis. We attempted to objectively characterize these unique skin surface changes qualitatively and quantitatively using non-invasive methods. Negative impression replicas were taken from the lesional skin of patients with EMPD or PEP as well as from the adjacent uninvolved skin. The findings were confirmed histologically. The replicas were examined by using computerized image analysis. Several parameters were analyzed that correlate with the changes in the anisotropy of the skin furrows (VC1), average skin roughness (KSD), average length of skin furrows (LEN), and number of skin furrows (NUM). There were significant decreases in KSD and NUM in EMPD, indicating a smoother skin surface in the lesional skin than in the adjacent normal skin. In contrast, the PEP lesion had an increase in VC1 and LEN and a decrease in NUM, which suggests larger skin ridges in the lesional skin than in the uninvolved skin. Thus the unique skin surface of the cutaneous disorders accompanied by epidermal invasion by non-epidermal cells, such as EMPD and PEP, was characterized both qualitatively and quantitatively using computerized image analysis of negative impression replicas.

  1. Low doses of nanodiamonds and silica nanoparticles have beneficial hormetic effects in normal human skin fibroblasts in culture.

    Science.gov (United States)

    Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S

    2016-04-01

    Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. The new topical ascomycin derivative SDZ ASM 981 does not induce skin atrophy when applied to normal skin for 4 weeks: a randomized, double-blind controlled study.

    Science.gov (United States)

    Queille-Roussel, C; Paul, C; Duteil, L; Lefebvre, M C; Rapatz, G; Zagula, M; Ortonne, J P

    2001-03-01

    SDZ ASM 981 is a selective inhibitor of inflammatory cytokines released from T lymphocytes and mast cells, which has been developed for the treatment of inflammatory skin diseases. In the present study, the atrophogenic potential of SDZ ASM 981 1% cream in humans was compared with that of medium and highly potent topical steroids, and vehicle. Four different preparations, SDZ ASM 981 1% cream, the corresponding vehicle of SDZ ASM 981 1% cream, betamethasone-17-valerate 0.1% cream and triamcinolone acetonide 0.1% cream, were applied to the volar aspect of the forearms of 16 healthy volunteers, twice daily, 6 days a week, for 4 weeks. Skin thickness was evaluated by ultrasound examination, clinical signs of atrophy by stereomicroscopy, and epidermal thickness was assessed by histology. Both topical corticosteroids induced a significant reduction in skin thickness, as compared with SDZ ASM 981 1% cream and vehicle, which were shown to be equivalent. The difference in skin thickness (measured by ultrasound examination) between patients treated with SDZ ASM 981 1% cream and those receiving either of the two topical steroids was significant from day 8 onwards. Histological analysis performed at day 29 showed significant epidermal thinning with topical steroids compared with SDZ ASM 981 1% cream or the vehicle. Conclusion The lack of atrophogenic properties of SDZ ASM 981 1% cream in this short-term study demonstrates its potential as long-term treatment for inflammatory skin diseases, thus overcoming a major drawback of topical steroids. This may also be important for the treatment of children, and sensitive areas of skin, such as the face and skin-folds.

  3. Cervical Adjacent Segment Disease

    OpenAIRE

    Özbek, Zühtü; Özkara, Emre; Yağmur, İpek; Arslantaş, Ali

    2017-01-01

    Cervical adjacent segment disease; is the general name ofdisc pathologies that develop in adjacent levels after cervical surgery. If thecervical adjacent segment disease that do not require reoperation and it doesnot cause clinical signs is called radiological cervical adjacent segmentpathology, but those causing radiculopathy, myelopathy or instability is calledclinic cervical adjacent segment pathology. The incidence of cervical adjacentsegment disease in 10-year follow-up is 2.4% -2.9%. Wh...

  4. Normal tissue tolerance to external beam radiation therapy: Skin; Dose de tolerance des tissus sains: la peau et les phaneres

    Energy Technology Data Exchange (ETDEWEB)

    Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)

    2010-07-15

    Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)

  5. Tenskinmetric Evaluation of Surface Energy Changes in Adult Skin: Evidence from 834 Normal Subjects Monitored in Controlled Conditions

    Directory of Open Access Journals (Sweden)

    Camilla Dal Bosco

    2014-03-01

    Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.

  6. Study of mast cell count in skin tags

    Directory of Open Access Journals (Sweden)

    Zaher Hesham

    2007-01-01

    Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.

  7. A comparison of the effects of bath additives on the barrier function of skin in normal volunteer subjects.

    Science.gov (United States)

    Hill, S; Edwards, C

    2002-03-01

    Emollients form an occlusive layer on the skin surface, reducing transepidermal water loss (TEWL), thus providing a temporary restoration of barrier function in compromised skin. This study evaluated the ability of three bath additives to reduce TEWL from compromised skin. The stratum corneum on areas of forearm skin was removed by the repeated application of D-Squame discs. After 1 hour, baseline measurements (t = 0) of TEWL were recorded before each arm was immersed for 10 min in a warm waterbath containing one of four treatments. The arms were air-dried for 20 min and the TEWL measurements repeated. Three further TEWL measurements were made at 30-min intervals. Measurements were made using a Tewameter in a controlled atmosphere. There was little difference between the products in terms of changes in mean TEWL values. However, when expressed relative to t = 0 values, some differences became apparent. The mean values for sites treated with Balmandol were lower than the other sites at 60, 90 and 120 min. When analysed by using the summary statistic AUC (area under the curve), the difference between Balmandol and water and also Balmandol and Eucerin was statistically significant (p < 0.05). These results would suggest that Balmandol has a greater effect on barrier function (as assessed by measurement of a reduction in TEWL values) than Eucerin.

  8. Spatial and temporal expression of types I and II receptors for transforming growth factor beta in normal equine skin and dermal wounds.

    Science.gov (United States)

    De Martin, Isabelle; Theoret, Christine L

    2004-01-01

    To describe immunolocalization of TGF-beta receptors (RI and RII) in normal equine skin and in thoracic or limb wounds, healing normally or with exuberant granulation tissue (EGT). Group A: six wounds on one metacarpus and one midthoracic area. Group B: six wounds on both metacarpi, one of which was bandaged to stimulate EGT. Immunohistochemistry was used to detect RI and RII expression in wound margins. Eight horses, randomly assigned to one of two study groups. Neutralizing polyclonal anti-rabbit RI and RII antibodies were used to detect spatial expression of RI and RII in biopsies obtained before wounding, at 12 and 24 hours, and 5, 10 and 14 days after wounding. RI and RII were co-localized in both unwounded and wounded skin. There were no differences in cell types staining positively between tissues obtained from the limb and the thorax, or from normally healing limb wounds and limb wounds with EGT, at any time. Because of increased cellularity within EGT, staining intensity of limb wounds with 'proud flesh' was greater than limb wounds healing normally, and thoracic wounds, during the proliferative phase of repair. Strong expression of RI and RII, particularly in limb wounds with EGT, suggested that signalling for stimulation of matrix proteins is in place to contribute to scarring. This information may help determine the appropriate time for using receptor antagonists to prevent scarring of limb wounds of horses.

  9. IgG and IgA with Potential Microbial-Binding Activity Are Expressed by Normal Human Skin Epidermal Cells

    Directory of Open Access Journals (Sweden)

    Dongyang Jiang

    2015-01-01

    Full Text Available The innate immune system of the skin is thought to depend largely on a multi-layered mechanical barrier supplemented by epidermis-derived antimicrobial peptides. To date, there are no reports of antimicrobial antibody secretion by the epidermis. In this study, we report the expression of functional immunoglobulin G (IgG and immunoglobulin A (IgA, previously thought to be only produced by B cells, in normal human epidermal cells and the human keratinocyte line HaCaT. While B cells express a fully diverse Ig, epidermal cell-expressed IgG or IgA showed one or two conservative VHDJH rearrangements in each individual. These unique VDJ rearrangements in epidermal cells were found neither in the B cell-derived Ig VDJ databases published by others nor in our positive controls. IgG and IgA from epidermal cells of the same individual had different VDJ rearrangement patterns. IgG was found primarily in prickle cells, and IgA was mainly detected in basal cells. Both epidermal cell-derived IgG and IgA showed potential antibody activity by binding pathogens like Staphylococcus aureus, the most common pathogenic skin bacteria, but the microbial-binding profile was different. Our data indicates that normal human epidermal cells spontaneously express IgG and IgA, and we speculate that these Igs participate in skin innate immunity.

  10. Adjacent segment disease.

    Science.gov (United States)

    Virk, Sohrab S; Niedermeier, Steven; Yu, Elizabeth; Khan, Safdar N

    2014-08-01

    EDUCATIONAL OBJECTIVES As a result of reading this article, physicians should be able to: 1. Understand the forces that predispose adjacent cervical segments to degeneration. 2. Understand the challenges of radiographic evaluation in the diagnosis of cervical and lumbar adjacent segment disease. 3. Describe the changes in biomechanical forces applied to adjacent segments of lumbar vertebrae with fusion. 4. Know the risk factors for adjacent segment disease in spinal fusion. Adjacent segment disease (ASD) is a broad term encompassing many complications of spinal fusion, including listhesis, instability, herniated nucleus pulposus, stenosis, hypertrophic facet arthritis, scoliosis, and vertebral compression fracture. The area of the cervical spine where most fusions occur (C3-C7) is adjacent to a highly mobile upper cervical region, and this contributes to the biomechanical stress put on the adjacent cervical segments postfusion. Studies have shown that after fusion surgery, there is increased load on adjacent segments. Definitive treatment of ASD is a topic of continuing research, but in general, treatment choices are dictated by patient age and degree of debilitation. Investigators have also studied the risk factors associated with spinal fusion that may predispose certain patients to ASD postfusion, and these data are invaluable for properly counseling patients considering spinal fusion surgery. Biomechanical studies have confirmed the added stress on adjacent segments in the cervical and lumbar spine. The diagnosis of cervical ASD is complicated given the imprecise correlation of radiographic and clinical findings. Although radiological and clinical diagnoses do not always correlate, radiographs and clinical examination dictate how a patient with prolonged pain is treated. Options for both cervical and lumbar spine ASD include fusion and/or decompression. Current studies are encouraging regarding the adoption of arthroplasty in spinal surgery, but more long

  11. Molecular cloning of canine protease-activated receptor-2 and its expression in normal dog tissues and atopic skin lesions.

    Science.gov (United States)

    Maeda, Shingo; Maeda, Sadatoshi; Shibata, Sanae; Chimura, Naoki; Fukata, Tsuneo

    2009-05-01

    Protease-activated receptor-2 (PAR-2) belongs to a new G protein-coupled receptor subfamily and is activated by serine proteases. PAR-2 has been demonstrated to play an important role in inflammation and immune response in allergic diseases. In this study, we cloned canine PAR-2 cDNA from the canine kidney by RT-PCR. The canine PAR-2 clone contained a full-length open reading frame encoding 397 amino acids that had 84% and 80% homology with human and mouse homologues, respectively. Canine PAR-2 mRNA was detected in the heart, lung, liver, pancreas, stomach, small intestine, colon, kidney, adrenal gland, spleen, thyroid gland, thymus, skeletal muscle, lymph node, fat and skin of three healthy dogs. The expression pattern of PAR-2 mRNA in canine tissues was similar to that in humans. The expression level of PAR-2 mRNA in skin was not different between the atopic dermatitis (AD) and healthy dogs, suggesting that the level of PAR-2 mRNA transcription may not be associated with development of canine AD. The canine PAR-2 cDNA clone obtained in this study will be useful for further investigation of the immunopathogenesis of canine allergic diseases.

  12. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  13. Methylmalonic and propionic acidemias: lipid profiles of normal and affected human skin fibroblasts incubated with (1-/sup 14/C)propionate

    Energy Technology Data Exchange (ETDEWEB)

    Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.

    1986-06-01

    Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with (1-/sup 14/C)propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines.

  14. Pharmacokinetic/pharmacodynamic analysis to evaluate ceftaroline fosamil dosing regimens for the treatment of community-acquired bacterial pneumonia and complicated skin and skin-structure infections in patients with normal and impaired renal function.

    Science.gov (United States)

    Canut, A; Isla, A; Rodríguez-Gascón, A

    2015-04-01

    In this study, the probability of pharmacokinetic/pharmacodynamic target attainment (PTA) of ceftaroline against clinical isolates causing community-acquired bacterial pneumonia (CABP) and complicated skin and skin-structure infection (cSSSI) in Europe was evaluated. Three dosing regimens were assessed: 600 mg every 12 h (q12 h) as a 1-h infusion (standard dose) or 600 mg every 8 h (q8 h) as a 2-h infusion in virtual patients with normal renal function; and 400 mg q12 h as a 1-h infusion in patients with moderate renal impairment. Pharmacokinetic and microbiological data were obtained from the literature. The PTA and the cumulative fraction of response (CFR) were calculated by Monte Carlo simulation. In patients with normal renal function, the ceftaroline standard dose (600 mg q12 h as a 1-h infusion) can be sufficient to treat CABP due to ceftazidime-susceptible (CAZ-S) Escherichia coli, CAZ-S Klebsiella pneumoniae, meticillin-susceptible Staphylococcus aureus, Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis (CFR>90%). However, against meticillin-resistant S. aureus (MRSA), the CFR was 72%. In cSSSI, the CFR was also ceftaroline 600 mg q8 h as a 2-h infusion or 400 mg q12 h as a 1-h infusion in patients with moderate renal insufficiency provided a high probability of treatment success (CFR ca. 100%) for most micro-organisms causing CABP and cSSSI, including MRSA and penicillin-non-susceptible S. pneumoniae. These results suggest that in patients with normal renal function, ceftaroline 600 mg q8 h as a 2-h infusion may be a better option than the standard dose, especially if the MRSA rate is high. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  15. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception.

    Directory of Open Access Journals (Sweden)

    Carl Hopkins

    Full Text Available Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception.

  16. Vibrotactile Presentation of Musical Notes to the Glabrous Skin for Adults with Normal Hearing or a Hearing Impairment: Thresholds, Dynamic Range and High-Frequency Perception.

    Science.gov (United States)

    Hopkins, Carl; Maté-Cid, Saúl; Fulford, Robert; Seiffert, Gary; Ginsborg, Jane

    2016-01-01

    Presentation of music as vibration to the skin has the potential to facilitate interaction between musicians with hearing impairments and other musicians during group performance. Vibrotactile thresholds have been determined to assess the potential for vibrotactile presentation of music to the glabrous skin of the fingertip, forefoot and heel. No significant differences were found between the thresholds for sinusoids representing notes between C1 and C6 when presented to the fingertip of participants with normal hearing and with a severe or profound hearing loss. For participants with normal hearing, thresholds for notes between C1 and C6 showed the characteristic U-shape curve for the fingertip, but not for the forefoot and heel. Compared to the fingertip, the forefoot had lower thresholds between C1 and C3, and the heel had lower thresholds between C1 and G2; this is attributed to spatial summation from the Pacinian receptors over the larger contactor area used for the forefoot and heel. Participants with normal hearing assessed the perception of high-frequency vibration using 1s sinusoids presented to the fingertip and were found to be more aware of transient vibration at the beginning and/or end of notes between G4 and C6 when stimuli were presented 10dB above threshold, rather than at threshold. An average of 94% of these participants reported feeling continuous vibration between G4 and G5 with stimuli presented 10dB above threshold. Based on the experimental findings and consideration of health effects relating to vibration exposure, a suitable range of notes for vibrotactile presentation of music is identified as being from C1 to G5. This is more limited than for human hearing but the fundamental frequencies of the human voice, and the notes played by many instruments, lie within it. However, the dynamic range might require compression to avoid the negative effects of amplitude on pitch perception.

  17. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    International Nuclear Information System (INIS)

    Donetti, Elena; Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica; Romagnoli, Paolo; Mastroianni, Nicolino; Pescitelli, Leonardo; Baruffaldi Preis, Franz W.; Prignano, Francesca

    2016-01-01

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  18. Interleukin 22 early affects keratinocyte differentiation, but not proliferation, in a three-dimensional model of normal human skin

    Energy Technology Data Exchange (ETDEWEB)

    Donetti, Elena, E-mail: elena.donetti@unimi.it [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Cornaghi, Laura; Arnaboldi, Francesca; Landoni, Federica [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Romagnoli, Paolo [Department of Experimental and Clinical Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Mastroianni, Nicolino [Department of Biomedical Sciences for Health, Università degli Studi di Milano, 20133 Milan (Italy); Pescitelli, Leonardo [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy); Baruffaldi Preis, Franz W. [I.R.C.C.S. Istituto Ortopedico Galeazzi, 20161 Milan (Italy); Prignano, Francesca [Department of Surgery and Translational Medicine, Università degli Studi di Firenze, 50125 Florence (Italy)

    2016-07-15

    Interleukin (IL)-22 is a pro-inflammatory cytokine driving the progression of the psoriatic lesion with other cytokines, as Tumor Necrosis Factor (TNF)-alpha and IL-17. Our study was aimed at evaluating the early effect of IL-22 alone or in combination with TNF-alpha and IL-17 by immunofluorescence on i) keratinocyte (KC) proliferation, ii) terminal differentiation biomarkers as keratin (K) 10 and 17 expression, iii) intercellular junctions. Transmission electron microscopy (TEM) analysis was performed. A model of human skin culture reproducing a psoriatic microenvironment was used. Plastic surgery explants were obtained from healthy young women (n=7) after informed consent. Fragments were divided before adding IL-22 or a combination of the three cytokines, and harvested 24 (T24), 48 (T48), and 72 (T72) h later. From T24, in IL-22 samples we detected a progressive decrease in K10 immunostaining in the spinous layer paralleled by K17 induction. By TEM, after IL-22 incubation, keratin aggregates were evident in the perinuclear area. Occludin immunostaining was not homogeneously distributed. Conversely, KC proliferation was not inhibited by IL-22 alone, but only by the combination of cytokines. Our results suggest that IL-22 affects keratinocyte terminal differentiation, whereas, in order to induce a proliferation impairment, a more complex psoriatic-like microenvironment is needed.

  19. Substance P restores normal skin architecture and reduces epidermal infiltration of sensory nerve fiber in TNCB-induced atopic dermatitis-like lesions in NC/Nga mice.

    Science.gov (United States)

    Choi, Hyeongwon; Kim, Dong-Jin; Nam, Seungwoo; Lim, Sunki; Hwang, Jae-Sung; Park, Ki Sook; Hong, Hyun Sook; Won, Younsun; Shin, Min Kyung; Chung, Eunkyung; Son, Youngsook

    2018-03-01

    Atopic dermatitis (AD) is a chronic inflammatory skin disorder characterized by intense pruritus and eczematous lesion. Substance P (SP) is an 11-amino-acid endogenous neuropeptide that belongs to the tachykinin family and several reports recently have supported the anti-inflammatory and tissue repairing roles of SP. In this study, we investigated whether SP can improve AD symptoms, especially the impaired skin barrier function, in 2, 4, 6-trinitrochlorobenzene (TNCB)-induced chronic dermatitis of NC/Nga mice or not. AD-like dermatitis was induced in NC/Nga mice by repeated sensitization with TNCB for 5 weeks. The experimental group designations and topical treatments were as follows: vehicle group (AD-VE); SP group (AD-SP); and SP with NK1R antagonist CP99994 (AD-SP-A) group. Histological analysis was performed to evaluate epidermal differentiation, dermal integrity, and epidermal nerve innervation in AD-like lesions. The skin barrier functions and pruritus of NC/Nga mice were evaluated by measuring transepidermal water loss (TEWL) and scratching behavior, respectively. Topical SP treatment resulted in significant down-regulation of Ki67 and the abnormal-type keratins (K) K6, K16, and K17, restoration of filaggrin and claudin-1, marked reduction of TEWL, and restoration of basement membrane and dermal collagen deposition, even under continuous sensitization of low dose TNCB. In addition, SP significantly reduced innervation of itch-evoking nerve fibers, gelatinase activity and nerve growth factor (NGF) expression in the epidermis but upregulated semaphorin-3A (Sema3A) expression in the epidermis, along with reduced scratching behavior in TNCB-treated NC/Nga mice. All of these effects were completely reversed by co-treatment with the NK1R antagonist CP99994. In cultured human keratinocytes, SP treatment reduced expression of TGF-α, but upregulated TGF-β and Sema3A. Topically administered SP can restore normal skin barrier function, reduce epidermal infiltration

  20. Hyperelastic Material Properties of Mouse Skin under Compression.

    Directory of Open Access Journals (Sweden)

    Yuxiang Wang

    Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given

  1. Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.

    Science.gov (United States)

    Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T

    1999-04-01

    The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.

  2. Singlet oxygen luminescence as an in vivo photodynamic therapy dose metric: validation in normal mouse skin with topical amino-levulinic acid

    Science.gov (United States)

    Niedre, M J; Yu, C S; Patterson, M S; Wilson, B C

    2005-01-01

    Although singlet oxygen (1O2) has long been proposed as the primary reactive oxygen species in photodynamic therapy (PDT), it has only recently been possible to detect it in biological systems by its luminescence at 1270 nm. Having previously demonstrated this in vitro and in vivo, we showed that cell survival was strongly correlated to the 1O2 luminescence in cell suspensions over a wide range of treatment parameters. Here, we extend this to test the hypothesis that the photobiological response in vivo is also correlated with 1O2 generation, independent of individual treatment parameters. The normal skin of SKH1-HR hairless mice was sensitised with 20% amino-levulinic acid-induced protoporophyrin IX and exposed to 5, 11, 22 or 50 J cm−2 of pulsed 523 nm light at 50 mW cm−2, or to 50 J cm−2 at 15 or 150 mW cm−2. 1O2 luminescence was measured during treatment and the photodynamic response of the skin was scored daily for 2 weeks after treatment. As observed by other authors, a strong irradiance dependence of the PDT effect was observed. However, in all cases the responses increased with the 1O2 luminescence, independent of the irradiance, demonstrating for the first time in vivo an unequivocal mechanistic link between 1O2 generation and photobiological response. PMID:15655542

  3. Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

    Directory of Open Access Journals (Sweden)

    Anna W. Sobanska

    2012-01-01

    Full Text Available Ethylhexyl triazone (ET was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A cyclohexane-diethyl ether 1 : 1 (v/v and (B cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials, with R > 0.998. For both mobile phases limits of detection (LOD were 0.03 and limits of quantification (LOQ 0.1 μg spot−1. Both methods were validated.

  4. Adjacent segment degeneration

    OpenAIRE

    Birjandi, Alireza

    2012-01-01

    Abstract: Adjacent segment disease (ASD) is defined as degeneration that develops at mobile segments above or below a fused spinal segment and usually develops after spinal fusion or other back surgeries. Nearly 5 decades ago, the medical findings related to ASD were usually released in case reports as a relatively unusual complication of lumbar or lumbosacral fusions. Since the initial reports, ASD has been found to occur more often than the earlier predictions for its prospect incidence. It...

  5. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    International Nuclear Information System (INIS)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot

  6. A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography.

    Science.gov (United States)

    Boone, M A L M; Suppa, M; Marneffe, A; Miyamoto, M; Jemec, G B E; Del Marmol, V

    2016-10-01

    High-definition optical coherence tomography (HD-OCT) features of actinic keratosis (AK) may aid in its diagnosis and therapeutic strategy. A diagnostic algorithm permitting discrimination of AK from squamous cell carcinoma (SCC) and normal skin has been proposed. However, diagnostic accuracy strongly depends on the experience of physicians. In two recent studies, it was demonstrated that HD-OCT permits to quantify in vivo optical properties such as light attenuation in intrinsic ageing skin, in melanocytic lesions and in basal cell carcinoma. This approach seems to permit a semiautomated classification of lesions easier to handle by non-experts. The aim of this paper was to quantify in vivo optical properties of facial located AK/SCC lesions, such as light attenuation, by HD-OCT. Additional objectives were to determine the best critical value of these optical properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis. Moreover, relative attenuation factor (μ raf ) at different skin layers (1-3) could be determined. Optical properties with high diagnostic accuracy (DA) and high negative predictive values (NPV) could be defined permitting the differentiation between normal skin, non-Bowenoid AK without follicular involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivo

  7. Expression and Localization of Peroxisome Proliferator-Activated Receptors and Nuclear Factor κB in Normal and Lesional Psoriatic Skin

    DEFF Research Database (Denmark)

    Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus

    2003-01-01

    Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...

  8. Study of skin and nail Candida species as a normal flora based on age groups in healthy persons in Tehran-Iran.

    Science.gov (United States)

    Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F

    2017-12-01

    The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.

  9. Blood flow in skin, subcutaneous adipose tissue and skeletal muscle in the forearm of normal man during an oral glucose load

    DEFF Research Database (Denmark)

    Bülow, J; Astrup, A; Christensen, N J

    1987-01-01

    Blood flow to the forearm, and the subcutaneous tissue and skin in the forearm were measured by strain gauge plethysmography, 133Xe-elimination and Laser Doppler flowmetry during an oral glucose load (I g glucose kg-1 lean body mass) and during control conditions. The forearm blood flow remained......, muscle blood flow decreased about 20-30% during both experiments. Proximal nervous blockade did not abolish the glucose-induced vasodilatation in subcutaneous tissue. In the glucose experiment, arterial glucose concentration increased to 7.8 +/- 1.17 mmol l-1 30 min after the load was given...... constant during both experiments. Glucose induced a two-fold vasodilatation in subcutaneous tissue. In skin, glucose induced a relative vasodilatation and later a relative vasoconstriction compared with control experiments. When estimated from forearm blood flow and subcutaneous and skin blood flows...

  10. Relationship of p53 Mutations to Epidermal Cell Proliferation and Apoptosis in Human UV-Induced Skin Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Janine G. Einspahr

    1999-11-01

    Full Text Available Human skin is continually subjected to UV-irradiation with the p53 gene playing a pivotal role in repair of UV-induced DNA damage and apoptosis. Consequently, p53 alterations are early events in human UV-induced skin carcinogenesis. We studied 13 squamous cell carcinomas (SCC, 16 actinic keratoses (AK, 13 samples adjacent to an AK (chronically sun-damaged, and 14 normal-appearing skin samples for p53 mutation, p53 immunostaining (IHC, apoptosis (in situ TUNEL and morphology, and proliferation (PCNA. The frequency of p53 mutation increased from 14% in normal skin, to 38.5% in sun-damaged skin, 63% in AK, and 54% in SCC. p53 IHC increased similarly. Apoptosis (TUNEL increased from 0.06 ± 0.02%, to 0.1 ± 0.2, 0.3 ± 0.3, and 0.4 ± 0.3 in normal skin, sun-damaged skin, AK, and SCC, respectively. Apoptosis was strongly correlated with proliferation (i.e., TUNEL and PCNA, r = 0.7, P < 0.0001, and proliferation was significantly increased in the progression from normal skin to SCC. Bax was significantly increased in SCC compared to AK. These data imply that apoptosis in samples with a high frequency of p53 mutation may not necessarily be p53-dependent. We suggest that there is a mechanism for apoptosis in response to increased cellular proliferation that is p53-independent.

  11. Sun’s effect on skin

    Science.gov (United States)

    The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...

  12. A new algorithm for the discrimination of actinic keratosis from normal skin and squamous cell carcinoma based on in vivo analysis of optical properties by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, M A L M; Suppa, M; Marneffe, A

    2016-01-01

    accuracy strongly depends on the experience of physicians. In two recent studies, it was demonstrated that HD-OCT permits to quantify in vivo optical properties such as light attenuation in intrinsic ageing skin, in melanocytic lesions and in basal cell carcinoma. This approach seems to permit......BACKGROUND: High-definition optical coherence tomography (HD-OCT) features of actinic keratosis (AK) may aid in its diagnosis and therapeutic strategy. A diagnostic algorithm permitting discrimination of AK from squamous cell carcinoma (SCC) and normal skin has been proposed. However, diagnostic...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...

  13. Efficacy of keishibukuryogan, a traditional Japanese herbal medicine, in treating cold sensation and numbness after stroke: clinical improvement and skin temperature normalization in 22 stroke patients.

    Science.gov (United States)

    Fujita, Keishi; Yamamoto, Tetsuya; Kamezaki, Takao; Matsumura, Akira

    2010-01-01

    Cold sensation and numbness have been reported as post-stroke sensory sequelae attributable to distal axonopathy, which is caused by chronic ischemia of diseased limbs resulting from dysfunction of vasomotor regulatory systems. Keishibukuryogan is a traditional herbal medicine used to treat symptoms of peripheral ischemia such as cold extremities. This study investigated clinical improvement and skin temperature in peripheral ischemia patients to determine the efficacy of keishibukuryogan in alleviating post-stroke cold sensation and numbness. Twenty-two stroke patients with cold sensation and/or numbness were enrolled in this study. Subjective cold sensation and numbness, evaluated using the visual analogue scale, were found in 21 and 31 limbs, respectively. The skin temperature of diseased and healthy limbs was recorded. We observed all patients for 4 weeks and 17 patients for 8 weeks after administration of keishibukuryogan. The skin temperature of diseased limbs was significantly higher than baseline at 4 weeks and 8 weeks, whereas that of healthy limbs did not change significantly. Cold sensation and numbness were significantly improved at 4 weeks and 8 weeks compared to baseline. Keishibukuryogan administration resulted in warming of diseased limbs and improved cold sensation and numbness, probably by increasing peripheral blood flow.

  14. ethiopian rift and adjacent highlands

    African Journals Online (AJOL)

    ABSTRACT: Remotely sensed thermal-infrared spectral data can be used to derive surface temperature of any object if the optical and thermal properties are known. In this study 1M band six has been used to assess the spatial variability of the kinetic temperature of the central Ethiopian rift lakes and adjacent highlands.

  15. Static and dynamic nanomechanical properties of human skin tissue using atomic force microscopy: effect of scarring in the upper dermis.

    Science.gov (United States)

    Grant, C A; Twigg, P C; Tobin, D J

    2012-11-01

    Following traumatic injury, skin has the capacity to repair itself through a complex cascade of biochemical change. The dermis, which contains a load-bearing collagenous network structure, is remodelled over a long period of time, affecting its mechanical behaviour. This study examines the nanomechanical and viscoelastic properties of the upper dermis from human skin that includes both healthy intact and scarred tissue. Extensive nanoindentation analysis shows that the dermal scar tissue exhibits stiffer behaviour than the healthy intact skin. The scar skin also shows weaker viscoelastic creep and capability to dissipate energy at physiologically relevant frequencies than the adjacent intact skin. These results are discussed in conjunction with a visual change in the orientation of collagenous fibrils in the scarred dermis compared with normal dermis, as shown by atomic force microscopy imaging. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  16. Immunohistochemical analysis of regulatory T cell markers FOXP3 and GITR on CD4(+) CD25(+) T cells in normal skin and inflammatory dermatoses

    NARCIS (Netherlands)

    de Boer, Onno J.; van der Loos, Chris M.; Teeling, Peter; van der Wal, Allard C.; Teunissen, Marcel B. M.

    2007-01-01

    Regulatory T cells (Treg) are a subset of T lymphocytes that play a central role in immunologic tolerance and in the termination of immune responses. The identification of these cells in normal and inflammatory conditions may contribute to a better understanding of underlying pathology. We

  17. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (pharmaceutical delivery and wound dressings.

  18. Maturation of teeth adjacent to dental agenesis site.

    Science.gov (United States)

    Ben-Bassat, Yocheved; Babadzhanov, Daniel; Brin, Ilana; Hazan-Molina, Hagai; Aizenbud, Dror

    2014-10-01

    The purpose of this study was to evaluate the developmental stage of teeth adjacent to the agenesis site in comparison to their antimeres. Panoramic views of 39 patients with unilateral dental agenesis and 42 normal controls were evaluated. The dental developmental stage (normal or delayed) of the teeth adjacent to the agenesis site was determined for each patient using the Haavikko's method, while the overall dental age was determined by Becker's method. No statistically significant difference was found in the developmental stage of teeth adjacent to the agenesis, compared to their antimere and to the same teeth in the normal control group. However, the prevalence of cases with no difference in development was almost double for the tooth distal to the agenesis site compared to the tooth mesial to the agenesis site in the hypodontia group (84.6% distal and 43.6% mesial; p agenesis site was the 1st permanent molar. (1) No difference was found between the developmental stage of teeth adjacent to the agenesis site and their antimeres. (2) Teeth mesial to the agenesis site showed some delay in development compared to teeth distal to the agenesis site, in this study. (3) The 1st molars, which were in most of the cases the distal adjacent tooth to the site of agenesis, showed developmental stability. (4) Additional longitudinal studies are needed to examine the dental developmental pattern in patients with agenesis.

  19. Potentiation by caffeine of x-ray damage to cultured human skin fibroblasts from normal subjects and ataxia-telangiectasia patients

    International Nuclear Information System (INIS)

    Furcinitti, P.S.

    1983-01-01

    Caffeine was found to potentiate x-ray-induced killing of human diploid fibroblasts from a normal subject and an ataxia-telangiectasia (AT) patient when it was present at 2 mM concentration for 30 to 66 h postirradiation. The dose-modifying factor for caffeine-treated normal cells had an average value of 1.26 +- 0.13 which did not vary significantly with treatment time or x-ray dose. The dose-modifying factor for caffeine-treated AT cells was 1.12 +- 0.12 at 30 h, rose to 1.66 +- 0.17 at 41 h, and decreased to 1.31 +- 0.13 at 66 h. Thus no clear difference was observed between these two cell strains' susceptibility to postirradiation caffeine treatment

  20. Preliminary observations on expression of transforming growth factors beta1 and beta3 in equine full-thickness skin wounds healing normally or with exuberant granulation tissue.

    Science.gov (United States)

    Theoret, Christine L; Barber, Spencer M; Moyana, Terence N; Gordon, John R

    2002-01-01

    To determine whether transforming growth factor (TGF)-beta1 and -beta3 expression differs between equine limb wounds healing normally and those healing with experimentally induced exuberant granulation tissue (EGT). Six wounds were created on the lateral aspect of both metacarpi of each horse; one forelimb was untreated, and the other was bandaged to stimulate the development of EGT. Sequential wound biopsies allowed comparison of growth factor expression between the two types of wound. Four horses (2 to 4 years of age; 350 to 420 kg). Wounds were assessed grossly, histologically, and by enzyme-linked immunosorbent assay (ELISA) for TGF-beta1 and -beta3 expression at 12 and 24 hours and 2, 5, 10, and 14 days postoperatively. Bandaged wounds developed EGT. In all wounds, TGF-beta1 peaked early and remained elevated at 14 days. Peak TGF-beta1 concentration was higher in wounds with EGT, but not significantly so. Expression of TGF-beta3 differed from TGF-beta1, with peak TGF-beta3 concentrations being delayed. Concentrations of TGF-beta3 were higher in wounds healing normally, but this difference was not significant. During both normal and exuberant wound repair, the expression of TGF-beta1 occurred earlier than TGF-beta3 expression. Wounds healing with EGT tended to have higher concentrations of fibrogenic TGF-beta1 and lower concentrations of antifibrotic TGF-beta3 than wounds healing normally, although these differences were not statistically significant. This study suggests that the production of EGT in bandaged wounds may be related to increased expression of fibrogenic TGF-beta1 and decreased expression of antifibrotic TGF-beta3. Further investigation of the roles of TGF-beta1 and -beta3 may be important in understanding the molecular control of EGT in horses. Copyright 2002 by The American College of Veterinary Surgeons

  1. Sagging Skin

    Science.gov (United States)

    ... for Every Season How to Choose the Best Skin Care Products In This Section Dermatologic Surgery What is dermatologic ... for Every Season How to Choose the Best Skin Care Products Sagging Skin Treatment Options Learn more about the ...

  2. Effect of Equal Daily Doses Achieved by Different Power Densities of Low-Level Laser Therapy at 635 nm on Open Skin Wound Healing in Normal and Diabetic Rats

    Directory of Open Access Journals (Sweden)

    Róbert Kilík

    2014-01-01

    Full Text Available Background and Objective. Despite the fact that the molecular mechanism of low-level laser therapy (LLLT is not yet known, the exploitation of phototherapy in clinical medicine and surgery is of great interest. The present study investigates the effects of LLLT on open skin wound healing in normal and diabetic rats. Materials and Methods. Four round full-thickness skin wounds on dorsum were performed in male adult nondiabetic (n=24 and diabetic (n=24 Sprague–Dawley rats. AlGaInP (635 nm, wavelength; 5 J/cm2, daily dose was used to deliver power densities of 1, 5, and 15 mW/cm2 three times daily until euthanasia. Results. PMNL infiltration was lower in the irradiated groups (15 mW/cm2. The synthesis and organisation of collagen fibres were consecutively enhanced in the 5 mW/cm2 and 15 mW/cm2 groups compared to the others in nondiabetic rats. In the diabetic group the only significant difference was recorded in the ratio PMNL/Ma at 15 mW/cm2. A significant difference in the number of newly formed capillaries in the irradiated group (5, 15 mW/cm2 was recorded on day six after injury compared to the control group. Conclusion. LLLT confers a protective effect against excessive inflammatory tissue response; it stimulates neovascularization and the early formation of collagen fibres.

  3. Skin Biomes.

    Science.gov (United States)

    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A

    2016-05-01

    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  4. Y-type congenital urethral duplication with normal dorsal urethra and small ventral fistula to perineal skin – 28th reported case

    Directory of Open Access Journals (Sweden)

    Donald E. Meier

    2016-05-01

    Full Text Available There are numerous types of urethral duplication previously described in the literature including a Type IIA2Y where a large ventral channel branches from the hypoplastic, dorsal, orthotopic urethra. There have been 27 previously reported cases of a similar defect, called “congenital posterior urethrocutaneous fistula” (CUPF with the only difference being that the ventral urethra is hypoplastic and the dorsal, orthotopic one normal. The difference in treatment for these 2 entities is markedly different, and preoperative identification of the appropriate abnormality is essential. Treatment of CUPF requires only safe excision of the ventral segment, but treatment for a Type IIA2Y duplication requires resection of the hypoplastic, orthotopic urethra and transposition of the larger ventral segment into the dorsal orthotopic position. The outcome for treatment of CUPF is much better than for treatment of Type IIA2Y entities. We herein present the 28th case of CUPF in the English literature with discussion of the anatomy, appropriate diagnostic criteria, and safe method of treatment for these entities.

  5. An elastic second skin.

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G; Sakamoto, Fernanda H; Gilchrest, Barbara A; Anderson, R Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (appearance in a 5-point severity scale. The XPL platform may offer advanced solutions to compromised skin barrier function, pharmaceutical delivery and wound dressings.

  6. Skin Infections

    Science.gov (United States)

    ... Abscess Cellulitis Taking Care of Your Skin Abscess Impetigo Ringworm Cellulitis Should I Pop My Pimple? Tips for Taking Care of Your Skin Impetigo Paronychia Pityriasis Rosea Abscess View more Partner Message ...

  7. Skin Aging

    Science.gov (United States)

    ... too. Sunlight is a major cause of skin aging. You can protect yourself by staying out of ... person has smoked. Many products claim to revitalize aging skin or reduce wrinkles, but the Food and ...

  8. Skin graft

    Science.gov (United States)

    ... caused a large amount of skin loss Burns Cosmetic reasons or reconstructive surgeries where there has been skin damage or skin ... anesthesia are: Reactions to medicines Problems with breathing Risks for this surgery are: Bleeding Chronic pain (rarely) Infection Loss of ...

  9. Skin optics

    NARCIS (Netherlands)

    van Gemert, M. J.; Jacques, S. L.; Sterenborg, H. J.; Star, W. M.

    1989-01-01

    Quantitative dosimetry in the treatment of skin disorders with (laser) light requires information on propagation of light in the skin related to the optical properties of the individual skin layers. This involves the solution of the integro-differential equation of radiative transfer in a model

  10. Anti-oxidant defence mechanism in vitiliginous skin increases with skin type

    NARCIS (Netherlands)

    Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.

    2012-01-01

    Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing

  11. Simulation of color of port wine stain skin and its dependence on skin variables

    NARCIS (Netherlands)

    Verkruysse, W.; Lucassen, G. W.; van Gemert, M. J.

    1999-01-01

    The understanding of why Port Wine Stain (PWS) skin is redder and darker as compared to normal skin has so far been based on qualitative analysis. This study aims at quantitatively analyzing the influence of skin anatomy variables on perceived skin color. Reflectance spectra for visible light from

  12. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  13. Patents and Antitrust: Application to Adjacent Markets

    OpenAIRE

    Nicholas Economides; William N. Hebert

    2007-01-01

    We examine the intersection of patents and antitrust where a patent holder uses the monopoly power it possesses in the market for a patented product to exclude competitors in an adjacent market and attempt to monopolize or monopolize the adjacent market. The present scheme for awarding patents cannot judge when the issuance of a patent will lead to the appropriate balance between innovation and efficiency. Where a patent holder’s invention uses an interface with adjacent products, the patent ...

  14. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  15. Mutations in DNA polymerase eta are not detected in squamous cell carcinoma of the skin.

    Science.gov (United States)

    Glick, Eitan; White, Lisa M; Elliott, Nathan A; Berg, Daniel; Kiviat, Nancy B; Loeb, Lawrence A

    2006-11-01

    The major etiological agent in skin cancer is exposure to UV-irradiation and the concomitant DNA damage. UV-induced DNA lesions, such as thymine dimers, block DNA synthesis by the major DNA polymerases and inhibit the progression of DNA replication. Bypass of thymine dimers and related lesions is dependent on the translesion polymerase DNA polymerase eta (Poleta). In the inherited disorder, xeroderma pigmentosum variant (XPV), inactivation of Poleta results in extreme sensitivity to UV light and a marked increase in the incidence of skin cancer. Here, we tested the hypothesis that somatic mutations and/or polymorphisms in the POLH gene that encodes Poleta are associated with the induction of UV-dependent skin cancers. We sequenced the exonic regions of the Poleta open reading frame in DNA from 17 paired samples of squamous cell skin carcinoma and adjacent histologically normal tissue. We analyzed approximately 120,000 nucleotides and detected no mutations in POLH in the tumors. However, we identified 6 different single-nucleotide polymorphisms, 3 of them previously undocumented, which were present in both the tumor and paired normal tissue. We conclude that neither mutations nor polymorphisms in the coding regions of POLH are required for the generation of human skin squamous cell carcinoma.

  16. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    ... a serious case, you might need medical help. Impetigo —A skin infection caused by bacteria. Usually the ... and form a thick crust. You can treat impetigo with antibiotics. Melanoma © 2008 Logical Images, Inc. Melanoma — ...

  17. Characterization of oily mature skin by biophysical and skin imaging techniques.

    Science.gov (United States)

    de Melo, M O; Maia Campos, P M B G

    2018-02-13

    The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Fluorescence excitation-emission matrix spectroscopy of vitiligo skin in vivo (Conference Presentation)

    Science.gov (United States)

    Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey

    2016-02-01

    Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.

  19. Optical coherence tomography for imaging of skin and skin diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studied......, as have many diseases. The method can provide accurate measures of epidermal and nail changes in normal tissue. Skin cancer and other tumors, as well as inflammatory diseases, have been studied and good agreement found between OCT images and histopathological architecture. OCT also allows noninvasive...... monitoring of morphologic changes in skin diseases and may have a particular role in the monitoring of medical treatment of nonmelanoma skin cancer. The technology is however still evolving and continued technological development will necessitate an ongoing evaluation of its diagnostic accuracy. Several...

  20. Proteomic Profiling of Radiation-Induced Skin Fibrosis in Rats: Targeting the Ubiquitin-Proteasome System

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wenjie [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China); Luo, Judong [Department of Radiotherapy, Changzhou Tumor Hospital, Soochow University, Changzhou (China); Sheng, Wenjiong; Xue, Jiao; Li, Ming [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Ji, Jiang [Department of Dermatology, the Second Affiliated Hospital of Soochow University, Suzhou (China); Liu, Pengfei [Department of Gastroenterology, the Affiliated Jiangyin Hospital of Southeast University, Jiangyin (China); Zhang, Xueguang [Institute of Medical Biotechnology and Jiangsu Stem Cell Key Laboratory, Medical College of Soochow University, Suzhou (China); Cao, Jianping [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Zhang, Shuyu, E-mail: zhang.shuyu@hotmail.com [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China)

    2016-06-01

    Purpose: To investigate the molecular changes underlying the pathogenesis of radiation-induced skin fibrosis. Methods and Materials: Rat skin was irradiated to 30 or 45 Gy with an electron beam. Protein expression in fibrotic rat skin and adjacent normal tissues was quantified by label-free protein quantitation. Human skin cells HaCaT and WS-1 were treated by x-ray irradiation, and the proteasome activity was determined with a fluorescent probe. The effect of proteasome inhibitors on Transforming growth factor Beta (TGF-B) signaling was measured by Western blot and immunofluorescence. The efficacy of bortezomib in wound healing of rat skin was assessed by the skin injury scale. Results: We found that irradiation induced epidermal and dermal hyperplasia in rat and human skin. One hundred ninety-six preferentially expressed and 80 unique proteins in the irradiated fibrotic skin were identified. Through bioinformatic analysis, the ubiquitin-proteasome pathway showed a significant fold change and was investigated in greater detail. In vitro experiments demonstrated that irradiation resulted in a decline in the activity of the proteasome in human skin cells. The proteasome inhibitor bortezomib suppressed profibrotic TGF-β downstream signaling but not TGF-β secretion stimulated by irradiation in HaCaT and WS-1 cells. Moreover, bortezomib ameliorated radiation-induced skin injury and attenuated epidermal hyperplasia. Conclusion: Our findings illustrate the molecular changes during radiation-induced skin fibrosis and suggest that targeting the ubiquitin-proteasome system would be an effective countermeasure.

  1. Skin Cancer Screening

    Science.gov (United States)

    ... Cancer Patient Skin Cancer Patient Skin Cancer Treatment Melanoma Treatment Merkel Cell Carcinoma Treatment Skin Cancer Prevention Skin Cancer Screening Health Professional Skin Cancer Treatment Melanoma Treatment Merkel Cell Carcinoma Treatment Skin Cancer Prevention Genetics ...

  2. HDAC inhibitor SAHA normalizes the levels of VLCFAs in human skin fibroblasts from X-ALD patients and downregulates the expression of proinflammatory cytokines in Abcd1/2-silenced mouse astrocytes.

    Science.gov (United States)

    Singh, Jaspreet; Khan, Mushfiquddin; Singh, Inderjit

    2011-11-01

    X-adrenoleukodystrophy (X-ALD) is a peroxisomal metabolic disorder caused by mutations in the ABCD1 gene encoding the peroxisomal ABC transporter adrenoleukodystrophy protein (ALDP). The consistent metabolic abnormality in all forms of X-ALD is an inherited defect in the peroxisomal β-oxidation of very long chain FAs (VLCFAs >C22:0) and the resultant pathognomic accumulation of VLCFA. The accumulation of VLCFA leads to a neuroinflammatory disease process associated with demyelination of the cerebral white matter. The present study underlines the importance of a potent histone deacetylase (HDAC) inhibitor, suberoylanilide hydroxamic acid (SAHA) in inducing the expression of ABCD2 [adrenoleukodystrophy-related protein (ALDRP)], and normalizing the peroxisomal β-oxidation, as well as the saturated and monounsaturated VLCFAs in cultured human skin fibroblasts of X-ALD patients. The expression of ELOVL1, the single elongase catalyzing the synthesis of both saturated VLCFA (C26:0) and monounsaturated VLCFA (C26:1), was also reduced by SAHA treatment. In addition, using Abcd1/Abcd2-silenced mouse primary astrocytes, we also examined the effects of SAHA in VLCFA-induced inflammatory response. SAHA treatment decreased the inflammatory response as expression of inducible nitric oxide synthase, inflammatory cytokine, and activation of NF-κB in Abcd1/Abcd2-silenced mouse primary astrocytes was reduced. These observations indicate that SAHA corrects both the metabolic disease of VLCFA as well as secondary inflammatory disease; therefore, it may be an ideal drug candidate to be tested for X-ALD therapy in humans.

  3. Skin abscess

    Science.gov (United States)

    ... can help identify the cause of the infection. Treatment You can apply moist heat (such as warm compresses) to help the abscess ... if you develop new symptoms during or after treatment of a skin abscess. Prevention ... the skin around minor wounds clean and dry to prevent infection. Call your provider if you ...

  4. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  5. Migration of PCBs from Sealants to Adjacent Material

    DEFF Research Database (Denmark)

    Andersen, Helle Vibeke; Gunnarsen, Lars Bo; Kampmann, Kristoffer

    2015-01-01

    PCB in sealants can migrate into porous surfaces like concrete and brick and contaminate these materials. The study focuses on an analysis of concentration profiles in relation to alleviation of PCB contamination. The PCB content was determined in 20 samples of concrete and 6 samples of brick...... adjacent to outdoor PCB-containing sealants. The samples were submitted to the laboratory for normal commercial assessment of PCB content in relation to the handling of waste from renovation works in Denmark. The results showed that the PBC concentration in the sealant not necessarily relate...... to the concentration of the adjacent material. The profiles of PCB concentration into the materials showed some variation, though in general there is a tendency of relative higher concentration near the primary source in concrete and longer migration at low concentrations in brick. The concentration profiles seemed...

  6. The Aging Prostate Is Never "Normal"

    DEFF Research Database (Denmark)

    Schlomm, Thorsten; Weischenfeldt, Joachim; Korbel, Jan

    2015-01-01

    We argue against the recently published statement that tumor-specific molecular alterations found in "normal" prostate tissue from cancer patients challenge focal therapy approaches that only target a visible cancer lesion and not the adjacent molecular field....

  7. Adjacent segment disease following cervical spine surgery.

    Science.gov (United States)

    Cho, Samuel K; Riew, K Daniel

    2013-01-01

    Cervical spine surgery is broadly divided into fusion and nonfusion procedures. Anterior cervical diskectomy and fusion (ACDF) is a common procedure, although adjacent segment disease following the surgery is an ongoing clinical concern. Adjacent segment cervical disease occurs in approximately 3% of patients per year, with an expected incidence of 25% within the first 10 years following fusion. Nonfusion procedures such as anterior diskectomy and posterior foraminotomy do not decrease the rate of adjacent segment disease compared with ACDF. Recently, enthusiasm has developed for artificial disk replacement as a motion-sparing alternative to fusion. To date, however, multiple clinical trials and subsequent follow-up studies have failed to demonstrate significant reduction of adjacent segment disease when artificial disk replacement is performed instead of fusion.

  8. Adjacent Segment Pathology after Lumbar Spinal Fusion

    OpenAIRE

    Lee, Jae Chul; Choi, Sung-Woo

    2015-01-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant contro...

  9. Adjacent Segment Pathology after Anterior Cervical Fusion

    OpenAIRE

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-01-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of mo...

  10. Skin Cancer

    Science.gov (United States)

    ... R, Taylor SC, Lim HW. Skin cancer and photoprotection in people of color: a review and recommendations ... 4): 663 - 672.e3 19 World Health Organization, Solar ultraviolet radiation: Global burden of disease from solar ...

  11. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  12. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... Cryotherapy is done using a cotton swab that has been dipped into liquid nitrogen or a probe ...

  13. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types are basal cell cancer and squamous cell cancer. They usually form on the head, face, neck, hands, and arms. ...

  14. Skin Pigment

    Science.gov (United States)

    ... This Article Medical Dictionary Also of Interest (Quiz) Impetigo and Ecthyma (News) Don't Get Caught Without ... Professional version Also of Interest Test your knowledge Impetigo is a bacterial skin infection. The infection leads ...

  15. Skin - clammy

    Science.gov (United States)

    Causes of clammy skin include: Anxiety attack Heart attack Heat exhaustion Internal bleeding Low blood oxygen levels Medicine reaction Sepsis (body-wide infection) Severe allergic reaction (anaphylaxis) Severe pain Shock (low blood pressure)

  16. Skin Biopsy

    Science.gov (United States)

    ... tape it closed with small strips of clear, sticky tape. If you get stitches, your doctor will ... of Your Skin Melanoma Eczema Aspiration and Biopsy: Bone Marrow Impetigo Pityriasis Rosea View more Partner Message ...

  17. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin

    OpenAIRE

    Li, Z; Hu, L; Elias, PM; Man, M-Q

    2018-01-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...

  18. Discrimination of non-melanoma skin lesions from non-tumor human skin tissues in vivo using Raman spectroscopy and multivariate statistics.

    Science.gov (United States)

    Silveira, Fabricio L; Pacheco, Marcos T T; Bodanese, Benito; Pasqualucci, Carlos A; Zângaro, Renato A; Silveira, Landulfo

    2015-01-01

    Raman spectroscopy was used to discriminate human non-melanoma skin lesions from non-tumor tissues in vivo. This work proposed the discrimination between non-melanoma (basal cell carcinoma, BCC; squamous cell carcinoma, SCC) and pre-cancerous lesions (actinic keratosis, AK) from benign lesions and normal (non-tumor group, NT) tissues, using near-infrared Raman spectroscopy with a Raman probe. Prior to surgery, the spectra of suspicious lesions were obtained in situ. The spectra of adjacent, clinically normal skin were also obtained. Lesions were resectioned and submitted for histopathology. The Raman spectra were measured using a Raman spectrometer (830 nm). Two types of discrimination models were developed to distinguish the different histopathological groups. The principal components analysis discriminant analysis (PCA/DA) and the partial least squares discriminant analysis (PLS/DA) were based on Euclidean, quadratic and Mahalanobis distances. PCA and PLS spectral vectors showed spectral features of skin constituents, such as lipids (between 1,250 cm(-1) and 1,300 cm(-1) and at 1,450 cm(-1)) and proteins (between 870 cm(-1) and 940 cm(-1), 1,240 cm(-1) and 1,271 cm(-1), and at 1,000 cm(-1) and 1,450 cm(-1)). Despite the small spectral differences between malignant lesions and benign tissues, the algorithms discriminated the spectra of non-melanoma skin and pre-cancerous lesions from benign and normal tissues, with an overall accuracy of 82.8% and 91.9%, respectively. PCA and PLS could discriminate Raman spectra of skin tissues, opening the way for an in vivo optical diagnosis. © 2015 Wiley Periodicals, Inc.

  19. UVB 311 nm tolerance of vitiligo skin increases with skin photo type

    NARCIS (Netherlands)

    Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete

    2005-01-01

    It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we

  20. Skin decontamination

    International Nuclear Information System (INIS)

    Moehrle, G.

    1975-01-01

    A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream

  1. Matrix metalloproteinase-1 expression in breast cancer and cancer-adjacent tissues by immunohistochemical staining

    Science.gov (United States)

    XUAN, JIAJIA; ZHANG, YUNFENG; ZHANG, XIUJUN; HU, FEN

    2015-01-01

    Although matrix metalloproteinase-1 (MMP-1) has been considered a factor of crucial importance for breast cancer cells invasion and metastasis, the expression of MMP-1 in different breast cancer and cancer-adjacent tissues have not been fully examined. In the present study, immunohistochemical staining was used to detect the MMP-1 expression in non-specific invasive ductal carcinoma of the breast, cancer-adjacent normal breast tissue, lymph node metastatic non-specific invasive ductal carcinoma of the breast and normal lymph node tissue. The results showed that MMP-1 expression is different in the above tissues. MMP-1 had a positive expression in normal lymph node tissue and lymph node metastatic non-specific invasive ductal carcinoma. The MMP-1 negative expression rate was only 6.1% in non-specific invasive ductal carcinoma of the breast and 2.9% in cancer-adjacent normal breast tissue respectively. MMP-1 expression is higher in non-specific invasive ductal carcinoma and lymph node metastatic non-specific invasive ductal carcinoma compared to cancer-adjacent normal breast tissue and normal lymph node tissue. In conclusion, higher expression of MMP-1 in breast cancer may play a crucial role in promoting breast cancer metastasis. PMID:26137243

  2. [Skin defect coverage with micro skin graft].

    Science.gov (United States)

    Gümüş, Nazim; Kaya, Yalçin; Karakaya, Sadik; Camci, Cemalettin

    2002-04-01

    The aim of this study is to coverage of the large skin defect with microskin graft. The wound coverage of the large skin defect may be difficult with auto skin graft. In these patients, split thickness skin graft may be used in a bloc shape or expanded skin graft shape and a stamp skin graft shape or expanded stamp skin graft shape. On the other hand, split thickness skin graft may be used as a micrograft shape after the mincing process, which reduces of the graft size in a few millimeters. In this study, 6 patients with skin defect was admitted in our clinic, and their skin defect was treated with micro skin graft. Expansion ratio was 1:15. Epithelialization on the wound surface was completed in 4 to 6 weeks and cobblestone appearance was observed after the wound coverage. Skin defect coverage with micrograft is an effective technique like the other skin graft coverage methods.

  3. Skin perfusion pressure measured with a photo sensor in an air-filled plastic balloon: validity and reproducibility on the lower leg in normal subjects and patients suspected of obliterative arterial disease

    DEFF Research Database (Denmark)

    Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase

    2011-01-01

    An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...

  4. Adjacent stimulation and measurement patterns considered harmful

    International Nuclear Information System (INIS)

    Adler, Andy; Maimaitijiang, Yasheng; Gaggero, Pascal Olivier

    2011-01-01

    We characterize the ability of electrical impedance tomography (EIT) to distinguish changes in internal conductivity distributions, and analyze it as a function of stimulation and measurement patterns. A distinguishability measure, z, is proposed which is related to the signal-to-noise ratio of a medium and to the probability of detection of conductivity changes in a region of interest. z is a function of the number of electrodes, the EIT stimulation and measurement protocol, the stimulation amplitude, the measurement noise, and the size and location of the contrasts. Using this measure we analyze various choices of stimulation and measurement patterns under the constraint of medical electrical safety limits (maximum current into the body). Analysis is performed for a planar placement of 16 electrodes for simulated 3D tank and chest shapes, and measurements in a saline tank. Results show that the traditional (and still most common) adjacent stimulation and measurement patterns have by far the poorest performance (by 6.9 ×). Good results are obtained for trigonometric patterns and for pair drive and measurement patterns separated by over 90°. Since the possible improvement over adjacent patterns is so large, we present this result as a call to action: adjacent patterns are harmful, and should be abandoned. We recommend using pair drive and measurement patterns separated by one electrode less than 180°. We describe an approach to modify an adjacent pattern EIT system by adjusting electrode placement

  5. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  6. Does the sailfish skin reduce the skin friction like the shark skin?

    Science.gov (United States)

    Sagong, Woong; Kim, Chulkyu; Choi, Sangho; Jeon, Woo-Pyung; Choi, Haecheon

    2008-10-01

    The sailfish is the fastest sea animal, reaching its maximum speed of 110 km/h. On its skin, a number of V-shaped protrusions pointing downstream exist. Thus, in the present study, the possibility of reducing the skin friction using its shape is investigated in a turbulent boundary layer. We perform a parametric study by varying the height and width of the protrusion, the spanwise and streamwise spacings between adjacent ones, and their overall distribution pattern, respectively. Each protrusion induces a pair of streamwise vortices, producing low and high shear stresses at its center and side locations, respectively. These vortices also interact with those induced from adjacent protrusions. As a result, the drag is either increased or unchanged for most of the cases considered. Some of these cases show that the skin friction itself is reduced but the total drag including the form drag on the protrusion is larger than that of a smooth surface. In a few cases, the drag is decreased only slightly (˜1%) but this amount is within the experimental uncertainty. Since the shape of present protrusions is similar to that used by Sirovich and Karlsson [Nature (London) 388, 753 (1997)] where V-shaped protrusions pointing upstream were considered, we perform another set of experiments following their study. However, we do not obtain any drag reduction even with random distribution of those V-shaped protrusions.

  7. Additional decompression at adjacent segments leads to adjacent segment degeneration after PLIF.

    Science.gov (United States)

    Miyagi, Masayuki; Ikeda, Osamu; Ohtori, Seiji; Tsuneizumi, Yoshikazu; Someya, Yukio; Shibayama, Masataka; Ogawa, Yasufumi; Inoue, Gen; Orita, Sumihisa; Eguchi, Yawara; Kamoda, Hiroto; Arai, Gen; Ishikawa, Tetsuhiro; Aoki, Yasuchika; Toyone, Tomoaki; Ooi, Toshio; Takahashi, Kazuhisa

    2013-08-01

    Adjacent segment degeneration (ASD) is one of the major complications of lumbar fusion. Several previous retrospective studies reported ASD after PLIF. However, few reports evaluated whether decompression surgery combined with fusion surgery increases the rate of complications in adjacent segments. The purpose of the current study was to investigate the degeneration in decompressed adjacent segments after PLIF. A total of 23 patients (12 men, 11 women; average age, 58.6) who underwent PLIF surgery [1 level (n = 9), 2 levels (n = 8), 3 levels (n = 4), 4 levels (n = 2)] were included. Additional adjacent decompression above or below the level of interbody fusion was performed at 25 levels and no adjacent decompression was performed at 15 levels. We retrospectively investigated ASD by X-ray films of all 40 adjacent segments (above and below fusion level) and clinical outcomes of all 23 cases. Of the 40 adjacent segments, 19 (47.5%) showed ASD and 9 (22.5%) showed symptomatic ASD. In the 19 segments with ASD, ASD occurred in 16 of 25 (64.0%) segments at decompressed sites compared with 3 of 15 (20.0%) non-decompressed sites. The ratio of ASD in adjacent segments was significantly higher at decompressed sites than at non-decompressed sites (p < 0.01). ASD occurs frequently in association with additional decompression above or below the level of PLIF. In cases in which the adjacent segments require decompression, a surgical strategy that preserves as much of the posterior complex as possible should be selected.

  8. Time-constrained project scheduling with adjacent resources

    NARCIS (Netherlands)

    Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.

    2008-01-01

    We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with Adjacent Resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by

  9. Time-constrained project scheduling with adjacent resources

    NARCIS (Netherlands)

    Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.

    We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with adjacent resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by

  10. Adjacent Segment Pathology after Lumbar Spinal Fusion

    Science.gov (United States)

    Lee, Jae Chul

    2015-01-01

    One of the major clinical issues encountered after lumbar spinal fusion is the development of adjacent segment pathology (ASP) caused by increased mechanical stress at adjacent segments, and resulting in various radiographic changes and clinical symptoms. This condition may require surgical intervention. The incidence of ASP varies with both the definition and methodology adopted in individual studies; various risk factors for this condition have been identified, although a significant controversy still exists regarding their significance. Motion-preserving devices have been developed, and some studies have shown their efficacy of preventing ASP. Surgeons should be aware of the risk factors of ASP when planning a surgery, and accordingly counsel their patients preoperatively. PMID:26435804

  11. Skin Cancer Foundation

    Science.gov (United States)

    ... UVB Skin of Color Tanning Teacher Resources Related: What Is Skin Cancer? | Window Film | Healthy Lifestyle | True Stories Skin Cancer Information Actinic Keratosis Atypical Moles Basal Cell Carcinoma Melanoma Merkel Cell Carcinoma Squamous Cell Carcinoma Skin Cancer ...

  12. Adjacent Segment Pathology after Anterior Cervical Fusion.

    Science.gov (United States)

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon; Kim, Sung Kyu

    2016-06-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion.

  13. Adjacent Segment Pathology after Anterior Cervical Fusion

    Science.gov (United States)

    Chung, Jae Yoon; Park, Jong-Beom; Seo, Hyoung-Yeon

    2016-01-01

    Anterior cervical fusion has become a standard of care for numerous pathologic conditions of the cervical spine. However, subsequent development of clinically significant disc disease at levels adjacent to fused discs is a serious long-term complication of this procedure. As more patients live longer after surgery, it is foreseeable that adjacent segment pathology (ASP) will develop in increasing numbers of patients. Also, ASP has been studied more intensively with the recent popularity of motion preservation technologies like total disc arthroplasty. The true nature and scope of ASP remains poorly understood. The etiology of ASP is most likely multifactorial. Various factors including altered biomechanical stresses, surgical disruption of soft tissue and the natural history of cervical disc disease contribute to the development of ASP. General factors associated with disc degeneration including gender, age, smoking and sports may play a role in the development of ASP. Postoperative sagittal alignment and type of surgery are also considered potential causes of ASP. Therefore, a spine surgeon must be particularly careful to avoid unnecessary disruption of the musculoligamentous structures, reduced risk of direct injury to the disc during dissection and maintain a safe margin between the plate edge and adjacent vertebrae during anterior cervical fusion. PMID:27340541

  14. Bacterial skin flora of diabetic patients in the Jos University Teaching ...

    African Journals Online (AJOL)

    Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...

  15. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  16. Reduced FOXO1 expression accelerates skin wound healing and attenuates scarring.

    Science.gov (United States)

    Mori, Ryoichi; Tanaka, Katsuya; de Kerckhove, Maiko; Okamoto, Momoko; Kashiyama, Kazuya; Tanaka, Katsumi; Kim, Sangeun; Kawata, Takuya; Komatsu, Toshimitsu; Park, Seongjoon; Ikematsu, Kazuya; Hirano, Akiyoshi; Martin, Paul; Shimokawa, Isao

    2014-09-01

    The forkhead box O (FOXO) family has been extensively investigated in aging and metabolism, but its role in tissue-repair processes remains largely unknown. Herein, we clarify the molecular aspect of the FOXO family in skin wound healing. We demonstrated that Foxo1 and Foxo3a were both up-regulated during murine skin wound healing. Partial knockout of Foxo1 in Foxo1(+/-) mice throughout the body led to accelerated skin wound healing with enhanced keratinocyte migration, reduced granulation tissue formation, and decreased collagen density, accompanied by an attenuated inflammatory response, but we observed no wound phenotype in Foxo3a(-/-) mice. Fibroblast growth factor 2, adiponectin, and notch1 genes were significantly increased at wound sites in Foxo1(+/-) mice, along with markedly altered extracellular signal-regulated kinase 1/2 and AKT phosphorylation. Similarly, transient knockdown of Foxo1 at the wound site by local delivery of antisense oligodeoxynucleotides enhanced skin wound healing. The link between FOXO1 and scarring extends to patients, in particular keloid scars, where we see FOXO1 expression markedly increased in fibroblasts and inflammatory cells within the otherwise normal dermis. This occurs in the immediate vicinity of the keloid by comparison to the center of the mature keloid, indicating that FOXO1 is associated with the overgrowth of this fibrotic response into adjacent normal skin. Overall, our data indicate that molecular targeting of FOXO1 may improve the quality of healing and reduce pathological scarring. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  17. Long-Term Outcomes of Simultaneous Skin and Bowel Flaps for Esophageal Reconstruction.

    Science.gov (United States)

    Imaizumi, Atsushi; Liem, Anita A; Yang, Chun-Fan; Chen, Wency; Chen, Shih-Heng; Chen, Hung-Chi

    2015-08-01

    Esophageal reconstruction can be performed with skin or bowel flaps. The choice of flap remains controversial, as the long-term outcomes of skin flaps cannot always be assessed in patients with limited life expectancies due to advanced malignancy, unlike the pediatric and benign cases which have had esophageal reconstruction using bowel flaps. We report the long-term clinical and histopathological outcomes in a series of 45 cases repaired with combined skin and bowel flaps.Four patients developed symptomatic strictures after corrosive esophageal injuries were repaired with a combination of a tubed free radial forearm fasciocutaneous flap and a pedicled bowel flap. On average, 24 years had passed since uneventful initial esophageal reconstructions. Barium esophagograms were obtained in all cases and pathological examination was performed upon all surgical specimens.The cutaneous portions of the reconstructed esophagus exhibited a variety of findings on barium examination. Each of the 4 cases developed an esophagocutaneous fistula after revision; an average of 4 surgeries was required to close these fistulae. The inner surfaces of the portion of esophagus repaired with skin flaps showed extensive ulceration, polypoid lesions, and fibrosis. Pathology specimens from skin flaps showed extensive acute and chronic inflammation, microabscesses, fibrosis, and acanthosis, with depletion and degeneration of the pilosebaceous units. By contrast, adjacent parts of the esophagus repaired with bowel were widely patent with normal appearing mucosa.Our findings indicate that a bowel flap is durable with good tolerance to gastrointestinal content over long periods, whereas skin flaps often developed morphological changes and could not maintain long-term esophageal function without eventual stricture and dysphagia. We therefore recommend use of bowel flaps for esophageal reconstruction in patients with long life expectancy.

  18. Spondylolisthesis adjacent to a cervical disc arthroplasty does not increase the risk of adjacent level degeneration.

    Science.gov (United States)

    Kieser, David Christopher; Cawley, Derek Thomas; Roscop, Cecile; Mazas, Simon; Coudert, Pierre; Boissiere, Louis; Obeid, Ibrahim; Vital, Jean-Marc; Pointillart, Vincent; Gille, Olivier

    2018-03-31

    To understand whether a spondylolisthesis in the sub-axial spine cranial to a cervical disc arthroplasty (CDA) construes a risk of adjacent level disease (ALD). A retrospective review of 164 patients with a minimum 5-year follow-up of a cervical disc arthroplasty was performed. Multi-level surgeries, including hybrid procedures, were included. Multiple implant types were included. The two inter-vertebral discs (IVD) cranial of the CDA were monitored for evidence of radiologic degeneration using the Kettler criteria. The rate of ALD in CDA found in this series was 17.8%, with most affecting the immediately adjacent IVD (27.4 and 7.6%, respectively p = 0.000). Pre-operative mild spondylolisthesis adjacent to a planned CDA was not found to be a risk factor for ALD within 5 years. Those with a degenerative spondylolisthesis are at higher risk of ALD (33%) than those with a non-degenerative cause for their spondylolisthesis (11%). Post-operative CDA alignment, ROM or induced spondylolisthesis do not affect the rate of ALD in those with an adjacent spondylolisthesis. Patients with ALD experience significantly worse 5-year pain and functional outcomes than those unaffected by ALD. A pre-operatively identified mild spondylolisthesis in the sub-axial spine cranially adjacent to a planned CDA is not a risk factor for ALD within 5 years. These slides can be retrieved under Electronic Supplementary Material.

  19. Skin deposits in hereditary cystatin C amyloidosis

    DEFF Research Database (Denmark)

    Benedikz, Eirikur; Blöndal, H; Gudmundsson, G

    1990-01-01

    Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...

  20. Interaction between a normal shock wave and a turbulent boundary layer at high transonic speeds. Part 1: Pressure distribution. Part 2: Wall shear stress. Part 3: Simplified formulas for the prediction of surface pressures and skin friction

    Science.gov (United States)

    Adamson, T. C., Jr.; Liou, M. S.; Messiter, A. F.

    1980-01-01

    An asymptotic description is derived for the interaction between a shock wave and a turbulent boundary layer in transonic flow, for a particular limiting case. The dimensionless difference between the external flow velocity and critical sound speed is taken to be much smaller than one, but large in comparison with the dimensionless friction velocity. The basic results are derived for a flat plate, and corrections for longitudinal wall curvature and for flow in a circular pipe are also shown. Solutions are given for the wall pressure distribution and the shape of the shock wave. Solutions for the wall shear stress are obtained, and a criterion for incipient separation is derived. Simplified solutions for both the wall pressure and skin friction distributions in the interaction region are given. These results are presented in a form suitable for use in computer programs.

  1. Risks of Skin Cancer Screening

    Science.gov (United States)

    ... Cancer Patient Skin Cancer Patient Skin Cancer Treatment Melanoma Treatment Merkel Cell Carcinoma Treatment Skin Cancer Prevention Skin Cancer Screening Health Professional Skin Cancer Treatment Melanoma Treatment Merkel Cell Carcinoma Treatment Skin Cancer Prevention Genetics ...

  2. Loading effects of anterior cervical spine fusion on adjacent segments

    OpenAIRE

    Chien-Shiung Wang; Jia-Hao Chang; Ti-Sheng Chang; Hung-Yi Chen; Ching-Wei Cheng

    2012-01-01

    Adjacent segment degeneration typically follows anterior cervical spine fusion. However, the primary cause of adjacent segment degeneration remains unknown. Therefore, in order to identify the loading effects that cause adjacent segment degeneration, this study examined the loading effects to superior segments adjacent to fused bone following anterior cervical spine fusion. The C3–C6 cervical spine segments of 12 sheep were examined. Specimens were divided into the following groups: intact sp...

  3. The Skin Microbiome in Atopic Dermatitis and Its Relationship to Emollients.

    Science.gov (United States)

    Lynde, Charles W; Andriessen, Anneke; Bertucci, Vince; McCuaig, Catherine; Skotnicki, Sandy; Weinstein, Miriam; Wiseman, Marni; Zip, Catherine

    2016-01-01

    Human-associated bacterial communities on the skin, skin microbiome, likely play a central role in development of immunity and protection from pathogens. In atopic patients, the skin bacterial diversity is smaller than in healthy subjects. To review treatment strategies for atopic dermatitis in Canada, taking the skin microbiome concept into account. An expert panel of 8 Canadian dermatologists explored the role of skin microbiome in clinical dermatology, specifically looking at atopic dermatitis. The panel reached consensus on the following: (1) In atopic patients, the skin microbiome of lesional atopic skin is different from nonlesional skin in adjacent areas. (2) Worsening atopic dermatitis and smaller bacterial diversity are strongly associated. (3) Application of emollients containing antioxidant and antibacterial components may increase microbiome diversity in atopic skin. The skin microbiome may be the next frontier in preventive health and may impact the approach to atopic dermatitis treatment. © The Author(s) 2015.

  4. Biomechanical study on the effect of cervical spine fusion on adjacent-level intradiscal pressure and segmental motion.

    Science.gov (United States)

    Eck, Jason C; Humphreys, S Craig; Lim, Tae-Hong; Jeong, Soon Tack; Kim, Jesse G; Hodges, Scott D; An, Howard S

    2002-11-15

    A biomechanical study was performed using cadaveric cervical spine specimens. To determine the effect of cervical spine fusion on adjacent-level intradiscal pressure. Clinical studies have reported that patients with spinal fusion are at greater risk of pathology and early disc degeneration at adjacent levels. It is hypothesized that eliminating motion at one level leads to hypermobility and increased forces at adjacent levels, thus increasing the rate of disc degeneration. Six cadaveric cervical spine specimens were tested. Specimens were stabilized at T1 and loaded at C3 to 20 degrees of flexion and 15 degrees of extension. Intradiscal pressures and segmental motion at C4-C5 and C6-C7 were recorded first on intact specimens, and then after anterior cervical plating at C5-C6. Changes in intradiscal pressure and segmental motion were calculated and statistically analyzed using a paired Student t test. Intradiscal pressures were significantly increased during flexion at both adjacent levels. The pressure increased by 73.2% at C4-C5 (P = 0.002), and by 45.3% at C6-C7 (P = 0.006). Intradiscal pressures increased at both adjacent levels during extension, but not significantly. During flexion, segmental motion increased at both adjacent levels, with greater increases at C4-C5. During extension, segmental motion increased at both adjacent levels, with greater increases at C6-C7. Clinical studies have reported increased rates of disc degeneration at levels adjacent to fusion. It is believed that eliminating motion through fusion shifts the load to the adjacent levels, causing earlier disc degeneration. This study has shown that significant increases in intradiscal pressure and segmental motion occur at levels adjacent to fusion during normal range of motion. These results may partially explain the mechanism of early disc degeneration at levels adjacent to cervical spine fusion.

  5. Seismicity in Azerbaijan and Adjacent Caspian Sea

    International Nuclear Information System (INIS)

    Panahi, Behrouz M.

    2006-01-01

    So far no general view on the geodynamic evolution of the Black Sea to the Caspian Sea region is elaborated. This is associated with the geological and structural complexities of the region revealed by geophysical, geochemical, petrologic, structural, and other studies. A clash of opinions on geodynamic conditions of the Caucasus region, sometimes mutually exclusive, can be explained by a simplified interpretation of the seismic data. In this paper I analyze available data on earthquake occurrences in Azerbaijan and the adjacent Caspian Sea region. The results of the analysis of macroseismic and instrumental data, seismic regime, and earthquake reoccurrence indicate that a level of seismicity in the region is moderate, and seismic event are concentrated in the shallow part of the lithosphere. Seismicity is mostly intra-plate, and spatial distribution of earthquake epicenters does not correlate with the plate boundaries

  6. A comprehensive two-dimensional gel protein database of noncultured unfractionated normal human epidermal keratinocytes: towards an integrated approach to the study of cell proliferation, differentiation and skin diseases

    DEFF Research Database (Denmark)

    Celis, J E; Madsen, Peder; Rasmussen, H H

    1991-01-01

    A two-dimensional (2-D) gel database of cellular proteins from noncultured, unfractionated normal human epidermal keratinocytes has been established. A total of 2651 [35S]methionine-labeled cellular proteins (1868 isoelectric focusing, 783 nonequilibrium pH gradient electrophoresis) were resolved......, melanocytes, fibroblasts, dermal microvascular endothelial cells, peripheral blood mononuclear cells and sweat duct cells. The keratinocyte 2-D gel protein database will be updated yearly in the November issue of Electrophoresis. Udgivelsesdato: 1991-Nov...

  7. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... for Every Season How to Choose the Best Skin Care Products In This Section Dermatologic Surgery What is dermatologic ... for Every Season How to Choose the Best Skin Care Products Neuromodulators for Aging Skin Treatment Options Learn more ...

  8. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  9. Effect of low-level laser therapy on the release of interleukin-6 and basic fibroblast growth factor from cultured human skin fibroblasts in normal and high glucose mediums.

    Science.gov (United States)

    Esmaeelinejad, Mohammad; Bayat, Mohammad

    2013-12-01

    This study evaluated the effects of low-level laser therapy (LLLT) on human skin fibroblasts (HSFs) that have been cultured in high glucose concentration media. HSFs were cultured under physiological glucose condition medium, and then cultured in high glucose concentration medium (15 mM/L) for 1 or 2 weeks prior to LLLT. Experimental HSFs were irradiated with three energy densities (0.5, 1, and 2 J/cm(2)) once daily for three consecutive days. Release of interleukin-6 (IL-6) and basic fibroblast growth factor (bFGF) was evaluated using the enzyme-linked immunosorbent assay (ELISA) method. Statistical analysis showed three doses of 0.5 (p = 0.049), 1 (p = 0.027), and 2 J/cm(2) (p = 0.004) stimulated the release of IL-6 in HSFs cultured in high glucose concentration medium compared with that of non-irradiated HSFs that were cultured in the same medium. LLLT with 2 J/cm(2) induced the release of bFGF from HSFs cultured in high glucose concentration medium for 1 or 2 weeks (both p = 0.04). Our study showed that LLLT stimulated the release of IL-6 and bFGF from HSFs cultured in high glucose concentration medium. LLLT was more effective in releasing IL-6 and bFGF while HSFs which were cultured in physiologic glucose concentration medium during laser irradiation.

  10. Pursuing Normality

    DEFF Research Database (Denmark)

    Madsen, Louise Sofia; Handberg, Charlotte

    2018-01-01

    BACKGROUND: The present study explored the reflections on cancer survivorship care of lymphoma survivors in active treatment. Lymphoma survivors have survivorship care needs, yet their participation in cancer survivorship care programs is still reported as low. OBJECTIVE: The aim of this study...... implying an influence on whether to participate in cancer survivorship care programs. Because of "pursuing normality," 8 of 9 participants opted out of cancer survivorship care programming due to prospects of "being cured" and perceptions of cancer survivorship care as "a continuation of the disease...

  11. Clinical scoring and instrumental analysis to evaluate skin types.

    Science.gov (United States)

    Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G

    2013-04-01

    The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.

  12. Skin and soft tissue infection.

    Science.gov (United States)

    Sharma, S; Verma, K K

    2001-07-01

    Abstract. Normal skin is heavily colonized by bacterial flora. The most common are the various nonpathogenic gram-positive bacteria such as Staphylococcus epidermidis (coagulase-negative). Skin and soft tissue infections are usually caused by Staphylococcus aureus (S. aureus) and Streptococcus pyogenes. This article discusses common and some not so common bacterial skin infections, including impetigo, folliculitis, furncles and carbuncles, cellulitis and erysipelas, gangrenous cellulitis, staphylococcal scalded skin syndrome and scarlet fever. Impetigo and ecthyma are common bacterial infections of the skin commonly caused by S. aureus and / or Group A streptoccus. In mild and localized impetigo topical antibiotics whereas in widespread or severe one and in ecthyma systemic antibiotics like, cloxacillin, erythromycin, azithromycin or cephalexin should be used. Folliculitis, furunculosis and carbuncle are folliculocentric infections caused by S. aureus involving the variable depth and extent of the follicle(s) and surrounding tissue. These conditions can be treated with topical or systemic antibiotics like cloxacillin, cephalexin, erythromycin, amoxicillin/clavulanic acid or vancomycin. Staphylococcal scalded skin syndrome is a toxin mediated exfoliative dermatosis caused by S. aureus of phase group II. Intravenous penicillinase-resistant anti-staphylococcal antibiotics like methicillin, cloxacillin, cephalosporin or erythromycin are required. Erysipelas and cellulitis are acute infections of dermal and subcutaneous tissues caused most frequently by Group A beta-hemolytic streptococci (erysipelas) or S. aureus requiring systemic antibiotics like oral or intravenous penicillin, erythromycin, cephalexin, cloxacillin, vacomycin, minocycline or ciprofloxacin depending upon the severity, suspected causative organism and culture/sensitivity results. Gangrenous cellulitis is characterized by infection with necrosis of skin and underlying subcutaneous tissue due to various

  13. Visual Adjacency Lists for Dynamic Graphs.

    Science.gov (United States)

    Hlawatsch, Marcel; Burch, Michael; Weiskopf, Daniel

    2014-11-01

    We present a visual representation for dynamic, weighted graphs based on the concept of adjacency lists. Two orthogonal axes are used: one for all nodes of the displayed graph, the other for the corresponding links. Colors and labels are employed to identify the nodes. The usage of color allows us to scale the visualization to single pixel level for large graphs. In contrast to other techniques, we employ an asymmetric mapping that results in an aligned and compact representation of links. Our approach is independent of the specific properties of the graph to be visualized, but certain graphs and tasks benefit from the asymmetry. As we show in our results, the strength of our technique is the visualization of dynamic graphs. In particular, sparse graphs benefit from the compact representation. Furthermore, our approach uses visual encoding by size to represent weights and therefore allows easy quantification and comparison. We evaluate our approach in a quantitative user study that confirms the suitability for dynamic and weighted graphs. Finally, we demonstrate our approach for two examples of dynamic graphs.

  14. Biological Rhythms in the Skin

    Directory of Open Access Journals (Sweden)

    Mary S. Matsui

    2016-05-01

    Full Text Available Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN of the hypothalamus, which directs an organism’s rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional–translational autoregulatory loops. This master clock, following environmental cues, regulates an organism’s sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.

  15. Biological Rhythms in the Skin.

    Science.gov (United States)

    Matsui, Mary S; Pelle, Edward; Dong, Kelly; Pernodet, Nadine

    2016-05-24

    Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN) of the hypothalamus, which directs an organism's rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional-translational autoregulatory loops. This master clock, following environmental cues, regulates an organism's sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period) cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.

  16. Malassezia skin diseases in humans.

    Science.gov (United States)

    Difonzo, E M; Faggi, E; Bassi, A; Campisi, E; Arunachalam, M; Pini, G; Scarfì, F; Galeone, M

    2013-12-01

    Although Malassezia yeasts are a part of the normal microflora, under certain conditions they can cause superficial skin infection, such as pityriasis versicolor (PV) and Malassezia folliculitis. Moreover the yeasts of the genus Malassezia have been associated with seborrheic dermatitis and dandruff, atopic dermatitis, psoriasis, and, less commonly, with confluent and reticulated papillomatosis, onychomycosis, and transient acantholytic dermatosis. The study of the clinical role of Malassezia species has been surrounded by controversy due to the relative difficulty in isolation, cultivation, and identification. This review focuses on the clinical, mycologic, and immunologic aspects of the various skin diseases associated with Malassezia. Moreover, since there exists little information about the epidemiology and ecology of Malassezia species in the Italian population and the clinical significance of these species is not fully distinguished, we will report data about a study we carried out. The aim of our study was the isolation and the identification of Malassezia species in PV-affected skin and non-affected skin in patients with PV and in clinically healthy individuals without any Malassezia associated skin disease.

  17. Analysis of translucency of skin by volume reflection for color formulation of facial prostheses

    NARCIS (Netherlands)

    Korfage, Anke; Borsboom, Peter C. F.; Dijkstra, Pieter U.; van Oort, Robert P.

    2009-01-01

    Purpose: A facial prosthesis demands a good visual match with the adjacent skin. Skin color and translucency must be mimicked by the prosthesis. Translucency can be defined as allowing the passage of light, yet diffusing it so as not to render the bodies beyond clearly visible, therefore being

  18. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Cancer Institute. What You Need To Know About Melanoma and Other Skin Cancers: How To Check Your Skin. (NIH Publication No. ...

  19. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  20. Friction and durability of virgin and damaged skin with and without skin cream treatment using atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Bharat Bhushan

    2012-11-01

    Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.

  1. Urostomy - stoma and skin care

    Science.gov (United States)

    ... it well before you attach the pouch. Avoid skin care products that contain alcohol. These can make your skin ... the pouch to your skin. Use fewer special skin care products. This will make problems with your skin less ...

  2. Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue

    International Nuclear Information System (INIS)

    Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael

    2002-01-01

    We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo

  3. Analysis of adjacent segment reoperation after lumbar total disc replacement

    OpenAIRE

    Rainey, Scott; Blumenthal, Scott L.; Zigler, Jack E.; Guyer, Richard D.; Ohnmeiss, Donna D.

    2012-01-01

    Background Fusion has long been used for treating chronic back pain unresponsive to nonoperative care. However, potential development of adjacent segment degeneration resulting in reoperation is a concern. Total disc replacement (TDR) has been proposed as a method for addressing back pain and preventing or reducing adjacent segment degeneration. The purpose of the study was to determine the reoperation rate at the segment adjacent to a level implanted with a lumbar TDR and to analyze the pre-...

  4. Lymphatic albumin clearance from psoriatic skin

    International Nuclear Information System (INIS)

    Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.

    1983-01-01

    In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return

  5. Oily skin: an overview.

    Science.gov (United States)

    Sakuma, Thais H; Maibach, Howard I

    2012-01-01

    Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

  6. Prognostic Value of Lordosis Decrease in Radiographic Adjacent Segment Pathology After Anterior Cervical Corpectomy and Fusion.

    Science.gov (United States)

    Liu, Yin; Li, Na; Wei, Wei; Deng, Jing; Hu, Yuequn; Ye, Bin; Wang, Wei

    2017-10-31

    While cervical lordosis alteration is not uncommon after anterior cervical arthrodesis, its influence on radiological adjacent segment pathology (RASP) is still unclear. Biomechanical changes induced by arthrodesis may contribute to ASP onset. To investigate the correlation between cervical lordosis decrease and RASP onset after anterior cervical corpectomy and fusion (ACCF) and to determine its biomechanical effect on adjacent segments after surgery, 80 CSM patients treated with ACCF were retrospectively studied, and a baseline finite element model of the cervical spine as well as post-operation models with normal and decreased lordosis were established and validated. We found that post-operative lordosis decrease was prognostic in predicting RASP onset, with the hazard ratio of 0.45. In the FE models, ROM at the adjacent segment increased after surgery, and the increase was greater in the model with decreased lordosis. Thus, post-operative cervical lordosis change significantly correlated with RASP occurrence, and it may be of prognostic value. The biomechanical changes induced by lordosis change at the adjacent segments after corpectomy may be one of the mechanisms for this phenomenon. Restoring a well lordotic cervical spine after corpectomy may reduce RASP occurrence and be beneficial to long-term surgical outcomes.

  7. 33 CFR 80.1395 - Puget Sound and adjacent waters.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound and adjacent waters. 80.1395 Section 80.1395 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...

  8. Objectifying the Adjacent and Opposite Angles: A Cultural Historical Analysis

    Science.gov (United States)

    Daher, Wajeeh; Musallam, Nadera

    2018-01-01

    The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles'…

  9. OCT imaging of skin cancer and other dermatological diseases

    DEFF Research Database (Denmark)

    Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini

    2009-01-01

    Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)...

  10. Raman active components of skin cancer.

    Science.gov (United States)

    Feng, Xu; Moy, Austin J; Nguyen, Hieu T M; Zhang, Jason; Fox, Matthew C; Sebastian, Katherine R; Reichenberg, Jason S; Markey, Mia K; Tunnell, James W

    2017-06-01

    Raman spectroscopy (RS) has shown great potential in noninvasive cancer screening. Statistically based algorithms, such as principal component analysis, are commonly employed to provide tissue classification; however, they are difficult to relate to the chemical and morphological basis of the spectroscopic features and underlying disease. As a result, we propose the first Raman biophysical model applied to in vivo skin cancer screening data. We expand upon previous models by utilizing in situ skin constituents as the building blocks, and validate the model using previous clinical screening data collected from a Raman optical fiber probe. We built an 830nm confocal Raman microscope integrated with a confocal laser-scanning microscope. Raman imaging was performed on skin sections spanning various disease states, and multivariate curve resolution (MCR) analysis was used to resolve the Raman spectra of individual in situ skin constituents. The basis spectra of the most relevant skin constituents were combined linearly to fit in vivo human skin spectra. Our results suggest collagen, elastin, keratin, cell nucleus, triolein, ceramide, melanin and water are the most important model components. We make available for download (see supplemental information) a database of Raman spectra for these eight components for others to use as a reference. Our model reveals the biochemical and structural makeup of normal, nonmelanoma and melanoma skin cancers, and precancers and paves the way for future development of this approach to noninvasive skin cancer diagnosis.

  11. Ius Chasma Tributary Valleys and Adjacent Plains

    Science.gov (United States)

    2006-01-01

    This image covers valley tributaries of Ius Chasma, as well as the plains adjacent to the valleys. Ius Chasma is one of several canyons that make up the Valles Marineris canyon system. Valles Marineris likely formed by extension associated with the growth of the large volcanoes and topographic high of Tharsis to the northwest. As the ground was pulled apart, large and deep gaps resulted in the valleys seen in the top and bottom of this HiRISE image. Ice that was once in the ground could have also melted to create additional removal of material in the formation of the valleys. HiRISE is able to see the rocks along the walls of both these valleys and also impact craters in the image. Rock layers that appear lower down in elevation appear rougher and are shedding boulders. Near the top of the walls and also seen in patches along the smooth plains are brighter layers. These brighter layers are not shedding boulders so they must represent a different kind of rock formed in a different kind of environment than those further down the walls. Because they are highest in elevation, the bright layers are youngest in age. HiRISE is able to see dozens of the bright layers, which are perhaps only a meter in thickness. Darker sand dunes and ripples cover most of the plains and fill the floors of impact craters. Image PSP_001351_1715 was taken by the High Resolution Imaging Science Experiment (HiRISE) camera onboard the Mars Reconnaissance Orbiter spacecraft on November 9, 2006. The complete image is centered at -8.3 degrees latitude, 275.4 degrees East longitude. The range to the target site was 254.3 km (158.9 miles). At this distance the image scale ranges from 25.4 cm/pixel (with 1 x 1 binning) to 101.8 cm/pixel (with 4 x 4 binning). The image shown here has been map-projected to 25 cm/pixel and north is up. The image was taken at a local Mars time of 3:32 PM and the scene is illuminated from the west with a solar incidence angle of 59 degrees, thus the sun was about 31

  12. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  13. Infrared imaging of skin lesions

    Science.gov (United States)

    McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.

    2002-02-01

    IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.

  14. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... video. UPDATED: February 7, 2018 Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ...

  15. Skin Cancer Treatment

    Science.gov (United States)

    ... beds) over long periods of time. Having a fair complexion, which includes the following: Fair skin that freckles and burns easily, does not ... beds) over long periods of time. Having a fair complexion, which includes the following: Fair skin that ...

  16. Stages of Skin Cancer

    Science.gov (United States)

    ... beds) over long periods of time. Having a fair complexion, which includes the following: Fair skin that freckles and burns easily, does not ... beds) over long periods of time. Having a fair complexion, which includes the following: Fair skin that ...

  17. Healthy Skin Matters

    Science.gov (United States)

    ... keep your skin in good health. Eating a balanced diet will help you maintain a healthy weight and ... for your skin and your overall health. A balanced diet: Emphasizes fruits, vegetables, whole grains, and fat-free ...

  18. Examine Your Skin

    Medline Plus

    Full Text Available ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ...

  19. Radiation therapy -- skin care

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/patientinstructions/000735.htm Radiation therapy - skin care To use the sharing features on ... should treat your skin with care while receiving radiation therapy. Causes External radiation therapy uses high-powered x- ...

  20. Allergic Skin Conditions

    Science.gov (United States)

    ... 28 days to go away, even with treatment. Nickel, perfumes, dyes, rubber (latex) products and cosmetics also ... or swollen skin, you may have a skin allergy. • Urticaria (hives) are red, itchy, raised areas of ...

  1. Allergy testing - skin

    Science.gov (United States)

    ... not well controlled with medicine Hives and angioedema Food allergies Skin rashes ( dermatitis ), in which the skin becomes ... prick test may also be used to diagnose food allergies. Intradermal tests are not used to test for ...

  2. Allergy Skin Tests

    Science.gov (United States)

    ... Hay fever (allergic rhinitis) Allergic asthma Dermatitis (eczema) Food allergies Penicillin allergy Bee venom allergy Latex allergy Skin ... and dust mites. Skin testing may help diagnose food allergies. But because food allergies can be complex, you ...

  3. Correction of thickness measurement errors for two adjacent sheet structures in MR images

    International Nuclear Information System (INIS)

    Cheng Yuanzhi; Wang Shuguo; Sato, Yoshinobu; Nishii, Takashi; Tamura, Shinichi

    2007-01-01

    We present a new method for measuring the thickness of two adjacent sheet structures in MR images. In the hip joint, in which the femoral and acetabular cartilages are adjacent to each other, a conventional measurement technique based on the second derivative zero crossings (called the zero-crossings method) can introduce large underestimation errors in measurements of cartilage thickness. In this study, we have developed a model-based approach for accurate thickness measurement. We model the imaging process for two adjacent sheet structures, which simulate the two articular cartilages in the hip joint. This model can be used to predict the shape of the intensity profile along the sheet normal orientation. Using an optimization technique, the model parameters are adjusted to minimize the differences between the predicted intensity profile and the actual intensity profiles observed in the MR data. The set of model parameters that minimize the difference between the model and the MR data yield the thickness estimation. Using three phantoms and one normal cadaveric specimen, the usefulness of the new model-based method is demonstrated by comparing the model-based results with the results generated using the zero-crossings method. (author)

  4. Loading effects of anterior cervical spine fusion on adjacent segments

    Directory of Open Access Journals (Sweden)

    Chien-Shiung Wang

    2012-11-01

    Full Text Available Adjacent segment degeneration typically follows anterior cervical spine fusion. However, the primary cause of adjacent segment degeneration remains unknown. Therefore, in order to identify the loading effects that cause adjacent segment degeneration, this study examined the loading effects to superior segments adjacent to fused bone following anterior cervical spine fusion. The C3–C6 cervical spine segments of 12 sheep were examined. Specimens were divided into the following groups: intact spine (group 1; and C5–C6 segments that were fused via cage-instrumented plate fixation (group 2. Specimens were cycled between 20° flexion and 15° extension with a displacement control of 1°/second. The tested parameters included the range of motion (ROM of each segment, torque and strain on both the body and inferior articular process at the superior segments (C3–C4 adjacent to the fused bone, and the position of the neutral axis of stress at under 20° flexion and 15° extension. Under flexion and Group 2, torque, ROM, and strain on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. Under extension and Group 2, ROM for the fused segment was less than that of Group 1; torque, ROM, and stress on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. These analytical results indicate that the muscles and ligaments require greater force to achieve cervical motion than the intact spine following anterior cervical spine fusion. In addition, ROM and stress on the bodies and facets of the joint segments adjacent to the fused bone were significantly increased. Under flexion, the neutral axis of the stress on the adjacent segment moved backward, and the stress on the bodies of the segments adjacent to the fused bone increased. These comparative results indicate that increased stress on the adjacent segments is caused by stress-shielding effects

  5. Skin Conditions during Pregnancy

    Science.gov (United States)

    ... during pregnancy. For most skin changes, however, health care providers are not sure of the exact cause. Why do dark spots and patches appear on the skin during pregnancy? Dark spots and patches are caused by an increase in the body’s melanin—a natural substance that gives color to the skin and ...

  6. Microbiome and skin diseases

    NARCIS (Netherlands)

    Zeeuwen, P.L.; Kleerebezem, M.; Timmerman, H.M.; Schalkwijk, J.

    2013-01-01

    Purpose of review: This article reviews recent findings on the skin microbiome. It provides an update on the current understanding of the role of microbiota in healthy skin and in inflammatory and allergic skin diseases. Recent findings: Advances in computing and high-throughput sequencing

  7. In Vivo Characteristics of Nondegenerated Adjacent Segment Intervertebral Foramina in Patients With Degenerative Disc Disease During Flexion-Extension.

    Science.gov (United States)

    Cha, Thomas D; Moore, Gregory; Liow, Ming Han Lincoln; Zhong, Weiye; Wu, Minfei; Wang, Shaobai; Kang, James D; Wood, Kirkham B; Li, Guoan

    2017-03-15

    In vivo patient biomechanical study. To investigate the dimensions of lumbar intervertebral foramen (LIVF) of patients with degenerative disc disease (DDD) during a flexion-extension motion of the body. LIVF narrowing may result in nerve root compression. The area changes of degenerated and adjacent nondegenerated LIVFs in DDD patients under physiologic loading conditions are unknown. Nine symptomatic low back pain patients with radiological evidence of L4-S1 DDD were recruited. Each subject was magnetic resonance imaging scanned for construction of three-dimensional lumbar vertebral models, and fluoroscopically imaged when the body extended from 45 flexion to full extension for reconstruction of LIVF dimensions. The data of the adjacent segment L3/4 and diseased segments L4/5 and L5/S1 were compared with a normal control group at 45 flexion, upright, and full extension of the body. The mean LIVF areas of DDD segments were significantly smaller than those of the normal subjects in all positions (P 0.05). Similar reductions of the LIVF dimensions were observed at the adjacent and the involved levels of the DDD patients, implying that biomechanical changes might have already occurred at the adjacent segment despite the lack of radiographic evidence of degeneration. Subsequent research should focus on the effects of surgical fusion on the biomechanical features of the adjacent segment. N/A.

  8. Prognostic significance of the tumour-adjacent tissue in head and neck cancers.

    Science.gov (United States)

    Raudenska, Martina; Sztalmachova, Marketa; Gumulec, Jaromir; Fojtu, Michaela; Polanska, Hana; Balvan, Jan; Feith, Marek; Binkova, Hana; Horakova, Zuzana; Kostrica, Rom; Kizek, Rene; Masarik, Michal

    2015-12-01

    Even with significant advances in operative skills and adjuvant therapies, the overall survival of patients suffering with head and neck squamous cancers (HNSCC) is unsatisfactory. Accordingly, no clinically useful prognostic biomarkers have been found yet for HNSCC. Many studies analysed the expression of potential markers in tumour tissues compared to adjacent tissues. Nevertheless, due to the sharing of the same microenvironment, adjacent tissues show molecular similarity to tumour tissues. Thus, gene expression patterns of 94 HNSCC tumorous tissues were compared with 31 adjacent tissues and with 10 tonsillectomy specimens of non-cancer individuals. The genes analysed at RNA level using quantitative RT-PCR and correlated with clinico-pathological conditions were as follows: EGF, EGFR, MKI67, BCL2, BAX, FOS, JUN, TP53, VEGF, FLT1, MMP2, MMP9, MT1A and MT2A. The elevated MT2A, BAX, EGF and JUN expression was associated with the influence of tumour cells on the rearrangement of healthy tissues, as well as a significant shift in the BAX/BCL2 ratio. Our investigation also indicated that adjacent tissues play an important role in cancerogenesis by releasing several tumour-supporting factors such as EGF. A gradual increase in the metallothionein expression, from the lowest one in tonsillectomy samples to the highest ones in tumour samples, suggests that MT expression might be tissue reaction to the presence of tumour cells. The results of this study confirmed the significance of metallothionein in tumori-genesis and gave evidences for its use as a potential HNSCC biomarker. Furthermore, this study highlighted the importance of histologically normal tumour-adjacent tissue in prediction of HNSCC progress.

  9. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Science.gov (United States)

    Kermani, Hamed Reyhani; Keykhosravi, Ehsan; Mirkazemi, Masoud; Ehsaei, Mohammad R

    2013-01-01

    Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE) and T2 MRI (long TR/TE). Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes) demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%). However, patients with protruded discs showed less changes (30.9%). It showed that the difference was statistically significant (P<0.05). Conclusion: Extruded discs are associated with increased signal in T1-weighted MRI (short TR/TE) in the upper adjacent vertebrae. Signal changes in T2-weighted MRI (long TR/TE) in upper adjacent vertebrae are significantly more common in extruded discs, in comparison with protruded discs. PMID:25207294

  10. Ligamentum Flavum Hematoma in the Adjacent Segment after a long Level Fusion

    Science.gov (United States)

    Kim, Hyeun Sung; Lee, Sung Myung; Shin, Ho

    2011-01-01

    Ligamentum flavum hematoma (LFH) is a very rare condition of dural compression; most are observed in the mobile cervical and lumbar spine regions. A 67-year-old man who had a long level interbody fusion at L3-S1 four years ago presented with symptoms suggestive of dural compression. Magnetic resonance imaging showed a posterior semicircular mass located at the adjacent L2-L3 level. After decompression of the spinal canal and removal of the mass lesion, pathological examination of the surgical specimen revealed a hematoma within the ligamentum. The patient fully recovered to normal status after surgery. Here, we report our experience with a LFH in the adjacent segment after a long level fusion procedure and discuss the possible associated mechanisms. PMID:21494365

  11. Dry skin conditions, eczema and emollients in their management

    Directory of Open Access Journals (Sweden)

    Siddappa K

    2003-03-01

    Full Text Available Dry skin, which refers to roughened, flaky, or scaly skin that is less flexible than normal and dry to feel, is relatively common problem in all age groups, but is more common in elderly individuals. The water content of the stratum corneum is of paramount importance in maintaining the normal appearance and texture of human skin. The relative hydration of the stratum corneum is a composite of 3 factors viz. the rate of water transport from dermis to stratum corneum, the rate of surface loss of water and the rate of water binding ability of stratum corneum. Loss of integrity of the barrier function is a central factor in the development of dry skin conditions and eczema. The various factors involved in producing dry skin, various causes of dry skin and the role of emollients in the management of these conditions are discussed.

  12. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    barrier integrity, factors influencing the penetration of the skin, influence of wet work, and guidance for prevention and saving the barrier. Distinguished researchers have contributed to this book, providing a comprehensive and thorough overview of the skin barrier function. Researchers in the field...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  13. Pursuing prosthetic electronic skin

    Science.gov (United States)

    Chortos, Alex; Liu, Jia; Bao, Zhenan

    2016-09-01

    Skin plays an important role in mediating our interactions with the world. Recreating the properties of skin using electronic devices could have profound implications for prosthetics and medicine. The pursuit of artificial skin has inspired innovations in materials to imitate skin's unique characteristics, including mechanical durability and stretchability, biodegradability, and the ability to measure a diversity of complex sensations over large areas. New materials and fabrication strategies are being developed to make mechanically compliant and multifunctional skin-like electronics, and improve brain/machine interfaces that enable transmission of the skin's signals into the body. This Review will cover materials and devices designed for mimicking the skin's ability to sense and generate biomimetic signals.

  14. The use of matriderm and autologous skin graft in the treatment of full thickness skin defects.

    Science.gov (United States)

    Min, Jang Hwan; Yun, In Sik; Lew, Dae Hyun; Roh, Tai Suk; Lee, Won Jai

    2014-07-01

    For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG) are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800), the value of the trans-epidermal water loss (TEWL) was 10.0 (range, 8.15-11.00) g/hr/m(2), and the humidification value was 24.0 (range, 15.5-30.0). The levels of erythema and melanin were 352.0 arbitrary unit (AU) (range, 299.25-402.75 AU) and 211.0 AU (range, 158.25-297.00 AU), respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. The results of this study demonstrate that a dermal substitute (Matriderm) with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

  15. The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

    Directory of Open Access Journals (Sweden)

    Jang Hwan Min

    2014-07-01

    Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

  16. Skin manifestations in a case of trisomy 16 mosaicism

    DEFF Research Database (Denmark)

    Ousager, Lilian Bomme; Brandrup, Flemming; Andersen, Charlotte Brasch

    2006-01-01

    We present a 48-year-old man with unilateral dermatological manifestations including hypertrichosis, telangiectasia, hyperkeratosis and hyperpigmentation. Additional findings included skeletal abnormalities and left-sided hearing loss. Skin biopsies showed changes characteristic of porokeratosis....... Fibroblast karyotyping from affected skin demonstrated trisomy 16 mosaicism, in contrast to the normal karyotype in unaffected skin and blood lymphocytes. The possible role of trisomy 16 in porokeratosis is discussed....

  17. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  18. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... Anyone Can Get Skin Cancer brochure Is it true that only people with light skin get skin cancer? No. Anyone can get skin cancer. It's more common among people with a light (fair) skin tone, but skin cancer can affect anyone. ...

  19. Complications of ichthyosis beyond the skin.

    Science.gov (United States)

    Diaz, Lucia Z; Browning, John C; Smidt, Aimee C; Rizzo, William B; Levy, Moise L

    2013-01-01

    Although ichthyoses are noted for their skin features, like many dermatologic conditions, patients are often impacted in ways beyond the skin. Much has been described in recent years regarding quality of life and skin disorders. This is certainly the case for ichthyosis. For neonates or others with diffuse involvement of their skin, nutritional needs are often exceeding normal requirements. These can often result in growth abnormalities. Lastly, with specific subtypes of ichthyosis, compromise of tissues around the eyes and ears can be of concern to some patients. Certainly, some forms of ichthyosis are routinely complicated by such findings. It is important for practitioners caring for individuals with ichthyosis to have these issues in mind. © 2013 Wiley Periodicals, Inc.

  20. Influence of cantilevered sheet pile deflection on adjacent roadways.

    Science.gov (United States)

    2009-06-01

    Cantilevered sheet pile walls are often used adjacent roadways as temporary support during construction. Excess movement of these walls has led to excessive roadway distress causing additional repairs to be necessary. This study assessed the effects ...

  1. Systems of pillarless working of adjacent, sloped and inclined seams

    Energy Technology Data Exchange (ETDEWEB)

    Batmanov, Yu.K.; Bakhtin, A.F.; Bulavka, E.I.

    1979-01-01

    An analysis is made (advantages and disadvantages) of existing and recommended (pillarless) systems of working adjacent, sloped, and inclined seams. The economic benefits, area and extent of those systems are indicated. 8 references, 4 figures.

  2. Diagnosis of malignant melanoma and basal cell carcinoma by in vivo NIR-FT Raman spectroscopy is independent of skin pigmentation

    DEFF Research Database (Denmark)

    Philipsen, P A; Knudsen, L; Gniadecka, M

    2013-01-01

    and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...

  3. Adjacent segment disease perspective and review of the literature.

    Science.gov (United States)

    Saavedra-Pozo, Fanor M; Deusdara, Renato A M; Benzel, Edward C

    2014-01-01

    Adjacent segment disease has become a common topic in spine surgery circles because of the significant increase in fusion surgery in recent years and the development of motion preservation technologies that theoretically should lead to a decrease in this pathology. The purpose of this review is to organize the evidence available in the current literature on this subject. FOR THIS LITERATURE REVIEW, A SEARCH WAS CONDUCTED IN PUBMED WITH THE FOLLOWING KEYWORDS: adjacent segment degeneration and disease. Selection, review, and analysis of the literature were completed according to level of evidence. The PubMed search identified 850 articles, from which 41 articles were selected and reviewed. The incidence of adjacent segment disease in the cervical spine is close to 3% without a significant statistical difference between surgical techniques (fusion vs arthroplasty). Authors report the incidence of adjacent segment disease in the lumbar spine to range from 2% to 14%. Damage to the posterior ligamentous complex and sagittal imbalances are important risk factors for both degeneration and disease. Insufficient evidence exists at this point to support the idea that total disc arthroplasty is superior to fusion procedures in minimizing the incidence of adjacent segment disease. The etiology is most likely multifactorial but it is becoming abundantly clear that adjacent segment disease is not caused by motion segment fusion alone. Fusion plus the presence of abnormal end-fusion alignment appears to be a major factor in creating end-fusion stresses that result in adjacent segment degeneration and subsequent disease. The data presented cast further doubt on previously established rationales for total disc arthroplasty, at least with regard to the effect of total disc arthroplasty on adjacent segment degeneration pathology.

  4. Adjacent Segment Disease Perspective and Review of the Literature

    Science.gov (United States)

    Saavedra-Pozo, Fanor M.; Deusdara, Renato A. M.; Benzel, Edward C.

    2014-01-01

    Background Adjacent segment disease has become a common topic in spine surgery circles because of the significant increase in fusion surgery in recent years and the development of motion preservation technologies that theoretically should lead to a decrease in this pathology. The purpose of this review is to organize the evidence available in the current literature on this subject. Methods For this literature review, a search was conducted in PubMed with the following keywords: adjacent segment degeneration and disease. Selection, review, and analysis of the literature were completed according to level of evidence. Results The PubMed search identified 850 articles, from which 41 articles were selected and reviewed. The incidence of adjacent segment disease in the cervical spine is close to 3% without a significant statistical difference between surgical techniques (fusion vs arthroplasty). Authors report the incidence of adjacent segment disease in the lumbar spine to range from 2% to 14%. Damage to the posterior ligamentous complex and sagittal imbalances are important risk factors for both degeneration and disease. Conclusion Insufficient evidence exists at this point to support the idea that total disc arthroplasty is superior to fusion procedures in minimizing the incidence of adjacent segment disease. The etiology is most likely multifactorial but it is becoming abundantly clear that adjacent segment disease is not caused by motion segment fusion alone. Fusion plus the presence of abnormal end-fusion alignment appears to be a major factor in creating end-fusion stresses that result in adjacent segment degeneration and subsequent disease. The data presented cast further doubt on previously established rationales for total disc arthroplasty, at least with regard to the effect of total disc arthroplasty on adjacent segment degeneration pathology. PMID:24688337

  5. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...

  6. Variability of adjacency effects in sky reflectance measurements.

    Science.gov (United States)

    Groetsch, Philipp M M; Gege, Peter; Simis, Stefan G H; Eleveld, Marieke A; Peters, Steef W M

    2017-09-01

    Sky reflectance R sky (λ) is used to correct in situ reflectance measurements in the remote detection of water color. We analyzed the directional and spectral variability in R sky (λ) due to adjacency effects against an atmospheric radiance model. The analysis is based on one year of semi-continuous R sky (λ) observations that were recorded in two azimuth directions. Adjacency effects contributed to R sky (λ) dependence on season and viewing angle and predominantly in the near-infrared (NIR). For our test area, adjacency effects spectrally resembled a generic vegetation spectrum. The adjacency effect was weakly dependent on the magnitude of Rayleigh- and aerosol-scattered radiance. The reflectance differed between viewing directions 5.4±6.3% for adjacency effects and 21.0±19.8% for Rayleigh- and aerosol-scattered R sky (λ) in the NIR. Under which conditions in situ water reflectance observations require dedicated correction for adjacency effects is discussed. We provide an open source implementation of our method to aid identification of such conditions.

  7. Biomechanical effects of pedicle screw fixation on adjacent segments.

    Science.gov (United States)

    Kyaw, Thein Aung; Wang, Zhuo; Sakakibara, Toshihiko; Yoshikawa, Takamasa; Inaba, Tadashi; Kasai, Yuichi

    2014-07-01

    Various biomechanical investigations have attempted to clarify the aetiology of adjacent segment disease (ASD). However, no biomechanical study has examined in detail the deformation behaviour of the adjacent segments when both pure torque and an angular displacement load are applied to the vertebrae along multiple segments. The purpose of this study is to investigate the biomechanical effects of pedicle screw fixation on adjacent segments. Ten cadaveric lumbar spines (L2-L5) of boars were used. Control and fusion models were prepared by disc damage and pedicle screw fixation of each specimen, and then, bending and rotation tests were performed using a six-axis material tester. In the biomechanical tests regulated by an angular displacement load, the range of motion (ROM) of the cranial and caudal adjacent segments in antero-posterior flexion and lateral bending was increased by about 20 % (p fusion surgery as a mechanism to compensate for the ROM lost due to excessive fusion by pedicle screw fixation, so that a large torque may be applied to adjacent segments within a physiologically possible range, and it might gradually lead to a degenerative intervertebral disc or progression of spondylolisthesis in the adjacent segments.

  8. Skin care products can aggravate epidermal function: studies in a murine model suggest a pathogenic role in sensitive skin.

    Science.gov (United States)

    Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang

    2018-02-01

    Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. [Effects of frictional properties on traumas of rabbit skin].

    Science.gov (United States)

    Li, Wei; Qu, Shuxin; Kong, Mei; Zhou, Zhongrong

    2008-04-01

    Simulative experiments on skin traumas between prosthetic socket materials and residual limb skin were investigated by using the means of tribology, histology and animal experiment. Healthy adult rabbits were used as animal model and their denuded back skin was selected as experimental position to simulate residual limb skin. The effects of different normal load and reciprocal sliding frequency on rabbit skin trauma grade were investigated by using a reciprocal sliding skin friction testing apparatus to simulate prosthesis gait. The traumatic subcutaneous tissue slice was stained with hematoxylineosin and the morphology was observed under the optical microscope. The scab thickness of traumatic skin was measured under x 10 object lens. The inflammatory cells were counted in a given visual field under x 20 object lens. The statistical significance analysis of scab thickness and inflammatory cells were carried out to assess the effect of different frictional conditions on skin pathological traumas. The results showed: the greater normal load and higher reciprocal sliding frequency applied on the rabbit skin, the more serious injury to skin and more inflammatory cells in the subcutaneous tissue at the same time. The findings provide a theoretical basis of comfortized prosthesis design and gait analysis for the amputee.

  10. The Volpe Center GPS Adjacent Band Compatibility Program Plan : GPS Adjacent Band Compatibility Workshop, Volpe Center, Cambridge MA

    Science.gov (United States)

    2014-09-18

    Approach to DOT GPS Adjacent Band Compatibility Assessment. Identify forums and provide public outreach to make sure the progress and work are as open and transparent as possible. Develop an implementation plan that incorporates aspects from the DOT ...

  11. Normal Pressure Hydrocephalus (NPH)

    Science.gov (United States)

    ... local chapter Join our online community Normal Pressure Hydrocephalus (NPH) Normal pressure hydrocephalus is a brain disorder ... Symptoms Diagnosis Causes & risks Treatments About Normal Pressure Hydrocephalus Normal pressure hydrocephalus occurs when excess cerebrospinal fluid ...

  12. Hydromagnetic flow and heat transfer adjacent to a stretching vertical sheet in a micropolar fluid

    Directory of Open Access Journals (Sweden)

    Yacob Nor Azizah

    2013-01-01

    Full Text Available An analysis is carried out for the steady two-dimensional mixed convection flow adjacent to a stretching vertical sheet immersed in an incompressible electrically conducting micropolar fluid. The stretching velocity and the surface temperature are assumed to vary linearly with the distance from the leading edge. The governing partial differential equations are transformed into a system of ordinary differential equations, which is then solved numerically using a finite difference scheme known as the Keller box method. The effects of magnetic and material parameters on the flow and heat transfer characteristics are discussed. It is found that the magnetic field reduces both the skin friction coefficient and the heat transfer rate at the surface for any given K and λ. Conversely, both of them increase as the material parameter increases for fixed values of M and λ.

  13. Cutaneous Leishmaniasis Induces a Transmissible Dysbiotic Skin Microbiota that Promotes Skin Inflammation.

    Science.gov (United States)

    Gimblet, Ciara; Meisel, Jacquelyn S; Loesche, Michael A; Cole, Stephen D; Horwinski, Joseph; Novais, Fernanda O; Misic, Ana M; Bradley, Charles W; Beiting, Daniel P; Rankin, Shelley C; Carvalho, Lucas P; Carvalho, Edgar M; Scott, Phillip; Grice, Elizabeth A

    2017-07-12

    Skin microbiota can impact allergic and autoimmune responses, wound healing, and anti-microbial defense. We investigated the role of skin microbiota in cutaneous leishmaniasis and found that human patients infected with Leishmania braziliensis develop dysbiotic skin microbiota, characterized by increases in the abundance of Staphylococcus and/or Streptococcus. Mice infected with L. major exhibit similar changes depending upon disease severity. Importantly, this dysbiosis is not limited to the lesion site, but is transmissible to normal skin distant from the infection site and to skin from co-housed naive mice. This observation allowed us to test whether a pre-existing dysbiotic skin microbiota influences disease, and we found that challenging dysbiotic naive mice with L. major or testing for contact hypersensitivity results in exacerbated skin inflammatory responses. These findings demonstrate that a dysbiotic skin microbiota is not only a consequence of tissue stress, but also enhances inflammation, which has implications for many inflammatory cutaneous diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Construction of Three-Dimensional Dermo-Epidermal Skin Equivalents Using Cell Coating Technology and Their Utilization as Alternative Skin for Permeation Studies and Skin Irritation Tests.

    Science.gov (United States)

    Akagi, Takami; Nagura, Mayuka; Hiura, Ayami; Kojima, Hajime; Akashi, Mitsuru

    2017-06-01

    In vitro generated human skin equivalents are generating interest as promising tools in basic study, as alternatives to animal testing, and for clinical applications in regenerative medicine. For prediction of skin irritation and corrosion, three-dimensional human skin equivalents consisting of differentiated human keratinocytes (KCs) have been developed and some models have been internationally accepted. However, more delicate assessments using full-thickness skin models, such as skin sensitization tests, cannot be performed due to the lack of a dermis containing fibroblasts or appendages. In a previous study, we developed dermo-epidermal human skin equivalents (DESEs) using a cell coating technique, which employs cell surface coating by layer-by-layer assembled extracellular matrix (ECM) films. The DESEs with dermis consisting of normal human dermal fibroblasts (NHDFs) and epidermis consisting of human KCs were easily fabricated by using this technology. In this study, the constructed DESEs were evaluated as an alternative skin for skin permeation and irritation tests. A good relationship of permeability coefficient of chemicals was observed between the DESEs and human skin data. We investigated whether the DESEs, a new in vitro skin model, are capable of identifying skin irritant and nonirritant substances among 20 reference chemicals. It was confirmed that the DESEs are applicable to skin irritation testing as defined in the European Centre for the Validation of Alternative Methods (ECVAM) Performance Standard (OECD Test Guideline 439). We further studied the construction of DESEs with density-controlled blood capillary networks using human umbilical vein endothelial cells (HUVECs). The results suggest that DESEs allowing incorporation of skin appendages are more promising alternatives to animal testing and can be applied to the design of physiologically relevant in vitro skin models.

  15. Frequent DPH3 promoter mutations in skin cancers.

    Science.gov (United States)

    Denisova, Evgeniya; Heidenreich, Barbara; Nagore, Eduardo; Rachakonda, P Sivaramakrishna; Hosen, Ismail; Akrap, Ivana; Traves, Víctor; García-Casado, Zaida; López-Guerrero, José Antonio; Requena, Celia; Sanmartin, Onofre; Serra-Guillén, Carlos; Llombart, Beatriz; Guillén, Carlos; Ferrando, Jose; Gimeno, Enrique; Nordheim, Alfred; Hemminki, Kari; Kumar, Rajiv

    2015-11-03

    Recent reports suggested frequent occurrence of cancer associated somatic mutations within regulatory elements of the genome. Based on initial exome sequencing of 21 melanomas, we report frequent somatic mutations in skin cancers in a bidirectional promoter of diphthamide biosynthesis 3 (DPH3) and oxidoreductase NAD-binding domain containing 1 (OXNAD1) genes. The UV-signature mutations occurred at sites adjacent and within a binding motif for E-twenty six/ternary complex factors (Ets/TCF), at -8 and -9 bp from DPH3 transcription start site. Follow up screening of 586 different skin lesions showed that the DPH3 promoter mutations were present in melanocytic nevi (2/114; 2%), melanoma (30/304; 10%), basal cell carcinoma of skin (BCC; 57/137; 42%) and squamous cell carcinoma of skin (SCC; 12/31; 39%). Reporter assays carried out in one melanoma cell line for DPH3 and OXNAD1 orientations showed statistically significant increased promoter activity due to -8/-9CC > TT tandem mutations; although, no effect of the mutations on DPH3 and OXNAD1 transcription in tumors was observed. The results from this study show occurrence of frequent somatic non-coding mutations adjacent to a pre-existing binding site for Ets transcription factors within the directional promoter of DPH3 and OXNAD1 genes in three major skin cancers. The detected mutations displayed typical UV signature; however, the functionality of the mutations remains to be determined.

  16. Skin tribology: Science friction?

    OpenAIRE

    Heide, E. van der; Zeng, X.; Masen, M.A.

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is frequently one of the interacting surfaces in relative motion. People seem to solve these problems related to skin friction based upon a trial-and-error strategy and based upon on our sense for touch....

  17. Molecular Disorganization of Axons Adjacent to Human Cortical Microinfarcts

    Directory of Open Access Journals (Sweden)

    Hamza Coban

    2017-08-01

    Full Text Available Cortical microinfarcts (CMIs are microscopically identified wedge-shaped ischemic lesions that occur at or near the cortical surface and result from occlusion of penetrating arterioles. These microscopic lesions can be observed with high-resolution magnetic resonance imaging in aging brains and in patients with cerebrovascular disease. Recent studies have suggested that strategically located microinfarcts strongly correlate with cognitive deficits, which can contribute to Alzheimer’s disease as well as other forms of dementia. We have recently shown that the molecular organization of axons into functional microdomains is altered in areas adjacent to white matter lacunar and microinfarcts, creating a peri-infarct penumbral injury in surviving axons. Whether similar changes in nodal, adjacent paranodal, and proximal axon initial segment molecular organization occur in the cortex adjacent to human CMIs is not known. Paraffin-embedded sections of autopsy brain tissue from five patients with CMIs were immunofluorescently labeled for nodal and paranodal markers including beta-IV spectrin, ankyrin-G, and contactin-associated protein. High magnification images from the peri-infarct cortical tissue were generated using confocal microscopy. In surviving cortical tissue adjacent to microinfarcts, we observed a dramatic loss of axon initial segments, suggesting that neuronal firing capacity in adjacent cortical tissue is likely compromised. The number of identifiable nodal/paranodal complexes in surviving cortical tissue is reduced adjacent to microinfarcts, while the average paranodal length is increased indicating a breakdown of axoglial contact. This axonal microdomain disorganization occurs in the relative absence of changes in the structural integrity of myelinated axons as measured by myelin basic protein and neurofilament staining. These findings indicate that the molecular organization of surviving axons adjacent to human CMIs is abnormal

  18. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Directory of Open Access Journals (Sweden)

    Hamed Reyhani Kermani

    2013-12-01

    Full Text Available Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE and T2 MRI (long TR/TE.   Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%. However, patients with protruded discs showed less changes (30.9%. It showed that the difference was statistically significant (P

  19. The Relationship Between Morphology of Lumbar Disc Herniation and MRI Changes in Adjacent Vertebral Bodies

    Directory of Open Access Journals (Sweden)

    Hamed Reyhani Kermani

    2013-12-01

    Full Text Available   Background: Intervertebral disc herniation has two common types, extrusion and protrusion, which may affect the adjacent vertebrae.In addition, it is associated with significant signal changes in T1 MRI (short TR/TE and T2 MRI (long TR/TE.   Methods: The present study is a cross-sectional analytic one, in which sampling was performed retrospectively. Cases were randomly selected from the patients undergoing discectomy in our department in a one-year period. Before surgery, MRI images, T1-weighted and T2-weighted sagittal cuts were interpreted by an expert radiologist. Signal intensity of the upper and the lower adjacent vertebra and the operated herniated disc were compared with the normal discs, both in T1-weighted and T2-weighted. Changes in signal intensity were recorded in qualitative variables. Statistical analysis was then performed between two groups. Results: In the present study, we have evaluated 170 patients undergoing lumbar disc herniation surgery, which included 97 protruded and 86 extruded discs. The patients’ age ranged from 21 to 78 years old, with an average of 43.03 ±11.4 years. Evaluating the type of discopathy with the presence of signal changes (hypo or hyper signal changes demonstrated more signal changes in upper adjacent vertebrae in T2-weighted MRI (45.3%. However, patients with protruded discs showed less changes (30.9%. It showed that the difference was statistically significant (P

  20. Characterization of hair follicle development in engineered skin substitutes.

    Directory of Open Access Journals (Sweden)

    Penkanok Sriwiriyanont

    Full Text Available Generation of skin appendages in engineered skin substitutes has been limited by lack of trichogenic potency in cultured postnatal cells. To investigate the feasibility and the limitation of hair regeneration, engineered skin substitutes were prepared with chimeric populations of cultured human keratinocytes from neonatal foreskins and cultured murine dermal papilla cells from adult GFP transgenic mice and grafted orthotopically to full-thickness wounds on athymic mice. Non-cultured dissociated neonatal murine-only skin cells, or cultured human-only skin keratinocytes and fibroblasts without dermal papilla cells served as positive and negative controls respectively. In this study, neonatal murine-only skin substitutes formed external hairs and sebaceous glands, chimeric skin substitutes formed pigmented hairs without sebaceous glands, and human-only skin substitutes formed no follicles or glands. Although chimeric hair cannot erupt readily, removal of upper skin layer exposed keratinized hair shafts at the skin surface. Development of incomplete pilosebaceous units in chimeric hair corresponded with upregulation of hair-related genes, LEF1 and WNT10B, and downregulation of a marker of sebaceous glands, Steroyl-CoA desaturase. Transepidermal water loss was normal in all conditions. This study demonstrated that while sebaceous glands may be involved in hair eruption, they are not required for hair development in engineered skin substitutes.

  1. Fusionless instrumentation in growing spine and adjacent segment problems: an experimental study in immature pigs.

    Science.gov (United States)

    Yilgor, Caglar; Demirkiran, H Gokhan; Aritan, Serdar; Kosemehmetoglu, Kemal; Daglioglu, Kenan; Isikhan, Selen Yilmaz; Yazici, Muharrem

    2013-12-01

    spine model, in comparison with IF applications, FI is closer to normal physiology even after several lengthening procedures regarding the adjacent segment discs, facet joints, and motion, when interpreting the radiological, biomechanical, and histological results altogether.

  2. Wound healing in denervated rat skin.

    Science.gov (United States)

    Fukai, Takao; Takeda, Akira; Uchinuma, Eijyu

    2005-01-01

    Recently, several reports have suggested that innervation influences wound healing. However, some investigators have reported that nerve injury prevented wound healing while others have suggested it had no influence on full-thickness skin wound healing. We created denervated skin areas on rats by dissection of the spinal hemicord. Subsequently, 15-mm-diameter skin defects were made symmetrically within the denervated area on the right side of the back and the normal innervated area on the left side. Biopsies were performed at 3, 7, and 14 days after wounding. We measured changes of the wound surface area, the rate of wound contraction, and the rate of epithelialization. The differences were not significant at 3 or 7 days after the operation. However, we could observe significantly delayed wound healing of the denervated skin areas compared to the normal areas at 14 days. Both wound contraction and epithelialization were delayed in the denervated groups. Our results suggest that sensory disturbance is a negative factor for skin wound healing.

  3. Vertebroplasty for adjacent vertebral fracture following lumbar interbody fusion.

    Science.gov (United States)

    Ahn, Yong; Lee, Sang-Ho

    2011-02-01

    Adjacent segment vertebral compression fracture after lumbosacral instrumented fusion has been reported to be a significant complication. Recently, percutaneous vertebroplasty (PVP) has been widely used for the treatment of non-traumatic osteoporotic vertebral fracture. However, the clinical effect of this minimally invasive treatment option to the post-fusion vertebral fracture has rarely been reported. We analysed characteristics of adjacent vertebral fractures following lumbar fusion and evaluated the clinical outcome of PVP. A total of 202 consecutive patients underwent PVP for compression fracture in our institute between January 2007 and December 2008. Among them, nine symptomatic adjacent vertebral fractures following lumbar fusion were identified. We randomly selected 50 control patients undergoing vertebroplasty for osteoporotic compression fracture in single level. We analysed the clinical data according to age, height, body weight, body mass index (BMI), and bone mineral density (BMD). Clinical outcome was assessed by a visual analogue scale (VAS) score and the rate of overall satisfaction. Fractures occurred at the cranial adjacent vertebra after fusion surgery in all cases. The mean BMD score for the spine and femur were significantly higher than the control group (p adjacent segment disease. The increased stress around the fusion segment can cause vertebral fracture even with a relatively higher BMD score. Vertebroplasty for the post-fusion vertebral fracture can be as effective as it is for the usual osteoporotic vertebral fracture.

  4. Best Merge Region Growing Segmentation with Integrated Non-Adjacent Region Object Aggregation

    Science.gov (United States)

    Tilton, James C.; Tarabalka, Yuliya; Montesano, Paul M.; Gofman, Emanuel

    2012-01-01

    Best merge region growing normally produces segmentations with closed connected region objects. Recognizing that spectrally similar objects often appear in spatially separate locations, we present an approach for tightly integrating best merge region growing with non-adjacent region object aggregation, which we call Hierarchical Segmentation or HSeg. However, the original implementation of non-adjacent region object aggregation in HSeg required excessive computing time even for moderately sized images because of the required intercomparison of each region with all other regions. This problem was previously addressed by a recursive approximation of HSeg, called RHSeg. In this paper we introduce a refined implementation of non-adjacent region object aggregation in HSeg that reduces the computational requirements of HSeg without resorting to the recursive approximation. In this refinement, HSeg s region inter-comparisons among non-adjacent regions are limited to regions of a dynamically determined minimum size. We show that this refined version of HSeg can process moderately sized images in about the same amount of time as RHSeg incorporating the original HSeg. Nonetheless, RHSeg is still required for processing very large images due to its lower computer memory requirements and amenability to parallel processing. We then note a limitation of RHSeg with the original HSeg for high spatial resolution images, and show how incorporating the refined HSeg into RHSeg overcomes this limitation. The quality of the image segmentations produced by the refined HSeg is then compared with other available best merge segmentation approaches. Finally, we comment on the unique nature of the hierarchical segmentations produced by HSeg.

  5. Skin perfusion pressure on the legs measured as the external pressure required for skin reddening after blanching

    DEFF Research Database (Denmark)

    Holstein, P; Nielsen, P.E.; Lund, P

    1980-01-01

    The skin perfusion on the calf was measured photo-electrically and by isotope washout technique using external counter pressure by a blood pressure cuff. By the photocell the skin blanching threshold external pressure (BTEP) was recorded on histamine flared red skin. By isotope washout technique......Hg (SD 8.7). As compared to the intra-arterial blood pressure the BTEP was found to lie close to the mean blood pressure in normal subjects as well as in hypertensive subjects. The present data indicate that the skin perfusion pressure on the legs can be measured by the rapid photo-electric technique...

  6. The Raman spectrum character of skin tumor induced by UVB

    Science.gov (United States)

    Wu, Shulian; Hu, Liangjun; Wang, Yunxia; Li, Yongzeng

    2016-03-01

    In our study, the skin canceration processes induced by UVB were analyzed from the perspective of tissue spectrum. A home-made Raman spectral system with a millimeter order excitation laser spot size combined with a multivariate statistical analysis for monitoring the skin changed irradiated by UVB was studied and the discrimination were evaluated. Raman scattering signals of the SCC and normal skin were acquired. Spectral differences in Raman spectra were revealed. Linear discriminant analysis (LDA) based on principal component analysis (PCA) were employed to generate diagnostic algorithms for the classification of skin SCC and normal. The results indicated that Raman spectroscopy combined with PCA-LDA demonstrated good potential for improving the diagnosis of skin cancers.

  7. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    DEFF Research Database (Denmark)

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

    2010-01-01

    interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

  8. Discovery of skin lymphocytes was a game changer in experimental dermatology

    NARCIS (Netherlands)

    Matos, Tiago R.; de Rie, Menno A.

    2017-01-01

    A substantial part of ongoing research in experimental dermatology focuses on skin T cellsfor that reason, we find important to highlight the pioneering work of Jan D. Bos et al. from 1987 (The skin immune system (SIS): Distribution and immunophenotype of lymphocyte subpopulations in normal skin)

  9. Adjacent Infrared Multitarget Detection Using Robust Background Estimation

    Directory of Open Access Journals (Sweden)

    Sungho Kim

    2016-01-01

    Full Text Available Small target detection is very important for infrared search and track (IRST problems. Grouped targets are difficult to detect using the conventional constant false alarm rate (CFAR detection method. In this study, a novel multitarget detection method was developed to identify adjacent or closely spaced small infrared targets. The neighboring targets decrease the signal-to-clutter ratio in hysteresis threshold-based constant false alarm rate (H-CFAR detection, which leads to poor detection performance in cluttered environments. The proposed adjacent target rejection-based robust background estimation can reduce the effects of the neighboring targets and enhance the small multitarget detection performance in infrared images by increasing the signal-to-clutter ratio. The experimental results of the synthetic and real adjacent target sequences showed that the proposed method produces an upgraded detection rate with the same false alarm rate compared to the recent target detection methods (H-CFAR, Top-hat, and TDLMS.

  10. Evaluation of the stress distribution change at the adjacent facet joints after lumbar fusion surgery: a biomechanical study.

    Science.gov (United States)

    Ma, Jianxiong; Jia, Haobo; Ma, Xinlong; Xu, Weiguo; Yu, Jingtao; Feng, Rui; Wang, Jie; Xing, Dan; Wang, Ying; Zhu, Shaowen; Yang, Yang; Chen, Yang; Ma, Baoyi

    2014-07-01

    Spinal fusion surgery has been widely applied in clinical treatment, and the spinal fusion rate has improved markedly. However, its postoperative complications, especially adjacent segment degeneration, have increasingly attracted the attention of spinal surgeons. The most common pathological condition at adjacent segments is hypertrophic degenerative arthritis of the facet joint. To study the stress distribution changes at the adjacent facet joint after lumbar fusion with pedicle screw fixation, human cadaver lumbar spines were used in the present study, and electrical resistance strain gauges were attached on L1-L4 articular processes parallel or perpendicular to the articular surface of facet joints. Subsequently, electrical resistance strain gauge data were measured using anYJ-33 static resistance strain indicator with three types of models: the intact model, the laminectomy model, and the fusion model with pedicle screw fixation. The strain changes in the measurement sites indirectly reflect the stress changes. Significant differences in strain were observed between the normal and laminectomy state at all facet joints. Significant differences in strain were observed between the normal and the pedicle screw fixation fusion state at the L1/2 and L3/4 facet joints. The increased stress on the facet joints after lumbar fusion with pedicle screw fixation may be the cause of adjacent segment degeneration. © IMechE 2014.

  11. Autofluorescence properties of skin and applications in dermatology

    Science.gov (United States)

    Zeng, Haishan; McLean, David I.; MacAulay, Calum E.; Lui, Harvey

    2000-10-01

    Skin autofluorescence was observed as early as 1908. Its applications in dermatology was first reported in 1925- the use of Wood's lamp for the detection of fungal infection. In the first part of the paper, a historical review was presented on skin autofluorescence properties. In the second part, systematic research done in out laboratory on autofluorescence properties of normal and diseased skin was summarized. We developed three tools for the study: 1) a compact fiber optic spectrometer for in vivo macroscopic fluorescence spectral measurements on volunteers and patients; 2) a CCD camera based fluorescence imaging for in vivo macroscopic imaging of 2D fluorescence intensity distributions over various skin diseases; 3) a fiber optic microspectrophotometer (MSP) system for in vitro microscopic fluorescence spectral measurements and fluorescence imaging of frozen tissue sections. With these tools, we obtained the excitation-emission matrices (EEMs) of in vivo normal skin, the temporal dynamics of skin autofluorescence decay under continuous wave laser exposure, and fluorescence spectra of 1500 lesions from 600 patients spanning 35 disease types. Monte Carlo simulation has been employed to explain the autofluorescence decay dynamics and to reconstruct the in vivo spectra from in vitro microscopic fluorophore distribution and intrinsic fluorescence spectra of various skin structures. Spectral feature based linear discrimination function analysis and principal components decomposition analysis are performed to assess the potential of autofluorescence spectroscopy for skin cancer detection. Clinical test of a fluorescence scope system for skin cancer margin delineation is under way.

  12. Skin tribology: Science friction?

    NARCIS (Netherlands)

    Heide, E. van der; Zeng, X.; Masen, M.A.

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is

  13. Skin, Hair, and Nails

    Science.gov (United States)

    ... cells in skin, people couldn't feel warmth, cold, or other sensations. For instance, goosebumps form when the erector pili muscles contract to make hairs on the skin stand up straight when someone is cold, excited, or frightened — the blood vessels keep the ...

  14. Deformable skinning on bones

    DEFF Research Database (Denmark)

    Larsen, Bent Dalgaard; Petersen, Kim Steen; Jakobsen, Bjarke

    2001-01-01

    Applying skin to a model is a relatively simple task to implement. Nonetheless it seems that no good resource exists that describes both the concepts and math necessary to understand and implement skinning. The intention of this article is an attempt to give a thoroughly description of the theore...

  15. Emission of pesticides during drilling and deposition in adjacent areas

    Directory of Open Access Journals (Sweden)

    Heimbach, Udo

    2014-02-01

    Full Text Available In seven experiments seeds of maize, oil seed rape and barley, treated with neonicotinoids, were sown using pneumatic drilling equipment with deflectors attached in case of pneumatic suction systems. Directly adjacent to the drilled area of usually about 50 m width were replicated areas with bare soil as well as with crops. During maize (Zea mays drilling flowering oil seed rape (Brassica napus and during drilling of barley (Hordeum vulgare and oil seed rape flowering white mustard (Sinapis alba was adjacent. The amount of residues in the adjacent non crop areas in Petri dishes being distributed on the bare soil declined only slowly from 1 to 20 m distance from the area drilled. Seed batches with more abrasion and higher content of active substances in the dust resulted in higher residues off crop. After drilling of maize in four experiments in Petri dishes in adjacent non crop areas in 1-5 m distance between 0.02 and 0.40 g a.s./ha of neonicotinoids and in the adjacent oil seed rape a total of 0.05–0.80 g a.s./ha were detected. After drilling oil seed rape or barley these values were only 0.02–0.06 g a.s./ha in Petri dishes in non crop areas and 0.03-0.08 g a.s./ha in total in adjacent white mustard. In gauze net samplers installed vertically in 3 m distance in non crop areas up to seven times higher values were detected compared to Petri dishes.

  16. Transforaminal Endoscopic Surgery for Adjacent Segment Disease After Lumbar Fusion.

    Science.gov (United States)

    Telfeian, Albert Edward

    2017-01-01

    The natural history of degenerative disease after instrumented lumbar fusion can result in symptomatic radiculopathy at the adjacent segment. Here we describe our experience with transforaminal endoscopic decompression for the treatment of adjacent segment radiculopathy. A technique for the transforaminal endoscopic treatment of lumbar radiculopathy adjacent to instrumented lumbar fusions is presented. Prospectively, we followed a series of 9 consecutive patients operated on with lumbar radiculopathy above (5) or below (4) their instrumented fusion. Preoperative and postoperative clinical data with 2-year follow-up are presented. A consecutive series of 9 patients who underwent transforaminal endoscopic treatment for lumbar radiculopathy adjacent to an instrumented spinal fusion between 2012 and 2014 is presented. Three patients required revision to fusion at 2, 13, and 19 months postoperatively. The mean visual analogue scale score for radicular pain improved from an average pain score before surgery of 8.4 to 1.3 1 year after surgery and the mean visual analogue scale for back pain improved from an average pain score before surgery of 8.0 to 4.7 1 year after surgery (excluding the 1 patient with 2month postoperative failure). Transforaminal endoscopic surgical access to adjacent level disease pathology may be a unique approach to the treatment of adjacent segment disease because it allows for neural decompression of disc and foraminal pathology without requiring significant destabilizing bone removal. However, the 2-year failure rate presented here is 33%, which indicates that the benefit of this technique may ultimately be temporary. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Grenz ray-induced nonmelanoma skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Frentz, G.

    1989-09-01

    In 28 patients, nonmelanoma skin cancers developed in areas previously exposed to grenz rays. In 17 patients who did not have psoriasis, no other relevant carcinogenic exposure could be incriminated. Women were more often affected than men. Most of the tumors were basal cell cancers, and most of the patients had multiple tumors. No threshold dose could be established. The distribution of the latency time among patients without psoriasis was strictly normal (median 18 years). These observations suggest that usual therapeutic doses of grenz rays, as a single agent, are capable of causing skin cancer, but only in those persons who are abnormally sensitive to x-rays. 9 references.

  18. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  19. Photoprotection in ethnic skin

    Directory of Open Access Journals (Sweden)

    Mohammed S. Al-Jamal

    2014-12-01

    Full Text Available Although cutaneous photodamage is partially mitigated by darker skin pigmentation, sun-induced aging, dyspigmentation, sunburns, and skin cancers are reported worldwide in all skin types and races. The severity of photodamage varies from individual to individual, and is predominantly based upon genetic differences altering the body's response or susceptibility to sun damage. In addition, non-Caucasian patients are less likely to perform skin self-examinations, attend dermatologic follow-ups, and seven times less likely to apply sunscreen than Caucasian patients. Therefore, the remainder of this article will discuss the categories of photoprotective agent [environmental, biologic, physical, and UV filters, i.e., sunscreens] as well as the topics of photoaging, dyspigmentation, photocarcinogenesis, and the controversy surrounding vitamin D deficiency from photoprotection in the context of ethnic skin.

  20. Modeling fires in adjacent ship compartments with computational fluid dynamics

    International Nuclear Information System (INIS)

    Wix, S.D.; Cole, J.K.; Koski, J.A.

    1998-01-01

    This paper presents an analysis of the thermal effects on radioactive (RAM) transportation packages with a fire in an adjacent compartment. An assumption for this analysis is that the adjacent hold fire is some sort of engine room fire. Computational fluid dynamics (CFD) analysis tools were used to perform the analysis in order to include convective heat transfer effects. The analysis results were compared to experimental data gathered in a series of tests on tile US Coast Guard ship Mayo Lykes located at Mobile, Alabama

  1. In vivo skin elastography with high-definition optical videos.

    Science.gov (United States)

    Zhang, Yong; Brodell, Robert T; Mostow, Eliot N; Vinyard, Christopher J; Marie, Hazel

    2009-08-01

    Continuous measurements of biomechanical properties of skin provide potentially valuable information to dermatologists for both clinical diagnosis and quantitative assessment of therapy. This paper presents an experimental study on in vivo imaging of skin elastic properties using high-definition optical videos. The objective is to (i) investigate whether skin property abnormalities can be detected in the computed strain elastograms, (ii) quantify property abnormalities with a Relative Strain Index (RSI), so that an objective rating system can be established, (iii) determine whether certain skin diseases are more amenable to optical elastography and (iv) identify factors that may have an adverse impact on the quality of strain elastograms. There are three steps in optical skin elastography: (i) skin deformations are recorded in a video sequence using a high-definition camcorder, (ii) a dense motion field between two adjacent video frames is obtained using a robust optical flow algorithm, with which a cumulative motion field between two frames of a larger interval is derived and (iii) a strain elastogram is computed by applying two weighted gradient filters to the cumulative motion data. Experiments were carried out using videos of 25 patients. In the three cases presented in this article (hypertrophic lichen planus, seborrheic keratosis and psoriasis vulgaris), abnormal tissues associated with the skin diseases were successfully identified in the elastograms. There exists a good correspondence between the shape of property abnormalities and the area of diseased skin. The computed RSI gives a quantitative measure of the magnitude of property abnormalities that is consistent with the skin stiffness observed on clinical examinations. Optical elastography is a promising imaging modality that is capable of capturing disease-induced property changes. Its main advantage is that an elastogram presents a continuous description of the spatial variation of skin properties on

  2. Disc height and anteroposterior translation in fused and adjacent segments after lumbar spine fusion

    Directory of Open Access Journals (Sweden)

    Frobin, Wolfgang

    2003-09-01

    Full Text Available In a series of 46 patients the effects of spinal fusion upon intervertebral height and sagittal alignment in operated and non-operated segments were retrospectively evaluated on digitized radiographs. Data was compared with age- and gender-normalized standard values. The objective was to evaluate the influence of different types of spine fusions primarily upon adjacent segments, particularly in terms of degeneration and sagittal profile of the lumbar spine. Incidence of adjacent segment degeneration (ASD is still highly controversial. However, not every degeneration adjacent to spinal fusion must be caused by the fusion and responsibility of the fusion for ASD may vary with its range and type. Distortion Corrected Roentgen Analysis (DCRA was utilized. DCRA is a proven valid, reliable, observer-independent, and accurate tool for assessment of these parameters over time and in comparison with "normal" cohorts. With this method the exact posture of the patients needs not to be known.There was little evidence for serious fusion-related ASD within an average of 40 months follow-up. No difference could be detected for rigid vs. non-rigid fusion and instrumented vs. non-instrumented techniques. Temporary postoperative distraction effects could be detected in operated and non-operated segments. Absolute preoperative values for intervertebral height and vertebral slip were age-related. Retrospectively, the choice of segments for fusion was clearly based upon radiological criteria. Thus we conclude that radiological parameters have an obvious clinical relevance for decision-making and need to be quantified. Within the limitations of this pilot study, true fusion related ASD seems to be infrequent.

  3. Exploratory multivariate spectroscopic study on human skin.

    Science.gov (United States)

    Lauridsen, Rikke Kragh; Everland, Hanne; Nielsen, Lene Feldskov; Engelsen, Søren Balling; Nørgaard, Lars

    2003-05-01

    Spectroscopy on human skin is a field that is being adopted increasingly because of its rapidity and high reproducibility. Infrared reflectance (IR), near-infrared reflectance (NIR), and fluorescence spectroscopy have previously been applied to human skin in vivo to compare healthy and sick skin, including skin cancer, atopy, and leprosy. Exploratory data analysis/chemometrics is a tool for evaluating multivariate data such as spectroscopic measurements. The objective of this study was to explore the spectral variance spanned by people with normal integument, and to demonstrate the advantages of multivariate analysis to skin research. IR, NIR and fluorescence spectroscopy have been carried out in vivo on 216 volunteers' forearms before and after four tape strippings. The subjects were asked to fill in a questionnaire regarding factors suspected to influence the measurement results. Principal Component Analysis (PCA) was used to investigate whether the population can be divided into groups on the basis of their skin chemistry. Unless otherwise stated, the results are from the measurements prior to stripping. In contrast to IR and fluorescence spectra, NIR spectra proved able to detect gender differences. By use of PCA, classifications on male and female subjects were observed from the IR and NIR measurements, and as an indication from the fluorescence measurements. The NIR and fluorescence measurements varied between elderly and young subjects. The largest variance in the fluorescence landscapes was seen between pigmented and non-pigmented skin. No connection was found between the spectroscopic measurements and smoking or drinking habits. Future spectroscopic skin investigations should be balanced as regards to gender and age, as these can possibly affect the measurement results. Chemometrics proved to be superior to traditional attempts of interpreting the spectra.

  4. Androgens and androgen receptor action in skin and hair follicles.

    Science.gov (United States)

    Ceruti, Julieta María; Leirós, Gustavo José; Balañá, María Eugenia

    2018-04-15

    Beyond sexual functions, androgens exert their action in skin physiology and pathophysiology. Skin cells are able to synthesize most active androgens from gonadal or adrenal precursors and the enzymes involved in skin steroidogenesis are implicated both in normal or pathological processes. Even when the role of androgens and androgen receptor (AR) in skin pathologies has been studied for decades, their molecular mechanisms in skin disorders remain largely unknown. Here, we analyze recent studies of androgens and AR roles in several skin-related disorders, focusing in the current understanding of their molecular mechanisms in androgenetic alopecia (AGA). We review the molecular pathophysiology of type 2 5α-reductase, AR coactivators, the paracrine factors deregulated in dermal papillae (such as TGF-β, IGF 1, WNTs and DKK-1) and the crosstalk between AR and Wnt signaling in order to shed some light on new promising treatments. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Pathological skin picking: case presentation and review of the literature

    Directory of Open Access Journals (Sweden)

    Maria Isabela Sarbu

    2015-04-01

    Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.

  6. Adjacent segment motion after anterior cervical discectomy and fusion versus Prodisc-c cervical total disk arthroplasty: analysis from a randomized, controlled trial.

    Science.gov (United States)

    Kelly, Michael P; Mok, James M; Frisch, Richard F; Tay, Bobby K

    2011-07-01

    Post hoc analysis of data acquired in a prospective, randomized, controlled trial. To compare adjacent segment motion after anterior cervical discectomy and fusion (ACDF) versus cervical total disc arthroplasty (TDA). TDA has been designed to be a motion-preserving device, thus theoretically normalizing adjacent segment kinematics. Clinical studies with short-term follow-up have yet to demonstrate a consistent significant difference in the incidence of adjacent segment disease. Two hundred nine patients at 13 sites were treated in a prospective, randomized, controlled trial of ACDF versus TDA for single-level symptomatic cervical degenerative disc disease (SCDD). Flexion and extension radiographs were obtained at all follow-up visits. Changes in ROM were compared using the Wilcoxon signed-rank test and the Mann-Whitney U test. Predictors of postoperative ROM were determined by multivariate analysis using mixed effects linear regression. Data for 199 patients were available with 24-month follow-up. The groups were similar with respect to baseline demographics. A significant increase in motion at the cranial and caudal adjacent segments after surgery was observed in the ACDF group only (cranial: ACDF: +1.4° (0.4, 2.4), P = 0.01; TDA: +0.8°, (-0.1, +1.7), P = 0.166; caudal: ACDF: +2.6° (1.3, 3.9), P adjacent segment ROM was observed between ACDF and TDA. Only time was a significant predictor of postoperative ROM at both the cranial and caudal adjacent segments. Adjacent segment kinematics may be altered after ACDF and TDA. Multivariate analysis showed time to be a significant predictor of changes in adjacent segment ROM. No association between the treatment chosen (ACDF vs. TDA) and ROM was observed. Furthermore clinical follow-up is needed to determine whether possible differences in adjacent segment motion affect the prevalence of adjacent segment disease in the two groups.

  7. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  8. Testing for normality

    CERN Document Server

    Thode, Henry C

    2002-01-01

    Describes the selection, design, theory, and application of tests for normality. Covers robust estimation, test power, and univariate and multivariate normality. Contains tests ofr multivariate normality and coordinate-dependent and invariant approaches.

  9. Dry skin - self-care

    Science.gov (United States)

    ... pat skin dry then apply your moisturizer. Avoid skin care products and soaps that contain alcohol, fragrances, dyes, or other chemicals. Take short, warm baths or showers. Limit your ... gentle skin cleansers or soap with added moisturizers. Only use ...

  10. Eccrine syringofibroadenoma arising in peristomal skin: a report of two cases.

    Science.gov (United States)

    Clarke, Loren E; Ioffreda, Michael; Abt, Arthur B

    2003-01-01

    Eccrine syringofibroadenoma (ESFA) is a benign neoplasm arising from the intraepidermal portion of eccrine ducts. It is characterized by a distinctive histologic pattern of epithelial cells arranged in anastomosing cords surrounded by a fibrovascular stroma. Approximately 50 cases of ESFA have been reported, and in recent years the lesion has been described occurring in association with other skin conditions. We report 2 cases of ESFA arising in abdominal skin adjacent to enterostomy sites.

  11. Genetic indicators of radiotherapy normal tissue response

    International Nuclear Information System (INIS)

    Birrell, G.W.; Ramsay, J.R.; Lavin, M.F.

    2003-01-01

    Full text: The aims of this study are to identify a genetic signature for adverse normal tissue damage from clinical radiotherapy (RT) in breast cancer patients, and to characterize the differentially-regulated genes involved. We have chosen to use skin expression profiling for four main reasons; (1) skin is the tissue that expresses the damage and so is directly relevant to the investigation, (2) skin biopsies can be snap frozen to preserve and maintain the in vivo expression profile of the patient, (3) skin punch biopsies are minimally invasive which equates to a high participation rate from RT patients (4) radiosensitivity testing and similar assays of cultured cells have only a low correlation with clinical adverse reaction. We expect our molecular profiling approach will give insight into the inherent genetic status of the patient that has not been demonstrated in cellular assays. We have begun collecting and processing skin punch biopsies from unirradiated sites from informed, consenting patients with adverse (severe acute or late) reaction to the skin or subcutaneous tissue following a standard course of RT, and normal controls. We have profiled biopsies from 7 adverse normal tissue reaction patients and 4 controls. Analyses of this data has identified 202 differentially expressed genes (p<0.01) and a class prediction algorithm correctly identified as adverse reaction or normal reaction 6/7 (86%) of our test samples that it could predict. We plan to focus on the function of some of these genes to determine their biological and clinical relevance. This will include detailed analysis of several of the gene products in an effort to address why these genes are associated with clinical reaction and what signaling pathways are involved. We plan to expand our sample number to 50 severe normal tissue late reaction (RTOG Grade 3 or 4), 50 severe acute normal tissue reaction and 50 no late or acute reaction to RT (RTOG 0) patients. An expected outcome is to fabricate

  12. Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.

    Science.gov (United States)

    Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab

    2011-03-01

    OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.

  13. Early skin-to-skin care in extremely preterm infants: thermal balance and care environment.

    Science.gov (United States)

    Karlsson, Victoria; Heinemann, Ann-Britt; Sjörs, Gunnar; Nykvist, Kerstin Hedberg; Agren, Johan

    2012-09-01

    To evaluate infant thermal balance and the physical environment in extremely preterm infants during skin-to-skin care (SSC). Measurements were performed in 26 extremely preterm infants (gestational age 22-26 weeks; postnatal age, 2-9 days) during pretest (in incubator), test (during SSC), and posttest (in incubator) periods. Infants' skin temperature and body temperature, ambient temperature, and relative humidity were measured. Evaporimetry was used to determine transepidermal water loss, and insensible water loss through the skin was calculated. The infants maintained a normal body temperature during SSC. Transfer to and from SSC was associated with a drop in skin temperature, which increased during SSC. Ambient humidity and temperature were lower during SSC than during incubator care. Insensible water loss through the skin was higher during SSC. SSC can be safely used in extremely preterm infants. SSC can be initiated during the first week of life and is feasible in infants requiring neonatal intensive care, including ventilator treatment. During SSC, the conduction of heat from parent to infant is sufficiently high to compensate for the increase in evaporative and convective heat loss. The increased water loss through the skin during SSC is small and should not affect the infant's fluid balance. Copyright © 2012 Mosby, Inc. All rights reserved.

  14. Reconstructing in-vivo reflectance spectrum of pigmented skin lesion by Monte Carlo simulation

    Science.gov (United States)

    Wang, Shuang; He, Qingli; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan

    2012-03-01

    In dermatology applications, diffuse reflectance spectroscopy has been extensively investigated as a promising tool for the noninvasive method to distinguish melanoma from benign pigmented skin lesion (nevus), which is concentrated with the skin chromophores like melanin and hemoglobin. We carried out a theoretical study to examine melanin distribution in human skin tissue and establish a practical optical model for further pigmented skin investigation. The theoretical simulation was using junctional nevus as an example. A multiple layer skin optical model was developed on established anatomy structures of skin, the published optical parameters of different skin layers, blood and melanin. Monte Carlo simulation was used to model the interaction between excitation light and skin tissue and rebuild the diffuse reflectance process from skin tissue. A testified methodology was adopted to determine melanin contents in human skin based on in vivo diffuse reflectance spectra. The rebuild diffuse reflectance spectra were investigated by adding melanin into different layers of the theoretical model. One of in vivo reflectance spectra from Junctional nevi and their surrounding normal skin was studied by compare the ratio between nevus and normal skin tissue in both the experimental and simulated diffuse reflectance spectra. The simulation result showed a good agreement with our clinical measurements, which indicated that our research method, including the spectral ratio method, skin optical model and modifying the melanin content in the model, could be applied in further theoretical simulation of pigmented skin lesions.

  15. Skin disease among farmers using wastewater in rice cultivation in Nam Dinh, Vietnam

    DEFF Research Database (Denmark)

    Do, Thuy Trang; van der Hoek, Wim; Nguyen, Dang Tuan

    2007-01-01

    OBJECTIVE: To assess the risk of skin disease among farmers occupationally exposed to wastewater. METHODS: One-year follow-up study with monthly assessments of wastewater exposure and skin disease in Nam Dinh, northern Vietnam, in two adjacent communes with contrasting levels of wastewater use....... In each commune, 200 households were randomly selected. RESULTS: Of the 1103 individuals aged > or =15 years, 381 reported a skin problem at baseline or at any of the monthly visits, primarily dermatitis (eczema) and superficial fungal infections. Among the 874 subjects who were free from skin disease...... at baseline and who could be followed up > or =11 months, 183 developed a new skin disease (cumulative incidence 21%). Exposure to wastewater was a major risk factor for skin disease with a relative risk (RR) of 1.89 [95% confidence interval (CI) 1.39-2.57] in multivariable analysis. Other risk factors...

  16. The skin aging exposome.

    Science.gov (United States)

    Krutmann, Jean; Bouloc, Anne; Sore, Gabrielle; Bernard, Bruno A; Passeron, Thierry

    2017-03-01

    The term "exposome" describes the totality of exposures to which an individual is subjected from conception to death. It includes both external and internal factors as well as the human body's response to these factors. Current exposome research aims to understand the effects all factors have on specific organs, yet today, the exposome of human skin has not received major attention and a corresponding definition is lacking. This review was compiled with the collaboration of European scientists, specialized in either environmental medicine or skin biology. A comprehensive review of the existing literature was performed using PubMed. The search was restricted to exposome factors and skin aging. Key review papers and all relevant, epidemiological, in vitro, ex vivo and clinical studies were analyzed to determine the key elements of the exposome influencing skin aging. Here we propose a definition of the skin aging exposome. It is based on a summary of the existing scientific evidence for the role of exposome factors in skin aging. We also identify future research needs which concern knowledge about the interaction of distinct exposomal factors with each other and the resulting net effects on skin aging and suggest some protective measures. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Behaviour of REEs in a tropical estuary and adjacent continental ...

    Indian Academy of Sciences (India)

    The distribution and accumulation of the rare earth elements (REE) in the sediments of the Cochin. Estuary and adjacent continental shelf ... in petroleum cracking catalysis, for the produc- tion of light weight hydrocarbons such as ...... Physics and Chemistry of the Earth (eds) Ahrens L H,. Press F, Runcorn S K and Urey H C ...

  18. Bird use of banana plantations adjacent to Kibale National Park ...

    African Journals Online (AJOL)

    To evaluate bird use of a widespread matrix habitat in forested landscapes of western Uganda, I used mist nets to compare bird communities in the understory of continuous forest and adjacent banana plantations. Frugivorous and insectivorous birds accounted for a higher proportion of captures in the forest habitat than in ...

  19. PROBABILISTIC ZONING OF ADJACENT CATCHMENTS BY PHYSICAL MODELING

    Directory of Open Access Journals (Sweden)

    Yu. B. Andreev

    2012-01-01

    Full Text Available Now the probabilistic zoning of avalanche sites is being made either on the basis of the available field data, or using the mathematical and physical modeling of avalanche dynamics processes. The work purpose consisted in research of interaction and compiling probabilistic zoning maps of two adjacent avalanche sites by a physical modeling method. For the two adjacent sites № 9 and 10 on the slope of northern exposition ofTchegetMountain(Elbrus region,Caucasus the model of this slope with the scale of 1: 2 500 was created. The model dimension is 0,82 × 1,1 ×0,57 m. This model was produced using the 4-mm plywood sheets imposed against each other. The model horizontals correspond to the10 mnatural ones. The model slope was also surfaced by thin gypsum lay and then varnished. The fine-grained sawdust (0.1 mm with a natural friction angle of 43º has been chosen as the loose material modeling snow. A series of experiments on modeling avalanche releases from the two sites were carried out resulted in the measurements of avalanche deposit parameters such as run-out distance and length, width and thickness of deposits. The similarity criteria were used during the experiments. The morphometric features of adjacent sites interaction are revealed. The basic result of the carried out work will consist in the probabilistic zoning map of two adjacent sites № 9 and 10.

  20. Concurrent statistical learning of adjacent and nonadjacent dependencies

    NARCIS (Netherlands)

    Vuong, L.C.; Meyer, A.S.; Christiansen, M.H.

    2016-01-01

    When children learn their native language, they have to deal with a confusing array of dependencies between various elements in an utterance. The dependent elements may be adjacent to one another or separated by intervening material. Prior studies suggest that nonadjacent dependencies are hard to

  1. Measurement Methods to Determine Air Leakage Between Adjacent Zones

    Energy Technology Data Exchange (ETDEWEB)

    Hult, Erin L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Dickerhoff, Darryl J. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Price, Phillip N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2012-09-01

    Air leakage between adjacent zones of a building can lead to indoor air quality and energy efficiency concerns, however there is no existing standard for measuring inter-zonal leakage. In this study, synthesized data and field measurements are analyzed in order to explore the uncertainty associated with different methods for collecting and analyzing fan pressurization measurements to calculate interzone leakage.

  2. Optimal induced universal graphs and adjacency labeling for trees

    DEFF Research Database (Denmark)

    Alstrup, Stephen; Dahlgaard, Søren; Knudsen, Mathias Bæk Tejs

    2015-01-01

    bound. The lower bound and previously best upper bounds were presented in Alstrup and Rauhe (FOCS'02). Our upper bounds are obtained through a log2 n + O(1) labeling scheme for adjacency queries in forests. We hereby solve an open problem being raised repeatedly over decades, e.g. in Kannan, Naor...

  3. Herpetology of the American Madrean Archipelago and adjacent valleys

    Science.gov (United States)

    Lawrence L. C. Jones

    2005-01-01

    Approximately 110 species of amphibians (18 frogs and toads, and 1 salamander) and reptiles (47 snakes, 39 lizards, and 5 turtles) are known from the American Madrean Archipelago and adjacent valleys. The high diversity of the herpetofauna comes from a variety of factors, including a convergence of biotic communities representing deserts, grasslands, and mountains....

  4. Dose distribution in the irradiation with adjacent fields. Medical application

    International Nuclear Information System (INIS)

    Cudalbu, Cristina; Cozar, Onuc; Stan, Andrada

    2002-01-01

    In this paper we analyzed the absorbed dose distribution for the irradiation with two adjacent fields in the case of medulloblastoma treatment and we optimized the irradiation technique by using three adjacent fields. As a purpose of this study we considered the secondary effects of the irradiation with two adjacent fields at the sensitive organs such as heart and lung. The objectives of this paper are: to achieve dose uniformity in the field junction region; to avoid the underdosage or overdosage in the junction area; the hot spot created due to the overlap of the beams in the depth has to be clinically acceptable; the dosage received by a sensitive structure such as the spinal cord must not exceed its tolerance dose. We should specify that this treatment technique was developed considering the following risk factors: the possibility of introducing very large dosage errors across the junction; the tumor recurrence if it is underdosed; severe complications if it is overdosed. The analysis of the irradiation technique was made from two points of view, geometric and dosimetric. The analysis from geometric and dosimetric points of view entails the conclusion that at the cord and lung level exists the risk of an important overdosage. This inconvenience was solved by moving one of the fields at the other side of the risk organs (if this procedure is possible) and by optimizing the irradiation technique by using three adjacent fields. (authors)

  5. Realisation of two adjacent high tones: Acoustic evidence from ...

    African Journals Online (AJOL)

    We present findings of a multi-speaker production study that was undertaken to investigate the realisation of two adjacent high tones within the verb word in Northern Sotho, a Southern Bantu language. Experimental tokens are selected to ensure that the high tones originate from different combinations of morphosyntactic ...

  6. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    Hoogendoorn, R.J.W.; Helder, M.N.; Wuisman, P.I.J.M.; Bank, R.A.; Everts, V.; Smit, T.H.

    2008-01-01

    Study Design. The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were

  7. Adjacent segment degeneration: observations in a goat spinal fusion study

    NARCIS (Netherlands)

    Hoogendoorn, Roel J. W.; Helder, Macro N.; Wuisman, Paul I. J. M.; Bank, Ruud A.; Everts, Vincent E.; Smit, Theo H.

    2008-01-01

    The adjacent discs of 13 goats, originally used in a lumbar spinal fusion model study, were analyzed for symptoms of intervertebral disc degeneration by means of magnetic resonance imaging (MRI), macroscopy, and histology. These goats were followed for 6 months and the results were compared with 6

  8. The influence of intrinsic disc degeneration of the adjacent segments on its stress distribution after one-level lumbar fusion.

    Science.gov (United States)

    Kim, Ho-Joong; Kang, Kyoung-Tak; Chun, Heoung-Jae; Lee, Choon-Ki; Chang, Bong-Soon; Yeom, Jin S

    2015-04-01

    The presence of degeneration alters the stress within that particular degenerated disc. Therefore, the state of degeneration of the disc at the level adjacent to a single level fusion would influence the rate of subsequent further degeneration of that same adjacent disc. Therefore, the purpose of this study was to investigate the biomechanical effect of the disc degeneration at the adjacent segment on the stress of the corresponding segment after one segment lumbar fusion using validated finite element (FE) models. Three validated L2-L5 FE models with different grades of disc degeneration (normal, mild, moderate) at the L2-L5 were simulated. Based on the intact models that represented each grade of disc degeneration, the matched L3-L4 instrumented fusion models were developed. Therefore, three intact models and three matched fusion models were simulated. Under the 400-N pre-compressive follower loading, 7.5 Nm moments simulating flexion, extension, lateral bending, and torsion in five steps were imposed on the L2 superior endplate of three intact models. The hybrid loading protocol was utilized for the fusion models. The intradiscal pressure and the maximal von Mises stress of the annulus fibrosus in the L2-L3 and L4-L5 segments were analyzed and compared between fusion and intact models with each grade of disc degeneration. Disc degeneration led to an increase of maximal von Mises stress of annulus fibrosus at this degenerated disc, related to disc degeneration under flexion, extension, lateral bending and torsion moments. Furthermore, the fusion also increased a maximal von Mises stress of annulus fibrous at both proximal and distal adjacent segments under hybrid protocol. The increases of annular stress were greater at the proximal adjacent segment than those at distal adjacent segment. However, the contribution of the fusion surgery to the increment rate of annulus fibrosus stress at the adjacent segment did not increase in relation with disc degeneration

  9. Ultrastructure of elastosis in facial rhytidectomy skin

    Energy Technology Data Exchange (ETDEWEB)

    Rudolph, R.; Woodward, M.

    1981-03-01

    Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation.

  10. Predisposing Characteristics of Adjacent Segment Disease After Lumbar Fusion.

    Science.gov (United States)

    Alentado, Vincent J; Lubelski, Daniel; Healy, Andrew T; Orr, Robert D; Steinmetz, Michael P; Benzel, Edward C; Mroz, Thomas E

    2016-07-15

    Retrospective Review. The aim of this study was to determine medical, radiographic, and surgical risk factors for the development of adjacent segment disease (ASD) after lumbar fusion. ASD is a recognized outcome of spinal fusion that leads to increased costs and debilitating symptoms for patients. However, a comprehensive understanding of risk factors for the development of this surgical outcome does not exist. The medical records of patients who received their first lumbar fusion for any indication were retrospectively examined for preoperative medical comorbidities and medications, as well as surgical approach and perioperative complications. A blinded reviewer assessed radiographs for each patient to examine sagittal alignment after fusion. Multivariable logistic regression was used to model the risk of developing ASD on the basis of one or more predictors. A total of 137 patients fit the inclusion criteria; 9% required a follow-up operation for degeneration at segments adjacent to the fusion. The ASD group had a mean follow-up of 21.1 months prior to revision surgery and an overall follow-up of 41.0 months. The average follow-up in the control group was 14.0 months. Statistically significant independent predictors of developing ASD included antidepressant use [odds ratio (OR) = 5.4], diagnosis of degenerative scoliosis (OR = 34.2), fusion of L4-S1 (OR = 56.5), having no decompressions adjacent to the fusion, and low sacral slope (OR = 0.9). No patient who developed ASD received a decompression adjacent to the fusion such that an OR could not be generated for this independent predictor. This study is the first to use a combination of medical, surgical, and postoperative sagittal balance as risk factors for the development of adjacent segment disease after lumbar fusion. The awareness of these risk factors may allow for better patient selection and surgical technique to decrease the probability of acquiring this adverse outcome. 4.

  11. The Normal Distribution From Binomial to Normal

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 6. The Normal Distribution From Binomial to Normal. S Ramasubramanian. Series Article Volume 2 Issue 6 June 1997 pp 15-24. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/002/06/0015-0024 ...

  12. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  13. Age influences the skin reaction pattern to mechanical stress and its repair level through skin care products.

    Science.gov (United States)

    Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela

    2018-03-01

    Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

    Directory of Open Access Journals (Sweden)

    Anjanappa

    2015-01-01

    Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

  15. Examine Your Skin

    Medline Plus

    Full Text Available ... Stage III Melanoma Treatment: Stage IV Finding the Right Doctor Glossary of Terms Resources Resources Global Resources Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card ...

  16. Aging changes in skin

    Science.gov (United States)

    ... MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Aging changes in skin URL of this page: //medlineplus. ...

  17. Allergy Skin Tests

    Science.gov (United States)

    ... medications: Know your options Allergy skin tests About Advertisement Mayo Clinic does not endorse companies or products. ... a Job Site Map About This Site Twitter Facebook Google YouTube Pinterest Mayo Clinic is a not- ...

  18. Bacterial Skin Infections

    Science.gov (United States)

    ... other immune disorders, or hepatitis People who are undergoing chemotherapy or treatment with other drugs that suppress the immune system Skin that is inflamed or damaged by sunburn, scratching, or other trauma is more likely to become infected. In fact, ...

  19. Occupational skin diseases

    DEFF Research Database (Denmark)

    Mahler, V; Aalto-Korte, K; Alfonso, J H

    2017-01-01

    in Science and Technology (COST) Action TD 1206 (StanDerm) (www.standerm.eu). RESULTS: Besides a national health service or a statutory health insurance, most European member states implemented a second insurance scheme specifically geared at occupational diseases [insurance against occupational risks......BACKGROUND: Work-related skin diseases (WSD) are caused or worsened by a professional activity. Occupational skin diseases (OSD) need to fulfil additional legal criteria which differ from country to country. OSD range amongst the five most frequently notified occupational diseases (musculoskeletal...... diseases, neurologic diseases, lung diseases, diseases of the sensory organs, skin diseases) in Europe. OBJECTIVE: To retrieve information and compare the current state of national frameworks and pathways to manage patients with occupational skin disease with regard to prevention, diagnosis, treatment...

  20. [Currently available skin substitutes].

    Science.gov (United States)

    Oravcová, Darina; Koller, Ján

    2014-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

  1. Dry Skin (Xerosis)

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  2. Caring for Tattooed Skin

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  3. Fungal Skin Infections

    Science.gov (United States)

    ... Abbreviations Weights & Measures ENGLISH View Professional English Deutsch Japanese Espaniol Find information on medical topics, symptoms, drugs, ... touching the infected area. Diagnosis Skin scrapings or cultures Doctors may suspect a fungal infection when they ...

  4. Examine Your Skin

    Medline Plus

    Full Text Available ... Doctor Glossary of Terms Resources Resources Global Resources Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card Download a Patient Navigation Card ...

  5. Examine Your Skin

    Medline Plus

    Full Text Available ... Who We Are Be On Our PAGE MIF Staff Programs & Services Scientific Advisory Board Advisory Board Patrons & ... Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card Download a ...

  6. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  7. Renal-skin syndromes.

    Science.gov (United States)

    Has, Cristina; He, Yinghong

    2017-07-01

    Renal-skin syndroms are a group of genetic disorders with renal and cutaneous manifestations that target molecular components present in both organs. Inherited renal-skin syndromes are mainly associated with defects of cell-matrix adhesion. We provide a non-exhaustive overview of the main molecular players at cell-matrix adhesions in mouse models and in human genetic disorders affecting kidney and skin. Renal and urinary tract involvement is described in all four major epidermolysis bullosa types and, in particular, in junctional subtypes and in recessive dystrophic epidermolysis bullosa. Here, we describe in detail those subtypes for which reno-urinary involvement is a constant and primary feature. Furthermore, complex multiorgan disorders with a predisposition to malignancies or attributable to metabolic defects that involve both kidney and skin are briefly summarized.

  8. Biocatalytic Polymer Skin Adhesives

    National Research Council Canada - National Science Library

    LeJeune, Keith

    2001-01-01

    .... Preliminary results also suggest that the incorporation of enzymes within such polymers reduces immunogenic and allergenic responses that are often observed when applying protein-based materials on skin tissue...

  9. Skin lesion of blastomycosis

    Science.gov (United States)

    ... infection. It is most often found in: Africa Canada, around the Great Lakes South central and north ... is diagnosed by identifying the fungus in a culture taken from a skin lesion. This usually requires ...

  10. Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin

    Directory of Open Access Journals (Sweden)

    Nisbet SJ

    2018-04-01

    Full Text Available Stephanie J Nisbet Skin Health Medical Affairs, GSK Consumer Healthcare, Weybridge, Surrey, UK Purpose: This 3-week, open-label, noncomparative clinical study evaluated the skin acceptability of a cosmetic moisturizer in subjects with sensitive skin, by monitoring adverse events (AEs and cutaneous discomfort related to normal usage.Materials and methods: Female subjects aged between 18–60 years, with Fitzpatrick phototype classification I–IV and sensitive skin, verified by a positive reaction on the stinging test at screening, were included. Subjects applied the moisturizer to their face and body twice daily for 21±2 days at home and recorded study product usage and feelings of cutaneous discomfort (eg, dryness, prickling, stinging, and itching in a diary; any AEs were reported to the clinic. At study end, skin acceptability of the moisturizer was investigator-assessed based on the nature of AEs and subjects’ self-reported feelings of discomfort, and by clinical evaluation of skin reactions in the area of moisturizer application (appearance of erythema, formation of edema, and skin desquamation; scored according to an adapted Draize and Kligman scale. Only subjects with a treatment compliance of ≥80% were included in the final analysis.Results: In total, 35 subjects initiated and completed the study; all were compliant to the minimum study product usage. Per investigator clinical dermatological assessment at study end, none of the 35 subjects had skin reactions in the area of moisturizer application and there were no reported AEs. One subject reported sensations of mild prickling and itching immediately after applying the moisturizer (not classified as AEs, which spontaneously remitted after complete absorption of the product and were noted only in exposed areas. These events were considered by the investigator as being possibly/probably related to the use of study product; however, no clinical signs of skin reaction were observed in

  11. A novel image-based BRDF measurement system and its application to human skin

    Science.gov (United States)

    Bintz, Jeffrey R.; Mendenhall, Michael J.; Marciniak, Michael A.; Butler, Samuel D.; Lloyd, James Tommy

    2016-09-01

    Human skin detection is an important first step in search and rescue (SAR) scenarios. Previous research performed human skin detection through an application specific camera system that ex- ploits the spectral properties of human skin at two visible and two near-infrared (NIR) wavelengths. The current theory assumes human skin is diffuse; however, it is observed that human skin exhibits specular and diffuse reflectance properties. This paper presents a novel image-based bidirectional reflectance distribution function (BRDF) measurement system, and applies it to the collection of human skin BRDF. The system uses a grid projecting laser and a novel signal processing chain to extract the surface normal from each grid location. Human skin BRDF measurements are shown for a variety of melanin content and hair coverage at the four spectral channels needed for human skin detection. The NIR results represent a novel contribution to the existing body of human skin BRDF measurements.

  12. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  13. ReciPlySkin

    DEFF Research Database (Denmark)

    Popovic Larsen, Olga; Andersen, Mikkel; Munk-Andersen, Niklas

    2017-01-01

    The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report.......The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report....

  14. Adnexal Tumours Of Skin

    Directory of Open Access Journals (Sweden)

    Parate Sanjay N

    1998-01-01

    Full Text Available A total 120 cases of epidermal appendage tumours of skin were analysed and classified according to the classification provided by WHO’. Epidermal appendage tumours accounted for 12.87% of all skin tumours, of which 29.17% were benign and 70.83% were malignant. Most of the tumours (75.83% were in the head and face region. The most common tumour was basal cell epithelioma (55%.

  15. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  16. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  17. Ki-67 and PCNA Expression in Canine Mammary Tumors and Adjacent Nonneoplastic Mammary Glands: Prognostic Impact by a Multivariate Survival Analysis.

    Science.gov (United States)

    Carvalho, M I; Pires, I; Prada, J; Lobo, L; Queiroga, F L

    2016-11-01

    The assessment of tumor proliferation has been considered a determining prognostic factor in canine mammary tumors (CMTs). However, no studies have assessed the prognostic importance of proliferation in adjacent nonneoplastic mammary glands. We included 64 CMTs (21 benign and 43 malignant) and studied the proliferation index (PI) of Ki-67 and proliferating cell nuclear antigen (PCNA) together with several clinicopathological characteristics. A positive and statistically significant correlation between the PI of Ki-67 and PCNA in tumors and adjacent nonneoplastic mammary glands was observed in benign and malignant tumors. Tumor size, skin ulceration, histological type, mitotic index, nuclear grade, differentiation grade, histological grade of malignancy, lymph node metastasis, Ki-67, and PCNA expression in tumors and adjacent nonneoplastic mammary glands were statistically associated with overall survival by univariate analysis in malignant cases (n = 43). Histological grade of malignancy and high intratumoral PCNA retained their significance by multivariate analysis arising as independent predictors of overall survival. Interestingly, the PI of Ki-67 and PCNA of adjacent nontumoral mammary glands were associated with clinicopathological features of tumor aggressiveness and shorter overall survival, demonstrating the need to better explore this adjacent non-neoplastic tissue. © The Author(s) 2016.

  18. New adjacent Bis-tetrahydrofuran Annonaceous acetogenins from Annona muricata.

    Science.gov (United States)

    Chang, Fang-Rong; Liaw, Chih-Chuang; Lin, Chih-Yuan; Chou, Chi-Jung; Chiu, Hui-Fen; Wu, Yang-Chang

    2003-03-01

    Bioactivity-guided fractionation led to the isolation of two new Annonaceous acetogenins, annocatacin A ( 1). and annocatacin B ( 2). from the seeds and the leaves, respectively, of Annona muricata. Compounds 1 and 2 are the first examples where the adjacent bis-tetrahydrofuran ring system is located at C-15. The new structures were elucidated and characterized by spectral and chemical methods. Both Annonaceous acetogenins 1 and 2 showed significant in vitro cytotoxicity toward the human hepatoma cell lines, Hep G2 and 2,2,15, and were compared with the known adjacent bis-tetrahydrofuran acetogenins, neoannonin ( 3). desacetyluvaricin ( 4). bullatacin ( 5). asimicin ( 6). annoglaucin ( 7). squamocin ( 8). and rollimusin ( 9).

  19. Osteopathic Manipulative Treatment for the Management of Adjacent Segment Pathology.

    Science.gov (United States)

    Lewis, Drew D; Summers, Garth K

    2017-12-01

    Adjacent segment pathology is an adverse effect of spinal fusion that precipitates accelerated spinal degenerative changes at vertebral segments contiguous with the fused vertebrae. The accelerated degeneration related to ASP can be challenging to manage, as it can lead to conditions such as radiculopathy and can create the need for reoperation. In the present case, a 50-year-old woman with a previous spinal fusion presented with a 1-year history of progressive low back pain, lumbar radiculopathy, and sciatica. Osteopathic manipulative treatment was used to manage her pain, and the patient reported that the treatment provided long-term resolution of her sciatica symptoms. This case demonstrates an effective use of osteopathic manipulative treatment in the conservative management of lumbar radiculopathy related to adjacent segment pathology.

  20. Normalized modes at selected points without normalization

    Science.gov (United States)

    Kausel, Eduardo

    2018-04-01

    As every textbook on linear algebra demonstrates, the eigenvectors for the general eigenvalue problem | K - λM | = 0 involving two real, symmetric, positive definite matrices K , M satisfy some well-defined orthogonality conditions. Equally well-known is the fact that those eigenvectors can be normalized so that their modal mass μ =ϕT Mϕ is unity: it suffices to divide each unscaled mode by the square root of the modal mass. Thus, the normalization is the result of an explicit calculation applied to the modes after they were obtained by some means. However, we show herein that the normalized modes are not merely convenient forms of scaling, but that they are actually intrinsic properties of the pair of matrices K , M, that is, the matrices already "know" about normalization even before the modes have been obtained. This means that we can obtain individual components of the normalized modes directly from the eigenvalue problem, and without needing to obtain either all of the modes or for that matter, any one complete mode. These results are achieved by means of the residue theorem of operational calculus, a finding that is rather remarkable inasmuch as the residues themselves do not make use of any orthogonality conditions or normalization in the first place. It appears that this obscure property connecting the general eigenvalue problem of modal analysis with the residue theorem of operational calculus may have been overlooked up until now, but which has in turn interesting theoretical implications.Á

  1. [Environmental pollution and skin aging].

    Science.gov (United States)

    Vierkötter, A

    2011-08-01

    Extrinsic skin aging is the skin aging process induced by environmental factors. The most prominent environmental factor leading to extrinsic skin aging is the sun; therefore extrinsic skin aging is also known as photoaging. However, numerous studies in recent years have shown that smoking leads to extrinsic skin aging. Further, very recently it has been shown, that environmental pollution by traffic is also associated with the occurrence of signs of extrinsic skin aging. Thus, in preventive skin aging strategies the long-term exposure towards air pollution by traffic must also be considered.

  2. New analysis methods for skin fine-structure via optical image and development of 3D skin Cycloscan(™).

    Science.gov (United States)

    Han, J Y; Nam, G W; Lee, H K; Kim, M J; Kim, E J

    2015-11-01

    This study was conducted to develop methods for measuring skin fine-structure via optical image and apparatus for photographing to analyze efficacy of anti-aging. We developed an apparatus named 3D Skin CycloScan(™) to evaluate the efficacy of cosmetics by imagification of skin fine-structure such as wrinkles, pores, and skin texture. The semi-sphere shaped device has 12 different sequential flashing light sources captures optical image simultaneously in one second to exclude the influence of the subject's movement. The normal map that is extracted through shape from shading method is composed of face contour and skin fine-structure parts. When the low-frequency component which is the result of the Gaussian Filter application is eliminated, we can get only skin fine-structure. In this normal map, it is possible to extract two-dimensional vector map called direction map and we can regulate the intensity of the image of wrinkles, pores, and skin texture after filtering the direction map. We performed a clinical study to apply this new apparatus and methods to evaluate an anti-aging efficacy of cosmetics visually and validate with other conventional methods. After using anti-aging cream including 2% adenosine for 8 weeks, the total amount of fine wrinkle around eye area detected via 3D Skin CycloScan(™) was reduced by 12.1%. Also, wrinkles on crow's feet measured by PRIMOS COMPACT(®) (GFMesstechnik GmbH, Germany) reduced 11.7%. According to an aspect of the present study, by changing the direction of the lights toward to subject's skin, we can obtain the information about the fine structures present on the skin such as wrinkles, pores, or skin texture and represent it as an image. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Plutonium in soil adjacent to Rocky Flats plant

    International Nuclear Information System (INIS)

    Hume, M.W.; Illsley, C.T.

    1979-01-01

    In 1975, lawsuits were filed claiming contaminated lands adjacent to the plant. Five remote as well as 89 sites on lands under litigation were sampled using four sampling techniques at each site. An additional 71 sites were sampled using the Rockwell International technique. No results approached the EPA proposed guideline screening level of 200 mCi/km 2 , although numerous sites to the last of the plant exceed 2 d/m/g (10 mCi/km 2 )

  4. The Benguela upwelling ecosystem lies adjacent to the south ...

    African Journals Online (AJOL)

    denise

    The Benguela upwelling ecosystem lies adjacent to the south-western coast of Africa, from southern Angola. (15°S) to Cape Agulhas (35°S; Fig. 1). Ecologically, it is split into separate northern and southern sub- systems by a zone of intense perennial upwelling near. Lüderitz (26–27.5°S; Shannon 1985). As is charac-.

  5. Fish species diversity and conservation in Beijing and adjacent areas

    OpenAIRE

    Chunguang Zhang; Yahui Zhao; Yingchun Xing; Ruilu Guo; Qing Zhang; Yun Feng; Enyuan Fan

    2011-01-01

    Based on field surveys between 2002 and 2010, and fish collections in the National Zoological Museum, Institute of Zoology, Chinese Academy of Sciences, a total of 93 wild fish species including 12 in-troduced species had been recorded in Beijing and adjacent areas. Eighty five of these species, including some migratory and estuarine fishes, are native to the region. Only 43 native wild species were collected in our field work from 2002 to 2010. Compared with the historical records, nearly 50...

  6. Jaw position uncertainty and adjacent fields in breast cancer radiotherapy.

    Science.gov (United States)

    Hedin, Emma; Bäck, Anna; Chakarova, Roumiana

    2015-11-08

    Locoregional treatment of breast cancer involves adjacent, half blocked fields matched at isocenter. The objective of this work is to study the dosimetric effects of the uncertainties in jaw positioning for such a case, and how a treatment planning protocol including adjacent field overlap of 1 mm affects the dose distribution. A representative treatment plan, involving 6 and 15 photon beams, for a patient treated at our hospital is chosen. Monte Carlo method (EGSnrc/BEAMnrc) is used to simulate the treatment. Uncertainties in jaw positioning of ± 1 mm are addressed, which implies extremes in reality of 2 mm field gap/overlap when planning adjacent fields without overlap and 1 mm gap or 3 mm overlap for a planning protocol with 1 mm overlap. Dosimetric parameters for PTV, lung and body are analyzed. Treatment planning protocol with 1 mm overlap of the adjacent fields does not considerably counteract possible underdosage of the target in the case studied. PTV-V95% is for example reduced from 95% for perfectly aligned fields to 90% and 91% for 2 mm and 1 mm gap, respectively. However, the risk of overdosage in PTV and in healthy soft tissue is increased when following the protocol with 1 mm overlap. A 3 mm overlap compared to 2 mm overlap results in an increase in maximum dose to PTV, PTV-D2%, from 113% to 121%. V120% for 'Body-PTV' is also increased from 5 cm(3) to 14 cm(3). A treatment planning protocol with 1 mm overlap does not considerably improve the coverage of PTV in the case of erroneous jaw positions causing gap between fields, but increases the overdosage in PTV and doses to healthy tissue, in the case of overlapping fields, for the case investigated.

  7. Processing multiple non-adjacent dependencies: evidence from sequence learning

    Science.gov (United States)

    de Vries, Meinou H.; Petersson, Karl Magnus; Geukes, Sebastian; Zwitserlood, Pienie; Christiansen, Morten H.

    2012-01-01

    Processing non-adjacent dependencies is considered to be one of the hallmarks of human language. Assuming that sequence-learning tasks provide a useful way to tap natural-language-processing mechanisms, we cross-modally combined serial reaction time and artificial-grammar learning paradigms to investigate the processing of multiple nested (A1A2A3B3B2B1) and crossed dependencies (A1A2A3B1B2B3), containing either three or two dependencies. Both reaction times and prediction errors highlighted problems with processing the middle dependency in nested structures (A1A2A3B3_B1), reminiscent of the ‘missing-verb effect’ observed in English and French, but not with crossed structures (A1A2A3B1_B3). Prior linguistic experience did not play a major role: native speakers of German and Dutch—which permit nested and crossed dependencies, respectively—showed a similar pattern of results for sequences with three dependencies. As for sequences with two dependencies, reaction times and prediction errors were similar for both nested and crossed dependencies. The results suggest that constraints on the processing of multiple non-adjacent dependencies are determined by the specific ordering of the non-adjacent dependencies (i.e. nested or crossed), as well as the number of non-adjacent dependencies to be resolved (i.e. two or three). Furthermore, these constraints may not be specific to language but instead derive from limitations on structured sequence learning. PMID:22688641

  8. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    OpenAIRE

    Ana Guadalupe Ramírez Olvera; Manuel Villarreal Arroyo; Luis Mario Hinojosa Martínez; Enrique Méndez Pérez; Luis Romeo Ramos Hinojosa

    2015-01-01

    OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, ...

  9. Skin color. Could it be a new fingerprint?

    Science.gov (United States)

    Musa, Omer A; Abdel Rahman, Jehan E; Magzoub, Aamir A; Abdel Mageed, Mohamad T

    2011-08-01

    To prove that the difference in human skin color can be used as a new fingerprint. A cross-sectional descriptive study was conducted in the Faculty of Medicine, The National Ribat University, Khartoum, Sudan between January and June 2010. The study consists of 139 subjects, which includes 41 Sudanese identical twins (82 subjects), 50 subjects from the general population, and 7 Chinese. All subjects were free of skin lesions. Based on reflectance spectrophotometry, the skin color has been read for all subjects from the inner upper arm using the Medisun skin check. Visual judgment on color differences was carried out directly with 3 normal observers, and through digital photos. Skin color was found to be different in all subjects under the study depending on visual judgment, digital photos, and skin color readings. Differences in skin color were also found between different parts of the body (color map). Color intensity reading in the first twin was 4.010 +/- 0.5, and in the second twin was 3.89 +/- 0.44 with a significant difference (p=0.001). The general population sample showed significant differences in skin color from each other, and from the Chinese group (p=0.002). In this study, we found that skin color between identical twins is different, as well as in the whole population, and could be a new personal identification method, which needs further international studies.

  10. Predicting Biological Age from a Skin Surface Capacitive Analysis

    Science.gov (United States)

    Bevilacqua, Alessandro; Gherardi, Alessandro; Ferri, Massimo

    The skin is the largest (and the most exposed) organ of the body both in terms of surface area and weight. Its care is of great importance for both aesthetics and health issues. Often, the skin appearance gives us information about the skin health status as well as hints at the biological age. Therefore, the skin surface characterization is of great significance for dermatologists as well as for cosmetic scientists in order to evaluate the effectiveness of medical or cosmetic treatments. So far, no in vivo measurements regarding skin topography characterization could be achieved routinely to evaluate skin aging. This work describes how a portable capacitive device, normally used for fingerprint acquisition, can be utilized to achieve measures of skin aging routinely. The capacitive images give a high resolution (50 μm) representation of skin topography, in terms of wrinkles and cells. In this work, we have addressed the latter: through image segmentation techniques, cells have been localized and identified and a feature related to their area distribution has been generated. Accurate experiments accomplished in vivo show how the feature we conceived is linearly related to skin aging. Besides, since this finding has been achieved using a low cost portable device, this could boost research in this field as well as open doors to an application based on an embedded system.

  11. Skin manifestations of growth hormone-induced diseases.

    Science.gov (United States)

    Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P

    2016-09-01

    The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.

  12. Predicting Agenesis of the Mandibular Second Premolar from Adjacent Teeth.

    Directory of Open Access Journals (Sweden)

    Geetanjali Sharma

    Full Text Available Early diagnosis of agenesis of the mandibular second premolar (P2 enhances management of the dental arch in the growing child. The aim of this study was to explore the relationship in the development of the mandibular first molar (M1 and first premolar (P1 at early stages of P2 (second premolar. Specifically, we ask if the likelihood of P2 agenesis can be predicted from adjacent developing teeth. We selected archived dental panoramic radiographs with P2 at crown formation stages (N = 212 and calculated the likelihood of P2 at initial mineralisation stage 'Ci' given the tooth stage of adjacent teeth. Our results show that the probability of observing mandibular P2 at initial mineralisation stage 'Ci' decreased as both the adjacent P1 and M1 matured. The modal stage at P2 'Ci' was P1 'Coc' (cusp outline complete and M1 'Crc' (crown complete. Initial mineralisation of P2 was observed up to P1 'Crc' and M1 stage 'R½' (root half. The chance of observing P2 at least 'Coc' (coalescence of cusps was considerably greater prior to these threshold stages compared to later stages of P1 and M1. These findings suggest that P2 is highly unlikely to develop if P1 is beyond 'Crc' and M1 is beyond 'R½'.

  13. Predicting Agenesis of the Mandibular Second Premolar from Adjacent Teeth.

    Science.gov (United States)

    Sharma, Geetanjali; Johal, Ama S; Liversidge, Helen M

    2015-01-01

    Early diagnosis of agenesis of the mandibular second premolar (P2) enhances management of the dental arch in the growing child. The aim of this study was to explore the relationship in the development of the mandibular first molar (M1) and first premolar (P1) at early stages of P2 (second premolar). Specifically, we ask if the likelihood of P2 agenesis can be predicted from adjacent developing teeth. We selected archived dental panoramic radiographs with P2 at crown formation stages (N = 212) and calculated the likelihood of P2 at initial mineralisation stage 'Ci' given the tooth stage of adjacent teeth. Our results show that the probability of observing mandibular P2 at initial mineralisation stage 'Ci' decreased as both the adjacent P1 and M1 matured. The modal stage at P2 'Ci' was P1 'Coc' (cusp outline complete) and M1 'Crc' (crown complete). Initial mineralisation of P2 was observed up to P1 'Crc' and M1 stage 'R½' (root half). The chance of observing P2 at least 'Coc' (coalescence of cusps) was considerably greater prior to these threshold stages compared to later stages of P1 and M1. These findings suggest that P2 is highly unlikely to develop if P1 is beyond 'Crc' and M1 is beyond 'R½'.

  14. Adjacent Segment Disease in the Cervical and Lumbar Spine.

    Science.gov (United States)

    Tobert, Daniel G; Antoci, Valentin; Patel, Shaun P; Saadat, Ehsan; Bono, Christopher M

    2017-04-01

    Adjacent segment disease (ASD) is disappointing long-term outcome for both the patient and clinician. In contrast to adjacent segment degeneration, which is a common radiographic finding, ASD is less common. The incidence of ASD in both the cervical and lumbar spine is between 2% and 4% per year, and ASD is a significant contributor to reoperation rates after spinal arthrodesis. The etiology of ASD is multifactorial, stemming from existing spondylosis at adjacent levels, predisposed risk to degenerative changes, and altered biomechanical forces near a previous fusion site. Numerous studies have sought to identify both patient and surgical risk factors for ASD, but a consistent, sole predictor has yet to be found. Spinal arthroplasty techniques seek to preserve physiological biomechanics, thereby minimizing the risk of ASD, and long-term clinical outcome studies will help quantify its efficacy. Treatment strategies for ASD are initially nonoperative, provided a progressive neurological deficit is not present. The spine surgeon is afforded many surgical strategies once operative treatment is elected. The goal of this manuscript is to consider the etiologies of ASD, review its manifestations, and offer an approach to treatment.

  15. Permeability of commercial solvents through living human skin

    DEFF Research Database (Denmark)

    Ursin, C; Hansen, C M; Van Dyk, J W

    1995-01-01

    A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....

  16. Raman Spectroscopy Studies of Normal and Burned Biological Tissue

    Science.gov (United States)

    Zarnani, Faranak; Maass, David; Idris, Ahamed; Glosser, Robert

    2011-03-01

    Burn injuries are a significant medical problem, and need to be treated quickly and precisely. Burned skin needs to be removed early, within hours (less than 24 hrs) of injury, when the margins of the burn are still hard to define. Studies show that treating and excising burn wounds soon after the injury prevents the wound from becoming deeper, reduces the release of proinflammatory mediators, and reduces or prevents the systemic inflammatory reaction syndrome. Also, removing burned skin prepares the affected region for skin grafting. Raman spectroscopy could be used as an objective diagnostic method that will assist burn surgeons in removing burned skin precisely. As a first step in developing a diagnostic tool, we present Raman spectroscopy information from normal and burned ex vivo rat skin, and a comparison of our findings. Raman spectroscopy is explored for its specificity and sensitivity.

  17. EGFR-inhibitors, radiotherapy and normal tissue toxicity

    DEFF Research Database (Denmark)

    Eriksen, J. G.

    2015-01-01

    EGFR-inhibitors have been used in several clinical settings during the last decade and side-effects related to normal tissues like the skin, mucosa and kidney has been well described. However, when EGFR-inhibitors are combined with radiotherapy, then different skin and mucosa toxicity profiles can...... will be explained with references to the current knowledge of the biology of skin toxicity. Treatment options for acute side-effects in skin and mucosa after bio-radiotherapy is rarely causal. A few attempts have been done; some of them aiming to rephosphorylate the EGFreceptor in the skin with vitamin K3. The talk...... single nucleotide polymorphisms in the EGF-gene that alter the ligand-receptor binding might be responsible for the observed clinical correlation. These data will be discussed in the light of EGFR-inhibition in combination with chemotherapy and/or radiotherapy....

  18. Spiritual and religious aspects of skin and skin disorders

    Science.gov (United States)

    Shenefelt, Philip D; Shenefelt, Debrah A

    2014-01-01

    Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, “goose bumps”, redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. PMID:25120377

  19. Generation of Chimeric RNAs by cis-splicing of adjacent genes (cis-SAGe) in mammals.

    Science.gov (United States)

    Zhuo, Jian-Shu; Jing, Xiao-Yan; Du, Xin; Yang, Xiu-Qin

    2018-02-20

    Chimeric RNA molecules, possessing exons from two or more independent genes, are traditionally believed to be produced by chromosome rearrangement. However, recent studies revealed that cis-splicing of adjacent genes (cis- SAGe) is one of the major mechanisms underlying the formation of chimeric RNAs. cis-SAGe refers to intergenic splicing of directly adjacent genes with the same transcriptional orientation, resulting in read-through transcripts, termed chimeric RNAs, which contain sequences from two or more parental genes. cis-SAGe was first identified in tumor cells, since then its potential in carcinogenesis has attracted extensive attention. More and more scientists are focusing on it. With the development of research, cis-SAGe was found to be ubiquitous in various normal tissues, and might make a crucial contribution to the formation of novel genes in the evolution of genomes. In this review, we summarize the splicing pattern, expression characteristics, possible mechanisms, and significance of cis-SAGe in mammals. This review will be helpful for general understanding of the current status and development tendency of cis-SAGe.

  20. [The role of sonic hedgehog pathway in skin carcinogenesis].

    Science.gov (United States)

    Lesiak, Aleksandra; Sysa-Jedrzejowska, Anna; Narbutt, Joanna

    2010-08-01

    Non melanoma skin cancers (NMSC) involving basal (BCC)--and squamosus cell carcinomas (SCC) and are the most frequent skin cancers in Caucasians. Ultraviolet radiation is the main environmental risk factor for NMSC development. The aim of this paper is to review the latest opinions concerning the role of sonic hedgehog pathway in non-melanoma skin cancers development. Experimental data indicate that sonic hedgehog pathway might be involved in skin carcinogenesis. Under physiological conditions sonic hedgehog pathway is responsible for normal embryogenesis, regeneration of damaged tissues and for regulation of cell proliferation. It was revealed that UVR caused inactivated mutation in PATCHED gene encoding Ptch1 protein. These events lead to deregulation of sonic hedgehog pathway trough activation of Smo protein and Gli transcriptional factors what stimulates cell proliferation and in consequence NMSC development. Literature data indicate that understanding of molecular background of skin cancers might be a reason for introduction of new therapeutic approaches including sonic hedgehog pathway inhibitors.

  1. Care and management of a stoma: maintaining peristomal skin health.

    Science.gov (United States)

    Boyles, Anna; Hunt, Sharon

    2016-09-22

    It is estimated that around one in 500 people in the UK are living with a stoma, with approximately 21 000 operations that result in stoma formation being performed each year ( Colostomy Association, 2016 ). These people face a unique set of challenges in maintaining the integrity of their peristomal skin. This article explores the normal structure and function of skin and how the care and management of a stoma presents challenges for maintaining peristomal skin health. Particular focus is paid to the incidence of skin problems for those living with a stoma, whether it is temporary or permanent, and the factors that contribute to skin breakdown in this population. Wider factors such as the central role of the clinical nurse specialist and the impact of product usage on positive outcomes and health economics are also considered.

  2. Skin conditions: common skin rashes in infants.

    Science.gov (United States)

    Zuniga, Ramiro; Nguyen, Tam

    2013-04-01

    Infants exhibit many skin rashes. Erythema toxicum neonatorum presents as erythematous macules, papules, and pustules on the face, trunk, and extremities; it typically resolves spontaneously within 1 week. Neonatal acne presents as comedones or erythematous papules on the face, scalp, chest, and back. Infantile acne is similar but starts after the neonatal period. Both conditions typically resolve spontaneously; failure to resolve within 1 year warrants evaluation for androgen excess. Neonatal cephalic pustulosis is an acne variant caused by hypersensitivity to Malassezia furfur. It is typically self-limited, but severe cases are managed with topical ketoconazole. Miliaria and milia are caused by sweat retention and present as tiny vesicles or papules; they resolve spontaneously. Contact diaper dermatitis is managed by keeping the diaper area clean and with open air exposure. Diaper dermatitis due to Candida albicans is managed with topical antifungals. Seborrheic dermatitis causes scaling on the scalp. Management involves shampooing and removing scales with a soft brush after applying mineral oil or petrolatum; severe cases are managed with tar or ketoconazole shampoo. Atopic dermatitis is related to food allergy in approximately one-third of children. Food allergy can be confirmed with oral food challenges or skin prick tests. Management includes elimination of irritants and triggers and use of low-potency topical steroids. Written permission from the American Academy of Family Physicians is required for reproduction of this material in whole or in part in any form or medium.

  3. Traumatic degloving lesion of penile and scrotal skin

    Directory of Open Access Journals (Sweden)

    Luiz A. Zanettini

    2005-06-01

    Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.

  4. "Ser diferente é normal?"/"Being different: is it normal?"

    Directory of Open Access Journals (Sweden)

    Viviane Veras

    2007-01-01

    Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are

  5. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably......Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  6. Smoking and skin disease

    DEFF Research Database (Denmark)

    Thomsen, S F; Sørensen, L T

    2010-01-01

    Tobacco smoking is a serious and preventable health hazard that can cause or exacerbate a number of diseases and shorten life expectancy, but the role of smoking as an etiologic factor in the development of skin disease is largely unknown. Although epidemiological evidence is sparse, findings...... suggest that tobacco smoking is a contributing factor in systemic lupus erythematosus, psoriasis, palmoplantar pustulosis, cutaneous squamous cell carcinoma, hidradenitis suppurativa, and genital warts. In contrast, smoking may confer some protective effects and mitigate other skin diseases, notably...... pemphigus vulgaris, pyoderma gangrenosum, aphthous ulcers, and Behçet's disease. Various degenerative dermatologic conditions are also impacted by smoking, such as skin wrinkling and dysregulated wound healing, which can result in post-surgical complications and delayed or even arrested healing of chronic...

  7. Environment and the skin

    International Nuclear Information System (INIS)

    Suskind, R.R.

    1990-01-01

    The skin is an important organ of defense adaptation and a portal of entry for xenobiotics. It is vulnerable to physical, chemical, and biologic agents and capable of expressing responses to these agents in a variety of pathologic patterns. These patterns are characterized by morphologic and functional features which are elicited by careful examination and test procedures. Cutaneous cancer may result from exposure to nonionizing as well as ionizing radiation, to specific identifiable chemical hazards, and may be enhanced by trauma. Cutaneous hazards of chemical sources are largely found in the workplace and among consumer products, including drugs and toilet goods. Environmental skin diseases and injuries are preventable. Prior to use assessment for safety and for possible risks from exposure to an agent, product, or process is of primary importance in the prevention and control of environmental skin disease and injury

  8. Tubuloreticular inclusions in skin biopsies from patients with HIV infection

    DEFF Research Database (Denmark)

    Pedersen, C; Horn, T; Junge, Jette

    1989-01-01

    Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... of the patients without TRI, interferon activity was below detection level. The occurrence of TRI was not dependent on the presence of free p24 antigen in serum. It is concluded that the occurrence of TRI in entothelial cells of skin capillaries is associated with late stages of HIV infection and this may...

  9. Changes in transepidermal water loss and skin hydration according to expression of aquaporin-3 in psoriasis.

    Science.gov (United States)

    Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon; Lee, Jeung Hoon

    2012-05-01

    Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin.

  10. Skin in pregnancy

    Directory of Open Access Journals (Sweden)

    Raj Sujata

    1992-01-01

    Full Text Available Screening for cutaneous disorders was undertaken in 1,175 pregnant women attending ante-natal clinic. Skin disease or STD being encountered in 114 (9.7%. Pruritus was present in 7.1 percent and was mostly due to candidiadis. The physiological skin changes were frequently observed. Candidiasis was by far the commonest infection with a 2.9 percent incidence. Syphilis was the commonest STD followed by Donovanosis and condyloma acuminata. Specific pregnancy dermatoses were seen in 1.5 percent and included prurigo gestationis, pruritic urticarial papules and plaques (PUPPP and pruritus gravidarum.

  11. Skin in pregnancy

    OpenAIRE

    Raj Sujata; Khopkar Uday; Kapasi Akila; Wadhwa S

    1992-01-01

    Screening for cutaneous disorders was undertaken in 1,175 pregnant women attending ante-natal clinic. Skin disease or STD being encountered in 114 (9.7%). Pruritus was present in 7.1 percent and was mostly due to candidiadis. The physiological skin changes were frequently observed. Candidiasis was by far the commonest infection with a 2.9 percent incidence. Syphilis was the commonest STD followed by Donovanosis and condyloma acuminata. Specific pregnancy dermatoses were seen in 1.5 per...

  12. Skin disorders during menopause.

    Science.gov (United States)

    Duarte, Gleison V; Trigo, Ana Cm; Paim de Oliveira, Mária de Fátima

    2016-02-01

    Menopause is the cessation of menstrual periods due to the loss of ovarian function. Among the various phases of a woman's life, menopause has the greatest impact on health and has been one of the most neglected areas of research. Hormonal changes caused by menopause can lead to problems in the skin and its annexes, and despite the high frequency of dermatologic signs and symptoms, studies on this topic are limited. In this article, we review the skin disorders that result from the hormonal changes of menopause and other common dermatoses observed during this period and assess possible therapeutic approaches.

  13. Skin cancer and melanoma

    International Nuclear Information System (INIS)

    Moylan, D.J.

    1991-01-01

    In this chapter, the author discusses various types of non-melanoma malignant skin cancer, as well as malignant melanoma. Non-melanoma skin cancer, such as basal cell and squamous cell carcinomas, occasionally metastasize, but only late in the course of the disease. On the other hand, even relatively small primary melanomas tend to disseminate to regional lymph nodes and to distant sites. The author presents various treatment plans, including radiation therapy. Cutaneous melanomas have been considered relatively radioresistant. This is the rationale for the use of large fraction radiation therapy in the treatment of melanomas with the fraction sizes varying from 4--8 Gy

  14. Use of skin stretchers for single-stage bilateral mastectomies in a dog and a cat.

    Science.gov (United States)

    Miyazaki, Yuta; Aikawa, Takeshi; Shimatsu, Taichi; Nishimura, Masaaki; Sadahiro, Shigeo

    2018-04-01

    To describe the application of skin stretchers for closure of single-stage bilateral mastectomies in a dog and a cat. Clinical case report. A 12-year-old intact female Miniature Dachshund and a 13-year-old spayed female domestic short-hair cat. Skin stretchers were applied to the site of the skin adjacent to mammary glands for 2-4 days before surgery. Cable tension was adjusted every 6-8 hours to elongate the skin and to achieve primary closure of single-stage bilateral mastectomy without tension. Wound closure after single-stage bilateral mastectomy was achieved without tension or major complication in both animals. Use of skin stretchers allows primary closure of single-stage bilateral mastectomy in dogs and cats. © 2017 The American College of Veterinary Surgeons.

  15. In vivo Characteristics of Non-degenerated Adjacent Segment Intervertebral Foramina in Patients with Degenerative Disc Disease during Flexion-Extension

    Science.gov (United States)

    Cha, Thomas D.; Moore, Gregory; Liow, Ming Han Lincoln; Zhong, Weiye; Wu, Minfei; Wang, Shaobai; Kang, James D.; Wood, Kirkham B.; Li, Guoan

    2016-01-01

    Study Design In vivo patient biomechanical study. Objective To investigate the dimensions of lumbar intervertebral foramen (LIVF) of patients with degenerative disc disease (DDD) during a flexion-extension motion of the body. Summary of Background Data LIVF narrowing may result in nerve root compression. The area changes of degenerated and adjacent non-degenerated LIVFs in DDD patients under physiologic loading conditions are unknown. Methods Nine symptomatic low back pain patients with radiological evidence of L4-S1 DDD were recruited. Each subject was MRI scanned for construction of 3D lumbar vertebral models, and fluoroscopically imaged when the body extended from 45° flexion to full extension for reconstruction of LIVF dimensions. The data of the adjacent segment L3/4 and diseased segment L4/5 and L5/S1 were compared with a normal control group at 45° flexion, upright, and full extension of the body. Results The mean LIVF areas of DDD segments were significantly smaller than those of the normal subjects in all positions (p0.05). Conclusion Similar reductions of the LIVF dimensions were observed at the adjacent and the involved levels of the DDD patients, implying that biomechanical changes might have already occurred at the adjacent segment despite the lack of radiographic evidence of degeneration. Subsequent research should focus on the effects of surgical fusion on the biomechanical features of the adjacent segment. Level of Evidence N/A PMID:27379419

  16. [ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

    Science.gov (United States)

    Song, Zhifang; Liu, Dewu

    2014-07-01

    To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

  17. Microwave treatment of renal cell carcinoma adjacent to renal sinus.

    Science.gov (United States)

    Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

    2016-11-01

    To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4cm (100%, 29/29) and RCCs >4cm (75%, 9/12, p=0.021). During the median follow-up of 37.6 (range, 3.0-97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. US-guided percutaneous MWA appears to be a promising method for RCCs adjacent to renal sinus, especially for tumors ≤4cm. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Biomechanical Evaluation of Lumbar Decompression Adjacent to Instrumented Segments.

    Science.gov (United States)

    Grunert, Peter; Reyes, Phillip M; Newcomb, Anna G U S; Towne, Sara B; Kelly, Brian P; Theodore, Nicholas; Härtl, Roger

    2016-12-01

    Multilevel lumbar stenosis, in which 1 level requires stabilization due to spondylolisthesis, is routinely treated with multilevel open laminectomy and fusion. We hypothesized that a minimally invasive (MI) decompression is biomechanically superior to open laminectomy and may allow decompression of the level adjacent the spondylolisthesis without additional fusion. To study the mechanical effect of various decompression procedures adjacent to instrumented segments in cadaver lumbar spines. Conditions tested were (1) L4-L5 instrumentation, (2) L3-L4 MI decompression, (3) addition of partial facetectomy at L3-L4, and (4) addition of laminectomy at L3-L4. Flexibility tests were performed for range of motion (ROM) analysis by applying nonconstraining, pure moment loading during flexion-extension, lateral bending, and axial rotation. Compression flexion tests were performed for motion distribution analysis. After instrumentation, MI decompression increased flexion-extension ROM at L3-L4 by 13% (P = .03) and axial rotation by 23% (P = .003). Partial facetectomy further increased axial rotation by 15% (P = .03). After laminectomy, flexion-extension ROM further increased by 12% (P = .05), a 38% increase from baseline, and axial rotation by 17% (P = .02), a 58% increase from baseline. MI decompression yielded no significant increase in segmental contribution of motion at L3-L4, in contrast to partial facetectomy and laminectomy (<.05). MI tubular decompression is biomechanically superior to open laminectomy adjacent to instrumented segments. These results lend support to the concept that in patients in whom a multilevel MI decompression is performed, the fusion might be limited to the segments with actual instability. MI, minimally invasive.

  19. Skin Care of the Newborn

    Directory of Open Access Journals (Sweden)

    Serap Utaş

    2011-09-01

    Full Text Available Development of the skin barrier continues up to one year after birth. The immaturity of the epidermal barrier in the neonatal period may cause dry skin, vulnerability to trauma, rapid onset of microbial colonization and percutaneous drug toxicity. Skin barrier is essential for infants. Skin care practices should, however, preserve skin integrity, prevent toxicity and address concerns such as potential sensitivity from chemical exposure. This article reviews the skin care of the newborns. (Turk­derm 2011; 45: 123-6

  20. Microwave treatment of renal cell carcinoma adjacent to renal sinus

    International Nuclear Information System (INIS)

    Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

    2016-01-01

    Highlights: • This study shows US-guided microwave ablation appears to be a promising method to treat renal cell carcinoma adjacent to renal sinus. • The estimated 1-, 3- and 5-year RCC-related survival were 100%, 93.3% and 93.3%, respectively. • The estimated 1-, 3- and 5-year overall survival were 97.1%, 87.8%, 83.6%, respectively. • For patients with RCC ≤4 cm, initial ablation success was 100% (29/29) and the estimated 5-year disease-free survival were 81.5%. - Abstract: Purpose: To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. Materials and methods: This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1 day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. Results: IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4 cm (100%, 29/29) and RCCs >4 cm (75%, 9/12, p = 0.021). During the median follow-up of 37.6 (range, 3.0–97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4 cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. Conclusion: US-guided percutaneous MWA

  1. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    OpenAIRE

    Ninomiya, Koshi; Iwatsuki, Koichi; Ohnishi, Yu-ichiro; Ohkawa, Toshika; Yoshimine, Toshiki

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to...

  2. Osteoid Osteoma of Cervical Spine in two adjacent Vertebrae

    Directory of Open Access Journals (Sweden)

    MR Etemadifar

    2005-09-01

    Full Text Available Osteoid osteoma is a benign bone tumor, mainly seen in 10-30 years male. Spine is a relatively common site and almost always, posterior elements are involved. Plain X-Ray-, CT scan and Isotope scan help to identify and localize spine lesions. We described one 18 years old boy with 3 years low neck pain. Isotope scan, MRI and CT scan showed two lesions in C7 and T1. Gross inspection and histopathology examination confirmed osteoid osteoma in two adjacent vertebrae which has not been reported elsewhere in the literature. Key words: Osteoid Osteoma, Spine, Multifocal

  3. Microwave treatment of renal cell carcinoma adjacent to renal sinus

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Yongyan, E-mail: gaoyongyan7@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Department of Ultrasound, The General Hospital of Chinese People’s Armed Police Forces, 69 Yongding Road, Beijing, 100039 (China); Liang, Ping, E-mail: liangping301@hotmail.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Yu, Xiaoling, E-mail: 784107477@qq.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Yu, Jie, E-mail: 1411495161@qq.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Cheng, Zhigang, E-mail: 13691367317@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Han, Zhiyu, E-mail: hanzhiyu122@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Duan, Shaobo, E-mail: Dustin2662@163.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China); Huang, Hui, E-mail: 309hh@sina.com [Department of Interventional Ultrasound, Chinese PLA General Hospital, 28 Fuxing Road, Beijing, 100853 (China)

    2016-11-15

    Highlights: • This study shows US-guided microwave ablation appears to be a promising method to treat renal cell carcinoma adjacent to renal sinus. • The estimated 1-, 3- and 5-year RCC-related survival were 100%, 93.3% and 93.3%, respectively. • The estimated 1-, 3- and 5-year overall survival were 97.1%, 87.8%, 83.6%, respectively. • For patients with RCC ≤4 cm, initial ablation success was 100% (29/29) and the estimated 5-year disease-free survival were 81.5%. - Abstract: Purpose: To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. Materials and methods: This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1 day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. Results: IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4 cm (100%, 29/29) and RCCs >4 cm (75%, 9/12, p = 0.021). During the median follow-up of 37.6 (range, 3.0–97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4 cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. Conclusion: US-guided percutaneous MWA

  4. Modular cervical plate system for adjacent segment disease.

    Science.gov (United States)

    Hawasli, Ammar H; Cashin, John L; Wright, Neill M

    2018-02-23

    Adjacent-level disease after anterior cervical discectomy and fusion (ACDF) occurs in a significant proportion of patients and frequently requires revision operation. Methods using traditional plates typically require removal of the plate with anecdotally increased operative-time and morbidity. We review our experience in treating symptomatic adjacent-segment disease using both traditional plate removal and modular- plate system which allows for add-on plate components rather than removal of the entire plate. Authors compared 64 patients with revision surgery using modular-plate system for adjacent- segment disease compared to 2-cohorts: (1) patients with traditional plate-removal and (2) patients with no prior plate. Clinical data included demographics, original surgery, presentation, current surgery, use of modular system, need for preoperative computed-topography, operative-time, blood loss, hospital stay, complications, length of dysphagia, neck disability index and time-until-fusion. Modular cervical plate system was utilized to prevent exposure and removal of the entire plate. The terminal portion of the plate was exposed and the distal module was removed. Following the discectomy/arthrodesis, a module-plate extension was added onto the previous plate for extension of the prior instrumentation. Preoperative planning computed-topography was required in 26% of plate-removal and 17% of modular-plate cases. Revision surgery with no prior plate had reduced operative-time (77.0±18.1 min) when compared with plate removal (103.8±46.2 min; p<0.01). Blood-loss was lower for modular-plate system (38.3±20.4 mL) and no prior plate (38.4±12.6 mL) versus plate removal (78.2±65.9 mL, p<0.01). Hospital stay was similar for all groups. No complications were experienced with modular-plate revision but plate removal and revision after no prior plate carried 7.7% and 10.5% complication rates, respectively. There was a trend towards lower dysphagia and neck disability index

  5. Adjacent segment infection after surgical treatment of spondylodiscitis

    OpenAIRE

    Siam, Ahmed Ezzat; El Saghir, Hesham; Boehm, Heinrich

    2015-01-01

    Background This is the first case series to describe adjacent segment infection (ASI) after surgical treatment of spondylodiscitis (SD). Materials and methods Patients with SD, spondylitis who were surgically treated between 1994 and 2012 were included. Out of 1187 cases, 23 (1.94?%) returned to our institution (Zentralklinik Bad Berka) with ASI: 10?males, 13 females, with a mean age of 65.1?years and a mean follow-up of 69?months. Results ASI most commonly involved L3?4 (seven patients), T12...

  6. About Skin-to-Skin Care (Kangaroo Care)

    Science.gov (United States)

    ... Size Email Print Share About Skin-to-Skin Care Page Content Article Body You may be able ... care, also called kangaroo care. What is Kangaroo Care? Kangaroo care was developed in South America as ...

  7. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    ... Americans spend billions of dollars each year on skin care products that promise to erase wrinkles, lighten age spots, and eliminate itching, flaking, or redness. As you age, your skin changes. It becomes thinner and loses fat, making ...

  8. Shark skin laceration.

    Science.gov (United States)

    Doherty, Sean D; Rosen, Ted

    2006-10-31

    We present a case of multiple lacerations occurring from an encounter with a bull shark in which violent contact was made with the animal's rough skin. Conservative treatment of the injury resulted in good clinical outcome without any complications. Such events are only rarely reported in the medical literature.

  9. Noninvasive Skin Tightening Treatment

    Science.gov (United States)

    2015-01-01

    Noninvasive skin tightening has become one of the most common cosmetic aesthetic procedures being performed today. The use of radiofrequency devices for these procedures has been at the forefront of this trend for the past several years. Newer and more sophisticated radiofrequency devices are being brought to the market and presented here are the Venus Freeze and Venus Legacy. PMID:26155322

  10. Noninvasive Skin Tightening Treatment

    OpenAIRE

    Gold, Michael H.

    2015-01-01

    Noninvasive skin tightening has become one of the most common cosmetic aesthetic procedures being performed today. The use of radiofrequency devices for these procedures has been at the forefront of this trend for the past several years. Newer and more sophisticated radiofrequency devices are being brought to the market and presented here are the Venus Freeze and Venus Legacy.

  11. Preventing Skin Cancer

    Centers for Disease Control (CDC) Podcasts

    2016-05-18

    A man and a woman talk about how they’ve learned to protect their skin from the sun over the years. .  Created: 5/18/2016 by National Center for Chronic Disease Prevention and Health Promotion (NCCDPHP).   Date Released: 5/18/2016.

  12. Skin painting studies

    International Nuclear Information System (INIS)

    Witschi, H.P.; Smith, L.H.; Goad, M.E.; Anthony, W.B.; Gipson, L.C.; Stephens, T.J.; Whitaker, M.S.

    1987-01-01

    In order to estimate eventual risks to human health as a consequence of incidental and prolonged skin contact, it is necessary to obtain some information on the potential of coal-derived liquids to elicit skin cancer. In addition, it also must be established whether prolonged dermal exposure will produce signs of toxicity not only on the skin but to internal organs. During the past 2 years, they completed a life-long skin painting study with mice designed to answer some of these questions. The following materials were tested: Raw H-coal blend, containing 5700 ppm N; H-coal blend after low hydrotreatment (2650 ppm N); H-coal blend after high hydrotreatment (0.2 ppm N); H-coal home heating oil, a devolatilized version of the high-hydrotreatment H-coal blend; and an H-coal reformed naphtha. Two petroleum-derived references samples were used: Petroleum No. 2 fuel oil and high catalytically cracked naphtha. Benzo(a)pyrene was used as reference substance. Experimental animals were male and female C3H mice

  13. Skin lesion removal

    Science.gov (United States)

    ... likely to be done when there is a concern about a skin cancer. Most often, an area the shape of an ellipse is removed, as this makes it easier to close with stitches. The entire lesion is removed, going as deep as the fat, if needed, to ...

  14. Outer nuclear membrane fusion of adjacent nuclei in varicella-zoster virus-induced syncytia.

    Science.gov (United States)

    Wang, Wei; Yang, Lianwei; Huang, Xiumin; Fu, Wenkun; Pan, Dequan; Cai, Linli; Ye, Jianghui; Liu, Jian; Xia, Ningshao; Cheng, Tong; Zhu, Hua

    2017-12-01

    Syncytia formation has been considered important for cell-to-cell spread and pathogenesis of many viruses. As a syncytium forms, individual nuclei often congregate together, allowing close contact of nuclear membranes and possibly fusion to occur. However, there is currently no reported evidence of nuclear membrane fusion between adjacent nuclei in wild-type virus-induced syncytia. Varicella-zoster virus (VZV) is one typical syncytia-inducing virus that causes chickenpox and shingles in humans. Here, we report, for the first time, an interesting observation of apparent fusion of the outer nuclear membranes from juxtaposed nuclei that comprise VZV syncytia both in ARPE-19 human epithelial cells in vitro and in human skin xenografts in the SCID-hu mouse model in vivo. This work reveals a novel aspect of VZV-related cytopathic effect in the context of multinucleated syncytia. Additionally, the information provided by this study could be helpful for future studies on interactions of viruses with host cell nuclei. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Early skin tumor detection from microscopic images through image processing

    International Nuclear Information System (INIS)

    Siddiqi, A.A.; Narejo, G.B.; Khan, A.M.

    2017-01-01

    The research is done to provide appropriate detection technique for skin tumor detection. The work is done by using the image processing toolbox of MATLAB. Skin tumors are unwanted skin growth with different causes and varying extent of malignant cells. It is a syndrome in which skin cells mislay the ability to divide and grow normally. Early detection of tumor is the most important factor affecting the endurance of a patient. Studying the pattern of the skin cells is the fundamental problem in medical image analysis. The study of skin tumor has been of great interest to the researchers. DIP (Digital Image Processing) allows the use of much more complex algorithms for image processing, and hence, can offer both more sophisticated performance at simple task, and the implementation of methods which would be impossibly by analog means. It allows much wider range of algorithms to be applied to the input data and can avoid problems such as build up of noise and signal distortion during processing. The study shows that few works has been done on cellular scale for the images of skin. This research allows few checks for the early detection of skin tumor using microscopic images after testing and observing various algorithms. After analytical evaluation the result has been observed that the proposed checks are time efficient techniques and appropriate for the tumor detection. The algorithm applied provides promising results in lesser time with accuracy. The GUI (Graphical User Interface) that is generated for the algorithm makes the system user friendly. (author)

  16. Early Skin Tumor Detection from Microscopic Images through Image Processing

    Directory of Open Access Journals (Sweden)

    AYESHA AMIR SIDDIQI

    2017-10-01

    Full Text Available The research is done to provide appropriate detection technique for skin tumor detection. The work is done by using the image processing toolbox of MATLAB. Skin tumors are unwanted skin growth with different causes and varying extent of malignant cells. It is a syndrome in which skin cells mislay the ability to divide and grow normally. Early detection of tumor is the most important factor affecting the endurance of a patient. Studying the pattern of the skin cells is the fundamental problem in medical image analysis. The study of skin tumor has been of great interest to the researchers. DIP (Digital Image Processing allows the use of much more complex algorithms for image processing, and hence, can offer both more sophisticated performance at simple task, and the implementation of methods which would be impossibly by analog means. It allows much wider range of algorithms to be applied to the input data and can avoid problems such as build up of noise and signal distortion during processing. The study shows that few works has been done on cellular scale for the images of skin. This research allows few checks for the early detection of skin tumor using microscopic images after testing and observing various algorithms. After analytical evaluation the result has been observed that the proposed checks are time efficient techniques and appropriate for the tumor detection. The algorithm applied provides promising results in lesser time with accuracy. The GUI (Graphical User Interface that is generated for the algorithm makes the system user friendly

  17. Effects of radiation on levels of DNA damage in normal non-adjacent mucosa from colorectal cancer cases.

    LENUS (Irish Health Repository)

    Sheridan, Juliette

    2013-03-01

    Defects in DNA repair pathways have been linked with colorectal cancer (CRC). Adjuvant radiotherapy has become commonplace in the treatment of rectal cancer however it is associated with a higher rate of second cancer formation. It is known that radiation results in DNA damage directly or indirectly by radiation-induced bystander effect (RIBE) by causing double-strand breaks (DSBs). The majority of work in RIBE has been performed in cell lines and limited studies have been in or ex vivo.

  18. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, E.; Chunmao, H.; Lutgers, H.L.; Links, T.P.; Smit, A.J.; Rakhorst, G.; de Graaff, R.

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e. g. due to

  19. Skin color independent assessment of aging using skin autofluorescence

    NARCIS (Netherlands)

    Koetsier, M.; Nur, Erfan; Chunmao, Han; Lutgers, Helen L.; Links, Thera P.; Smit, Andries J.; Rakhorst, Gerhard; Graaff, Reindert

    2010-01-01

    Skin autofluorescence (AF) for the non-invasive assessment of the amount of accumulated tissue Advanced Glycation Endproducts (AGEs) increases with aging. In subjects with darker skin colors, measurements typically result in lower AF values than in subjects with fair skin colors, e.g. due to

  20. Adjacent segment disease in degenerative pathologies with posterior instrumentation

    Directory of Open Access Journals (Sweden)

    Ana Guadalupe Ramírez Olvera

    2015-03-01

    Full Text Available OBJECTIVE: To establish the real incidence of adjacent segment disease after fusion, and to identify the levels and predisposing factors for the pathology, as well as the functional results. METHODS: a retrospective case series study with level of evidence IIB, in a sample of 179 patients diagnosed with stenosis of the lumbar spine, spondylolisthesis and degenerative scoliosis, submitted to surgery in the period 2005 to December 2013, with posterior instrumentation and posterolateral fusion, with follow-up from 2007 until May 2014, in which the symptomology and radiographic findings were evaluated, to establish the diagnosis and treatment. RESULTS: the study included 179 patients diagnosed with stenosis of the lumbar spine (n=116, isthmic and degenerative spondylolisthesis (n=50 and degenerative scoliosis (n=13; during the study, 20 cases of adjacent level segment were identified, 80% of which were treated surgically with extension of the instrumentation, while 20% were treated conservatively with NSAIDs and therapeutic blocks. CONCLUSION: An incidence of 11% was found, with an average of 3.25 years in diagnosis and treatment, a prevalence of females and diagnosis of stenosis of the lumbar canal on posterior instrumentation, a predominance of levels L4-L5; 80% were treated with extension of the instrumentation. The complications were persistent radiculopathy, infection of the surgical wound, and one death due to causes not related to the lumbar pathology.

  1. Absorbed dose distribution analyses in irradiation with adjacent fields

    International Nuclear Information System (INIS)

    Cudalbu, C.; Onuc, C.; Andrada, S.

    2002-01-01

    Because the special irradiation technique with adjacent fields is the most used in the case of medulloblastoma treatment, we consider very important to specify some general information about medulloblastoma. This malignant disease has a large incidence in children with age between 5-7 years. This tumor usually originates in the cerebellum and is referred to as primitive undifferentiated tumor. It may spread contiguously to the cerebellar peduncle, floor of the fourth ventricle, into the cervical spine. In addition, it may spread via the cerebrospinal fluid intracranially and/or to the spinal cord. For this purpose it is necessary to perform a treatment technique with cranial tangential fields combined with adjacent fields for the entire spinal cord to achieve a perfect coverage of the zones with malignant cells. The treatment in this case is an association between surgery-radio-chemotherapy, where the radiotherapy has a very important roll and a curative purpose. This is due to the fact that the migration of malignant cells in the body can't be controlled by surgery. Because of this special irradiation technique used in medulloblastoma treatment, we chase to describe in this paper this complex type of irradiation where the implications of the beams divergence in doses distribution are essentials

  2. Skin Cancer Can Strike Anyone

    Science.gov (United States)

    ... left temple. He has spoken out about the importance of regular screening for skin cancer. Photo: Frontpage / ... melanin, which is responsible for skin and hair color. Melanoma can spread very rapidly, and the incidence ...

  3. Candida infection of the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000880.htm Candida infection of the skin To use the sharing features on this page, please enable JavaScript. Candida infection of the skin is a yeast infection ...

  4. Effect of Orally Administered Collagen Peptides from Bovine Bone on Skin Aging in Chronologically Aged Mice

    Directory of Open Access Journals (Sweden)

    Hongdong Song

    2017-11-01

    Full Text Available Collagen peptides (CPs have demonstrated to exert beneficial effects on skin photoaging. However, little has been done to evaluate their effects on chronologically aged skin. Here, the effects of CPs from bovine bone on skin aging were investigated in chronologically aged mice. 13-month-old female Kunming mice were administered with CPs from bovine bone (200, 400 and 800 mg/kg body weight/day or proline (400 mg/kg body weight/day for 8 weeks. Mice body weight, spleen index (SI and thymus index (TI, degree of skin laxity (DSL, skin components, skin histology and antioxidant indicators were analyzed. Ingestion of CPs or proline had no effect on mice skin moisture and hyaluronic acid content, but it significantly improved the skin laxity, repaired collagen fibers, increased collagen content and normalized the ratio of type I to type III collagen in chronologically aged skin. CPs prepared by Alcalase performed better than CPs prepared by collagenase. Furthermore, CPs intake also significantly improved the antioxidative enzyme activities in skin. These results indicate that oral administration of CPs from bovine bone or proline can improve the laxity of chronologically aged skin by changing skin collagen quantitatively and qualitatively, and highlight their potential application as functional foods to combat skin aging in chronologically aged process.

  5. NADPH Oxidases and Their Roles in Skin Homeostasis and Carcinogenesis.

    Science.gov (United States)

    Rudolf, Jana; Raad, Houssam; Taieb, Alain; Rezvani, Hamid Reza

    2017-11-17

    Skin protects the body from dehydration, pathogens, and external mutagens. NADPH oxidases are central components for regulating the cellular redox balance. There is increasing evidence indicating that reactive oxygen species (ROS) generated by members of this enzyme family play important roles in the physiology and pathophysiology of the skin. Recent Advances: NADPH oxidases are active producers of ROS such as superoxide and hydrogen peroxide. Different isoforms are found in virtually all tissues. They play pivotal roles in normal cell homeostasis and in the cellular responses to various stressors. In particular, these enzymes are integral parts of redox-sensitive prosurvival and proapoptotic signaling pathways, in which they act both as effectors and as modulators. However, continuous (re)activation of NADPH oxidases can disturb the redox balance of cells, in the worst-case scenario in a permanent manner. Abnormal NADPH oxidase activity has been associated with a wide spectrum of diseases, as well as with aging and carcinogenesis. Sunlight with its beneficial and deleterious effects induces the activation of NADPH oxidases in the skin. Evidence for the important roles of this enzyme family in skin cancer and skin aging, as well as in many chronic skin diseases, is now emerging. Understanding the precise roles of NADPH oxidases in normal skin homeostasis, in the cellular responses to solar radiation, and during carcinogenesis will pave the way for their validation as therapeutic targets not only for the prevention and treatment of skin cancers but also for many other skin-related disorders. Antioxid. Redox Signal. 00, 000-000.

  6. Epidermal proliferation of nude mouse skin, pig skin, and pig skin grafts. Failure of nude mouse skin to respond to the tumor promoter 12- O-tetradecanoyl phorbol 13-acetate

    Science.gov (United States)

    1980-01-01

    Human skin transplanted to nude mice offers a possible experimental system for the study of normal epidermal proliferation and differentiation, and for their pathological counterparts. Crucial to the development of such a system is the demonstration that such grafts retain the responsive features of donor skin. To document that donor proliferative characteristics are maintained in the grafts, a comparative analysis of agents that induce proliferation was made on skin of mice homozygous and heterozygous for nude, on pig skin, and on pig skin transplanted onto nude mice. A wave of epidermal proliferation could be induced in pig skin and pig skin grafted onto nude mice, but not in nude mouse skin after the topical application of 10 ng 12-O- tetradecanoyl phorbol 13-acetate (TPA). A 10-fold greater concentration of TPA or 5% croton oil induced proliferation in all species of epidermis studied. Mice, heterozygous for nude, showed a normal response to 10 ng TPA, suggesting that the ability to respond to TPA may be related, in part, to a recessive genetic trait. Nude mouse skin transplanted to a heterozygous littermate capable of responding to 10 ng TPA does not respond. These observations argue that: the graft retains its donor proliferative characteristics when transplanted to the nude, and the inability of the nude mouse to respond to lower doses of TPA may be related to absorption, the nude gene(s), or an inherent threshold to response. The lack of response to the promoter TPA provides a plausible explanation for the decreased incidence of tumors arising in nude mice during two-stage carcinogenesis experiments. PMID:7000965

  7. Skin Pedagogies and Abject Bodies

    Science.gov (United States)

    Kenway, Jane; Bullen, Elizabeth

    2011-01-01

    How does the beauty industry "narrate the skin"? What does it teach women from different cultural groups about the female body? How does skin function as a site where female subjection and abjection are produced and reproduced? In this paper we examine the skin industry pointing to its extreme commodification of the female body and to the…

  8. Maintaining Healthy Skin -- Part 1

    Science.gov (United States)

    ... care of your skin NUTRITION: To keep your skin healthy, eat a well-balanced diet that includes plenty of protein foods, fruits and vegetables (fresh if possible) and liquids. If you are having a skin problem, such as a pressure sore or a ...

  9. Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair

    Directory of Open Access Journals (Sweden)

    Anna Meilana

    2015-08-01

    Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play

  10. Epidermal grafting versus split-thickness skin grafting for wound healing (EPIGRAAFT): study protocol for a randomised controlled trial

    OpenAIRE

    Kanapathy, Muholan; Hachach-Haram, Nadine; Bystrzonowski, Nicola; Harding, Keith; Mosahebi, Afshin; Richards, Toby

    2016-01-01

    Background Split-thickness skin grafting (SSG) is an important modality for wound closure. However, the donor site becomes a second, often painful wound, which may take more time to heal than the graft site itself and holds the risk of infection and scarring. Epidermal grafting (EG) is an alternative method of autologous skin grafting that harvests only the epidermal layer of the skin by applying continuous negative pressure on the normal skin to raise blisters. This procedure has minimal don...

  11. Corners of normal matrices

    Indian Academy of Sciences (India)

    The structure of general normal matrices is far more complicated than that of two special kinds — hermitian and unitary. There are many interesting theorems for hermitian and unitary matrices whose extensions to arbitrary normal matrices have proved to be extremely recalcitrant (see e.g., [1]). The problem whose study we ...

  12. Normalized medical information visualization.

    Science.gov (United States)

    Sánchez-de-Madariaga, Ricardo; Muñoz, Adolfo; Somolinos, Roberto; Castro, Antonio; Velázquez, Iker; Moreno, Oscar; García-Pacheco, José L; Pascual, Mario; Salvador, Carlos H

    2015-01-01

    A new mark-up programming language is introduced in order to facilitate and improve the visualization of ISO/EN 13606 dual model-based normalized medical information. This is the first time that visualization of normalized medical information is addressed and the programming language is intended to be used by medical non-IT professionals.

  13. Baby Poop: What's Normal?

    Science.gov (United States)

    ... I'm breast-feeding my newborn and her bowel movements are yellow and mushy. Is this normal for baby poop? Answers from Jay L. Hoecker, M.D. Yellow, mushy bowel movements are perfectly normal for breast-fed babies. Still, ...

  14. Risk factors for adjacent segment disease after lumbar fusion

    Science.gov (United States)

    Lee, Choon Sung; Lee, Sung-Woo; Ahn, Young-Joon; Kim, Yung-Tae; Lee, Dong-Ho; Lee, Mi Young

    2009-01-01

    The incidence of adjacent segment problems after lumbar fusion has been found to vary, and risk factors for these problems have not been precisely verified, especially based on structural changes determined by magnetic resonance imaging. The purpose of this retrospective clinical study was to describe the incidence and clinical features of adjacent segment disease (ASD) after lumbar fusion and to determine its risk factors. We assessed the incidence of ASD in patients who underwent lumbar or lumbosacral fusions for degenerative conditions between August 1995 and March 2006 with at least a 1-year follow-up. Patients less than 35 years of age at the index spinal fusion, patients with uninstrumented fusion, and patients who had not achieved successful union were excluded. Of the 1069 patients who underwent fusions, 28 (2.62%) needed secondary operations because of ASD and were included in this study. In order to identify the risk factors, we matched a disease group and a control group. The disease group consisted of 26 of the 28 patients with ASD, excluding the 2 patients for whom we did not have initial MRI data. Each patient in the disease group was matched by age, sex, fusion level and follow-up period with a control patient. The assumed risk factors included disc and facet degeneration, instability, listhesis, rotational deformity, and disc wedging. The mean age of the 28 patients with ASD requiring surgical treatment was 58.4 years, which did not differ significantly from that of the population in which ASD did not develop (58.2 years, p = 0.894). Of the 21 patients who underwent floating fusion, only 1 developed distal ASD. Facet degeneration was a significant risk factor (p < 0.01) on logistic regression analysis. The incidence of distal ASD was much lower than that of proximal ASD. Pre-existing facet degeneration may be associated with a high risk of adjacent segment problems following lumbar fusion procedures. PMID:19533182

  15. Cervical adjacent segment pathology following fusion: Is it due to fusion?

    OpenAIRE

    Rosenthal, Philip; Kim, Kee D

    2013-01-01

    Adjacent segment pathology affects 25% of patients within ten years of anterior cervical diskectomy and fusion (ACDF). Laboratory studies demonstrate fused segments increase adjacent level stress including elevated intradiscal pressure and increased range of motion. Radiographic adjacent segment pathology (RASP) has been associated to ACDF in multiple statistically significant studies. Randomized controlled trials (RCTs) comparing anterior cervical discectomy and arthroplasty (ACDA) and ACDF ...

  16. The Buried Bumper Syndrome: External Bumper Extraction after Radial Mini Incisions and Replacement through an Adjacent Tract

    Directory of Open Access Journals (Sweden)

    M. A. Benatta

    2016-01-01

    Full Text Available Although considered as a safe method to provide long-term nutritional support, percutaneous endoscopic gastrostomy (PEG may be complicated by a buried bumper syndrome (BBS, a life-threatening condition. Removal of the PEG tube with its buried bumper and reinsertion of a new PEG tube is often necessary. Since its description in 1988, less than 50 cases of BBS managed by external extraction of the buried bumper have been reported. We report a case of buried bumper that was removed by external traction without the need for endoscopic or laparoscopic treatment but with the need of two radial millimeter skin incisions after abdominal CT study and finally immediate PEG replacement but through an adjacent site.

  17. Skin contamination dosimeter

    Science.gov (United States)

    Hamby, David M [Corvallis, OR; Farsoni, Abdollah T [Corvallis, OR; Cazalas, Edward [Corvallis, OR

    2011-06-21

    A technique and device provides absolute skin dosimetry in real time at multiple tissue depths simultaneously. The device uses a phoswich detector which has multiple scintillators embedded at different depths within a non-scintillating material. A digital pulse processor connected to the phoswich detector measures a differential distribution (dN/dH) of count rate N as function of pulse height H for signals from each of the multiple scintillators. A digital processor computes in real time from the differential count-rate distribution for each of multiple scintillators an estimate of an ionizing radiation dose delivered to each of multiple depths of skin tissue corresponding to the multiple scintillators embedded at multiple corresponding depths within the non-scintillating material.

  18. Skin barrier in rosacea*

    Science.gov (United States)

    Addor, Flavia Alvim Sant'Anna

    2016-01-01

    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  19. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

    Science.gov (United States)

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

  20. Skin Cancer: Biology, Risk Factors & Treatment

    Science.gov (United States)

    ... turn Javascript on. Feature: Skin Cancer Skin Cancer: Biology, Risk Factors & Treatment Past Issues / Summer 2013 Table ... Articles Skin Cancer Can Strike Anyone / Skin Cancer: Biology, Risk Factors & Treatment / Timely Healthcare Checkup Catches Melanoma ...

  1. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Directory of Open Access Journals (Sweden)

    Koshi Ninomiya

    2014-01-01

    Full Text Available A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted.

  2. Tritium in the Savannah River estuary and adjacent marine waters

    International Nuclear Information System (INIS)

    Hayes, D.W.

    1979-01-01

    The tritium distribution in the Savannah River estuary and adjacent marine waters was measured to provide information on the dilution, mixing and movement of Savannah River water in this region. The Savannah River marine region was chosen because the average tritium concentration in this river is approximately 5 pCi/ml, whereas other rivers in the southeastern United States of America average less than 0.5 pCi/ml. The increased tritium concentration in the Savannah River is due to releases from the Savannah River Plant of the Department of Energy. Tritium measurements have proved particularly effective in estimating the flushing time of the Savannah River estuary (2.4 days) and in delineating the relative contribution to the water masses in Ossabaw and Port Royal Sounds from the river and from sea-water. Ossabaw and Port Royal Sounds are located approximately 20 km south and north of the Savannah River estuary respectively. (author)

  3. Improved lookup table to correct CRT adjacent pixel nonlinearity

    Science.gov (United States)

    Klein, Stanley A.; Carney, Thom; Hu, Q. James

    1995-04-01

    Standard 1D gamma-correcting lookup tables do not compensate for adjacent pixel spatial nonlinearities along the direction of the display raster. These nonlinearities can alter the local mean luminance and contrast of the displayed image. Five steps are described for generating a 2D lookup table (LUT) that compensates for the nonlinearity. By adjusting the 2D LUT so it takes into account the inherent blur at light to dark transitions of the display system, the usable luminance range of the LUT can be extended while reducing the ringing artifact associated with luminance compensation. Use of the blur-compensated 2D LUT incurs no additional computational effort over an uncompensated 2D LUT. Matlab programs are included that can be used to generate a 2D LUT for a user's particular display system.

  4. Adjacent Lumbar Disc Herniation after Lumbar Short Spinal Fusion

    Science.gov (United States)

    Iwatsuki, Koichi; Ohnishi, Yu-ichiro; Yoshimine, Toshiki

    2014-01-01

    A 70-year-old outpatient presented with a chief complaint of sudden left leg motor weakness and sensory disturbance. He had undergone L4/5 posterior interbody fusion with L3–5 posterior fusions for spondylolisthesis 3 years prior, and the screws were removed 1 year later. He has been followed up for 3 years, and there had been no adjacent segment problems before this presentation. Lumbar magnetic resonance imaging (MRI) showed a large L2/3 disc hernia descending to the L3/4 level. Compared to the initial MRI, this hernia occurred in an “intact” disc among multilevel severely degenerated discs. Right leg paresis and bladder dysfunction appeared a few days after admission. Microscopic lumbar disc herniotomy was performed. The right leg motor weakness improved just after the operation, but the moderate left leg motor weakness and difficulty in urination persisted. PMID:25276453

  5. Cell and fiber attachment to demineralized dentin. A comparison between normal and periodontitis-affected root surfaces.

    Science.gov (United States)

    Polson, A M; Hanes, P J

    1987-07-01

    The purpose of the present study was to compare and contrast cellular, connective tissue, and epithelial responses to dentin specimens derived from the roots of either normal or periodontitis-affected human teeth after surface demineralization. Rectangular dentin specimens, with opposite faces of root and pulpal dentin, were derived from beneath root surfaces covered by periodontal ligament (normal) or calculus-covered areas of periodontitis-affected teeth. In each of the groups, the specimens were treated with citric acid (pH 1 for 3 min), whereupon they were implanted transcutaneously into incisional wounds on the dorsal surface of rats with one end of the implant protruding through the skin. 4 specimens were available in each group at 10 days after implantation. Histologic and histometric analyses of the root surfaces of the implants included counts of adhering cells, evaluation of connective tissue fiber relationships, and assessment of epithelial migration. New connective tissue attachment with inhibition of epithelial migration occurred in both groups. Cementum formation was not present. Comparisons between the groups showed no significant differences regarding length of implant surface adjacent to connective tissue, number of attached cells, or density and diameter of attached fibers. The fiber attachment system which had developed on these demineralized surfaces seemed intrinsic to the connective tissue location, and differed morphologically from corresponding fibers attaching the root surface in a normal periodontium. It was concluded that there were no observable differences between the new connective tissue attachment systems which developed on demineralized dentin from either normal or periodontitis-affected root surfaces.

  6. Making nuclear 'normal'

    International Nuclear Information System (INIS)

    Haehlen, Peter; Elmiger, Bruno

    2000-01-01

    The mechanics of the Swiss NPPs' 'come and see' programme 1995-1999 were illustrated in our contributions to all PIME workshops since 1996. Now, after four annual 'waves', all the country has been covered by the NPPs' invitation to dialogue. This makes PIME 2000 the right time to shed some light on one particular objective of this initiative: making nuclear 'normal'. The principal aim of the 'come and see' programme, namely to give the Swiss NPPs 'a voice of their own' by the end of the nuclear moratorium 1990-2000, has clearly been attained and was commented on during earlier PIMEs. It is, however, equally important that Swiss nuclear energy not only made progress in terms of public 'presence', but also in terms of being perceived as a normal part of industry, as a normal branch of the economy. The message that Swiss nuclear energy is nothing but a normal business involving normal people, was stressed by several components of the multi-prong campaign: - The speakers in the TV ads were real - 'normal' - visitors' guides and not actors; - The testimonials in the print ads were all real NPP visitors - 'normal' people - and not models; - The mailings inviting a very large number of associations to 'come and see' activated a typical channel of 'normal' Swiss social life; - Spending money on ads (a new activity for Swiss NPPs) appears to have resulted in being perceived by the media as a normal branch of the economy. Today we feel that the 'normality' message has well been received by the media. In the controversy dealing with antinuclear arguments brought forward by environmental organisations journalists nowadays as a rule give nuclear energy a voice - a normal right to be heard. As in a 'normal' controversy, the media again actively ask themselves questions about specific antinuclear claims, much more than before 1990 when the moratorium started. The result is that in many cases such arguments are discarded by journalists, because they are, e.g., found to be

  7. Photothermal Radiometry for Skin Research

    Directory of Open Access Journals (Sweden)

    Perry Xiao

    2016-02-01

    Full Text Available Photothermal radiometry is an infrared remote sensing technique that has been used for skin and skin appendages research, in the areas of skin hydration, hydration gradient, skin hydration depth profiling, skin thickness measurements, skin pigmentation measurements, effect of topically applied substances, transdermal drug delivery, moisture content of bio-materials, membrane permeation, and nail and hair measurements. Compared with other technologies, photothermal radiometry has the advantages of non-contact, non-destructive, quick to make a measurement (a few seconds, and being spectroscopic in nature. It is also colour blind, and can work on any arbitrary sample surfaces. It has a unique depth profiling capability on a sample surface (typically the top 20 µm, which makes it particularly suitable for skin measurements. In this paper, we present a review of the photothermal radiometry work carried out in our research group. We will first introduce the theoretical background, then illustrate its applications with experimental results.

  8. The genetics of skin fragility.

    Science.gov (United States)

    Has, Cristina; Bruckner-Tuderman, Leena

    2014-01-01

    Genetic skin fragility manifests with diminished resistance of the skin and mucous membranes to external mechanical forces and with skin blistering, erosions, and painful wounds as clinical features. Skin fragility disorders, collectively called epidermolysis bullosa, are caused by mutations in 18 distinct genes that encode proteins involved in epidermal integrity and dermal-epidermal adhesion. The genetic spectrum, along with environmental and genetic modifiers, creates a large number of clinical phenotypes, spanning from minor localized lesions to severe generalized blistering, secondary skin cancer, or early demise resulting from extensive loss of the epidermis. Laboratory investigations of skin fragility have greatly augmented our understanding of genotype-phenotype correlations in epidermolysis bullosa and have also advanced skin biology in general. Current translational research concentrates on the development of biologically valid treatments with therapeutic genes, cells, proteins, or small-molecule compounds in preclinical settings or human pilot trials.

  9. Lateral Lumbar Interbody Fusion andin SituScrew Fixation for Rostral Adjacent Segment Stenosis of the Lumbar Spine.

    Science.gov (United States)

    Choi, Young Hoon; Kwon, Shin Won; Moon, Jung Hyeon; Kim, Chi Heon; Chung, Chun Kee; Park, Sung Bae; Heo, Won

    2017-11-01

    The purpose of this study is to describe the detailed surgical technique and short-term clinical and radiological outcomes of lateral lumbar interbody fusion (LLIF) and in situ lateral screw fixation using a conventional minimally invasive screw fixation system (MISF) for revision surgery to treat rostral lumbar adjacent segment disease. The medical and radiological records were retrospectively reviewed. The surgery was indicated in 10 consecutive patients with rostral adjacent segment stenosis and instability. After the insertion of the interbody cage, lateral screws were inserted into the cranial and caudal vertebra using the MISF through the same LLIF trajectory. The radiological and clinical outcomes were assessed preoperatively and at 1, 3, 6, and 12 months postoperatively. The median follow-up period was 13 months (range, 3-48 months). Transient sensory changes in the left anterior thigh occurred in 3 patients, and 1 patient experienced subjective weakness; however, these symptoms normalized within 1 week. Back and leg pain were significantly improved ( p fusion was confirmed in 7 patients. Subsidence and mechanical failure did not occur in any patients. This study demonstrates that LLIF and in situ lateral screw fixation may be an alternative surgical option for rostral lumbar adjacent segment disease.

  10. Proposed derivation of skin contamination and skin decontamination limits

    International Nuclear Information System (INIS)

    Schieferdecker, H.; Koelzer, W.; Henrichs, K.

    1986-01-01

    From the primary dose limits for the skin, secondary dose limits were derived for skin contamination which can be used in practical radiation protection work. Analogous to the secondary dose limit for the maximum permissible body burden in the case of incorporation, dose limits for the 'maximum permissible skin burden' were calculated, with the help of dose factors, for application in the case of skin contamination. They can be derived from the skin dose limit values. For conditions in which the skin is exposed to temporary contamination, a limit of skin contamination was derived for immediately removable contamination and for one day of exposure. For non-removable contamination a dose limit of annual skin contamination was defined, taking into account the renewal of the skin. An investigation level for skin contamination was assumed, as a threshold, above which certain measures must be taken; these to include appropriate washing not more than three times, with the subsequent procedure determined by the level of residual contamination. The dose limits are indicated for selected radionuclides. (author)

  11. On Mathematical Optimization for the Visualization of Frequencies and Adjacencies as Rectangular Maps

    DEFF Research Database (Denmark)

    Carrizosa, Emilio; Guerrero, Vanesa; Morales, Dolores Romero

    2018-01-01

    In this paper we address the problem of visualizing a frequency distribution and an adjacency relation attached to a set of individuals. We represent this information using a rectangular map, i.e., a subdivision of a rectangle into rectangular portions so that each portion is associated with one...... individuals as adjacent rectangular portions as possible and adding as few false adjacencies, i.e., adjacencies between rectangular portions corresponding to non-adjacent individuals, as possible. We formulate this visualization problem as a Mixed Integer Linear Programming (MILP) model. We propose...

  12. Coronal MRI in the diagnosis of corona radiata infarcts adjacent to the lateral ventricles

    Energy Technology Data Exchange (ETDEWEB)

    Iwamoto, Toshihiko; Abe, Shin-e; Kanaya, Kiyoshi; Kubo, Hideki; Takasaki, Masaru (Tokyo Medical Coll. (Japan))

    1992-04-01

    To clarify pathophysiology of vascular lesions in corona radiata infarcts adjacent to the body of the lateral ventricle (CRILV), 17 patients with CRILV were studied by using magnetic resonance (MR) imaging. Based on the coronal MR images obtained between the anterior and posterior commissures, the patients were divided into two groups: (I) the group having infarcts below a line extending from the upper edge of the insular cistern to the external angle of the lateral ventricle adjacent to the corpus callosum (n=11); and (II) the group having lesions above the line towards the centrum semiovale (n=6). Most of the patients in both groups were male and had hypertension. Symptoms were gradually deteriorated and stroke in the morning was frequent in both groups, althrough the time from onset to completion was longer in Group II than Group I. In comparing clinical manifestations in Groups I and II, pure motor hemiparesis was found in 5 and 3 patients, and sensorimotor stroke in 2 and one patients, respectively. Drowsiness was found in 2 for Group I, while aphasia occurred in 2 for Group II. In addition, pseudobular and asymptomatic palsy occurred in each one patient for Group I. Prognosis was favorable in both groups, except for 2 who died of aspiration pneumonia. In Group I, 11 infarcts were well-defined, less than 15 mm in diameter on CT scans and were sclerotic in the main arteries without obstruction on angiograms. In contrast, Group II had ill-defined, larger low-density areas on CT scans and trunk obstruction of the internal carotid or middle cerebral arteries on angiograms. SPECT scans showed diffuse defect in Group II, in contrast to normal to diffuse or multiple defects in Group I. In Group I, lacunar lesions seemed to be caused by ischemia of the perforators, and in Group II, terminal zone infarcts in the territory of the cortical branches or watershed infarcts seemd to be caused by main trunk obstruction. (N.K.).

  13. Risk factors for adjacent segment degeneration after iliac screw fixation in lumbar degenerative kyphoscoliosis.

    Science.gov (United States)

    Kim, Sang-Il; Ha, Kee-Yong; Suh, Dong-Whan; Oh, In-Soo

    2017-01-01

    To analyze pre- and postoperative spinopelvic parameters and sagittal profiles in lumbar degenerative kyphoscoliosis (LDK) patients who underwent surgery using iliac screw (IS) and the incidence and risk factor of radiological adjacent segment degeneration (ASD). A total of 32 patients, who had undergone surgical correction and lumbar/thoracolumbar fusion with pedicle screws and IS instrumentation for LDK with a minimum 2-year follow-up, were included. Ten cases with ASD (group 1) and 22 cases without ASD (group 2) were compared to see pre- and postoperative change in sagittal view of spine and adjacent segment. Parameters of both groups were analyzed before and after surgery with each parameters being tested on correlativity. All deformity types of patients were classified using Scoliosis Research Society (SRS)-Schwab classification. Risk factors of ASD were evaluated using variables of SRS-Schwab classification. Group 1, rather than group 2, showed significant increment in pelvic incidence (PI). Curve types, classified using SRS-Schwab classification, were all corrected using IS; and after correction, coronal curve type was N curve and PI minus lumbar lordosis (LL) and pelvic tilt showed tendency to decrease. Cases with preoperative sagittal vertical axis (SVA) more than 10 cm and with postoperative PI minus LL more than 20° were at higher risk of developing ASD. For those with high PI, it might be a risk to cause ASD. Maintaining normal thoracic and lumbar angle, correction of SVA less than 4 cm, and PI minus LL below 20° are proper ways to avoid ASD after surgery.

  14. Aging and senescence of skin cells in culture

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2015-01-01

    Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...

  15. Subjective facial skin type, based on the sebum related symptoms, can reflect the objective casual sebum level in acne patients.

    Science.gov (United States)

    Choi, C W; Choi, J W; Youn, S W

    2013-05-01

    The relationship between the subjective skin type and the casual sebum level was not fully clarified. To investigate the characteristics of subjective skin type and to find the relationship between the subjective skin types and the skin type-related symptoms, casual sebum level, along with the objective skin type. Seven hundred and nine patients, clinically diagnosed with acne, were included. The questionnaire and the casual sebum level measurement were performed. The determining symptoms of each subjective skin type were investigated. The 95% confidence interval of casual sebum level of each subjective skin type was calculated. The most frequent subjective skin type was the combination type. The dryness, tightness, and oiliness can be conclusive symptoms in determining the subjective skin type. The mean and the 95% confidence interval of the casual sebum level was highest in the oily skin type, followed by the combination, normal, and dry skin type. We found that the subjective skin type was determined by the skin type-related symptoms. The 95% confidence intervals of the casual sebum level of each subjective skin type were established. Based on the skin type-related symptoms, the casual sebum level of acne patients can be estimated. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  16. Correlation between polarization sensitive optical coherence tomography and second harmonic generation microscopy in skin.

    Science.gov (United States)

    Le, Viet-Hoan; Lee, Seunghun; Kim, Bumju; Yoon, Yeoreum; Yoon, Calvin J; Chung, Wan Kyun; Kim, Ki Hean

    2015-07-01

    Both polarization sensitive optical coherence tomography (PS-OCT) and second harmonic generation (SHG) microscopy are 3D optical imaging methods providing information related to collagen in the skin. PS-OCT provides birefringence information which is due to the collagen composition of the skin. SHG microscopy visualizes collagen fibers in the skin based on their SHG property. These two modalities have been applied to the same skin pathologies associated with collagen changes, but their relationship has not been examined. In this study, we tried to find the relationship by imaging the same skin samples with both modalities. Various parts of the normal rat skin and burn damaged skin were imaged ex vivo, and their images were analyzed both qualitatively and quantitatively. PS-OCT images were analyzed to obtain tissue birefringence. SHG images were analyzed to obtain collagen orientation indices by applying 2D Fourier transform. The skin samples having higher birefringence values had higher collagen orientation indices, and a linear correlation was found between them. Burn damaged skin showed decreases in both parameters compared to the control skins. This relationship between the bulk and microscopic properties of skin may be useful for further skin studies.

  17. Novel biodegradable porous scaffold applied to skin regeneration.

    Science.gov (United States)

    Wang, Hui-Min; Chou, Yi-Ting; Wen, Zhi-Hong; Wang, Chau-Zen; Wang, Zhao-Ren; Chen, Chun-Hong; Ho, Mei-Ling

    2013-01-01

    Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  18. Novel biodegradable porous scaffold applied to skin regeneration.

    Directory of Open Access Journals (Sweden)

    Hui-Min Wang

    Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.

  19. An investigation into the management of acute skin reactions from tangential breast irradiation

    International Nuclear Information System (INIS)

    Meegan, M.A.; Haycocks, T.R.

    1997-01-01

    This research examined the acute skin reaction of two consecutive groups receiving tangetial breast irradiation for carcinoma of the breast. The first group used the traditional skin care advice of using warm water only within the treatment area, while the second group continued with their normal skin care regime. Data was collected on the physical manifestations of the acute reaction, medical history, the use of concurrent cytotoxic agents, treatment parameters and skin care products used. Statistical analysis using the T-test method showed no difference in the skin reaction between the two groups. The investigation has lead to a change of policy in the management of acute breast reactions. Patients receiving radiation therapy to the breast or chest wall can now use their routine skin care products with no adverse effect on skin reactions. (author)

  20. The fibrinolytic response in injured animal tissues normally low in fibrinolytic activity

    NARCIS (Netherlands)

    Smokovitis, A.; Astrup, T.

    1980-01-01

    Rabbit skin, normally of low fibrinolytic activity, and guinea-pig skin, of medium activity, after crush injury or after the intradermal or subcutaneous injection of aluminum hydroxide, show a remarkable increase in fibrinolytic activity. The activity is caused by a plasminogen activator and is

  1. Effects of tretinoin on wound healing in aged skin.

    Science.gov (United States)

    de Campos Peseto, Danielle; Carmona, Erica Vilaça; Silva, Kellyn Cristina da; Guedes, Flavia Roberta Valente; Hummel Filho, Fernando; Martinez, Natalia Peres; Pereira, José Aires; Rocha, Thalita; Priolli, Denise Gonçalves

    2016-03-01

    Aged and adult populations have differences in the structural, biological, and healing properties of skin. Comparative studies of healing under the influence of retinoids in both these populations are very important and, to the best of our knowledge, have not been performed to date. The purpose of this study was to compare the activities of topical tretinoin in aged and adult animal models of wound healing by secondary intention. Male aged rats (24 months old, n = 7) and adult rats (6 months old, n = 8) were used. The rats were assigned to the following groups according to the dates on which wound samples were excised (day 14 or 21 after model creation): treated group, control group, and naive group. Topical application of tretinoin cream was used only on the proximal wound and was applied daily for 7 days. Wound healing areas were measured using metal calipers, and morphological analysis was performed. Slides were stained with Hematoxylin and Eosin, Masson's trichrome, and periodic acid-Schiff stains. Statistical analysis adopted a 5% coefficient for rejection of the null hypothesis. Although aged animals showed skin repair, complete reepithelialization was found on day 21 in some animals of both groups (treated and control). In aged rats, the wound area was significantly smaller in treated wounds than in untreated wounds, resulting in a larger scar area compared with the adult group. When treated wounds were compared, no differences were found between the wound areas in adult and aged rats. As expected, the collagen concentration was higher in normal skin from adult rats than in normal skin from aged animals, but there was no difference when aged skin was treated with tretinoin. These results indicate that tretinoin increases collagen synthesis in aged skin and returns the healing process to a normal state of skin healing. © 2016 by the Wound Healing Society.

  2. Normality in Analytical Psychology

    Science.gov (United States)

    Myers, Steve

    2013-01-01

    Although C.G. Jung’s interest in normality wavered throughout his career, it was one of the areas he identified in later life as worthy of further research. He began his career using a definition of normality which would have been the target of Foucault’s criticism, had Foucault chosen to review Jung’s work. However, Jung then evolved his thinking to a standpoint that was more aligned to Foucault’s own. Thereafter, the post Jungian concept of normality has remained relatively undeveloped by comparison with psychoanalysis and mainstream psychology. Jung’s disjecta membra on the subject suggest that, in contemporary analytical psychology, too much focus is placed on the process of individuation to the neglect of applications that consider collective processes. Also, there is potential for useful research and development into the nature of conflict between individuals and societies, and how normal people typically develop in relation to the spectrum between individuation and collectivity. PMID:25379262

  3. Normal Female Reproductive Anatomy

    Science.gov (United States)

    ... an inner lining called the endometrium. Normal female reproductive system anatomy. Topics/Categories: Anatomy -- Gynecologic Type: Color, Medical Illustration Source: National Cancer Institute Creator: Terese Winslow (Illustrator) AV Number: CDR609921 Date Created: November 17, 2014 Date Added: ...

  4. Normal growth and development

    Science.gov (United States)

    A child's growth and development can be divided into four periods: Infancy Preschool years Middle childhood years Adolescence Soon after birth, an infant normally loses about 5% to 10% of their birth weight. By about age ...

  5. Normal pressure hydrocephalus

    Science.gov (United States)

    Hydrocephalus - occult; Hydrocephalus - idiopathic; Hydrocephalus - adult; Hydrocephalus - communicating; Dementia - hydrocephalus; NPH ... Ferri FF. Normal pressure hydrocephalus. In: Ferri FF, ed. ... Elsevier; 2016:chap 648. Rosenberg GA. Brain edema and disorders ...

  6. Normal Functioning Family

    Science.gov (United States)

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Español Text Size Email Print Share Normal Functioning Family Page Content Article Body Is there any way ...

  7. Normal Pressure Hydrocephalus

    Science.gov (United States)

    ... improves the chance of a good recovery. Without treatment, symptoms may worsen and cause death. What research is being done? The NINDS conducts and supports research on neurological disorders, including normal pressure hydrocephalus. Research on disorders such ...

  8. Nigerian Veterinary Journal Return to Normal Oestrous of Mongrel ...

    African Journals Online (AJOL)

    'Department of Veterinary Surgery and Radiology, Faculty of Veterinary Medicine, Ahmadu Bello University, Zaria. *Corresponding. Author: E-maiIAddress: ... suppression in the bitch and queen, local skin alterations and behavioural modification ... The control group bitches cycled normally at their individual breeding.

  9. High-salt diet increases hormonal sensitivity in skin pre-capillary resistance vessels.

    Science.gov (United States)

    Helle, F; Karlsen, T V; Tenstad, O; Titze, J; Wiig, H

    2013-03-01

    Recent data indicate that the skin of rats on a high-salt diet is able to accumulate Na(+) without commensurate water. This extrarenal mechanism of Na(+) homoeostasis could affect skin vasoregulation. We hypothesized that the major resistance vessel of rat skin, the pre-capillary arterioles, has increased vasoreactivity within the physiological range of circulating ANG II, a hormone relevant to salt-sensitive hypertension. Skin arterioles from skin and muscle were isolated using the agar-infusion technique. Vessels from rats fed high-salt and low-salt diet had similar lumen diameter and media area/lumen area ratio. Contractile sensitivity to ANG II was increased in skin vessels from high-salt vessels at all doses tested starting at 10(-10) m (P diet. As ANG II and the renin-angiotensin system are strongly involved in salt conservation, we explored whether vasoreactivity for noradrenaline was increased as well, because this is a functionally unrelated hormone. At low doses, contractions were similar, but at 10(-5) and 10(-4) m, noradrenaline produced stronger contractions in skin vessels from high-salt compared with low-salt rats (P high-salt diet, which could increase peripheral resistance in many situations and contribute to higher pressure in salt-sensitive hypertension. As vessels from adjacent muscle were unaffected, we raise the interesting possibility that increased vasoreactivity in the skin could be linked to osmotically inactive Na(+) accumulation. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  10. Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods

    DEFF Research Database (Denmark)

    Remvig, L; Duhn, Ph; Ullman, S

    2010-01-01

    The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...

  11. A novel approach to measuring the frictional behaviour of human skin in vivo

    NARCIS (Netherlands)

    Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile

    2012-01-01

    Friction involving human skin plays a key role in human life. The availability of a portable tribometer improves the accessibility to large number of both subjects and anatomical sites. This is the first mobile device suitable to measure skin friction with a controlled and variable normal load

  12. Removal of heavy metal contamination from peanut skin extracts by waste biomass adsorption

    Science.gov (United States)

    Polyphenols are a rapidly increasing portion of the nutraceutical and functional food marketplace. Peanut skins are a waste product which have potential as a low-cost source of polyphenols. Extraction and concentration of peanut skin extracts can cause normally innocuous levels of the heavy metal co...

  13. Transcriptome Analysis Reveals Markers of Aberrantly Activated Innate Immunity in Vitiligo Lesional and Non-Lesional Skin

    Science.gov (United States)

    Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen

    2012-01-01

    Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting

  14. Transcriptome analysis reveals markers of aberrantly activated innate immunity in vitiligo lesional and non-lesional skin.

    Directory of Open Access Journals (Sweden)

    Richard Yu

    Full Text Available BACKGROUND: Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. METHODS AND MATERIALS: Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1 transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2 abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3 distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. RESULTS: Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. CONCLUSIONS AND CLINICAL IMPLICATIONS: As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that

  15. Effect of topically applied lipids on surfactant-irritated skin.

    Science.gov (United States)

    Lodén, M; Andersson, A C

    1996-02-01

    Moisturizers are used daily by many people to alleviate symptoms of dry skin. All of them contain lipids. It has been suggested that topically applied lipids may interfere with the structure and function of the permeability barrier. The influence of a single application of nine different lipids on normal skin and skin irritated by sodium lauryl sulphate (SLS) was studied in 21 healthy subjects. Parameters assessed were visible signs of irritation, and objectively measured cutaneous blood flow and transepidermal water loss (TEWL). The substances tested were hydrocortisone, petrolatum, fish oil, borage oil, sunflower seed oil, canola oil, shea butter, and fractions of unsaponifiable lipids from canola oil and shea butter. Water was included as a control. On normal skin, no significant differences in the effects of the test substances were found, whereas significant differences were observed when they were applied to SLS-irritated skin. The visible signs of SLS-induced irritation were significantly less pronounced after treatment with the sterol-enriched fraction from canola oil than after treatment with water. This fraction, and hydrocortisone, reduced cutaneous blood flow. Furthermore, application of hydrocortisone, canola oil, and its sterol-enriched fraction, resulted in significantly lower TEWL than with water. The other lipids had no effect on the degree of irritation. In conclusion, lipids commonly used in moisturizers may reduce skin reactions to irritants. Previous studies have shown that, in barrier perturbed skin, the synthesis of sterols is increased. The observed effects of canola oil and its fraction of unsaponifiable lipids on SLS-induced irritation suggest the possibility that they assisted the skin in supplying the damaged barrier with adequate lipids.

  16. Simultaneous Occurrence of Periodontal and Skin Abscesses in a ...

    African Journals Online (AJOL)

    Pre-operative quantitative analysis of plasma CRP was 1500mg/l, moderate growth of Staphylococcus aureus and Porphyromonas gingivalis were isolated from the skin and periodontal pus respectively and basic heamatological values were within normal range. Intensive non-surgical periodontal therapy was done at ...

  17. [Enzynology of infected part of red skin ginseng].

    Science.gov (United States)

    Si, Y; Shang, Y; Chen, Z; Teng, B; Hu, B

    1997-06-01

    By means of polyacrylaminde gel eletrothoresis and thin layer scanning, the paper semi-quantitatively studies some relation between component and activity of isoenayme of Ginseng infecting red skin desease. The results show activity of esterase increases 100% than that of normal Ginseng; activity of polyphenol oxidase increases 60-30% and represent new isoenzyme bands in the early infection in juxtapose transolant experiment.

  18. Effects of advanced glycation end-products (AGEs) on skin ...

    African Journals Online (AJOL)

    kappa B (NF-κB) localization and cell viability were measured in vivo. Keratinocytes from normal skin were cultured in AGE-enriched conditional media, and the cell viability, apoptosis, adhesion and migration were detected in order to find the ...

  19. Skin moisturization mechanisms: new data.

    Science.gov (United States)

    Bonté, F

    2011-05-01

    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  20. In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy

    International Nuclear Information System (INIS)

    Borisova, E.; Avramov, L.

    2000-01-01

    The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)

  1. Assessment of extent of skin involvement in scleroderma using shear wave elastography

    Directory of Open Access Journals (Sweden)

    Anupam Wakhlu

    2017-01-01

    Full Text Available Introduction: Scleroderma (systemic sclerosis [SSc] is a rare autoimmune disease which manifests as fibrosis in the skin and other internal organs. Conventionally, the modified Rodnan skin score (MRSS has been used to quantify the extent of skin fibrosis (resulting in skin tightness in SSc. This technique, although widely validated, is limited by the requirement of a trained, experienced assessor. Recent literature suggests that utilization of the objective ultrasound-based assessment of skin fibrosis utilizing shear wave elastography (SWE may be a more robust technique to detect early skin tightness in SSc. Methods: We evaluated the use of SWE (assessed by an experienced radiologist in 24 patients with SSc compared with 16 healthy controls. Results: Our patients were predominantly females, with median disease duration of 1.5 years and median MRSS of 17. There was minimal intraobserver variation in the assessment of SWE. Patients with SSc had higher SWE values (mean elasticity [Emean] compared to healthy controls at most assessed sites for the MRSS. The Emeancorrelated significantly at all sites with the MRSS scores. At the sites where MRSS was scored as 0 (normal, the Emeanin patients with SSc was higher when compared with similarly clinical normal skin in patients with SSc, suggesting potential early involvement of these areas of the skin with fibrosis. Conclusion: SWE is a promising tool to objectively assess skin fibrosis in SSc and may be useful in detecting early, subclinical skin involvement in this disease.

  2. Epidemiology of skin cancer.

    Science.gov (United States)

    Leiter, Ulrike; Eigentler, Thomas; Garbe, Claus

    2014-01-01

    Melanoma and nonmelanoma skin cancer (NMSC) are now the most common types of cancer in white populations. Both tumor entities show an increasing incidence rate worldwide but a stable or decreasing mortality rate. NMSC is the most common cancer in white-skinned individuals with a worldwide increasing incidence. NMSC is an increasing problem for health care services worldwide which causes significant morbidity. The rising incidence rates of NMSC are probably caused by a combination of increased exposure to ultraviolet (UV) or sun light, increased outdoor activities, changes in clothing style, increased longevity, ozone depletion, genetics and in some cases, immune suppression. An intensive UV exposure in childhood and adolescence was causative for the development of basal cell carcinoma (BCC) whereas for the etiology of SCC a chronic UV exposure in the earlier decades was accused. Cutaneous melanoma is the most rapidly increasing cancer in white populations, in the last 3 decades incidence rates have risen up to 5-fold. In 2008 melanoma was on place 5 in women and on place 8 in men of the most common solid tumor entities in Germany. The frequency of its occurrence is closely associated with the constitutive color of the skin, and the geographical zone. Changes in outdoor activities and exposure to sunlight during the past 50 years are an important factor for the increasing incidence of melanoma. Mortality rates of melanoma show a stabilization in the USA, Australia and also in European countries. In contrast to SCC, melanoma risk seems to be associated with an intermittent exposure to sunlight. Prevention campaigns aim on reducing incidence and achieving earlier diagnosis, which resulted in an ongoing trend toward thin melanoma since the last two decades. However, the impact of primary prevention measures on incidence rates of melanoma is unlikely to be seen in the near future, rather increasing incidence rates to 40-50/100,000 inhabitants/year should be expected in

  3. Climate change and skin.

    Science.gov (United States)

    Balato, N; Ayala, F; Megna, M; Balato, A; Patruno, C

    2013-02-01

    Global climate appears to be changing at an unprecedented rate. Climate change can be caused by several factors that include variations in solar radiation received by earth, oceanic processes (such as oceanic circulation), plate tectonics, and volcanic eruptions, as well as human-induced alterations of the natural world. Many human activities, such as the use of fossil fuel and the consequent accumulation of greenhouse gases in the atmosphere, land consumption, deforestation, industrial processes, as well as some agriculture practices are contributing to global climate change. Indeed, many authors have reported on the current trend towards global warming (average surface temperature has augmented by 0.6 °C over the past 100 years), decreased precipitation, atmospheric humidity changes, and global rise in extreme climatic events. The magnitude and cause of these changes and their impact on human activity have become important matters of debate worldwide, representing climate change as one of the greatest challenges of the modern age. Although many articles have been written based on observations and various predictive models of how climate change could affect social, economic and health systems, only few studies exist about the effects of this change on skin physiology and diseases. However, the skin is the most exposed organ to environment; therefore, cutaneous diseases are inclined to have a high sensitivity to climate. For example, global warming, deforestation and changes in precipitation have been linked to variations in the geographical distribution of vectors of some infectious diseases (leishmaniasis, lyme disease, etc) by changing their spread, whereas warm and humid environment can also encourage the colonization of the skin by bacteria and fungi. The present review focuses on the wide and complex relationship between climate change and dermatology, showing the numerous factors that are contributing to modify the incidence and the clinical pattern of many

  4. Relationship between screw sagittal angle and stress on endplate of adjacent segments after anterior cervical corpectomy and fusion with internal fixation: a Chinese finite element study.

    Science.gov (United States)

    Zhang, Yu; Tang, Yibo; Shen, Hongxing

    2017-12-01

    In order to reduce the incidence of adjacent segment disease (ASD), the current study was designed to establish Chinese finite element models of normal 3rd~7th cervical vertebrae (C3-C7) and anterior cervical corpectomy and fusion (ACCF) with internal fixation , and analyze the influence of screw sagittal angle (SSA) on stress on endplate of adjacent cervical segments. Mimics 8.1 and Abaqus/CAE 6.10 softwares were adopted to establish finite element models. For C4 superior endplate and C6 inferior endplate, their anterior areas had the maximum stress in anteflexion position, and their posterior areas had the maximum stress in posterior extension position. As SSA increased, the stress reduced. With an increase of 10° in SSA, the stress on anterior areas of C4 superior endplate and C6 inferior endplate reduced by 12.67% and 7.99% in anteflexion position, respectively. With an increase of 10° in SSA, the stress on posterior areas of C4 superior endplate and C6 inferior endplate reduced by 9.68% and 10.22% in posterior extension position, respectively. The current study established Chinese finite element models of normal C3-C7 and ACCF with internal fixation , and demonstrated that as SSA increased, the stress on endplate of adjacent cervical segments decreased. In clinical surgery, increased SSA is able to play important role in protecting the adjacent cervical segments and reducing the incidence of ASD.

  5. Four Cases of Atopic Dermatitis Complicated by Sjogren's Syndrome: Link between Dry Skin and Autoimmune Anhidrosis

    Directory of Open Access Journals (Sweden)

    Shun Kitaba

    2011-01-01

    Full Text Available We report four adult cases of atopic dermatitis (AD complicated by Sjogren's syndrome (SS. The patients fulfilled diagnostic criteria for AD and SS. All cases showed persistent itchy dry skin and eczematous lesions complicated by sicca symptoms including dry eyes and dry mouth with moderate joint pain. One case manifested annular erythema and another manifested widespread discoid erythema. To investigate the underlying cause of dry skin in these cases, sweating function was evaluated using a quantitative sudomotor axon reflex test (QSART in which the axon reflex is stimulated by acetylcholine iontophoresis. The sweating latency time was significantly prolonged in eczematous skin of AD and AD/SS compared to normal controls. Axon reflex (AXR sweat volume was also significantly reduced in AD (normal and eczematous skin and AD/SS (normal and eczema compared to normal control. In contrast, the direct sweat volume of lesional or non-lesional AD skin induced by direct stimulation with acetylcholine was only slightly reduced compared to that in normal controls, but not in SS and lesional skin of AD/SS patients. These results suggest that the impaired sweat response in AD is attributable to an abnormal sudomotor axon reflex, which is accelerated and modulated when complicated by SS resulting in dry skin in the present cases.

  6. Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer

    OpenAIRE

    David A. Quigley; Eve Kandyba; Phillips Huang; Kyle D. Halliwill; Jonas Sjölund; Facundo Pelorosso; Christine E. Wong; Gillian L. Hirst; Di Wu; Reyno Delrosario; Atul Kumar; Allan Balmain

    2016-01-01

    Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways. Gene networks related to specific cell types and signaling pathways, including sonic hedgehog (Shh), Wnt,...

  7. The content and ratio of type I and III collagen in skin differ with age ...

    African Journals Online (AJOL)

    Results obtained showed that the mean content of type I and III and type I/III ratio in normal skin differed significantly among age groups (P0.05), with the lowest levels of type I, III, and the highest ratio of type I/III observed in the elderly age group. Differences between normal uninjured skin and hypertrophic scar tissue were ...

  8. Contamination and decontamination of skin

    International Nuclear Information System (INIS)

    Severa, J.; Knajfl, J.

    1983-01-01

    In external contamination the beta radiation dose is the prevalent component of the total dose absorbed by the skin. There exist four types of radionUclide bonds to the skin: mechanical retention of solid particles or solution on the surface and in the pores, physical adsorption of nondissociated molecules or colloids, the ion exchange effect, and chemisorption. Radionuclides then penetrate the skin by transfollicular transfer. The total amount of radioactive substances absorbed into the skin depends on the condition of the skin. Skin is decontaminated by washing with lukewarm water and soap or with special decontamination solutions. The most widely used components of decontamination solutions are detergents, chelaton, sodium hexametaphosphate, oxalic acid, citric acid. The main principles of the decontamination of persons are given. (M.D.)

  9. Microscopic contact area and friction between medical textiles and skin.

    Science.gov (United States)

    Derler, S; Rotaru, G-M; Ke, W; El Issawi-Frischknecht, L; Kellenberger, P; Scheel-Sailer, A; Rossi, R M

    2014-10-01

    The mechanical contact between medical textiles and skin is relevant in the health care for patients with vulnerable skin or chronic wounds. In order to gain new insights into the skin-textile contact on the microscopic level, the 3D surface topography of a normal and a new hospital bed sheet with a regular surface structure was measured using a digital microscope. The topographic data was analysed concerning material distribution and real contact area against smooth surfaces as a function of surface deformations. For contact conditions that are relevant for the skin of patients lying in a hospital bed it was found that the order of magnitude of the ratio of real and apparent contact area between textiles and skin or a mechanical skin model lies between 0.02 and 0.1 and that surface deformations, i.e. penetration of the textile surface asperities into skin or a mechanical skin model, range from 10 to 50µm. The performed analyses of textile 3D surface topographies and comparisons with previous friction measurement results provided information on the relationship between microscopic surface properties and macroscopic friction behaviour of medical textiles. In particular, the new bed sheet was found to be characterised by a trend towards a smaller microscopic contact area (up to a factor of two) and by a larger free interfacial volume (more than a factor of two) in addition to a 1.5 times lower shear strength when in contact with counter-surfaces. The applied methods can be useful to develop improved and skin-adapted materials and surfaces for medical applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Skin pattern analysis for lesion classification using local isotropy.

    Science.gov (United States)

    She, Zhishun; Excell, Peter S

    2011-05-01

    The observation that skin pattern tends to be disrupted by malignant skin lesions, but not by benign ones suggests that measurements of skin pattern disruption on simply captured white light optical clinical (WLC) skin images could be a useful contribution to a diagnostic feature set. Previous work, which generated a flow field of skin pattern using a measurement of local line direction and intensity, was encouraging. The aim of this paper is to investigate the possibility of extracting new features using local isotropy metrics to quantify the skin pattern disruption. The skin pattern was extracted from WLC skin images by high-pass filtering. A local tensor matrix was computed. The local isotropy was measured by the condition number of the local tensor matrix. The difference of this measure over the lesion and normal skin areas, combined with the local line direction and the ABCD features, was used as a lesion classifier. A set of images of malignant melanoma and benign naevi was analysed. A one-dimensional scatter plot showed the potential of a local isotropy metric, showing an area of 0.70 under the receiver operating characteristic (ROC) curve. A two-dimensional scatter plot, combined with the local line direction, indicated enhancement of the classification performance, showing an area of 0.89 under the ROC curve. A three-dimensional scatter plot combined with the local line direction and the ABCD features, using principal component analysis, demonstrated excellent separation of benign and malignant lesions. An ROC plot for this case enclosed an area of 0.96. The experimental results show that the local isotropy metric has a potential to increase lesion classifier accuracy. Combined with the local line direction and the ABCD features, it is very promising as a method to distinguish malignant melanoma from benign lesions. © 2010 John Wiley & Sons A/S.

  11. The evaluation of skin friction using a frictional feel analyzer.

    Science.gov (United States)

    Egawa, Mariko; Oguri, Motoki; Hirao, Tetsuji; Takahashi, Motoji; Miyakawa, Michio

    2002-02-01

    Sensory evaluation is an important factor for cosmetic products. Several devices for the measurement of sensory properties have been developed in recent years. The objective here is to measure skin surface friction using these devices and examine the correlation with other physiological parameters in order to evaluate the potential of physical measurement of tactile sensation. A KES-SE Frictional Analyzer, a commercial device for measurement of surface frictional characteristics, was used in this study. An arm holder was added to this device for measurement on the human forearm. The frictional coefficient (MIU) and its mean deviation (MMD) were used as the parameter to indicate surface friction. The moisture content in the stratum corneum was measured with a Corneometer CM825, the transepidermal water loss with a Tewameter TM210, the viscoelastic properties of the skin with a Cutometer SEM575 and the skin surface pattern by observing the negative replica using silicon rubber. The MIU was not influenced by load; however, it was increased due to water application on the skin. The relationship between MIU and the moisture content in the stratum comeum, between MMD and skin surface pattern and between MMD and viscosity of both normal human forearm skin and SDS (sodium dodecyl sulfate)-induced dry skin were confirmed by statistical analysis in a test on human subjects. There was also a correlation between either MIU or MMD and sensory evaluation in the morning after the application of moisturizing products. Human skin surface friction was measured by using a KES-SE Frictional Analyzer. Judging from the correlation between either MIU or MMD and sensory evaluation, we considered this instrumental analysis to be useful for evaluating the tactile impression of human skin.

  12. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  13. Targeted Therapy in Nonmelanoma Skin Cancers

    Directory of Open Access Journals (Sweden)

    Giulia Spallone

    2011-05-01

    Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  14. Targeted Therapy in Nonmelanoma Skin Cancers

    Energy Technology Data Exchange (ETDEWEB)

    Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio, E-mail: antonio.costanzo@uniroma2.it [Department of Dermatology, University of Rome “Tor Vergata”, Via Montpellier 1, 00199, Rome (Italy)

    2011-05-03

    Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.

  15. The skin prick test.

    Science.gov (United States)

    Frati, F; Incorvaia, C; Cavaliere, C; Di Cara, G; Marcucci, F; Esposito, S; Masieri, S

    2018-01-01

    The skin prick test (SPT) is the most common test for the diagnosis of allergy. SPT is performed by pricking the skin, usually in the volar surface of the forearm, with a lancet through a drop of an allergen extract and is usually the first choice test in the diagnostic workup for allergic diseases because of its reliability, safety, convenience and low cost. SPT is minimally invasive and has the advantage of testing multiple allergens in 15 to 20 min. In children, SPT is far less disturbing than venipuncture and is used to obtain a sample of serum to measure specific IgE through in vitro tests. There is a good correlation (about 85-95%) between SPT and in vitro tests. Globally, SPT is an excellent diagnostic tool, with a positive predictive value ranging from 95-100%. SPTs can identify sensitivity to inhalants, foods, some drugs, occupational allergens, hymenoptera venom and latex. However, the relevance of such sensitivity to allergens should always be carefully interpreted in the light of the clinical history, because sensitization and clinical allergy may not coincide. In regards to safety, though the reports of systemic reactions, and particularly anaphylaxis, are very rare, in vitro IgE tests should be preferred if previous severe reactions emerge from the patient’s clinical history.

  16. Modern sedimentary processes along the Doce river adjacent continental shelf

    Directory of Open Access Journals (Sweden)

    Valéria da Silva Quaresma

    Full Text Available In areas of the continental shelf where sediment supply is greater than the sediment dispersion capacity, an extensive terrigenous deposits and consequently submerged deltas can be formed. The Eastern Brazilian shelf is characterized by the occurrence of river feed deltas in between starving coasts. Herein, modern sedimentary processes acting along the Doce river adjacent continental shelf are investigated. The main objective was to understand the shelf sediment distribution, recognizing distinct sedimentary patterns and the major influence of river sediment discharge in the formation of shelf deposits. The study used 98 surficial samples that were analyzed for grain size, composition and bulk density. Results revealed 3 distinct sectors: south - dominated by mud fraction with a recent deposition from riverine input until 30 m deep and from this depth bioclastic sands dominate; central north - sand mud dominated, been recognized as a bypass zone of resuspended sediment during high energy events; and north - relict sands with high carbonate content. The modern sedimentation processes along the Doce river continental shelf is dominated by distinct sedimentary regimes, showing a strong fluvial influence associated with wave/wind induced sediment dispersion and a carbonate regime along the outer shelf. These regimes seem to be controlled by the distance from the river mouth and bathymetric gradients.

  17. Mechanical interactions between adjacent airways in the lung.

    Science.gov (United States)

    Ma, Baoshun; Bates, Jason H T

    2014-03-15

    The forces of mechanical interdependence between the airways and the parenchyma in the lung are powerful modulators of airways responsiveness. Little is known, however, about the extent to which adjacent airways affect each other's ability to narrow due to distortional forces generated within the intervening parenchyma. We developed a two-dimensional computational model of two airways embedded in parenchyma. The parenchyma itself was modeled in three ways: 1) as a network of hexagonally arranged springs, 2) as a network of triangularly arranged springs, and 3) as an elastic continuum. In all cases, we determined how the narrowing of one airway was affected when the other airway was relaxed vs. when it narrowed to the same extent as the first airway. For the continuum and triangular network models, interactions between airways were negligible unless the airways lay within about two relaxed diameters of each other, but even at this distance the interactions were small. By contrast, the hexagonal spring network model predicted that airway-airway interactions mediated by the parenchyma can be substantial for any degree of airway separation at intermediate values of airway contraction forces. Evidence to date suggests that the parenchyma may be better represented by the continuum model, which suggests that the parenchyma does not mediate significant interactions between narrowing airways.

  18. Cryogun cryotherapy for oral leukoplakia and adjacent melanosis lesions.

    Science.gov (United States)

    Chen, Hsin-Ming; Cheng, Shih-Jung; Lin, Hung-Pin; Yu, Chuan-Hang; Wu, Yang-Che; Chiang, Chun-Pin

    2015-09-01

    Our previous study has shown that cryogun cryotherapy is a good and effective treatment modality for oral leukoplakia. In this study, we used cryogun cryotherapy to treat 72 oral leukoplakia and adjacent smoking-induced melanosis (OLM) lesions on the buccal mucosae. Of 72 OLM lesions, 14 had epithelial hyperplasia with parakeratosis, 24 had epithelial hyperplasia with hyperkeratosis, 26 had mild dysplasia, seven had moderate dysplasia, and one had severe dysplasia. Complete regression was achieved in all 72 OLM lesions after a mean of 3.3 ± 1.3 cryogun cryotherapy treatments. We found that OLM lesions in patients without smoking habit, with the greatest diameter cryotherapy treatment to achieve complete regression than those OLM lesions in patients with smoking habit, with the greatest diameter ≥ 2.8 cm, without epithelial dysplasia, or with a surface keratin thickness > 50 μm (all P-values cryotherapy treatment number (all P-values cryotherapy treatment required to achieve complete regression of the OLM lesion by multivariate logistic regression analyses. Cryogun cryotherapy is an effective treatment modality for OLM lesions. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Repeated adjacent-segment degeneration after posterior lumbar interbody fusion.

    Science.gov (United States)

    Okuda, Shinya; Oda, Takenori; Yamasaki, Ryoji; Maeno, Takafumi; Iwasaki, Motoki

    2014-05-01

    One of the most important sequelae affecting long-term results is adjacent-segment degeneration (ASD) after posterior lumbar interbody fusion (PLIF). Although several reports have described the incidence rate, there have been no reports of repeated ASD. The purpose of this report was to describe 1 case of repeated ASD after PLIF. A 62-year-old woman with L-4 degenerative spondylolisthesis underwent PLIF at L4-5. At the second operation, L3-4 PLIF was performed for L-3 degenerative spondylolisthesis 6 years after the primary operation. At the third operation, L2-3 PLIF was performed for L-2 degenerative spondylolisthesis 1.5 years after the primary operation. Vertebral collapse of L-1 was detected 1 year after the third operation, and the collapse had progressed. At the fourth operation, 3 years after the third operation, vertebral column resection of L-1 and replacement of titanium mesh cages with pedicle screw fixation between T-4 and L-5 was performed. Although the patient's symptoms resolved after each operation, the time between surgeries shortened. The sacral slope decreased gradually although each PLIF achieved local lordosis at the fused segment.

  20. Flow and edge scour in current adjacent to stone covers

    DEFF Research Database (Denmark)

    Petersen, Thor U.; Sumer, B. Mutlu; Bøgelund, Jon

    2015-01-01

    This paper presents the results of an experimental investigation on edge scour adjacent to a stone cover laid on a sandy bed. The three-dimensional flow over the edge of the stone layer has been investigated by the use of particle image velocimetry. The flow measurements show a significant amount...... of turbulence in the primary flow near the junction between the stone layer and the sand bed and the formation of complex secondary-flow structures. The results show that the flow and the edge scour process in a steady current are governed by the size of the roughness elements and to some extent the side slope...... of the berm. The edge scour is caused by the combined action of the primary flow and the secondary flow. The primary flow stirs up the sediment and puts it into suspension, and the secondary flow carries it away from the junction between the stone layer and the sand bed, resulting in a scour hole forming...