Mast cell distribution in normal adult skin
A.S. Janssens (Artiena Soe); R. Heide (Rogier); J.C. den Hollander (Jan); P.G.M. Mulder (P. G M); B. Tank (Bhupendra); A.P. Oranje (Arnold)
2005-01-01
markdownabstract__AIMS:__ To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. __METHODS:__ Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults.
Mast cell distribution in normal adult skin.
Janssens, A S; Heide, R; den Hollander, J C; Mulder, P G M; Tank, B; Oranje, A P
2005-03-01
To investigate mast cell distribution in normal adult skin to provide a reference range for comparison with mastocytosis. Mast cells (MCs) were counted in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders in adults. There was an uneven distribution of MCs in different body sites using the anti-tryptase monoclonal antibody technique. Numbers of MCs on the trunk, upper arm, and upper leg were similar, but were significantly different from those found on the lower leg and forearm. Two distinct groups were formed--proximal and distal. There were 77.0 MCs/mm2 at proximal body sites and 108.2 MCs/mm2 at distal sites. Adjusted for the adjacent diagnosis and age, this difference was consistent. The numbers of MCs in uninvolved skin adjacent to basal cell carcinomas and other dermatological disorders were not different from those in the control group. Differences in the numbers of MCs between the distal and the proximal body sites must be considered when MCs are counted for a reliable diagnosis of mastocytosis. A pilot study in patients with mastocytosis underlined the variation in the numbers of MCs in mastocytosis and normal skin, but showed a considerable overlap. The observed numbers of MCs in adults cannot be extrapolated to children. MC numbers varied significantly between proximal and distal body sites and these differences must be considered when MCs are counted for a reliable diagnosis of mastocytosis. There was a considerable overlap between the numbers of MCs in mastocytosis and normal skin.
Nishimura, Meiko; Hayashi, Mitsuhiro; Mizutani, Yu; Takenaka, Kei; Imamura, Yoshinori; Chayahara, Naoko; Toyoda, Masanori; Kiyota, Naomi; Mukohara, Toru; Aikawa, Hiroaki; Fujiwara, Yasuhiro; Hamada, Akinobu; Minami, Hironobu
2018-04-06
The development of skin rashes is the most common adverse event observed in cancer patients treated with epidermal growth factor receptor-tyrosine kinase inhibitors such as erlotinib. However, the pharmacological evidence has not been fully revealed. Erlotinib distribution in the rashes was more heterogeneous than that in the normal skin, and the rashes contained statistically higher concentrations of erlotinib than adjacent normal skin in the superficial skin layer (229 ± 192 vs. 120 ± 103 ions/mm 2 ; P = 0.009 in paired t -test). LC-MS/MS confirmed that the concentration of erlotinib in the skin rashes was higher than that in normal skin in the superficial skin layer (1946 ± 1258 vs. 1174 ± 662 ng/cm 3 ; P = 0.028 in paired t -test). The results of MALDI-MSI and LC-MS/MS were well correlated (coefficient of correlation 0.879, P distribution of erlotinib in the skin tissue was visualized using non-labeled MALDI-MSI. Erlotinib concentration in the superficial layer of the skin rashes was higher than that in the adjacent normal skin. We examined patients with advanced pancreatic cancer who developed skin rashes after treatment with erlotinib and gemcitabine. We biopsied both the rash and adjacent normal skin tissues, and visualized and compared the distribution of erlotinib within the skin using matrix-assisted laser desorption/ionization mass spectrometry imaging (MALDI-MSI). The tissue concentration of erlotinib was also measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) with laser microdissection.
TP53 mutations in clinically normal mucosa adjacent to oral carcinomas
DEFF Research Database (Denmark)
Thode, Christenze; Bilde, Anders; von Buchwald, Christian
2010-01-01
BACKGROUND: The tumour-suppressor protein p53 often accumulates in histologically normal epithelium adjacent to oral squamous cell carcinomas (OSCC). We investigated whether this was associated with mutations in TP53, the gene for p53, and might implicate impending malignancy. METHODS: Specimens...... products were separated by denatured gradient gel electrophoresis. Fragments with a deviant DGEE pattern were sequenced. RESULTS: TP53 mutations were found in six of 18 tumours. Fourteen specimens contained histologically normal mucosa adjacent to the tumour; 13 of these showed small clusters of p53...
Bos, J. D.; Zonneveld, I.; Das, P. K.; Krieg, S. R.; van der Loos, C. M.; Kapsenberg, M. L.
1987-01-01
The complexity of immune response-associated cells present in normal human skin was recently redefined as the skin immune system (SIS). In the present study, the exact immunophenotypes of lymphocyte subpopulations with their localizations in normal human skin were determined quantitatively. B cells
Effect of friction on vibrotactile sensation of normal and dehydrated skin.
Chen, S; Ge, S; Tang, W; Zhang, J
2016-02-01
Vibrotactile sensation mediated is highly dependent on surface mechanical and frictional properties. Dehydration of skin could change these properties. To investigate the relationship between friction and vibrotactile sensation of normal and dehydrated skin. Vibrations were firstly measured during surface exploration using a biomimetic sensor. Piglet skin was used as human skin model to study frictional properties for both normal and dehydrated skin using an atomic force microscope on nanoscale and a pin-on-disk tribometer on macroscale. Effect of vibrational frequency on friction and vibrotactile perception was also observed on nano and macro scale for normal and dehydrated skin. The result indicated that dehydrated skin was less sensitive than normal skin. The coefficient of friction of dehydrated skin is smaller than that of normal skin on both nano and macro scale. The coefficient of friction increases as increasing scanning frequencies. There is a positive correlation between coefficient of friction and vibrotactile sensation on nanoscale and macroscale. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Study of mast cell count in skin tags
Directory of Open Access Journals (Sweden)
Zaher Hesham
2007-01-01
Full Text Available Background: Skin tags or acrochordons are common tumors of middle-aged and elderly subjects. They consist of loose fibrous tissue and occur mainly on the neck and major flexures as small, soft, pedunculated protrusions. Objectives: The aim was to compare the mast cells count in skin tags to adjacent normal skin in diabetic and nondiabetic participants in an attempt to elucidate the possible role of mast cells in the pathogenesis of skin tags. Participants and Methods: Thirty participants with skin tags were divided into group I (15 nondiabetic participants and group II (15 diabetic participants. Three biopsies were obtained from each participant: a large skin tag, a small skin tag and adjacent normal skin. Mast cell count from all the obtained sections was carried out, and the mast cell density was expressed as the average mast cell count/high power field (HPF. Results: A statistically significant increase in mast cells count in skin tags in comparison to normal skin was detected in group I and group II. There was no statistically significant difference between mast cell counts in skin tags of both the groups. Conclusion: Both the mast cell mediators and hyperinsulinemia are capable of inducing fibroblast proliferation and epidermal hyperplasia that are the main pathologic abnormalities seen in all types of skin tags. However, the presence of mast cells in all examined skin tags regardless of diabetes and obesity may point to the possible crucial role of mast cells in the etiogenesis of skin tags through its interaction with fibroblasts and keratinocytes.
Morphology and epidermal thickness of normal skin imaged by optical coherence tomography
DEFF Research Database (Denmark)
Mogensen, Mette; Morsy, Hanan A.; Thrane, Lars
2008-01-01
colour. Methods: OCT imaging is based on infrared light reflection/backscatter from tissue. PS-OCT detects birefringence of tissue. Imaging was performed in 12 skin regions. ET was calculated from the OCT images. Results: Normal skin has a layered structure. Layering is less pronounced in adults......Background: Optical coherence tomography (OCT) is an optical imaging technology with a potential in the non-invasive diagnosis of skin cancer. To identify skin pathologies using OCT, it is of prime importance to establish baseline morphological features of normal skin. Aims: The aim of this study...... is to describe normal skin morphology using OCT and polarization-sensitive OCT (PS-OCT), which is a way of representing birefringent tissue such as collagen in OCT images. Anatomical locations in 20 healthy volunteers were imaged, and epidermal thickness (ET) was measured and compared to age, gender and skin...
Histological Study on the Skin of Japanese Flounder Paralichthys olivaceus
Institute of Scientific and Technical Information of China (English)
ZHU Jie; ZHANG Xiumei; GAO Tianxiang
2005-01-01
Histological development of Japanese flounder Paralichthys olivaceus larval skin and ultrastructural difference of skin between reared normal and malpigmented Japanese flounder were studied with light microscopy (LM) and transmission electron microscopy (TEM). The results show that the skin develops slowly before the metamorphosis, while at the onset of metamorphosis, the skin develops quickly and becomes complete in structure till about 50 d after being hatched. Ultrastructural observation on the normal and malpigmented skins shows that the iridophore and melanophore are adjacent to each other. Profile and structure of the two kinds of pigment cells are more complete in the skin of normal ocular side than in the skin of pigmented blind side. The ultrastructure of typical chloride cell was observed in the skin of Japanese flounder larvae for the first time.
Reflectance spectrometry of normal and bruised human skins: experiments and modeling
International Nuclear Information System (INIS)
Kim, Oleg; Alber, Mark; McMurdy, John; Lines, Collin; Crawford, Gregory; Duffy, Susan
2012-01-01
A stochastic photon transport model in multilayer skin tissue combined with reflectance spectroscopy measurements is used to study normal and bruised skins. The model is shown to provide a very good approximation to both normal and bruised real skin tissues by comparing experimental and simulated reflectance spectra. The sensitivity analysis of the skin reflectance spectrum to variations of skin layer thicknesses, blood oxygenation parameter and concentrations of main chromophores is performed to optimize model parameters. The reflectance spectrum of a developed bruise in a healthy adult is simulated, and the concentrations of bilirubin, blood volume fraction and blood oxygenation parameter are determined for different times as the bruise progresses. It is shown that bilirubin and blood volume fraction reach their peak values at 80 and 55 h after contusion, respectively, and the oxygenation parameter is lower than its normal value during 80 h after contusion occurred. The obtained time correlations of chromophore concentrations in developing contusions are shown to be consistent with previous studies. The developed model uses a detailed seven-layer skin approximation for contusion and allows one to obtain more biologically relevant results than those obtained with previous models using one- to three-layer skin approximations. A combination of modeling with spectroscopy measurements provides a new tool for detailed biomedical studies of human skin tissue and for age determination of contusions. (paper)
Kiprono, Samson K; Masenga, John E; Chaula, Baraka M; Naafs, Bernard
2012-07-30
Skin flora varies from one site of the body to another. Individual's health, age and gender determine the type and the density of skin flora. A 1 cm² of the skin on the sternum was rubbed with sterile cotton swab socked in 0.9% normal saline and plated on blood agar. This was cultured at 35 °C. The bacteria were identified by culturing on MacConkey agar, coagulase test, catalase test and gram staining. Swabs were obtained from 66 individuals affected by albinism and 31 individuals with normal skin pigmentation. Those with normal skin were either relatives or staying with the individuals affected by albinism who were recruited for the study. The mean age of the 97 recruited individuals was 30.6 (SD ± 14.9) years. The mean of the colony forming units was 1580.5 per cm2. Those affected by albinism had a significantly higher mean colony forming units (1680 CFU per cm²) as compared with 453.5 CFU per cm² in those with normally pigmented skin (p = 0.023). The skin type and the severity of sun- damaged skin was significantly associated with a higher number of colony forming units (p = 0.038). Individuals affected by albinism have a higher number of colony forming units which is associated with sun- damaged skin.
Hyperpigmentation of the skin associated with minocycline therapy
International Nuclear Information System (INIS)
Gordon, G.; Sparano, B.M.; Iatropoulos, M.J.
1985-01-01
Skin biopsy specimens and discolored fingernails from minocycline-treated patients were examined by light and electron microscopy, histochemistry, and energy-dispersive x-ray analysis. Both hyperpigmented and adjacent normally pigmented skin samples contained pigment-laden macrophages in the dermis, although these cells were more numerous in the hyperpigmented skin samples. Elemental analysis showed that both pigment deposits and stratum corneum of hyperpigmented skin samples contained iron and calcium. Discolored areas of fingernails from a minocycline-treated patient also contained iron and calcium. Both skin and nail discoloration were possibly due to the presence of an iron chelate of minocycline and/or quinoid derivatives of minocycline. The presence of iron-containing pigment in normal as well as hyperpigmented skin may have predisposed to formation of minocycline-associated pigment in these patients
Reproducible pattern of microRNA in normal human skin
DEFF Research Database (Denmark)
Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert
2010-01-01
RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease....
Reproducible pattern of microRNA in normal human skin
DEFF Research Database (Denmark)
Holst, Line; Kaczkowski, Bogumil; Gniadecki, Robert
2010-01-01
RNA expression pattern in normal human skin. Here we investigated miRNA expression profiles from skin biopsies of 8 healthy volunteers taken from sun protected and mildly photo damaged skin using the modified protocol for miRNA extraction. We were able to show a constant pattern of miRNA expression between...... different individuals. We did not find any significant differences in miRNA expression between sun protected and mildly photodamaged skin. These results may be valuable for future design of studies on miRNA expression in skin disease.......MicroRNAs (miRNAs) regulate cell growth, differentiation and apoptosis via specific targeting of messenger RNA (mRNA). Aberrant mRNA expression contributes to pathological processes such as carcinogenesis. To take advantage of miRNA profiling in skin disease it is essential to investigate mi...
Clinical and histological effects of blue light on normal skin.
Kleinpenning, M.M.; Smits, T.; Frunt, M.H.A.; Erp, P.E.J. van; Kerkhof, P.C.M. van de; Gerritsen, R.M.
2010-01-01
INTRODUCTION: Phototherapy with visible light is gaining interest in dermatological practice. Theoretically, blue light could induce biological effects comparable to ultraviolet A (UVA) radiation. OBJECTIVES: To study the effects of blue light on normal skin in terms of photodamage, skin ageing and
International Nuclear Information System (INIS)
Hofmann, D.K.; Kleinebeckel, D.; Luther, W.
1978-01-01
In the experiments performed by W. Luther on young Ambystoma mexicanum, tails of host animals were irradiated with 2000 r. Afterwards a skin cuff was removed from the mid-tail region. From non-irradiated donor animals, square pieces of skin dorsally adjacent to both hindlimbs were grafted (either 90 0 -rotated or unrotated) to both sides of the denuded area of the irradiated host tail. After 3 weeks the tails were amputated across the skin transplants, and the structures which had regenerated from the distal portions of the tails were fixed 6-16 weeks later. Morhological and histological investigation revealed that 4 out of 12 regenerates from rotated grafts showed clear limb characteristics. (orig./AJ) [de
Zhu, G H; Wang, S T; Yao, M Z; Cai, J H; Chen, C Y; Yang, Z X; Hong, L; Yang, S Y
2014-04-16
The objective of this study was to explore the feasibility and methods of screening the residual normal ovarian tissue adjacent to orthotopic ovarian carcinomas in nude mice. Human epithelial ovarian cancer cells (OVCAR3) were subcutaneously implanted for a tumor source and ovarian orthotopic transplantation. The cancer tissue, proximal paraneoplastic tissue, middle paraneoplastic tissue, remote paraneoplastic tissue, and normal ovarian tissue were removed. CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was detected by reverse transcription polymerase chain reaction. We obtained 35 paraneoplastic residual ovarian tissues with normal biopsies from 40 cases of an orthotopic epithelial ovarian carcinoma model (87.5%). CK-7, CA125, p53, survivin, MMP-2, and TIMP-2 expression was lower in proximal paraneoplastic tissue than in cancer tissue (P tissue (P tissue as well as among residual normal ovarian tissues with different severity (P > 0.05). In ovarian tissues of 20 normal nude mice, the expression of CK- 7, CA125, p53, survivin, MMP-2, and TIMP-2 was negative. Overall, the expression levels of CK-7, CA125, p53, survivin, MMP-2, TIMP-2, and other molecular markers showed a decreasing trend in the non-cancer tissue direction. The expression levels can be used as standards to screen residual normal ovarian tissue. We can obtain relatively safe normal ovarian tissues adjacent to epithelial ovarian cancer.
Normal variants of skin in neonates
Directory of Open Access Journals (Sweden)
Kulkarni M
1996-01-01
Full Text Available 2221 consecutive live births taking place between March 1994 and February 1995 were evaluated for a minimum period of 5 days to note for the occurrence of various normal anatomical variants specially those of skin. Birth weight, gestational age, maternal age, socio-economic status and consanguinity were carefully recorded in all the cases. Mongolian spots (72%, Epstein pearls (43.8%, Milia (26.2% and Erythema toxicum (25.2%, were the common dermatological variants noted. Maturity of the babies and possibly genetic factors (consanguinity are important factors in their causation as ordered in our study.
International Nuclear Information System (INIS)
Leygue, Etienne; Dotzlaw, Helmut; Watson, Peter H; Murphy, Leigh C
2000-01-01
Using semiquantitative reverse transcription-polymerase chain reaction assays, we investigated the expression of variant messenger RNAs relative to wild-type estrogen receptor (ER)-α messenger RNA in normal breast tissues and their adjacent matched breast tumor tissues. Higher ER variant truncated after sequences encoding exon 2 of the wild-type ER-α (ERC4) messenger RNA and a lower exon 3 deleted ER-α variant (ERD3) messenger RNA relative expression in the tumor compartment were observed in the ER-positive/PR-positive and the ER-positive subsets, respectively. A significantly higher relative expression of exon 5 deleted ER-α varient (ERD5) messenger RNA was observed in tumor components overall. These data demonstrate that changes in the relative expression of ER-α variant messenger RNAs occur between adjacent normal and neoplastic breast tissues. We suggest that these changes might be involved in the mechanisms that underlie breast tumorigenesis. Estrogen receptor (ER)-α and ER-β are believed to mediate the action of estradiol in target tissues. Several ER-α and ER-β variant messenger RNAs have been identified in both normal and neoplastic human tissues. Most of these variants contain a deletion of one or more exons of the wild-type (WT) ER messenger RNAs. The putative proteins that are encoded by these variant messenger RNAs would therefore be missing some functional domains of the WT receptors, and might interfere with WT-ER signaling pathways. The detection of ER-α variants in both normal and neoplastic human breast tissues raised the question of their possible role in breast tumorigenesis. We have previously reported an increased relative expression of exon 5 deleted ER-α variant (ERD5) messenger RNA and of another ER-α variant truncated of all sequences following the exon 2 of the WT ER-α (ERC4) messenger RNA in breast tumor samples versus independent normal breast tissues. In contrast, a decreased relative expression of exon 3 deleted ER
Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.
Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T
1999-04-01
The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.
Yasukochi, Yumi; Nakahara, Takeshi; Koike, Akihiro; Ichikawa, Ryutaro; Koga, Tetsuya; Furue, Masutaka
2015-05-01
We experienced a 75-year-old male patient with a refractory and severely painful skin ulcer on the right back. He had suffered from ischemic heart disease and undergone percutaneous coronary intervention 5 months prior to the consultation with us. The characteristic clinical appearance, location of the lesion and his past medical history led us to the diagnosis of radiation-induced skin ulcer. Magnetic resonance imaging, computed tomography as well as bone scintigraphy showed fractures of the right back rib adjacent to the ulcer, which was thought to be attributable to bone damage due to X-ray radiation and/or persistent secondary inflammation of the chronic ulcer. In the published work, there are no other reports of bone fractures associated with radiation dermatitis after coronary interventional radiology. © 2015 Japanese Dermatological Association.
Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin
DEFF Research Database (Denmark)
Kamstrup, M.; Faurschou, A.; Gniadecki, R.
2008-01-01
In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...
DEFF Research Database (Denmark)
Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt
1997-01-01
Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... yielded the following results: (1) in atopic dermatitis lesional skin an increased number of mast cell profiles was found as compared with nonlesional skin, (2) comparing atopic dermatitis skin with normal skin, a significantly increased number of mast cell profiles per millimetre squared was found...
Xie, Qiang; Wang, Hongbei; Heilman, Edward R; Walsh, Michael G; Haseeb, M A; Gupta, Raavi
2014-01-01
Enhancer of Zeste Homolog 2 (EZH2) is a polycomb group protein that has been shown to be involved in the progression of multiple human cancers including melanoma. The expression of EZH2 in normal skin and in pre-malignant and malignant cutaneous squamous cell carcinoma (SCC) has not been studied. We examined the expression of EZH2 in normal skin, actinic keratosis (AK), SCC in situ, well-differentiated (SCC-WD), moderately-differentiated (SCC-MD) and poorly-differentiated SCC (SCC-PD) to ascertain whether EZH2 expression differentiates these conditions. Immunohistochemical staining for EZH2 was performed on formalin-fixed paraffin-embedded biopsies and a tissue microarray containing normal skin, AK, SCC in situ, and SCC of different grades. In comparison to the normal skin, EZH2 expression in actinic keratosis was increased (p=0.03). Similarly, EZH2 expression in all of the neoplastic conditions studied (SCC in situ, SCC-WD, SCC-MD and SCC-PD) was greatly increased in comparison to both the normal skin and actinic keratosis (p≤0.001). EZH2 expression increases incrementally from normal skin to AK and further to SCC, suggesting a role for EZH2 in the progression and differentiation of SCC. EZH2 expression may be used as a diagnostic marker for differentiating SCC from AK or normal skin.
Protoporphyrin IX formation and photobleaching in different layers of normal human skin
DEFF Research Database (Denmark)
Togsverd-Bo, Katrine; Idorn, Luise W; Philipsen, Peter A
2012-01-01
human skin was tape-stripped and incubated with 20% methylaminolevulinate (MAL) or 20% hexylaminolevulinate (HAL) for 3 h. Fluorescence microscopy quantified PpIX accumulation in epidermis, superficial, mid and deep dermis, down to 2 mm. PpIX photobleaching by light-emitting diode (LED, 632 nm, 18......Topical photodynamic therapy (PDT) is used for various skin disorders, and selective targeting of specific skin structures is desirable. The objective was to assess accumulation of PpIX fluorescence and photobleaching within skin layers using different photosensitizers and light sources. Normal...... and 37 J/cm(2)), intense pulsed light (IPL, 500-650 nm, 36 and 72 J/cm(2)) and long-pulsed dye laser (LPDL, 595 nm, 7.5 and 15 J/cm(2)) was measured using fluorescence photography and microscopy. We found higher PpIX fluorescence intensities in epidermis and superficial dermis in HAL-incubated skin than...
Skin hydration, microrelief and greasiness of normal skin in Antarctica.
Tsankov, N; Mateev, D; Darlenski, R
2018-03-01
The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.
Hashida, Yumiko; Nakajima, Kimiko; Nakajima, Hideki; Shiga, Takeo; Tanaka, Moe; Murakami, Masanao; Matsuzaki, Shigenobu; Naganuma, Seiji; Kuroda, Naoki; Seki, Yasutaka; Katano, Harutaka; Sano, Shigetoshi; Daibata, Masanori
2016-09-01
Although Merkel cell polyomavirus (MCPyV) has the potential to cause Merkel cell carcinoma (MCC), it is also found in the normal skin of healthy individuals. However, the mechanism for transformation of MCPyV to an oncogenic form is unknown. To investigate the levels of MCPyV infection in the normal skin patients with MCC compared with those in a control cohort. We studied a total of six Japanese patients with cutaneous MCC. Sun-exposed and sun-unexposed skin swabs were obtained and analyzed for MCPyV loads using quantitative real-time polymerase chain reaction. At first, we found a patient with MCC carrying an extremely high load of MCPyV DNA in normal skin. This unique case prompted us to further explore the levels of MCPyV as skin microbiota in patients with MCC. We showed that MCPyV DNA levels were significantly higher in swabs obtained from normal skin samples of six patients with MCC compared with those from 30 age-matched healthy individuals and 19 patients with other cutaneous cancers. Whereas MCPyV strains obtained from the normal skin of patients with MCC had gene sequences without structural alterations, sequences of the tumor-derived strains showed truncating mutations or deletions. Although the number of patients with MCC studied was small, our findings suggest that MCC may occur with a background of high MCPyV load in the skin, and are expected to stimulate further studies on whether such skin virome levels could be one of predictive markers for the development of MCC. Copyright © 2016 Elsevier B.V. All rights reserved.
Confocal laser-scanning microscopy of capillaries in normal and psoriatic skin
Archid, Rami; Patzelt, Alexa; Lange-Asschenfeldt, Bernhard; Ahmad, Sufian S.; Ulrich, Martina; Stockfleth, Eggert; Philipp, Sandra; Sterry, Wolfram; Lademann, Juergen
2012-10-01
An important and most likely active role in the pathogenesis of psoriasis has been attributed to changes in cutaneous blood vessels. The purpose of this study was to use confocal laser-scanning microscopy (CLSM) to investigate dermal capillaries in psoriatic and normal skin. The structures of the capillary loops in 5 healthy participants were compared with those in affected skin of 13 psoriasis patients. The diameters of the capillaries and papillae were measured for each group with CLSM. All investigated psoriasis patients showed elongated, widened, and tortuous microvessels in the papillary dermis, whereas all healthy controls showed a single capillary loop in each dermal papilla. The capillaries of the papillary loop and the dermal papilla were significantly enlarged in the psoriatic skin lesions (diameters 24.39±2.34 and 146.46±28.52 μm, respectively) in comparison to healthy skin (diameters 9.53±1.8 and 69.48±17.16 μm, respectively) (P<0.001). CLSM appears to represent a promising noninvasive technique for evaluating dermal capillaries in patients with psoriasis. The diameter of the vessels could be seen as a well-quantifiable indicator for the state of psoriatic skin. CLSM could be useful for therapeutic monitoring to delay possible recurrences.
Hayashi, M; Okamura, K; Araki, Y; Suzuki, M; Tanaka, T; Abe, Y; Nakano, S; Yoshizawa, J; Hozumi, Y; Inoie, M; Suzuki, T
2018-05-01
Acquired skin hypopigmentation has many etiologies, including autoimmune melanocyte destruction, skin aging, inflammation, and chemical exposure. Distinguishing lesions from normally pigmented skin is clinically important to precisely assess disease severity. However, no gold standard assessment method has been reported. We aimed to investigate whether spectrophotometers are useful for assessing vitiligo and rhododendrol (4-(4-hydroxyphenol)-2-butanol) (Rhododenol ® )-induced leukoderma disease severity by quantifying skin color. Mexameter ® MX18 and CM-700d spectrophotometer were used for assessing vitiligo/leukoderma by measuring melanin index, L*a*b* color space, and ΔE*ab value, which represents the color difference between two subjects and is calculated by the values of L*a*b*. MX18 and CM-700d can quantitatively distinguish vitiligo/leukoderma from normally pigmented skin based on melanin index. CM-700d consistently quantified the color of vitiligo/leukoderma lesions and surrounding normally pigmented skin in L*a*b* color spaces and ΔE*ab. ΔE*ab is well correlated with melanin index and clinical appearance. ΔE*ab has been frequently used in aesthetic dentistry; however, current study is the first to use it in the measurement of skin color. ΔE*ab seems to be a useful parameter to evaluate the color contrast between vitiligo/leukoderma and surrounding normally pigmented skin and can be used to evaluate disease severity and patient's quality of life. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Hyperelastic Material Properties of Mouse Skin under Compression.
Directory of Open Access Journals (Sweden)
Yuxiang Wang
Full Text Available The skin is a dynamic organ whose complex material properties are capable of withstanding continuous mechanical stress while accommodating insults and organism growth. Moreover, synchronized hair cycles, comprising waves of hair growth, regression and rest, are accompanied by dramatic fluctuations in skin thickness in mice. Whether such structural changes alter skin mechanics is unknown. Mouse models are extensively used to study skin biology and pathophysiology, including aging, UV-induced skin damage and somatosensory signaling. As the skin serves a pivotal role in the transfer function from sensory stimuli to neuronal signaling, we sought to define the mechanical properties of mouse skin over a range of normal physiological states. Skin thickness, stiffness and modulus were quantitatively surveyed in adult, female mice (Mus musculus. These measures were analyzed under uniaxial compression, which is relevant for touch reception and compression injuries, rather than tension, which is typically used to analyze skin mechanics. Compression tests were performed with 105 full-thickness, freshly isolated specimens from the hairy skin of the hind limb. Physiological variables included body weight, hair-cycle stage, maturity level, skin site and individual animal differences. Skin thickness and stiffness were dominated by hair-cycle stage at young (6-10 weeks and intermediate (13-19 weeks adult ages but by body weight in mature mice (26-34 weeks. Interestingly, stiffness varied inversely with thickness so that hyperelastic modulus was consistent across hair-cycle stages and body weights. By contrast, the mechanics of hairy skin differs markedly with anatomical location. In particular, skin containing fascial structures such as nerves and blood vessels showed significantly greater modulus than adjacent sites. Collectively, this systematic survey indicates that, although its structure changes dramatically throughout adult life, mouse skin at a given
International Nuclear Information System (INIS)
Supe, S.S.; Deka, A.C.; Deka, B.C.; Sathiyanaranyanan, V.K.
1991-01-01
In radiotherapy treatment planning we come across many situations when treatment is given by using two adjacent fields, for e.g. for treatment of Hodgkin's disease. A pair of adjacent field have been used regularly for the treatment of ovarian tumours. A small separation is given at the skin level, otherwise hot spots are observed at the depth of interest. The separation depend upon tumour depths, and source to skin distance (SSD). Formulae have been derived for the separation as well as for hot and cold spots. The case of adjacent field becomes more complicated when anterior as well as posterior adjacent fields are used. It is not completely possible to avoid the hot and cold spots in such cases. This is partially avoided by shifting the gap on the skin surface during the course of treatment. (author). 2 refs., 2 tabs
Short, Michael A.; Lui, Harvey; McLean, David I.; Zeng, Haishan; Alajlan, Abdulmajeed; Chen, Michael X.
2005-04-01
A less invasive method of reliably detecting skin cancers is required. Raman spectroscopy is just one of several spectroscopic methods that look promising, but are not yet sufficiently reliable. More information is needed on how and why the Raman spectra of cancerous skin tissue is different from its normal counterpart. We have used confocal micro-Raman spectroscopy with a spatial resolution of about a micron to obtain spectra of unstained thin sections of human skin. We found that there were clear differences in the Raman spectra between cancerous and non-cancerous tissue both in cells and in the connective tissue. The DNA contribution to the spectra was generally stronger in malignant cells than normal ones. In regions of the dermis far away from the tumor one obtains the usual collagen spectra of normal skin, but adjacent to the tumor the spectra no longer appeared to be those of native collagen.
International Nuclear Information System (INIS)
Henry, R.E.; Malone, J.M.; Daly, M.J.; Hughes, J.H.; Moore, W.S.
1982-01-01
Quantitation of skin perfusion provides objective criteria to determine the optimal amputation level in ischemic limb disease, to assess the maturation of pedicle flaps in reconstructive surgery, and to select appropriate treatment for chronic skin ulcers. A technique for measurement of skin perfusion using intradermal (ID) Xe-133 and a gamma camera/minicomputer system was previously reported. An update of this procedure is now reported, the normal range for the lower extremity in men, observations on the effects of ambient temperature, and an experience using the procedure to determine amputation level
Influence of water and salt solutions on UVB irradiation of normal skin and psoriasis
International Nuclear Information System (INIS)
Boer, J.; Schothorst, A.A.; Boom, B.; Suurmond, D.; Hermans, J.
1982-01-01
The influence of tap-water (TW) and salt solutions on the minimal erythema dose (MED) was investigated for normal human skin and uninvolved skin of psoriasis patients. MED (UVB) determinations on the forearm revealed that: (1) the MED definitely decreases whenever the arm is immersed in TW or NaCl solutions with a low concentration (4%) prior to UVB exposure, whereas almost saturated NaCl solution (26%), as well as locum Dead Sea water (LDSW), do not produce a change in the MED, and (2) the decrease in MED obtained by wetting the skin with TW was no longer present when the skin was allowed to dry for 20 min. A decrease in water uptake by skin (in vivo) and by callus (in vitro) was found as the salt concentration of the external solution increased. It is proposed that water taken up by the skin plays an important role in the sensitivity of the skin to UVB exposure. Bathing in TW or 4% NaCl prior to UVB exposure offered a slight to moderate improvement in psoriasis over UVB irradiation alone. Finally, it was shown that there is no obvious difference in clearance of the psoriatic skin between a bath in TW, 4% NaCl, or LDSW prior to UVB exposure. (orig.)
Mast cells are dispensable for normal and activin-promoted wound healing and skin carcinogenesis.
Antsiferova, Maria; Martin, Caroline; Huber, Marcel; Feyerabend, Thorsten B; Förster, Anja; Hartmann, Karin; Rodewald, Hans-Reimer; Hohl, Daniel; Werner, Sabine
2013-12-15
The growth and differentiation factor activin A is a key regulator of tissue repair, inflammation, fibrosis, and tumorigenesis. However, the cellular targets, which mediate the different activin functions, are still largely unknown. In this study, we show that activin increases the number of mature mast cells in mouse skin in vivo. To determine the relevance of this finding for wound healing and skin carcinogenesis, we mated activin transgenic mice with CreMaster mice, which are characterized by Cre recombinase-mediated mast cell eradication. Using single- and double-mutant mice, we show that loss of mast cells neither affected the stimulatory effect of overexpressed activin on granulation tissue formation and reepithelialization of skin wounds nor its protumorigenic activity in a model of chemically induced skin carcinogenesis. Furthermore, mast cell deficiency did not alter wounding-induced inflammation and new tissue formation or chemically induced angiogenesis and tumorigenesis in mice with normal activin levels. These findings reveal that mast cells are not major targets of activin during wound healing and skin cancer development and also argue against nonredundant functions of mast cells in wound healing and skin carcinogenesis in general.
Characterization of oily mature skin by biophysical and skin imaging techniques.
de Melo, M O; Maia Campos, P M B G
2018-02-13
The skin is a complex biological system and may suffer change according to the environmental factors, as higher temperatures can increase sebum excretion, presenting oiliness and acne. These alterations can persist during the aging and provoke more changes in aged skin. In this study we evaluated the mature oily skin characteristics using biophysical and skin imaging techniques. Sixty healthy female subjects, aged between 39 and 55 years old were recruited and separated into 2 groups according to their skin type: normal/dry and oily skin. The skin was evaluated in terms of stratum corneum water content, transepidermal water loss (TEWL) sebum content, dermis thickness and echogenicity, skin microrelief, and pores content. The mature oily skin presented no significant differences when compared to the normal/dry skin on the stratum corneum water content and TEWL parameters. The sebum content was significantly higher on the oily skin group. The microrelief analysis showed an increase of skin roughness values in the oily skin and increase of scaliness in the normal/dry skin. The oily skin showed lower dermis echogenicity mainly in the frontal region and higher dermis thickness when compared to normal/dry skin. The mature oily skin showed different characteristics from normal/dry skin in terms of sebum content, microrelief parameters, and dermis thickness. This way, the characterization of mature oily skin in an objective way is very important to development of dermocosmetic products for more effective treatments focused specially on this type of skin. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Draelos, Zoe D
2006-07-01
Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.
Directory of Open Access Journals (Sweden)
Abbas Rasi
2014-01-01
Full Text Available Background: For many years the association of skin tags and endocrynopathies has been postulated, although many reports are available but it has never been evaluated to mean normal population. Dyslipidemia is a frequent disorder among people and seemed to be necessary for screening within skin tag condition. This study is designed to find any possible association between skin tags and dyslipidemia. Materials and Methods: From April 2009 to June 2011, 168 patients enrolled the study. Among the remaining 152 patients, there were 89 females (58.5% and 63 males (%41.5. Based on the TLGS study 136 men and 220 women enrolled the control group of study. The mean age was 28.4 years. Patients trained to have normal free diet for at least 1 month then referred to the laboratory. Blood samples were taken over 12 hours fasting with 2 hours intervals. Hypertriglyceridemia was defined as plasma level ≥160 mg/dl for men and ≥130 mg/dl for women. Hypercholesterolemia pointed at its value >200 mg/dl. Normal HDL levels was defined as >39 mg/dl for men and >35 mg/dl to women. Results: Mean skin tag number was 12.6 per subject. The most frequent localizations of skin tags were neck and upper chest (mean number: 13.4, 48.9% followed by axilla (mean number: 11.6, 33% and breast (10.2, 10.1% in the patient group. The mean cholesterol level of case group was 192.2 ± 33.1 mg/dl, while it was 187.0 ± 42 mg/dl in the control group. The mean ± SD for triglyceride was 132.1 ± 69 mg/dl in comparison to 129 ± 74 in the control group. Conclusion: The study showed no significant differences between normal population and patients′ lipid profile.
Li, Yuanying; Wang, Yu; Zhang, Wei; Jiang, Leiwei; Zhou, Wenming; Liu, Zhi; Li, Shijun; Lu, Hongguang
2018-02-28
Seborrhoeic keratosis is an age-related skin disease. Amyloid precursor protein (APP) plays an important role in the pathogenesis of age-related Alzheimer's disease. The aim of this study was to elucidate the expression characteristics of APP in seborrhoeic keratosis tissues (n = 50), and explore whether the production of APP is related to the onset of seborrhoeic keratosis and skin ageing, including ultraviolet (UV)-induced ageing, as observed in normal skin (n = 79). The results of immunohistochemistry, Western blotting and quantitative real-time PCR showed that APP and its downstream products (i.e. amyloid-β42) were more highly expressed in seborrhoeic keratosis than in paired adjacent normal skin tissues. In contrast, the expression of its key secretase (i.e. β-secretase1) was generally low. Furthermore, APP expression was higher in UV-exposed than non-exposed skin sites, and expression in the older age group (61-85 years) was greater than that in the younger age group (41-60 years) in seborrhoeic keratosis tissues (pkeratosis and is a marker of skin ageing and UV damage. Further research will elucidate whether therapeutic mitigation of increased levels of APP in the skin might delay the onset of seborrhoeic keratosis and skin ageing.
Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.
Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R
1991-12-01
The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.
International Nuclear Information System (INIS)
Hannan, M.A.; Smith, B.P.; Sigut, D.; Sackey, K.
1990-01-01
Fibroblast cells derived from a cafe-au-lait spot and normal-appearing skin of a neurofibromatosis (NF-6) patient were studied for radiosensitivity in comparison with two normal cell lines used as controls. No difference in radiosensitivity was observed between the patient's cell lines and the controls using acute gamma-irradiation. However, a markedly increased radiosensitivity of the fibroblasts obtained from the patient's skin of normal appearance was demonstrated after chronic gamma-irradiation. The cells from the cafe-au-lait spot showed intermediate sensitivity to chronic irradiation as compared with the control cell lines and the fibroblasts derived from the normal skin of the patient. These results showed the usefulness of chronic irradiation in detecting increased cellular radiosensitivity which may result from a unique DNA repair defect in an NF patient. We suggest that enhanced genetic changes in radiosensitive NF patients may lead to formation of cafe-au-lait lesions and certain tumors. Such a transformation may be associated with production of radiotolerant cells
Skin blood flow from gas transport: helium xenon and laser Doppler compared
Energy Technology Data Exchange (ETDEWEB)
Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.
1988-03-01
A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics.
Skin blood flow from gas transport: helium xenon and laser Doppler compared
International Nuclear Information System (INIS)
Neufeld, G.R.; Galante, S.R.; Whang, J.M.; DeVries, D.; Baumgardner, J.E.; Graves, D.J.; Quinn, J.A.
1988-01-01
A study was designed to compare three independent measures of cutaneous blood flow in normal healthy volunteers: xenon-133 washout, helium flux, and laser velocimetry. All measurements were confined to the volar aspect of the forearm. In a large group of subjects we found that helium flux through intact skin changes nonlinearly with the controlled local skin temperature whereas helium flux through stripped skin, which is directly proportional to skin blood flow, changes linearly with cutaneous temperature over the range 33 degrees to 42 degrees. In a second group of six volunteers we compared helium flux through stripped skin to xenon-133 washout (intact skin) at a skin temperature of 33 degrees, and we found an essentially linear relationship between helium flux and xenon measured blood flow. In a third group of subjects we compared helium flux blood flow (stripped skin) to laser doppler velocimetric (LDV) measurements (intact skin) at adjacent skin sites and found a nonlinear increase in the LDV skin blood flow compared to that determined by helium over the same temperature range. A possible explanation for the nonlinear increases of helium flux through intact skin and of LDV output with increasing local skin temperature is that they reflect more than a change in blood flow. They may also reflect physical changes in the stratum corneum, which alters its diffusional resistance to gas flux and its optical characteristics
Characterization of Ninjurin and TSC22 induction after X-irradiation of normal human skin cells
International Nuclear Information System (INIS)
Koike, Manabu; Ninomiya, Yasuharu; Koike, Aki
2008-01-01
The skin is an external organ that is most frequently exposed to radiation. It is important to elucidate the influence of radiation exposure on the skin at the molecular level. To identify radiation-responsive genes in human skin cells, we used microarray technology to examine the effects of irradiation on 641 genes in normal human epidermal keratinocytes at 4 h and 8 h postirradiation with a cytotoxic dose of X-ray (10 Gy). We found that 18 genes were upregulated and 35 genes were downregulated in keratinocytes at 4 h and/or 8 h postirradiation. Ninjurin, whose function remains unknown in keratinocytes, was induced most strongly by X-irradiation. Several known apoptosis-related genes, such as TSC22, were also upregulated. We characterized Ninjurin and TSC22 induction after X-irradiation of normal human skin cells. The induction of the expression of Ninjurin and TSC22 mRNA in keratinocytes following high-dose X-irradiation was confirmed by northern blot analysis. In dermal fibroblasts, Ninjurin, but not TSC22, was induced after X-ray irradiation. The dependence of both gene expression on the status of an apoptosis regulator, p53, was found. In addition, the expression of both mRNA was induced upon treatment with an apoptosis inducer, etoposide. On the other hand, TSC22, but not Ninjurin, was induced and accumulated in keratinocytes upon treatment with an apoptosis inducer, anisomycin. However, in transient expression assay, EYFP-TSC22, as well as EYFP-Ninjurin or EYFP alone, did not induce apoptosis in keratinocytes in contrast to EYFP-GADD45. Taken together, these findings have important implications on the understanding of the mechanism underlying the complex response of skin cells following X-irradiation. (author)
International Nuclear Information System (INIS)
Soares, Julio C.A.C.R.; Canellas, Catarine G.L.; Lopes, Ricardo T.; Anjos, Marcelino J.
2011-01-01
In this work, the concentrations of trace elements were measured in acrochordon, a skin lesion also known as skin tag or fibroepithelial polyp, as well as in normal skin from the same patient. The samples were analysed by Synchrotron Radiation Total Reflection X- ray Fluorescence (SRTXRF) in the Synchrotron Light National Laboratory (LNLS) in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, has involved 17 patients. It was evaluated the presence of P, S, Cl, K, Ca, Cr, Mn, Fe, Cu, Zn, Br and Rb in the paired samples, which were compared, and significant differences were found in some of them. (author)
Institute of Scientific and Technical Information of China (English)
GUO Huarong; HUANG Bing; QI Fei; ZHANG Shicui
2007-01-01
The distribution and ultrastructure of pigment cells in skins of normal and albino adult turbots were examined with transmission electron microscopy (TEM). Three types of pigment cells of melanophore, iridophore and xanthophore have been recognized in adult turbot skins. The skin color depends mainly on the amount and distribution of melanophore and iridophore, as xanthophore is quite rare. No pigment cells can be found in the epidermis of the skins. In the pigmented ocular skin of the turbot, melanophore and iridophore are usually co-localized in the dermis. This is quite different from the distribution in larvae skin. In albino and white blind skins of adult turbots, however, only iridophore monolayer still exists, while the melanophore monolayer disappears. This cytological evidence explains why the albino adult turbot, unlike its larvae, could never resume its body color no matter what environmental and nutritional conditions were provided. Endocytosis is quite active in the cellular membrane of the iridophore. This might be related to the formation of reflective platelet and stability of the iridophore.
Zhao, Jianhua; Richer, Vincent; Al Jasser, Mohammed; Zandi, Soodabeh; Kollias, Nikiforos; Kalia, Sunil; Zeng, Haishan; Lui, Harvey
2016-02-01
Fluorescence signals depend on the intensity of the exciting light, the absorption properties of the constituent molecules, and the efficiency with which the absorbed photons are converted to fluorescence emission. The optical features and appearance of vitiligo have been explained primarily on the basis of reduced epidermal pigmentation, which results in abnormal white patches on the skin. The objective of this study is to explore the fluorescence properties of vitiligo and its adjacent normal skin using fluorescence excitation-emission matrix (EEM) spectroscopy. Thirty five (35) volunteers with vitiligo were acquired using a double-grating spectrofluorometer with excitation and emission wavelengths of 260-450 nm and 300-700 nm respectively. As expected, the most pronounced difference between the spectra obtained from vitiligo lesions compared to normally pigmented skin was that the overall fluorescence was much higher in vitiligo; these differences increased at shorter wavelengths, thus matching the characteristic spectral absorption of epidermal melanin. When comparing the fluorescence spectra from vitiligo to normal skin we detected three distinct spectral bands centered at 280nm, 310nm, and 335nm. The 280nm band may possibly be related to inflammation, whereas the 335 nm band may arise from collagen or keratin cross links. The source of the 310 nm band is uncertain; it is interesting to note its proximity to the 311 nm UV lamps used for vitiligo phototherapy. These differences are accounted for not only by changes in epidermal pigment content, but also by other optically active cutaneous biomolecules.
DEFF Research Database (Denmark)
Westergaard, Majken; Henningsen, Jeanette; Johansen, Claus
2003-01-01
Abnormal epidermal proliferation and differentiation characterize the inflammatory skin disease psoriasis. Here we demonstrate that expression of PPARdelta mRNA and protein is markedly upregulated in psoriatic lesions and that lipoxygenase products accumulating in psoriatic lesions are potent...... activators of PPARdelta. The expression levels of NF-kappaB p50 and p65 were not significantly altered in lesional compared with nonlesional psoriatic skin. In the basal layer of normal epidermis both p50 and p65 were sequestered in the cytoplasm, whereas p50, but not p65, localized to nuclei...... in the suprabasal layers, and this distribution was maintained in lesional psoriatic skin. In normal human keratinocytes PPAR agonists neither impaired IL-1beta-induced translocation of p65 nor IL-1beta-induced NF-kappaB DNA binding. We show that PPARdelta physically interacts with the N-terminal Rel homology...
Normal tissue tolerance to external beam radiation therapy: Skin
International Nuclear Information System (INIS)
Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A.
2010-01-01
Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)
Moinfar, Farid; Beham, Alfred; Friedrich, Gerhard; Deutsch, Alexander; Hrzenjak, Andelko; Luschin, Gero; Tavassoli, Fattaneh A
2008-05-01
Genetic abnormalities in microenvironmental tissues with subsequent alterations of reciprocal interactions between epithelial and mesenchymal cells play a key role in the breast carcinogenesis. Although a few reports have demonstrated abnormal fibroblastic functions in normal-appearing fibroblasts taken from the skins of breast cancer patients, the genetic basis of this phenomenon and its implication for carcinogenesis are unexplored. We analyzed 12 mastectomy specimens showing invasive ductal carcinomas. In each case, morphologically normal epidermis and dermis, carcinoma, normal stroma close to carcinoma, and stroma at a distant from carcinoma were microdissected. Metastatic-free lymphatic tissues from lymph nodes served as a control. Using PCR, DNA extracts were examined with 11 microsatellite markers known for a high frequency of allelic imbalances in breast cancer. Losses of heterozygosity and/or microsatellite instability were detected in 83% of the skin samples occurring either concurrently with or independently from the cancerous tissues. In 80% of these cases at least one microsatellite marker displayed loss of heterozygosity or microsatellite instability in the skin, which was absent in carcinoma. A total of 41% of samples showed alterations of certain loci observed exclusively in the carcinoma but not in the skin compartments. Our study suggests that breast cancer is not just a localized genetic disorder, but rather part of a larger field of genetic alterations/instabilities affecting multiple cell populations in the organ with various cellular elements, ultimately contributing to the manifestation of the more 'localized' carcinoma. These data indicate that more global assessment of tumor micro- and macro-environment is crucial for our understanding of breast carcinogenesis.
Defective channels lead to an impaired skin barrier.
Blaydon, Diana C; Kelsell, David P
2014-10-15
Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.
DEFF Research Database (Denmark)
Damsgaard, T E; Olesen, A B; Sørensen, Flemming Brandt
1997-01-01
Stereological quantification of mast cell numbers was applied to sections of punch biopsies from lesional and nonlesional skin of atopic dermatitis patients and skin of healthy volunteers. We also investigated whether the method of staining and/or the fixative influenced the results...... of the determination of the mast cell profile numbers. The punch biopsies were taken from the same four locations in both atopic dermatitis patients and normal individuals. The locations were the scalp, neck and flexure of the elbow (lesional skin), and nates (nonlesional skin). Clinical scoring was carried out...... at the site of each biopsy. After fixation and plastic embedding, the biopsies were cut into 2 microns serial sections. Ten sections, 30 microns apart, from each biopsy were examined and stained alternately with either toluidine blue or Giemsa stain and mast cell profile numbers were determined. The study...
Xiong, S. Y.; Yang, J. G.; Zhuang, J.
2011-10-01
In this work, we use nonlinear spectral imaging based on two-photon excited fluorescence (TPEF) and second harmonic generation (SHG) for analyzing the morphology of collagen and elastin and their biochemical variations in basal cell carcinoma (BCC), squamous cell carcinoma (SCC) and normal skin tissue. It was found in this work that there existed apparent differences among BCC, SCC and normal skin in terms of their thickness of the keratin and epithelial layers, their size of elastic fibers, as well as their distribution and spectral characteristics of collagen. These differences can potentially be used to distinguish BCC and SCC from normal skin, and to discriminate between BCC and SCC, as well as to evaluate treatment responses.
Reduced FOXO1 expression accelerates skin wound healing and attenuates scarring.
Mori, Ryoichi; Tanaka, Katsuya; de Kerckhove, Maiko; Okamoto, Momoko; Kashiyama, Kazuya; Tanaka, Katsumi; Kim, Sangeun; Kawata, Takuya; Komatsu, Toshimitsu; Park, Seongjoon; Ikematsu, Kazuya; Hirano, Akiyoshi; Martin, Paul; Shimokawa, Isao
2014-09-01
The forkhead box O (FOXO) family has been extensively investigated in aging and metabolism, but its role in tissue-repair processes remains largely unknown. Herein, we clarify the molecular aspect of the FOXO family in skin wound healing. We demonstrated that Foxo1 and Foxo3a were both up-regulated during murine skin wound healing. Partial knockout of Foxo1 in Foxo1(+/-) mice throughout the body led to accelerated skin wound healing with enhanced keratinocyte migration, reduced granulation tissue formation, and decreased collagen density, accompanied by an attenuated inflammatory response, but we observed no wound phenotype in Foxo3a(-/-) mice. Fibroblast growth factor 2, adiponectin, and notch1 genes were significantly increased at wound sites in Foxo1(+/-) mice, along with markedly altered extracellular signal-regulated kinase 1/2 and AKT phosphorylation. Similarly, transient knockdown of Foxo1 at the wound site by local delivery of antisense oligodeoxynucleotides enhanced skin wound healing. The link between FOXO1 and scarring extends to patients, in particular keloid scars, where we see FOXO1 expression markedly increased in fibroblasts and inflammatory cells within the otherwise normal dermis. This occurs in the immediate vicinity of the keloid by comparison to the center of the mature keloid, indicating that FOXO1 is associated with the overgrowth of this fibrotic response into adjacent normal skin. Overall, our data indicate that molecular targeting of FOXO1 may improve the quality of healing and reduce pathological scarring. Copyright © 2014 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Incorporation of 14C-linoleic acid in lipids of normal and psoriatic human skin
International Nuclear Information System (INIS)
Ruestow, B.; Metz, D.; Kunze, D.; Meffert, H.
1980-01-01
The 14 C-linoleic acid incorporation in lipids of surviving epidermis and corium of normal and psoriatic human skin was investigated. Changes of lipid metabolism were found in both epidermis and corium. Particularly the turnover of phospholipids was increased in the uninvolved psoriatic epidermis in relation to the involved psoriatic epidermis or to healthy controls. Possible reasons of these phenomena and the significance of structural lipids in psoriasis are discussed. (author)
International Nuclear Information System (INIS)
Liu Xudong; Zeng Bingfang; Fan Cunyi; Jiang Peizhu; Hu Xiao
2006-01-01
To find the properties in the oscillatory components of the cutaneous blood flow on the successful free flap, a wavelet transform was applied to the laser Doppler flowmetry (LDF) signals which were measured simultaneously on the surfaces of the free latissimus dorsi myocutaneous flap and on the adjacent intact skin of the healthy limb, of 18 patients. The frequency interval from 0.0095 to 1.6 Hz was examined and was divided into five subintervals (I: 0.0095-0.021 Hz; II: 0.021-0.052 Hz; III: 0.052-0.145 Hz; IV: 0.145-0.6 Hz and V: 0.6-1.6 Hz) corresponding to endothelial metabolic, neurogenic, myogenic, respiratory and cardiac origins. The average amplitude and total power in the frequency range 0.0095-1.6 Hz as well as within subintervals I, II, IV and V were significantly lower for signals measured on the free flap than those obtained in the healthy limb. However in interval III, they were significantly higher. The normalized spectral amplitude and power in the free flap were significantly lower in only two intervals, I and II, yet in interval III they were significantly higher; no statistical significance was observed in intervals IV and V. The distinctive finding made in this study, aside from the decrease of endothelial metabolic processes and sympathetic control, was the significant increase of myogenic activity in the free flap. It is hoped that this work will contribute towards knowledge on blood circulation in free flaps and make the monitoring by LDF more reliable
Experiment K-7-29: Connective Tissue Studies. Part 1; Rat Skin, Normal and Repair
Vailas, A. C.; Grindeland, R.; Ashman, R.; Choy, V.; Durnova, G.; Graf, B.; Griffith, P.; Kaplansky, A. S.; Kolis, S.; Martinez, D.;
1994-01-01
The skin repair studies started to be problematic for the following reasons: (1) It was very difficult to locate the wound and many lesions were not of the same dimensions. A considerable amount of time was devoted to the identification of the wound using polarized light. We understand that this experiment was added on to the overall project. Marking of the wound site and standard dimensions should be recommended for the next flight experiment. (2) The tissue was frozen, therefore thawing and fixation caused problems with some of the immunocytochemical staining for obtaining better special resolution with light microscopy image processing. Despite these problems, we were unable to detect any significant qualitative differences for the following wound markers: (1) Collagen Type 3, (2) Hematotoxylin and Eosin, and (3) Macrophage Factor 13. All protein markers were isolated from rat sources and antibodies prepared and tested for cross reactivity with other molecules at the University of Wisconsin Hybridoma Facility. However, rat skin from the non lesioned site 'normal' showed interesting biochemical results. Skin was prepared for the following measurements: (1) DNA content, (2) Collagen content by hydroxyproline, and (3) uronic acid content and estimation of ground substance. The results indicated there was a non-significant increase (10%) in the DNA concentration of skin from flight animals. However, the data expressed as a ratio DNA/Collagen estimates the cell or nuclear density that supports a given quantity of collagen showed a dramatic increase in the flight group (33%). This means flight conditions may have slowed down collagen secretion and/or increased cell proliferation in adult rat skin. Further biochemical tests are being done to determine the crosslinking of elastin which will enhance the insight to assessing changes in skin turnover.
Anti-oxidant defence mechanism in vitiliginous skin increases with skin type
Briganti, S.; Caron-Schreinemachers, A.-L. D. B.; Picardo, M.; Westerhof, W.
2012-01-01
Background Vitiligo skin shows different burning capacity in people with different phototype. In normal skin antioxidant status is correlated to skin phototype, but unexpectedly it appears that there is a gradual decrease in burning susceptibility of depigmented skin of individuals with increasing
Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y
2010-01-01
Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.
International Nuclear Information System (INIS)
Keyse, S.M.; Moss, S.H.; Davies, D.J.G.
1983-01-01
Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)
Survival of human diploid skin fibroblasts from normal individuals after X-irradiation
International Nuclear Information System (INIS)
Little, J.B.; Nove, J.; Strong, L.C.; Nichols, W.W.
1988-01-01
The cytotoxic effect of X-rays was measured by a colony formation assay in multiple experiments with fibroblast cell strains derived from 24 presumably normal individuals, received as 65 different coded and blinded samples. Each strain was received on two or more occasions at different times and bearing different codes. The means and standard deviations of the survival curve parameters for the 24 strains were: D 0 = 123 +- 23; D 10 = 273 +- 42 cGy. The D 0 ranged from 89 to 175 and the D 10 from 196 to 372 cGy. The degree of interexperimental variation, though generally minimal, differed considerably among cell strains. There was no systematic effect of passage level, cloning efficiency, serum lot, age or sex of the donor on X-ray survival. These results confirm that the intrinsic radiosensitivity varies significantly among skin fibroblasts isolated from clinically normal individuals, apparently owing to as yet unidentified genetic factors. (Author)
International Nuclear Information System (INIS)
Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan
1995-01-01
Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when
Direct immunofluorescence of normal skin in rheumatoid arthritis.
Fitzgerald, O M; Barnes, L; Woods, R; McHugh, L; Barry, C; O'Loughlin, S
1985-11-01
The clinical significance of previously described immunoglobulin and complement deposition in the superficial dermal vessel walls of patients with rheumatoid arthritis is unknown. In the present study, skin biopsies were obtained from the normal forearm and buttock of 48 unselected patients with rheumatoid arthritis and were examined by direct immunofluorescence (IF) for the presence of immunoglobulin (IgG,A,M) and complement (C3) in the vessel walls. Deposits of C3, IgM or IgG were detected in 10 patients. Five patients had deposits at the forearm sample alone, four patients had deposits at both biopsy sites, while one patient was positive at the buttock alone. Clinical features were similar in patients with and without vessel IF. However, patients with IF were significantly more seropositive with lower levels of complement and raised levels of serum IgA and IgM. There was also an increased level of circulating IgG immune complexes in these patients. Further analysis following exclusion of seronegative patients revealed similar results. This study suggests that the presence of vessel IF identifies a subgroup of patients who have evidence of more severe immunological disturbance.
Shimizu, Ruka; Kishi, Kazuo
2012-01-01
Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...
Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...
Kaya, Zehra; Akkiprik, Mustafa; Karabulut, Sevgi; Peker, Irem; Gullu Amuran, Gokce; Ozmen, Tolga; Gulluoglu, Bahadır M; Kaya, Handan; Ozer, Ayse
2017-09-01
Both insulin-like growth factor-binding protein 7 (IGFBP7) and telomere length (TL) are associated with proliferation and senescence of human breast cancer. This study assessed the clinical significance of both TL and IGFBP7 methylation status in breast cancer tissues compared with adjacent normal tissues. We also investigated whether IGFBP7 methylation status could be affecting TL. Telomere length was measured by quantitative PCR to compare tumors with their adjacent normal tissues. The IGFBP7 promoter methylation status was evaluated by methylation-specific PCR and its expression levels were determined by western blotting. Telomeres were shorter in tumor tissues compared to controls (Pbreast cancer with invasive ductal carcinoma (IDC; n=72; P=.014) compared with other histological type (n=29), and TL in IDC with HER2 negative (n=53; P=.017) was higher than TL in IDC with HER2 positive (n=19). However, telomeres were shortened in advanced stages and growing tumors. IGFBP7 methylation was observed in 90% of tumor tissues and 59% of controls (P=.0002). Its frequency was significantly higher in IDC compared with invasive mixed carcinoma (IMC; P=.002) and it was not correlated either with protein expression or the other clinicopathological parameters. These results suggest that IGFBP7 promoter methylation and shorter TL in tumor compared with adjacent tissues may be predictive biomarkers for breast cancer. Telomere maintenance may be indicative of IDC and IDC with HER2 (-) of breast cancer. Further studies with larger number of cases are necessary to verify this association. © 2016 Wiley Periodicals, Inc.
Dainichi, Teruki; Amano, Satoshi; Matsunaga, Yukiko; Iriyama, Shunsuke; Hirao, Tetsuji; Hariya, Takeshi; Hibino, Toshihiko; Katagiri, Chika; Takahashi, Motoji; Ueda, Setsuko; Furue, Masutaka
2006-02-01
Chemical peeling with salicylic acid in polyethylene glycol vehicle (SA-PEG), which specifically acts on the stratum corneum, suppresses the development of skin tumors in UVB-irradiated hairless mice. To elucidate the mechanism through which chemical peeling with SA-PEG suppresses skin tumor development, the effects of chemical peeling on photodamaged keratinocytes and cornified envelopes (CEs) were evaluated in vivo. Among UVB-irradiated hairless mice, the structural atypia and expression of p53 protein in keratinocytes induced by UVB irradiation were intensely suppressed in the SA-PEG-treated mice 28 days after the start of weekly SA-PEG treatments when compared to that in the control UVB-irradiated mice. Incomplete expression of filaggrin and loricrin in keratinocytes from the control mice was also improved in keratinocytes from the SA-PEG-treated mice. In photo-exposed human facial skin, immature CEs were replaced with mature CEs 4 weeks after treatment with SA-PEG. Restoration of photodamaged stratum corneum by treatment with SA-PEG, which may affect remodeling of the structural environment of the keratinocytes, involved the normalization of keratinocyte differentiation and suppression of skin tumor development. These results suggest that the stratum corneum plays a protective role against carcinogenesis, and provide a novel strategy for the prevention of photo-induced skin tumors.
Energy Technology Data Exchange (ETDEWEB)
Wang, Wenjie [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China); Luo, Judong [Department of Radiotherapy, Changzhou Tumor Hospital, Soochow University, Changzhou (China); Sheng, Wenjiong; Xue, Jiao; Li, Ming [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Ji, Jiang [Department of Dermatology, the Second Affiliated Hospital of Soochow University, Suzhou (China); Liu, Pengfei [Department of Gastroenterology, the Affiliated Jiangyin Hospital of Southeast University, Jiangyin (China); Zhang, Xueguang [Institute of Medical Biotechnology and Jiangsu Stem Cell Key Laboratory, Medical College of Soochow University, Suzhou (China); Cao, Jianping [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Zhang, Shuyu, E-mail: zhang.shuyu@hotmail.com [School of Radiation Medicine and Protection and Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou (China); Cyrus Tang Hematology Center, Soochow University, Suzhou (China)
2016-06-01
Purpose: To investigate the molecular changes underlying the pathogenesis of radiation-induced skin fibrosis. Methods and Materials: Rat skin was irradiated to 30 or 45 Gy with an electron beam. Protein expression in fibrotic rat skin and adjacent normal tissues was quantified by label-free protein quantitation. Human skin cells HaCaT and WS-1 were treated by x-ray irradiation, and the proteasome activity was determined with a fluorescent probe. The effect of proteasome inhibitors on Transforming growth factor Beta (TGF-B) signaling was measured by Western blot and immunofluorescence. The efficacy of bortezomib in wound healing of rat skin was assessed by the skin injury scale. Results: We found that irradiation induced epidermal and dermal hyperplasia in rat and human skin. One hundred ninety-six preferentially expressed and 80 unique proteins in the irradiated fibrotic skin were identified. Through bioinformatic analysis, the ubiquitin-proteasome pathway showed a significant fold change and was investigated in greater detail. In vitro experiments demonstrated that irradiation resulted in a decline in the activity of the proteasome in human skin cells. The proteasome inhibitor bortezomib suppressed profibrotic TGF-β downstream signaling but not TGF-β secretion stimulated by irradiation in HaCaT and WS-1 cells. Moreover, bortezomib ameliorated radiation-induced skin injury and attenuated epidermal hyperplasia. Conclusion: Our findings illustrate the molecular changes during radiation-induced skin fibrosis and suggest that targeting the ubiquitin-proteasome system would be an effective countermeasure.
Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Lukasz R; Pomorski, Zbigniew J H
2011-04-01
The purpose of this study was to evaluate transepidermal water loss (TEWL), skin hydration and skin pH in normal cats. Twenty shorthaired European cats of both sexes were examined in the study. Measurements were taken from five different sites: the lumbar region, the axillary fossa, the inguinal region, the ventral abdominal region and the left thoracic region. In each of the regions, TEWL, skin hydration and skin pH were measured. The highest TEWL value was observed in the axillary fossa (18.22g/h/m(2)) and the lowest in the lumbar region (10.53g/h/m(2)). The highest skin hydration was found in the inguinal region (18.29CU) and the lowest in the lumbar region (4.62CU). The highest skin pH was observed in the inguinal region (6.64) and the lowest in the lumbar region (6.39). Statistically significant differences in TEWL were observed between the lumbar region and the left side of the thorax region (P=0.016), the axillary fossa (P=0.0004), the ventral region (P=0.005), and the inguinal region (P=0.009). There were significant differences in skin hydration between the lumbar region and the left thorax (P=0.000003), the axillary fossa (P=0.002), the ventral abdomen (P=0.03), and the inguinal region (P=0.0003) as well as between the thorax and the ventral abdomen (P=0.005). TEWL was higher in females (15g/h/m(2)) than in males (4.57g/h/m(2)). Skin hydration was higher in females (13.89CU) than in males (12.28CU). Significant differences were not found between males and females for TEWL and skin hydration. Skin pH was higher in males (6.94) than in females (6.54), which was significant (P=0.004). Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.
Fullerton, A; Serup, J
1997-02-01
To study whether anatomical location and age and gender of subjects had any influence on the objective skin colour measurements. Baseline colour in prone position was measured with the Minolta ChromaMeter® in the upper, middle and lower level of the upper back and on the forearm of 168 volunteers. These two sites are commonly used in skin testing. Higher basal a* and lower basal L* levels were found on the upper scapular region compared to the lower scapular region and the subscapular region. The basal b* level showed no variation relative to site. The basal a* and the basal b* levels were lower on the forearm compared to the upper back while the basal L* level was higher. Females above 65 years showed a less coloured skin with lower values as compared to those of younger age. Females were found to have a generally lower basal a* level than males both on the upper back and forearm skin. These relatively major differences and sources of variation have to be considered when planning irritancy studies where colour differences between erythema and normal skin is used.
Expression and activity of arginase isoenzymes during normal and diabetes-impaired skin repair.
Kämpfer, Heiko; Pfeilschifter, Josef; Frank, Stefan
2003-12-01
Within the past years, an important role for nitric oxide (NO) in skin repair has been well defined. As NO is synthesized from L-arginine by NO synthases (NOS), the availability of L-arginine might be one rate-limiting factor of NO production at the wound site. Upon injury, arginase-1 and -2 mRNA, protein, and activity were strongly induced reaching a maximum between day 3 and day 7 postwounding. Immunohistochemistry colocalized both arginases and the inducible NOS (iNOS) at epithelial sites at the margins of the wound. Notably, diabetes-impaired skin repair in leptin-deficient mice (diabetes/diabetes, db/db; and obese/obese, ob/ob) was characterized by an abnormally elevated arginase activity in wound tissue in the absence of an expression of iNOS. Expression analyses demonstrated that arginase-1 contributed to increased arginase activities in impaired repair. Interestingly, an improved healing of chronic wound situations in leptin-supplemented ob/ob mice was strongly associated with an adjustment of the dysregulated expression of L-arginine-converting enzymes: an attenuated iNOS expression was upregulated early in repair and an augmented arginase-1 expression and activity was downregulated in the presence of markedly elevated numbers of macrophages during late repair. These data suggest a coordinated consumption of L-arginine by the NOS and arginase enzymatic pathways at the wound site as a prerequisite for a balanced NO (via iNOS) and polyamine (via arginases) synthesis that drives a normal skin repair.
Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha
2015-06-25
Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.
Majdzadeh, Ali; Lee, Anthony M D; Wang, Hequn; Lui, Harvey; McLean, David I; Crawford, Richard I; Zloty, David; Zeng, Haishan
2015-05-01
Recent advances in biomedical optics have enabled dermal and epidermal components to be visualized at subcellular resolution and assessed noninvasively. Multiphoton microscopy (MPM) and reflectance confocal microscopy (RCM) are noninvasive imaging modalities that have demonstrated promising results in imaging skin micromorphology, and which provide complementary information regarding skin components. This study assesses whether combined MPM/RCM can visualize intracellular and extracellular melanin granules in the epidermis and dermis of normal human skin. We perform MPM and RCM imaging of in vivo and ex vivo skin in the infrared domain. The inherent three-dimensional optical sectioning capability of MPM/RCM is used to image high-contrast granular features across skin depths ranging from 50 to 90 μm. The optical images thus obtained were correlated with conventional histologic examination including melanin-specific staining of ex vivo specimens. MPM revealed highly fluorescent granular structures below the dermal-epidermal junction (DEJ) region. Histochemical staining also demonstrated melanin-containing granules that correlate well in size and location with the granular fluorescent structures observed in MPM. Furthermore, the MPM fluorescence excitation wavelength and RCM reflectance of cell culture-derived melanin were equivalent to those of the granules. This study suggests that MPM can noninvasively visualize and quantify subepidermal melanin in situ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Brock, W.A.; Wike, J.; Tucker, S.L.
1995-01-01
To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs
Acral peeling skin syndrome: report of two cases.
García, Elena García; Carreño, Rosario Granados; Martínez González, Miguel A; Reyes, José Jiménez
2005-01-01
Peeling skin syndrome is a rare dermatosis characterized by spontaneous and painless peeling of the skin. The authors report two patients with history of spontaneous, asymptomatic, and noninflammatory peeling skin of the acral surfaces after soaking in water. On light microscopy, blisters were located in the mid layers of the stratum corneum, above the granular layer. Ultrastructural examination revealed increased intercellular lipids and abnormal, "moth-eaten," keratohyalin granules, but the authors were unable to determine whether the separation initiated within the horny cells or between adjacent cells. These patients represented a localized variant of peeling skin syndrome.
Directory of Open Access Journals (Sweden)
Yan'an Wu
Full Text Available Colorectal cancer (CRC is one of the most commonly diagnosed cancers in the world. A genome-wide screening of transcriptome dysregulation between cancer and normal tissue would provide insight into the molecular basis of CRC initiation and progression. Compared with microarray technology, which is commonly used to identify transcriptional changes, the recently developed RNA-seq technique has the ability to detect other abnormal regulations in the cancer transcriptome, such as alternative splicing, novel transcripts or gene fusion. In this study, we performed high-throughput transcriptome sequencing at ~50× coverage on CRC, adjacent non-tumor and distant normal tissue. The results revealed cancer-specific, differentially expressed genes and differential alternative splicing, suggesting that the extracellular matrix and metabolic pathways are activated and the genes related to cell homeostasis are suppressed in CRC. In addition, one tumor-restricted gene fusion, PRTEN-NOTCH2, was also detected and experimentally confirmed. This study reveals some common features in tumor invasion and provides a comprehensive survey of the CRC transcriptome, which provides better insight into the complexity of regulatory changes during tumorigenesis.
International Nuclear Information System (INIS)
Selsky, C.A.
1978-01-01
The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylamino-fluorene-treated herpes simplex virus type 1 strain MP was studied in normal and xeroderma pigmentosum human skin fibroblasts. Virus treated with either agent demonstrated lower survival in XP cells from complementation groups A, B, C and D than in normal fibroblasts. The relative reactivation ability of XP cells from the different genetic complementation groups was found to be the same for both irradiated and chemically treated virus. In addition, the inactivation kinetics for virus treated with either agent in the XP variant were comparable to that seen in normal skin fibroblasts. The addition of 2 or 4 mmoles caffeine to the post-infection assay medium had no effect on the inactivation kinetics of virus treated by either agent in the XP variant or in XP cells from the different genetic complementation groups. Treatment of the virus with nitrogen mustard resulted in equivalent survival in normal and XP genetic complementation group D cells. No apparent defect was observed in the ability of XP heterozygous skin fibroblasts to repair virus damaged with up to 100 μg N-acetoxy-2-acetylaminofluorene per ml. These findings indicate that the repair of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus is accomplished by the same pathway or different pathways sharing a common intermediate step and that the excision defect of XP cells plays little if any role in the reactivation of nitrogen mustard treated virus. (Auth.)
... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...
Trujillo, Kristina A.; Heaphy, Christopher M.; Mai, Minh; Vargas, Keith M.; Jones, Anna C.; Vo, Phung; Butler, Kimberly S.; Joste, Nancy E.; Bisoffi, Marco; Griffith, Jeffrey K
2011-01-01
Previous studies have shown that a field of genetically altered but histologically normal tissue extends 1 cm or more from the margins of human breast tumors. The extent, composition and biological significance of this field are only partially understood, but the molecular alterations in affected cells could provide mechanisms for limitless replicative capacity, genomic instability and a microenvironment that supports tumor initiation and progression. We demonstrate by microarray, qRT-PCR and immunohistochemistry a signature of differential gene expression that discriminates between patient-matched, tumor-adjacent histologically normal breast tissues located 1 cm and 5 cm from the margins of breast adenocarcinomas (TAHN-1 and TAHN-5, respectively). The signature includes genes involved in extracellular matrix remodeling, wound healing, fibrosis and epithelial to mesenchymal transition (EMT). Myofibroblasts, which are mediators of wound healing and fibrosis, and intra-lobular fibroblasts expressing MMP2, SPARC, TGF-β3, which are inducers of EMT, were both prevalent in TAHN-1 tissues, sparse in TAHN-5 tissues, and absent in normal tissues from reduction mammoplasty. Accordingly, EMT markers S100A4 and vimentin were elevated in both luminal and myoepithelial cells, and EMT markers α-smooth muscle actin and SNAIL were elevated in luminal epithelial cells of TAHN-1 tissues. These results identify cellular processes that are differentially activated between TAHN-1 and TAHN-5 breast tissues, implicate myofibroblasts as likely mediators of these processes, provide evidence that EMT is occurring in histologically normal tissues within the affected field and identify candidate biomarkers to investigate whether or how field cancerization contributes to the development of primary or recurrent breast tumors. PMID:21105047
UVB 311 nm tolerance of vitiligo skin increases with skin photo type
Caron-Schreinemachers, Anne-Lou D. B.; Kingswijk, Melanie M.; Bos, Jan D.; Westerhof, Wiete
2005-01-01
It is assumed that skin is protected against sunburn by melanin. In patients with vitiligo, there are white patches in the normal pigmented skin. We noticed that there is a difference in burning capacity of these white patches between people with different skin types. With UVB 311 nm lamps, we
International Nuclear Information System (INIS)
Selsky, C.A.
1976-01-01
The host-cell reactivation of UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated herpes simplex virus type 1 strain mp was studied in normal human skin fibroblasts and xeroderma pigmentosum skin fibroblasts from XP genetic complementation groups A-D and in an XP variant. The increasing relative order for the host-cell reactivation of both types of damaged virus in the different complementation groups is A = D < B < C; XP variant = normal controls. XP complementation group D cells, which manifest the most severe inhibition of her ability for both UV-irradiated and N-acetoxy-2-acetylaminofluorene-treated virus, can reactivate nitrogen mustard treated HSV-1 mp to the same extent as normal cells. Together, these results indicate that (1) Excision repair of UV and N-acetoxy-2-acetylaminofluorene DNA damaged viruses share a common rate limiting enzymatic step and (2) The repair defect in xeroderma pigmentosum cells plays little or no role in the recovery of nitrogen mustard treated virus. The results of studies on the effect of caffeine on the survival of both UV- and N-acetoxy-2-acetylaminofluorene-treated virus in normal and XP cells imply that the reactivation of HSV-1 mp is mediated by an excision repair process with little if any recovery contributed by post-replication repair mechanisms. The host-cell reactivation of N-acetoxy-2-acetylaminofluorene-treated HSV-1 mp was also correlated with the defective UV-induced unscheduled DNA synthesis in two skin fibroblast strains established from a skin biopsy obtained from each of two juvenile females who had been clinically diagnosed as xeroderma pigmentosum. These findings are discussed in relation to the further characterization of the xeroderma pigmentosum phenotype and their possible utilization for the selection and isolation of new mammalian cell DNA repair mutants
Influence of low-energy laser radiation on normal skin and certain tumor tissues
Energy Technology Data Exchange (ETDEWEB)
Pletnev, S.D.; Karpenko, O.M.
For some years, the authors' Institute has studied the influence of various types of low-energy laser radiation on normal tissue and the growth of tumors. Radiation at 3 and 30 J/cm/sup 2/ causes an increase in biological activity of various cell elements, manifested as an increase in mitotic activity of the cells in the basal layer of the epidermis, conglomeration of chromatin in the cell nuclei and an increase in degranulation of fat cells in the process of their migration to the reticular layer. Also noted was an increase in content of fibroblastic and lymphohistocytic elements in the dermis, as well as an increase in collagenization of connective tissue. It was found that irradiation of the skin by helium-neon, cadmium-helium and nitrogen lasers before and after grafting of the cells of various tumors modifies the course of the tumor process. This effect is apparently related to the fact that systematic irradiation results in changes creating a favorable background for survival and proliferation of tumor cells in the skin tissue medium. The changes facilitate an increase in survival and growth of both pigmented and nonpigmented tumors. Low power radiation stimulates the activity of the cells or cell structures; medium power stimulates their activity; high power suppresses activity.
Three-Dimensional In Vitro Skin and Skin Cancer Models Based on Human Fibroblast-Derived Matrix.
Berning, Manuel; Prätzel-Wunder, Silke; Bickenbach, Jackie R; Boukamp, Petra
2015-09-01
Three-dimensional in vitro skin and skin cancer models help to dissect epidermal-dermal and tumor-stroma interactions. In the model presented here, normal human dermal fibroblasts isolated from adult skin self-assembled into dermal equivalents with their specific fibroblast-derived matrix (fdmDE) over 4 weeks. The fdmDE represented a complex human extracellular matrix that was stabilized by its own heterogeneous collagen fiber meshwork, largely resembling a human dermal in vivo architecture. Complemented with normal human epidermal keratinocytes, the skin equivalent (fdmSE) thereof favored the establishment of a well-stratified and differentiated epidermis and importantly allowed epidermal regeneration in vitro for at least 24 weeks. Moreover, the fdmDE could be used to study the features of cutaneous skin cancer. Complementing fdmDE with HaCaT cells in different stages of malignancy or tumor-derived cutaneous squamous cell carcinoma cell lines, the resulting skin cancer equivalents (fdmSCEs) recapitulated the respective degree of tumorigenicity. In addition, the fdmSCE invasion phenotypes correlated with their individual degree of tissue organization, disturbance in basement membrane organization, and presence of matrix metalloproteinases. Together, fdmDE-based models are well suited for long-term regeneration of normal human epidermis and, as they recapitulate tumor-specific growth, differentiation, and invasion profiles of cutaneous skin cancer cells, also provide an excellent human in vitro skin cancer model.
A Simple Device For Measuring Skin Friction
Directory of Open Access Journals (Sweden)
Gupta A.B
1995-01-01
Full Text Available A simple device for measuring skin friction in vivo is described. The frictional coefficient of normal Indian skin and the effect of hydration and application of talc and glycerol on the frictional coefficient and also the friction of ichthyotic skin have been determined with its help. The average value of friction of friction of normal India skin at forearm is found to be 0.41 +- 0.08, the hydration raises the value to 0.71 +- 0.11 and the effect of glycerol is also to school it up to 0.70+- 0.05, almost equal to that of water. The effect of talc however is opposite and its application lowers the friction to 0.21+-0.07. The mean coeff of friction for ichthyotic skin is found to be 0.21+- 0.0.5, which closely agrees with talc-treated normal skin. A good positive correlation (p<0.01 between friction and sebum level at skin site, with r = 0.64, has been observed.
Filipović, Mila; Gledović, Ana; Lukić, Milica; Tasić-Kostov, Marija; Isailović, Tanja; Pantelić, Ivana; Vuleta, Gordana; Savić, Snežana
2016-11-01
Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. With the employment of noninvasive skin biophysical measurements, skin hydration (EC), transepi-dermal water loss (TEWL), erythema index (EI) and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study) on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031
Directory of Open Access Journals (Sweden)
Filipović Mila
2016-01-01
Full Text Available Background/Aim. Since skin moisturization may be achieved by both actives and chosen carrier, plant stem cells, squalene and natural alkyl polyglucoside emulsifier may be potential components of contemporary cosmetic products. The aim of the study was in vivo evaluation of the skin irritation potential and the efficacy of Alpine Rose stem cells incorporated into li-posomes and olive oil squalene as ingredients of moisturizing creams, with respect to the novel emulsifier used for creams’ stabilization. Methods. With the employment of noninvasive skin biophysical measurements, skin hydration (EC, transepi-dermal water loss (TEWL, erythema index (EI and viscoelas-ticity were measured on 76 healthy volunteers. In the first phase, skin irritation after a 24-hour occlusion and the long-term efficacy of creams (a 21-day study on healthy skin were evaluated. Phase II of the study focused on the cream efficacy assessment after a 6-day treatment of sodium lauryl sulfate-irritated skin. Results. After a 24-hour occlusion, there were no significant changes in the EI for any tested sample. In the second phase of the study, the EI was not significantly altered for the cream containing squalene, while the application of all active samples resulted in a significant reduction of TEWL. In both phases of the study an EC increase was recorded, espe-cially for the squalene-containing cream. Conclusion. Due to the lack of skin irritation and skin barrier impairment along with the marked hydration effect, it could be said that the in-vestigated actives incorporated into alkyl polyglucoside emulsi-fier-stabilized creams may be safely applied as ingredients for "tailor-made" cosmetic moisturizers intended for normal and dry skin care, whereas olive oil squalene could be used for the treatment of irritated or sensitive skin as well. [Projekat Ministarstva nauke Republike Srbije, br. TR34031
The skin uses sunlight to help manufacture vitamin D, which is important for normal bone formation. But sometimes its ultraviolet light can be ... the pigment melanin. Melanin protects skin from the sun's ultraviolet rays, which can burn the skin, and ...
Normal Skin Microbiota is Altered in Pre-clinical Hidradenitis Suppurativa
DEFF Research Database (Denmark)
Ring, Hans Christian; Bay, Lene; Kallenbach, Klaus
2017-01-01
therefore hypothesized that clinically unaffected HS skin would also have an increased presence of biofilm compared with that of healthy controls. We conducted a case-control study, investigating the morphology of the axillary skin microbiota. Peptide nucleic acid – fluorescence in situ hybridization probes...... were used in combination with confocal laser scanning microscopy. Significant differences were found in both distribution and quantity of the cutaneous microbiota in clinically non-affected axillary skin of patients with HS compared with healthy controls. Surprisingly, we detected fewer bacteria...... and less biofilm in patients with HS. The reduced microbiota in patients with HS may play an important role in the early course of the disease....
van Hoof, Marc; Wigren, Stina; Duimel, Hans; Savelkoul, Paul H M; Flynn, Mark; Stokroos, Robert Jan
2015-01-01
Percutaneous implants, such as bone conduction hearing implants, suffer from complications that include inflammation of the surrounding skin. A sealed skin-abutment interface can prevent the ingress of bacteria, which should reduce the occurrence of peri-abutment dermatitis. It was hypothesized that a hydroxyapatite (HA)-coated abutment in conjunction with soft tissue preservation surgery should enable integration with the adjacent skin. Previous research has confirmed that integration is never achieved with as-machined titanium abutments. Here, we investigate, in vivo, if skin integration is achievable in patients using a HA-coated abutment. One titanium abutment (control) and one HA-coated abutment (case) together with the surrounding skin were surgically retrieved from two patients who had a medical indication for this procedure. Histological sections of the skin were investigated using light microscopy. The abutment was qualitatively analyzed using scanning electron microscopy. The titanium abutment only had a partial and thin layer of attached amorphous biological material. The HA-coated abutment was almost fully covered by a pronounced thick layer of organized skin, composed of different interconnected structural layers. Proof-of-principle evidence that the HA-coated abutment can achieve integration with the surrounding skin was presented for the first time.
Energy Technology Data Exchange (ETDEWEB)
Netchareonsirisuk, Ponsawan [Chulalongkorn University, Program in Biotechnology, Faculty of Science (Thailand); Puthong, Songchan [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand); Dubas, Stephan [Chulalongkorn University, Petroleum and Petrochemical College (Thailand); Palaga, Tanapat [Chulalongkorn University, Department of Microbiology, Faculty of Science (Thailand); Komolpis, Kittinan, E-mail: kittinan.k@chula.ac.th [Chulalongkorn University, Antibody Production Research Unit, Institute of Biotechnology and Genetic Engineering (Thailand)
2016-11-15
Silver nanoparticles (AgNPs) are among the most widely used nanomaterials in medical and consumer products. However, safety in the uses of AgNPs is still controversial. The toxicity of AgNPs toward various cell types has been reported to depend on the surface properties of the nanoparticles. In this study, the effect of AgNPs with the average size of 5–15 nm on the viability of the CCD-986SK human normal skin fibroblast cell line and A375 human malignant melanoma cell line was evaluated. Comparative toxicity studies, based on MTT assay, were performed by using either sodium alginate or poly (4-styrenesulfonic acid-co-maleic acid) sodium salt (PSSMA) as capping agent in the nanoparticle preparation. The cytotoxicity tests revealed that AgNO{sub 3} alone was highly toxic to both cell types while both alginate and PSSMA alone were not toxic. AgNPs capped with alginate were selectively toxic to the cancer cell line but not to the normal cell line while AgNPs capped with PSSMA were toxic to both cancer and normal cell lines. Judging from the 50 % inhibition concentration (IC{sub 50}), it was found that the cancer cell line was more sensitive to AgNPs than the normal cell line. Study on the mode of cell death by annexin V and propidium iodide staining revealed that AgNPs induced more apoptotic cell death (84–90 %) than necrosis (8–12 %) in the skin cancer cell line. These results suggest that the toxicity of AgNPs depended on the type of capping agent and the type of cell line.
International Nuclear Information System (INIS)
Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.
1987-01-01
The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation
Terahertz pulse imaging in reflection geometry of human skin cancer and skin tissue
International Nuclear Information System (INIS)
Woodward, Ruth M; Cole, Bryan E; Wallace, Vincent P; Pye, Richard J; Arnone, Donald D; Linfield, Edmund H; Pepper, Michael
2002-01-01
We demonstrate the application of terahertz pulse imaging (TPI) in reflection geometry for the study of skin tissue and related cancers both in vitro and in vivo. The sensitivity of terahertz radiation to polar molecules, such as water, makes TPI suitable for studying the hydration levels in the skin and the determination of the lateral spread of skin cancer pre-operatively. By studying the terahertz pulse shape in the time domain we have been able to differentiate between diseased and normal tissue for the study of basal cell carcinoma (BCC). Basal cell carcinoma has shown a positive terahertz contrast, and inflammation and scar tissue a negative terahertz contrast compared to normal tissue. In vivo measurements on the stratum corneum have enabled visualization of the stratum corneum-epidermis interface and the study of skin hydration levels. These results demonstrate the potential of terahertz pulse imaging for the study of skin tissue and its related disorders, both in vitro and in vivo
Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.
2013-01-01
Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445
Matching the skin barrier to the skin type.
Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia
Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.
Kikuchi, K; Tagami, H; Akaraphanth, R; Aiba, S
2011-01-01
Although the nipple and areola of the breast constitute a unique and prominent area on the chest, so far no study has been done on the functional properties of their skin surfaces. To study the stratum corneum (SC) covering the areola using noninvasive methods. Eighteen adult healthy subjects comprising nine men and nine women and 18 age- and sex-matched patients with atopic dermatitis (AD), none of whom had visible skin lesions, participated in the study. Transepidermal water loss (TEWL), skin surface hydration and skin surface lipid levels were measured on the areola and adjacent breast skin. The size of the skin surface corneocytes of these skin regions was assessed. All the healthy subjects showed significantly higher TEWL accompanied by smaller sized corneocytes on the areola than on the adjacent breast skin. Only female subjects revealed a significantly higher skin surface hydration state together with significantly increased skin surface lipid levels on the areola than on the adjacent breast skin. These sex differences were observed even in patients with AD. Comparison between healthy individuals and the patients with AD demonstrated higher TEWL, decreased skin surface hydration state and lower skin surface lipid levels associated with smaller sized corneocytes in the areola in the patients with AD, especially in male patients. In adults, the SC barrier function and SC water-binding capacity of the areola were functionally poorer than in the adjacent skin, being covered by smaller sized corneocytes and lower amounts of skin surface lipids, especially in men and in patients with AD. © 2011 The Authors. BJD © 2011 British Association of Dermatologists 2011.
Histopathology of normal skin and melanomas after nanosecond pulsed electric field treatment
Chen, Xinhua; Swanson, R. James; Kolb, Juergen F.; Nuccitelli, Richard; Schoenbach, Karl H.
2011-01-01
Nanosecond pulsed electric fields (nsPEFs) can affect the intracellular structures of cells in vitro. This study shows the direct effects of nsPEFs on tumor growth, tumor volume, and histological characteristics of normal skin and B16-F10 melanoma in SKH-1 mice. A melanoma model was set up by injecting B16-F10 into female SKH-1 mice. After a 100-pulse treatment with an nsPEF (40-kV/cm field strength; 300-ns duration; 30-ns rise time; 2-Hz repetition rate), tumor growth and histology were studied using transillumination, light microscopy with hematoxylin and eosin stain and transmission electron microscopy. Melanin and iron within the melanoma tumor were also detected with specific stains. After nsPEF treatment, tumor development was inhibited with decreased volumes post-nsPEF treatment compared with control tumors (Pelectric fields surrounding the needle electrodes. PMID:19730404
Psychoneuroimmunology and the Skin.
Honeyman, Juan F
2016-08-23
The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.
Optical coherence tomography for imaging of skin and skin diseases
DEFF Research Database (Denmark)
Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini
2009-01-01
Optical coherence tomography (OCT) is an emerging imaging technology based on light reflection. It provides real-time images with up to 2-mm penetration into the skin and a resolution of approximately 10 μm. It is routinely used in ophthalmology. The normal skin and its appendages have been studi...... technical solutions are being pursued to further improve the quality of the images and the data provided, and OCT is being integrated in multimodal imaging devices that would potentially be able to provide a quantum leap to the imaging of skin in vivo....
Delineating the cell death mechanisms associated with skin electroporation.
Schultheis, Katherine; Smith, Trevor R F; Kiosses, William B; Kraynyak, Kimberly A; Wong, Amelia; Oh, Janet; Broderick, Kate Elizabeth
2018-06-28
The immune responses elicited following delivery of DNA vaccines to the skin has previously been shown to be significantly enhanced by the addition of electroporation (EP) to the treatment protocol. Principally, EP increases the transfection of pDNA into the resident skin cells. In addition to increasing the levels of in vivo transfection, the physical insult induced by EP is associated with activation of innate pathways which are believed to mediate an adjuvant effect, further enhancing DNA vaccine responses. Here, we have investigated the possible mechanisms associated with this adjuvant effect, primarily focusing on the cell death pathways associated with the skin EP procedure independent of pDNA delivery. Using the minimally invasive CELLECTRA®-3P intradermal electroporation device that penetrates the epidermal and dermal layers of the skin, we have investigated apoptotic and necrotic cell death in relation to the vicinity of the electrode needles and electric field generated. Employing the well-established TUNEL assay, we detected apoptosis beginning as early as one hour after EP and peaking at the 4 hour time point. The majority of the apoptotic events were detected in the epidermal region directly adjacent to the electrode needle. Using a novel propidium iodide in vivo necrotic cell death assay, we detected necrotic events concentrated in the epidermal region adjacent to the electrode. Furthermore, we detected up-regulation of calreticulin expression on skin cells after EP, thus labeling these cells for uptake by dendritic cells and macrophages. These results allow us to delineate the cell death mechanisms occurring in the skin following intradermal EP independently of pDNA delivery. We believe these events contribute to the adjuvant effect observed following electroporation at the skin treatment site.
Scar evaluation of split thickness skin graft donor site
Directory of Open Access Journals (Sweden)
Jani Muha
2014-12-01
Full Text Available BACKGROUND. Split thickness skin graft harvesting causes a certain degree of scaring on the donor site. Donor site scar can cause aesthetic and functional sequelae on the patient's body. Our goal was to study the process of donor site selection, and then evaluate donor site scars and their impact on patients. PATIENTS AND METHODS. This retrospective study included 45 patients aged 5 to 61 years (in average 36, who have been treated with STSG in the 2004–2010 period. 57.8% of them were men. On a follow-up visit, we photographed healed skin defects and donor sites. We then determined and compared the surface areas of skin defect and the donor site using the Adobe® Illustrator® CS5 computer program. Donor site scars were assessed according to the Vancouver scar scale (VSS. We examined scar’s light touch sensitivity with monofilaments and skin colouring compared to adjacent healthy skin using colorimeter. Patients were also interviewed about their treatment course in a form of a standardized questionnaire. RESULTS. Our research has revealed that 20.0% of patients participated in the decision making process of choosing the donor site, while in 80.0% the donor site was chosen by the surgeon himself. 6.7% of patients were not satisfied with their donor site. Most of the patients (37/45 had donor sites on their thighs. In average, the donor site surface area was 94% bigger than the skin defect area. We found statistically significant differences in VSS values, light touch sensitivity and skin colouring between donor site scaring and adjacent healthy skin. CONCLUSIONS. Donor site scar can represent a lasting aesthetic and functional disability for patients. Our research has shown that most of the patients do not participate in the donor site selection process, but are satisfied with their donor site. In most cases, STGSs are harvested from the thigh, other anatomical regions, where scarring would be aesthetically less obtrusive, are underused
Energy Technology Data Exchange (ETDEWEB)
Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)
2013-03-01
Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.
International Nuclear Information System (INIS)
Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi
2013-01-01
Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes
In vivo study of human skin using pulsed terahertz radiation
Energy Technology Data Exchange (ETDEWEB)
Pickwell, E [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Cole, B E [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Fitzgerald, A J [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom); Pepper, M [Semiconductor Physics Group, Cavendish Laboratory, Cambridge University, Madingley Road, Cambridge CB3 0HE (United Kingdom); Wallace, V P [TeraView Ltd, Unit 302/4 Cambridge Science Park, Cambridge CB4 0WG (United Kingdom)
2004-05-07
Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation.
In vivo study of human skin using pulsed terahertz radiation
International Nuclear Information System (INIS)
Pickwell, E; Cole, B E; Fitzgerald, A J; Pepper, M; Wallace, V P
2004-01-01
Studies in terahertz (THz) imaging have revealed a significant difference between skin cancer (basal cell carcinoma) and healthy tissue. Since water has strong absorptions at THz frequencies and tumours tend to have different water content from normal tissue, a likely contrast mechanism is variation in water content. Thus, we have previously devised a finite difference time-domain (FDTD) model which is able to closely simulate the interaction of THz radiation with water. In this work we investigate the interaction of THz radiation with normal human skin on the forearm and palm of the hand in vivo. We conduct the first ever systematic in vivo study of the response of THz radiation to normal skin. We take in vivo reflection measurements of normal skin on the forearm and palm of the hand of 20 volunteers. We compare individual examples of THz responses with the mean response for the areas of skin under investigation. Using the in vivo data, we demonstrate that the FDTD model can be applied to biological tissue. In particular, we successfully simulate the interaction of THz radiation with the volar forearm. Understanding the interaction of THz radiation with normal skin will form a step towards developing improved imaging algorithms for diagnostic detection of skin cancer and other tissue disorders using THz radiation
Stereological quantification of lymphocytes in skin biopsies from atopic dermatitis patients
DEFF Research Database (Denmark)
Ellingsen, A R; Sørensen, F B; Larsen, Jytte Overgaard
2001-01-01
with active eczema in 8 adults with AD and from clinically normal skin from 4 of the patients. Five persons without allergy or skin disease served as controls. The mean number of lymphocytes in 4-mm skin biopsies was 469,000 and 124,000 in active eczema and in clinically normal skin, respectively. Compared......Atopic dermatitis (AD) is histologically characterized by lymphocytic infiltration of the skin and quantitative assessment is required. This study introduces stereological techniques to quantify the number of lymphocytes in skin biopsies. Four-millimetre punch biopsies were taken from skin...... with controls, the number of lymphocytes in biopsies increased by a factor of 6.8 in active eczema and a factor of 1.8 in clinically normal skin. If 20% of skin is affected by eczema the total number of lymphocytes located in the affected skin can be estimated to 1.27 x 10(10). A patient with clinically...
Schaffler, Klaus; Reeh, Peter; Duan, W Rachel; Best, Andrea E; Othman, Ahmed A; Faltynek, Connie R; Locke, Charles; Nothaft, Wolfram
2013-02-01
Laser (radiant-heat) evoked potentials (LEPs) from vertex-EEG peak-to-peak (PtP) amplitude were used to determine acute antinociceptive/antihyperalgesic efficacy of ABT-102, a novel TRPV1 antagonist efficacious in preclinical pain models, compared with active controls and placebo in normal and UV(B)-inflamed skin. This was a randomized, placebo- and active-controlled, double-blind, intra-individual, crossover trial. Twenty-four healthy subjects received six sequences of single doses of ABT-102 (0.5, 2, 6 mg), etoricoxib 90 mg, tramadol 100 mg and placebo. Painful stimuli were induced by CO(2) -laser on normal and UV(B) -inflamed skin. LEPs and visual analogue scale (VAS-pain) ratings were taken at baseline and hourly up to 8 h post-dose from both skin types. Compared with placebo, significant mean decreases in the primary variable of LEP PtP-amplitude from UV(B)-inflamed skin were observed with ABT-102 6 mg (P < 0.001), ABT-102 2 mg (P = 0.002), tramadol 100 mg (P < 0.001), and etoricoxib 90 mg (P = 0.001) over the 8 h period; ABT-102 0.5 mg was similar to placebo. ABT-102 6 mg was superior to active controls over the 8 h period (P < 0.05) whereas ABT-102 2 mg was comparable. Improvements in VAS scores compared with placebo were observed with ABT-102 6 mg (P < 0.001) and ABT-102 2 mg (P = 0.002). ABT-102 average plasma concentrations were 1.3, 4.4 and 9.4 ng ml(-1) for the 0.5, 2 and 6 mg doses, respectively. There were no clinically significant safety findings. TRPV-1 antagonism appears promising in the management of clinical pain, but requires further investigation. © 2012 Abbott. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.
Gimblet, Ciara; Meisel, Jacquelyn S; Loesche, Michael A; Cole, Stephen D; Horwinski, Joseph; Novais, Fernanda O; Misic, Ana M; Bradley, Charles W; Beiting, Daniel P; Rankin, Shelley C; Carvalho, Lucas P; Carvalho, Edgar M; Scott, Phillip; Grice, Elizabeth A
2017-07-12
Skin microbiota can impact allergic and autoimmune responses, wound healing, and anti-microbial defense. We investigated the role of skin microbiota in cutaneous leishmaniasis and found that human patients infected with Leishmania braziliensis develop dysbiotic skin microbiota, characterized by increases in the abundance of Staphylococcus and/or Streptococcus. Mice infected with L. major exhibit similar changes depending upon disease severity. Importantly, this dysbiosis is not limited to the lesion site, but is transmissible to normal skin distant from the infection site and to skin from co-housed naive mice. This observation allowed us to test whether a pre-existing dysbiotic skin microbiota influences disease, and we found that challenging dysbiotic naive mice with L. major or testing for contact hypersensitivity results in exacerbated skin inflammatory responses. These findings demonstrate that a dysbiotic skin microbiota is not only a consequence of tissue stress, but also enhances inflammation, which has implications for many inflammatory cutaneous diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase
2011-01-01
An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical...... blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high...... reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new...
Bacterial skin flora of diabetic patients in the Jos University Teaching ...
African Journals Online (AJOL)
Diabetics frequently are afflicted with bacterial skin infections because of the high circulating blood sugar. The frequent skin infections in these patients may be a result of change in normal skin flora. This study was carried out to find out the normal skin flora of these patients. Ninety four (50 study and 44 control) consecutive ...
Li, Z; Hu, L; Elias, PM; Man, M-Q
2018-01-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin.To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin.Following topical ...
International Nuclear Information System (INIS)
Nielsen, Steen Levin; Nielsen, Anne Lerberg; Vind, Susanne Haase; Thomassen, Anders
2011-01-01
An inflatable small plastic bag including a photo sensor was constructed for measurement of skin perfusion pressure avoiding the rim of the photo sensor over bony and tendineous surfaces of the tibia below the knee, at the ankle, and on the dorsal forefoot. Compression was obtained using a conical blood pressure cuff with continuous decrease from suprasystolic arm pressure. The validity of skin perfusion pressure with the new device was compared to that of isotope washout below the knee in normal subjects and in patients with an ischemic forefoot with acceptable agreement. The method had a high reproducibility within and between days in normal subjects. Compared to systolic arterial pressure measured using a strain gauge with a cuff on the ankle in normal subjects and patients with intermittent claudication the new device showed blood pressure in the skin closer to the diastolic pressure. The new pressure device thus had acceptable validity and reproducibility for estimation of the skin perfusion pressure and can be used on bony and tendineous sites on the lower limb in regions where critical wound healing is frequent, e.g. ankle and forefoot
Lymphatic albumin clearance from psoriatic skin
International Nuclear Information System (INIS)
Staberg, B.; Klemp, P.; Aasted, M.; Worm, A.M.; Lund, P.
1983-01-01
In nine patients with untreated psoriasis vulgaris, human serum albumin labelled with 125 I or 131 I was injected intradermally in symmetrically located involved and uninvolved skin. The activity of the depots was followed by external detection, and the arrival of labelled albumin in plasma was monitored. In involved psoriatic skin the local mean half-time (T1/2) for tracer disappearance was 20.8 +/- 8.2 (S.D.) hr and in clinically normal skin, 29.1 +/- 9.6 (S.D.) hr. The difference was significant (p less than 0.002). Accordingly, the tracer from involved skin reached higher plasma levels than the tracer from uninvolved skin. However, under slight lymphatic stasis the appearance rate of radiolabelled albumin in plasma from both tissues was minimal during 1 to 2 hours after the injection, indicating that a local direct transvascular drainage of plasma albumin from the interstitium of diseased and normal skin was negligible. We conclude that the previously demonstrated increased extravasation of plasma proteins in involved psoriatic skin is compensated by an increased lymphatic drainage of plasma proteins, and not by an increased local transvascular return
p63 in skin development and ectodermal dysplasias
Koster, Maranke I.
2010-01-01
The transcription factor p63 is critically important for skin development and maintenance. Processes that require p63 include epidermal lineage commitment, epidermal differentiation, cell adhesion, and basement membrane formation. Not surprisingly, alterations in the p63 pathway underlie a subset of ectodermal dysplasias, developmental syndromes in which the skin and skin appendages do not develop normally. This review summarizes the current understanding of the role of p63 in normal development and ectodermal dysplasias. PMID:20445549
Ectodermal dysplasia-skin fragility syndrome
Directory of Open Access Journals (Sweden)
Vijay S Adhe
2011-01-01
Full Text Available Ectodermal dysplasia-skin fragility (EDSF syndrome is a rare and first described inherited disorder of desmosomes. It occurs due to loss-of-function mutations in PKP1 gene resulting in poorly formed desmosomes and loss of desmosomal and epidermal integrity. We report a case of a 2-year-old Indian male child who presented with palmoplantar hyperkeratosis with fissuring, short, sparse, and easily pluckable scalp hair, nail dystrophy, and multiple erosions over the skin. Skin biopsy showed epidermal hyperplasia with widening of intercellular spaces. His developmental milestones were delayed but intelligence was normal. Echocardiography, X-ray chest, and electrocardiogram were normal. Very few cases of this syndrome have been reported in the literature. We consider this as the first case report from India.
International Nuclear Information System (INIS)
Kutovyi, V.A.; Komir, A.I.
2013-01-01
The results of the frequency dependence of surface resistance of copper in diffuse and specular reflection of electrons from the conductive surface of the high-frequency resonance of the system depending on the frequency of the electromagnetic field in the normal and anomalous skin effect. Found, the surface resistance of copper is reduced by more than 10 times at the temperature of liquid helium, as compared with a surface resistivity at room temperature, at frequencies f ≤ 173 MHz, for diffuse reflection of conduction electrons from the surface of the conductive layer, and the specular reflection - at frequencies f ≤ 346 MHz
OCT imaging of skin cancer and other dermatological diseases
DEFF Research Database (Denmark)
Mogensen, Mette; Thrane, Lars; Jørgensen, Thomas Martini
2009-01-01
Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a lar...... number of applications in the fields of non-melanoma skin cancer, malignant melanomas, psoriasis and dermatitis, infestations, bullous skin diseases, tattoos, nails, haemangiomas, and other skin diseases. (© 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim)......Optical coherence tomography (OCT) provides clinicians and researchers with micrometer-resolution, in vivo, cross-sectional images of human skin up to several millimeter depth. This review of OCT imaging applied within dermatology covers the application of OCT to normal skin, and reports on a large...
Correction of thickness measurement errors for two adjacent sheet structures in MR images
International Nuclear Information System (INIS)
Cheng Yuanzhi; Wang Shuguo; Sato, Yoshinobu; Nishii, Takashi; Tamura, Shinichi
2007-01-01
We present a new method for measuring the thickness of two adjacent sheet structures in MR images. In the hip joint, in which the femoral and acetabular cartilages are adjacent to each other, a conventional measurement technique based on the second derivative zero crossings (called the zero-crossings method) can introduce large underestimation errors in measurements of cartilage thickness. In this study, we have developed a model-based approach for accurate thickness measurement. We model the imaging process for two adjacent sheet structures, which simulate the two articular cartilages in the hip joint. This model can be used to predict the shape of the intensity profile along the sheet normal orientation. Using an optimization technique, the model parameters are adjusted to minimize the differences between the predicted intensity profile and the actual intensity profiles observed in the MR data. The set of model parameters that minimize the difference between the model and the MR data yield the thickness estimation. Using three phantoms and one normal cadaveric specimen, the usefulness of the new model-based method is demonstrated by comparing the model-based results with the results generated using the zero-crossings method. (author)
Schaffler, Klaus; Nicolas, Laurent B; Borta, Andreas; Brand, Tobias; Reitmeir, Peter; Roebling, Robert; Scholpp, Joachim
2017-07-01
The aim of the present study was to assess the predictivity of laser-(radiant-heat)-evoked potentials (LEPs) from the vertex electroencephalogram, using an algesimetric procedure, testing the anti-nociceptive/anti-hyperalgesic effects of single oral doses of four marketed analgesics (of different compound classes) vs. placebo, in healthy volunteers with three skin types. This was a randomized, placebo-controlled, single-blind, five-way-crossover trial. Twenty-five healthy male/female Caucasians were included (receiving celecoxib 200 mg, pregabalin 150 mg, duloxetine 60 mg, lacosamide 100 mg or placebo) in a Williams design, with CO 2 laser-induced painful stimuli to normal, ultraviolet (UV) B-inflamed and capsaicin-irritated skin. LEPs and visual analogue scale ratings were taken at baseline and hourly for 6 h postdose from all three skin types. In normal skin, the averaged postdose LEP peak-to-peak-(PtP)-amplitudes were reduced by pregabalin (-2.68 μV; 95% confidence interval (CI) -4.16, 1.19) and duloxetine (-1.73 μV; 95% CI -3.21, -0.26) but not by lacosamide and celecoxib vs. placebo. On UVB-irradiated skin, reflecting inflammatory pain, celecoxib induced a pronounced reduction in LEP PtP amplitudes vs. placebo (-6.2 μV; 95% CI -7.88, -4.51), with a smaller reduction by duloxetine (-4.54 μV; 95% CI -6.21, -2.87) and pregabalin (-3.72 μV; 95% CI -5.40, -2.04), whereas lacosamide was inactive. LEP PtP amplitudes on capsaicin-irritated skin, reflecting peripheral/spinal sensitization, as in neuropathic pain, were reduced by pregabalin (-3.78 μV; 95% CI -5.31, -2.25) and duloxetine (-2.32 μV; 95% CI -3.82, -0.82) but not by celecoxib or lacosamide vs. placebo, which was in agreement with known clinical profiles. Overall, PtP amplitude reductions were in agreement with subjective ratings. LEP algesimetry is sensitive to analgesics with different modes of action and may enable the effects of novel analgesics to be assessed during early clinical
DEFF Research Database (Denmark)
Boone, M A L M; Suppa, M; Marneffe, A
2016-01-01
properties for discrimination of AK from SCC and from normal sun exposed skin and to subdifferentiate AKs. METHODS: The technique of semi-log plot has been implemented on HD-OCT signals. This permitted the in vivo measurement of OCT signals coming from the skin entrance up to the superficial reticular dermis...... involvement, non-Bowenoid AK with follicular involvement, Bowenoid AK, hypertrophic and lichenoid form of AK and squamous cell carcinoma. CONCLUSION: HD-OCT seems to enable the combination of in vivo morphological analysis of cellular and 3D microarchitectural structures with in vivo analysis of optical...... properties of tissue scatterers in AK/SCC lesions and normal sun-exposed skin. In vivoHD-OCT analysis of optical properties permits AK discrimination from SCC and AK subdifferentiation with higher accuracy than in vivoHD-OCT analysis of morphology alone....
Proteomic profiling reveals candidate markers for arsenic-induced skin keratosis.
Guo, Zhiling; Hu, Qin; Tian, Jijing; Yan, Li; Jing, Chuanyong; Xie, Heidi Qunhui; Bao, Wenjun; Rice, Robert H; Zhao, Bin; Jiang, Guibin
2016-11-01
Proteomics technology is an attractive biomarker candidate discovery tool that can be applied to study large sets of biological molecules. To identify novel biomarkers and molecular targets in arsenic-induced skin lesions, we have determined the protein profile of arsenic-affected human epidermal stratum corneum by shotgun proteomics. Samples of palm and foot sole from healthy subjects were analyzed, demonstrating similar protein patterns in palm and sole. Samples were collected from the palms of subjects with arsenic keratosis (lesional and adjacent non-lesional samples) and arsenic-exposed subjects without lesions (normal). Samples from non-exposed healthy individuals served as controls. We found that three proteins in arsenic-exposed lesional epidermis were consistently distinguishably expressed from the unaffected epidermis. One of these proteins, the cadherin-like transmembrane glycoprotein, desmoglein 1 (DSG1) was suppressed. Down-regulation of DSG1 may lead to reduced cell-cell adhesion, resulting in abnormal epidermal differentiation. The expression of keratin 6c (KRT6C) and fatty acid binding protein 5 (FABP5) were significantly increased. FABP5 is an intracellular lipid chaperone that plays an essential role in fatty acid metabolism in human skin. This raises a possibility that overexpression of FABP5 may affect the proliferation or differentiation of keratinocytes by altering lipid metabolism. KRT6C is a constituent of the cytoskeleton that maintains epidermal integrity and cohesion. Abnormal expression of KRT6C may affect its structural role in the epidermis. Our findings suggest an important approach for future studies of arsenic-mediated toxicity and skin cancer, where certain proteins may represent useful biomarkers of early diagnoses in high-risk populations and hopefully new treatment targets. Further studies are required to understand the biological role of these markers in skin pathogenesis from arsenic exposure. Copyright © 2016 Elsevier Ltd
Directory of Open Access Journals (Sweden)
Pinar Cetinay Aydin
2014-08-01
Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428
Formation of thymine containing dimers in skin exposed to ultraviolet radiation
Energy Technology Data Exchange (ETDEWEB)
Johnson, B E [Dundee Univ. (UK)
1978-01-01
Nuclear DNA appears to be the major molecular target for the inhibitory, mutagenic and lethal effects of ultraviolet radiation on cells in culture. Cyclobutyl dimers between adjacent pyrimidine bases, the major photochemical lesions for these effects in prokaryotes, also play a part in UVR effects on eukaryotes cells. Pyrimidine dimers have been isolated from in vivo UV-irradiated guinea pig and mouse skin. The wavelength dependence for dimer induction is similar to that for acute skin reactions but no direct causal relationship has been established. Sunlight UVR may induce dimers in skin DNA. Excision of dimers from mouse skin in vivo is deficient as it is for most rodent cells in culture; human cell excision is efficient and the difficulties in interpretation of UV-carcinogenesis results with mice in terms of human skin cancer are therefore increased.
Energy Technology Data Exchange (ETDEWEB)
Biswal, N C; Wu, Z; Chu, J [Rush University Medical Center, Chicago, IL (United States); Sun, J [Argonne National Laboratory, Lemont, IL (United States)
2015-06-15
Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy.
International Nuclear Information System (INIS)
Biswal, N C; Wu, Z; Chu, J; Sun, J
2015-01-01
Purpose: To assess the potential of dynamic infrared imaging to evaluate early skin reactions during radiation therapy in cancer patients. Methods: Thermal images were captured by our home-built system consisting of two flash lamps and an infrared (IR) camera. The surface temperature of the skin was first raised by ∼ 6 °C from ∼1 ms short flashes; the camera then captured a series of IR images for 10 seconds. For each image series, a basal temperature was recorded for 0.5 seconds before flash was triggered. The temperature gradients (ε) were calculated between a reference point (immediately after the flash) and at a time point of 2sec, 4sec and 9sec after that. A 1.0 cm region of interest (ROI) on the skin was drawn; the mean and standard deviations of the ROIs were calculated. The standard ε values for normal human skins were evaluated by imaging 3 healthy subjects with different skin colors. All of them were imaged on 3 separate days for consistency checks. Results: The temperature gradient, which is the temperature recovery rate, depends on the thermal properties of underlying tissue, i.e. thermal conductivity. The average ε for three volunteers averaged over 3 measurements were 0.64±0.1, 0.72±0.2 and 0.80±0.3 at 2sec, 4sec and 9sec respectively. The standard deviations were within 1.5%–3.2%. One of the volunteers had a prior small skin burn on the left wrist and the ε values for the burned site were around 9% (at 4sec) and 13% (at 9sec) lower than that from the nearby normal skin. Conclusion: The temperature gradients from the healthy subjects were reproducible within 1.5%–3.2 % and that from a burned skin showed a significant difference (9%–13%) from the normal skin. We have an IRB approved protocol to image head and neck patients scheduled for radiation therapy
Pershing, L K; Bakhtian, S; Wright, E D; Rallis, T M
1995-08-01
Uninvolved skin of psoriasis may not be entirely normal. The object was to characterize healthy, uninvolved psoriatic skin and lesional skin by biophysical methods. Involved and uninvolved psoriatic and age-gender matched healthy skin was measured objectively with a colorimeter and evaporimeter and subjectively with visual assessment in 14 subjects. Visual assessment of erythema (E), scaling (S) and induration (I) as well as the target lesion score at the involved psoriatic skin sites were significantly elevated (puninvolved psoriatic skin >healthy skin (pcolorimeter L* and a* scale values at uninvolved psoriatic skin sites were lower and higher (pcolorimeter description (L*× b*)/a* significantly differentiated healthy skin from both involved and uninvolved psoriatic skin. These collective data highlight that even visually appearing uninvolved psoriatic skin is compromised compared with healthy skin. These objective, noninvasive but differential capabilities of the colorimeter and evaporimeter will aid in the mechanistic quantification of new psoriatic drug therapies and in conjuction with biochemical studies, add to understanding of the multifactorial pathogenesis of psoriasis.
International Nuclear Information System (INIS)
Rude, J.M.; Friedberg, E.C.
1977-01-01
Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to UV radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a UV fluence of 5 J/m 2 . At this same UV fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the UV fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in UV-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semiconservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity
Main approaches for delivering antioxidant vitamins through the skin to prevent skin ageing.
Gašperlin, Mirjana; Gosenca, Mirjam
2011-07-01
One of the major contributions to skin photoageing and diseases is oxidative stress, caused by UV radiation inducing reactive oxygen and nitrogen species. Successful prophylaxis and therapy would necessitate control of the oxidant/antioxidant balance at the affected site, which can be achieved through the external supply of endogenous antioxidants. This review discusses possible strategies for dermal delivery of the antioxidant vitamins E and C, as oral supplementation has proved insufficient. These antioxidants have low skin bioavailability, owing to their poor solubility, inefficient skin permeability, or instability during storage. These drawbacks can be overcome by various approaches, such as chemical modification of the vitamins and the use of new colloidal drug delivery systems. New knowledge is included about the importance of: enhancing the endogenous skin antioxidant defense through external supply; the balance between various skin antioxidants; factors that can improve the skin bioavailability of antioxidants; and new delivery systems, such as microemulsions, used to deliver vitamins C and E into the skin simultaneously. A promising strategy for enhancing skin protection from oxidative stress is to support the endogenous antioxidant system, with antioxidants containing products that are normally present in the skin.
Skew-adjacency matrices of graphs
Cavers, M.; Cioaba, S.M.; Fallat, S.; Gregory, D.A.; Haemers, W.H.; Kirkland, S.J.; McDonald, J.J.; Tsatsomeros, M.
2012-01-01
The spectra of the skew-adjacency matrices of a graph are considered as a possible way to distinguish adjacency cospectral graphs. This leads to the following topics: graphs whose skew-adjacency matrices are all cospectral; relations between the matchings polynomial of a graph and the characteristic
ICRP-26 and skin contamination
International Nuclear Information System (INIS)
Finnigan, T.; Huda, W.; Newbery, G.R.
1979-01-01
The experience of dealing with skin contamination incidents at The Radiochemical Centre over a 3-year period is presented. Data are given for the primary isotopes involved, the duration of skin contamination, and the skin doses that arise from these incidents. The methods employed in performing dosimetry for skin contamination are discussed and examples involving the isotopes carbon-14 and indium-111 are described. For skin contamination incidents, the mode of penetration of the activity into skin is normally not known and this can be of major significance for the final skin dose estimate. The operational health physics difficulties encountered in complying with both ICRP-26 and UK legislation for skin contamination are considered. In the event of multiple exposure (i.e. skin doses calculated from whole body film badges, extremity TLD dose meters and skin contamination) there is ambiguity in the precise meaning of the skin dose. The usefulness of Derived Working Levels is also discussed. Experience at The Radiochemical Centre has shown that good plant design, proper training and prompt action in dealing with contamination incidents ensures that overexposures to skin from accidental contamination are rare occurrences. (author)
An Assessment of Normalized Difference Skin Index Robustness in Aquatic Environments
2014-03-27
20 11 40 0. 56 0. 57 0. 58 0. 590 . 6 0. 61 0. 62 0. 63 W av el en gt h (n m ) Reflectance 0 m L 1. 07 m L 2. 14 m L 3. 21 m L 4. 28 m L 35 .7 1...thickness from water concentration profiles obtained with Raman spectroscopy”. Acta Dermato-Venereologica, 87(1):4–8, 2007. [10] Eismann, Michael T...confocal Raman spectroscopy”. Skin Research and Technology, 16(2):137–141, 2009. [35] Nunez, Abel S. “A physical model of human skin and its application
Number of Langerhans cells is decreased in premalignant keratosis and skin cancers.
Shevchuk, Z; Filip, A; Shevchuk, V; Kashuba, E
2014-03-01
It was shown earlier that a number of CD207 positive Langerhans cells was lower in basal cell carcinomas than in the normal epidermis. Moreover, benign skin lesions presented a higher number of Langerhans cells when they were compared to malignant tumors. To count Langerhans cells, assessing expression levels of CD1A and CD207 markers in actinic keratosis, basal and squamous cell carcinomas, compared with the normal skin. Comparison of Langerhans cells might give a valuable prognostic marker for skin cancer. Immunohistochemistry and methods of statistics were used. Expression of CD1A and CD207 markers was assessed in tumor samples of actinic keratosis, cutaneous basal and squamous cell carcinomas, in comparison with the normal skin. In each cohort there were 40 patients (and 11 healthy individuals). We have shown that the number of Langerhans cells is considerably lower in cutaneous basal and squamous cell carcinomas, compared with their number in the normal skin (p keratosis, basal and squamous cell carcinoma. This may suggest an alteration of Langerhans cells phenotype in skin neoplastic diseases, making the number of Langerhans cells a valuable prognostic factor for skin tumors.
Zhu, Y H; Song, S P; Luo, W; Elias, P M; Man, M Q
2011-01-01
Studies have demonstrated that some cutaneous biophysical properties vary with age, gender and body sites. However, the characteristics of the skin friction coefficient in different genders and age groups have not yet been well established. In the present study, we assess the skin friction coefficient in a larger Chinese population. A total of 633 subjects (300 males and 333 females) aged 0.15-79 years were enrolled. A Frictiometer FR 770 and Corneometer CM 825 (C&K MPA 5) were used to measure the skin friction coefficient and stratum corneum hydration, respectively, on the dorsal surface of the hand, the forehead and the canthus. In the females, the maximum skin friction coefficients on both the canthus and the dorsal hand skin were observed around the age of 40 years. In the males, the skin friction coefficient on the dorsal hand skin gradually increased from 0 to 40 years of age, and changed little afterward. Skin friction coefficients on some body sites were higher in females than in age-matched males in some age groups. On the canthus and the dorsal hand skin of females, a positive correlation was found between skin friction coefficient and stratum corneum hydration (p skin friction coefficient was positively correlated with stratum corneum hydration on the forehead and the dorsal hand skin (p skin friction coefficient varies with age, gender and body site, and positively correlates with stratum corneum hydration on some body sites. Copyright © 2010 S. Karger AG, Basel.
An atlas of normal skeletal scintigraphy
International Nuclear Information System (INIS)
Flanagan, J.J.; Maisey, M.N.
1985-01-01
This atlas was compiled to provide the neophyte as well as the experienced radiologist and the nuclear medicine physician with a reference on normal skeletal scintigraphy as an aid in distinguishing normal variations in skeletal uptake from abnormal findings. Each skeletal scintigraph is labeled, and utilizing an identical scale, a relevant skeletal photograph and radiograph are placed adjacent to the scintigraph
Human Wharton's jelly mesenchymal stem cells promote skin wound healing through paracrine signaling.
Arno, Anna I; Amini-Nik, Saeid; Blit, Patrick H; Al-Shehab, Mohammed; Belo, Cassandra; Herer, Elaine; Tien, Col Homer; Jeschke, Marc G
2014-02-24
The prevalence of nonhealing wounds is predicted to increase due to the growing aging population. Despite the use of novel skin substitutes and wound dressings, poorly vascularized wound niches impair wound repair. Mesenchymal stem cells (MSCs) have been reported to provide paracrine signals to promote wound healing, but the effect of human Wharton's jelly-derived MSCs (WJ-MSCs) has not yet been described in human normal skin. Human WJ-MSCs and normal skin fibroblasts were isolated from donated umbilical cords and normal adult human skin. Fibroblasts were treated with WJ-MSC-conditioned medium (WJ-MSC-CM) or nonconditioned medium. Expression of genes involved in re-epithelialization (transforming growth factor-β2), neovascularization (hypoxia-inducible factor-1α) and fibroproliferation (plasminogen activator inhibitor-1) was upregulated in WJ-MSC-CM-treated fibroblasts (P≤0.05). WJ-MSC-CM enhanced normal skin fibroblast proliferation (P≤0.001) and migration (P≤0.05), and promoted wound healing in an excisional full-thickness skin murine model. Under our experimental conditions, WJ-MSCs enhanced skin wound healing in an in vivo mouse model.
Epigenetic alterations of the SERPINE1 gene in oral squamous cell carcinomas and normal oral mucosa
DEFF Research Database (Denmark)
Gao, Shan; Nielsen, Boye Schnack; Krogdahl, Annelise
2010-01-01
, 17 of 20 patients with oral carcinoma were found to have between 2.5- and 50-fold increased tumor PAI-1 mRNA level, as compared with the matched tumor-adjacent normal tissues. The PAI-1 mRNA level in connective tissues from 15 healthy volunteers was similar to the level in tumor-adjacent normal...... tissues, but the level in epithelium was 5- to 10-fold lower. Analyzing DNA methylation of 25 CpG sites within 960 bp around the transcription initiation site of the SERPINE1 gene by bisulfite sequencing, we did the surprising observation that both tumors and tumor-adjacent normal tissue had a significant...... level of methylation, whereas there was very little methylation in tissue from healthy volunteers, suggesting that tumor-adjacent normal tissue already contains transformation-associated epigenetic changes. However, there was no general inverse correlation between PAI-1 mRNA levels and SERPINE1 gene...
International Nuclear Information System (INIS)
Kim, Yeon Sil; Lee, Dong Soo; Yoo, Mi Na; Hong, Joo Young; Yoon, Se Chul; Jang, Hong Suk
2011-01-01
Use of intensity-modulated radiation therapy (IMRT) for head and neck cancer is gradually increasing, because it could facilitate more sophsticated treatment of target volumes and reduction of acute and late sequelae. However, theoretically, there is a potential risk of increased skin surface dose resulting from multiple obliquity effects caused by multiple tangential beams. Moreover, we sometimes confronted with more skin reactions in the patients treated with IMRT than conventional techniques. In this study, we evaluated skin surface dose adjacent to the target volumes to verify whether the use of IMRT would increase the skin dose more than we predicted. This study had shown that the use of IMRT did not increase the skin surface hot point dose. The measured skin surface dose was 20 to 40 percent of the adjacent target prescription dose, and was within acceptable dose range. Our study had some limitations with small number of experimental patients and methodological problems. Potential risk of increasing skin dose with bolus effect of aquaplaster should be examined in the future trials. In addition, the accurate set-up verification should be maintained because of steep dose gradient between skin surface and target volumes within a short distance in the head and neck cancer patients.
Skin cancer of Nagasaki atomic bomb survivors, 3
International Nuclear Information System (INIS)
Sadamori, Naoki; Mine, Mariko; Hori, Makoto; Noda, Yoshinori; Fujiwara, Naoko; Takahara, Osamu; Sadamori, Michiko; Nishimoto, Katsutaro; Ota, Hisahiro.
1990-01-01
In Report 1 of this series, we suspected that the incidence of skin cancer in Nagasaki A-bomb survivors might have increased based on evidence of chromosomal aberrations and clonal formations in cultured skin cells. In Report 2, we described the results of a preliminary study using 110 cases of skin cancer collected from the three major hospitals in Nagasaki City (Nagasaki University Hospital, A-bomb Hospital and Citizens Hospital). In that study a high correlation was observed between the incidence of skin cancer and exposure distance in the analysis of all 110 cases and of the 50 male cases (p<0.01), but no such correlation was noted in a separate analysis of the 60 female cases. In this report, 140 cases of skin cancer collected from 31 hospitals in Nagasaki City and adjacent districts were statistically analyzed in respect to the estimated distance from the hypocenter, using the data of a total of 66,276 A-bomb survivors recorded in the Scientific Data Center of the Atomic Bomb Disaster, Nagasaki University School of Medicine. The results disclosed a high correlation between the incidence of skin cancer and the exposure distance (p<0.01). In addition, this correlation was the same even when the cases were analyzed separately according to sex. (author)
Skin cancer of Nagasaki atomic bomb survivors, 4
International Nuclear Information System (INIS)
Sadamori, Naoki; Mine, Mariko; Hori, Makoto; Noda, Yoshinori; Fujiwara, Naoko; Takahara, Osamu; Sadamori, Michiko; Nishimoto, Katsutaro; Ota, Hisahiro.
1990-01-01
We previously reported that there was a high correlation between the exposure dose and the incidence of skin cancer in A-bomb survivors using the data of the Nagasaki Life Span Study of Radiation Effects Research Foundation and Nagasaki Tumor Registry. In Report 3 of this series, we clarified that the correlation between the exposure distance and the incidence of skin cancer was statistically significant in 140 cases of skin cancer collected from 31 hospitals in Nagasaki City and adjacent districts on the basis of the data of the total 66,276 A-bomb survivors recorded in the Scientific Data Center of Atomic Bomb Disaster, Nagasaki University School of Medicine, and that the correlation was the same even when the cases were divided by sex. In this report, we examined the chronological change of the incidence of skin cancer in Nagasaki A-bomb survivors, using the data of the Scientific Data Center of Atomic Bomb Disaster. It is likely that the incidence of skin cancer in Nagasaki A-bomb survivors has increased after 1962, especially after 1975 in those exposed within 2.5km from the hypocenter compared to those exposed at 3.0km or more. (author)
International Nuclear Information System (INIS)
Giudici, T.A.; Chen, R.G.; Oizumi, J.; Shaw, K.N.; Ng, W.G.; Donnell, G.N.
1986-01-01
Normal human skin fibroblasts and those from methylmalonic acidemia and propionic acidemia patients were grown in culture. Following incubation with [1- 14 C]propionate, the major lipid classes in the cells were separated by thin layer chromatography and isolated fractions analyzed by radio gas chromatography for the presence of odd-numbered long-chain fatty acids; the pattern of even-numbered long-chain fatty acids was obtained also. Normal fibroblasts incorporated a small percentage of propionate into odd-numbered fatty acids which were present in all lipids studied. The abnormal cells incorporated a larger amount while maintaining the characteristic ratios of odd-numbered fatty acids found in the normal line. Most of the radioactivity was associated with phospholipids which are the predominant constituents of cell membranes. A characteristic C15/C17 ratio was found for different phospholipids and the triglyceride fraction; pentadecanoic acid was the principal odd-numbered fatty acid utilized in the assembly of complex lipids. Compared to even-numbered long-chain fatty acids the absolute amount of odd-numbered fatty acids was low (1-2%), even in affected cells. An unusual polar lipid fraction was isolated in the course of the study. In the normal cell it contained several unlabeled eicosanoids which were missing from the same fraction of both affected cell lines
Directory of Open Access Journals (Sweden)
Bharat Bhushan
2012-11-01
Full Text Available Skin can be damaged by the environment easily. Skin cream is an effective and rapid way to moisten the skin by changing the skin surface properties. Rat skin and pig skin are common animal models for studies and were used as skin samples in this study. The nano- and macroscale friction and durability of damaged skin were measured and compared with those of virgin (intact/undamaged skin. The effect of skin cream on friction and durability of damaged and virgin skin samples is discussed. The effects of velocity, normal load, relative humidity and number of cycles were studied. The nanoscale studies were performed by using atomic force microscope (AFM, and macroscale studies were performed by using a pin-on-disk (POD reciprocating tribometer. It was found that damaged skin has different mechanical properties, surface roughness, contact angle, friction and durability compared to that of virgin skin. But similar changes occur after skin cream treatment. Rat and pig skin show similar trends in friction and durability.
Polarization singularities of the object field of skin surface
International Nuclear Information System (INIS)
Angelsky, O V; Ushenko, A G; Ushenko, Yu A; Ushenko, Ye G
2006-01-01
The paper deals with the investigation of formation mechanisms of laser radiation polarization structure scattered by an optically thin surface layer of human skin in two registration zones: a boundary field and a far zone of Fraunhofer diffraction. The conditions of forming polarization singularities by such an object in the scattered radiation field have been defined. Statistical and fractal polarization structure of object fields of physiologically normal and pathologically changed skin has been studied. It has been shown that polarization singularities of radiation scattered by physiologically normal skin samples have a fractal coordinate structure. It is characteristic for fields of pathologically changed skin to have a statistical coordinate structure of polarization singularities in all diffraction zones
Friction coefficient of skin in real-time.
Sivamani, Raja K; Goodman, Jack; Gitis, Norm V; Maibach, Howard I
2003-08-01
Friction studies are useful in quantitatively investigating the skin surface. Previous studies utilized different apparatuses and materials for these investigations but there was no real-time test parameter control or monitoring. Our studies incorporated the commercially available UMT Series Micro-Tribometer, a tribology instrument that permits real-time monitoring and calculation of the important parameters in friction studies, increasing the accuracy over previous tribology and friction measurement devices used on skin. Our friction tests were performed on four healthy volunteers and on abdominal skin samples. A stainless steel ball was pressed on to the skin with at a pre-set load and then moved across the skin at a constant velocity of 5 mm/min. The UMT continuously monitored the friction force of the skin and the normal force of the ball to calculate the friction coefficient in real-time. Tests investigated the applicability of Amonton's law, the impact of increased and decreased hydration, and the effect of the application of moisturizers. The friction coefficient depends on the normal load applied, and Amonton's law does not provide an accurate description for the skin surface. Application of water to the skin increased the friction coefficient and application of isopropyl alcohol decreased it. Fast acting moisturizers immediately increased the friction coefficient, but did not have the prolonged effect of the slow, long lasting moisturizers. The UMT is capable of making real-time measurements on the skin and can be used as an effective tool to study friction properties. Results from the UMT measurements agree closely with theory regarding the skin surface.
Institute of Scientific and Technical Information of China (English)
TANG Jin; GUO Wei-chun; YU Ling; ZHAO Sheng-hao
2010-01-01
Objective: To observe the clinical efficacy of artificial skin combined with vacuum sealing drainage (VSD) in treating large-area skin defects.Methods: Totally 18 patients with skin defects, treated with artificial skin combined with VSD from September 2008to May 2009 in our hospital, were retrospectively analyzed in this study. There were 15 males and 3 females, aged 7-66years, 34.3 years on average. Among them, 10 cases had skin laceration caused by traffic accidents (7 with open fractures), 1 mangled injury, 1 blast injury, 1 stump infection combined with skin defects after amputation and 5 heel ulcers.Results: All skin grafts in 16 cases survived after being controlled by VSD for one time. For the rest 2 patients,one with skin avulsion on the left foot was given median thickness skin grafts after three times of VSD, the other with open fractures in the left tibia and fibula caused by a traffic accident was given free flap transplantation. Skin grafts of both patients survived, with normal color and rich blood supply.Conclusion: Skin grafting in conjunction with artificial skin and VSD is much more effective than traditional dressing treatment and worth wide application in clinic.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Elevation of telomerase activity in chronic radiation ulcer of human skin
International Nuclear Information System (INIS)
Li Xiaoying; Zhao Po; Wang Dewen; Yang Zhixiang
1997-01-01
Objective: To investigate the levels of telomerase activity in chronic radiation ulcers of human skin and the possible relationship between the enzyme and cancer transformation. Method: Using nonisotopic telomere repeat amplification protocol (TRAP), detections were performed in 20 cases of chronic radiation ulcers of human skin, 5 cases of normal skin tissues and 5 cases of carcinoma. Results: The positive rates for telomerase activity were 30.0%(6/20), 0(0/5) and 100%(5/5) in chronic radiation ulcers of human skin, normal skin and carcinoma, respectively. The telomerase activity in radiation ulcer was weaker than in carcinoma. Conclusion: The telomerase activity assay might be used as a marker for predicting the prognosis and the effect of treatment in chronic radiation ulcer of human skin
The Pinking Shears: A Novel Tool for Improving Skin Graft Cosmesis
Directory of Open Access Journals (Sweden)
Cormac W. Joyce, MB BCh
2014-12-01
Full Text Available Summary: A significant aesthetic disadvantage to split skin grafts is the obvious transition between the graft and the normal skin. We report on a novel method to interrupt this transition point by using pinking shears, which are dressmaking scissors with saw-toothed blades that create a chevron pattern instead of a straight edge. We describe a case where the pinking shears were utilized on a split skin graft and Integra for reconstruction of the skin on a volar forearm. This technique allows for breaking-up of the transition point between the skin graft and normal skin and gives rise to an improved aesthetic outcome as the boundary is significantly less well-defined. This novel method shows promise and further study is certainly warranted.
Chronologic and actinically induced aging in human facial skin
International Nuclear Information System (INIS)
Gilchrest, B.A.; Szabo, G.; Flynn, E.; Goldwyn, R.M.
1983-01-01
Clinical and histologic stigmata of aging are much more prominent in habitually sun-exposed skin than in sun-protected skin, but other possible manifestations of actinically induced aging are almost unexplored. We have examined the interrelation of chronologic and actinic aging using paired preauricular (sun-exposed) and postauricular (sun-protected) skin specimens. Keratinocyte cultures derived from sun-exposed skin consistently had a shorter in vitro lifespan but increased plating efficiency compared with cultures derived from adjacent sun-protected skin of the same individual, confirming a previous study of different paired body sites. Electron microscopic histologic sections revealed focal abnormalities of keratinocyte proliferation and alignment in vitro especially in those cultures derived from sun-exposed skin and decreased intercellular contact in stratified colonies at late passage, regardless of donor site. One-micron histologic sections of the original biopsy specimens revealed no striking site-related keratinocyte alterations, but sun-exposed specimens had fewer epidermal Langerhans cells (p less than 0.001), averaging approximately 50 percent the number in sun-protected skin, a possible exaggeration of the previously reported age-associated decrease in this cell population. These data suggest that sun exposure indeed accelerates aging by several criteria and that, regardless of mechanism, environmental factors may adversely affect the appearance and function of aging skin in ways amenable to experimental quantitation
Ding, Jin-Ping; Fang, Lin; Wang, Lian-Zhao
2015-01-01
Secondary skin graft contraction leading to cosmetic deformity remains a great challenge. These two case reports present serious skin graft contraction and the treatment with micro-plasma radiofrequency technology. Two patients presented with complaints of post-burn depigmentation on the forehead and the hand, respectively, and received dermabrasion and thin split-thickness skin grafting. Then, many localized contraction lesions occurred after 4 weeks. The treatment selected was non-surgical removal using micro-plasma radiofrequency technology with the following energy parameters: a roller tip at 80 watts, three passes in different directions. No complications were observed. The contracted skin was ablated without affecting the pigment distribution. The consequents were that the color, appearance, and texture of the grafted skin matched the adjacent skin well and had better patient acceptance.
Energy Technology Data Exchange (ETDEWEB)
Rude' e, J.M.; Friedberg, E.C.
1977-03-01
Rates of semiconservative DNA synthesis have been investigated in asynchronous xeroderma pigmentosum (XP), XP variant, and normal human skin fibroblasts using the technique of cellular autoradiography. In unirradiated cells, no differences in DNA synthesis rates were detected among the three cell strains. Exposure to uv radiation caused the rate of DNA synthesis to decrease for at least three hours in all three cell strains. In the normal cell strain, recovery of the DNA synthetic rate occurred at later times following a uv fluence of 5 J/m2. At this same uv fluence, recovery was absent in classical XP cells during a 24 h post-irradiation period while it was slower than normal in XP variant cells. When the uv fluence to classical XP and XP variant cells was reduced so that survival in all three cell strains was approximately the same (25%), recovery of the DNA synthetic rate was similar in all three cell strains. These results are discussed in terms of current models of DNA replication in uv-irradiated cells and indicate: (1) that pyrimidine dimers are very effective blocks to DNA synthesis and (2) that there is no inherent defect in semi-conservative DNA synthesis in either classical XP or XP variant cells which is independent of a defect in DNA repair capacity.
Han, J Y; Nam, G W; Lee, H K; Kim, M J; Kim, E J
2015-11-01
This study was conducted to develop methods for measuring skin fine-structure via optical image and apparatus for photographing to analyze efficacy of anti-aging. We developed an apparatus named 3D Skin CycloScan(™) to evaluate the efficacy of cosmetics by imagification of skin fine-structure such as wrinkles, pores, and skin texture. The semi-sphere shaped device has 12 different sequential flashing light sources captures optical image simultaneously in one second to exclude the influence of the subject's movement. The normal map that is extracted through shape from shading method is composed of face contour and skin fine-structure parts. When the low-frequency component which is the result of the Gaussian Filter application is eliminated, we can get only skin fine-structure. In this normal map, it is possible to extract two-dimensional vector map called direction map and we can regulate the intensity of the image of wrinkles, pores, and skin texture after filtering the direction map. We performed a clinical study to apply this new apparatus and methods to evaluate an anti-aging efficacy of cosmetics visually and validate with other conventional methods. After using anti-aging cream including 2% adenosine for 8 weeks, the total amount of fine wrinkle around eye area detected via 3D Skin CycloScan(™) was reduced by 12.1%. Also, wrinkles on crow's feet measured by PRIMOS COMPACT(®) (GFMesstechnik GmbH, Germany) reduced 11.7%. According to an aspect of the present study, by changing the direction of the lights toward to subject's skin, we can obtain the information about the fine structures present on the skin such as wrinkles, pores, or skin texture and represent it as an image. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Use of skin stretchers for single-stage bilateral mastectomies in a dog and a cat.
Miyazaki, Yuta; Aikawa, Takeshi; Shimatsu, Taichi; Nishimura, Masaaki; Sadahiro, Shigeo
2018-04-01
To describe the application of skin stretchers for closure of single-stage bilateral mastectomies in a dog and a cat. Clinical case report. A 12-year-old intact female Miniature Dachshund and a 13-year-old spayed female domestic short-hair cat. Skin stretchers were applied to the site of the skin adjacent to mammary glands for 2-4 days before surgery. Cable tension was adjusted every 6-8 hours to elongate the skin and to achieve primary closure of single-stage bilateral mastectomy without tension. Wound closure after single-stage bilateral mastectomy was achieved without tension or major complication in both animals. Use of skin stretchers allows primary closure of single-stage bilateral mastectomy in dogs and cats. © 2017 The American College of Veterinary Surgeons.
Guo, X; Ruiz, A; Rando, R R; Bok, D; Gudas, L J
2000-11-01
When exogenous [(3)H]retinol (vitamin A) was added to culture medium, normal human epithelial cells from the oral cavity, skin, lung and breast took up and esterified essentially all of the [(3)H]retinol within a few hours. As shown by [(3)H]retinol pulse-chase experiments, normal epithelial cells then slowly hydrolyzed the [(3)H]retinyl esters to [(3)H]retinol, some of which was then oxidized to [(3)H]retinoic acid (RA) over a period of several days. In contrast, cultured normal human fibroblasts and human umbilical vein endothelial cells (HUVEC) did not esterify significant amounts of [(3)H]retinol; this lack of [(3)H]retinol esterification was correlated with a lack of expression of lecithin:retinol acyltransferase (LRAT) transcripts in normal fibroblast and HUVEC strains. These results indicate that normal, differentiated cell types differ in their ability to esterify retinol. Human carcinoma cells (neoplastically transformed epithelial cells) of the oral cavity, skin and breast did not esterify much [(3)H]retinol and showed greatly reduced LRAT expression. Transcripts of the neutral, bile salt-independent retinyl ester hydrolase and the bile salt-dependent retinyl ester hydrolase were undetectable in all of the normal cell types, including the epithelial cells. These experiments suggest that retinoid-deficiency in the tumor cells could develop because of the lack of retinyl esters, a storage form of retinol.
Hydrocortisone Diffusion Through Synthetic Membrane, Mouse Skin, and Epiderm™ Cultured Skin.
Christensen, John Mark; Chuong, Monica Chang; Le, Hang; Pham, Loan; Bendas, Ehab
2011-03-01
OBJECTIVES: The penetration of hydrocortisone (HC) from six topical over-the-counter products along with one prescription cream through cultured normal human-derived epidermal keratinocytes (Epiderm™), mouse skin and synthetic nylon membrane was performed as well as the effect hydrating the skin by pre-washing was explored using the Upright Franz Cell. METHOD AND RESULTS: Permeation of HC through EpiDerm™, mouse skin and synthetic membrane was highest with the topical HC gel formulation with prewash treatment of the membranes among seven products evaluated, 198 ± 32 µg/cm(2), 746.32 ± 12.43 µg/cm(2), and 1882 ± 395.18 µg/cm(2), respectively. Pre-washing to hydrate the skin enhanced HC penetration through EpiDerm™ and mouse skin. The 24-hour HC released from topical gel with prewash treatment was 198.495 ± 32 µg/cm(2) and 746.32 ± 12.43 µg/cm(2) while without prewash, the 24-h HC released from topical gel was 67.2 ± 7.41 µg/cm(2) and 653.43 ± 85.62 µg/cm(2) though EpiDerm™ and mouse skin, respectively. HC penetration through synthetic membrane was ten times greater than through mouse skin and EpiDerm™. Generally, the shape, pattern, and rank order of HC diffusion from each commercial product was similar through each membrane.
Laser-induced fluorescence for the detection of esophageal and skin cancer
Vo-Dinh, Tuan; Panjehpour, Masoud; Overholt, Bergein F.; Julius, Clark E.; Overholt, Suzanne; Phan, Mary N.
2003-07-01
Laser-induced fluorescence (LIF) is used for in-vivo cancer diagnosis of the esophagus and skin cancer. For esophageal measurements a fiberoptic probe inserted through an endoscope was used. Autofluorescence of normal and malignant tissues were measured directly on patient skin without requiring an endoscope. Measurement of the fluorescence signal from the tissue was performed using laser excitation at 410 nm. The methodology was applied to differentiate normal and malignant tumors of the esophagus and malignant skin lesions. The results of this LIF approach were compared with histopathology results of the biopsy samples and indicated excellent agreement in the classification of normal and malignant tumors for the samples investigated.
[Skin hydration and hydrating products].
Duplan, H; Nocera, T
2018-05-01
One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.
International Nuclear Information System (INIS)
Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.
1985-01-01
Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)
Expression of p63 and Cyclooxygenase-2 and Their Correlation in Skin Tumors
Institute of Scientific and Technical Information of China (English)
WU Yan; LIU Houjun; LI Jiawen
2007-01-01
To study the expression of p63 and cyclooxygenase-2 (cox-2) in skin tumors and evaluate the correlation between p63 and cox-2, the expressions of cox-2 and p63 were measured by streptavidin-peroxidase complex immunohistochemical technique in 17 cases of skin squamous cell carcinoma (SCC), 19 cases of Bowen's disease(Bowen), 11 cases of actinic keratosis(AK), 12 cases of seborreic keratosis(SK) and 13 specimens of normal skin. Our results showed that the expression of p63 in skin squamous cell carcinoma, Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while the expression of p63 in seborreic keratosis was significantly higher than that in normal skin. The expression of cox-2 in skin squamous cell carcinoma,Bowen's disease and actinic keratosis were significantly higher than that in seborreic keratosis, while no statistical difference was noted in the expression of cox-2 between seborreic keratosis and normal skin. Cox-2 expression was positively correlated with the high p63 expression in malignant skin tumors. The increased expression of cox-2 and p63 may play an important role in the development of skin tumors and work synergetically in malignant skin tumors.
Skin cancer of Nagasaki atomic bomb survivors, 5
International Nuclear Information System (INIS)
Sadamori, Naoki; Mine, Mariko; Hori, Makoto; Noda, Yoshinori; Fujiwara, Naoko; Takahara, Osamu; Sadamori, Michiko; Nishimoto, Katsutaro; Ota, Hisahiro.
1990-01-01
We already reported that there was a high correlation between the exposure dose and the incidence of skin cancer in A-bomb survivors using the data of the Nagasaki Life Span Study of Radiation Effects Research Foundation and Nagasaki Tumor Registry. In Report 3 of this series, we confirmed that the correlation between the exposure distance and the incidence of skin cancer was statistically significant. In Report 4, we clarified that the incidence of skin cancer in proximally exposed Nagasaki A-bomb survivors when compared to distally exposed victims appears to be increasing since 1975. In this final report of the series, we examined the characteristics of skin cancer in Nagasaki A-bomb survivors using 140 skin cancer cases collected from 31 hospitals in Nagasaki City and adjacent districts on the basis of the data of a total of 66,276 A-bomb survivors recorded in the Scientific Data Center of Atomic Bomb Disaster, Nagasaki University School of Medicine. Among the various items examined, the only item that showed a statistical significance was the age at exposure in the cases of squamous cell carcinoma, i.e., those exposed within 2.5 km from the hypocenter were significantly younger than those exposed at 3.0 km or more. (author)
Time-constrained project scheduling with adjacent resources
Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.
We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with adjacent resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by
Time-constrained project scheduling with adjacent resources
Hurink, Johann L.; Kok, A.L.; Paulus, J.J.; Schutten, Johannes M.J.
2008-01-01
We develop a decomposition method for the Time-Constrained Project Scheduling Problem (TCPSP) with Adjacent Resources. For adjacent resources the resource units are ordered and the units assigned to a job have to be adjacent. On top of that, adjacent resources are not required by single jobs, but by
Imaging-guided two-photon excitation-emission-matrix measurements of human skin tissues
Yu, Yingqiu; Lee, Anthony M. D.; Wang, Hequn; Tang, Shuo; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan
2012-07-01
There are increased interests on using multiphoton imaging and spectroscopy for skin tissue characterization and diagnosis. However, most studies have been done with just a few excitation wavelengths. Our objective is to perform a systematic study of the two-photon fluorescence (TPF) properties of skin fluorophores, normal skin, and diseased skin tissues. A nonlinear excitation-emission-matrix (EEM) spectroscopy system with multiphoton imaging guidance was constructed. A tunable femtosecond laser was used to vary excitation wavelengths from 730 to 920 nm for EEM data acquisition. EEM measurements were performed on excised fresh normal skin tissues, seborrheic keratosis tissue samples, and skin fluorophores including: NADH, FAD, keratin, melanin, collagen, and elastin. We found that in the stratum corneum and upper epidermis of normal skin, the cells have large sizes and the TPF originates from keratin. In the lower epidermis, cells are smaller and TPF is dominated by NADH contributions. In the dermis, TPF is dominated by elastin components. The depth resolved EEM measurements also demonstrated that keratin structure has intruded into the middle sublayers of the epidermal part of the seborrheic keratosis lesion. These results suggest that the imaging guided TPF EEM spectroscopy provides useful information for the development of multiphoton clinical devices for skin disease diagnosis.
Use of autologous tissue engineered skin to treat porcine full-thickness skin defects
Institute of Scientific and Technical Information of China (English)
CAI Xia; CAO Yi-lin; CUI Lei; LIU Wei; GUAN Wen-xiang
2005-01-01
Objective: To explore a feasible method to repair full-thickness skin defects utilizing tissue engineered techniques. Methods: The Changfeng hybrid swines were used and the skin specimens were cut from the posterior limb girdle region, from which the keratinocytes and fibroblasts were isolated and harvested by trypsin, EDTA, and type II collagenase. The cells were seeded in Petri dishes for primary culture. When the cells were in logarithmic growth phase, they were treated with trypsin to separate them from the floor of the tissue culture dishes. A biodegradable material, Pluronic F-127, was prefabricated and mixed with these cells, and then the cell-Pluronic compounds were seeded evenly into a polyglycolic acid (PGA). Then the constructs were replanted to the autologous animals to repair the full-thickness skin defects. Histology and immunohistochemistry of the neotissue were observed in 1, 2, 4, and 8 postoperative weeks. Results: The cell-Pluronic F-127-PGA compounds repaired autologous full-thickness skin defects 1 week after implantation. Histologically, the tissue engineered skin was similar to the normal skin with stratified epidermis overlying a moderately thick collageneous dermis. Three of the structural proteins in the epidermal basement membrane zone, type IV collagen, laminin, and type VII collagen were detected using immunohistochemical methods. Conclusions: By studying the histology and immunohistochemistry of the neotissue, the bioengineered skin graft holds great promise for improving healing of the skin defects.
International Nuclear Information System (INIS)
Pineda, Arturo López; Ogoe, Henry Ato; Balasubramanian, Jeya Balaji; Rangel Escareño, Claudia; Visweswaran, Shyam; Herman, James Gordon; Gopalakrishnan, Vanathi
2016-01-01
Adenocarcinoma (ADC) and squamous cell carcinoma (SCC) are the most prevalent histological types among lung cancers. Distinguishing between these subtypes is critically important because they have different implications for prognosis and treatment. Normally, histopathological analyses are used to distinguish between the two, where the tissue samples are collected based on small endoscopic samples or needle aspirations. However, the lack of cell architecture in these small tissue samples hampers the process of distinguishing between the two subtypes. Molecular profiling can also be used to discriminate between the two lung cancer subtypes, on condition that the biopsy is composed of at least 50 % of tumor cells. However, for some cases, the tissue composition of a biopsy might be a mix of tumor and tumor-adjacent histologically normal tissue (TAHN). When this happens, a new biopsy is required, with associated cost, risks and discomfort to the patient. To avoid this problem, we hypothesize that a computational method can distinguish between lung cancer subtypes given tumor and TAHN tissue. Using publicly available datasets for gene expression and DNA methylation, we applied four classification tasks, depending on the possible combinations of tumor and TAHN tissue. First, we used a feature selector (ReliefF/Limma) to select relevant variables, which were then used to build a simple naïve Bayes classification model. Then, we evaluated the classification performance of our models by measuring the area under the receiver operating characteristic curve (AUC). Finally, we analyzed the relevance of the selected genes using hierarchical clustering and IPA® software for gene functional analysis. All Bayesian models achieved high classification performance (AUC > 0.94), which were confirmed by hierarchical cluster analysis. From the genes selected, 25 (93 %) were found to be related to cancer (19 were associated with ADC or SCC), confirming the biological relevance of our
Skin deposits in hereditary cystatin C amyloidosis
DEFF Research Database (Denmark)
Benedikz, Eirikur; Blöndal, H; Gudmundsson, G
1990-01-01
Clinically normal skin from 47 individuals aged 9-70 years was investigated. Cystatin C amyloid deposits were found in various locations of the skin by light and/or electron microscopy, in all 12 patients with a clinical history of hereditary cystatin C amyloidosis (HCCA). Six asymptomatic...... individuals, who had the Alu 1 restriction fragment length polymorphism (RFLP) marker reported to cosegregate with the disease, also had cystatin C amyloid deposits in the skin. Three asymptomatic individuals (age 17-46) belonging to the HCCA families were without amyloid in the skin but had Alu 1 RFLP marker...
Modeling of skin cancer dermatoscopy images
Iralieva, Malica B.; Myakinin, Oleg O.; Bratchenko, Ivan A.; Zakharov, Valery P.
2018-04-01
An early identified cancer is more likely to effective respond to treatment and has a less expensive treatment as well. Dermatoscopy is one of general diagnostic techniques for skin cancer early detection that allows us in vivo evaluation of colors and microstructures on skin lesions. Digital phantoms with known properties are required during new instrument developing to compare sample's features with data from the instrument. An algorithm for image modeling of skin cancer is proposed in the paper. Steps of the algorithm include setting shape, texture generation, adding texture and normal skin background setting. The Gaussian represents the shape, and then the texture generation based on a fractal noise algorithm is responsible for spatial chromophores distributions, while the colormap applied to the values corresponds to spectral properties. Finally, a normal skin image simulated by mixed Monte Carlo method using a special online tool is added as a background. Varying of Asymmetry, Borders, Colors and Diameter settings is shown to be fully matched to the ABCD clinical recognition algorithm. The asymmetry is specified by setting different standard deviation values of Gaussian in different parts of image. The noise amplitude is increased to set the irregular borders score. Standard deviation is changed to determine size of the lesion. Colors are set by colormap changing. The algorithm for simulating different structural elements is required to match with others recognition algorithms.
International Nuclear Information System (INIS)
Hirschi, M.; Netrawali, M.S.; Remsen, J.F.; Cerutti, P.A.
1981-01-01
The formation of single-strand breaks by near-ultraviolet light at 313 nm and by aerobic gamma-rays was compared for skin fibroblast monolayer cultures from 4 normal donors (NF) and 8 patients with Bloom's syndrome (BS) by the alkaline elution method. In 6 of 8 BS strains, the number of breaks induced by near-ultraviolet light, 2.25 kJ/sq m, at 0 degrees was comparable to NF, while elevated breakage was observed in BS strains HG 369 and HG 916. Breakage frequencies were increased substantially in 6 of 8 BS strains relative to NF when the near-ultraviolet light exposure was at 37 degrees. BS strain GM 2520 represents an exception since normal breakage frequencies were induced both at 0 degrees and 37 degrees. Aerobic gamma-rays (75 R) induced comparable numbers of single-strand breaks in BS and NF strains at 0 degrees. The breakage frequencies were reduced an average of 17% in NF when the same dose was given at 30 degrees followed by 6 min incubation. Under the same conditions, the breakage frequencies were on the average reduced by 42% relative to 0 degrees in the BS strains, indicating that they possess normal or possibly slightly increased capacities for the rejoining of gamma-ray-induced breaks
Directory of Open Access Journals (Sweden)
Vishnu Hosur
2017-08-01
Full Text Available In humans, gain-of-function (GOF mutations in RHBDF2 cause the skin disease tylosis. We generated a mouse model of human tylosis and show that GOF mutations in RHBDF2 cause tylosis by enhancing the amount of amphiregulin (AREG secretion. Furthermore, we show that genetic disruption of AREG ameliorates skin pathology in mice carrying the human tylosis disease mutation. Collectively, our data suggest that RHBDF2 plays a critical role in regulating EGFR signaling and its downstream events, including development of tylosis, by facilitating enhanced secretion of AREG. Thus, targeting AREG could have therapeutic benefit in the treatment of tylosis.
Permeability of commercial solvents through living human skin
DEFF Research Database (Denmark)
Ursin, C; Hansen, C M; Van Dyk, J W
1995-01-01
A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... of DMSO and octyl acetate were measured. No octyl acetate was detected and the permeability of DMSO was proportional to its mole fraction in the mixture. The effect of two hours of solvent exposure on the viability of skin (based on DNA synthesis) was measured and found to be very dependent on the solvent....
DEFF Research Database (Denmark)
Mogensen, Mette; Jørgensen, Thomas Martini; Nürnberg, Birgit Meincke
2009-01-01
BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess the diagn......BACKGROUND Optical coherence tomography (OCT) is an optical imaging technique that may be useful in diagnosis of non-melanoma skin cancer (NMSC). OBJECTIVES To describe OCT features in NMSC such as actinic keratosis (AK) and basal cell carcinoma (BCC) and in benign lesions and to assess...
Directory of Open Access Journals (Sweden)
Shun Kitaba
2011-01-01
Full Text Available We report four adult cases of atopic dermatitis (AD complicated by Sjogren's syndrome (SS. The patients fulfilled diagnostic criteria for AD and SS. All cases showed persistent itchy dry skin and eczematous lesions complicated by sicca symptoms including dry eyes and dry mouth with moderate joint pain. One case manifested annular erythema and another manifested widespread discoid erythema. To investigate the underlying cause of dry skin in these cases, sweating function was evaluated using a quantitative sudomotor axon reflex test (QSART in which the axon reflex is stimulated by acetylcholine iontophoresis. The sweating latency time was significantly prolonged in eczematous skin of AD and AD/SS compared to normal controls. Axon reflex (AXR sweat volume was also significantly reduced in AD (normal and eczematous skin and AD/SS (normal and eczema compared to normal control. In contrast, the direct sweat volume of lesional or non-lesional AD skin induced by direct stimulation with acetylcholine was only slightly reduced compared to that in normal controls, but not in SS and lesional skin of AD/SS patients. These results suggest that the impaired sweat response in AD is attributable to an abnormal sudomotor axon reflex, which is accelerated and modulated when complicated by SS resulting in dry skin in the present cases.
Li, Zhengxiao; Hu, Lizhi; Elias, Peter M; Man, Mao-Qiang
2018-02-01
Sensitive skin is defined as a spectrum of unpleasant sensations in response to a variety of stimuli. However, only some skin care products provoke cutaneous symptoms in individuals with sensitive skin. Hence, it would be useful to identify products that could provoke cutaneous symptoms in individuals with sensitive skin. To assess whether vehicles, as well as certain branded skin care products, can alter epidermal function following topical applications to normal mouse skin. Following topical applications of individual vehicle or skin care product to C57BL/6J mice twice daily for 4 days, transepidermal water loss (TEWL) rates, stratum corneum (SC) hydration and skin surface pH were measured on treated versus untreated mouse skin with an MPA5 device and pH 900 pH meter. Our results show that all tested products induced abnormalities in epidermal functions of varying severity, including elevations in TEWL and skin surface pH, and reduced SC hydration. Our results suggest that mice can serve as a predictive model that could be used to evaluate the potential safety of skin care products in humans with sensitive skin. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Discovery of skin lymphocytes was a game changer in experimental dermatology
Matos, Tiago R.; de Rie, Menno A.
2017-01-01
A substantial part of ongoing research in experimental dermatology focuses on skin T cellsfor that reason, we find important to highlight the pioneering work of Jan D. Bos et al. from 1987 (The skin immune system (SIS): Distribution and immunophenotype of lymphocyte subpopulations in normal skin)
Keilani, C; Agard, D; Duhoux, A; Lakhel, A; Giraud, O; Brachet, M; Duhamel, P; Bey, E
2017-03-31
In harvesting skin to cover the defect caused by a burn, a second wound is created, the donor site wound. We propose an alternative method to manage the donor site: taking a split-thickness skin graft (STSG) from a donor site adjacent to the burn wound to be treated, and meshing at a 3:1 ratio to cover both sites at once. The main objective of this study is to evaluate the effectiveness of covering both burn wound and adjacent donor site with the same STSG in elderly and bedridden patients. We retrospectively reviewed the medical records of 6 patients over 60 years old or/and bedridden presenting with a small burn wound who underwent STSG of both burn wound and adjacent donor site between April 2016 and November 2016 in the Department of Plastic Surgery and Burn Treatment at Percy Military Hospital (France). Their data were compared with data of five patients who had undergone the usual STSG procedure during the same period. There was a statistically significant difference between patients who underwent adjacent STSG procedure and those who underwent usual STSG procedure in healing time (days) mean (SD) (7,33 ± 1,03 vs. 16,2 ± 0,83; p = 0,007) and Numeric Rating Scale pain mean (SD) at day 2 (0,33 ± 0,33 vs. 2,4 ± 1,35; p = 0,04). Grafting both acute burn wound and adjacent donor site with the same graft seems to be an easy method to improve healing and minimize pain in the STSG donor site in elderly and bedridden patients.
Effects of irradiation of skin flaps
International Nuclear Information System (INIS)
Sumi, Y.; Ueda, M.; Oka, T.; Torii, S.
1984-01-01
The reaction of skin flaps to irradiation and the optimum postoperative time for irradiation was studied in the rat. Flaps showed different reactions depending on the time of irradiation. There was a correlation between the radiosensitivity and the vascularity of the flap. Those flaps in the marginal hypovascular stage of revascularization showed reactions similar to normal skin. However, severe adverse reactions were observed in the marginal hypervascular stage
Systemic sclerosis with normal or nonspecific nailfold capillaroscopy.
Fichel, Fanny; Baudot, Nathalie; Gaitz, Jean-Pierre; Trad, Salim; Barbe, Coralie; Francès, Camille; Senet, Patricia
2014-01-01
In systemic sclerosis (SSc), a specific nailfold videocapillaroscopy (NVC) pattern is observed in 90% of cases and seems to be associated with severity and progression of the disease. To describe the characteristics of SSc patients with normal or nonspecific (normal/nonspecific) NVC. In a retrospective cohort study, clinical features and visceral involvements of 25 SSc cases with normal/nonspecific NVC were compared to 63 SSc controls with the SSc-specific NVC pattern. Normal/nonspecific NVC versus SSc-specific NVC pattern was significantly associated with absence of skin sclerosis (32 vs. 6.3%, p = 0.004), absence of telangiectasia (47.8 vs. 17.3%, p = 0.006) and absence of sclerodactyly (60 vs. 25.4%, p = 0.002), and less frequent severe pulmonary involvement (26.3 vs. 58.2%, p = 0.017). Normal/nonspecific NVC in SSc patients appears to be associated with less severe skin involvement and less frequent severe pulmonary involvement. © 2014 S. Karger AG, Basel.
Temperament affects sympathetic nervous function in a normal population.
Kim, Bora; Lee, Jae-Hon; Kang, Eun-Ho; Yu, Bum-Hee
2012-09-01
Although specific temperaments have been known to be related to autonomic nervous function in some psychiatric disorders, there are few studies that have examined the relationship between temperaments and autonomic nervous function in a normal population. In this study, we examined the effect of temperament on the sympathetic nervous function in a normal population. Sixty eight healthy subjects participated in the present study. Temperament was assessed using the Korean version of the Cloninger Temperament and Character Inventory (TCI). Autonomic nervous function was determined by measuring skin temperature in a resting state, which was recorded for 5 minutes from the palmar surface of the left 5th digit using a thermistor secured with a Velcro® band. Pearson's correlation analysis and multiple linear regression were used to examine the relationship between temperament and skin temperature. A higher harm avoidance score was correlated with a lower skin temperature (i.e. an increased sympathetic tone; r=-0.343, p=0.004) whereas a higher persistence score was correlated with a higher skin temperature (r=0.433, p=0.001). Hierarchical linear regression analysis revealed that harm avoidance was able to predict the variance of skin temperature independently, with a variance of 7.1% after controlling for sex, blood pressure and state anxiety and persistence was the factor predicting the variance of skin temperature with a variance of 5.0%. These results suggest that high harm avoidance is related to an increased sympathetic nervous function whereas high persistence is related to decreased sympathetic nervous function in a normal population.
Institute of Scientific and Technical Information of China (English)
ZHOU Hongbo; CHEN Zhuchang
2007-01-01
Based on the comparative analysis of end effect on skin friction of displacement-pile (driven pile),the end effect on skin friction of bored pile is studied.The end effect on skin friction between driven pile and bored pile is different and the end effect on skin friction of bored pile is reduce of skin friction in the soil layer adjacent to the pile end.The degradation degree of skin friction is deduced with the increase of the distance from pile end.The concept of additional mud cake formed by the effect of cushion at the bottom of borehole during pouring concrete is introduced to explain the mechanism of end effect on skin friction of the bored pile.The test results of post-grouting piles indicate that the post-grouting technique is an effective way to improve the end effect on skin friction of bored pile.
Zouboulis, Christos C; Elewa, Rana; Ottaviani, Monica; Fluhr, Joachim; Picardo, Mauro; Bernois, Armand; Heusèle, Catherine; Camera, Emanuela
2018-03-01
Skin aging is associated with alterations of surface texture, sebum composition and immune response. Mechanical stress induces repair mechanisms, which may be dependent on the age and quality of the skin. The response to mechanical stress in young and aged individuals, their subjective opinion and the objective effectiveness of skin care products were evaluated by biophysical skin quality parameters (stratum corneum hydration, transepidermal water loss, skin pH, pigmentation and erythema) at baseline, 1, 6, 24h and 7days at the forearms of 2 groups of healthy volunteers, younger than 35 years (n=11) and older than 60 years (n=13). In addition, casual surface lipid composition was studied under the same conditions at the baseline and day 7 after mechanical stress induction. Evaluations were also performed in stressed skin areas treated daily with skin care products and the subjective opinion of the volunteers was additionally documented. The tested groups exhibited age-associated baseline skin functions as well as casual surface lipid composition and different reaction patterns to mechanical stress. Skin care was more effective in normalizing skin reaction to stress in the young than in the aged group. The subjective volunteer opinion correlated with the objective measurements. Copyright © 2017 Elsevier B.V. All rights reserved.
Raman spectroscopy reveals biophysical markers in skin cancer surgical margins
Feng, Xu; Moy, Austin J.; Nguyen, Hieu T. M.; Zhang, Yao; Fox, Matthew C.; Sebastian, Katherine R.; Reichenberg, Jason S.; Markey, Mia K.; Tunnell, James W.
2018-02-01
The recurrence rate of nonmelanoma skin cancer is highly related to the residual tumor after surgery. Although tissueconserving surgery, such as Mohs surgery, is a standard method for the treatment of nonmelanoma skin cancer, they are limited by lengthy and costly frozen-section histopathology. Raman spectroscopy (RS) is proving to be an objective, sensitive, and non-destructive tool for detecting skin cancer. Previous studies demonstrated the high sensitivity of RS in detecting tumor margins of basal cell carcinoma (BCC). However, those studies rely on statistical classification models and do not elucidate the skin biophysical composition. As a result, we aim to discover the biophysical differences between BCC and primary normal skin structures (including epidermis, dermis, hair follicle, sebaceous gland and fat). We obtained freshly resected ex vivo skin samples from fresh resection specimens from 14 patients undergoing Mohs surgery. Raman images were acquired from regions containing one or more structures using a custom built 830nm confocal Raman microscope. The spectra were grouped using K-means clustering analysis and annotated as either BCC or each of the five normal structures by comparing with the histopathology image of the serial section. The spectral data were then fit by a previously established biophysical model with eight primary skin constituents. Our results show that BCC has significant differences in the fit coefficients of nucleus, collagen, triolein, keratin and elastin compared with normal structures. Our study reveals RS has the potential to detect biophysical changes in resection margins, and supports the development of diagnostic algorithms for future intraoperative implementation of RS during Mohs surgery.
Al-Nsour, Hind Fahed; Al-Zoubi, Tamara Trad; Al-Rimawi, Ali Salaheddin
2018-03-01
Facial and dental aesthetics are becoming of great concern for patients, especially for the younger generation. Tooth color matching and selection is considered a vital element in order to create an attractive beautiful smile. The importance of tooth color matching is to adjust tooth colors to obtain a good match with adjacent teeth and the skin. This is considered a challenge especially if adjacent teeth were lost or records of patients' teeth color were not available. The aim of this study was to determine the relationship between skin complexion and tooth value in a Jordanian population. A cross-sectional study of 520 individuals who were randomly selected and belonging to different age groups, ranging from 15-65 years, with equal sex distribution. These patients visited the dental clinics at different Jordanian military hospitals. The study was carried out over a period of one year from 2015 to 2016. The randomly selected sample was examined by one researcher. Shade of the middle third of the labial surface of central incisor was determined visually using VITA tooth guide, 3D-MASTER shade guide. Tooth shades were divided into two categories according to their value. The skin complexion was identified using Fitzpatrick skin type test, and was categorized into two categories (fair and dark). Data were statistically analyzed using Epi Info version 6. A statistically significant tooth shade value difference was discovered among subjects of different skin color (pvalue among a Jordanian population. Thus, considering the skin complexion when choosing tooth shades is helpful in achieving a pleasing good-looking smile, yet further investigations in this field must be carried out.
International Nuclear Information System (INIS)
Wahner, H.W.; Robertson, J.S.
1983-01-01
With respect to skin pedicles (tubular pedicle or direct flap), an estimation of the blood supply is of great importance in making a decision as to when to perform the separation from the original blood supply. This decision is based on empiric observation of the normal time of healing and varies greatly with the site and the concepts of the individual surgery. A number of methods have been proposed for testing the circulation of pedicle skin flaps or tubes, and these methods all seem more complicated and less accurate than the isotope method that is described in this chapter
Tribology of human skin and mechanical skin equivalents in contact with textiles
Derler, S.; Schrade, G.U.; Gerhardt, L.C.
2007-01-01
The friction of untreated human skin (finger) against a reference textile was investigated with 12 subjects using a force plate. In touch experiments, in which the subjects assessed the surface roughness of the textile at normal loads of 1.5 ± 0.7 N, the average friction coefficients ranged from
T-cell receptor gamma delta bearing cells in normal human skin
Bos, J. D.; Teunissen, M. B.; Cairo, I.; Krieg, S. R.; Kapsenberg, M. L.; Das, P. K.; Borst, J.
1990-01-01
T-cell antigen receptors (TCR) are divided into common alpha beta and less common gamma delta types. In the murine skin, TCR gamma delta+ cells have been reported to form the great majority of epidermal T lymphocytes. We have examined the relative contribution of TCR alpha beta+ and TCR gamma delta+
Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin
Directory of Open Access Journals (Sweden)
Nisbet SJ
2018-04-01
Full Text Available Stephanie J Nisbet Skin Health Medical Affairs, GSK Consumer Healthcare, Weybridge, Surrey, UK Purpose: This 3-week, open-label, noncomparative clinical study evaluated the skin acceptability of a cosmetic moisturizer in subjects with sensitive skin, by monitoring adverse events (AEs and cutaneous discomfort related to normal usage.Materials and methods: Female subjects aged between 18–60 years, with Fitzpatrick phototype classification I–IV and sensitive skin, verified by a positive reaction on the stinging test at screening, were included. Subjects applied the moisturizer to their face and body twice daily for 21±2 days at home and recorded study product usage and feelings of cutaneous discomfort (eg, dryness, prickling, stinging, and itching in a diary; any AEs were reported to the clinic. At study end, skin acceptability of the moisturizer was investigator-assessed based on the nature of AEs and subjects’ self-reported feelings of discomfort, and by clinical evaluation of skin reactions in the area of moisturizer application (appearance of erythema, formation of edema, and skin desquamation; scored according to an adapted Draize and Kligman scale. Only subjects with a treatment compliance of ≥80% were included in the final analysis.Results: In total, 35 subjects initiated and completed the study; all were compliant to the minimum study product usage. Per investigator clinical dermatological assessment at study end, none of the 35 subjects had skin reactions in the area of moisturizer application and there were no reported AEs. One subject reported sensations of mild prickling and itching immediately after applying the moisturizer (not classified as AEs, which spontaneously remitted after complete absorption of the product and were noted only in exposed areas. These events were considered by the investigator as being possibly/probably related to the use of study product; however, no clinical signs of skin reaction were observed in
Resveratrol anti-ultraviolet-induced guinea pig skin injury
International Nuclear Information System (INIS)
Li Wenxing; Zhao Ying
2014-01-01
Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)
Personnel decontamination and preventive skin care
International Nuclear Information System (INIS)
Henning, Klaus; Gojowczyk, Peter
2010-01-01
Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)
Effects of tretinoin on wound healing in aged skin.
de Campos Peseto, Danielle; Carmona, Erica Vilaça; Silva, Kellyn Cristina da; Guedes, Flavia Roberta Valente; Hummel Filho, Fernando; Martinez, Natalia Peres; Pereira, José Aires; Rocha, Thalita; Priolli, Denise Gonçalves
2016-03-01
Aged and adult populations have differences in the structural, biological, and healing properties of skin. Comparative studies of healing under the influence of retinoids in both these populations are very important and, to the best of our knowledge, have not been performed to date. The purpose of this study was to compare the activities of topical tretinoin in aged and adult animal models of wound healing by secondary intention. Male aged rats (24 months old, n = 7) and adult rats (6 months old, n = 8) were used. The rats were assigned to the following groups according to the dates on which wound samples were excised (day 14 or 21 after model creation): treated group, control group, and naive group. Topical application of tretinoin cream was used only on the proximal wound and was applied daily for 7 days. Wound healing areas were measured using metal calipers, and morphological analysis was performed. Slides were stained with Hematoxylin and Eosin, Masson's trichrome, and periodic acid-Schiff stains. Statistical analysis adopted a 5% coefficient for rejection of the null hypothesis. Although aged animals showed skin repair, complete reepithelialization was found on day 21 in some animals of both groups (treated and control). In aged rats, the wound area was significantly smaller in treated wounds than in untreated wounds, resulting in a larger scar area compared with the adult group. When treated wounds were compared, no differences were found between the wound areas in adult and aged rats. As expected, the collagen concentration was higher in normal skin from adult rats than in normal skin from aged animals, but there was no difference when aged skin was treated with tretinoin. These results indicate that tretinoin increases collagen synthesis in aged skin and returns the healing process to a normal state of skin healing. © 2016 by the Wound Healing Society.
Resistance of germfree athymic nude mice to two-stage skin carcinogenesis
Energy Technology Data Exchange (ETDEWEB)
Holland, J.M.; Perkins, E.H.
1979-01-01
Germfree athymic and normal littermate mice were compared with respect to their relative sensitivity to single skin application of dimethylbenzanthacine followed either by croton oil or TPA applied as a co-carcinogen. In separate experiments the acute response of both phenotypes to TPA was assessed by histologic examination of skin as well as the incorporttion of tritiated thymidine into acid insoluble material obtained from the isolated epidermis. Nude mice were observed to be less, equal, or more sensitive than normal littermate to topical skin carcinogenesis depending upon experimental variables. The tendency of solvent to spread rapidly on the skin of nude mice appeared to have the greatest influence on susceptibility to papilloma induction. Other factors of potential, although unproven importance, include differences in skin structure, possibly associated with accelerated activity of hair follicles as well as resistance to both the inflammatory and hyperplasiogenic effects of TPA.
Directory of Open Access Journals (Sweden)
NKA Maya Damayanti
2013-12-01
Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 So far, a lot of people who want their face skin always looks young though age continued to grow. It cannot be denied that aging will occur in everyone although some faster or later occur. Various ways were developed by scientists to fix this issue. Laser Skin Resurfacing (LSR technique to tighten facial skin is a procedure that is popular among the public and the practice of medicine. CO2 LSR technique is still a gold standard was used. Pain during surgery can be reduced when this technique was combined with air cooling. In addition, the adverse effects of post-operative might be tolerated. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}
Elevated c-Src and c-Yes expression in malignant skin cancers
Directory of Open Access Journals (Sweden)
Lee Jang
2010-08-01
Full Text Available Abstracts Background Src family kinases (SFKs play an important role in cancer proliferation, survival, motility, invasiveness, metastasis, and angiogenesis. Among the SFKs, c-Src and c-Yes are particularly over-expressed or hyper-activated in many human epithelial cancers. However, only a few studies have attempted to define the expression and role of c-Src and c-Yes in cutaneous carcinomas. Objectives To investigate the expression of c-Src and c-Yes in cutaneous carcinomas to include malignant melanoma (MM, squamous cell carcinoma (SCC and basal cell carcinoma (BCC. Methods We examined 6 normal skin tissues and 18 malignant skin tumor tissues using western blotting for the expression of c-Src and c-Yes. In another set, 16 specimens of MM, 16 SCCs and 16 BCCs were analyzed for the expression of c-Src and c-Yes using immunohistochemical staining. Results Western blotting showed that c-Src was expressed in all malignant skin tumors, but not in normal skin, while c-Yes was expressed in MM and SCC, but not in BCC and normal skin. Immunohistochemical staining results of c-Src and c-Yes in MM, SCC, and BCC mirrored those of the western blot analysis. Conclusions c-Src, rather than c-Yes, plays a key role in the proliferation and progression of malignant skin cancers.
Volumetric Visualization of Human Skin
Kawai, Toshiyuki; Kurioka, Yoshihiro
We propose a modeling and rendering technique of human skin, which can provide realistic color, gloss and translucency for various applications in computer graphics. Our method is based on volumetric representation of the structure inside of the skin. Our model consists of the stratum corneum and three layers of pigments. The stratum corneum has also layered structure in which the incident light is reflected, refracted and diffused. Each layer of pigment has carotene, melanin or hemoglobin. The density distributions of pigments which define the color of each layer can be supplied as one of the voxel values. Surface normals of upper-side voxels are fluctuated to produce bumps and lines on the skin. We apply ray tracing approach to this model to obtain the rendered image. Multiple scattering in the stratum corneum, reflective and absorptive spectrum of pigments are considered. We also consider Fresnel term to calculate the specular component for glossy surface of skin. Some examples of rendered images are shown, which can successfully visualize a human skin.
Human normal tissue reactions in radiotherapy
International Nuclear Information System (INIS)
Taniike, Keiko
1990-01-01
Acute and late normal tissue reactions in radiotherapy have not been considered to be major problems with conventional fractionation. But they may cause certain problems when newer schedules such as hyperfractionation or accelerated fractionation are used. In opposing parallel radiotherapy, the dose fractionation of skin or subcutaneous connective tissue are different between in one portal and two portals daily. So we examined acute skin erythema and late connective tissue fibrosis in the two groups (one and two portals) of the patients with uterus cancer. Acute skin erythema and late connective tissue fibrosis were slightly stronger in case of one portal daily. In relation to the anatomical site of skin, acute skin erythema was stronger at the buttocks than the lower abdomen, but late fibrosis was reverse to that. So the degree of acute skin erythema did not predict the degree of late connective tissue fibrosis. The number of Time Dose Fractionation Factor could roughly estimate the degree of erythema and fibrosis. Late fibrosis in 36 fractions increased with an increase of abdominal thickness, but acute erythema did not. (author)
Spectral Detection of Human Skin in VIS-SWIR Hyperspectral Imagery without Radiometric Calibration
2012-03-01
6 Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less melanin appears brighter because it has higher reflectance...6 illustrates the spectral reflectance of human skin with different melanin levels. One paper proposes a Normalized Difference Skin Index (NDSI), a...1.4% Melanin 12.6% Melanin 23.2% Melanin 34.3% Melanin 45% Melanin Figure 6. Spectral reflectance of human skin at VIS-SWIR wavelengths. Skin with less
Directory of Open Access Journals (Sweden)
Chermaine Deepa Antony
2016-01-01
Full Text Available Purpose. This study investigates the association between focal nodular mass with low signal in Hoffa’s fat pad adjacent to anterior femoral cartilage of the knee (FNMHF and focal cartilage abnormality in this region. Method. The magnetic resonance fast imaging employing steady-state acquisition sequence (MR FIESTA sagittal and axial images of the B1 and C1 region (described later of 148 patients were independently evaluated by two reviewers and categorized into four categories: normal, FNMHF with underlying focal cartilage abnormality, FNMHF with normal cartilage, and cartilage abnormality with no FNMHF. Results. There was a significant association (p=0.00 between FNMHF and immediate adjacent focal cartilage abnormality with high interobserver agreement. The absence of focal nodular lesions next to the anterior femoral cartilage has a very high negative predictive value for chondral injury (97.8%. Synovial biopsy of focal nodular lesion done during arthroscopy revealed some fibrocollagenous tissue and no inflammatory cells. Conclusion. We postulate that the FNMHF adjacent to the cartilage defects is a form of normal healing response to the cartilage damage. One patient with FHMHF and underlying cartilage abnormality was rescanned six months later. In this patient, the FNMHF disappeared and normal cartilage was observed in the adjacent region which may support this theory.
Late changes in pig skin after irradiation from beta-emitting sources of different energy
International Nuclear Information System (INIS)
Hamlet, R.; Heryet, J.C.; Hopewell, J.W.; Wells, J.; Charles, M.W.
1986-01-01
Skin fields were irradiated on 3-month-old pigs with Sr 90 , Tm 170 and Pm 147 sources, ranging in size from 1mm to 22.5 mm in diameter. The severity of late skin atrophy was assessed 2 years after irradiation by a comparison of the thickness of the dermis in exposed skin with that of an adjacent area of unirradiated skin. Quantitative measurements were made from histological sections. The maximum dermal thinning after Sr 90 β-irradiation was approx. 55%. Irradiation with Tm 170 produced a maximal thinning of approximately 35%. Irradiation with Pm 147 produced no observable atrophy in pig skin. These differences reflect the different depth-dose characteristics of the three β-emitting sources. Significant late dermal atrophy was seen after doses which only produced a minimal erythema in the acute phase of the reaction. There was also a lack of a field-size effect for late atrophy with all but the two smallest Sr 90 sources. This is the converse of the marked field-size effects reported for the acute skin reactions. (author)
Energy Technology Data Exchange (ETDEWEB)
Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)
2013-02-15
Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.
International Nuclear Information System (INIS)
Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling
2013-01-01
Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside
Fritz, Jason R; Phillips, Brett T; Conkling, Nicole; Fourman, Mitchell; Melendez, Mark M; Bhatnagar, Divya; Simon, Marcia; Rafailovich, Miriam; Dagum, Alexander B
2012-10-01
Dermal substitutes are currently used in plastic surgery to cover various soft tissue defects caused by trauma, burns, or ablative cancer surgery. Little information is available on the biomechanical properties of these dermal substitutes after adequate incorporation as compared to normal skin. Determining parameters such as tensile strength in these skin substitutes will help us further understand their wound healing properties and potential in developing artificial tissue constructs. We hypothesize that a dermal substitute has a lower stress-strain curve and altered stress-induced deformation quantified with tensiometry and digital image speckle correlation (DISC) analysis. Two separate 5×10-cm full-thickness wounds were created on the dorsum of 3 female swine. Fibrin glue was applied before either a full-thickness skin graft (FTSG) or application of artificial dermal matrix. On day 42, cultured autologous keratinocytes were applied as a cell sheet to the wound covered with Integra. On day 56, the wounds were fully excised and fresh tissue specimens, including normal skin, were stored in a physiological solution and prepared for analysis. Rectangular samples were excised from the center of each specimen measuring 4×4×30 mm. Using a tensiometer and DISC analysis, we evaluated the tensile strength of 3 different groups of skin, namely, normal, FTSG, and Integra. There is a significant difference between the Integra specimen when compared to normal skin and FTSG. We found a minimal difference in the stress-strain curves of the latter two. Integra alone shows plastic deformation with continued stretching before ultimate midline fracture. There is significant change between the Young's moduli of the normal skin and the Integra, whereas there is little difference between the FTSG and the normal skin; DISC confirms this analysis. The normal skin and FTSG show a convergence of vectors to a linear plane, whereas Integra shows very little organization. Using 2 different
Kremer, M; Lang, E; Berger, A C
2000-09-01
origin. These experimental results demonstrate the establishment of an effective cell cultivation process which may be suitable for scale-up production of the epidermal component as large-scale composite-skin grafts. When seeded into Integratrade mark and grafted onto the nude mouse a replacement skin with normal functioning dermal-epidermal components was developed. These results encourage the design of a clinical trial to assess the function of this composite graft in man.
Wang, Liyun; Yan, Feng; Yang, Yujia; Xiang, Xi; Qiu, Li
2017-07-01
The purpose of this study was to evaluate the usefulness of ultrasound shear-wave elastography (US-SWE) in characterization of localized scleroderma (LS), as well as in the disease staging. A total of 21 patients with 37 LS lesions were enrolled in this study. The pathologic stage (edema, sclerosis or atrophy) of the lesions was characterized by pathologic examination. The skin elastic modulus (E-values including E mean , E min , E max and E sd ) and thickness (h) was evaluated both in LS lesions and site-matched unaffected skin (normal controls) using US-SWE. The relative difference of E-values (E RD ) was calculated between each pair of lesions and its normal control for comparison among different pathologic stages. Of the 37 LS lesions, 2 were in edema, 22 were in sclerosis and 13 were in atrophy. US-SWE results showed a significant increase of skin elastic modulus and thickness in all lesions (p < 0.001 in sclerosis and p < 0.05 in atrophy) compared with the normal controls. The measured skin elastic modulus and thickness were greater in sclerosis than in atrophy. However, once normalized by skin thickness, the atrophic lesions, which were on average thinner, appeared significantly stiffer than those of the sclerosis (normalized E RD : an increase of 316.3% in atrophy vs. 50.6% in sclerosis compared with the controls, p = 0.007). These findings suggest that US-SWE allows for quantitative evaluation of the skin stiffness of LS lesions in different stages; however, the E-values directly provided by the US-SWE system alone do not distinguish between the stages, and the normalization by skin thickness is necessary. This non-invasive, real-time imaging technique is an ideal tool for assessing and monitoring LS disease severity and progression. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.
Nguyen, Dai Q A; Potokar, Tom S; Price, Patricia
2010-02-01
The field of wound healing and tissue repair has advanced rapidly in the last decade, with this there is an increasing emphasis on the importance of the functional and cosmetic outcomes following injury. Integra artificial skin is the most widely used synthetic skin substitute and is reported to have better outcomes in relation to the appearance and elasticity when compared to split thickness skin grafting (SSG). A review of the literature reveals very few trials that are based on an objective evaluation of Integra treated scars as compared to SSGs. This research aimed to provide objective data on the long-term outcome of Integra. All adult patients from the Welsh Burns Centre who had been successfully treated with Integra+/-SSG were invited to attend a clinic for a follow up provided they had been healed for greater than one year. The hypothesis that Integra scars are more pliable than skin grafts was tested objectively using the Cutometer, a suction device which measures skin elasticity. Of the 13 patients eligible, six were available for assessment. The results of this study suggest that Integra treated sites correlate well with normal skin as measured by the Cutometer. This was statistically significant for the parameters Ur/Ue (elastic function) and Ur/Uf (gross elasticity). On the other hand there was no correlation seen between the patients SSG sites and the patient's normal skin. With advances in medicine we are increasingly able to modulate wound healing and the resultant scars. In order to assess new and often costly treatments the need for objective scar measurement tools have become apparent. Integra has been advocated to improve scarring from injury. However, there have been few studies to evaluate the long-term outcome of Integra as compared to traditional methods such as SSG. In the past scar evaluation has been based on subjective scores by patients and clinicians. Now the mechanical properties of the skin can be evaluated using simple
Elemental composition of skin tissue by PIXE and INAA analyses
International Nuclear Information System (INIS)
Hollands, R.; Spyrou, N.M.
1997-01-01
Hypertrophic scars are a particular type of scar that can form after any type of dermal injury. They are unsightly, red, elevated above normal skin level, itchy and painful. At present no-one knows why these scars form. Due to the differences between scar tissue and normal skin it was decided to analyse skin tissue which at a later date would be compared to scar tissue. Spit skin graft (epidermis) samples as well as full thickness skin (epidermis to dermis) tissue were analysed using PIXE and RBS with a 2 MeV proton beam. The epidermis was compared to the dermis to see if there were any variations between the two. In all the samples P, S, Cl, K, Ca, Fe, and Cd were detected and in a majority of the samples Zn and Ba were found, using PIXE. It was found that, between the epidermis and dermis, there was an significant increase in P in the epidermis in both full thickness and split skin graft samples. Complementary elemental analysis was also performed using neutron activation, and Br, Na and Zn were detected. (author)
The measurement of skin impedance for the diagnosis of skin cancer
International Nuclear Information System (INIS)
Menzies, S.; Crook, B.; McCarthy, W.
1996-01-01
Full text: In vivo skin impedance measurements have been reported to be diagnostic in differentiating benign from malignant skin tumours (Kiss G et al. Borgyogy Vener Szle 45: 164,1969; Melczer N. In: Cancer of the Skin. Saunders Co. Philadelphia, 1976, pp293-313). However, in contrast to non-melanoma skin cancer, only, a small sample of malignant melanomas were reported in these previous studies. We performed skin impedance measurements on a larger sample of melanomas in order to assess the potential use of such instrumentation for clinical diagnosis. The diagnostic method described by Kiss and Horvath was reproduced with only minor modifications. Low voltage impedance measurements at 1600 Hz were taken over each lesion and on nearby surrounding normal skin. Filter paper (4mm diameter) soaked in 0.1 M KCl was used at the skin-probe interface. A minimum of 2 skin and 1 lesion measurements were taken. All lesions were taken from relatively hairless sites and were non abraded or ulcerated. With the exception of 6 seborrhoeic keratoses all lesions were excised for histological diagnosis. The lesions tested were 27 invasive melanomas, 3 in situ melanomas, 27 basal cell carcinomas (BCC), 70 benign melanocytic lesions, 19 seborrhoeic keratoses, 5 Bowens disease (in situ SCC), 1 squamous cell carcinoma (SCC) and 25 other benign lesions. Results were interpreted as previously (Melczer) by the quotient of skin impedance / lesion impedance > 1.5 indicating malignancy. Analysis of total melanocytic lesions gave a sensitivity of 44% and specificity of 83% for the diagnosis of invasive melanoma (p < 0.05). Fifty two percent of BCCs were positively diagnosed. Analysis of all benign versus all invasive malignancy gave a sensitivity of 47% and specificity of 77% for the diagnosis of invasive malignancy (p < 0.01). While impedance measurements at 1600 Hz provide a statistically significant differentiation of melanoma versus non-melanoma and invasive malignancy versus benign lesions
Quantification of gravity-induced skin strain across the breast surface.
Sanchez, Amy; Mills, Chris; Haake, Steve; Norris, Michelle; Scurr, Joanna
2017-12-01
Quantification of the magnitude of skin strain in different regions of the breast may help to estimate possible gravity-induced damage whilst also being able to inform the selection of incision locations during breast surgery. The aim of this study was to quantify static skin strain over the breast surface and to estimate the risk of skin damage caused by gravitational loading. Fourteen participants had 21 markers applied to their torso and left breast. The non-gravity breast position was estimated as the mid-point of the breast positions in water and soybean oil (higher and lower density than breast respectively). The static gravity-loaded breast position was also measured. Skin strain was calculated as the percentage extension between adjacent breast markers in the gravity and non-gravity loaded conditions. Gravity induced breast deformation caused peak strains ranging from 14 to 75% across participants, with potentially damaging skin strain (>60%) in one participant and skin strains above 30% (skin resistance zone) in a further four participants. These peak strain values all occurred in the longitudinal direction in the upper region of the breast skin. In the latitudinal direction, smaller-breasted participants experienced greater strain on the outer (lateral) breast regions and less strain on the inner (medial) breast regions, a trend which was reversed in the larger breasted participants (above size 34D). To reduce tension on surgical incisions it is suggested that preference should be given to medial latitudinal locations for smaller breasted women and lateral latitudinal locations for larger breasted women. Copyright © 2017 Elsevier Ltd. All rights reserved.
Effects of radiation on the skin blood volume pulse in humans
Energy Technology Data Exchange (ETDEWEB)
Zanelli, G D [Mount Vernon Hospital, Northwood (UK)
1977-01-01
Measurements have been made of the changes in skin blood volume pulse (BVP) in the irradiated skin of three patients (two female, one male) during and up to 250 days after radiotherapy for malignant disease. The instrumentation comprised a modified commercial finger photo-plethysmograph probe with associated electronics, and a survey of the literature revealed that the consensus of opinion seems to be that the recorded pulsations arise from small 'muscular' arteries and arterioles in the 40 to 300 ..mu..m size range. The results show that, as expected, normal, untreated skin shows sizeable variations in BVP. The BVP of irradiated skin became significantly greater than that of normal skin when a dose of 1000 to 1500 rad has been accumulated. The maximum amplitude of the BVP of the irradiated skin seemed to correlate well with the overall severity of the erythema, but increases in BVP preceded erythema flare-ups. In two patients, elevated BVP were recorded for irradiated areas even when most visual signs of erythema had disappeared. Mild cooling of irradiated and non-irradiated skin had differing effects in the BVP. The measurement of the BVP of irradiated skin is a simple, reliable and completely atraumatic method for investigating vascular damage to superficial tissues in humans.
Zöller, Nadja; Valesky, Eva; Butting, Manuel; Hofmann, Matthias; Kippenberger, Stefan; Bereiter-Hahn, Jürgen; Bernd, August; Kaufmann, Roland
2014-01-01
The treatment regime of non-healing or slowly healing wounds is constantly improving. One aspect is surgical defect coverage whereby mesh grafts and keratinocyte suspension are applied. Tissue-cultured skin autografts may be an alternative for the treatment of full-thickness wounds and wounds that cover large areas of the body surface. Autologous epidermal and dermal cells were isolated, expanded in vitro and seeded on collagen-elastin scaffolds. The developed autograft was immunohistochemically characterized and subsequently transplanted onto a facial chronic ulceration of a 71-year-old patient with vulnerable atrophic skin. Characterization of the skin equivalent revealed comparability to healthy human skin due to the epidermal strata, differentiation and proliferation markers. Within 138 days, the skin structure at the transplantation site closely correlated with the adjacent undisturbed skin. The present study demonstrates the comparability of the developed organotypic skin equivalent to healthy human skin and the versatility for clinical applications.
Permeability of commercial solvents through living human skin
DEFF Research Database (Denmark)
Ursin, C; Hansen, C M; Van Dyk, J W
1995-01-01
A procedure has been developed for measuring the steady state rate of permeation of commercial solvents through living human skin. To get the most consistent results, it was necessary with some solvents to normalize the solvent permeation rate of a given skin sample with its [3H]water permeation...... rate. For other solvents this was not necessary, so the un-normalized data were used. High [3H]water permeation rate also was used as a criterion for "defective" skin samples that gave erroneous permeability rates, especially for solvents having slow permeability. The linearity of the steady state data...... was characterized by calculation of the "percent error of the slope." The following permeability rates (g/m2h) of single solvents were measured: dimethyl sulfoxide (DMSO), 176; N-methyl-2-pyrrolidone, 171; dimethyl acetamide, 107; methyl ethyl ketone, 53; methylene chloride, 24; [3H]water, 14.8; ethanol, 11...
Folgosi-Correa, M. S.; Nogueira, G. E. C.
2012-06-01
The laser Doppler flowmetry allows the non-invasive assessment of the skin perfusion in real-time, being an attractive technique to study the human microcirculation in clinical settings. Low-frequency oscillations in the laser Doppler blood flow signal from the skin have been related to the endothelial, endothelial-metabolic, neurogenic and myogenic mechanisms of microvascular flow control, in the range 0.005-0.0095 Hz, 0.0095-0.021 Hz, 0.021-0.052 Hz and 0.052- 0.145 Hz respectively. The mean Amplitude (A) of the periodic fluctuations in the laser Doppler blood flow signal, in each frequency range, derived from the respective wavelet-transformed coefficients, has been used to assess the function and dysfunctions of each mechanism of flow control. Known sources of flow signal variances include spatial and temporal variability, diminishing the discriminatory capability of the technique. Here a new time domain method of analysis is proposed, based on the Time of Correlation (TC) of flow fluctuations between two adjacent sites. Registers of blood flow from two adjacent regions, for skin temperature at 32 0C (basal) and thermally stimulated (42 0C) of volar forearms from 20 healthy volunteers were collected and analyzed. The results obtained revealed high time of correlation between two adjacent regions when thermally stimulated, for signals in the endothelial, endothelial-metabolic, neurogenic and myogenic frequency ranges. Experimental data also indicate lower variability for TC when compared to A, when thermally stimulated, suggesting a new promising parameter for assessment of the microvascular flow control.
Huang, Yuanshen; Wang, Yang; Yu, Jie; Gao, Min; Levings, Megan; Wei, Shencai; Zhang, Shengquan; Xu, Aie; Su, Mingwan; Dutz, Jan; Zhang, Xuejun; Zhou, Youwen
2012-01-01
Background Vitiligo is characterized by the death of melanocytes in the skin. This is associated with the presence of T cell infiltrates in the lesional borders. However, at present, there is no detailed and systematic characterization on whether additional cellular or molecular changes are present inside vitiligo lesions. Further, it is unknown if the normal appearing non-lesional skin of vitiligo patients is in fact normal. The purpose of this study is to systematically characterize the molecular and cellular characteristics of the lesional and non-lesional skin of vitiligo patients. Methods and Materials Paired lesional and non-lesional skin biopsies from twenty-three vitiligo patients and normal skin biopsies from sixteen healthy volunteers were obtained with informed consent. The following aspects were analyzed: (1) transcriptome changes present in vitiligo skin using DNA microarrays and qRT-PCR; (2) abnormal cellular infiltrates in vitiligo skin explant cultures using flow cytometry; and (3) distribution of the abnormal cellular infiltrates in vitiligo skin using immunofluorescence microscopy. Results Compared with normal skin, vitiligo lesional skin contained 17 genes (mostly melanocyte-specific genes) whose expression was decreased or absent. In contrast, the relative expression of 13 genes was up-regulated. The up-regulated genes point to aberrant activity of the innate immune system, especially natural killer cells in vitiligo. Strikingly, the markers of heightened innate immune responses were also found to be up-regulated in the non-lesional skin of vitiligo patients. Conclusions and Clinical Implications As the first systematic transcriptome characterization of the skin in vitiligo patients, this study revealed previously unknown molecular markers that strongly suggest aberrant innate immune activation in the microenvironment of vitiligo skin. Since these changes involve both lesional and non-lesional skin, our results suggest that therapies targeting
Skin Diseases: Skin Health and Skin Diseases
Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...
Claudins 1, 2, 3, 4, 5 and 7 in solar keratosis and squamocellular carcinoma of the skin
Hintsala, Hanna-Riikka; Siponen, Maria; Haapasaari, Kirsi-Maria; Karihtala, Peeter; Soini, Ylermi
2013-01-01
Claudins are tight junction proteins regulating the paracellular permeability of cell layers. We investigated the expression of claudins 1, 2, 3, 4, 5 and 7 in a sample set consisting of a total of 93 cases representing normal skin, actinic keratoses and squamous cell carcinomas of the skin. There were several changes found in claudin expression. Claudin 1 appeared to be progressively decreased in solar keratosis and skin squamous cell carcinomas compared to normal skin while expression of claudin 2 was increased. With claudins 3 and 5 occasional immunoreactivity was found in squamous cell carcinomas. Claudins 4 and 7 were variably expressed in skin neoplasia compared to normal skin. According to the results expression of claudins 1 and 2 change in parallel with the severity of the epidermal preneoplastic and neoplastic lesions thus probably influencing the disturbed epithelial polarity characteristic of these lesions. Claudin 1 under- and claudin 2 overexpression also lead to a leakier epithelial barrier function of the skin with a resulting damage to skin epithelial resistance. Other claudins investigated in this study did not show progressive changes even though occasional overexpression of them was found in skin squamous cell carcinoma. PMID:24294371
Kieser, David Christopher; Cawley, Derek Thomas; Roscop, Cecile; Mazas, Simon; Coudert, Pierre; Boissiere, Louis; Obeid, Ibrahim; Vital, Jean-Marc; Pointillart, Vincent; Gille, Olivier
2018-03-31
To understand whether a spondylolisthesis in the sub-axial spine cranial to a cervical disc arthroplasty (CDA) construes a risk of adjacent level disease (ALD). A retrospective review of 164 patients with a minimum 5-year follow-up of a cervical disc arthroplasty was performed. Multi-level surgeries, including hybrid procedures, were included. Multiple implant types were included. The two inter-vertebral discs (IVD) cranial of the CDA were monitored for evidence of radiologic degeneration using the Kettler criteria. The rate of ALD in CDA found in this series was 17.8%, with most affecting the immediately adjacent IVD (27.4 and 7.6%, respectively p = 0.000). Pre-operative mild spondylolisthesis adjacent to a planned CDA was not found to be a risk factor for ALD within 5 years. Those with a degenerative spondylolisthesis are at higher risk of ALD (33%) than those with a non-degenerative cause for their spondylolisthesis (11%). Post-operative CDA alignment, ROM or induced spondylolisthesis do not affect the rate of ALD in those with an adjacent spondylolisthesis. Patients with ALD experience significantly worse 5-year pain and functional outcomes than those unaffected by ALD. A pre-operatively identified mild spondylolisthesis in the sub-axial spine cranially adjacent to a planned CDA is not a risk factor for ALD within 5 years. These slides can be retrieved under Electronic Supplementary Material.
Applications of positron annihilation to dermatology and skin cancer
International Nuclear Information System (INIS)
Liu, Guang; Chen, Hongmin; Chakka, Lakshmi; Gadzia, Joseph E.; Jean, Y.C.
2007-01-01
Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Applications of positron annihilation to dermatology and skin cancer
Energy Technology Data Exchange (ETDEWEB)
Liu, Guang; Chen, Hongmin; Chakka, Lakshmi [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); Gadzia, Joseph E. [Dermatology, Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS 66103 and Kansas Medical Clinic, Topeka, KS 66614 (United States); Jean, Y.C. [Department of Chemistry, University of Missouri-Kansas City, Kansas City, MO 64110 (United States); R and D Center for Membrane Technology, Chung Yuan Christian University, Chung-Li (China)
2007-07-01
Positronium annihilation lifetime experiments have been performed to investigate the interaction between skin cancer and positronium for human skin samples. Positronium annihilation lifetime is found to be shorter and intensity is found to be less for the samples with basal cell carcinoma and squamous cell carcinoma than the normal skin samples. These results indicate a reduction of free volume in the molecular level for the skin with cancer with respect to the skin without cancer. Positron annihilation spectroscopy may be potentially developed as a new noninvasive and external method for dermatology clinics, early detection of cancer, and nano-PET technology in the future. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Stratum corneum integrity as a predictor for peristomal skin problems in ostomates
DEFF Research Database (Denmark)
Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T
2010-01-01
BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...
Ultrasonography of Skin Changes in Legs with Chronic Venous Disease.
Caggiati, A
2016-10-01
In daily practice, ultrasonography (US) is used only to designate the location and pattern of venous lesions. Skin US is not performed between routine venous investigations. Skin morphology is evaluated by the same probes used for routine Duplex evaluation of superficial veins. US findings from evident skin lesions are comparatively evaluated with those from the surrounding apparently normal skin and from the contralateral leg. Inflammation and dermal edema can be found in the apparently normal skin of C2 legs. Swollen legs show thickening of the subcutaneous layer as a result of diffuse soaking or anechoic cavities, with or without dermal edema. Chronic hypodermitis is characterized by inflammatory edema in initial phases, and by liposclerosis in advanced cases. Recrudescence of inflammation provokes focal rarefactions of the subcutaneous layer, possibly related to ulcer opening. In legs with venous disorders, sonography refines clinical evaluation of the skin and may reveal changes not highlighted by inspection. Some of these changes could require further investigation because they have not yet been explained or described. Skin sonography should improve knowledge of the natural history of skin changes, as well as contribute to a better grading of venous diseases severity In particular, US evidence of cutaneous and subcutaneous changes in C2 legs should be considered to stratify the treatment in C2 legs, by identifying those in which varicose veins are not simply a cosmetic problem. Copyright © 2016 European Society for Vascular Surgery. Published by Elsevier Ltd. All rights reserved.
Reconstructing in-vivo reflectance spectrum of pigmented skin lesion by Monte Carlo simulation
Wang, Shuang; He, Qingli; Zhao, Jianhua; Lui, Harvey; Zeng, Haishan
2012-03-01
In dermatology applications, diffuse reflectance spectroscopy has been extensively investigated as a promising tool for the noninvasive method to distinguish melanoma from benign pigmented skin lesion (nevus), which is concentrated with the skin chromophores like melanin and hemoglobin. We carried out a theoretical study to examine melanin distribution in human skin tissue and establish a practical optical model for further pigmented skin investigation. The theoretical simulation was using junctional nevus as an example. A multiple layer skin optical model was developed on established anatomy structures of skin, the published optical parameters of different skin layers, blood and melanin. Monte Carlo simulation was used to model the interaction between excitation light and skin tissue and rebuild the diffuse reflectance process from skin tissue. A testified methodology was adopted to determine melanin contents in human skin based on in vivo diffuse reflectance spectra. The rebuild diffuse reflectance spectra were investigated by adding melanin into different layers of the theoretical model. One of in vivo reflectance spectra from Junctional nevi and their surrounding normal skin was studied by compare the ratio between nevus and normal skin tissue in both the experimental and simulated diffuse reflectance spectra. The simulation result showed a good agreement with our clinical measurements, which indicated that our research method, including the spectral ratio method, skin optical model and modifying the melanin content in the model, could be applied in further theoretical simulation of pigmented skin lesions.
Study of the skin effect in superconducting materials
Energy Technology Data Exchange (ETDEWEB)
Szeftel, Jacob, E-mail: jszeftel@lpqm.ens-cachan.fr [ENS Cachan, LPQM, 61 avenue du Président Wilson, 94230 Cachan (France); Sandeau, Nicolas [Aix Marseille Univ, CNRS, Centrale Marseille, Institut Fresnel, F-13013 Marseille (France); Khater, Antoine [Université du Maine, UMR 6087 Laboratoire PEC, F-72000 Le Mans (France)
2017-05-03
Highlights: • Comprehensive theoretical study of the skin effect in superconductors. • Based on Newton and Maxwell's equations. • Usual and anomalous skin effects dealt with in the same framework. - Abstract: The skin effect is analyzed to provide the numerous measurements of the penetration depth of the electromagnetic field in superconducting materials with a theoretical basis. Both the normal and anomalous skin effects are accounted for within a single framework, focusing on frequencies less than the superconducting gap. The emphasis is laid on the conditions required for the penetration depth to be equal to London's length, which enables us to validate an assumption widely used in the interpretation of all current experimental results.
The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects
Directory of Open Access Journals (Sweden)
Jang Hwan Min
2014-07-01
Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.
Directory of Open Access Journals (Sweden)
Camilla Dal Bosco
2014-03-01
Full Text Available To evaluate the influence of the skin aging critical level on the adult skin epidermal functional state, an improved analytical method based on the skin surface energetic measurement (TVS modeling was developed. Tenskinmetric measurements were carried out non-invasively in controlled conditions by contact angle method using only a water-drop as reference standard liquid. Adult skin was monitored by TVS Observatory according to a specific and controlled thermal protocol (Camianta protocol in use at the interconnected “Mamma Margherita Terme spa” of Terme Euganee. From June to November 2013, the surface free energy and the epidermal hydration level of adult skin were evaluated on arrival of 265 male and 569 female adult volunteers (51–90 years of age and when they departed 2 weeks later. Sensitive measurements were carried out at 0.1 mN/m. High test compliance was obtained (93.2% of all guests. Very interesting results are obtained. The high sensitivity and discrimination power of tenskinmetry combined with a thermal Camianta protocol demonstrate the possibility to evaluate at baseline level the surface energetic changes and the skin reactivity which occurs on adult skin.
Comparison of differences in knowledge about skin care bettwen young women and man
Directory of Open Access Journals (Sweden)
Katarzyna Bojarczuk
2017-08-01
Full Text Available Introduction: The skin of modern people is exposed daily to a number of irritants like stress, consequences of inadequate diet, exposure to chemicals and plastics. Those factors can pose a challenge not only for delicate skin of a child, or a woman, but also for more resistant skin of men. Every type of complexion requires individual care, adjusted to different conditions and life circumstances. The choice of proper skin care products should be based on basic skin type and also one's gender. Objectives: Evaluation of differences in students' knowledge about skin care in relation to their gender. Material and methods: Evaluation of students' knowledge concerning proper skin care guidelines was conducted among 210 students (150 women and 60 men using anonymous survey. Results: Majority of male respondents determined their skin type as a normal one (56.6%, majority of female respondents as a combination type (51.3%. Men in contrast to women are more often unable to evaluate the type of their own skin (16.7% vs 4.0%. Acne was the most common skin condition students of both sexes complained about. Daily skin care activities are performed by 96.6% interviewed women and 63.3% men. The regular use of face skin care products was reported by 87.3% of women and 31.6% of men. Conclusions: 1. Majority of women evaluate their basic skin type as combination one, most men regarded their skin type as normal . 2. Women more often than men take care of their skin and use adequate skin care products. 3. Facial moisturizing lotion is the most frequently chosen skin care product by both women and men.
Molecular effects of fractional carbon dioxide laser resurfacing on photodamaged human skin.
Reilly, Michael J; Cohen, Marc; Hokugo, Akishige; Keller, Gregory S
2010-01-01
Objective To elucidate the sequential changes in protein expression that play a role in the clinically beneficial results seen with fractional carbon dioxide (CO(2)) laser resurfacing of the face and neck. Methods Nine healthy volunteers were recruited for participation from the senior author's facial plastic surgery practice. After informed consent was obtained, each volunteer underwent a 2-mm punch biopsy from a discrete area of infra-auricular neck skin prior to laser treatment. Patients then immediately underwent laser resurfacing of photodamaged face and neck skin at a minimal dose (30 W for 0.1 second) with the Pixel Perfect fractional CO(2) laser. On completion of the treatment, another biopsy specimen was taken adjacent to the first site. Additional biopsy specimens were subsequently taken from adjacent skin at 2 of 3 time points (day 7, day 14, or day 21). RNA was extracted from the specimens, and reverse transcriptase-polymerase chain reaction and protein microarray analysis were performed. Comparisons were then made between time points using pairwise comparison testing. Results We found statistically significant changes in the gene expression of several matrix metalloproteinases (MMPs). The data demonstrate a consistent up-regulation of MMPs 1, 3, 9, and 13, all of which have been previously reported for fully ablative CO(2) laser resurfacing. There was also a statistically significant increase in MMP-10 and MMP-11 levels in this data set. Conclusion This study suggests that the molecular mechanisms of action are similar for both fractional and fully ablative CO(2) laser resurfacing.
Verhaegen, Pauline D.; Schouten, Hennie J.; Tigchelaar-Gutter, Wikky; van Marle, Jan; van Noorden, Cornelis J.; Middelkoop, Esther; van Zuijlen, Paul P.
2012-01-01
Surgeons are often faced with large defects that are difficult to close. Stretching adjacent skin can facilitate wound closure. In clinical practice, intraoperative stretching is performed in a cyclical or continuous fashion. However, exact mechanisms of tissue adaptation to stretch remain unclear.
Assessment of extent of skin involvement in scleroderma using shear wave elastography
Directory of Open Access Journals (Sweden)
Anupam Wakhlu
2017-01-01
Full Text Available Introduction: Scleroderma (systemic sclerosis [SSc] is a rare autoimmune disease which manifests as fibrosis in the skin and other internal organs. Conventionally, the modified Rodnan skin score (MRSS has been used to quantify the extent of skin fibrosis (resulting in skin tightness in SSc. This technique, although widely validated, is limited by the requirement of a trained, experienced assessor. Recent literature suggests that utilization of the objective ultrasound-based assessment of skin fibrosis utilizing shear wave elastography (SWE may be a more robust technique to detect early skin tightness in SSc. Methods: We evaluated the use of SWE (assessed by an experienced radiologist in 24 patients with SSc compared with 16 healthy controls. Results: Our patients were predominantly females, with median disease duration of 1.5 years and median MRSS of 17. There was minimal intraobserver variation in the assessment of SWE. Patients with SSc had higher SWE values (mean elasticity [Emean] compared to healthy controls at most assessed sites for the MRSS. The Emeancorrelated significantly at all sites with the MRSS scores. At the sites where MRSS was scored as 0 (normal, the Emeanin patients with SSc was higher when compared with similarly clinical normal skin in patients with SSc, suggesting potential early involvement of these areas of the skin with fibrosis. Conclusion: SWE is a promising tool to objectively assess skin fibrosis in SSc and may be useful in detecting early, subclinical skin involvement in this disease.
Directory of Open Access Journals (Sweden)
Dirk Breitkreutz
2013-01-01
Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.
Infrared imaging of skin lesions
McIntosh, Laura M.; Mansfield, James R.; Jackson, Michael; Crowson, A. Neil; Mantsch, Henry H.
2002-02-01
IR spectroscopy produces spectra in which detailed information concerning chemical structure is inherent. Numerous studies have demonstrated that the most useful IR methods for analysis of biological tissues are microscopic image-based techniques in which fine-scaled spatial and high-quality spectral information is integrated. Unlike traditional visible microscopic methods, the contrast in IR imaging is gained by differences in spectra and the spatial heterogeneity of biochemical components, not by the addition of stains. In order for IR imaging to be more broadly accepted, non-subjective data processing methods are being developed to extract the most out of the large spectral images that are acquired. This paper demonstrates data processing techniques that have been extremely useful in the analysis of normal and abnormal skin. Analysis of skin specimens is of particular clinical importance due to the difficulty in rendering a differential diagnosis. Unstained frozen skin sections were mapped using an IR microscope. Functional group mapping, clustering routines and linear discriminant analysis were used to process the data. Functional group mapping and clustering routines were useful in the initial interpretation of images and to research for trends in uncharacterized spectral images. LDA was useful for differentiating normal from abnormal tissue once a well- defined training spectral set was established. Representative spectroscopic images are shown that demonstrate the power of IR imaging.
Skin manifestations of growth hormone-induced diseases.
Kanaka-Gantenbein, Christina; Kogia, Christina; Abdel-Naser, Mohamed Badawy; Chrousos, George P
2016-09-01
The human skin is a well-organized organ bearing different types of cells in a well-structured interference to each other including epidermal and follicular keratinocytes, sebocytes, melanocytes, dermal papilla cells and fibroblasts, endothelial cells, sweat gland cells as well as nerves. Several hormones act on different cell types of the skin, while it is also considered an endocrine organ secreting hormones that act at several sites of the organism. GH receptors are found in almost all cell types forming the skin, while IGF-1 receptors' expression is restricted to the epidermal keratinocytes. Both Growth Hormone (GH) excess, as in the case of Acromegaly in adults, or Gigantism in growing children, and GH deficiency states lead to skin manifestations. In case of GH excess the main dermatological findings are skin thickening, coarsening of facial features, acrochordons, puffy hands and feet, oily skin and hyperhidrosis, while GH deficiency, on the contrary, is characterized by thin, dry skin and disorder of normal sweating. Moreover, special disorders associated with GH excess may have specific characteristics, as is the case of café-au-lait spots in Neurofibromatosis, or big café-au-lait skin hyperpigmented regions with irregular margins, as is the case in McCune-Albright syndrome. Meticulous examination of the skin may therefore contribute to the final diagnosis in cases of GH-induced disorders.
[ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].
Song, Zhifang; Liu, Dewu
2014-07-01
To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.
Clinical scoring and instrumental analysis to evaluate skin types.
Mercurio, D G; Segura, J H; Demets, M B A; Maia Campos, P M B G
2013-04-01
The biology of the skin is very complex, and there are a number of methods used to classify the different skin types. It is possible to measure or quantify the characteristics of the specific skin types, using a variety of techniques that can objectively evaluate the properties of the skin in a noninvasive manner. To clinically characterize different skin types by dermatological evaluation and biophysical and skin imaging techniques, and to evaluate the relationship between the different characteristics. The study recruited 26 volunteers. Clinical scoring was performed by a dermatologist who classified the volunteers' skin as normal or dry (group 1) and combination or oily (group 2). Objective measurements included skin microrelief, pH, oiliness, water content of the stratum corneum and transepidermal water loss (TEWL). Positive correlations were found between the level of skin oiliness and skin texture obtained from both instrumental analysis and clinical scoring. The combination and oily skin types had higher clinical scores for shine intensity, oiliness and tendency to pigmentation, and also had higher objective scores for sebum secretion, TEWL and roughness. Biophysical and skin imaging techniques are effective tools to help characterize skin type and assist in clinical dermatology. We found that different skin types had different characteristics related to skin microrelief, oiliness and TEWL, and therefore require specific dermatological treatments. © The Author(s) CED © 2013 British Association of Dermatologists.
Effect of skin hydration on the dynamics of fingertip gripping contact.
André, T; Lévesque, V; Hayward, V; Lefèvre, P; Thonnard, J-L
2011-11-07
The dynamics of fingertip contact manifest themselves in the complex skin movements observed during the transition from a stuck state to a fully developed slip. While investigating this transition, we found that it depended on skin hydration. To quantify this dependency, we asked subjects to slide their index fingertip on a glass surface while keeping the normal component of the interaction force constant with the help of visual feedback. Skin deformation inside the contact region was imaged with an optical apparatus that allowed us to quantify the relative sizes of the slipping and sticking regions. The ratio of the stuck skin area to the total contact area decreased linearly from 1 to 0 when the tangential force component increased from 0 to a maximum. The slope of this relationship was inversely correlated to the normal force component. The skin hydration level dramatically affected the dynamics of the contact encapsulated in the course of evolution from sticking to slipping. The specific effect was to reduce the tendency of a contact to slip, regardless of the variations of the coefficient of friction. Since grips were more unstable under dry skin conditions, our results suggest that the nervous system responds to dry skin by exaggerated grip forces that cannot be simply explained by a change in the coefficient of friction.
Ultrastructure of elastosis in facial rhytidectomy skin
International Nuclear Information System (INIS)
Rudolph, R.; Woodward, M.
1981-01-01
Skin from 19 facial rhytidectomies performed in patients with chronic solar damage was compared with postauricular skin from patients of similar age. Light microscopy demonstrated large areas of amorphous material that stained PAS positive in all 19 face-lift specimens, while none of the controls had such material. Electron microscopy of the ''elastotic'' material revealed large amorphous masses of granular material, with loss of the microfilament component of normal elastin. Current theories suggest that the elastotic material in solar-damaged skin is a product of radiation-damaged fibroblasts, rather than being either collagen or degenerated elastin. Such knowledge may help the plastic surgeons encourage rhytidectomy patients to protect themselves from solar radiation
Reliability of skin testing as a measure of nutritional state
International Nuclear Information System (INIS)
Forse, R.A.; Christou, N.; Meakins, J.L.; MacLean, L.D.; Shizgal, H.M.
1981-01-01
The reliability of skin testing to assess the nutritional state was evaluated in 257 patients who received total parenteral nutrition (TPN). The nutritional state was assessed by determining body composition, by multiple-isotope dilution. Immunocompetence was simultaneously evaluated by skin testing with five recall antigens. These measurements were carried out before and at two-week intervals during TPN. A statistically significant relationship existed between the response to skin testing and the nutritional state. A body composition consistent with malnutrition was present in the anergic patients, while body composition was normal in the patients who reacted normally to skin testing. However, a considerable overlap existed as 43% of the reactive patients were malnourished, and 21% of the anergic patients were normally nourished. Thirty-seven (43%) of the 86 anergic patients converted and became reactive during TPN, and their body composition improved significantly. The remaining 49 anergic patients (57%) did not convert, and their body composition did not change despite similar nutritional support. The principal difference between the two groups of anergic patients was the nature of the therapy administered. In the anergic patients who converted, therapy was aggressive and appropriate, and clinical improvement occurred in 23 (62.2%) of the patients, with a mortality of 5.4%. In the 49 patients who remained anergic, therapy was often inappropriate or unsuccessful, with clinical improvement in only three (6.1%) of the patients and a mortality of 42.8%. The data demonstrated a significant relationship between the response to skin testing and the nutritional state. However, because of the wide overlap, skin testing does not accurately assess a person's nutritional state. The persistence of the anergic state is indicative of a lack of response to therapy
International Nuclear Information System (INIS)
Snyder, D.S.; May, M.
1975-01-01
Application of 5% para-aminobenzoic acid (PABA) to hairless mice one hour prior to ultraviolet light (UVL) irradiation will almost totally protect these animals from developing tumors induced by chronic exposure to UVL in the 290 to 320 nm range in conjunction with a chemical carcinogen. Mice exposed to UVL and not protected by PABA developed primarily squamous cell carcinomas. Two months after cessation of chronic UVL exposure, the non-PABA-treated irradiated mouse skin appeared thickened, yellow, and wrinkled while showing elevated DNA synthesis, hyperplasia, hypergranulosis, and increased amounts of elastotic material. The PABA-treated skin was grossly normal
Pathological skin picking: case presentation and review of the literature
Directory of Open Access Journals (Sweden)
Maria Isabela Sarbu
2015-04-01
Full Text Available Pathological skin picking is a condition in which patients induce skin lesions through repetitive, compulsive excoriations of normal skin or skin with minor surface irregularities and they admit their role in the production of the lesions, but are unable to stop their behavior. Psychiatric comorbidities most often associated with skin picking include obsessive-compulsive disorder (OCD, anxiety disorders, mood disorders, body dysmorphic disorders, trichotillomania and compulsive-buying disorder. We report the case of a 17 year old female patient who addressed the dermatology department of our hospital with an eruption consisting of erythematous papules and plaques. The local examination revealed several clues of paramount importance in drawing the final conclusion and the psychiatric examination helped establish the diagnosis of pathological skin picking in a patient with obsessive-compulsive disorder.
Diversity of bacterial communities on the facial skin of different age-group Thai males
Directory of Open Access Journals (Sweden)
Alisa Wilantho
2017-11-01
Full Text Available Background Skin microbiome varies from person to person due to a combination of various factors, including age, biogeography, sex, cosmetics and genetics. Many skin disorders appear to be related to the resident microflora, yet databases of facial skin microbiome of many biogeographies, including Thai, are limited. Methods Metagenomics derived B-RISA and 16S rRNA gene sequencing was utilized to identify the culture-independent bacterial diversity on Thai male faces (cheek and forehead areas. Skin samples were categorized (grouped into (i normal (teenage.hea and (ii acne-prone (teenage.acn young adults, and normal (iii middle-aged (middle.hea and (iv elderly (elderly.hea adults. Results The 16S rRNA gene sequencing was successful as the sequencing depth had an estimated >98% genus coverage of the true community. The major diversity was found between the young and elderly adults in both cheek and forehead areas, followed by that between normal and acne young adults. Detection of representative characteristics indicated that bacteria from the order Rhizobiales, genera Sphingomonas and Pseudoalteromonas, distinguished the elderly.hea microbiota, along the clinical features of wrinkles and pores. Prediction of the metabolic potential revealed reduced metabolic pathways involved in replication and repair, nucleotide metabolism and genetic translation in the elderly.hea compared with that in the teenage.hea. For young adults, some unique compositions such as abundance of Propionibacterium acnes and Staphylococcus epidermidis, with a minor diversity between normal and acne skins, were detected. The metabolic potentials of the acne vs. normal young adults showed that teenage.acn was low in many cellular processes (e.g., cell motility and environmental adaptation, but high in carbohydrate metabolism, which could support acne growth. Moreover, comparison with the age-matched males from the US (Boulder, Colorado to gain insight into the diversity across
Diversity of bacterial communities on the facial skin of different age-group Thai males.
Wilantho, Alisa; Deekaew, Pamornya; Srisuttiyakorn, Chutika; Tongsima, Sissades; Somboonna, Naraporn
2017-01-01
Skin microbiome varies from person to person due to a combination of various factors, including age, biogeography, sex, cosmetics and genetics. Many skin disorders appear to be related to the resident microflora, yet databases of facial skin microbiome of many biogeographies, including Thai, are limited. Metagenomics derived B-RISA and 16S rRNA gene sequencing was utilized to identify the culture-independent bacterial diversity on Thai male faces (cheek and forehead areas). Skin samples were categorized (grouped) into (i) normal ( teenage.hea ) and (ii) acne-prone ( teenage.acn ) young adults, and normal (iii) middle-aged ( middle.hea ) and (iv) elderly ( elderly.hea ) adults. The 16S rRNA gene sequencing was successful as the sequencing depth had an estimated >98% genus coverage of the true community. The major diversity was found between the young and elderly adults in both cheek and forehead areas, followed by that between normal and acne young adults. Detection of representative characteristics indicated that bacteria from the order Rhizobiales, genera Sphingomonas and Pseudoalteromonas , distinguished the elderly.hea microbiota, along the clinical features of wrinkles and pores. Prediction of the metabolic potential revealed reduced metabolic pathways involved in replication and repair, nucleotide metabolism and genetic translation in the elderly.hea compared with that in the teenage.hea . For young adults, some unique compositions such as abundance of Propionibacterium acnes and Staphylococcus epidermidis , with a minor diversity between normal and acne skins, were detected. The metabolic potentials of the acne vs. normal young adults showed that teenage.acn was low in many cellular processes (e.g., cell motility and environmental adaptation), but high in carbohydrate metabolism, which could support acne growth. Moreover, comparison with the age-matched males from the US (Boulder, Colorado) to gain insight into the diversity across national biogeography
Resurfacing glabrous skin defects in the hand: the thenar base donor site.
Milner, Chris S; Thirkannad, Sunil M
2014-06-01
Defects of the glabrous skin surfaces of the palm and fingers result from numerous causes including larger fingertip injuries, unhealed burns, and after surgery for diverse pathologies. The qualities of glabrous skin are specifically tailored to the functional requirements of high-shear strength and robustness. Despite these unique properties, graft reconstruction of defects in the glabrous regions of the hand is frequently achieved with skin from nonglabrous donor sites such as the medial forearm. Nonglabrous skin has a poor color and texture match for such applications and is frequently associated with tender and unsightly donor scars. We describe our experiences of harvesting full-thickness grafts from the glabrous skin centered over the proximal flexion crease at the level of the metacarpophalangeal joint of the thumb. We have utilized this site to harvest skin grafts of up to 2 cm in width for the resurfacing of small-sized to medium-sized defects on the palmar surfaces of the hands and fingers in 28 patients under both traumatic and elective circumstances. The skin has an excellent type-match to the defect and is quick and easy to harvest due to its adjacent location to the defect. The donor scar matures quickly, and as it lies along the thumb base crease, it runs along one of the least used contact surfaces, thereby limiting the potential discomfort associated with FTSG harvest sites from other areas. Patient satisfaction with the procedure has been high, and it represents a useful alternative to traditional nonglabrous skin graft donor sites for small-sized to medium-sized defects.
Cyclic peptides as potential therapeutic agents for skin disorders.
Namjoshi, Sarika; Benson, Heather A E
2010-01-01
There is an increasing understanding of the role of peptides in normal skin function and skin disease. With this knowledge, there is significant interest in the application of peptides as therapeutics in skin disease or as cosmeceuticals to enhance skin appearance. In particular, antimicrobial peptides and those involved in inflammatory processes provide options for the development of new therapeutic directions in chronic skin conditions such as psoriasis and dermatitis. To exploit their potential, it is essential that these peptides are delivered to their site of action in active form and in sufficient quantity to provide the desired effect. Many polymers permeate the skin poorly and are vulnerable to enzymatic degradation. Synthesis of cyclic peptide derivatives can substantially alter the physicochemical characteristics of the peptide with the potential to improve its skin permeation. In addition, cyclization can stabilize the peptide structure and thereby increase its stability. This review describes the role of cyclic peptides in the skin, examples of current cyclic peptide therapeutic products, and the potential for cyclic peptides as dermatological therapeutics and cosmeceuticals.
Liao, Zhenhua; Fogel, Guy R.; Wei, Na; Gu, Hongsheng; Liu, Weiqiang
2015-01-01
Background The ideal procedure for multilevel cervical degenerative disc diseases remains controversial. Recent studies on hybrid surgery combining anterior cervical discectomy and fusion (ACDF) and artificial cervical disc replacement (ACDR) for 2-level and 3-level constructs have been reported in the literature. The purpose of this study was to estimate the biomechanics of 3 kinds of 4-level hybrid constructs, which are more likely to be used clinically compared to 4-level arthrodesis. Material/Methods Eighteen human cadaveric spines (C2–T1) were evaluated in different testing conditions: intact, with 3 kinds of 4-level hybrid constructs (hybrid C3–4 ACDR+C4–6 ACDF+C6–7ACDR; hybrid C3–5ACDF+C5–6ACDR+C6–7ACDR; hybrid C3–4ACDR+C4–5ACDR+C5–7ACDF); and 4-level fusion. Results Four-level fusion resulted in significant decrease in the C3–C7 ROM compared with the intact spine. The 3 different 4-level hybrid treatment groups caused only slight change at the instrumented levels compared to intact except for flexion. At the adjacent levels, 4-level fusion resulted in significant increase of contribution of both upper and lower adjacent levels. However, for the 3 hybrid constructs, significant changes of motion increase far lower than 4P at adjacent levels were only noted in partial loading conditions. No destabilizing effect or hypermobility were observed in any 4-level hybrid construct. Conclusions Four-level fusion significantly eliminated motion within the construct and increased motion at the adjacent segments. For all 3 different 4-level hybrid constructs, ACDR normalized motion of the index segment and adjacent segments with no significant hypermobility. Compared with the 4-level ACDF condition, the artificial discs in 4-level hybrid constructs had biomechanical advantages compared to fusion in normalizing adjacent level motion. PMID:26694835
International Nuclear Information System (INIS)
Chi, C.; Hayashi, Daisuke; Nemoto, Masato; Nyui, Minako; Anzai, Kazunori; Urano, Shiro
2011-01-01
We previously showed that free radicals and oxidative stress are involved in radiation-induced skin reactions. Since vitamin E (VE) is a particularly important lipophilic antioxidant, VE-deficient mice were used to examine its effects on radiation-induced skin damage. The VE content of the skin was reduced to one fourth of levels of normal mice. Neither the time of onset nor the extent of the reactions quantified with a scoring system differed between normal and VE-deficient mice after local X-irradiation (50 Gy). Similarly, there was no difference in the levels of the ascorbyl radical between the groups, although they were higher in irradiated skin than non-irradiated skin. X-irradiation increased the amount of Bax protein in the skin of normal mice both in the latent and acute inflammatory stages, time- and dose-dependently. The increase was associated with an increase in cytochrome c in the cytosolic fraction, indicating that apoptosis was also promoted by the irradiation. The increase in Bax protein correlated well with the thickness of the skin. Although a deficiency in VE should lower resistance to free radicals in the mitochondrial membrane and thus enhance radiation-induced Bax expression and apoptosis, it actually attenuated the increase in Bax protein caused by irradiation. (author)
Computed tomography of the normal sternum
International Nuclear Information System (INIS)
Goodman, L.R.; Teplick, S.K.; Kay, H.
1983-01-01
The normal CT anatomy of the sternum was studied in 35 patients. In addition to the normal appearance of the sternum, normal variants that may mimic desease were often noted. In the manubrium, part of the posterior cortical margin was unsharp and irregular in 34 of 35 patients. Part of the anterior cortical margin was indistinct in 20 of the 35 patients. Angulation of the CT gantry to a position more nearly perpendicular to the manubrium improved the definition of the cortical margins. The body of the sternum was ovoid to rectangular and usually had sharp cortical margins. Sections through the manubriosternal joint and xyphoid often demonstrated irregular mottled calcifications and indistinct margins again simulating bony lesions. The rib insertions, sternal clavicular joints, and adjacent soft-tissue appearance also were evaluated
Rajaram, Narasimhan; Kovacic, Dianne; Migden, Michael F.; Reichenberg, Jason S.; Nguyen, Tri H.; Tunnell, James W.
2009-02-01
Diffuse optical spectroscopy (DOS) and laser-induced fluorescence (LIF) techniques have widely been used as noninvasive tools for early cancer detection in several organs including the cervix, oral cavity and gastrointestinal tract. Using a combined DOS/LIF approach, one can simultaneously measure the morphology and biochemical composition of tissue and use these features to diagnose malignancy. We report for the first time to our knowledge both the optical properties and native fluorophore characteristics of non-melanoma skin cancer in the UV-visible range. We collected in vivo diffuse reflectance and intrinsic fluorescence measurements from 44 skin lesions on 37 patients. The skin sites were further categorized into three groups of non-melanoma skin cancer according to histopathology: 1) pre-cancerous actinic keratosis 2) malignant squamous cell carcinoma (SCC) and 3) basal cell carcinoma (BCC). We used a custom-built probe-based clinical system that collects both white light reflectance and laser-induced fluorescence in the wavelength range of 350-700 nm. We extracted the blood volume fraction, oxygen saturation, blood vessel size, tissue microarchitecture and melanin content from diffuse reflectance measurements. In addition, we determined the native fluorophore contributions of NADH, collagen and FAD from laser-induced fluorescence for all groups. The scattering from tissue decreased with progression from clinically normal to precancerous actinic keratosis to malignant SCC. A similar trend was observed for clinically normal skin and malignant BCC. Statistically significant differences were observed in the collagen contributions, which were lower in malignant SCC and BCC as compared to normal skin. Our data demonstrates that the mean optical properties and fluorophore contributions of normal, benign and malignant nonmelanoma cancers are significantly different from each other and can potentially be used as biomarkers for the early detection of skin cancer.
Hydroquinone neuropathy following use of skin bleaching creams: case report.
Karamagi, C; Owino, E; Katabira, E T
2001-04-01
A 30-year old black woman presented with gradual onset of weakness of the legs associated with burning sensation in the feet for two months. She had been using two hydroquinone based skin bleaching creams (MGC by M. G. C. International, MEKAKO by Anglo Fabrics BOLTON Ltd) for about four years. Her BP was 80/40 mm Hg supine with un-recordable diastolic pressure on standing. She had decreased power (Grade 3/5), loss of deep tendon reflexes and impairment of deep sensation in the lower limbs. A complete blood count, urinalysis, serum electrolytes, serum creatinine and uric acid were all normal. Oral GTT, VDRL and brucella tests were negative. Chest and abdominal radiographs did not show any abnormalities. A diagnosis of peripheral neuropathy with autonomic neuropathy possibly due to hydroquinone toxicity was made and she was advised to stop using hydroquinone based skin bleaching creams. Four months later she was asymptomatic, her BP was 120/80 mmHg supine and standing, and neurological examination was normal. The case raises the question of whether hydroquinone based skin bleaching creams could be a cause of peripheral neuropathy and underscores the need for research on hydroquinone based skin bleaching creams and neuropathy particularly in black women involved in the sale and/or use of skin bleaching creams.
Aging and senescence of skin cells in culture
DEFF Research Database (Denmark)
Rattan, Suresh
2015-01-01
Studying age-related changes in the physiology, biochemistry, and molecular biology of isolated skin cell populations in culture has greatly expanded the understanding of the fundamental aspects of skin aging. The three main cell types that have been studied extensively with respect to cellular...... aging in vitro are dermal fibroblasts, epidermal keratinocytes, and melanocytes. Serial subcultivation of normal diploid skin cells can be performed only a limited number of times, and the emerging senescent phenotype can be categorized into structural, physiological, biochemical, and molecular...... phenotypes, which can be used as biomarkers of cellular aging in vitro. The rate and phenotype of aging are different in different cell types. There are both common features and specific features of aging of skin fibroblasts, keratinocytes, melanocytes, and other cell types. A progressive accumulation...
One-sheet spiraling full thickness skin graft for penile resurfacing after paraffinoma excision
Directory of Open Access Journals (Sweden)
Theddeus O.H. Prasetyono
2011-08-01
Full Text Available In the midst of on-going non-illicit practice of silicone or paraffin injection to enlarge penis, the author reported 3 cases of surgical treatment to resurface the body of the penis after excision of the destructed penile skin using full thickness skin graft. The skin excision was performed technically through penile body degloving procedure. Full thickness skin graft was then applied as a single sheet donor tissue to cover the denuded penile body spirally. The full thickness graft, which is relatively easy to be performed, is no doubt much thinner than a skin flap, while it also bears a smaller degree of secondary contraction than split skin graft. The color of the skin is considerably matched as it comes from the groin, which is a nearby area of penis. The size and skin sensitization of the penis looks to be natural. The only disadvantage is the common possibility of either spiral or circular junctional scar in between graft edges and between the graft and the penile mucosa and skin to develop hypertrophic scar. However, this possible scar problem applies also to any other surgical scar with any donor tissue. Fortunately, the 3 cases posed no scar problem and normal appearance. All the patients have also regained their normal sexual function. (Med J Indones 2011; 20:222-5Keywords: full thickness skin graft, paraffinoma, siliconoma, sexual function
Preliminary experiments on quantification of skin condition
Kitajima, Kenzo; Iyatomi, Hitoshi
2014-03-01
In this study, we investigated a preliminary assessment method for skin conditions such as a moisturizing property and its fineness of the skin with an image analysis only. We captured a facial images from volunteer subjects aged between 30s and 60s by Pocket Micro (R) device (Scalar Co., Japan). This device has two image capturing modes; the normal mode and the non-reflection mode with the aid of the equipped polarization filter. We captured skin images from a total of 68 spots from subjects' face using both modes (i.e. total of 136 skin images). The moisture-retaining property of the skin and subjective evaluation score of the skin fineness in 5-point scale for each case were also obtained in advance as a gold standard (their mean and SD were 35.15 +/- 3.22 (μS) and 3.45 +/- 1.17, respectively). We extracted a total of 107 image features from each image and built linear regression models for estimating abovementioned criteria with a stepwise feature selection. The developed model for estimating the skin moisture achieved the MSE of 1.92 (μS) with 6 selected parameters, while the model for skin fineness achieved that of 0.51 scales with 7 parameters under the leave-one-out cross validation. We confirmed the developed models predicted the moisture-retaining property and fineness of the skin appropriately with only captured image.
Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods
DEFF Research Database (Denmark)
Remvig, Lars; Duhn, Ph; Ullman, S
2010-01-01
Objective: The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin...
Skin signs in Ehlers-Danlos syndrome: clinical tests and para-clinical methods
DEFF Research Database (Denmark)
Remvig, L; Duhn, Ph; Ullman, S
2010-01-01
The criteria for Ehlers-Danlos syndrome (EDS) and the hypermobility syndrome (HMS) should be reliable. Examination for general joint hypermobility has high reliability but there is only sparse information on the reliability of skin tests, and no information on the level of normal skin extensibility...
Immunohistochemical distribution of Ki67 in epidermis of thick glabrous skin of human digits.
Petrovic, Aleksandar; Petrovic, Vladimir; Milojkovic, Bobana; Nikolic, Ivan; Jovanovic, Dragan; Antovic, Aleksandra; Milic, Miroslav
2018-01-01
The glabrous skin on the flexor sides of hands and feet, compared to other integument regions, has thicker epidermis and more complex pattern of epidermal ridges, wherefore in microscopy is denominated as thick skin. The epidermis of this skin type has individually unique and permanent superficial patterns, called dermatoglyphics, which are maintained by regenerative potential of deep epidermal rete ridges, that interdigitate with adjacent dermis. Using light microscopy, we analyzed cadaveric big toes thick skin samples, described histology of deep epidermal ridges (intermediate, limiting, and transverse), and quantitatively evidenced their pattern of proliferation by immunohistochemical assessment of Ki67. Immunohistochemical distribution of Ki67 was confined to basal and suprabasal layers, with pattern of distribution specific for intermediate, limiting and transverse ridges that gradually transform within epidermal height. Deep epidermal ridges, interdigitating with dermal papillae, participate in construction of intricate epidermal base, whose possible role in epidermal regeneration was also discussed. Having a prominent morphology, this type of epidermis offers the best morphological insight in complexities of skin organization, and its understanding could challenge and improve currently accepted models of epidermal organization.
International Nuclear Information System (INIS)
Geise, R.A.; Ansel, H.J.
1990-01-01
Measurement of skin entrance exposures during fluoroscopic procedures is complicated by the use of automatic exposure control devices and the presence of contrast media. Due to variability in positioning spot films from patient to patient, standard dosimeters, such as thermoluminescent, cannot be properly placed on the skin prior to examination. Prepackaged film of the type used for portal verification in radiation therapy held next to the patient's skin in a specially modified patient examination gown was found to be useful for determining the entrance skin exposure from both fluoroscopy and spot films during air contrast barium enema exams. The usable sensitivity range of this film has been found satisfactory for exposure measurements at exposures and kVps typically used for gastrointestinal fluoroscopic procedures. Errors in exposure estimates due to changes in film speed and contrast with kVp are less than 5% for the range of kVps used. Errors from variations in beam quality due to the adjacency of scattering material are approximately 5%. Entrance exposures determined with film agreed with those determined from TLD measurements to within 21%, with an average difference of 9%
Normal anatomy of lung perfusion SPECT scintigraphy
International Nuclear Information System (INIS)
Moskowitz, G.W.; Levy, L.M.
1987-01-01
Ten patients studies for possible pulmonary embolic disease had normal lung perfusion planar and SPECT scintigraphy. A computer program was developed to superimpose the CT scans on corresponding SPECT images. Superimposition of CT scans on corresponding SPECT transaxial cross-sectional images, when available, provides the needed definition and relationships of adjacent organs. SPECT transaxial sections provide clear anatomic definition of perfusion defects without foreground and background lung tissue superimposed. The location, shape, and size of the perfusion defects can be readily assessed by SPECT. An algorithm was developed for the differentiation of abnormal pulmonary perfusion patterns from normal structures on variation
Pelle, Edward; Maes, Daniel; Huang, Xi; Frenkel, Krystyna; Pernodet, Nadine; Yarosh, Daniel B; Zhang, Qi
2012-01-01
Environmental trauma to human skin can lead to oxidative damage of proteins and affect their activity and structure. When methionine becomes oxidized to its sulfoxide form, methionine sulfoxide reductase A (MSRA) reduces it back to methionine. We report here the increase in MSRA in normal human epidermal keratinocytes (NHEK) after ultraviolet B (UVB) radiation, as well as the reduction in hydrogen peroxide levels in NHEK pre-treated with MSRA after exposure. Further, when NHEK were pre-treated with a non-cytotoxic pentapeptide containing methionine sulfoxide (metSO), MSRA expression increased by 18.2%. Additionally, when the media of skin models were supplemented with the metSO pentapeptide and then exposed to UVB, a 31.1% reduction in sunburn cells was evident. We conclude that the presence of MSRA or an externally applied peptide reduces oxidative damage in NHEK and skin models and that MSRA contributes to the protection of proteins against UVB-induced damage in skin.
Analysis of assistance procedures to normal birth in primiparous
Directory of Open Access Journals (Sweden)
Joe Luiz Vieira Garcia Novo
2016-04-01
Full Text Available Introduction: Current medical technologies in care in birth increased maternal and fetal benefits persist, despite numerous unnecessary procedures. The purpose of the normal childbirth care is to have healthy women and newborns, using a minimum of safe interventions. Objective: To analyze the assistance to normal delivery in secondary care maternity. Methodology: A total of 100 primiparous mothers who had vaginal delivery were included, in which care practices used were categorized: 1 according to the WHO classification for assistance to normal childbirth: effective, harmful, used with caution and used inappropriately; 2 associating calculations with the Bologna Index parameters: presence of a birth partner, partograph, no stimulation of labor, delivery in non-supine position, and mother-newborn skin-to-skin contact. Results: Birth partners (85%, correctly filled partographs (62%, mother-newborn skin-to-skin contact (36%, use of oxytocin (87%, use of parenteral nutrition during labor (86% and at delivery (74%, episiotomy (94% and uterine fundal pressure in the expulsion stage (58%. The overall average value of the Bologna Index of the mothers analyzed was 1.95. Conclusions: Some effective procedures recommended by WHO (presence of a birth partner, some effective and mandatory practices were not complied with (partograph completely filled, potentially harmful or ineffective procedures were used (oxytocin in labor/post-partum, as well as inadequate procedures (uterine fundal pressure during the expulsion stage, use of forceps and episiotomy. The maternity’s care model did not offer excellence procedures in natural birth to their mothers in primiparity, (BI=1.95.
Novel biodegradable porous scaffold applied to skin regeneration.
Wang, Hui-Min; Chou, Yi-Ting; Wen, Zhi-Hong; Wang, Chau-Zen; Wang, Zhao-Ren; Chen, Chun-Hong; Ho, Mei-Ling
2013-01-01
Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.
Novel biodegradable porous scaffold applied to skin regeneration.
Directory of Open Access Journals (Sweden)
Hui-Min Wang
Full Text Available Skin wound healing is an important lifesaving issue for massive lesions. A novel porous scaffold with collagen, hyaluronic acid and gelatin was developed for skin wound repair. The swelling ratio of this developed scaffold was assayed by water absorption capacity and showed a value of over 20 g water/g dried scaffold. The scaffold was then degraded in time- and dose-dependent manners by three enzymes: lysozyme, hyaluronidase and collagenase I. The average pore diameter of the scaffold was 132.5±8.4 µm measured from SEM images. With human skin cells growing for 7 days, the SEM images showed surface fractures on the scaffold due to enzymatic digestion, indicating the biodegradable properties of this scaffold. To simulate skin distribution, the human epidermal keratinocytes, melanocytes and dermal fibroblasts were seeded on the porous scaffold and the cross-section immunofluorescent staining demonstrated normal human skin layer distributions. The collagen amount was also quantified after skin cells seeding and presented an amount 50% higher than those seeded on culture wells. The in vivo histological results showed that the scaffold ameliorated wound healing, including decreasing neutrophil infiltrates and thickening newly generated skin compared to the group without treatments.
Proteomic Analysis of Laser Microdissected Melanoma Cells from Skin Organ Cultures
Hood, Brian L.; Grahovac, Jelena; Flint, Melanie S.; Sun, Mai; Charro, Nuno; Becker, Dorothea; Wells, Alan; Conrads, Thomas P
2010-01-01
Gaining insights into the molecular events that govern the progression from melanoma in situ to advanced melanoma, and understanding how the local microenvironment at the melanoma site influences this progression, are two clinically pivotal aspects that to date are largely unexplored. In an effort to identify key regulators of the crosstalk between melanoma cells and the melanoma-skin microenvironment, primary and metastatic human melanoma cells were seeded into skin organ cultures (SOCs), and grown for two weeks. Melanoma cells were recovered from SOCs by laser microdissection and whole-cell tryptic digests analyzed by nanoflow liquid chromatography-tandem mass spectrometry with an LTQ-Orbitrap. The differential protein abundances were calculated by spectral counting, the results of which provides evidence that cell-matrix and cell-adhesion molecules that are upregulated in the presence of these melanoma cells recapitulate proteomic data obtained from comparative analysis of human biopsies of invasive melanoma and a tissue sample of adjacent, non-involved skin. This concordance demonstrates the value of SOCs for conducting proteomic investigations of the melanoma microenvironment. PMID:20459140
DEFF Research Database (Denmark)
Tetens, Inge
claims in relation to astaxanthin and protection of the skin from UV-induced damage, defence against Helicobacter pylori, contribution to normal spermatogenesis, contribution to normal muscle function, and “immune system”. The scientific substantiation is based on the information provided by the Member...
Traumatic degloving lesion of penile and scrotal skin
Directory of Open Access Journals (Sweden)
Luiz A. Zanettini
2005-06-01
Full Text Available Avulsions of penile and scrotal skin are uncommon events and are caused mainly by accidents with industrial machines and agricultural machine belts. We report the case of a 30-year old patient with avulsion and traumatic degloving of the penile and scrotal skin, with exposure of the cavernous bodies, spongy body, and testes due to an industrial machine accident. Reconstruction was performed in steps, achieving a satisfactory esthetic result, normal voiding and reestablished sexual function.
Impact of overweight on the normal physiology of human in vivo skin
Directory of Open Access Journals (Sweden)
Liliana Tavares
2013-06-01
Full Text Available Obesity is an increasing public health issue, particularly in Portugal, where more than 50% of the population is obese. The pathophysiological consequences of being overweight have a severe cutaneous impact. However, there is still a lack of studies to link these alterations to BMI categories. This present work intends to identify the hydration and biomechanical behaviour changes related to weight augmentation. This transversal study was performed on a convenience sample of 57 volunteers, all females, aged between 20 and 46 (30±8 years old. Volunteers were divided in two groups – group I, with a BMI between 19,9 and 24,9 Kg/m2 and group II, between 25 and 29,9 Kg/m2. One single determination of the superficial hydration, transepidermal water loss and biomechanical behaviour of the skin, was obtained with non-invasive methods. The data showed that weight increase positively influences hydration levels and transepidermal water loss, and negatively influences the skin's biomechanical behaviour. Despite the relevance of these results, there is still a need for complementary studies, with a wider number of individuals, in order to better understand its nature and meaning.
Falk-Brynhildsen, K; Söderquist, B; Friberg, O; Nilsson, U G
2013-06-01
Sternal wound infection after cardiac surgery is a serious complication. Various perioperative strategies, including plastic adhesive drapes, are used to reduce bacterial contamination of surgical wounds. To compare plastic adhesive drape to bare skin regarding bacterial growth in wound and time to recolonization of the adjacent skin intraoperatively, in cardiac surgery patients. This single-blinded randomized controlled trial (May 2010 to May 2011) included 140 patients scheduled for cardiac surgery via median sternotomy. The patients were randomly allocated to the adhesive drape (chest covered with plastic adhesive drape) or bare skin group. Bacterial samples were taken preoperatively and intraoperatively every hour during surgery until skin closure. Disinfection with 0.5% chlorhexidine solution in 70% alcohol decreased coagulase-negative staphylococci (CoNS), while the proportion colonized with Propionibacterium acnes was not significantly reduced and was still present in more than 50% of skin samples. P. acnes was significantly more common in men than in women. Progressive bacterial recolonization of the skin occurred within 2-3 h. At 120 min there were significantly more positive cultures in the adhesive drape group versus bare skin group for P. acnes (63% vs 44%; P = 0.034) and for CoNS (45% vs 24%; P = 0.013). The only statistically significant difference in bacterial growth in the surgical wound was higher proportion of CoNS at the end of surgery in the adhesive drape group (14.7% vs 4.4%; P = 0.044). Plastic adhesive drape does not reduce bacterial recolonization. P. acnes colonized men more frequently, and was not decreased by disinfection with chlorhexidine solution in alcohol. Copyright © 2013 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION
Directory of Open Access Journals (Sweden)
Anjanappa
2015-01-01
Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also
Focal skin defect, limb anomalies and microphthalmia.
Jackson, K.E.; Andersson, H.C.
2004-01-01
We describe two unrelated female patients with congenital single focal skin defects, unilateral microphthalmia and limb anomalies. Growth and psychomotor development were normal and no brain malformation was detected. Although eye and limb anomalies are commonly associated, clinical anophthalmia and
International Nuclear Information System (INIS)
Lin, L H; Yu, H B; Zhu, X Q; Zhuo, S M; Chen, J X; Wang, Y Y; Yang, Y H
2013-01-01
Discoid lupus erythematosus (DLE) is a chronic dermatological disease which lacks valid methods for early diagnosis and therapeutic monitoring. Considering the collagen and elastin disorder due to mucin deposition of DLE, multiphoton microscopy (MPM) imaging techniques were employed to obtain high-resolution collagen and elastin images from the dermis. The content and distribution of collagen and elastin were quantified to characterize the dermal pathological status of skin lesions with DLE in comparison with normal skin. Our results showed a significant difference between skin lesions with DLE and normal skin in terms of the morphological structure of collagen and elastin in the dermis, demonstrating the possibility of MPM for noninvasively tracking the pathological process of DLE even in its early stages and evaluating the therapeutic efficacy at the molecular level. (paper)
Steroid synthesis by primary human keratinocytes; implications for skin disease
Energy Technology Data Exchange (ETDEWEB)
Hannen, Rosalind F., E-mail: r.f.hannen@qmul.ac.uk [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Michael, Anthony E. [Centre for Developmental and Endocrine Signalling, Academic Section of Obstetrics and Gynaecology, Division of Clinical Developmental Sciences, 3rd Floor, Lanesborough Wing, St. George' s, University of London, Cranmer Terrace, Tooting, London SW17 0RE (United Kingdom); Jaulim, Adil [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom); Bhogal, Ranjit [Life Science, Unilever R and D Colworth House, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Burrin, Jacky M. [Centre for Endocrinology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London EC1M 6BQ (United Kingdom); Philpott, Michael P. [Centre for Cutaneous Research, Institute of Cell and Molecular Science, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London E1 2AT (United Kingdom)
2011-01-07
Research highlights: {yields} Primary keratinocytes express the steroid enzymes required for cortisol synthesis. {yields} Normal primary human keratinocytes can synthesise cortisol. {yields} Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. {yields} StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3{beta}HSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7-{sup 3}H]-pregnenolone through each steroid intermediate to [7-{sup 3}H]-cortisol in cultured PHK. Trilostane (a 3{beta}HSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data
Steroid synthesis by primary human keratinocytes; implications for skin disease
International Nuclear Information System (INIS)
Hannen, Rosalind F.; Michael, Anthony E.; Jaulim, Adil; Bhogal, Ranjit; Burrin, Jacky M.; Philpott, Michael P.
2011-01-01
Research highlights: → Primary keratinocytes express the steroid enzymes required for cortisol synthesis. → Normal primary human keratinocytes can synthesise cortisol. → Steroidogenic regulators, StAR and MLN64, are expressed in normal epidermis. → StAR expression is down regulated in eczema and psoriatic epidermis. -- Abstract: Cortisol-based therapy is one of the most potent anti-inflammatory treatments available for skin conditions including psoriasis and atopic dermatitis. Previous studies have investigated the steroidogenic capabilities of keratinocytes, though none have demonstrated that these skin cells, which form up to 90% of the epidermis are able to synthesise cortisol. Here we demonstrate that primary human keratinocytes (PHK) express all the elements required for cortisol steroidogenesis and metabolise pregnenolone through each intermediate steroid to cortisol. We show that normal epidermis and cultured PHK express each of the enzymes (CYP11A1, CYP17A1, 3βHSD1, CYP21 and CYP11B1) that are required for cortisol synthesis. These enzymes were shown to be metabolically active for cortisol synthesis since radiometric conversion assays traced the metabolism of [7- 3 H]-pregnenolone through each steroid intermediate to [7- 3 H]-cortisol in cultured PHK. Trilostane (a 3βHSD1 inhibitor) and ketoconazole (a CYP17A1 inhibitor) blocked the metabolism of both pregnenolone and progesterone. Finally, we show that normal skin expresses two cholesterol transporters, steroidogenic acute regulatory protein (StAR), regarded as the rate-determining protein for steroid synthesis, and metastatic lymph node 64 (MLN64) whose function has been linked to cholesterol transport in steroidogenesis. The expression of StAR and MLN64 was aberrant in two skin disorders, psoriasis and atopic dermatitis, that are commonly treated with cortisol, suggesting dysregulation of epidermal steroid synthesis in these patients. Collectively these data show that PHK are capable of extra
"Ser diferente é normal?"/"Being different: is it normal?"
Directory of Open Access Journals (Sweden)
Viviane Veras
2007-01-01
Full Text Available A pergunta título deste trabalho retoma o slogan “Ser diferente é normal”, que é parte da campanha criada para uma organização não-governamental que atende portadores de Síndrome de Down. O objetivo é a inclusão social da pessoa com deficiência e o primeiro passo foi propor a inclusão de um grupo de diferentes no grupo dito normal. No vídeo de lançamento da campanha, o diferente, identificado como normal, é mostrado por meio de exemplos – um negro com cabelo black-power, um skin-head, um corpo tatuado, um corpo feminino halterofílico, uma família hippie, uma garota com síndrome de Down. A visão da adolescente dançando reduz, de certo modo, o efeito imaginário que vai além da síndrome, uma vez que apenas o corpo com seus olhinhos puxados se destacam, e não se interrogam questões cognitivas. Minha proposta é refletir sobre o estatuto paradoxal do exemplo, tal como é trabalhado nesse vídeo: se, por definição, um exemplo mostra de fato seu pertencimento a uma classe, pode-se concluir que é exatamente por ser exemplar que ele se encontra fora dela, no exato momento em que a exibe e define. The question in the title of this paper refers to the slogan "ser diferente é normal" ("It´s normal to be different", which is part of a campaign created for a NGO that supports people with Down syndrome. The objective of the campaign is to promote the social inclusion of individuals with Down syndrome, and the first step was to propose the inclusion of a group of "differents" in the so-called normal group. The film launching the campaign shows the different identified as normal by means of examples: a black man exhibiting blackpower haircut, a skin-head, a tattooed body, an over-athletic female body, a hippie family and a girl with Down syndrome. The vision of the dancing teenager lessens the imaginary effect that surpasses the syndrome, since only her body and her little oriental eyes stand out and no cognitive issues are
Park, Jonghwa; Kim, Jinyoung; Hong, Jaehyung; Lee, Hochan; Lee, Youngoh; Cho, Seungse; Kim, Sung-Woo; Kim, Jae Joon; Kim, Sung Youb; Ko, Hyunhyub
2018-04-01
Electronic skins (e-skins) with high sensitivity to multidirectional mechanical stimuli are crucial for healthcare monitoring devices, robotics, and wearable sensors. In this study, we present piezoresistive e-skins with tunable force sensitivity and selectivity to multidirectional forces through the engineered microstructure geometries (i.e., dome, pyramid, and pillar). Depending on the microstructure geometry, distinct variations in contact area and localized stress distribution are observed under different mechanical forces (i.e., normal, shear, stretching, and bending), which critically affect the force sensitivity, selectivity, response/relaxation time, and mechanical stability of e-skins. Microdome structures present the best force sensitivities for normal, tensile, and bending stresses. In particular, microdome structures exhibit extremely high pressure sensitivities over broad pressure ranges (47,062 kPa-1 in the range of <1 kPa, 90,657 kPa-1 in the range of 1-10 kPa, and 30,214 kPa-1 in the range of 10-26 kPa). On the other hand, for shear stress, micropillar structures exhibit the highest sensitivity. As proof-of-concept applications in healthcare monitoring devices, we show that our e-skins can precisely monitor acoustic waves, breathing, and human artery/carotid pulse pressures. Unveiling the relationship between the microstructure geometry of e-skins and their sensing capability would provide a platform for future development of high-performance microstructured e-skins.
Energy Technology Data Exchange (ETDEWEB)
Ginot, A.; Doyen, J.; Hannoun-Levi, J.M.; Courdi, A. [Service d' oncologie-radiotherapie, centre Antoine-Lacassagne, 06 - Nice (France)
2010-07-15
Acute skin toxicity is frequent during radiation therapy and can lead to temporary arrest of the treatment. Chronic toxicity can occur and conduct to cosmetic problems. Alopecia is the most frequent toxicity concerning hair and is most of the time reversible. Several factors linked to patients influence skin toxicity, such as under-nutrition, old age, obesity, smoking, skin diseases, autoimmune diseases, failure of DNA reparation. Skin, hair and nail toxicities depend also on radiation schedule. Acute toxicity is greater when dose per fraction increases. Chronic and acute toxicities are more often when total dose increases. Under 45 Gy, the risk of severe skin toxicity is low, and begins above 50 Gy. Skin toxicity depends also on the duration of radiotherapy and split course schedules are associated with less toxicities. Irradiation surface seems to influence skin toxicity but interaction is more complex. Reirradiation is often feasible in case of cancer recurrence but with a risk of grade 3-4 toxicity above all in head and neck cancer. The benefit/risk ratio has to be always precisely evaluated. Permanent alopecia is correlated with the follicle dose. Modern techniques of radiation therapy allow to spare skin. (authors)
miRNAs in inflammatory skin diseases and their clinical implications
DEFF Research Database (Denmark)
Løvendorf, Marianne B; Skov, Lone
2015-01-01
biological processes. The clinical implications of miRNAs are intriguing, both from a diagnostic and a therapeutic perspective. Accordingly, there is emerging evidence for the clinical potential of miRNAs as both biomarkers and possible therapeutic targets in skin diseases. Future studies will hopefully...... incomplete; however, it is known that miRNAs are implicated in various cellular processes of both normal and diseased skin. Some miRNAs appear to be consistently deregulated in several different inflammatory skin diseases, including psoriasis and atopic dermatitis, indicating a common role in fundamental...
Directory of Open Access Journals (Sweden)
Ya. O. Butko
2013-04-01
Full Text Available Introduction. Local therapy is an important method for treatment of dermatitis used to suppress the skin inflammation and the main related symptoms: hyperemia, edema, pruritus, lichenification etc. However today it is important to pay more attention to elimination of the skin dryness, restoration of the damaged epithelium and improvement of the skin barrier functions in dermatitis therapy. Considering all the requirements mentioned above, cream and ointment that correspond to the modern requirements of the local therapy were developed. They promote the decrease of inflammatory processes in skin (Mometasone furoate and Methylprednisolone atseponat are strong GCS with antipruritic, anti-inflammatory, vasoconstrictive, antiproliferative action and with minimum side effects, eliminate excessive skin dryness, restore the damaged epithelium, improve the skin condition and normalize the barrier functions of the skin (ceramides are the natural ceramides of the human’s skin. The purpose of this work was morphological study of the rats’ skin during treatment with cream “Mometasone with ceramides” and ointment “Methylprednisolone with ceramides” in the conditions of contact dermatitis inducted by turpentine. Materials and methods. Skin of animals was an object of the research after its treatment with cream “Mometasone with ceramides” and ointment “Methylprednisolone with ceramides”. The comparator preparations were cream “Elocom” and ointment “Advantan”. In the experiment 36 rats divided into groups were used. All the preparations were applied on the skin in a thin layer once a day. After the 5th day of the treatment animals were taken out of the experiment and all the tissue materials were fixed in 10% solution of formalin for morphological studies carrying out. Sections were stained with hematoxylin and eosine. An examination was carried out under the microscope Micros 400. Results of the research. The results showed that
Field enhancement due to anomalous skin effect inside a target
International Nuclear Information System (INIS)
Ma, G.; Tan, W.
1996-01-01
A new method based on Fourier transformation to study the skin effects is presented. Using this method, the field amplitude in plasma is represented in terms of electric conductivity, and the normal and anomalous skin effects are described through one formula by omitting the plasma dispersion or not. The results are in agreement with other publications [e.g., J. P. Matte and K. Aguenaou, Phys. Rev. A 45, 2558 (1992)] for equivalent parameters. But for deeper positions inside a target, which have not been studied by others, it is found that the field amplitude is considerably enhanced due to an anomalous skin effect, even for constant collision frequency. In addition, the skin absorptions and some calculations on an anomalous skin effect for different collision frequencies are also presented. copyright 1996 American Institute of Physics
Volodarsky-Perel, Alexander; Eldar-Geva, Talia; Holzer, Hananel E G; Schonberger, Oshrat; Reichman, Orna; Gal, Michael
2017-03-01
The optimal time to perform cryopreserved embryo transfer (CET) after a failed oocyte retrieval-embryo transfer (OR-ET) cycle is unknown. Similar clinical pregnancy rates were recently reported in immediate and delayed CET, performed after failed fresh OR-ET, in cycles with the gonadotrophin-releasing hormone (GnRH) antagonist protocol. This study compared outcomes of CET performed adjacently (<50 days, n = 67) and non-adjacently (≥50 to 120 days, n = 62) to the last OR-day of cycles with the GnRH agonist down-regulation protocol. Additional inclusion criteria were patients' age 20-38 years, the transfer of only 1-2 cryopreserved embryos, one treatment cycle per patient and artificial preparation for CET. Significantly higher implantation, clinical pregnancy and live birth rates were found in the non-adjacent group than in the adjacent group: 30.5% versus 11.3% (P = 0.001), 41.9% versus 17.9% (P = 0.003) and 32.3% versus 13.4% (P = 0.01), respectively. These results support the postponement of CET after a failed OR-ET for at least one menstrual cycle, when a preceding long GnRH-agonist protocol is used. Copyright © 2016 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Protective molecular mechanisms of resveratrol in UVR-induced Skin carcinogenesis.
Aziz, Saba W; Aziz, Moammir H
2018-01-01
Skin cancer is a major health problem worldwide. It is the most common cancer in the United States and poses a significant healthcare burden. Excessive UVR exposure is the most common cause of skin cancer. Despite various precautionary measures to avoid direct UVR exposure, the incidence of skin cancer and mortality related to it remains high. Furthermore, the current treatment options are expensive and have side effects including toxicity to normal cells. Thus, a safe and effective approach is needed to prevent and treat skin cancer. Chemopreventive strategy using naturally occurring compounds, such as resveratrol, is a promising approach to reduce the incidence of UVR-induced skin cancer and delay its progression. This review highlights the current body of evidence related to chemopreventive role of resveratrol and its molecular mechanisms in UVR-induced skin carcinogenesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Lee, Young; Je, Young-Jin; Lee, Sang-Sin; Li, Zheng Jun; Choi, Dae-Kyoung; Kwon, Yoo-Bin; Sohn, Kyung-Cheol; Im, Myung; Seo, Young Joon
2012-01-01
Background Aquaporins (AQPs) are a family of water transporting proteins present in many mammalian epithelial and endothelial cell types. Among the AQPs, AQP3 is known to be a water/glycerol transporter expressed in human skin. Objective The relationship between the expression level of AQP3 and transpidermal water loss (TEWL) in the lesional and peri-lesional skin of psoriasis-affected patients, and skin hydration in the lesional and peri-lesional skin of psoriasis patients, was investigated. Methods The expression of AQP3 in psoriasis-affected and healthy control skin was determined using immunohistochemical and immunofluroscence staining. TEWL and skin hydration were measured using a Tewameter® TM210 (Courage & Khazaka, Cologne, Germany) and a Corneometer® CM 820 (Courage & Khazaka), respectively. Results AQP3 was mainly expressed in the plasma membrane of stratum corneum and the stratum spinosum in normal epidermis. Unlike the normal epidermis, AQP3 showed decreased expression in the lesional and peri-lesional epidermis of psoriasis. TEWL was increased, and skin hydration was decreased, in the lesional and peri-lesional skin of psoriasis patients, compared with the healthy control sample. Conclusion Although various factors contribute to reduced skin hydration in the lesional and peri-lesional skin of psoriasis, AQP3 appears to be a key factor in the skin dehydration of psoriasis-affected skin. PMID:22577267
Real significance of skin contamination is
International Nuclear Information System (INIS)
Sudmann, R.H.
1983-01-01
For five decades, health physicists have discussed the thickness, area, significance of radioactive contamination and the exposures to various portions of the skin. Concern about instances of skin contamination extend beyond the resultant organ dose simply because it is a recognizable and quantifiable event. As such, there is a tendency for management and regulatory agencies to use it as a trend indicator. The final result is a score card similar to the list of OSHA reportable accidents. In fact, the skin contamination incidence rate has a somewhat different meaning to the health physicist, to the manager, and to the regulator. The question must then be asked, What is the true significance of skin contamination, Is it the resultant skin dose, Is it an indicator of loss of control, Is it both or neither. In order to answer these questions, Rockwell Hanford Operations began analysis of the previous five years records of skin contamination cases. Since by policy each incidence of skin contamination is documented, a large percentage of the 425 records analyzed were of low level activity (less than 100 dpm/cm 2 ) on the extremeties, primarily hands and fingers. Most of these cases were readily decontaminated with soap and water. Individual elements studied included: detection/monitoring methods and limits; impact of type of operation on the incidence rate; causes of and methods for reduction of the incidence rate; reporting and documentation; and dose assessment. Results of the study indicate that skin contamination rarely presents a beta dose problem because it is normally highly localized on the extremeties. Only in unusual cases does it represent a potential for internal deposition. Thus, the real importance of skin contamination incidence is as an indicator of deteriorating conditions and should be reviewed by health physicists, managers and regulators as such
Smarandachely Adjacent-Vertex-Distinguishing Proper Edge Chromatic Number of Cm∨Kn
Shunqin Liu
2016-01-01
According to different conditions, researchers have defined a great deal of coloring problems and the corresponding chromatic numbers. Such as, adjacent-vertex-distinguishing total chromatic number, adjacent-vertex-distinguishing proper edge chromatic number, smarandachely-adjacent-vertex-distinguishing proper edge chromatic number, smarandachely-adjacent-vertex-distinguishing proper total chromatic number. And we focus on the smarandachely adjacent-vertex-distinguishing proper edge chromatic...
Loading effects of anterior cervical spine fusion on adjacent segments
Directory of Open Access Journals (Sweden)
Chien-Shiung Wang
2012-11-01
Full Text Available Adjacent segment degeneration typically follows anterior cervical spine fusion. However, the primary cause of adjacent segment degeneration remains unknown. Therefore, in order to identify the loading effects that cause adjacent segment degeneration, this study examined the loading effects to superior segments adjacent to fused bone following anterior cervical spine fusion. The C3–C6 cervical spine segments of 12 sheep were examined. Specimens were divided into the following groups: intact spine (group 1; and C5–C6 segments that were fused via cage-instrumented plate fixation (group 2. Specimens were cycled between 20° flexion and 15° extension with a displacement control of 1°/second. The tested parameters included the range of motion (ROM of each segment, torque and strain on both the body and inferior articular process at the superior segments (C3–C4 adjacent to the fused bone, and the position of the neutral axis of stress at under 20° flexion and 15° extension. Under flexion and Group 2, torque, ROM, and strain on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. Under extension and Group 2, ROM for the fused segment was less than that of Group 1; torque, ROM, and stress on both the bodies and facets of superior segments adjacent to the fused bone were higher than those of Group 1. These analytical results indicate that the muscles and ligaments require greater force to achieve cervical motion than the intact spine following anterior cervical spine fusion. In addition, ROM and stress on the bodies and facets of the joint segments adjacent to the fused bone were significantly increased. Under flexion, the neutral axis of the stress on the adjacent segment moved backward, and the stress on the bodies of the segments adjacent to the fused bone increased. These comparative results indicate that increased stress on the adjacent segments is caused by stress-shielding effects
DEFF Research Database (Denmark)
Philipsen, P A; Knudsen, L; Gniadecka, M
2013-01-01
and skin tumour diagnostics in vivo. We obtained Raman spectra in vivo from the normal skin of 55 healthy persons with different skin pigmentation (Fitzpatrick skin type I-VI) and in vivo from 25 basal cell carcinomas, 41 pigmented nevi and 15 malignant melanomas. Increased skin pigmentation resulted...
Effects of external pressure loading on human skin blood flow measured by 133Xe clearance
International Nuclear Information System (INIS)
Holloway, G.A. Jr.; Daly, C.H.; Kennedy, D.; Chimoskey, J.
1976-01-01
Forearm skin blood flow was measured during external pressure loading in normal human subjects using 133 Xe washout from intracutaneous injection sites. Pressures ranging between 5 and 150 mmHg were applied through a 3-cm-diameter disc placed over the site of flow determination. The pressure was maintained constant by a servo-controlled loading mechanism. Flow decreased with pressures from 5 to 10 and 30 to 150 mmHg, but remained constant with pressures from 10 to 30 mmHg. Reactive hyperemia occurred following removal of pressures of 90 mmHg or greater, but did not occur following removal of lower pressures. The pressure-flow curve for parasacral skin of paraplegic subjects closely paralleled the pressure-flow curve of normal skin at pressures tested: 5 to 15 mmHg. These data are interpreted to demonstrate autoregulation of skin blood flow. Autoregulation in parasacral skin of paraplegic subjects suggests a peripheral mechanism. The occurrence of hyperemia at pressures which exceed the ability of skin to autoregulate suggests that both autoregulation and post occlusion hyperemia may have the same mechanism
The Roles of Vitamin C in Skin Health.
Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M
2017-08-12
The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.
Silveira, Landulfo, Jr.; Silveira, Fabrício L.; Bodanese, Benito; Pacheco, Marcos Tadeu T.; Zângaro, Renato A.
2012-02-01
This work demonstrated the discrimination among basal cell carcinoma (BCC) and normal human skin in vivo using near-infrared Raman spectroscopy. Spectra were obtained in the suspected lesion prior resectional surgery. After tissue withdrawn, biopsy fragments were submitted to histopathology. Spectra were also obtained in the adjacent, clinically normal skin. Raman spectra were measured using a Raman spectrometer (830 nm) with a fiber Raman probe. By comparing the mean spectra of BCC with the normal skin, it has been found important differences in the 800-1000 cm-1 and 1250-1350 cm-1 (vibrations of C-C and amide III, respectively, from lipids and proteins). A discrimination algorithm based on Principal Components Analysis and Mahalanobis distance (PCA/MD) could discriminate the spectra of both tissues with high sensitivity and specificity.
Removal of heavy metal contamination from peanut skin extracts by waste biomass adsorption
Polyphenols are a rapidly increasing portion of the nutraceutical and functional food marketplace. Peanut skins are a waste product which have potential as a low-cost source of polyphenols. Extraction and concentration of peanut skin extracts can cause normally innocuous levels of the heavy metal co...
A novel approach to measuring the frictional behaviour of human skin in vivo
Veijgen, N.K.; Masen, Marc Arthur; van der Heide, Emile
2012-01-01
Friction involving human skin plays a key role in human life. The availability of a portable tribometer improves the accessibility to large number of both subjects and anatomical sites. This is the first mobile device suitable to measure skin friction with a controlled and variable normal load
Care and management of a stoma: maintaining peristomal skin health.
Boyles, Anna; Hunt, Sharon
2016-09-22
It is estimated that around one in 500 people in the UK are living with a stoma, with approximately 21 000 operations that result in stoma formation being performed each year ( Colostomy Association, 2016 ). These people face a unique set of challenges in maintaining the integrity of their peristomal skin. This article explores the normal structure and function of skin and how the care and management of a stoma presents challenges for maintaining peristomal skin health. Particular focus is paid to the incidence of skin problems for those living with a stoma, whether it is temporary or permanent, and the factors that contribute to skin breakdown in this population. Wider factors such as the central role of the clinical nurse specialist and the impact of product usage on positive outcomes and health economics are also considered.
Biological Rhythms in the Skin
Directory of Open Access Journals (Sweden)
Mary S. Matsui
2016-05-01
Full Text Available Circadian rhythms, ≈24 h oscillations in behavior and physiology, are reflected in all cells of the body and function to optimize cellular functions and meet environmental challenges associated with the solar day. This multi-oscillatory network is entrained by the master pacemaker located in the suprachiasmatic nucleus (SCN of the hypothalamus, which directs an organism’s rhythmic expression of physiological functions and behavior via a hierarchical system. This system has been highly conserved throughout evolution and uses transcriptional–translational autoregulatory loops. This master clock, following environmental cues, regulates an organism’s sleep pattern, body temperature, cardiac activity and blood pressure, hormone secretion, oxygen consumption and metabolic rate. Mammalian peripheral clocks and clock gene expression have recently been discovered and are present in all nucleated cells in our body. Like other essential organ of the body, the skin also has cycles that are informed by this master regulator. In addition, skin cells have peripheral clocks that can function autonomously. First described in 2000 for skin, this review summarizes some important aspects of a rapidly growing body of research in circadian and ultradian (an oscillation that repeats multiple times during a 24 h period cutaneous rhythms, including clock mechanisms, functional manifestations, and stimuli that entrain or disrupt normal cycling. Some specific relationships between disrupted clock signaling and consequences to skin health are discussed in more depth in the other invited articles in this IJMS issue on Sleep, Circadian Rhythm and Skin.
Investigation of pion-treated human skin nodules for therapeutic gain
International Nuclear Information System (INIS)
Kligerman, M.M.; Sala, J.M.; Wilson, S.; Yuhas, J.M.
1978-01-01
A patient with multiple metastatic tumor nodules in the skin, from a primary breast carcinoma, was treated with graded doses of pions and x rays to establish skin tolerance. She was followed up for 346 days, permitting observation of time to regrowth of the tumor nodules. All 16 of these had disappeared after treatment, without significant correlation with type of radiation or dose, or with nodule size. However, time to regrowth depended both on the type and the dose of radiation. Earlier, relative biological effectiveness (RBE), was established at 1.42 for acute skin injury. Using this RBE to normalize doses of pions and x rays causing equivalent acute skin injury, and plotting those doses vs time to regrowth of tumor nodules, yielded a therapeutic gain (37.5%) in favor of pions. No late skin or subcutaneous tissue changes were seen, and no qualitative difference between pions and x rays in late skin effects was observed
Tubuloreticular inclusions in skin biopsies from patients with HIV infection
DEFF Research Database (Denmark)
Pedersen, C; Horn, T; Junge, Jette
1989-01-01
Skin biopsies obtained from apparently normal skin from 15 HIV infected patients and 6 anti-HIV negative patients were examined by electron microscopy. Tubuloreticular inclusions (TRI) were detected within the cytoplasm of capillary endothelial cells in 5/5 AIDS patients and in 2/5 patients...... of the patients without TRI, interferon activity was below detection level. The occurrence of TRI was not dependent on the presence of free p24 antigen in serum. It is concluded that the occurrence of TRI in entothelial cells of skin capillaries is associated with late stages of HIV infection and this may...
Bîrlea, Sinziana I; Corley, Gavin J; Bîrlea, Nicolae M; Breen, Paul P; Quondamatteo, Fabio; OLaighin, Gearóid
2009-01-01
We propose a new method for extracting the electrical properties of human skin based on the time constant analysis of its exponential response to impulse stimulation. As a result of this analysis an adjacent finding has arisen. We have found that stratum corneum electroporation can be detected using this analysis method. We have observed that a one time-constant model is appropriate for describing the electrical properties of human skin at low amplitude applied voltages (30V). Higher voltage amplitudes (>30V) have been proven to create pores in the skin's stratum corneum which offer a new, lower resistance, pathway for the passage of current through the skin. Our data shows that when pores are formed in the stratum corneum they can be detected, in-vivo, due to the fact that a second time constant describes current flow through them.
Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region
Firooz, Alireza; Sadr, Bardia; Babakoohi, Shahab; Sarraf-Yazdy, Maryam; Fanian, Ferial; Kazerouni-Timsar, Ali; Nassiri-Kashani, Mansour; Naghizadeh, Mohammad Mehdi; Dowlati, Yahya
2012-01-01
Background. Understanding the physiological, chemical, and biophysical characteristics of the skin helps us to arrange a proper approach to the management of skin diseases. Objective. The aim of this study was to measure 6 biophysical characteristics of normal skin (sebum content, hydration, transepidermal water loss (TEWL), erythema index, melanin index, and elasticity) in a normal population and assess the effect of sex, age, and body location on them. Methods. Fifty healthy volunteers in 5 age groups (5 males and females in each) were enrolled in this study. A multifunctional skin physiology monitor (Courage & Khazaka electronic GmbH, Germany) was used to measure skin sebum content, hydration, TEWL, erythema index, melanin index, and elasticity in 8 different locations of the body. Results. There were significant differences between the hydration, melanin index, and elasticity of different age groups. Regarding the locations, forehead had the highest melanin index, where as palm had the lowest value. The mean values of erythema index and melanin index and TEWL were significantly higher in males and anatomic location was a significant independent factor for all of 6 measured parameters. Conclusion. Several biophysical properties of the skin vary among different gender, age groups, and body locations. PMID:22536139
Jäger, Claudia; Brenner, Christiane; Habicht, Jüri; Wallich, Reinhard
2012-01-01
The promise of mesotherapy is maintenance and/or recovery of a youthful skin with a firm, bright and moisturized texture. Currently applied medications employ microinjections of hyaluronic acid, vitamins, minerals and amino acids into the superficial layer of the skin. However, the molecular and cellular processes underlying mesotherapy are still elusive. Here we analysed the effect of five distinct medication formulas on pivotal parameters involved in skin ageing, that is collagen expression, cell proliferation and morphological changes using normal human skin fibroblast cultures in vitro. Whereas in the presence of hyaluronic acid, NCTF135(®) and NCTF135HA(®) , cell proliferation was comparable to control cultures; however, with higher expression of collagen type-1, matrix metalloproteinase-1 and tissue inhibitor of matrix metalloproteinase-1, addition of Soluvit(®) N and Meso-BK led to apoptosis and/or necrosis of human fibroblasts. The data indicate that bioactive reagents currently applied for skin rejuvenation elicit strikingly divergent physiological processes in human skin fibroblast in vitro. © 2011 John Wiley & Sons A/S.
Impact of inflammation on iron stores in involved and non-involved psoriatic skin
International Nuclear Information System (INIS)
Pinheiro, T.; Ynsa, M.D.; Alves, L.C.; Teixeira, P.; Ferreira, J.; Filipe, P.
2015-01-01
Accumulating evidence supports a role for cellular Fe in cell proliferation, inflammation, and disease tolerance. Psoriasis is a severe inflammatory and hyper proliferative condition of human skin whose aetiology remains poorly understood. Herein, we performed nuclear microscopy techniques to quantify with cellular resolution and high sensitivity the concentration of Fe in lesional (psoriatic plaques) and non-lesional adjacent skin of psoriatic patients. Fe contents were measured across skin depth and along epidermal strata either by quantitatively imaging Fe distribution in regions of interest, or by determining Fe profiles through analysis of sequential points along selected transepts. Both procedures require deconvolution of spectra to project quantitative elemental data through the application of different software codes. Using these approaches a detailed quantitative distribution of Fe was resolved. We show that in both lesional and non-lesional skin, the epidermal profiles of Fe contents showed a peak at the basal layer and that Fe concentration along the basal layer was not uniformly distributed. Typically, Fe levels were significantly higher in epidermal ridges relative to regions above dermal papillae. Lesional skin displayed excess Fe over extended regions above basal layer. In conclusion, we found significantly increased Fe deposits in the epidermis of psoriatic patients, particularly in areas of epidermal hyper proliferation. These findings suggest an important role for Fe in the pathogenesis of psoriasis. They also raise the possibility that manipulation of Fe levels in the skin may become relevant for the clinical management of psoriasis
Impact of inflammation on iron stores in involved and non-involved psoriatic skin
Energy Technology Data Exchange (ETDEWEB)
Pinheiro, T., E-mail: murmur@ctn.ist.utl.pt [Instituto de Bioengenharia e Biociências, Instituto Superior Técnico, Universidade de Lisboa (Portugal); Ynsa, M.D. [Centro de Micro-Análisis de Materiales, Universidad Autonoma de Madrid (Spain); Alves, L.C. [Centro de Ciências e Tecnologias Nucleares, Instituto Superior Técnico, Universidade de Lisboa (Portugal); Teixeira, P.; Ferreira, J.; Filipe, P. [Unidade de Investigação em Dermatologia, Instituto de Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa (Portugal)
2015-04-01
Accumulating evidence supports a role for cellular Fe in cell proliferation, inflammation, and disease tolerance. Psoriasis is a severe inflammatory and hyper proliferative condition of human skin whose aetiology remains poorly understood. Herein, we performed nuclear microscopy techniques to quantify with cellular resolution and high sensitivity the concentration of Fe in lesional (psoriatic plaques) and non-lesional adjacent skin of psoriatic patients. Fe contents were measured across skin depth and along epidermal strata either by quantitatively imaging Fe distribution in regions of interest, or by determining Fe profiles through analysis of sequential points along selected transepts. Both procedures require deconvolution of spectra to project quantitative elemental data through the application of different software codes. Using these approaches a detailed quantitative distribution of Fe was resolved. We show that in both lesional and non-lesional skin, the epidermal profiles of Fe contents showed a peak at the basal layer and that Fe concentration along the basal layer was not uniformly distributed. Typically, Fe levels were significantly higher in epidermal ridges relative to regions above dermal papillae. Lesional skin displayed excess Fe over extended regions above basal layer. In conclusion, we found significantly increased Fe deposits in the epidermis of psoriatic patients, particularly in areas of epidermal hyper proliferation. These findings suggest an important role for Fe in the pathogenesis of psoriasis. They also raise the possibility that manipulation of Fe levels in the skin may become relevant for the clinical management of psoriasis.
Petrofsky, Jerrold; Paluso, Dominic; Anderson, Devyn; Swan, Kristin; Yim, Jong Eun; Murugesan, Vengatesh; Chindam, Tirupathi; Goraksh, Neha; Alshammari, Faris; Lee, Haneul; Trivedi, Moxi; Hudlikar, Akshay N; Katrak, Vahishta
2011-04-01
As predicted by the Pennes equation, skin blood flow is a major contributor to the removal of heat from an external heat source. This protects the skin from erythema and burns. But, for a person in a thermally neutral room, the skin is normally much cooler than arterial blood. Therefore, if skin blood flow (BF) increases, it should initially warm the skin paradoxically. To examine this phenomenon, 10 young male and female subjects participated in a series of experiments to examine the contribution of skin blood flow in the initial warming the skin after the application of local heat. Heat flow was measured by the use of a thermode above the brachioradialis muscle. The thermode was warmed by constant temperature water at 44°C entering the thermode at a water flow rate of 100 cm(3)/min. Skin temperature was measured by a thermistor and blood flow in the underlying skin was measured by a laser Doppler imager in single point mode. The results of the experiments showed that, when skin temperature is cool (31-32°C), the number of calories being transferred to the skin from the thermode cannot account for the rise in skin temperature alone. A significant portion of the rise in skin temperature is due to the warm arterialized blood traversing the skin from the core areas of the body. However, as skin temperature approaches central core temperature, it becomes less of a heat source and more of a heat sync such that when skin temperature is at or above core temperature, the blood flow to the skin, as predicted by Pennes, becomes a heat sync pulling heat from the thermode. Copyright © 2010 IPEM. Published by Elsevier Ltd. All rights reserved.
Epidermal hydrogen peroxide is not increased in lesional and non-lesional skin of vitiligo.
Zailaie, Mohammad Z
2017-01-01
It is widely believed that the loss of the epidermal melanocytes in vitiligo is basically due to excessive oxidative stress. Previous research work described abnormal elevation of the absolute concentration of the epidermal hydrogen peroxide (H 2 O 2 ) in lesional and non-lesional skin of vitiligo. Based on this finding, our primary research objective was to use this feature as a screening marker in individuals at a great risk of developing vitiligo. Ninety-six patients of non-segmental vitiligo (NSV) of varying durations, skin phototypes, and treatment modalities (psoralen UVA-, narrow band UVB-treated) were recruited for this study. Raman spectroscopic measurements, using an external probehead, of the lesional and non-lesional skin were obtained, and the resulting spectra were analyzed using the Opus software package of the MultiRam spectrometer and the intensity of the peak at 875 cm -1 that represents the absolute concentration of H 2 O 2 was calculated. Contrary to previous reports, in patients of skin phototype IV, the absolute concentrations of H 2 O 2 in non-lesional and lesional NSV of all groups were non-significantly decreased compared to normal control. In patients of NSV of skin phototype V, the decrease in the absolute concentrations of H 2 O 2 was not significant in the untreated group, and a slight non-significant increase in the NBUVB-treated group was noted. However, in the PUVA-treated group, the non-lesional skin demonstrated significant increase in the absolute concentration of H 2 O 2 , whereas the lesional skin showed only a slight non-significant increase compared to normal control. In NSV patients of skin phototype VI who were previously treated with PUVA, the non-lesional skin showed a slight non-significant increase in the absolute concentration of H 2 O 2 ; however, the lesional skin showed a marked significant decrease compared to normal control and the non-lesional skin. Thereof, one can conclude that the epidermal H 2 O 2 is not
Monte Carlo simulation of light reflection from cosmetic powders on the skin
Okamoto, Takashi; Motoda, Masafumi; Igarashi, Takanori; Nakao, Keisuke
2011-07-01
The reflection and scattering properties of light incident on skin covered with powder particles have been investigated. A three-layer skin structure with a spot is modeled, and the propagation of light in the skin and the scattering of light by particles on the skin surface are simulated by means of a Monte Carlo method. Under the condition in which only single scattering of light occurs in the powder layer, the reflection spectra of light from the skin change dramatically with the size of powder particles. The color difference between normal skin and spots is found to diminish more when powder particles smaller than the wavelength of light are used. It is shown that particle polydispersity suppresses substantially the extreme spectral change caused by monodisperse particles with a size comparable to the light wavelength.
In vivo study of the human skin by the method of laser-induced fluorescence spectroscopy
International Nuclear Information System (INIS)
Borisova, E.; Avramov, L.
2000-01-01
The goals of this study are to perform a preliminary evaluation of the diagnostic potential of noninvasive laser-induced auto-fluorescence spectroscopy (LIAFS) for human skin and optimize of detection and diagnosis of hollow organs and skin. In recent years, there has been growing interest in the use of laser-induced fluorescence to discriminate disease from normal surrounding tissue. The most fluorescence studies have used exogenous fluorophores of this discrimination. The laser-induced auto-fluorescence which is used for diagnosis of tissues in the human body avoids administration of any drugs. In this study a technique for optical biopsy of in vivo human skin is presented. The auto-fluorescence characterization of tissue relies on different spectral properties of tissues. It was demonstrated a differentiation between normal skin and skin with vitiligo. Two main endogenous fluorophores in the human skin account for most of the cellular auto-fluorescence for excitation wavelength 337 nm reduced from of nicotinamide adenine dinucleotide and collagen. The auto-fluorescence spectrum of human skin depend on main internal absorbers which are blood and melanin. In this study was described the effect caused by blood and melanin content on the shape of the auto-fluorescence spectrum of human skin. Human skin fluorescence spectrum might provide dermatologists with important information and such investigations are successfully used now in skin disease diagnostics, in investigation of the environmental factor impact or for evaluation of treatment efficiency. (authors)
Warashina, Tsutomu; Umehara, Kaoru; Miyase, Toshio
2012-01-01
A MeOH extract from the roots of Taraxacum platycarpum has shown significant effects on the proliferation of normal human skin fibroblasts. Chemical analysis of the extract resulted in the isolation of 26 compounds, including eight new triterpenes, one new sesquiterpene glycoside, and seventeen known compounds. The structure of each new compound was established using NMR spectroscopy. Some triterpenes had a significant effect on the proliferation of normal human skin fibroblasts.
An investigation into the management of acute skin reactions from tangential breast irradiation
International Nuclear Information System (INIS)
Meegan, M.A.; Haycocks, T.R.
1997-01-01
This research examined the acute skin reaction of two consecutive groups receiving tangetial breast irradiation for carcinoma of the breast. The first group used the traditional skin care advice of using warm water only within the treatment area, while the second group continued with their normal skin care regime. Data was collected on the physical manifestations of the acute reaction, medical history, the use of concurrent cytotoxic agents, treatment parameters and skin care products used. Statistical analysis using the T-test method showed no difference in the skin reaction between the two groups. The investigation has lead to a change of policy in the management of acute breast reactions. Patients receiving radiation therapy to the breast or chest wall can now use their routine skin care products with no adverse effect on skin reactions. (author)
Kruglikov, Ilja L
2016-01-01
Electrically layered tissue structure significantly modifies distribution of radiofrequency (RF) current in the dermis and in the subcutaneous adipose tissue comparing to that in a homogeneous medium. On the basis of the simple model of RF current distribution in a two-layer skin containing dermis and subcutis, we assess the influence of the dermal thickness on the current density in different skin layers. Under other equal conditions, current density in the dermis is higher for the skin having thinner dermis. This contradicts the main paradigm of the RF theory stating that treatment results are mainly dependent on the maximal temperature reached in a target tissue, since the best short- and long-term clinical results of RF application to the skin were reported in the areas having thicker dermis. To resolve this contradiction, it is proposed that the long-term effect of RF can be realized through a structural modification of the subcutaneous fat depot adjacent to the treated skin area. Stimulation of these cells located near the interface dermis/subcutis will demand the concentration of applied RF energy in this area and will require the optimal arrangement of RF electrodes on the skin surface.
Directory of Open Access Journals (Sweden)
Ilja L. Kruglikov
2016-01-01
Full Text Available Electrically layered tissue structure significantly modifies distribution of radiofrequency (RF current in the dermis and in the subcutaneous adipose tissue comparing to that in a homogeneous medium. On the basis of the simple model of RF current distribution in a two-layer skin containing dermis and subcutis, we assess the influence of the dermal thickness on the current density in different skin layers. Under other equal conditions, current density in the dermis is higher for the skin having thinner dermis. This contradicts the main paradigm of the RF theory stating that treatment results are mainly dependent on the maximal temperature reached in a target tissue, since the best short- and long-term clinical results of RF application to the skin were reported in the areas having thicker dermis. To resolve this contradiction, it is proposed that the long-term effect of RF can be realized through a structural modification of the subcutaneous fat depot adjacent to the treated skin area. Stimulation of these cells located near the interface dermis/subcutis will demand the concentration of applied RF energy in this area and will require the optimal arrangement of RF electrodes on the skin surface.
DEFF Research Database (Denmark)
Grøn, B; Andersson, A; Dabelsteen, Erik
1999-01-01
cultures. The organotypic skin and oral mucosa cultures showed a histological differentiation pattern analogous to that of normal skin and buccal mucosa, and a tissue-specific expression of carbohydrate structures and cytokeratins. However, both types of organotypic cultures also expressed markers which...... are normally seen during wound healing, including Lewis y, cytokeratin 16, and cytokeratin 19. We conclude that the organotypic cultures of oral mucosa and skin are suitable models for future studies of the function of cell-surface carbohydrates, although the expression of wound healing markers has to be taken...... the function of cell-surface carbohydrates, we established organotypic cultures of skin and buccal mucosa. In these cultures, keratinocytes are grown at the air-liquid interface on a supporting matrix consisting of homologous fibroblasts embedded in a collagen type I gel. We examined the expression of blood...
Energy Technology Data Exchange (ETDEWEB)
Takahara, Taro [St. Marianna Univ., Kawasaki, Kanagawa (Japan)
1996-12-01
The purpose of this paper is to evaluate correlation between the capability in the diagnosis of tumor extent and histology of adjacent tissue. MR-mammography (MRM) was obtained in twenty-one patients with surgically resected breast cancer by 0.5 T superconducting magnet (PHILIPS GY-ROSCAN T5-II, release 3.1). Pre and postcontrast 3D-spoiled gradient echo sequence were employed for MRM with spectral presaturation with inversion recovery (SPIR) and on-resonance MTC. The contrast determination time, the passing time of the center of k-space, was 1 min 50 s in 14 cases with key-hole imaging, and 2 min 46 s in 7 cases without key-hole imaging. Early enhancing area was considered as a tumor and an accuracy of tumor extent was evaluated by two radiologists. Accurate interpretation was obtained in 9 of 9 cases with atrophic mammary gland with fatty replacement and 3 of 3 cases with severe fibrosis in mammary gland. Seven cases were unclear in tumor margin due to intense enhancement of the adjacent tissue. One of 3 cases with normal mammary gland showed unclear margin of the tumor, which corresponded to the area of rich population of lobules in a young patient. Two of 2 cases of fibrocystic change with nonproliferative lesions in one case and proliferative lesions without atypia in another, showed unclear margin of tumor. Two cases of 2 intraductal spreading and 2 of 2 cases of massive interstitial invasion also showed unclear margin. The accuracy of tumor extent was found to have no correlation with either histology or enhancing ratio of the tumor. In conclusion, it is warranted to say that histology of adjacent tissue is an important factor to determine diagnostic capability of tumor extent by MRM. Fat replacement and fibrosis of the surrounding tissue are main causes of clear visualization of tumor, while normal mammary gland in young patients, fibrocystic change, intraductal spreading and invasion lead to the unclearness of tumor margin. (author)
International Nuclear Information System (INIS)
Takahara, Taro
1996-01-01
The purpose of this paper is to evaluate correlation between the capability in the diagnosis of tumor extent and histology of adjacent tissue. MR-mammography (MRM) was obtained in twenty-one patients with surgically resected breast cancer by 0.5 T superconducting magnet (PHILIPS GY-ROSCAN T5-II, release 3.1). Pre and postcontrast 3D-spoiled gradient echo sequence were employed for MRM with spectral presaturation with inversion recovery (SPIR) and on-resonance MTC. The contrast determination time, the passing time of the center of k-space, was 1 min 50 s in 14 cases with key-hole imaging, and 2 min 46 s in 7 cases without key-hole imaging. Early enhancing area was considered as a tumor and an accuracy of tumor extent was evaluated by two radiologists. Accurate interpretation was obtained in 9 of 9 cases with atrophic mammary gland with fatty replacement and 3 of 3 cases with severe fibrosis in mammary gland. Seven cases were unclear in tumor margin due to intense enhancement of the adjacent tissue. One of 3 cases with normal mammary gland showed unclear margin of the tumor, which corresponded to the area of rich population of lobules in a young patient. Two of 2 cases of fibrocystic change with nonproliferative lesions in one case and proliferative lesions without atypia in another, showed unclear margin of tumor. Two cases of 2 intraductal spreading and 2 of 2 cases of massive interstitial invasion also showed unclear margin. The accuracy of tumor extent was found to have no correlation with either histology or enhancing ratio of the tumor. In conclusion, it is warranted to say that histology of adjacent tissue is an important factor to determine diagnostic capability of tumor extent by MRM. Fat replacement and fibrosis of the surrounding tissue are main causes of clear visualization of tumor, while normal mammary gland in young patients, fibrocystic change, intraductal spreading and invasion lead to the unclearness of tumor margin. (author)
LENUS (Irish Health Repository)
Flanagan, Annabelle M
2007-04-01
Skin cancer, the most common cancer in the general population, is strongly associated with exposure to the ultraviolet component of sunlight. To investigate the relationship between DNA damage processing and skin tumour development, we determined the POLH status of a cohort of skin cancer patients. The human POLH gene encodes DNA polymerase eta (poleta), which normally carries out accurate translesion synthesis past the major UV-induced photoproduct, the dithymine cyclobutane dimer. In the absence of active poleta in xeroderma pigmentosum variant (XPV) patients, mutations accumulate at sites of UV-induced DNA damage, providing the initiating step in skin carcinogenesis. Forty patients diagnosed with skin cancer were genotyped for polymorphisms in the POLH protein-coding sequence, using glycosylase-mediated polymorphism detection (GMPD) and direct DNA sequencing of POLH PCR products derived from white blood cell genomic DNA. All individuals carried the wild-type POLH sequence. No POLH mutations were identified in genomic DNA from skin tumours derived from 15 of these patients. As determined by RT-PCR, POLH mRNA was expressed in all normal and skin tumour tissue examined. Poleta protein was also detectable by Western blotting, in two matched normal and skin tumour extracts. An alternatively spliced form of POLH mRNA, lacking exon 2, was more readily detected in skin tissue than in white blood cells from the same patient. Real-time PCR was used to quantify POLH expression in matched normal and skin tumour-derived mRNA from a series of patients diagnosed with either basal or squamous cell carcinoma. Compared to matched normal skin tissue from the same patient, 1 of 7 SCC, and 4 of 10 BCC tumours examined showed at least a 2-fold reduction in POLH expression, while 1 of 7 SCC, and 3 of 10 BCC tumours showed at least a 2-fold increase in POLH expression. Differences in gene expression, rather than sequence changes may be the main mechanism by which POLH status varies
Energy Technology Data Exchange (ETDEWEB)
Syh, J; Syh, J; Patel, B; Wu, H; Durci, M [Willis-Knighton Medical Center, Shreveport, LA (United States)
2015-06-15
Purpose: This case study was designated to confirm the optimized plan was used to treat skin surface of left leg in three stages. 1. To evaluate dose distribution and plan quality by alternating of the source loading catheters pattern in flexible Freiberg Flap skin surface (FFSS) applicator. 2. To investigate any impact on Dose Volume Histogram (DVH) of large superficial surface target volume coverage. 3. To compare the dose distribution if it was treated with electron beam. Methods: The Freiburg Flap is a flexible mesh style surface mold for skin radiation or intraoperative surface treatments. The Freiburg Flap consists of multiple spheres that are attached to each other, holding and guiding up to 18 treatment catheters. The Freiburg Flap also ensures a constant distance of 5mm from the treatment catheter to the surface. Three treatment trials with individual planning optimization were employed: 18 channels, 9 channels of FF and 6 MeV electron beam. The comparisons were highlighted in target coverage, dose conformity and dose sparing of surrounding tissues. Results: The first 18 channels brachytherapy plan was generated with 18 catheters inside the skin-wrapped up flap (Figure 1A). A second 9 catheters plan was generated associated with the same calculation points which were assigned to match prescription for target coverage as 18 catheters plan (Figure 1B). The optimized inverse plan was employed to reduce the dose to adjacent structures such as tibia or fibula. The comparison of DVH’s was depicted on Figure 2. External beam of electron RT plan was depicted in Figure 3. Overcall comparisons among these three were illustrated in Conclusion: The 9-channel Freiburg flap flexible skin applicator offers a reasonably acceptable plan without compromising the coverage. Electron beam was discouraged to use to treat curved skin surface because of low target coverage and high dose in adjacent tissues.
On the possibility of the patient's skin overheating during low-intensive phototherapy
Kokodii, Mykola G.; Korobov, Anatoliy M.; Timaniyk, Vladimir A.; Titova, Natalia V.; Burlibay, Aron; Omiotek, Zbigniew; Szatkowska, Małgorzata; Luganskaya, Saule
2017-08-01
This paper proposes a simple mathematical model of heating process of the human skin and adjacent inner layers with the LED radiation used in the prevention and treatment devices for various diseases. The problem takes into account the heat removal by blood flow to the vessels. It is shown that abnormal blood flow due to the compression of tissue can lead to severe heating of the body and its burn. This may result even from using small LEDs of 2,5-30 mW.
The effects of mucopolysaccharide polysulphate on hydration and elasticity of human skin.
Wanitphakdeedecha, Rungsima; Eimpunth, Sasima; Manuskiatti, Woraphong
2011-01-01
Background. Mucopolysaccharide polysulphate (MPS) has been used in medicine as an anti-inflammatory and antithrombotic agent for over 50 years. Its chemical structure permits considerable hydrogen bonding with adjacent water molecules, which effectively leads to hydration of the surrounding tissue. In addition, it stimulates endogenous hyaluronate synthesis, resulting in an increase in water-binding capacity and viscoelasticity of the skin. Objective. To study the efficacy of 0.1% MPS on hydration and elasticity of human skin. Methods. The first part of this study was a randomized double blind placebo-controlled study which included 60 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825. The volunteers were treated with either 0.1% MPS or vehicle control. All subjects were asked to apply 1 g of cream to their face twice daily for a total period of 4 weeks. Skin hydration and elasticity were measured at baseline and week 4 with Corneometer CM 825 and cutometer MPA 580, respectively, at forehead and both cheeks. The second part of this study focused on the efficacy of 0.1% MPS on skin hydration after single application. 20 female volunteers aged 30-45 years with dry skin, defined by Corneometer CM 825, were recruited to the study. All subjects were asked to apply 2 g of 0.1% MPS cream on entirely randomly selected forearm. Skin hydration at the middle of both forearms was measured at baseline, immediately after application, and every 1 hour after application for a period of 10 hours. Results. 57 subjects (28 in vehicle control group, 29 in MPS) completed treatment protocol. The baseline skin hydration of both groups was not significantly different (P = 0.47). Hower, there was a statistically significant difference in skin hydration at 4 weeks between MPS and placebo group (P = 0.01). Skin elasticity was significantly improved at week 4 in both groups (vehicle-control, P skin elasticity between MPS and vehicle-control group
UV-radiation and skin cancer dose effect curves
International Nuclear Information System (INIS)
Henriksen, T.; Dahlback, A.; Larsen, S.H.
1988-08-01
Norwegian skin cancer data were used in an attempt to arrive at the dose effect relationship for UV-carcinogenesis. The Norwegian population is relatively homogenous with regard to skin type and live in a country where the annual effective UV-dose varies by approximately 40 percent. Four different regions of the country, each with a broadness of 1 o in latitude (approximately 111 km), were selected . The annual effective UV-doses for these regions were calculated assuming normal ozone conditions throughout the year. The incidence of malignant melanoma and non-melanoma skin cancer (mainly basal cell carcinoma) in these regions were considered and compared to the annual UV-doses. For both these types of cancer a quadratic dose effect curve seems to be valid. Depletions of the ozone layer results in larger UV-doses which in turn may yield more skin cancer. The dose effect curves suggest that the incidence rate will increase by an ''amplification factor'' of approximately 2
Touch Receptors Undergo Rapid Remodeling in Healthy Skin
Directory of Open Access Journals (Sweden)
Kara L. Marshall
2016-11-01
Full Text Available Sensory tissues exposed to the environment, such as skin, olfactory epithelia, and taste buds, continuously renew; therefore, peripheral neurons must have mechanisms to maintain appropriate innervation patterns. Although somatosensory neurons regenerate after injury, little is known about how these neurons cope with normal target organ changes. To elucidate neuronal plasticity in healthy skin, we analyzed the structure of Merkel-cell afferents, which are gentle touch receptors, during skin remodeling that accompanies mouse hair-follicle regeneration. The number of Merkel cells is reduced by 90% and axonal arbors are simplified during active hair growth. These structures rebound within just days. Computational modeling predicts that Merkel-cell changes are probabilistic, but myelinated branch stability depends on Merkel-cell inputs. Electrophysiology and behavior demonstrate that tactile responsiveness is less reliable during active growth than in resting skin. These results reveal that somatosensory neurons display structural plasticity at the cost of impairment in the reliability of encoding gentle touch.
Ectodermal dysplasia-skin fragility syndrome: A rare case report
Directory of Open Access Journals (Sweden)
Subhash Kashyap
2015-01-01
Full Text Available Ectodermal dysplasia/skin fragility syndrome (ED-SFS is a newly described autosomal recessive disorder characterized by skin fragility and blistering, palmoplantar keratoderma, abnormal hair growth, nail dystrophy, and occasionally defective sweating. It results from mutations in the PKP1 gene encoding plakophilin 1 (PKP1, which is an important component of stratifying epithelial desmosomes and a nuclear component of many cell types. Only 12 cases of this rare genodermatosis have been reported so far. We present an unusual case of ED-SFS in a 12-year boy who was normal at birth but subsequently developed skin fragility, hair and nail deformities, abnormal dentition, palmoplantar keratoderma, and abnormal sweating but no systemic abnormality.
International Nuclear Information System (INIS)
Stuart, P.M.; Beck-Maier, B.; Melvold, R.W.
1984-01-01
We have evaluated the relative contribution of bone-marrow-derived cells to skin allograft immunogenicity in mice differing only at class II major histocompatibility genes by using bone marrow radiation chimeras as donors. The mouse strains used were C57BL/6Kh (B6) and B6.C-H-2bm12 (bm12), which differ only at at A beta gene of the I region of the mouse H-2 complex. Our results demonstrated that skin from (B6----bm12) chimeras was accepted by bm12 recipients and rejected by B6 mice in a manner indistinguishable from that of normal bm12 skin. Likewise, naive bm12 mice rejected (bm12----B6) chimeric skin and normal B6 skin equally well, and B6 animals accepted both types of skin grafts. Our data argues that the donor cell-type leading to graft rejection across limited I region differences is not of bone marrow origin, and that these cells must--at least under certain circumstances--express class II antigens
Manolis, Evangelos N; Tsakris, Athanassios; Kaklamanos, Ioannis; Markogiannakis, Antonios; Siomos, Konstadinos
2006-03-01
Although beam-scanning carbon dioxide (CO2) lasers have provided a highly efficient tool for esthetic skin rejuvenation there has been no comprehensive animal studies looking into microbial skin changes following CO2 laser skin resurfacing. To evaluate the in vivo effects of CO2 laser skin resurfacing in an experimental rat model in comparison with mechanical abrasion on the skin microbial flora. Four separate cutaneous sections of the right dorsal surface of 10 Wistar rats were treated with a CO2 laser, operating at 18 W and delivering a radiant energy of 5.76 J/cm2, while mechanical abrasions of the skin were created on four sections of the left dorsal surface using a scalpel. Samples for culture and biopsies were obtained from the skin surfaces of the rats on day 1 of application of the CO2 laser or mechanical abrasion, as well as 10, 30, and 90 days after the procedure. The presence of four microorganisms (staphylococci, streptococci, diphtheroids, and yeasts) was evaluated as a microbe index for the skin flora, and colony counts were obtained using standard microbiological methods. Skin biopsy specimens, following CO2 laser treatment, initially showed epidermal and papillary dermal necrosis and later a re-epithelization of the epidermis as well as the generation of new collagen on the upper papillary dermis. The reduction in microbial counts on day 1 of the CO2 laser-inflicted wound was statistically significant for staphylococci and diphtheroids compared with the baseline counts (p=.004 and pSkin resurfacing using CO2 lasers considerably reduces microbial counts of most microorganisms in comparison with either normal skin flora or a scalpel-inflicted wound. This might contribute to the positive clinical outcome of laser skin resurfacing.
Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin
National Research Council Canada - National Science Library
Chang, Howard Y
2008-01-01
The results from year I of funding suggest that appropriate markers and technologies are in place for systematic investigation of the positional identity of fibroblasts both in normal and diseased tissues...
A study on the quantitative evaluation of skin barrier function
Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko
2015-03-01
We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.
Small Demodex populations colonize most parts of the skin of healthy dogs.
Ravera, Iván; Altet, Laura; Francino, Olga; Sánchez, Armand; Roldán, Wendy; Villanueva, Sergio; Bardagí, Mar; Ferrer, Lluís
2013-02-01
It is unproven that all dogs harbour Demodex mites in their skin. In fact, several microscopic studies have failed to demonstrate mites in healthy dogs. Demodex canis is a normal inhabitant of the skin of most, if not all, dogs. This hypothesis was tested using a sensitive real-time PCR to detect Demodex DNA in the skin of dogs. One hundred dogs living in a humane society shelter, 20 privately owned and healthy dogs and eight dogs receiving immunosuppressive or antineoplastic therapy. Hair samples (250-300 hairs with their hair bulbs) were taken from five or 20 skin locations. A real-time PCR that amplifies a 166 bp sequence of the D. canis chitin synthase gene was used. The percentage of positive dogs increased with the number of sampling points. When a large canine population was sampled at five cutaneous locations, 18% of dogs were positive for Demodex DNA. When 20 skin locations were sampled, all dogs tested positive for mite DNA. Our study indicates that Demodex colonization of the skin is present in all dogs, independent of age, sex, breed or coat. Nevertheless, the population of mites in a healthy dog appears to be small. Demodex DNA was amplified from all 20 cutaneous points investigated, without statistically significant differences. Using a real-time PCR technique, Demodex mites, albeit in very low numbers, were found to be normal inhabitants of haired areas of the skin of healthy dogs. © 2013 The Authors. Veterinary Dermatology © 2013 ESVD and ACVD.
International Nuclear Information System (INIS)
Han, S.R.
1988-01-01
The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon
Enhanced unscheduled DNA synthesis in UV-irradiated human skin explants treated with T4N5 liposomes
International Nuclear Information System (INIS)
Yarosh, D.B.; Kibitel, J.T.; Green, L.A.; Spinowitz, A.
1991-01-01
Epidermal keratinocytes cultured from explants of skin cancer patients, including biopsies from xeroderma pigmentosum patients, were ultraviolet light-irradiated and DNA repair synthesis was measured. Repair capacity was much lower in xeroderma pigmentosum patients than in normal patients. The extent of DNA repair replication did not decline with the age of the normal patient. Treatment with T4N5 liposomes containing a DNA repair enzyme enhanced repair synthesis in both normal and xeroderma pigmentosum keratinocytes in an irradiation- and liposome-dose dependent manner. These results provide no evidence that aging people or skin cancer patients are predisposed to cutaneous malignancy by a DNA repair deficiency, but do demonstrate that T4N5 liposomes enhance DNA repair in the keratinocytes of the susceptible xeroderma pigmentosum and skin cancer population
Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.
2016-03-01
Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.
Lee, Kyung Suk; Kim, Jun Oh; Kim, Nam Gyun; Lee, Yoon Jung; Park, Young Ji; Kim, Jun Sik
2017-12-01
Surgery for reconstruction of defects after surgery should be performed selectively and the many points must be considered. The authors conducted this study to compare the local flap and skin graft by facial location in the reconstruction after resection of facial skin cancer. The authors performed the study in patients that had received treatment in Department of Plastic Surgery, Gyeongsang National University. The cases were analyzed according to the reconstruction methods for the defects after surgery, sex, age, tumor site, and tumor size. Additionally, the authors compared differences of aesthetic satisfaction (out of 5 points) of patients in the local flap and skin graft by facial location after resection of facial skin cancer by dividing the face into eight areas. A total of 153 cases were confirmed. The most common facial skin cancer was basal cell carcinoma (56.8%, 87 cases), followed by squamous cell carcinoma (37.2%, 57 cases) and bowen's disease (5.8%, 9 cases). The most common reconstruction method was local flap 119 cases (77.7%), followed by skin graft 34 cases (22.3%). 86 patients answered the questionnaire and mean satisfaction of the local flap and skin graft were 4.3 and 3.5 ( p =0.04), respectively, indicating that satisfaction of local flap was significantly high. When comparing satisfaction of patients according to results, local flap shows excellent effects in functional and cosmetic aspects would be able to provide excellent results rather than using a skin graft with poor touch and tone compared to the surrounding normal skin.
DNA repair in Bloom's syndrome skin fibroblasts after ultraviolet light irradiation
International Nuclear Information System (INIS)
Kurihara, Takayuki; Inoue, Masao; Kawashima, Hiroko; Yagi, Takashi; Takebe, Hiraku.
1981-01-01
Skin fibroblasts from a patient with Bloom's syndrome (86NoKi) were assayed for various DNA repair activities after ultraviolet light (UV) irradiation. Cultured fibroblasts as well as lymphocytes obtained from this patient showed a high frequency of spontaneous sister chromatid exchanges (SCEs). There was no significant difference between 86NoKi fibroblasts and skin fibroblasts from normal donors in the sensitivity to UV as measured by inactivation of colony forming activity, the capacity of host-cell reactivation (HCR) of UV-irradiated virus, and the amount of unscheduled DNA synthesis (UDS) after UV irradiation. However, the yield of UV-induced SCEs in 86NoKi cells was significantly higher than that in normal cells. (author)
Further search for selectivity of positron annihilation in the skin and cancerous systems
International Nuclear Information System (INIS)
Liu Guang; Chen Hongmin; Chakka, Lakshmi; Cheng Meiling; Gadzia, Joseph E.; Suzuki, R.; Ohdaira, T.; Oshima, N.; Jean, Y.C.
2008-01-01
Positronium annihilation lifetime (PAL) spectroscopy and Doppler broadening energy spectra (DBES) have been used to search for selectivity and sensitivity for cancerous skin samples with and without cancer. This study is to further explore the melanoma cancerous system and other different types of skin samples. We found that the S parameter in melanoma skin samples cut at 0.39 mm depth from the same patient's skin is smaller than near the skin surface. However in 10 melanoma samples from different patients, the S parameters vary significantly. Similarly, among 10 normal skin samples without cancer, the S parameters also vary largely among different patients. To understand the sensitivity of PAS as a tool to detect cancer formation at the early stage, we propose a controlled and systematic study of in vivo experiments using UV-induced cancer skin from living animals
International Nuclear Information System (INIS)
Hayashi, Yoshihito; Miura, Nobuhiro; Shinyashiki, Naoki; Yagihara, Shin
2005-01-01
We have investigated the dielectric properties of human skin in vivo at frequencies up to 10 GHz using a time-domain reflectometry method with open-ended coaxial probes. Since γ-dispersion results from the reorientation of free water molecules, the free water content of skin is quantitatively determined by dielectric measurements. The free water content of finger skin increased by about 10% after soaking in 37 0 C water for 30 min, and it systematically decreased again through the drying process, as expected. Thus this analytical method has been applied to the study of skin burns. The free water content of burned human cheek skin due to hydrofluoric acid was significantly lower than that of normal skin, and the burned skin recovered through the healing process. In the case of a human hand skin burn due to heat, although the free water content was almost the same as that of normal skin at the beginning, it decreased during the healing process for the first 10 days, then began to increase. Although the number of test subjects was one for each experiment, it was shown that free water content is a good indicator for evaluating skin health and can be well monitored by dielectric spectroscopy
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Energy Technology Data Exchange (ETDEWEB)
Alves, Vinicius M. [Laboratory of Molecular Modeling and Design, Faculty of Pharmacy, Federal University of Goiás, Goiânia, GO 74605-220 (Brazil); Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Muratov, Eugene [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Laboratory of Theoretical Chemistry, A.V. Bogatsky Physical–Chemical Institute NAS of Ukraine, Odessa 65080 (Ukraine); Fourches, Denis [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States); Strickland, Judy; Kleinstreuer, Nicole [ILS/Contractor supporting the NTP Interagency Center for the Evaluation of Alternative Toxicological Methods (NICEATM), P.O. Box 13501, Research Triangle Park, NC 27709 (United States); Andrade, Carolina H. [Laboratory of Molecular Modeling and Design, Faculty of Pharmacy, Federal University of Goiás, Goiânia, GO 74605-220 (Brazil); Tropsha, Alexander, E-mail: alex_tropsha@unc.edu [Laboratory for Molecular Modeling, Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina, Chapel Hill, NC 27599 (United States)
2015-04-15
Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R{sup 2} = 0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q{sup 2}{sub ext} = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. - Highlights: • It was compiled the largest publicly-available skin permeability dataset. • Predictive QSAR models were developed for skin permeability. • No concordance between skin
International Nuclear Information System (INIS)
Alves, Vinicius M.; Muratov, Eugene; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander
2015-01-01
Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R 2 = 0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q 2 ext = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. - Highlights: • It was compiled the largest publicly-available skin permeability dataset. • Predictive QSAR models were developed for skin permeability. • No concordance between skin sensitization and
Outer nuclear membrane fusion of adjacent nuclei in varicella-zoster virus-induced syncytia.
Wang, Wei; Yang, Lianwei; Huang, Xiumin; Fu, Wenkun; Pan, Dequan; Cai, Linli; Ye, Jianghui; Liu, Jian; Xia, Ningshao; Cheng, Tong; Zhu, Hua
2017-12-01
Syncytia formation has been considered important for cell-to-cell spread and pathogenesis of many viruses. As a syncytium forms, individual nuclei often congregate together, allowing close contact of nuclear membranes and possibly fusion to occur. However, there is currently no reported evidence of nuclear membrane fusion between adjacent nuclei in wild-type virus-induced syncytia. Varicella-zoster virus (VZV) is one typical syncytia-inducing virus that causes chickenpox and shingles in humans. Here, we report, for the first time, an interesting observation of apparent fusion of the outer nuclear membranes from juxtaposed nuclei that comprise VZV syncytia both in ARPE-19 human epithelial cells in vitro and in human skin xenografts in the SCID-hu mouse model in vivo. This work reveals a novel aspect of VZV-related cytopathic effect in the context of multinucleated syncytia. Additionally, the information provided by this study could be helpful for future studies on interactions of viruses with host cell nuclei. Copyright © 2017 Elsevier Inc. All rights reserved.
Effects of the association of chemotherapy and radiotherapy on normal mouse skin
International Nuclear Information System (INIS)
Guigon, M.; Frindel, E.; Tubiana, M.; Hewitt, J.
1978-01-01
The effects of an association of chemotherapy and radiotherapy on the skin of mice were studied. The following drugs were tested; hydroxyurea, Methotrexate, and Bleomycin; they were injected at various times before irradiation. When hydroxyurea was injected 15 min before irradiation, the early and late cutaneous reactions were significantly lower than with irradiation alone. This protective effect corresponds to about 500 rad for an irradiation dose of 2500 rad. In the other protocols, we observed either no increase of the effect as a result of adjuvant chemotherapy (Methotrexate) or slightly increased reactions
Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.
Generation of Chimeric RNAs by cis-splicing of adjacent genes (cis-SAGe) in mammals.
Zhuo, Jian-Shu; Jing, Xiao-Yan; Du, Xin; Yang, Xiu-Qin
2018-02-20
Chimeric RNA molecules, possessing exons from two or more independent genes, are traditionally believed to be produced by chromosome rearrangement. However, recent studies revealed that cis-splicing of adjacent genes (cis- SAGe) is one of the major mechanisms underlying the formation of chimeric RNAs. cis-SAGe refers to intergenic splicing of directly adjacent genes with the same transcriptional orientation, resulting in read-through transcripts, termed chimeric RNAs, which contain sequences from two or more parental genes. cis-SAGe was first identified in tumor cells, since then its potential in carcinogenesis has attracted extensive attention. More and more scientists are focusing on it. With the development of research, cis-SAGe was found to be ubiquitous in various normal tissues, and might make a crucial contribution to the formation of novel genes in the evolution of genomes. In this review, we summarize the splicing pattern, expression characteristics, possible mechanisms, and significance of cis-SAGe in mammals. This review will be helpful for general understanding of the current status and development tendency of cis-SAGe.
Directory of Open Access Journals (Sweden)
El Safoury Omar
2010-01-01
Full Text Available Background: Skin tags (ST are common tumors. They mainly consist of loose fibrous tissue and occur on the neck and major flexures as small, soft, pedunculated protrusions. Decrease in endocrine, hormone level and other factors are thought to play a role in the evolution of ST. Leptin is an adipocyte-derived hormone that acts as a major regulatory hormone for food intake and energy homeostasis. Leptin deficiency or resistance can result in profound obesity and diabetes in humans. A role of mast cell in the pathogenesis of ST is well recognized. Aims: To investigate the role of leptin in the pathogenesis of ST and to clarify whether there is a correlation between mast cell count and leptin level in ST. Methods: Forty-five skin biopsies were taken from 15 patients with ST. From each patient, a biopsy of a large ST (length >4 mm, a small ST (length <2 mm and a normal skin biopsy (as a control were taken. The samples were processed for leptin level. Skin biopsies were stained with hematoxylin and eosin and toluidine blue-uranyl nitrate metachromatic method for mast cell count was used. Results: There was a significant increased level of leptin in the ST compared to the normal skin. It was highly significant in small ST than in big ST (P = 0.0001 and it was highly significant in small and big ST compared to controls, P = 0.0001 and P = 0.001, respectively. There was a significant increase in mast cell count in the ST, which did not correlate with the increased levels of leptin. Conclusion: This is the first report to demonstrate that tissue leptin may play a role in the pathogenesis of ST. The significant increase in the levels of leptin and mast cell count in ST may indicate a possible role of adipoimmune in the benign skin growths.
El sol: ¿enemigo de nuestra piel? The sun: enemy of our skin?
Directory of Open Access Journals (Sweden)
Moraima Mora Ochoa
Full Text Available Actualmente existe una elevada mortalidad y morbilidad por cáncer de piel, lo cual representa un grave problema que va en aumento; por tal razón, en el presente estudio se revisó la bibliografía especializada sobre algunos aspectos de interés, tales como: interacción de las radiaciones solares sobre esta parte del organismo, efectos beneficiosos y perjudiciales, respuestas cutáneas normales y anormales, relación entre el cáncer de piel y las radiaciones ultravioletas, así como medidas de protección solar, las cuales permitirán mantener una piel sana y saludable.Currently, there is a high mortality and morbidity due to skin cancer, which represents an increasingly serious problem. Therefore, this study reviewed the specialized literature on some aspects of interest such as interaction of solar radiations on this part of the body, beneficial and harmful effects, normal and abnormal skin responses, relationship between skin cancer and ultraviolet radiations, as well as sun protection measures, which will allow us to maintain a healthy skin.
Progressive skin necrosis of a huge occipital encephalocele
Andarabi, Yasir; Nejat, Farideh; El-Khashab, Mostafa
2008-01-01
Objects: Progressive skin necrosis of giant occipital encephalocoele is an extremely rare complication found in neonates. Infection and ulceration of the necrosed skin may lead to meningitis or sepsis. We present here a neonate with giant occipital encephalocoele showing progressive necrosis during the first day of his life. Methods: A newborn baby was found to have a huge mass in the occipital region, which was covered by normal pink-purplish skin. During the last hours of the first day of his life, the sac started becoming ulcerated accompanied with a rapid color change in the skin, gradually turning darker and then black. The neonate was taken up for urgent excision and repair of the encephalocele. Two years after the operation, he appears to be well-developed without any neurological problems. Conclusion: Necrosis may have resulted from arterial or venous compromise caused by torsion of the pedicle during delivery or after birth. The high pressure inside the sac associated with the thin skin of the encephalocoele may be another predisposing factor. In view of the risk of ulceration and subsequent infection, urgent surgery of the necrotizing encephalocele is suggested. PMID:19753210
Progressive skin necrosis of a huge occipital encephalocele
Directory of Open Access Journals (Sweden)
Andarabi Yasir
2008-01-01
Full Text Available Objects: Progressive skin necrosis of giant occipital encephalocoele is an extremely rare complication found in neonates. Infection and ulceration of the necrosed skin may lead to meningitis or sepsis. We present here a neonate with giant occipital encephalocoele showing progressive necrosis during the first day of his life. Methods: A newborn baby was found to have a huge mass in the occipital region, which was covered by normal pink-purplish skin. During the last hours of the first day of his life, the sac started becoming ulcerated accompanied with a rapid color change in the skin, gradually turning darker and then black. The neonate was taken up for urgent excision and repair of the encephalocele. Two years after the operation, he appears to be well-developed without any neurological problems. Conclusion: Necrosis may have resulted from arterial or venous compromise caused by torsion of the pedicle during delivery or after birth. The high pressure inside the sac associated with the thin skin of the encephalocoele may be another predisposing factor. In view of the risk of ulceration and subsequent infection, urgent surgery of the necrotizing encephalocele is suggested.
Martin, Richard; Henley, Jessica B; Sarrazin, Patrick; Seité, Sophie
2015-12-01
Changes in the composition of microbial communities that colonize skin have been linked to several diseases including psoriasis. Nevertheless, the intra-individual dynamics and how these communities respond to balneotherapy remain poorly understood. This open label study was conducted between July and September 2012. Microbial communities of patients with psoriasis vulgaris were characterized prior and post a 3-week selenium-rich water balneotherapy treatment at the thermal care center La Roche-Posay (La Roche-Posay, France). Balneotherapy consisted of high-pressure filiform showers, baths, facial, and body spray treatments as well as La Roche-Posay thermal spring water (LRP-TSW) consumption. Swabs were taken from affected and proximal unaffected skin and the 16S rRNA bacterial gene was used to analyze the composition of bacterial communities. Using the same 16S rRNA gene tool, we tried to describe the LRP-TSW bacterial landscape. This study included 54 patients diagnosed with moderate to severe forms of psoriasis vulgaris. After eliminating individuals lacking paired samples from both visits, 29 individuals were analyzed for their microbiome profile. Shannon Diversity Index and global bacterial landscape indicate similar microbial communities on both unaffected and adjacent affected skin. PASI values decreased post-balneotherapy implying improvement of disease severity. No significant change in the Shannon Diversity Index was noticed at the end of the third week. The average taxonomic composition of skin microbial communities associated with unaffected and affected skin of psoriatic patients post-balneotherapy shows that treatment with LRP-TSW significantly increased the level of Xanthomonas genus and, to a lesser extent, Corynebacterium genus. The Xanthomonas genus belongs to the main Xanthomonadaceae family found in LRP-TSW and also on healthy skin. In psoriatic patients, a poor bacterial biodiversity was noticed and the bacterial communities were similar on
International Nuclear Information System (INIS)
Husain, I.; Vijayan, E.; Ramaiah, A.; Pasricha, J.S.; Madan, N.C.
1982-01-01
Tyrosinase activity (Monophenol, dihydroxyphenylalanine: oxygen oxidoreductase EC 1.14.18.1) in vitiligo and normal epidermal homogenates of skin from human beings was measured by estimating beta 3,4-dihydroxyphenylalanine (dopa) by a highly sensitive fluorometric method described in this paper. The tyrosine activity in the vitiligo skin was about 4 to 37% of corresponding normal skin. The activity of tyrosinase in normal human skin from different individuals and from different regions of the body was in the range of 4 to 140 picomoles of beta 3,4-dihydroxyphenylalanine formed per min/mg protein of epidermal homogenate. The enzyme from vitiligo and normal skin was severely inhibited by substance(s) of low molecular weight. The enzyme exhibits a lag of about 4 hr in the absence of added beta 3,4-dihydroxyphenylalanine and 1 hr in presence of 5 microM dopa. Tyrosinase from the normal and vitiligo skin was inhibited by excess concentration of tyrosine. The homogenates from vitiligo skin could synthesize melanin from C14(U)-L-Tyrosine. The rate of tyrosine incorporation into melanin by the epidermal homogenates is increased by 3,4-dihydroxyphenylalanine (dopa) disproportionate to its effect on tyrosinase activity. Based on the data presented in this paper it is concluded that melanocytes are present in the vitiligo skin. A tentative hypothesis is put forward to explain the lack of melanin synthesis by the vitiligo skin under in vivo conditions, although melanocytes are present
International Nuclear Information System (INIS)
Zheng Huaien; Cheng Tianmin; Yan Yongtang
1994-01-01
Bone marrow and skin allografts from the same donor were transplanted to rats inflicted with 8 Gy γ-radiation combined with third degree burns of 15% body surface area within 6 hr post injury. Pathological changes of hematopoietic tissues and skin allografts were studied. All injured controls died within 7 days post injury without bone marrow regeneration; 50% of treated rats survived with living skin allografts on 50th day post injury. On days 100 and 480 post operation, grafted skin still survived well on recipients with normal ultrastructure. Epidermic cells of skin allografts proliferated on day 5, developed and repaired on day 10. Histological structure of the skin returned to normal on day 30 post operation. The regeneration of bone marrow appeared on 5th day, increased markedly on day 10, and almost completed on day 15 after bone marrow transplantation. However, the regeneration of lymphocytes in cortex of spleen and lymph nodes did not appear until day 15 of BMT. The results show that bone marrow and skin allograft transplantation at early time post injury in most severe combined radiation-burn injury have tremendous beneficial effects, and the skin allograft can survive for a long time
Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...
Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin.
Pellerin, Laurence; Henry, Julie; Hsu, Chiung-Yueh; Balica, Stéfana; Jean-Decoster, Catherine; Méchin, Marie-Claire; Hansmann, Britta; Rodriguez, Elke; Weindinger, Stefan; Schmitt, Anne-Marie; Serre, Guy; Paul, Carle; Simon, Michel
2013-04-01
Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by a disturbed epidermal barrier. In a subset of patients, this is explained by nonsense mutations in the gene encoding filaggrin (FLG). We sought to evaluate the respective role of FLG mutations and proinflammatory cytokines and to assess the expression of FLG, hornerin (HRNR), and FLG2, 2 FLG-like proteins, which are involved in epidermal barrier functions, in normal skin and both lesional and nonlesional skin of patients with AD. An FLG-genotyped cohort of 73 adults with AD and 73 aged-matched control subjects was analyzed by using immunohistochemistry and immunoblotting. Normal primary human keratinocytes were differentiated in either the absence or presence of IL-4, IL-13, and IL-25. Compared with control subjects, FLG, HRNR, and FLG2 were detected at significantly lower levels in the skin of patients with AD, irrespective of their FLG genotype. The reduction was greater in lesional compared with nonlesional skin. In addition, the proFLG/FLG ratio was found to be higher in the skin of wild-type patients than in control subjects. Cytokine treatment of keratinocytes induced a dramatic reduction in FLG, FLG2, and HRNR expression both at the mRNA and protein levels. The stratum corneum of lesional but also clinically unaffected skin of adults with AD is abnormal, with reduced expression of FLG and FLG-like proteins. In addition to nonsense mutations, proinflammatory cytokines and some defects in the proFLG processing can contribute to the FLG downregulation. Our study suggests that skin inflammation reduces the expression of FLG-like proteins, contributing to the AD-related epidermal barrier dysfunction. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.
Effects of advanced glycation end-products (AGEs) on skin ...
African Journals Online (AJOL)
kappa B (NF-κB) localization and cell viability were measured in vivo. Keratinocytes from normal skin were cultured in AGE-enriched conditional media, and the cell viability, apoptosis, adhesion and migration were detected in order to find the ...
Deshpande, P; Ralston, D R; MacNeil, S
2013-09-01
Over the past two decades a range of 3D models for human skin have been described. Some include native collagen and intrinsic basement membrane proteins and fibroblasts, others are based on xenogeneic collagen or synthetic supports often without fibroblasts. The aim of this study was to look at the influence of media calcium, basement membrane and fibroblasts on the quality of 3D tissue engineered skin produced using human de-epidermized acellular dermis. In this study we deliberately used Euro skin as the source of the donor dermis to examine to what extent this could provide an effective dermal substrate for producing 3D skin for clinical use. Keratinocytes were cultured in the presence and absence of fibroblasts and both with and without basement membrane on decellularized dermis at calcium concentrations ranging from 250μM to 1.6mM over a period of 14 days. Results showed the formation of a well attached epithelium with many of the features of normal skin in the presence of a basement membrane. This was largely independent of the presence of fibroblasts and not greatly influenced by the concentration of calcium in the media. However there was a clear requirement for physiological levels of calcium in the formation of a stratified epithelium in the absence of a basement membrane. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.
Skin Diseases: Cross-section of human skin
Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...
Escosa, Frederic O.; Roca, Eduard; Ferrer, Oriol
2018-04-01
Detailed geologic mapping combined with well and seismic data from the Eastern Prebetic Zone (SE Iberia) reveal extensional and contractional structures that permit characterization of passive margin development and its incorporation into a thin-skinned fold-and-thrust belt. The study area is represented by NW-directed, ENE-trending folds and thrusts faults locally disrupted by the NW-trending Matamoros Basin and the active Jumilla and La Rosa diapirs. These structures resulted from the thin-skinned inversion of the proximal part of the Eastern South Iberian passive margin containing prerift salt. Here, Upper Jurassic to Santonian thick-skinned extension controlled the accumulation of sediment over mobile prerift salt. This in turn defined the style of salt tectonics characterized by monoclinal drape folds, suprasalt extensional faults and diapirs. The structural and sedimentological analysis suggests that during extension, salt localizes strain thus decoupling sub- and suprasalt deformation. Thick-skinned extension controls suprasalt deformation as well as its location and distribution which changes over time. Salt also localizes strain during inversion. The preexisting salt structures, weaker than adjacent areas, preferentially absorb the contractional deformation. In addition, the stepped subsalt geometry that results from thick-skinned extension also controls the shortening propagation. Therefore, the degree of strain localization depends on the thickness of the suprasalt cover and on the dip of subsalt faults relative to the thin-skinned transport direction.
A systematic review of definitions and classification systems of adjacent segment pathology.
Kraemer, Paul; Fehlings, Michael G; Hashimoto, Robin; Lee, Michael J; Anderson, Paul A; Chapman, Jens R; Raich, Annie; Norvell, Daniel C
2012-10-15
Systematic review. To undertake a systematic review to determine how "adjacent segment degeneration," "adjacent segment disease," or clinical pathological processes that serve as surrogates for adjacent segment pathology are classified and defined in the peer-reviewed literature. Adjacent segment degeneration and adjacent segment disease are terms referring to degenerative changes known to occur after reconstructive spine surgery, most commonly at an immediately adjacent functional spinal unit. These can include disc degeneration, instability, spinal stenosis, facet degeneration, and deformity. The true incidence and clinical impact of degenerative changes at the adjacent segment is unclear because there is lack of a universally accepted classification system that rigorously addresses clinical and radiological issues. A systematic review of the English language literature was undertaken and articles were classified using the Grades of Recommendation Assessment, Development, and Evaluation criteria. RESULTS.: Seven classification systems of spinal degeneration, including degeneration at the adjacent segment, were identified. None have been evaluated for reliability or validity specific to patients with degeneration at the adjacent segment. The ways in which terms related to adjacent segment "degeneration" or "disease" are defined in the peer-reviewed literature are highly variable. On the basis of the systematic review presented in this article, no formal classification system for either cervical or thoracolumbar adjacent segment disorders currently exists. No recommendations regarding the use of current classification of degeneration at any segments can be made based on the available literature. A new comprehensive definition for adjacent segment pathology (ASP, the now preferred terminology) has been proposed in this Focus Issue, which reflects the diverse pathology observed at functional spinal units adjacent to previous spinal reconstruction and balances
Premaladha, J; Ravichandran, K S
2016-04-01
Dermoscopy is a technique used to capture the images of skin, and these images are useful to analyze the different types of skin diseases. Malignant melanoma is a kind of skin cancer whose severity even leads to death. Earlier detection of melanoma prevents death and the clinicians can treat the patients to increase the chances of survival. Only few machine learning algorithms are developed to detect the melanoma using its features. This paper proposes a Computer Aided Diagnosis (CAD) system which equips efficient algorithms to classify and predict the melanoma. Enhancement of the images are done using Contrast Limited Adaptive Histogram Equalization technique (CLAHE) and median filter. A new segmentation algorithm called Normalized Otsu's Segmentation (NOS) is implemented to segment the affected skin lesion from the normal skin, which overcomes the problem of variable illumination. Fifteen features are derived and extracted from the segmented images are fed into the proposed classification techniques like Deep Learning based Neural Networks and Hybrid Adaboost-Support Vector Machine (SVM) algorithms. The proposed system is tested and validated with nearly 992 images (malignant & benign lesions) and it provides a high classification accuracy of 93 %. The proposed CAD system can assist the dermatologists to confirm the decision of the diagnosis and to avoid excisional biopsies.
Alves, Vinicius M.; Muratov, Eugene; Fourches, Denis; Strickland, Judy; Kleinstreuer, Nicole; Andrade, Carolina H.; Tropsha, Alexander
2015-01-01
Skin permeability is widely considered to be mechanistically implicated in chemically-induced skin sensitization. Although many chemicals have been identified as skin sensitizers, there have been very few reports analyzing the relationships between molecular structure and skin permeability of sensitizers and non-sensitizers. The goals of this study were to: (i) compile, curate, and integrate the largest publicly available dataset of chemicals studied for their skin permeability; (ii) develop and rigorously validate QSAR models to predict skin permeability; and (iii) explore the complex relationships between skin sensitization and skin permeability. Based on the largest publicly available dataset compiled in this study, we found no overall correlation between skin permeability and skin sensitization. In addition, cross-species correlation coefficient between human and rodent permeability data was found to be as low as R2=0.44. Human skin permeability models based on the random forest method have been developed and validated using OECD-compliant QSAR modeling workflow. Their external accuracy was high (Q2ext = 0.73 for 63% of external compounds inside the applicability domain). The extended analysis using both experimentally-measured and QSAR-imputed data still confirmed the absence of any overall concordance between skin permeability and skin sensitization. This observation suggests that chemical modifications that affect skin permeability should not be presumed a priori to modulate the sensitization potential of chemicals. The models reported herein as well as those developed in the companion paper on skin sensitization suggest that it may be possible to rationally design compounds with the desired high skin permeability but low sensitization potential. PMID:25560673
Expression of telomerase reverse transcriptase in radiation-induced chronic human skin ulcer
International Nuclear Information System (INIS)
Zhao Po; Li Zhijun; Lu Yali; Zhong Mei; Gu Qingyang; Wang Dewen
2001-01-01
Objective: To investigate the expression of the catalytic subunit of telomerase, telomerase reverse transcriptase (TRT) and the possible relationship between the TRT and cancer transformation or poor healing in radiation-induced chronic ulcer of human skin. Methods: Rabbit antibody against human TRT and SP immunohistochemical method were used to detect TRT expression in 24 cases of formalin-fixed, paraffin-embed human skin chronic ulcer tissues induced by radiation, 5 cases of normal skin, 2 of burned skin, and 8 of carcinoma. Results: The positive rate for TRT was 58.3%(14/24) in chronic radiation ulcers, of which the strongly positive rate was 41.7%(10/24) and the weakly positive 16.7%(4/24), 0% in normal (0/5) and burned skin (0/2), and 100% in carcinoma (8/8). The strongly positive expression of TRT was observed almost always in the cytoplasm and nucleus of squamous epithelial cells of proliferative epidermis but the negative and partly weakly positive expression in the smooth muscles, endothelia of small blood vessels and capillaries, and fibroblasts. Chronic inflammtory cells, plasmacytes and lymphocytes also showed weakly positive for TRT. Conclusion: TRT expression could be involved in the malignant transformation of chronic radiation ulcer into squamous carcinoma, and in the poor healing caused by sclerosis of small blood vessels and lack of granulation tissue consisting of capillaries and fibroblasts
Energy Technology Data Exchange (ETDEWEB)
Wiles, A. N.; Loyalka, S. K. [University of Missouri, Columbia, MO (United States); Izaguirre, E. W. [University of Missouri, Columbia, MO (United States); Baylor Scott & White Health, Temple, TX (United States)
2015-06-15
Purpose: To develop a tissue model of Cherenkov radiation emitted from the skin surface during external beam radiotherapy. Imaging Cherenkov radiation emitted from human skin allows visualization of the beam position and potentially surface dose estimates, and our goal is to characterize the optical properties of these emissions. Methods: We developed a Monte Carlo model of Cherenkov radiation generated in a semi-infinite tissue slab by megavoltage x-ray beams with optical transmission properties determined by a two-layered skin model. We separate the skin into a dermal and an epidermal layer in our model, where distinct molecular absorbers modify the Cherenkov intensity spectrum in each layer while we approximate the scattering properties with Mie and Rayleigh scattering from the highly structured molecular organization found in human skin. Results: We report on the estimated distributions of the Cherenkov wavelength spectrum, emission angles, and surface distribution for the modeled irradiated skin surface. The expected intensity distribution of Cherenkov radiation emitted from skin shows a distinct intensity peak around 475 nm, the blue region of the visible spectrum, between a pair of optical absorption bands in hemoglobin and a broad plateau beginning near 600 nm and extending to at least 700 nm where melanin and hemoglobin absorption are both low. We also find that the Cherenkov intensity decreases with increasing angle from the surface normal, the majority being emitted within 20 degrees of the surface normal. Conclusion: Our estimate of the spectral distribution of Cherenkov radiation emitted from skin indicates an advantage to using imaging devices with long wavelength spectral responsivity. We also expect the most efficient imaging to be near the surface normal where the intensity is greatest; although for contoured surfaces, the relative intensity across the surface may appear to vary due to decreasing Cherenkov intensity with increased angle from the
Spiritual and religious aspects of skin and skin disorders
Directory of Open Access Journals (Sweden)
Shenefelt PD
2014-08-01
Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious
Pulsed Er:YAG- and 308 nm UV-excimer laser: an in vitro and in vivo study of skin-ablative effects
Energy Technology Data Exchange (ETDEWEB)
Kaufmann, R.; Hibst, R.
1989-01-01
Using a pulsed XeCl excimer laser (308 nm) and a pulsed Er:YAG laser (2,940 nm), we investigated skin ablation as a function of pulse number, radiant energy, and repetition rate. In vitro analysis of lesions performed in freshly excised human skin were consistent with in vivo results obtained from experiments on pig skin. Pulsed 308 nm laser radiation caused considerable nonspecific thermal tissue injury followed by an inflammatory reaction and impaired healing of lesions in vivo. These findings were especially pronounced with higher repetition rates, which would be required for efficient destruction of larger lesions. On the other hand, the 2.94 microns Er:YAG laser radiation produced clean and precise lesions with only minimal adjacent injury. In vivo skin ablation caused intraoperative bleeding with deeper penetration. The Er:YAG laser offers a promising surgical tool for careful removal of superficial epidermal lesions, if higher repetition rates, and an appropriate laser beam delivery system are available for clinical use.
Targeted Therapy in Nonmelanoma Skin Cancers
International Nuclear Information System (INIS)
Spallone, Giulia; Botti, Elisabetta; Costanzo, Antonio
2011-01-01
Nonmelanoma skin cancer (NMSC) is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC), representing around 75% of NMSC and Squamous Cell Carcinomas (SCC). The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC
Targeted Therapy in Nonmelanoma Skin Cancers
Directory of Open Access Journals (Sweden)
Giulia Spallone
2011-05-01
Full Text Available Nonmelanoma skin cancer (NMSC is the most prevalent cancer in light-skinned populations, and includes mainly Basal Cell Carcinomas (BCC, representing around 75% of NMSC and Squamous Cell Carcinomas (SCC. The incidence of these tumors is continuously growing. It was found that the overall number of procedures for NMSC in US rose by 76%, from 1,158,298 in 1992 to 2,048,517 in 2006. Although mortality from NMSC tends to be very low, clearly the morbidity related to these skin cancers is very high. Treatment options for NMSC include both surgical and nonsurgical interventions. Surgery was considered the gold standard therapy, however, advancements in the knowledge of pathogenic mechanisms of NMSCs led to the identification of key targets for drug intervention and to the consequent development of several targeted therapies. These represent the future in treatment of these common forms of cancer ensuring a high cure rate, preservation of the maximal amount of normal surrounding tissue and optimal cosmetic outcome. Here, we will review recent advancements in NMSC targeted therapies focusing on BCC and SCC.
Su, Ping-Jung; Chen, Wei-Liang; Hong, Jin-Bon; Li, Tsung-Hsien; Wu, Ruei-Jr; Chou, Chen-Kuan; Lin, Sung-Jan; Dong, Chen-Yuan
2010-02-01
We used polarization-resolved, second harmonic generation (P-SHG) microscopy at single pixel resolution for medical diagnosis of pathological skin dermis, and found that P-SHG can be used to distinguish normal and dermal pathological conditions of keloid, morphea, and dermal elastolysis. We find that the histograms of the d33/d31 ratio for the pathological skins to contain two peak values and to be wider than that of the normal case, suggesting that the pathological dermal collagen fibers tend to be more structurally heterogeneous. Our work demonstrates that pixel-resolved, second-order susceptibility microscopy is effective for detecting heterogeneity in spatial distribution of collagen fibers.
Significant skin burns may occur with the use of a water balloon in HIFU treatment
Ritchie, Robert; Collin, Jamie; Wu, Feng; Coussios, Constantin; Leslie, Tom; Cranston, David
2012-10-01
HIFU is a minimally-invasive therapy suitable for treating selected intra-abdominal tumors. Treatment is safe although skin burns may occur due to pre-focal heating. HIFU treatment of a renal transplant tumor located in the left lower abdomen was undertaken in our centre. Treatment was performed prone, requiring displacement of the abdominal wall away from the treatment field using a water balloon, constructed of natural rubber latex and filled with degassed water. Intra-operatively, ultrasound imaging and physical examination of the skin directly over the focal region was normal. Immediately post-operative, a full-thickness skin burn was evident at the periphery of the balloon location, outside the expected HIFU path. Three possibilities may account for this complication. Firstly, the water balloon may have acted as a lens, focusing the HIFU to a neo-focus off axis. Secondly, air bubbles may have been entrapped between the balloon and the skin, causing heating at the interface. Finally, heating of the isolated water within the balloon may have been sufficient to cause burning. In this case, the placement of a water balloon caused a significant skin burn. Care should be taken in their use as burns, situated off axis, may occur even if the overlying skin appears normal.
Tight Skin 2 Mice Exhibit Delayed Wound Healing Caused by Increased Elastic Fibers in Fibrotic Skin.
Long, Kristen B; Burgwin, Chelsea M; Huneke, Richard; Artlett, Carol M; Blankenhorn, Elizabeth P
2014-09-01
Rationale: The Tight Skin 2 (Tsk2) mouse model of systemic sclerosis (SSc) has many features of human disease, including tight skin, excessive collagen deposition, alterations in the extracellular matrix (ECM), increased elastic fibers, and occurrence of antinuclear antibodies with age. A tight skin phenotype is observed by 2 weeks of age, but measurable skin fibrosis is only apparent at 10 weeks. We completed a series of wound healing experiments to determine how fibrosis affects wound healing in Tsk2/+ mice compared with their wild-type (WT) littermates. Method: We performed these experiments by introducing four 4 mm biopsy punched wounds on the back of each mouse, ventral of the midline, and observed wound healing over 10 days. Tsk2/+ mice showed significantly delayed wound healing and increased wound size compared with the WT littermates at both 5 and 10 weeks of age. We explored the potential sources of this response by wounding Tsk2/+ mice that were genetically deficient either for the NLRP3 inflammasome (a known fibrosis mediator), or for elastic fibers in the skin, using a fibulin-5 knockout. Conclusion: We found that the loss of elastic fibers restores normal wound healing in the Tsk2/+ mouse and that the loss of the NLRP3 inflammasome had no effect. We conclude that elastic fiber dysregulation is the primary cause of delayed wound healing in the Tsk2/+ mouse and therapies that promote collagen deposition in the tissue matrix in the absence of elastin deposition might be beneficial in promoting wound healing in SSc and other diseases.
Evaluation of pH of bathing soaps and shampoos for skin and hair care
Directory of Open Access Journals (Sweden)
Jose Tarun
2014-01-01
Full Text Available Background: Normal healthy skin has potential of hydrogen (pH range of 5.4-5.9 and a normal bacterial flora. Use of soap with high pH causes an increase in skin pH, which in turn causes an increase in dehydrative effect, irritability and alteration in bacterial flora. The majority of soaps and shampoos available in the market do not disclose their pH. Aims and Objectives: The aim of this study was to assess the pH of different brands of bathing soaps and shampoos available in the market. Materials and Methods: The samples of soaps and shampoos were collected from shops in the locality. The samples of different brands are coded before the analysis of the pH. Solution of each sample was made and pH was measured using pH meter. Results: Majority of the soaps have a pH within the range of 9-10. Majority of the shampoos have a pH within the range of 6-7. Conclusions: The soaps and shampoos commonly used by the population at large have a pH outside the range of normal skin and hair pH values. Therefore, it is hoped that before recommending soap to patient especially those who have sensitive and acne prone skin, due consideration is given to the pH factor and also that manufacturers will give a thought to pH of soaps and shampoos manufactured by them, so that their products will be more skin and hair friendly.
Cutting and skin-ablative properties of pulsed mid-infrared laser surgery.
Kaufmann, R; Hartmann, A; Hibst, R
1994-02-01
Pulsed mid-infrared lasers allow a precise removal of soft tissues with only minimal thermal damage. To study the potential dermatosurgical usefulness of currently available systems at different wavelengths (2010-nm Thulium:YAG laser, 2100-nm Holmium:YAG laser, 2790-nm Erbium:YSGG laser, and 2940-nm Erbium:YAG laser) in vivo on pig skin. Immediate effects and wound healing of superficial laser-abrasions and incisions were compared with those of identical control lesions produced by dermabrasion, scalpel incisions, or laser surgery performed by a 1060-nm Nd:YAG and a 1060-nm CO2 laser (continuous and superpulsed mode). Best efficiency and least thermal injury was found for the pulsed Erbium:YAG laser, leading to ablative and incisional lesions comparable to those obtained by dermabrasion or superficial scalpel incisions, respectively. In contrast to other mid-infrared lasers tested, the 2940-nm Erbium:YAG laser thus provides a potential instrument for future applications in skin surgery, especially when aiming at a careful ablative removal of delicate superficial lesions with maximum sparing of adjacent tissue structures. However, in the purely incisional application mode pulsed mid-infrared lasers, though of potential usefulness in microsurgical indications (eg, surgery of the cornea), do not offer a suggestive alternative to simple scalpel surgery of the skin.
Methylquercetins stimulate melanin biosynthesis in a three-dimensional skin model.
Yamauchi, Kosei; Mitsunaga, Tohru
2018-03-01
In a previous study, we found that both synthetic 3-O-methylquercetin (3MQ) and 3,4',7-O-trimethylquercetin (34'7TMQ) increased extracellular melanin content. 34'7TMQ increased the activity of melanogenic enzymes by stimulating the p38 pathway and the expression of microphthalmia-associated transcription factor (MITF). In contrast, 3MQ increased the activity of melanogenic enzymes without the involvement of MITF, which suggests that 3MQ inhibits the degradation of melanogenic enzymes. In the present study, we investigated the effects of 3MQ and 34'7TMQ on melanogenesis in normal human melanocytes and using a commercial three-dimensional (3D) skin model system. Both 3MQ and 34'7TMQ elongated the dendrites of normal human melanocytes from a Caucasian donor, but did not stimulate melanogenesis in the melanocytes. In the 3D skin model, which included melanocytes from an Asian donor, 3MQ and 34'7TMQ increased and elongated the melanocytes and showed a tendency to stimulate melanogenesis. These results suggest that 3MQ and 34'7TMQ could be put to practical use in skin care products and agents aimed at preventing hair graying.
Radovich, Milan; Clare, Susan E; Atale, Rutuja; Pardo, Ivanesa; Hancock, Bradley A; Solzak, Jeffrey P; Kassem, Nawal; Mathieson, Theresa; Storniolo, Anna Maria V; Rufenbarger, Connie; Lillemoe, Heather A; Blosser, Rachel J; Choi, Mi Ran; Sauder, Candice A; Doxey, Diane; Henry, Jill E; Hilligoss, Eric E; Sakarya, Onur; Hyland, Fiona C; Hickenbotham, Matthew; Zhu, Jin; Glasscock, Jarret; Badve, Sunil; Ivan, Mircea; Liu, Yunlong; Sledge, George W; Schneider, Bryan P
2014-01-01
Triple-negative breast cancers (TNBCs) are a heterogeneous set of tumors defined by an absence of actionable therapeutic targets (ER, PR, and HER-2). Microdissected normal ductal epithelium from healthy volunteers represents a novel comparator to reveal insights into TNBC heterogeneity and to inform drug development. Using RNA-sequencing data from our institution and The Cancer Genome Atlas (TCGA) we compared the transcriptomes of 94 TNBCs, 20 microdissected normal breast tissues from healthy volunteers from the Susan G. Komen for the Cure Tissue Bank, and 10 histologically normal tissues adjacent to tumor. Pathway analysis comparing TNBCs to optimized normal controls of microdissected normal epithelium versus classic controls composed of adjacent normal tissue revealed distinct molecular signatures. Differential gene expression of TNBC compared with normal comparators demonstrated important findings for TNBC-specific clinical trials testing targeted agents; lack of over-expression for negative studies and over-expression in studies with drug activity. Next, by comparing each individual TNBC to the set of microdissected normals, we demonstrate that TNBC heterogeneity is attributable to transcriptional chaos, is associated with non-silent DNA mutational load, and explains transcriptional heterogeneity in addition to known molecular subtypes. Finally, chaos analysis identified 146 core genes dysregulated in >90 % of TNBCs revealing an over-expressed central network. In conclusion, use of microdissected normal ductal epithelium from healthy volunteers enables an optimized approach for studying TNBC and uncovers biological heterogeneity mediated by transcriptional chaos.
Bek-Thomsen, Malene; Lomholt, Hans B.; Scavenius, Carsten; Enghild, Jan J.; Brüggemann, Holger
2014-01-01
Acne vulgaris is a very common disease of the pilosebaceous unit of the human skin. The pathological processes of acne are not fully understood. To gain further insight sebaceous follicular casts were extracted from 18 healthy and 20 acne-affected individuals by cyanoacrylate-gel biopsies and further processed for mass spectrometry analysis, aiming at a proteomic analysis of the sebaceous follicular casts. Human as well as bacterial proteins were identified. Human proteins enriched in acne and normal samples were detected, respectively. Normal follicular casts are enriched in proteins such as prohibitins and peroxiredoxins which are involved in the protection from various stresses, including reactive oxygen species. By contrast, follicular casts extracted from acne-affected skin contained proteins involved in inflammation, wound healing and tissue remodeling. Among the most distinguishing proteins were myeloperoxidase, lactotransferrin, neutrophil elastase inhibitor and surprisingly, vimentin. The most significant biological process among all acne-enriched proteins was ‘response to a bacterium’. Identified bacterial proteins were exclusively from Propionibacterium acnes. The most abundant P. acnes proteins were surface-exposed dermatan sulphate adhesins, CAMP factors, and a so far uncharacterized lipase in follicular casts extracted from normal as well as acne-affected skin. This is a first proteomic study that identified human proteins together with proteins of the skin microbiota in sebaceous follicular casts. PMID:25238151
Xu, Zihan; Zhang, Zhenxin; Wang, Benfeng; Sun, Yaowen; Guo, Yadong; Gao, Wenjie; Qin, Gaoping
2014-11-01
To investigate the effect of delayed skin grafting combined traction in severe joint cicatricial contracture. At the first stage, the joint cicatricial contracture was released completely with protection of vessels, nerves and tendons. The wound was covered with allogenetic skin or biomaterials. After skin traction for 7-14 days, the joint could reach the extension position. Then the skin graft was performed on the wound. 25 cases were treated from Mar. 2000 to May. 2013. Primary healing was achieved at the second stage in all the cases. The skin graft had a satisfactory color and elasticity. Joint function was normal. All the patients were followed up for 3 months to 11 years with no hypertrophic scar and contraction relapse, except for one case who didn' t have enough active exercise on shoulder joint. Delayed skin grafting combined traction can effectively increase the skin graft survival rate and improve the joint function recovery.
Diffuse Reflectance Spectroscopy of Human Skin Using a Commercial Fiber Optic Spectrometer
International Nuclear Information System (INIS)
Atencio, J. A. Delgado; Rodriguez, M. Cunill; Montiel, S. Vazquez y; Castro, Jorge; Rodriguez, A. Cornejo; Gutierrez, J. L.; Martinez, F.; Gutierrez, B.; Orozco, E.
2008-01-01
Diffuse reflectance spectroscopy is a reliable and easy to implement technique in human tissue characterization. In this work we evaluate the performance of the commercial USB4000 miniature fiber optic spectrometer in the in-vivo measurement of the diffuse reflectance spectra of different healthy skin sites and lesions in a population of 54 volunteers. Results show, that this spectrometer reproduces well the typical signatures of skin spectra over the 400-1000 nm region. Remarkable spectral differences exist between lesions and normal surrounding skin. A diffusion-based model was used to simulate reflectance spectra collected by the optical probe of the system
Simultaneous Occurrence of Periodontal and Skin Abscesses in a ...
African Journals Online (AJOL)
Pre-operative quantitative analysis of plasma CRP was 1500mg/l, moderate growth of Staphylococcus aureus and Porphyromonas gingivalis were isolated from the skin and periodontal pus respectively and basic heamatological values were within normal range. Intensive non-surgical periodontal therapy was done at ...
Radio-induced fibrosis of skin: contribution to its development and treatment
International Nuclear Information System (INIS)
Vozenin-Brotons, Marie-Catherine
1999-01-01
Fibrosis of skin is frequently observed after therapeutic and accidental irradiations, and is characterized by the appearance of activated fibroblasts called myo-fibroblasts and the accumulation of extracellular matrix compounds. We postulated that radiation fibrosis could be considered as a chronic scar, where constant production of activating signals are emitted, whereas no negative feed back regulation occur. However, recent studies demonstrated that radiation-induced fibrosis could be treated using therapeutic agents like the superoxide dismutase. In order to better understand the mechanisms leading to skin fibrosis, we studied both the early reactions and the late fibrotic tissue induced by high radiation doses in normal skin. In particular, we investigated in the role of growth factors in these reactions. The synthesis of TGF-β1 was found to be increased, both the epidermis and the dermis, immediately after irradiation. This overexpression sustained during the development and the persistence phases of fibrosis, suggesting that the immediate cellular response induce a cascade of activation for genes and proteins which will result in the late effect of radiation in skin. Furthermore, these observations showed that the TGF-β1 could be a target for anti-fibrotic treatment. In order to test this hypothesis and to investigate further in the mechanisms leading to fibrosis regression after SOD treatment, we develop normal and fibrosis-like reconstructed skin models. These reconstructed skins were treated with liposomal and carrier-free Cu/Zn SOD, and examined for their effects on cell number, apoptosis and phenotypic differentiation. The results showed that SOD did not induce myo-fibroblast cell death or apoptosis whereas it significantly reduced TGF-β1 expression, thus demonstrating that SOD might be considered as a potent antagonist of the major fibro-genic growth factor. We also found that SOD significantly lowered the levels of the myo-fibroblast marker
Nonablative fractional laser resurfacing in Asian skin--a review.
Sachdeva, Silonie
2010-12-01
Skin resurfacing has been a part of cosmetic dermatology for more than two decades now, and most of it has been ablative with traditional aggressive lasers including the CO(2) and erbium. The last few years have seen a revolutionary change with the invention of nonablative lasers for skin tightening. Fractional resurfacing is a new concept of cutaneous remodeling whereby laser-induced zones of microthermal injury are surrounded by normal untreated tissue that helps in quicker healing. The various wavelengths used are 1320, 1440, and 2940 nm with depth of penetration ranging from 25 μ to 1.2 mm. This article reviews the history of nonablative fractional laser resurfacing, its indications, contraindications, and a review of use in Asian skin with Fitzpatrick type III-VI. © 2010 Wiley Periodicals, Inc.
Rational Design and Enhanced Biocompatibility of a Dry Adhesive Medical Skin Patch
Kwak, Moon Kyu
2011-07-28
A new type of medical skin patch is developed that contains high-density, mushroom-like micropillars. Such dry-adhesive micropillars are highly biocompatible, have minimized side effects, and provide reasonable normal adhesion strength. To arrive at optimal conditions for the dry adhesive skin patch, the proper design of various structural and material parameters of micropillars is investigated. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Objectifying the adjacent and opposite angles: a cultural historical analysis
Daher, Wajeeh; Musallam, Nadera
2018-02-01
The angle topic is central to the development of geometric knowledge. Two of the basic concepts associated with this topic are the adjacent and opposite angles. It is the goal of the present study to analyze, based on the cultural historical semiotics framework, how high-achieving seventh grade students objectify the adjacent and opposite angles' concepts. We videoed the learning of a group of three high-achieving students who used technology, specifically GeoGebra, to explore geometric relations related to the adjacent and opposite angles' concepts. To analyze students' objectification of these concepts, we used the categories of objectification of knowledge (attention and awareness) and the categories of generalization (factual, contextual and symbolic), developed by Radford. The research results indicate that teacher's and students' verbal and visual signs, together with the software dynamic tools, mediated the students' objectification of the adjacent and opposite angles' concepts. Specifically, eye and gestures perceiving were part of the semiosis cycles in which the participating students were engaged and which related to the mathematical signs that signified the adjacent and the opposite angles. Moreover, the teacher's suggestions/requests/questions included/suggested semiotic signs/tools, including verbal signs that helped the students pay attention, be aware of and objectify the adjacent and opposite angles' concepts.
Zhang, Yu; Tang, Yibo; Shen, Hongxing
2017-12-01
In order to reduce the incidence of adjacent segment disease (ASD), the current study was designed to establish Chinese finite element models of normal 3rd~7th cervical vertebrae (C3-C7) and anterior cervical corpectomy and fusion (ACCF) with internal fixation , and analyze the influence of screw sagittal angle (SSA) on stress on endplate of adjacent cervical segments. Mimics 8.1 and Abaqus/CAE 6.10 softwares were adopted to establish finite element models. For C4 superior endplate and C6 inferior endplate, their anterior areas had the maximum stress in anteflexion position, and their posterior areas had the maximum stress in posterior extension position. As SSA increased, the stress reduced. With an increase of 10° in SSA, the stress on anterior areas of C4 superior endplate and C6 inferior endplate reduced by 12.67% and 7.99% in anteflexion position, respectively. With an increase of 10° in SSA, the stress on posterior areas of C4 superior endplate and C6 inferior endplate reduced by 9.68% and 10.22% in posterior extension position, respectively. The current study established Chinese finite element models of normal C3-C7 and ACCF with internal fixation , and demonstrated that as SSA increased, the stress on endplate of adjacent cervical segments decreased. In clinical surgery, increased SSA is able to play important role in protecting the adjacent cervical segments and reducing the incidence of ASD.
Woolery-Lloyd, Heather; Kammer, Jenna N
2011-01-01
Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.
Variable length adjacent partitioning for PTS based PAPR reduction of OFDM signal
International Nuclear Information System (INIS)
Ibraheem, Zeyid T.; Rahman, Md. Mijanur; Yaakob, S. N.; Razalli, Mohammad Shahrazel; Kadhim, Rasim A.
2015-01-01
Peak-to-Average power ratio (PAPR) is a major drawback in OFDM communication. It leads the power amplifier into nonlinear region operation resulting into loss of data integrity. As such, there is a strong motivation to find techniques to reduce PAPR. Partial Transmit Sequence (PTS) is an attractive scheme for this purpose. Judicious partitioning the OFDM data frame into disjoint subsets is a pivotal component of any PTS scheme. Out of the existing partitioning techniques, adjacent partitioning is characterized by an attractive trade-off between cost and performance. With an aim of determining effects of length variability of adjacent partitions, we performed an investigation into the performances of a variable length adjacent partitioning (VL-AP) and fixed length adjacent partitioning in comparison with other partitioning schemes such as pseudorandom partitioning. Simulation results with different modulation and partitioning scenarios showed that fixed length adjacent partition had better performance compared to variable length adjacent partitioning. As expected, simulation results showed a slightly better performance of pseudorandom partitioning technique compared to fixed and variable adjacent partitioning schemes. However, as the pseudorandom technique incurs high computational complexities, adjacent partitioning schemes were still seen as favorable candidates for PAPR reduction
Variable length adjacent partitioning for PTS based PAPR reduction of OFDM signal
Energy Technology Data Exchange (ETDEWEB)
Ibraheem, Zeyid T.; Rahman, Md. Mijanur; Yaakob, S. N.; Razalli, Mohammad Shahrazel; Kadhim, Rasim A. [School of Computer and Communication Engineering, Universiti Malaysia Perlis, 02600 Arau, Perlis (Malaysia)
2015-05-15
Peak-to-Average power ratio (PAPR) is a major drawback in OFDM communication. It leads the power amplifier into nonlinear region operation resulting into loss of data integrity. As such, there is a strong motivation to find techniques to reduce PAPR. Partial Transmit Sequence (PTS) is an attractive scheme for this purpose. Judicious partitioning the OFDM data frame into disjoint subsets is a pivotal component of any PTS scheme. Out of the existing partitioning techniques, adjacent partitioning is characterized by an attractive trade-off between cost and performance. With an aim of determining effects of length variability of adjacent partitions, we performed an investigation into the performances of a variable length adjacent partitioning (VL-AP) and fixed length adjacent partitioning in comparison with other partitioning schemes such as pseudorandom partitioning. Simulation results with different modulation and partitioning scenarios showed that fixed length adjacent partition had better performance compared to variable length adjacent partitioning. As expected, simulation results showed a slightly better performance of pseudorandom partitioning technique compared to fixed and variable adjacent partitioning schemes. However, as the pseudorandom technique incurs high computational complexities, adjacent partitioning schemes were still seen as favorable candidates for PAPR reduction.
Proteome analysis identifies L1CAM/CD171 and DPP4/CD26 as novel markers of human skin mast cells.
Gschwandtner, M; Paulitschke, V; Mildner, M; Brunner, P M; Hacker, S; Eisenwort, G; Sperr, W R; Valent, P; Gerner, C; Tschachler, E
2017-01-01
The function of skin mast cells has been well documented in IgE-mediated allergic reactions, whereas other mast cell functions are poorly defined. This study aimed at identifying novel mast cell proteins by proteome analysis of primary human skin mast cells. The proteome of skin mast cells was compared to other cell types and analyzed using bioinformatics. The expression and function of two proteins hitherto not described in skin mast cells was investigated in isolated mast cells as well as in mast cells in situ. Within the mast cell proteome, we identified 49 highly expressed proteins previously not described in mast cells; 21 of these proteins were found to be selectively expressed in mast cells. Two proteins, the neural cell adhesion molecule L1 and dipeptidyl peptidase 4, were further studied. L1 was found to be highly expressed in mast cells in normal, psoriasis, and mastocytosis skin. Dipeptidyl peptidase 4 was found to be expressed in mast cells in normal, psoriasis, and mastocytosis skin as well as in bone marrow mast cells in patients with systemic mastocytosis. In normal skin, mast cells were identified as a major source of dipeptidyl peptidase 4 and we also found that skin mast cells and fibroblasts secrete an active form of this enzyme. In a systematic proteomics approach we identified two novel mast cell proteins potentially relevant to skin homeostasis: neural cell adhesion molecule L1 and dipeptidyl peptidase 4. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Mytych, Jennifer; Wnuk, Maciej; Rattan, Suresh I S
2016-04-01
Nanodiamonds (ND) and silica nanoparticles (SiO2-NP) have been much investigated for their toxicity at high doses, little is known about their biological activity at low concentrations. Here we report the biphasic dose response of ND and SiO2-NP in modulating normal human facial skin fibroblasts (FSF1) in culture. ND and SiO2-NP at low concentration (up to 0.5 μg/ml) had beneficial effects on FSF1 in terms of increasing their proliferation and metabolic activity. Exposure of FSF1 cells to low levels of NP enhanced their wound healing ability in vitro and slowed down aging during serial passaging as measured by maintenance of youthful morphology, reduction in the rate of loss of telomeres, and the over all proliferative characteristics. Furthermore, NP treatment induced the activation of Nrf2- and FOXO3A-mediated cellular stress responses, including an increased expression of heme oxygenease (HO-1), sirtuin (SIRT1), and DNA methyltransferase II (DNMT2). These results imply that ND and SiO2-NP at low doses are potential hormetins, which exert mild stress-induced beneficial hormetic effects through improved survival, longevity, maintenance, repair and function of human cells. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ultrastructural changes in human skin after exposure to a pulsed laser
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, H.; Tan, O.T.; Parrish, J.A.
1985-05-01
Selective vascular injury following irradiation using a pulsed laser source at 577 nm was examined using ultrastructural methods in the skin of 3 fair-skinned healthy human volunteers. This vascular-specific damage was confined to the papillary dermis. Red blood cells were altered in several ways. As well as an increase in the electron density, configurational distortion modified the normal biconcave forms to ameboid structures. The most interesting finding was the appearance within these altered cells of well-defined circular/oval electron-lucent areas of 800 A diameter, possibly representing a heat-fixed record of steam formation within the red blood cell. In addition, considerable degenerative changes were evident in endothelial cells and pericytes, while mast cells, neutrophils, histiocytes, and fibroblasts as well as collagen bundles immediately surrounding most laser-damaged blood vessels appeared normal.
In vivo diagnosis of skin cancer using polarized and multiple scattered light spectroscopy
Bartlett, Matthew Allen
This thesis research presents the development of a non-invasive diagnostic technique for distinguishing between skin cancer, moles, and normal skin using polarized and multiple scattered light spectroscopy. Polarized light incident on the skin is single scattered by the epidermal layer and multiple scattered by the dermal layer. The epidermal light maintains its initial polarization while the light from the dermal layer becomes randomized and multiple scattered. Mie theory was used to model the epidermal light as the scattering from the intercellular organelles. The dermal signal was modeled as the diffusion of light through a localized semi-homogeneous volume. These models were confirmed using skin phantom experiments, studied with in vitro cell cultures, and applied to human skin for in vivo testing. A CCD-based spectroscopy system was developed to perform all these experiments. The probe and the theory were tested on skin phantoms of latex spheres on top of a solid phantom. We next extended our phantom study to include in vitro cells on top of the solid phantom. Optical fluorescent microscope images revealed at least four distinct scatterers including mitochondria, nucleoli, nuclei, and cell membranes. Single scattering measurements on the mammalian cells consistently produced PSD's in the size range of the mitochondria. The clinical portion of the study consisted of in vivo measurements on cancer, mole, and normal skin spots. The clinical study combined the single scattering model from the phantom and in vitro cell studies with the diffusion model for multiple scattered light. When parameters from both layers were combined, we found that a sensitivity of 100% and 77% can be obtained for detecting cancers and moles, respectively, given the number of lesions examined.
Directory of Open Access Journals (Sweden)
Yoon-Jung Kim
2015-01-01
Full Text Available Thread embedding acupuncture (TEA is an acupuncture treatment applied to many diseases in Korean medical clinics because of its therapeutic effects by continuous stimulation to tissues. It has recently been used to enhance facial skin appearance and antiaging, but data from evidence-based medicine are limited. To investigate whether TEA therapy can inhibit skin photoaging by ultraviolet B (UVB irradiation, we performed analyses for histology, histopathology, in situ zymography and western blot analysis in HR-1 hairless mice. TEA treatment resulted in decreased wrinkle formation and skin thickness (Epidermis; P=0.001 versus UV in UVB irradiated mice and also inhibited degradation of collagen fibers (P=0.010 versus normal by inhibiting proteolytic activity of gelatinase matrix-metalloproteinase-9 (MMP-9. Western blot data showed that activation of c-Jun N-terminal kinase (JNK induced by UVB (P=0.002 versus normal group was significantly inhibited by TEA treatment (P=0.005 versus UV with subsequent alleviation of MMP-9 activation (P=0.048 versus UV. These results suggest that TEA treatment can have anti-photoaging effects on UVB-induced skin damage by maintenance of collagen density through regulation of expression of MMP-9 and related JNK signaling. Therefore, TEA therapy may have potential roles as an alternative treatment for protection against skin damage from aging.
Directory of Open Access Journals (Sweden)
Yira Bermudez
Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.
Directory of Open Access Journals (Sweden)
Abbaszadeh A.
2017-06-01
Full Text Available Normal skin is composed of epidermis and dermis. Skin is susceptible to radiation damage because it is a continuously renewing organ containing rapidly proliferating mature cells. Radiation burn is a damage to the skin or other biological tissues caused by exposure to radiofrequency energy or ionizing radiation. Acute skin reaction is the most frequently occurring side effect of radiation therapy. Generally, any chemical/ biological agent given before or at the time of irradiation to prevent or ameliorate damage to normal tissues is called a radioprotector. Melatonin is a highly lipophilic substance that easily penetrates organic membranes and therefore is able to protect important intracellular structures including mitochondria and DNA against oxidative damage directly at the sites where such a kind of damage would occur. Melatonin leads to an increase in the molecular level of some important antioxidative enzymes such as superoxide, dismotase and glutation-peroxidase, and also a reduction in synthetic activity of nitric oxide. There is a large body of evidence which proves the efficacy of Melatonin in ameliorating UV and X ray-induced skin damage. We propose that, in the future, Melatonin would improve the therapeutic ratio in radiation oncology and ameliorate skin damage more effectively when administered in optimal and non-toxic doses
Gruzdeva, N I; Zherebtsov, L D; Vasilevskiĭ, V K; Vremzen, S A
1975-04-01
The authors describe a method of determination of the colour of the skin in man based on the use of contactless photoelectric colorimeter made especially for this purpose. The mean normal values of the indices of the skin colour of the anterior and the posterior surface of the arm in 45 men and 35 women of the Europeoid race under normal conditions are presented.
DA 5505: a novel topical formulation of terbinafine that enhances skin penetration and retention.
Thapa, Raj Kumar; Han, Sang-Duk; Park, Hyoung Geun; Son, Miwon; Jun, Joon Ho; Kim, Jong Oh
2015-01-01
Topical fungal infections can become severe if left untreated. Efficient treatment modalities for topical fungal infections aid the penetration of antifungal agents deep into viable skin layers. Terbinafine is a fungicidal agent that inhibits ergosterol, an essential fungal component. The main objective of this study was to evaluate skin permeation and retention of a terbinafine-loaded solution containing chitosan as a film former. Comparative assessment of skin permeation and retention was performed using a prepared formulation (DA 5505) and marketed formulations of terbinafine in murine and porcine skin. To mimic fungal infection of skin, keratinized skin was induced in NC/Nga mice. In comparison with the marketed formulations, DA 5505 exhibited significantly better skin permeation. The flux, permeation coefficient, and enhancement ratio of terbinafine were remarkably increased by DA 5505 in comparison with the marketed formulations, and lag time was dramatically reduced. DA 5505 significantly increased cumulative terbinafine retention in viable skin layers in comparison with the marketed solution, suggesting enhanced efficacy. Furthermore, DA 5505 exhibited superior skin permeation in normal skin and keratinized skin. Thus, the DA 5505 formulation has the potential to effectively deliver terbinafine to superficial and deep cutaneous fungal infections.
Törmä, Hans; Lindberg, Magnus; Berne, Berit
2008-05-01
Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.
33 CFR 80.1395 - Puget Sound and adjacent waters.
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound and adjacent waters. 80.1395 Section 80.1395 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... waters. The 72 COLREGS shall apply on all waters of Puget Sound and adjacent waters, including Lake Union...
Directory of Open Access Journals (Sweden)
El Maged Rabee A
2007-01-01
Full Text Available Abstract Background This study was conducted to evaluate the immunohistochemical (IHC expression of interleukin 8 (IL-8 in skin biopsies of inflammatory acne vulgaris (IAV in an attempt to understand the disease pathogenesis. Materials and methods A total of 58 biopsies, 29 from lesional IAV and 29 normal non lesional sites were immunostained for IL-8. The intensity of staining was evaluated in the epidermis and dermis and was scored as mild, moderate and severe. The expression was correlated with the clinical grade, disease course and histological changes. Results IL-8 immunoreactivity was expressed in lesional IAV compared to non lesional skin biopsies (p Conclusion We were able to demonstrate altered immunoreactivity of IL-8 in IAV compared to normal skin. Targeted therapy to block IL-8 production may hold promise in limiting the deleterious effects of IL-8-mediated inflammatory response and angiogenesis.
Individual signatures and environmental factors shape skin microbiota in healthy dogs.
Cuscó, Anna; Belanger, Janelle M; Gershony, Liza; Islas-Trejo, Alma; Levy, Kerinne; Medrano, Juan F; Sánchez, Armand; Oberbauer, Anita M; Francino, Olga
2017-10-13
The individual, together with its environment, has been reported as the main force driving composition and structure of skin microbiota in healthy dogs. Therefore, one of the major concerns when analyzing canine skin microbiota is the likely influence of the environment. Despite the dense fur covering, certain skin diseases exhibit differential prevalence among skin sites, dog breeds, and individuals. We have characterized the normal variability of dog skin microbiota in a well-controlled cohort of a large number of Golden-Labrador Retriever crossed dogs (N = 35) with similar ages, related genetic background, and a shared environment. We found that the individual drives the skin microbiota composition and structure followed by the skin site. The main bacterial classes inhabiting dog skin in this cohort are Gammaproteobacteria and Bacilli. We also detected bacteria associated to the environment on different dog skin sites that could be reflecting the different degrees of exposure of each skin site and each dog. Network analyses elucidated bacterial interactions within and between skin sites, especially in the chin, abdomen, axilla, and perianal region, with the highly shared interactions probably representing an anatomical, behavioral, or environmental component. When analyzing each skin site independently to assess host-specific factors, we found that temporality (season of birth and time spent in the kennel) affected all the skin sites and specially the inner pinna. The most abundant taxon driving this difference was Sphingomonas. We also found taxonomic differences among male and female dogs on the abdomen, axilla, and back. We observed a large inter-individual variability and differences among skin sites. Host-specific variables, such as temporality or sex, were also shaping skin microbiota of healthy dogs, even in an environmental homogenous cohort.
Bertolesi, Gabriel E; Vazhappilly, Sherene T; Hehr, Carrie L; McFarlane, Sarah
2016-03-01
Light-regulated skin colour change is an important physiological process in invertebrates and lower vertebrates, and includes daily circadian variation and camouflage (i.e. background adaptation). The photoactivation of melanopsin-expressing retinal ganglion cells (mRGCs) in the eye initiates an uncharacterized neuroendocrine circuit that regulates melanin dispersion/aggregation through the secretion of alpha-melanocyte-stimulating hormone (α-MSH). We developed experimental models of normal or enucleated Xenopus embryos, as well as in situ cultures of skin of isolated dorsal head and tails, to analyse pharmacological induction of skin pigmentation and α-MSH synthesis. Both processes are triggered by a melanopsin inhibitor, AA92593, as well as chloride channel modulators. The AA9253 effect is eye-dependent, while functional data in vivo point to GABAA receptors expressed on pituitary melanotrope cells as the chloride channel blocker target. Based on the pharmacological data, we suggest a neuroendocrine circuit linking mRGCs with α-MSH secretion, which is used normally during background adaptation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Variability of hair coat and skin traits as related to adaptation in Criollo Limonero cattle.
Landaeta-Hernández, Antonio; Zambrano-Nava, Sunny; Hernández-Fonseca, Juan P; Godoy, Rosario; Calles, Marcos; Iragorri, José L; Añez, Lauderys; Polanco, Miguel; Montero-Urdaneta, Merilio; Olson, Tim
2011-03-01
The variation in hair coat and skin histology traits of Criollo Limonero cattle was analyzed using 213 Criollo Limonero females. Skin biopsies were obtained from slick-haired (N=16) and normal-haired (N=14) animals. Measured traits included hair length (HL), color coat (CC), number of hair follicles per square centimeter (NHF), sweat glands per square centimeter (NSG), sweat glands size (SGS), sebaceous glands per square centimeter (NSBG), blood vessels per square centimeter (NBV), and thickness of epidermis (TE). Hair length differed (P0.05) were found between slick-haired and normal-haired animals in NHF (637 ± 164 vs 587 ± 144, respectively), NSG (556 ± 134 vs 481 ± 118, respectively), NSBG (408 ± 87 vs 366 ± 77, respectively), NBV (1628 ± 393 vs 1541 ± 346, respectively), and TE (1.24 ± 0.14 vs 1.32 ± 0.12, respectively). However, SGS was greater (PCriollo Limonero cattle are predominantly bayo-coated, slick-haired, with a reduced number of hair follicles relative to Zebu cattle, sweat and sebaceous glands in proportion to hair follicle numbers, and with a high blood flow irrigating the skin. There is a sub-group of red-coated animals with yellow or cream skin, thicker epidermis, and with a higher frequency of normal-haired animals. It appears that the slick hair gene has been favored by natural selection in this breed.
Management of defects on lower extremities with the use of matriderm and skin graft.
Choi, Jun-Young; Kim, Seong-Hun; Oh, Gwang-Jin; Roh, Si-Gyun; Lee, Nae-Ho; Yang, Kyung-Moo
2014-07-01
The reconstruction of large skin and soft tissue defects on the lower extremities is challenging. The skin graft is a simple and frequently used method for covering a skin defect. However, poor skin quality and architecture are well-known problems that lead to scar contracture. The collagen-elastin matrix, Matriderm, has been used to improve the quality of skin grafts; however, no statistical and objective review of the results has been reported. Thirty-four patients (23 male and 11 female) who previously received a skin graft and simultaneous application of Matriderm between January 2010 and June 2012 were included in this study. The quality of the skin graft was evaluated using Cutometer, occasionally accompanied by pathologic findings. All 34 patients showed good skin quality compared to a traditional skin graft and were satisfied with their results. The statistical data for the measurement of the mechanical properties of the skin were similar to those for normal skin. In addition, there was no change in the engraftment rate. The biggest problem of a traditional skin graft is scar contracture. However, the dermal matrix presents an improvement in skin quality with elastin and collagen. Therefore, a skin graft along with a simultaneous application of Matriderm is safe and effective and leads to a significantly better outcome from the perspective of skin elasticity.
A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin
Directory of Open Access Journals (Sweden)
Nisma Mujahid
2017-06-01
Full Text Available The presence of dark melanin (eumelanin within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in “redhaired” Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk.
A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin.
Mujahid, Nisma; Liang, Yanke; Murakami, Ryo; Choi, Hwan Geun; Dobry, Allison S; Wang, Jinhua; Suita, Yusuke; Weng, Qing Yu; Allouche, Jennifer; Kemeny, Lajos V; Hermann, Andrea L; Roider, Elisabeth M; Gray, Nathanael S; Fisher, David E
2017-06-13
The presence of dark melanin (eumelanin) within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in "redhaired" Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK) has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Morphogenesis and Biomechanics of Engineered Skin Cultured Under Uniaxial Strain.
Blackstone, Britani N; Powell, Heather M
2012-04-01
Split-thickness autograft is the standard wound treatment for full-thickness burns. In large burns, sparse availability of uninjured skin prevents rapid closure of the wound, resulting in increased scar tissue formation or mortality. Tissue-engineered skin (ES) offers promise when autografts are not available. ES, constructed from a polymeric scaffold and skin cells, has been shown to reduce donor site area required to permanently close wounds, mortality, and morbidity from scarring but cannot restore all skin functions. Current generations of ES are orders of magnitude weaker than normal human skin, leading to difficulty in surgical application, greater susceptibility to mechanical damage during fabrication and application, and less elasticity and strength once engrafted. Previous studies to improve ES biomechanics focus on altering the scaffolding material, which resulted in modest improvements but often inhibited proper skin development. As the skin is naturally under static strain, adding these mechanical cues to the culture environment is hypothesized to improve ES biomechanics. ES was cultured under applied static strains ranging from 0% to 40% strain for a total of 10 days. Strain magnitudes of 10% and 20% strain resulted in significantly stronger ES than unstrained controls, showed upregulation of many genes encoding structural extracellular matrix proteins, and exhibited increased epidermal cell proliferation and differentiation. Enhanced biomechanical properties of ES can allow for facile surgical application and less damage during dressing changes. These findings suggest that mechanical cues play a significant role in skin development and should be further explored.
Comparison of skin responses from macroscopic and microscopic UV challenges
Seo, InSeok; Bargo, Paulo R.; Chu, Melissa; Ruvolo, Eduardo; Kollias, Nikiforos
2011-03-01
The minimal erythema dose induced by solar-simulated radiation is a useful measure of UV sensitivity of skin. Most skin phototests have been conducted by projecting a flat field of UV radiation onto the skin in an area greater than 15 cm × 15 cm with an increment of radiation doses. In this study, we investigated the responses of human skin to solar-simulated radiation of different field sizes. Twelve human subjects of skin phototype I-IV were exposed to solar-simulated radiation (SSR) on their upper inner arm or on their lower back with a series of doses in increments of 20% in order to determine the threshold dose to induce a minimal perceptible erythema response (MED). Each dose was delivered with a liquid light guide (8 mm diameter on the back or 6 mm on the upper inner arm) and with quartz optical fibers of 200 μm diameter. The resulting skin responses were evaluated visually and investigated with a reflectance confocal microscope and imaging. The erythema response to the microscopic challenge was always diffuse with no clear boundaries extending to several times the exposed site diameter at doses greater than 2 MED. The skin returned to normal appearance from the microscopic challenge after two weeks of exposure while change in appearance for the larger areas persisted for several weeks to months. This new modality of testing provides the possibility to study skin at the microscopic level with a rapid recovery following challenge.
PH- Mapping Of Prepubertal Skin Of Indian Subjects
Directory of Open Access Journals (Sweden)
Gupta A B
1995-01-01
Full Text Available PH- mapping of skin was made by measuring the skin surface pH in 61 normal Indian subjects (35M, 26F in the prepubertal age group at 21 different sites from scalp to sole at an ambient temperature 25-32C and a relative humidity 60-65%. The pH values at axilla, umbilicus, palm, fingerfolds, foot, sole, and cheek were found to be consistently higher than those at scalp, forehead, retroauricular folds, antecubital and popliteal fossae, anterior arm, anterior the mean pH of male skin appeared to be lower than that of female. The highest pH recorded was in axilla (5.98 for male, 6.00 for female, irrespective of sex. The lowest value however was in anterior neck (4.59 for male and in antecubital fossa (4.83 for female. While the origin of the skin pH is yet to be definitely known, it was observed that a high density of both sweat gland and bacteria flora leads to a high pH, and high concentration of sebaceous gland and of bacterial flora to a lower pH.
Villanova, Federica; Flutter, Barry; Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O
2014-04-01
Innate lymphoid cells (ILCs) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterize the ILCs in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in the skin and blood of normal individuals and psoriasis patients are CD3-negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in the blood of psoriasis patients compared with healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen, indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILCs in the skin compared with blood. Moreover, the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared with normal skin. A detailed time course of a psoriasis patient treated with anti-tumor necrosis factor showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis.
"Healing Effect of Topical Nifedipine on Skin Wounds of Diabetic Rats "
Directory of Open Access Journals (Sweden)
Abbas Ebadi
2003-07-01
Full Text Available Non-healing foot ulcers in patients with diabetes are the leading causes of complications such as infection and amputation. Ulceration is the most common single precursor to amputation and has been identified as a causative factor in 85% of lower extremity amputations. It seems that poor outcomes are generally associated with infection, peripheral vascular disease and wounds of increasing depth. Nifedipine, a calcium channel blocker that is mainly used for the treatment of cardiovascular disorders has recently been used to treat wounds caused by peripheral vascular disorders. In present study topical Nifedipine 3% has been used to treat skin wounds in normal and diabetic rats. Effects of Nifedipine were evaluated in three different phases of wound healing process. In both experiments (normal and diabetic rats topical Nifedipine significantly improved inflammatory phase. However, maturation phase was only significantly improved in diabetic rats. Nifedipine did not affect proliferation phase in either group significantly. Overall results of this study showed topical Nifedipine improved skin wound healing process in normal and diabetic rats.
Gallic Acid Promotes Wound Healing in Normal and Hyperglucidic Conditions
Directory of Open Access Journals (Sweden)
Dong Joo Yang
2016-07-01
Full Text Available Skin is the outermost layer of the human body that is constantly exposed to environmental stressors, such as UV radiation and toxic chemicals, and is susceptible to mechanical wounding and injury. The ability of the skin to repair injuries is paramount for survival and it is disrupted in a spectrum of disorders leading to skin pathologies. Diabetic patients often suffer from chronic, impaired wound healing, which facilitate bacterial infections and necessitate amputation. Here, we studied the effects of gallic acid (GA, 3,4,5-trihydroxybenzoic acid; a plant-derived polyphenolic compound on would healing in normal and hyperglucidic conditions, to mimic diabetes, in human keratinocytes and fibroblasts. Our study reveals that GA is a potential antioxidant that directly upregulates the expression of antioxidant genes. In addition, GA accelerated cell migration of keratinocytes and fibroblasts in both normal and hyperglucidic conditions. Further, GA treatment activated factors known to be hallmarks of wound healing, such as focal adhesion kinases (FAK, c-Jun N-terminal kinases (JNK, and extracellular signal-regulated kinases (Erk, underpinning the beneficial role of GA in wound repair. Therefore, our results demonstrate that GA might be a viable wound healing agent and a potential intervention to treat wounds resulting from metabolic complications.
Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J
2017-01-01
A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.
Karuppasamy, K; Yadav, Ajit S; Saxena, Gaurav K
2015-12-01
Thermal inactivation of normal and starved cells of Salmonella Enteritidis on chicken skin previously exposed to different concentrations of acidified sodium chlorite (ASC) or tri-sodium phosphate (TSP) was investigated. Inoculated skin was pretreated with different concentration of ASC or TSP, packaged in bags, and then immersed in a circulating water bath at 60 to 68 °C. The recovery medium was Hektoen enteric agar. D-values, determined by linear regression, for normal cells on chicken skin, were 2.79, 1.17 and 0.53 min whereas D-values for starved cells were 4.15, 1.83 and 0.66 at 60, 64 and 68 °C, respectively. z-values for normal cells were 3.54 and for starved cells were 2.29. Pretreatment of Salmonella Enteritidis cells with 0 to 200 ppm of ASC or 0 to 1.0 % TSP resulted in lower D-values at all temperatures. Sensory results indicated no significance differences for control and treatments. Thus, results of this study indicated that pretreatment of chicken skin with ASC or TSP increased sensitivity of Salmonella Enteritidis to heat without affecting organoleptic quality of chicken meat.
Ablative skin resurfacing with a novel microablative CO2 laser.
Gotkin, Robert H; Sarnoff, Deborah S; Cannarozzo, Giovanni; Sadick, Neil S; Alexiades-Armenakas, Macrene
2009-02-01
Carbon dioxide (CO2) laser skin resurfacing has been a mainstay of facial rejuvenation since its introduction in the mid 1990s. Recently, a new generation of fractional or microablative CO2 lasers has been introduced to the marketplace. According to the concept of fractional photothermolysis, these lasers ablate only a fraction of the epidermal and dermal architecture in the treatment area. An array of microscopic thermal wounds is created that ablates the epidermis and dermis within very tiny zones; adjacent to these areas, the epidermis and dermis are spared. This microablative process of laser skin resurfacing has proven safe and effective not only for facial rejuvenation, but elsewhere on the body as well. It is capable of improving wrinkles, acne scars, and other types of atrophic scars and benign pigmented lesions associated with elastotic, sun-damaged skin. Because of the areas of spared epidermis and dermis inherent in a procedure that employs fractional photothermolysis, healing is more rapid compared to fully ablative CO2 laser skin resurfacing and downtime is proportionately reduced. A series of 32 consecutive patients underwent a single laser resurfacing procedure with the a new microablative CO2 laser. All patients were followed for a minimum of 6 months and were asked to complete patient satisfaction questionnaires; a 6 month postoperative photographic evaluation by an independent physician, not involved in the treatment, was also performed. Both sets of data were graded and reported on a quartile scale. Results demonstrated greater than 50% improvement in almost all patients with those undergoing treatment for wrinkles, epidermal pigment or solar elastosis deriving the greatest change for the better (>75%).
Proposed derivation of skin contamination and skin decontamination limits
International Nuclear Information System (INIS)
Schieferdecker, H.; Koelzer, W.; Henrichs, K.
1986-01-01
From the primary dose limits for the skin, secondary dose limits were derived for skin contamination which can be used in practical radiation protection work. Analogous to the secondary dose limit for the maximum permissible body burden in the case of incorporation, dose limits for the 'maximum permissible skin burden' were calculated, with the help of dose factors, for application in the case of skin contamination. They can be derived from the skin dose limit values. For conditions in which the skin is exposed to temporary contamination, a limit of skin contamination was derived for immediately removable contamination and for one day of exposure. For non-removable contamination a dose limit of annual skin contamination was defined, taking into account the renewal of the skin. An investigation level for skin contamination was assumed, as a threshold, above which certain measures must be taken; these to include appropriate washing not more than three times, with the subsequent procedure determined by the level of residual contamination. The dose limits are indicated for selected radionuclides. (author)
... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
High Rhodotorula sequences in skin transcriptome of patients with diffuse systemic sclerosis.
Arron, Sarah T; Dimon, Michelle T; Li, Zhenghui; Johnson, Michael E; Wood, Tammara A; Feeney, Luzviminda; Angeles, Jorge G; Lafyatis, Robert; Whitfield, Michael L
2014-08-01
Previous studies have suggested a role for pathogens as a trigger of systemic sclerosis (SSc), although neither a pathogen nor a mechanism of pathogenesis is known. Here we show enrichment of Rhodotorula sequences in the skin of patients with early, diffuse SSc compared with that in normal controls. RNA-seq was performed on four SSc patients and four controls, to a depth of 200 million reads per patient. Data were analyzed to quantify the nonhuman sequence reads in each sample. We found little difference between bacterial microbiome and viral read counts, but found a significant difference between the read counts for a mycobiome component, R. glutinis. Normal samples contained almost no detected R. glutinis or other Rhodotorula sequence reads (mean score 0.021 for R. glutinis, 0.024 for all Rhodotorula). In contrast, SSc samples had a mean score of 5.039 for R. glutinis (5.232 for Rhodotorula). We were able to assemble the D1-D2 hypervariable region of the 28S ribosomal RNA (rRNA) of R. glutinis from each of the SSc samples. Taken together, these results suggest that R. glutinis may be present in the skin of early SSc patients at higher levels than in normal skin, raising the possibility that it may be triggering the inflammatory response found in SSc.
Distribution and degradation of albumin in extensive skin disease
DEFF Research Database (Denmark)
Worm, Anne-Marie; Taaning, E; Rossing, N
1981-01-01
The distribution and degradation of albumin were determined in twelve patients with extensive skin disease and in ten control subjects by measuring the metabolic turnover and transcapillary escape of 132 I-labelled albumin. The ratio of intravascular to total mass of albumin was normal. Thus...... the observed hypoalbuminaemia and the low intravascular mass reflect a reduced mass of total body albumin. The rate of synthesis was normal, but the transcapillary escape rate reflecting the microvascular leakiness to macromolecules, and the fractional disappearance rate were significantly higher...
Yamashita, Kazuta; Higashino, Kosaku; Sakai, Toshinori; Takata, Yoichiro; Hayashi, Fumio; Tezuka, Fumitake; Morimoto, Masatoshi; Chikawa, Takashi; Nagamachi, Akihiro; Sairyo, Koichi
2017-01-01
Percutaneous endoscopic surgery for the lumbar spine has become established in the last decade. It requires only an 8 mm skin incision, causes minimal damage to the paravertebral muscles, and can be performed under local anesthesia. With the advent of improved equipment, in particular the high-speed surgical drill, the indications for percutaneous endoscopic surgery have expanded to include lumbar spinal canal stenosis. Transforaminal percutaneous endoscopic discectomy has been used to treat intervertebral stenosis. However, it has been reported that adjacent level disc degeneration and foraminal stenosis can occur following intervertebral segmental fusion. When this adjacent level pathology becomes symptomatic, additional fusion surgery is often needed. We performed minimally invasive percutaneous full endoscopic lumbar foraminoplasty in an awake and aware 50-year-old woman under local anesthesia. The procedure was successful with no complications. Her radiculopathy, including muscle weakness and leg pain due to impingement of the exiting nerve, improved after the surgery. J. Med. Invest. 64: 291-295, August, 2017.
... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...
ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.
Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya
2013-01-01
ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.
Skin fragility syndrome in a cat with cholangiohepatitis and hepatic lipidosis.
Daniel, Alexandre G T; Lucas, Sílvia R R; Júnior, Archivaldo R; Monteiro, Paula R G; Ramos, Daniela; Pires, Carolina G; Sinhorini, Idércio L
2010-02-01
A case of acquired skin fragility syndrome associated with hepatic disease in a 9-year-old, spayed female, domestic shorthair cat is described. The cat was admitted to the veterinary hospital of the University of São Paulo (Brazil) with a 6-week history of vomiting, inappetence and weight loss. Remarkable signs were weakness, lethargy and profound jaundice that had been present for 10 days according to the owner. On completion of the physical examination, when the cat was gently manipulated for blood collection the thoracic limb and interscapular skin tore. Liver enzymes and bilirubin levels were all above the normal range. On histological examination of skin and liver, Masson's trichrome stain showed collagen fibre alteration and major hepatocyte abnormalities. Findings were consistent with feline skin fragility syndrome associated with cholangiohepatitis and hepatic lipidosis. Copyright 2009 ESFM and AAFP. Published by Elsevier Ltd. All rights reserved.
The effect of skin thickness determined using breast CT on mammographic dosimetry
International Nuclear Information System (INIS)
Huang Shihying; Boone, John M.; Yang, Kai; Kwan, Alexander L. C.; Packard, Nathan J.
2008-01-01
The effect of breast skin thickness on dosimetry in mammography was investigated. Breast computed tomography (CT) acquisition techniques, combined with algorithms designed for determining specific breast metrics, were useful for estimating skin thickness. A radial-geometry edge detection scheme was implemented on coronal reconstructed breast CT (bCT) images to measure the breast skin thickness. Skin thickness of bilateral bCT volume data from 49 women and unilateral bCT volume data from 2 women (10 healthy women and 41 women with BIRADS 4 and 5 diagnoses) was robustly measured with the edge detection scheme. The mean breast skin thickness (±inter-breast standard deviation) was found to be 1.45±0.30 mm. Since most current published normalized glandular dose (D gN ) coefficients are based on the assumption of a 4-mm breast skin thickness, the D gN values computed with Monte Carlo techniques will increase up to 18% due to the thinner skin layers (e.g., 6-cm 50% glandular breast, 28 kVp Mo-Mo spectrum). The thinner skin dimensions found in this study suggest that the current D gN values used for mammographic dosimetry lead to a slight underestimate in glandular dose
Effect of emulsification on the skin permeation and UV protection of catechin.
Yoshino, Sachie; Mitoma, Tomoaki; Tsuruta, Keiko; Todo, Hiroaki; Sugibayashi, Kenji
2014-06-01
An anti-aging effect may be obtained by skin application of tea catechins (Camellia sinensis) since they have high ultraviolet (UV)-protection activity. In this study, the skin permeation of catechin (C), epicatechin (EC), epigallocatechin (EGC), epicatechin gallate (ECg) and epigallocatechin gallate (EGCg) was determined and compared, and the effect of emulsification on the skin permeation of C was measured. The UV-protective effect of C was also determined. The in vitro skin permeability of each catechin derivative was determined using side-by-side diffusion of cells. The UV-protective effect of C was determined by applying different concentrations of C to the solution or emulsion on a three-dimensional cultured human skin model or normal human epidermal keratinocytes with UV-irradiation. ECg and EGCg with gallate groups showed lower skin permeability than C, EC and EGC without gallate groups, suggesting that the skin permeability of catechin derivatives may be dependent on the existence of a gallate group. Interestingly, the skin permeation of C was increased by an o/w emulsification. In addition, the C emulsion showed a significantly higher UV-protective effect by C than that with its aqueous solution. These results suggest that the o/w emulsion of catechin derivatives is probably useful as a cosmetic formulation with anti-aging efficacy.
Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery
Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.
2010-01-01
Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044
Wang, Siyu; Zhang, Guirong; Meng, Huimin; Li, Li
2013-02-01
Evidence demonstrated that sweat was an important factor affecting skin physiological properties. We intended to assess the effects of exercise-induced sweating on the sebum, stratum corneum (SC) hydration and skin surface pH of facial skin. 102 subjects (aged 5-60, divided into five groups) were enrolled to be measured by a combination device called 'Derma Unit SSC3' in their frontal and zygomatic regions when they were in a resting state (RS), at the beginning of sweating (BS), during excessive sweating (ES) and an hour after sweating (AS), respectively. Compared to the RS, SC hydration in both regions increased at the BS or during ES, and sebum increased at the BS but lower during ES. Compared to during ES, Sebum increased in AS but lower than RS. Compared to the RS, pH decreased in both regions at the BS in the majority of groups, and increased in frontal region during ES and in zygomatic region in the AS. There was an increase in pH in both regions during ES in the majority of groups compared to the BS, but a decrease in the AS compared to during ES. The study implies that even in summer, after we sweat excessively, lipid products should be applied locally in order to maintain stability of the barrier function of the SC. The study suggests that after a short term(1 h or less) of self adjustment, excessive sweat from moderate exercise will not impair the primary acidic surface pH of the facial skin. Exercise-induced sweating significantly affected the skin physiological properties of facial region. © 2012 John Wiley & Sons A/S.
Skin bleaching: highlighting the misuse of cutaneous depigmenting agents.
Dadzie, O E; Petit, A
2009-07-01
Hydroquinone and other cutaneous depigmenting agents are widely used by dermatologists to treat pigmentary disorders. On 29 August 2006, the US Food and Drug Administration (FDA) published a monograph in the US Federal Register proposing to ban all hydroquinone products that have not been approved via a New Drug Application process. Reports in the scientific literature on the occurrence of exogenous ochronosis, in relation to the use of hydroquinone, was one of the concerns expressed by the FDA in relation to this agent. However, a review of the English-language scientific literature reveals that most of the reported cases of hydroquinone-induced exogenous ochronosis occurs in Africa, where the cultural practice of skin bleaching is highly prevalent. Skin bleaching is the practice of applying hydroquinone and/or other depigmenting agents to specific or widespread areas of the body, the primary function being to lighten normally dark skin. This practice typically occurs in men and women with Fitzpatrick skin phototypes IV to VI. It is a dangerous practice associated with a diverse range of side-effects, including mercury poisoning. Thus, this current discussion within the dermatological community on the safety of hydroquinone provides a unique opportunity to raise awareness about skin bleaching.
Local adjacency metric dimension of sun graph and stacked book graph
Yulisda Badri, Alifiah; Darmaji
2018-03-01
A graph is a mathematical system consisting of a non-empty set of nodes and a set of empty sides. One of the topics to be studied in graph theory is the metric dimension. Application in the metric dimension is the navigation robot system on a path. Robot moves from one vertex to another vertex in the field by minimizing the errors that occur in translating the instructions (code) obtained from the vertices of that location. To move the robot must give different instructions (code). In order for the robot to move efficiently, the robot must be fast to translate the code of the nodes of the location it passes. so that the location vertex has a minimum distance. However, if the robot must move with the vertex location on a very large field, so the robot can not detect because the distance is too far.[6] In this case, the robot can determine its position by utilizing location vertices based on adjacency. The problem is to find the minimum cardinality of the required location vertex, and where to put, so that the robot can determine its location. The solution to this problem is the dimension of adjacency metric and adjacency metric bases. Rodrguez-Velzquez and Fernau combine the adjacency metric dimensions with local metric dimensions, thus becoming the local adjacency metric dimension. In the local adjacency metric dimension each vertex in the graph may have the same adjacency representation as the terms of the vertices. To obtain the local metric dimension of values in the graph of the Sun and the stacked book graph is used the construction method by considering the representation of each adjacent vertex of the graph.
Skin cancer margin analysis within minutes with full-field OCT (Conference Presentation)
Dalimier, Eugénie; Ogrich, Lauren; Morales, Diego; Cusack, Carrie Ann; Abdelmalek, Mark; Boccara, Claude; Durkin, John
2017-02-01
Non-melanoma skin cancer (NMSC) is the most common cancer. Treatment consists of surgical removal of the skin cancer. Traditional excision involves the removal of the visible skin cancer with a significant margin of normal skin. On cosmetically sensitive areas, Mohs micrographic tissue is the standard of care. Mohs uses intraoperative microscopic margin assessment which minimizes the surgical defect and can help reduce the recurrence rate by a factor of 3. The current Mohs technique relies on frozen section tissue slide preparation which significantly lengthens operative time and requires on-site trained histotechnicians. Full-Field Optical Coherence Tomography (FFOCT) is a novel optical imaging technique which provides a quick and efficient method to visualize cancerous areas in minutes, without any preparation or destruction of the tissue. This study aimed to evaluate the potential of FFOCT for the analysis of skin cancer margins during Mohs surgery. Over 150 images of Mohs specimens were acquired intraoperatively with FFOCT before frozen section analysis. The imaging procedure took less than 5 minutes for each specimen. No artifacts on histological preparation were found arising from FFOCT manipulation; however frozen section artifact was readily seen on FFOCT. An atlas was established with FFOCT images and corresponding histological slides to reveal FFOCT reading criteria of normal and cancerous structures. Blind analysis showed high concordance between FFOCT and histology. FFOCT can potentially reduce recurrence rates while maintaining short surgery times, optimize clinical workflow, and decrease healthcare costs. For the patient, this translates into smaller infection risk, decreased stress, and better comfort.
DEFF Research Database (Denmark)
Carrizosa, Emilio; Guerrero, Vanesa; Morales, Dolores Romero
2018-01-01
individuals as adjacent rectangular portions as possible and adding as few false adjacencies, i.e., adjacencies between rectangular portions corresponding to non-adjacent individuals, as possible. We formulate this visualization problem as a Mixed Integer Linear Programming (MILP) model. We propose......In this paper we address the problem of visualizing a frequency distribution and an adjacency relation attached to a set of individuals. We represent this information using a rectangular map, i.e., a subdivision of a rectangle into rectangular portions so that each portion is associated with one...
International Nuclear Information System (INIS)
Okano, Toshio; Yasumura, Mitsue; Mizuno, Kumiko; Kobayashi, Tadashi
1978-01-01
The photochemical conversion of 7-dehydrocholesterol (7-DHC) into vitamin D 3 in rat skin was experimentally studied. The skin stripped off from a sacrificed normal rat was irradiated with an ultraviolet light for a constant period in the first in vitro experiment. The normal rat irradiated under the same conditions mentioned above was sacrificed and then the skin was stripped off in the second in vivo experiment. Lipids were individually extracted with chloroformmethanol (1:1) from the skin obtained in the two experiments and the solvent was evaporated. The resulting residue was saponified and the unsaponified matter extracted with benzene was purified by application to hydroxyalkoxypropyl (HAP) Sephadex column chromatography. The resulting purified vitamin D 3 fraction was applied to high performance liquid chromatography (HPLC) in order to estimate vitamin D 3 . No peak, aside from that of alphanaphthol as an initial standard, was observed in the HPLC chromatogram on the skin obtained from the non-irradiated rat, whereas the peak corresponding to vitamin D 3 was observed in each HPLC chromatogram on both the irradiated skin (in vitro experiment) and the skin obtained from the irradiated rat (in vivo experiment). The result shows that 7-DHC in rat skin was photochemically converted into vitamin D 3 . (Iwakiri, K.)
Rafat, Z; Hashemi, S J; Ahamdikia, K; Daie Ghazvini, R; Bazvandi, F
2017-12-01
The skin is the body's largest organ that hosts heterogeneous inhabitants. Until now, the diversity of the cutaneous microbiome was mainly investigated for bacteria and there is a little information about the skin fungal flora. Also, among skin fungal flora, Candida is found as a main member whose distribution is affected by sex, age, climate. In this study, differences in Candida community structure associated with 9 different skin sites of 238 healthy people during 10 months from July to March 2016, are described. These subjects were divided by age into 4 groups: infants, children, adults and geriatrics. The collected samples were examined by culture on Sabouraud Chloramphenicol Agar and CHROM-agar Candida. For precise identification of species ITS1-5. 8S-ITS2 rDNA regions were sequenced where needed. The frequency of Candida species was significantly different between age groups. The most Candida isolations were related to the elderly age group and the fewest in the infants. C. parapsilosis virtually, was the predominant isolated species in all age groups. This study showed no statistically significant effect of the subject's sex on Candida population resident on human skin surface. Copyright © 2017. Published by Elsevier Masson SAS.
Cure of skin cancer. Surgical cure of skin cancer
International Nuclear Information System (INIS)
Zikiryakhodjaev, D.Z.; Sanginov, D.R.
2001-01-01
In this chapter authors studied the cure of skin cancer in particular the surgical cure of skin cancer. They noted that surgical cure of skin cancer is remain one of the primary and most important methods in treatment of skin cancer
On Pathos Adjacency Cut Vertex Jump Graph of a Tree
Nagesh.H.M; R.Chandrasekhar
2014-01-01
In this paper the concept of pathos adjacency cut vertex jump graph PJC(T) of a tree T is introduced. We also present a characterization of graphs whose pathos adjacency cut vertex jump graphs are planar, outerplanar, minimally non-outerplanar, Eulerian and Hamiltonian.
Rational Design and Enhanced Biocompatibility of a Dry Adhesive Medical Skin Patch
Kwak, Moon Kyu; Jeong, Hoon-Eui; Suh, Kahp Y.
2011-01-01
A new type of medical skin patch is developed that contains high-density, mushroom-like micropillars. Such dry-adhesive micropillars are highly biocompatible, have minimized side effects, and provide reasonable normal adhesion strength. To arrive
Emission of pesticides during drilling and deposition in adjacent areas
Directory of Open Access Journals (Sweden)
Heimbach, Udo
2014-02-01
Full Text Available In seven experiments seeds of maize, oil seed rape and barley, treated with neonicotinoids, were sown using pneumatic drilling equipment with deflectors attached in case of pneumatic suction systems. Directly adjacent to the drilled area of usually about 50 m width were replicated areas with bare soil as well as with crops. During maize (Zea mays drilling flowering oil seed rape (Brassica napus and during drilling of barley (Hordeum vulgare and oil seed rape flowering white mustard (Sinapis alba was adjacent. The amount of residues in the adjacent non crop areas in Petri dishes being distributed on the bare soil declined only slowly from 1 to 20 m distance from the area drilled. Seed batches with more abrasion and higher content of active substances in the dust resulted in higher residues off crop. After drilling of maize in four experiments in Petri dishes in adjacent non crop areas in 1-5 m distance between 0.02 and 0.40 g a.s./ha of neonicotinoids and in the adjacent oil seed rape a total of 0.05–0.80 g a.s./ha were detected. After drilling oil seed rape or barley these values were only 0.02–0.06 g a.s./ha in Petri dishes in non crop areas and 0.03-0.08 g a.s./ha in total in adjacent white mustard. In gauze net samplers installed vertically in 3 m distance in non crop areas up to seven times higher values were detected compared to Petri dishes.
Polymorphic light eruption and skin cancer prevalence: is one protective against the other?
LENUS (Irish Health Repository)
Lembo, S
2008-12-01
Ultraviolet (UV) radiation (UVR) interacts with chromophores in cutaneous cells with consequent antigenicity. The normal response to this is a downregulation of immune responsiveness. Failure of the immune system to downregulate and to ignore transient photoantigens in human skin results in polymorphic light eruption (PLE), the commonest of the photodermatoses. UVR initiates and promotes skin cancer (SC): UV-induced immunosuppression permits the expansion of UV-mutated clones of cells which ultimately lead to SC.
Skin dosimetry - radiological protection aspects of skin dosimetry
International Nuclear Information System (INIS)
Dennis, J.A.
1991-01-01
Following a Workshop in Skin Dosimetry, a summary of the radiological protection aspects is given. Aspects discussed include routine skin monitoring and dose limits, the need for careful skin dosimetry in high accidental exposures, techniques for assessing skin dose at all relevant depths and the specification of dose quantities to be measured by personal dosemeters and the appropriate methods to be used in their calibration. (UK)
DEFF Research Database (Denmark)
Kring Tannert, Line; Stahl Skov, Per; Bjerremann Jensen, Louise
2012-01-01
Cold urticaria is a skin condition characterized by rapid appearance of itchy wheals and occasionally angioedema in response to cold stimulation. Antihistamines do not sufficiently protect all patients from symptoms, even when used in higher than standard doses. In these patients, desensitization...
Establishment of Demodex canis on canine skin engrafted onto scid-beige mice.
Caswell, J L; Yager, J A; Barta, J R; Parker, W
1996-12-01
A small animal model of canine demodicosis is described. Normal canine skin was engrafted onto scid (severe combined immunodeficient)-beige mice, which lack functional B and T lymphocytes and have reduced natural killer cell activity. The xenografts were later infected with Demodex canis collected from a dog with demodicosis. At 30-112 days following infection, mites were seen histologically in the canine hair follicles of the engrafted skin. Demodex canis adults, nymphs, larvae, and eggs were present in samples macerated in sodium hydroxide. Mite infestations could not be demonstrated in the mouse skin, nor were mites passed from the infected graft to uninfected skin grafts on in-contact mice. This model may be utilized to assess the efficacy of miticidal treatments, to evaluate the importance of specific components of the immune response, and to study the biology of D. canis.
Tosi, Isabella; Grys, Katarzyna; Sreeneebus, Hemawtee; Perera, Gayathri K; Chapman, Anna; Smith, Catherine H; Di Meglio, Paola; Nestle, Frank O
2013-01-01
Innate lymphoid cells (ILC) are increasingly appreciated as key regulators of tissue immunity. However, their role in human tissue homeostasis and disease remains to be fully elucidated. Here we characterise the ILC in human skin from healthy individuals and from the inflammatory skin disease psoriasis. We show that a substantial proportion of IL-17A and IL-22 producing cells in skin and blood of normal individuals and psoriasis patients are CD3 negative innate lymphocytes. Deep immunophenotyping of human ILC subsets showed a statistically significant increase in the frequency of circulating NKp44+ ILC3 in blood of psoriasis patients compared to healthy individuals or atopic dermatitis patients. More than 50% of circulating NKp44+ ILC3 expressed cutaneous lymphocyte-associated antigen indicating their potential for skin homing. Analysis of skin tissue revealed a significantly increased frequency of total ILC in skin compared to blood. Moreover the frequency of NKp44+ ILC3 was significantly increased in non-lesional psoriatic skin compared to normal skin. A detailed time course of a psoriasis patient treated with anti-TNF showed a close association between therapeutic response, decrease in inflammatory skin lesions, and decrease of circulating NKp44+ ILC3. Overall, data from this initial observational study suggest a potential role for NKp44+ ILC3 in psoriasis pathogenesis. PMID:24352038
Immunohistochemical analysis of the distribution of desmoglein 1 and 2 in the skin of dogs and cats.
Miragliotta, Vincenzo; Coli, Alessandra; Ricciardi, Maria P; Podestà, Adriano; Abramo, Francesca
2005-11-01
To compare the distribution of desmoglein (Dsg) 1 and 2 in skin specimens obtained from dogs and cats to provide information about the possible role of the density of Dsg 1 and 2 in the localization of lesions attributable to pemphigus foliaceus in these 2 species. Skin biopsy specimens obtained from 4 dogs and 4 cats. Biopsy specimens were collected from the muzzle, bridge of the nose, ear, dorsum, abdomen, area adjacent to the teats, and footpads of each animal. Immunohistochemical analysis was performed on formalin-fixed, paraffin-embedded skin samples by use of a biotinylated mouse monoclonal anti-Dsg 1 and 2 antibody raised against bovine muzzle. Color development was performed by use of the streptavidin-biotin-peroxidase method with a chromogenic substrate. Immunohistochemical staining yielded a positive reaction in skin samples obtained from all anatomic sites. The intensity and distribution of staining were related to the number of layers of the stratum spinosum. No differences were detected between samples obtained from dogs and cats. No differences in intensity of Dsg 1 and 2 antigen were observed in the stratum spinosum between skin samples obtained from dogs and cats. Analysis of this result suggests that factors other than the distribution of Dsg may be responsible for the differences in localization of primary clinical lesions in dogs and cats with pemphigus foliaceus.
Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...
Energy Technology Data Exchange (ETDEWEB)
Noriega, David C., E-mail: dcnoriega1970@gmail.com [Valladolid University Hospital, Spine Department (Spain); Marcia, Stefano, E-mail: stemarcia@gmail.com [SS. Trinità Hospital ASL 8 Cagliari, Department of Radiology (Italy); Ardura, Francisco, E-mail: fardura@ono.com [Valladolid University Hospital, Spine Department (Spain); Lite, Israel Sanchez, E-mail: israelslite@hotmail.com [Valladolid University Hospital, Radiology Department (Spain); Marras, Mariangela, E-mail: mariangela.marrasmd@gmail.com [Azienda Ospedaliero Brotzu (A.O.B.), Department of Radiology (Italy); Saba, Luca, E-mail: lucasaba@tiscali.it [Azienda Ospedaliero Universitaria (A.O.U.), Department of Radiology (Italy)
2016-09-15
ObjectiveThe purpose of this study was to assess, by the mean apparent diffusion coefficient (ADC), if a relationship exists between disc ADC and MR findings of adjacent disc degeneration after thoracolumbar fractures treated by anatomic reduction using vertebral augmentation (VAP).Materials and MethodsTwenty non-consecutive patients (mean age 50.7 years; range 45–56) treated because of vertebral fractures, were included in this study. There were 10 A3.1 and 10 A1.2 fractures (AO classification). Surgical treatment using VAP was applied in 14 cases, and conservative in 6 patients. MRI T2-weighted images and mapping of apparent diffusion coefficient (ADC) of the intervertebral disc adjacent to the fractured segment were performed after a mean follow-up of 32 months. A total of 60 discs, 3 per patient, were analysed: infra-adjacent, supra-adjacent and a control disc one level above the supra-adjacent.ResultsNo differences between patients surgically treated and those following a conservative protocol regarding the average ADC values obtained in the 20 control discs analysed were found. Considering all discs, average ADC in the supra-adjacent level was lower than in the infra-adjacent (1.35 ± 0.12 vs. 1.53 ± 0.06; p < 0.001). Average ADC values of the discs used as a control were similar to those of the infra-adjacent level (1.54 ± 0.06). Compared to surgically treated patients, discs at the supra-adjacent fracture level showed statistically significant lower values in cases treated conservatively (p < 0.001). The variation in the delay of surgery had no influence on the average values of ADC at any of the measured levels.ConclusionsADC measurements of the supra-adjacent discs after a mean follow-up of 32 months following thoracolumbar fractures, showed that restoration of the vertebral collapse by minimally invasive VAP prevents posttraumatic disc degeneration.
Heterogeneous Stem Cells in Skin Homeostatis and Wound Repair
Directory of Open Access Journals (Sweden)
Anna Meilana
2015-08-01
Full Text Available BACKGROUND: The skin protects mammals from insults, infection and dehydration and enables thermoregulation and sensory perception. Various skin-resident cells carry out these diverse functions. Constant turnover of cells and healing upon injury necessitate multiple reservoirs of stem cells. The skin is a complex organ harboring several distinct populations of stem cells and a rich array of cell types. Advances in genetic and imaging tools have brought new findings about the lineage relationships between skin stem cells and their progeny. Such knowledge may offer novel avenues for therapeutics and regenerative medicine. CONTENT: In the past years, our view of the mechanisms that govern skin homeostasis and regeneration have markedly changed. New populations of stem cells have been identified that behave spatio-temporally differently in healthy tissues and in situations of damage, indicating that a great level of stem cell heterogeneity is present in the skin. There are believed to be distinct populations of stem cells in different locations. The lineages that they feed are normally constrained by signals from their local environment, but they can give rise to all epidermal lineages in response to appropriate stimuli. Given the richness of structures such as blood vessels, subcutaneous fat, innervation and the accumulation of fibroblasts under the upper parts of the rete ridges (in the case of human skin, it is reasonable to speculate that the microenvironment might be essential for interfollicular epidermal homeostasis. The bloodstream is probably the main source of long-range signals reaching the skin, and cues provided by the vascular niche might be essential for skin homeostasis. SUMMARY: A key function of the interfollicular epidermis is to act as a protective interface between the body and the external environment, and it contains several architectural elements that enable it to fulfill this function. All elements of the epidermis play
Merkel cells are long-lived cells whose production is stimulated by skin injury✰
Wright, Margaret C.; Logan, Gregory J.; Bolock, Alexa M.; Kubicki, Adam C.; Hemphill, Julie A.; Sanders, Timothy A.; Maricich, Stephen M.
2017-01-01
Mechanosensitive Merkel cells are thought to have finite lifespans, but controversy surrounds the frequency of their replacement and which precursor cells maintain the population. We found by embryonic EdU administration that Merkel cells undergo terminal cell division in late embryogenesis and survive long into adulthood. We also found that new Merkel cells are produced infrequently during normal skin homeostasis and that their numbers do not change during natural or induced hair cycles. In contrast, live imaging and EdU experiments showed that mild mechanical injury produced by skin shaving dramatically increases Merkel cell production. We confirmed with genetic cell ablation and fate-mapping experiments that new touch dome Merkel cells in adult mice arise from touch dome keratinocytes. Together, these independent lines of evidence show that Merkel cells in adult mice are long-lived, are replaced rarely during normal adult skin homeostasis, and that their production can be induced by repeated shaving. These results have profound implications for understanding sensory neurobiology and human diseases such as Merkel cell carcinoma. PMID:27998808
Merkel cells are long-lived cells whose production is stimulated by skin injury.
Wright, Margaret C; Logan, Gregory J; Bolock, Alexa M; Kubicki, Adam C; Hemphill, Julie A; Sanders, Timothy A; Maricich, Stephen M
2017-02-01
Mechanosensitive Merkel cells are thought to have finite lifespans, but controversy surrounds the frequency of their replacement and which precursor cells maintain the population. We found by embryonic EdU administration that Merkel cells undergo terminal cell division in late embryogenesis and survive long into adulthood. We also found that new Merkel cells are produced infrequently during normal skin homeostasis and that their numbers do not change during natural or induced hair cycles. In contrast, live imaging and EdU experiments showed that mild mechanical injury produced by skin shaving dramatically increases Merkel cell production. We confirmed with genetic cell ablation and fate-mapping experiments that new touch dome Merkel cells in adult mice arise from touch dome keratinocytes. Together, these independent lines of evidence show that Merkel cells in adult mice are long-lived, are replaced rarely during normal adult skin homeostasis, and that their production can be induced by repeated shaving. These results have profound implications for understanding sensory neurobiology and human diseases such as Merkel cell carcinoma. Copyright © 2016 Elsevier Inc. All rights reserved.
Microscopic contact area and friction between medical textiles and skin.
Derler, S; Rotaru, G-M; Ke, W; El Issawi-Frischknecht, L; Kellenberger, P; Scheel-Sailer, A; Rossi, R M
2014-10-01
The mechanical contact between medical textiles and skin is relevant in the health care for patients with vulnerable skin or chronic wounds. In order to gain new insights into the skin-textile contact on the microscopic level, the 3D surface topography of a normal and a new hospital bed sheet with a regular surface structure was measured using a digital microscope. The topographic data was analysed concerning material distribution and real contact area against smooth surfaces as a function of surface deformations. For contact conditions that are relevant for the skin of patients lying in a hospital bed it was found that the order of magnitude of the ratio of real and apparent contact area between textiles and skin or a mechanical skin model lies between 0.02 and 0.1 and that surface deformations, i.e. penetration of the textile surface asperities into skin or a mechanical skin model, range from 10 to 50µm. The performed analyses of textile 3D surface topographies and comparisons with previous friction measurement results provided information on the relationship between microscopic surface properties and macroscopic friction behaviour of medical textiles. In particular, the new bed sheet was found to be characterised by a trend towards a smaller microscopic contact area (up to a factor of two) and by a larger free interfacial volume (more than a factor of two) in addition to a 1.5 times lower shear strength when in contact with counter-surfaces. The applied methods can be useful to develop improved and skin-adapted materials and surfaces for medical applications. Copyright © 2014 Elsevier Ltd. All rights reserved.
Artificial skin and patient simulator comprising the artificial skin
2011-01-01
The invention relates to an artificial skin (10, 12, 14), and relates to a patient simulator (100) comprising the artificial skin. The artificial skin is a layered structure comprising a translucent cover layer (20) configured for imitating human or animal skin, and comprising a light emitting layer
DEFF Research Database (Denmark)
Skov, Lone; Hansen, Henrik; Barker, J. N.
1997-01-01
Ultraviolet-B (UVB), in addition to direct effects on DNA, induces immunological changes in the skin that predispose to the development of skin cancer. Whether ultraviolet-A (UVA) induces similar changes is unknown. This effect can be investigated in humans in vivo using epicutaneous antigens...... as a model of tumour antigens. Volunteers (n = 46) were randomly assigned to received no sensitization, sensitization with the allergen diphenylcyclopropenone (DPCP) on non-UV-exposed normal skin, or sensitization with DPCP on skin exposed to three minimal erythema doses (MED) of either UVA or UVB radiation...... the immunization rate compared with sensitization on non-irradiated skin (P UVA radiation did not result in a decreased immunization rate compared with non-irradiated skin. These results indicate that in humans erythemagenic...
Early skin tumor detection from microscopic images through image processing
International Nuclear Information System (INIS)
Siddiqi, A.A.; Narejo, G.B.; Khan, A.M.
2017-01-01
The research is done to provide appropriate detection technique for skin tumor detection. The work is done by using the image processing toolbox of MATLAB. Skin tumors are unwanted skin growth with different causes and varying extent of malignant cells. It is a syndrome in which skin cells mislay the ability to divide and grow normally. Early detection of tumor is the most important factor affecting the endurance of a patient. Studying the pattern of the skin cells is the fundamental problem in medical image analysis. The study of skin tumor has been of great interest to the researchers. DIP (Digital Image Processing) allows the use of much more complex algorithms for image processing, and hence, can offer both more sophisticated performance at simple task, and the implementation of methods which would be impossibly by analog means. It allows much wider range of algorithms to be applied to the input data and can avoid problems such as build up of noise and signal distortion during processing. The study shows that few works has been done on cellular scale for the images of skin. This research allows few checks for the early detection of skin tumor using microscopic images after testing and observing various algorithms. After analytical evaluation the result has been observed that the proposed checks are time efficient techniques and appropriate for the tumor detection. The algorithm applied provides promising results in lesser time with accuracy. The GUI (Graphical User Interface) that is generated for the algorithm makes the system user friendly. (author)
Flexible and fragmentable tandem photosensitive nanocrystal skins
Akhavan, S.; Uran, C.; Bozok, B.; Gungor, K.; Kelestemur, Y.; Lesnyak, V.; Gaponik, N.; Eychmüller, A.; Demir, H. V.
2016-02-01
We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of single monolayers of colloidal water-soluble CdTe and CdHgTe nanocrystals (NCs) in adjacent junctions on a Kapton polymer tape. Owing to the usage of a single NC layer in each junction, noise generation was significantly reduced while keeping the resulting PNS films considerably transparent. In each junction, photogenerated excitons are dissociated at the interface of the semi-transparent Al electrode and the NC layer, with holes migrating to the contact electrode and electrons trapped in the NCs. As a result, the tandem PNSs lead to an open-circuit photovoltage buildup equal to the sum of those of the two single junctions, exhibiting a total voltage buildup of 128.4 mV at an excitation intensity of 75.8 μW cm-2 at 350 nm. Furthermore, we showed that these flexible PNSs could be bent over 3.5 mm radius of curvature and cut out in arbitrary shapes without damaging the operation of individual parts and without introducing any significant loss in the total sensitivity. These findings indicate that the NC skins are promising as building blocks to make low-cost, flexible, large-area UV/visible sensing platforms with highly efficient full-spectrum conversion.We proposed and demonstrated the first account of large-area, semi-transparent, tandem photosensitive nanocrystal skins (PNSs) constructed on flexible substrates operating on the principle of photogenerated potential buildup, which avoid the need for applying an external bias and circumvent the current-matching limitation between junctions. We successfully fabricated and operated the tandem PNSs composed of
International Nuclear Information System (INIS)
Kobayashi, K.
1977-01-01
Mitotic activity of normal (unwounded) and wounded skin was measured in the control (nonirradiated) and whole-body or partial-body x-irradiated mouse. Higher mitotic activity in the anterior than in the posterior region of the body was found in both the normal and the wounded skin of the control mouse. Whole-body irradiation (500 R) depressed completely the mitotic activity of normal skin 2 to 4 days after irradiation. In spite of this depression in mitotic activity, a surgical incision made 1 to 3 days after irradiation could induce a burst of proliferation after an inhibition of an initial mitosis increase. When the animals were partially irradiated with 500 R 3 days before wounding, it was shown that mitosis at 24 hr after wounding was inhibited markedly by the local effect of irradiation and that mitosis also could be inhibited diversely by the abscopal effect of irradiation. Because of a close similarity of sequential mitotic patterns between whole-body-irradiated and flapped-skin-only-irradiated groups (direct irradiation), the effect of irradiation upon mitosis was considered to be primarily local. Some discussions were made concerning the possible reasons which made a difference in mitotic patterns between the head-only-irradiated group, the irradiated group including the head and other parts of the body except for the skin flap
19 CFR 12.63 - Seal-skin or sea-otter-skin waste.
2010-04-01
... 19 Customs Duties 1 2010-04-01 2010-04-01 false Seal-skin or sea-otter-skin waste. 12.63 Section... OF THE TREASURY SPECIAL CLASSES OF MERCHANDISE Fur-Seal Or Sea-Otter Skins § 12.63 Seal-skin or sea-otter-skin waste. Seal-skin or sea-otter-skin waste composed of small pieces not large enough to be...
International Nuclear Information System (INIS)
Duncan, H.J.; Faris, I.B.
1986-01-01
1. A simplified isotope (sup(99m)Tc) washout technique has been devised to calculate the skin perfusion pressure (SPP) and skin vascular resistance (SVR). This test is simple, requires inexpensive equipment and is well tolerated by patients. 2. SPP and SVR were calculated in 20 patients 30 years of age and in 15 patients with peripheral vascular disease (PVD). With increasing age the SPP and SVP were increased. The SPP was similar to the mean arterial pressure in normal individuals but was decreased in patients with PVD. The SPP is a useful indicator of the severity of the PVD. 3. The SPP and SVR were higher in the calf than in the foot. This is probably related to the decrease in pressure in the distal arterial tree. 4. SPP was increased by 110% and skin blood flow by 190% by arterial reconstructive surgery. This test may be of use in assessing the effectiveness of arterial surgery. (author)
DEFF Research Database (Denmark)
Pedersen, Tanja Xenia; Leethanakul, Chidchanop; Patel, Vyomesh
2003-01-01
keratinocytes from incisional mouse skin wounds and adjacent normal skin keratinocytes. Changes in gene expression were determined by comparative cDNA array analyses, and the approach was validated by in situ hybridization. The analyses identified 48 candidate genes not previously associated with wound...... reepithelialization. Furthermore, the analyses revealed that the phenotypic resemblance of wound keratinocytes to squamous cell carcinoma is mimicked at the level of gene expression, but notable differences between the two tissue-remodeling processes were also observed. The combination of laser capture...
Mowla, Alireza; Taimre, Thomas; Lim, Yah L.; Bertling, Karl; Wilson, Stephen J.; Prow, Tarl W.; Soyer, H. P.; Rakić, Aleksandar D.
2016-04-01
We propose a compact, self-aligned, low-cost, and versatile infrared diffuse-reflectance laser imaging system using a laser feedback interferometry technique with possible applications in in vivo biological tissue imaging and skin cancer detection. We examine the proposed technique experimentally using a three-layer agar skin phantom. A cylindrical region with a scattering rate lower than that of the surrounding normal tissue was used as a model for a non-melanoma skin tumour. The same structure was implemented in a Monte Carlo computational model. The experimental results agree well with the Monte Carlo simulations validating the theoretical basis of the technique. Results prove the applicability of the proposed technique for biological tissue imaging, with the capability of depth sectioning and a penetration depth of well over 1.2 mm into the skin phantom.
Skin absorption through atopic dermatitis skin
DEFF Research Database (Denmark)
Halling-Overgaard, A-S; Kezic, S; Jakasa, I
2017-01-01
Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...
Chen, Defu; Ren, Jie; Wang, Ying; Gu, Ying
2014-11-01
Vascular-targeted photodynamic therapy (V-PDT) is known to be an effective therapeutic modality for the treatment of port wine stains (PWS). Monitoring the PWS microvascular response to the V-PDT is crucial for improving the effectiveness of PWS treatment. The objective of this study was to use laser Doppler technique to directly assess the skin perfusion in PWS before and during V-PDT. In this study, 30 patients with PWS were treated with V-PDT. A commercially laser Doppler line scanner (LDLS) was used to record the skin perfusion of PWS immediately before; and at 1, 3, 5, 7, 10, 15 and 20 minutes during V-PDT treatment. Our results showed that there was substantial inter- and intra-patient perfusion heterogeneity in PWS lesion. Before V-PDT, the comparison of skin perfusion in PWS and contralateral healthy control normal skin indicated that PWS skin perfusion could be larger than, or occasionally equivalent to, that of control normal skin. During V-PDT, the skin perfusion in PWS significantly increased after the initiation of V-PDT treatment, then reached a peak within 10 minutes, followed by a slowly decrease to a relatively lower level. Furthermore, the time for reaching peak and the subsequent magnitude of decrease in skin perfusion varied with different patients, as well as different PWS lesion locations. In conclusion, the LDLS system is capable of assessing skin perfusion changes in PWS during V-PDT, and has potential for elucidating the mechanisms of PWS microvascular response to V-PDT.
... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...
Large-proportional shrunken bio-replication of shark skin based on UV-curing shrinkage
International Nuclear Information System (INIS)
Chen, Huawei; Che, Da; Zhang, Xin; Yue, Yue; Zhang, Deyuan
2015-01-01
The shark skin effect has attracted worldwide attention because of its superior drag reduction. As the product of natural selection, the maximum drag reduction of shark skin is found in its normal living environment. Large-proportional shrinkage of shark skin morphology is greatly anticipated for its adaptation to faster fluid flow. One novel approach, large-proportional shrunken bio-replication, is proposed as a method to adjust the optimal drag reduction region of shark skin based on the shrinkage of UV-cured material. The shark skin is taken as a replica template to allow large-proportional shrinking in the drag reduction morphology by taking advantage of the shrinkage of UV-curable material. The accuracy of the large-proportional shrunken bio-replication approach is verified by a comparison between original and shrunken bio-replicated shark skin, which shows that the shrinking ratio can reach 23% and the bio-replication accuracy is higher than 95%. In addition, the translation of the optimum drag reduction peak of natural surface function to various applications and environments is proved by drag reduction experiments. (technical note)
Benefits of optical coherence tomography for imaging of skin diseases
Directory of Open Access Journals (Sweden)
Utz S.R.
2015-09-01
Full Text Available Aim: working out the methods of visualization of information obtained during optical coherent tomography in normal skin and in series of inflammatory disorders. Materials and Methods. OCS1300SS (made in Thorlabs, USA was used in which the source of emission of radiation was a super-luminiscent diode with mean wavelength of 1325 nm. 12 patients with different skin conditions and 5 virtually healthy volunteers were examined with ОСТ procedure in OPD and IPD settings. High resolution USG numerical system DUB (TPM GmbH, Germany was used for comparative USG assessment. Results. ОСТ demonstrated considerably more detailed picture of the objects scanned compared to USG investigation. Image obtained with the help of ОСТ contains vital information about sizes of macro-morphological elements, status of vascular elements and their density in different depths of the skin. Conclusion. Additional results obtained from ОСТ of the skin lesions in plane section improves attraction for ОСТ in practical dermatology.
Leite-Silva, Vânia R; Liu, David C; Sanchez, Washington Y; Studier, Hauke; Mohammed, Yousuf H; Holmes, Amy; Becker, Wolfgang; Grice, Jeffrey E; Benson, Heather Ae; Roberts, Michael S
2016-05-01
We assessed the effects of flexing and massage on human skin penetration and toxicity of topically applied coated and uncoated zinc oxide nanoparticles (˜75 nm) in vivo. Noninvasive multiphoton tomography with fluorescence lifetime imaging was used to evaluate the penetration of nanoparticles through the skin barrier and cellular apoptosis in the viable epidermis. All nanoparticles applied to skin with flexing and massage were retained in the stratum corneum or skin furrows. No significant penetration into the viable epidermis was seen and no cellular toxicity was detected. Exposure of normal in vivo human skin to these nanoparticles under common in-use conditions of flexing or massage is not associated with significant adverse events.
International Nuclear Information System (INIS)
Kiger, S.W. III; Micca, P.L.; Morris, G.M.; Coderre, J.A.
2002-01-01
Clinical trials of boron neutron capture therapy (BNCT) for intracranial tumours using boronphenylalanine-fructose undertaken at Harvard-MIT and Brookhaven National Laboratory have observed acute normal tissue reactions in the skin and oral mucosa. Because the range of the 10 B(n,a) 7 Li reaction products is very short, 10-14 μm combined, knowledge of the 10B microdistribution in tissue is critical for understanding the microdosimetry and radiobiology of BNCT. This paper reports measurements of the microdistribution of 10 B in an animal model, rat skin and tongue, using high resolution quantitative autoradiography (HRQAR), a neutron-induced track etch autoradiographic technique. The steep spatial gradient and high absolute value relative to blood of the 10 B concentration observed in some strata of the rat tongue epithelium and skin are important for properly evaluating the radiobiology and the biological effectiveness factors for normal tissue reactions such as oral mucositis, which are generally assessed using the blood boron concentration rather than the tissue boron concentration. (author)
Linares, Miguel A; Zakaria, Alan; Nizran, Parminder
2015-12-01
Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.
Electrospun Poly(lactic acid-co-glycolic acid) Scaffolds for Skin Tissue Engineering
Kumbar, Sangamesh G.; Nukavarapu, Syam Prasad; James, Roshan; Nair, Lakshmi S.; Laurencin, Cato T.
2008-01-01
Electrospun fiber matrices composed of scaffolds of varying fiber diameters were investigated for potential application of severe skin loss. Few systematic studies have been performed to examine the effect of varying fiber diameter electrospun fiber matrices for skin regeneration. The present study reports the fabrication of poly[lactic acid-co-glycolic acid] (PLAGA) matrices with fiber diameters of 150–225, 200–300, 250–467, 500–900, 600–1200, 2500–3000 and 3250–6000 nm via electrospinning. All fiber matrices found to have a tensile modulus from 39.23 ± 8.15 to 79.21 ± 13.71 MPa which falls in the range for normal human skin. Further, the porous fiber matrices have porosity between 38–60 % and average pore diameters between 10–14µm. We evaluated the efficacy of these biodegradable fiber matrices as skin substitutes by seeding them with human skin fibroblasts (hSF). Human skin fibroblasts acquired a well spread morphology and showed significant progressive growth on fiber matrices in the 350–1100 nm diameter range. Collagen type III gene expression was significantly up-regulated in hSF seeded on matrices with fiber diameters in the range of 350–1100 nm. Based on the need, the proposed fiber skin substitutes can be successfully fabricated and optimized for skin fibroblast attachment and growth. PMID:18639927
Moist skin care can diminish acute radiation-induced skin toxicity
International Nuclear Information System (INIS)
Momm, F.; Weissenberger, C.; Bertelt, S.; Henke, M.
2003-01-01
Background: Radiation treatment may induce acute skin reactions. There are several methods of managing them. Validity of these methods, however, is not sufficiently studied. We therefore investigated, whether moist skin care with 3% urea lotion will reduce acute radiation skin toxicity. Patients and Methods: 88 patients with carcinomas of the head and neck undergoing radiotherapy with curative intent (mean total dose 60 Gy, range: 50-74 Gy) were evaluated weekly for acute skin reactions according to the RTOG-CTC score. In 63 patients, moist skin care with 3% urea lotion was performed. The control group consisted of 25 patients receiving conventional dry skin care. The incidence of grade I, II, and III reactions and the radiation dose at occurrence of a particular reaction were determined and statistically analyzed using the log-rank test. The dose-time relations of individual skin reactions are described. Results: At some point of time during radiotherapy, all patients suffered from acute skin reactions grade I, > 90% from grade II reactions. 50% of patients receiving moist skin care experienced grade I reactions at 26 Gy as compared to 22 Gy in control patients (p = 0.03). Grade II reactions occurred at 51 Gy versus 34 Gy (p = 0.006). Further, 22% of the patients treated with moist skin care suffered from acute skin toxicity grade III as compared to 56% of the controls (p = 0.0007). Conclusion: Moist skin care with 3% urea lotion delays the occurrence and reduces the grade of acute skin reactions in percutaneously irradiated patients with head and neck tumors. (orig.)
Fluvastatin as a micropore lifetime enhancer for sustained delivery across microneedle-treated skin.
Ghosh, Priyanka; Brogden, Nicole K; Stinchcomb, Audra L
2014-02-01
Microneedles (MNs), a physical skin permeation enhancement technique, facilitate drug delivery across the skin, thus enhancing the number of drugs that can be delivered transdermally in therapeutically relevant concentrations. The micropores created in the skin by MNs reseal because of normal healing processes of the skin, thus limiting the duration of the drug delivery window. Pore lifetime enhancement strategies can increase the effectiveness of MNs as a drug delivery mechanism by prolonging the delivery window. Fluvastatin (FLU), a HMGCoA reductase inhibitor, was used in this study to enhance the pore lifetime by inhibiting the synthesis of cholesterol, a major component of the stratum corneum lipids. The study showed that using FLU as a pretreatment it is possible to enhance the pore lifetime of MN-treated skin and thus allow for sustained drug delivery. The skin recovered within a 30-45-min time period following the removal of occlusion, and there was no significant irritation observed due to the treatment compared to the control sites. Thus, it can be concluded that localized skin treatment with FLU can be used to extend micropore lifetime and deliver drugs for up to 7 days across MN-treated skin. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Bancelin, Stéphane; Lynch, Barbara; Bonod-Bidaud, Christelle; Ducourthial, Guillaume; Psilodimitrakopoulos, Sotiris; Dokládal, Petr; Allain, Jean-Marc; Schanne-Klein, Marie-Claire; Ruggiero, Florence
2015-12-01
Soft connective tissues such as skin, tendon or cornea are made of about 90% of extracellular matrix proteins, fibrillar collagens being the major components. Decreased or aberrant collagen synthesis generally results in defective tissue mechanical properties as the classic form of Elhers-Danlos syndrome (cEDS). This connective tissue disorder is caused by mutations in collagen V genes and is mainly characterized by skin hyperextensibility. To investigate the relationship between the microstructure of normal and diseased skins and their macroscopic mechanical properties, we imaged and quantified the microstructure of dermis of ex vivo murine skin biopsies during uniaxial mechanical assay using multiphoton microscopy. We used two genetically-modified mouse lines for collagen V: a mouse model for cEDS harboring a Col5a2 deletion (a.k.a. pN allele) and the transgenic K14-COL5A1 mice which overexpress the human COL5A1 gene in skin. We showed that in normal skin, the collagen fibers continuously align with stretch, generating the observed increase in mechanical stress. Moreover, dermis from both transgenic lines exhibited altered collagen reorganization upon traction, which could be linked to microstructural modifications. These findings show that our multiscale approach provides new crucial information on the biomechanics of dermis that can be extended to all collagen-rich soft tissues.
International Nuclear Information System (INIS)
Yamada, Michiko
1992-01-01
This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)
BNCT clinical trials of skin melanoma patients in Argentina
International Nuclear Information System (INIS)
Roth, Berta M.; Bonomi, Marcelo R.; Gonzalez, Sara J.
2006-01-01
The clinical outcome of six skin melanoma BNCT irradiations is presented. Three patients (A, B and C), with multiple subcutaneous skin metastases progressed to chemotherapy were infused with ∼14 g/m 2 of boronophenylalanine ( 10 BPA)-fructose and irradiated in the hyperthermal neutron beam of the RA-6 reactor. Patient A received two one fraction irradiations in different areas of the leg, B received one fraction and C was irradiated in three consecutive fields at the calf, heel and foot sole. The maximum prescribed dose to normal skin ranged from 16.5 to 24 Gy-Eq. With a minimum follow-up of 10 months there was a G1 acute epithelitis in A and B and a G3 in C. No late toxicity was observed. Due to the in-field tumor-growth-delay and the absence of severe acute and/or late toxicity observed during the follow-up period, a dose-escalation trial is ongoing. (author)
Late nonstochastic changes in pig skin after β irradiation
International Nuclear Information System (INIS)
Peel, D.M.; Hopewell, J.W.; Wells, J.; Charles, M.W.
1985-01-01
Late radiation-induced changes in pig skin have been assessed following irradiation with β-rays from a 22.5- or 15-mm-diameter 90 Sr/ 90 Y source and a 19- or 9-mm-diameter 170 Tm source. Late damage, in terms of dermal atrophy, was assessed 2 years after irradiation from measurements of dermal thickness of 40-50% of the control value, occurred at a dose of approx. 40 Gy from the 22.5-mm source and approx. 75 Gy from the 15-mm source. In the case of 170 Tm the 19- and 9-mm sources produced similar degrees of atrophy at equal doses. Maximum atrophy occurred at approx. 70 Gy, when the dermis was approx. 70% of the thickness of normal skin. Significant late tissue atrophy was seen at doses, from both types of radiation, which only produced minimal erythema in the early reaction. Such late reactions need to be taken into account when revised radiological protection criteria are proposed for skin
DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.
Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim
2017-12-01
In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.
Active compliant wall for skin friction reduction
International Nuclear Information System (INIS)
Pätzold, A.; Peltzer, I.; Nitsche, W.; Goldin, N.; King, R.; Haller, D.; Woias, P.
2013-01-01
Highlights: • Objective: Delay of laminar-turbulent transition on a wing by active wall actuation. • Natural, convective TS-instabilities are damped by travelling counter waves. • Piezo driven active wall and model predictive controller were developed. • TS amplitudes were damped by 83.6% (equals 15.7 dB within instability band). • Significant effect on skin friction distribution. -- Abstract: In order to reduce skin friction drag, an active laminarisation method is developed. Laminar-turbulent boundary layer transition caused by Tollmien–Schlichting (TS) waves is delayed by attenuation of these convective instabilities. An actively driven compliant wall is integrated as part of a wing’s surface. Different configurations of piezo-based actuators are combined with an array of sensitive surface flow sensors. Wall-normal actuation as well as inclined wall displacement are investigated. Together with a realtime-control strategy, transition onset is shifted downstream by six average TS-wave lengths. Using the example of flow velocity, the influence of variable flow conditions on TS-damping rates was investigated. Besides, the boundary layer flow downstream of the active wall area as well as required wall deflections and the global damping effect on skin friction are presented in this paper
Spin Hall magnetoresistance in antiferromagnet/normal metal bilayers
Manchon, Aurelien
2017-01-01
We investigate the emergence of spin Hall magnetoresistance in a magnetic bilayer composed of a normal metal adjacent to an antiferromagnet. Based on a recently derived drift diffusion equation, we show that the resistance of the bilayer depends on the relative angle between the direction transverse to the current flow and the Néel order parameter. While this effect presents striking similarities with the spin Hall magnetoresistance recently reported in ferromagnetic bilayers, its physical origin is attributed to the anisotropic spin relaxation of itinerant spins in the antiferromagnet.
Skin temperature during sunbathing--relevance for skin cancer
DEFF Research Database (Denmark)
Petersen, Bibi; Philipsen, Peter Alshede; Wulf, Hans Christian
2014-01-01
It has been found that exposure to heat and infrared radiation (IR) can be carcinogenic, and that a combination of ultraviolet radiation (UVR) and IR possibly amplifies carcinogenesis. To investigate how the skin temperature is affected by sunbathing, we measured the skin temperature on 20 healthy...... volunteers over 6 days' sun holiday in Egypt. Temperatures were measured with an infrared thermometer gun at 8 skin sites on the volunteers while they were indoors in the morning and when sunbathing during the day. Skin temperatures were higher during sunbathing (33.5 °C ± 2.1 °C) (mean ± SD) than when...... indoors in the morning (32.6 °C ± 1.4 °C) (mean ± SD) (P skin temperature for men was higher than for women by 0.40 °C in the morning (P = 0.02) and by 0.44 °C during sunbathing (P skin temperature, which possibly...
Kikuchi, Kumiko; Masuda, Yuji; Yamashita, Toyonobu; Kawai, Eriko; Hirao, Tetsuji
2015-05-01
Heterogeneity with respect to skin color tone is one of the key factors in visual perception of facial attractiveness and age. However, there have been few studies on quantitative analyses of the color heterogeneity of facial skin. The purpose of this study was to develop image evaluation methods for skin color heterogeneity focusing on skin chromophores and then characterize ethnic differences and age-related changes. A facial imaging system equipped with an illumination unit and a high-resolution digital camera was used to develop image evaluation methods for skin color heterogeneity. First, melanin and/or hemoglobin images were obtained using pigment-specific image-processing techniques, which involved conversion from Commission Internationale de l'Eclairage XYZ color values to melanin and/or hemoglobin indexes as measures of their contents. Second, a spatial frequency analysis with threshold settings was applied to the individual images. Cheek skin images of 194 healthy Asian and Caucasian female subjects were acquired using the imaging system. Applying this methodology, the skin color heterogeneity of Asian and Caucasian faces was characterized. The proposed pigment-specific image-processing techniques allowed visual discrimination of skin redness from skin pigmentation. In the heterogeneity analyses of cheek skin color, age-related changes in melanin were clearly detected in Asian and Caucasian skin. Furthermore, it was found that the heterogeneity indexes of hemoglobin were significantly higher in Caucasian skin than in Asian skin. We have developed evaluation methods for skin color heterogeneity by image analyses based on the major chromophores, melanin and hemoglobin, with special reference to their size. This methodology focusing on skin color heterogeneity should be useful for better understanding of aging and ethnic differences. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
In-Vivo Human Skin to Textiles Friction Measurements
Pfarr, Lukas; Zagar, Bernhard
2017-10-01
We report on a measurement system to determine highly reliable and accurate friction properties of textiles as needed for example as input to garment simulation software. Our investigations led to a set-up that allows to characterize not just textile to textile but also textile to in-vivo human skin tribological properties and thus to fundamental knowledge about genuine wearer interaction in garments. The method of test conveyed in this paper is measuring concurrently and in a highly time resolved manner the normal force as well as the resulting shear force caused by a friction subject intending to slide out of the static friction regime and into the dynamic regime on a test bench. Deeper analysis of various influences is enabled by extending the simple model following Coulomb's law for rigid body friction to include further essential parameters such as contact force, predominance in the yarn's orientation and also skin hydration. This easy-to-use system enables to measure reliably and reproducibly both static and dynamic friction for a variety of friction partners including human skin with all its variability there might be.
Togsverd-Bo, Katrine; Philipsen, Peter Alshede; Hædersdal, Merete; Wulf, Hans Christian Olsen
2018-01-01
Ultraviolet radiation (UVR)-induced skin cancers varies among organ transplant recipients (OTRs). To improve individual risk assessment of skin cancer, objectively quantified skin photodamage is needed. We measured personal UVR-exposure dose in OTRs and assessed the relation between individual UVR exposure, skin cancer and objectively measured photodamage in terms of skin autofluorescence, pigmentation, and black light-evaluated solar lentigines. Danish OTRs with (n=15) and without a history of skin cancer (n=15) kept sun diaries from May to September and wore personal dosimeters recording time-stamped UVR doses in standard erythema doses (SED). Photodamage was quantified as skin autofluorescence with excitation at 370nm (F370) and 430nm (F430), skin pigmentation (pigment protection factor, PPF), and black light-evaluated solar lentigines. OTRs with skin cancer received a higher UVR dose than OTRs without skin cancer (median 116 SED vs. 67 SED, p=0.07) and UVR exposure doses were correlated with increased PPF (p=0.052) and F370 on the shoulder (F370 shoulder ) (p=0.04). We found that skin cancer was associated with F370 shoulder (OR 10.53, CI 3.3-31,938; p=0.018) and time since transplantation (OR 1.34, CI 0.95-1.91, p=0.097). A cut-off at 7.2 arbitrary units, 89% of OTRs with skin cancer had F370 shoulder values above 7.2 arbitrary units and F370 shoulder was additionally related to patient age (p=0.09) and black light-evaluated solar lentigines (p=0.04). F370 autofluorescence indicates objectively measured photodamage and may be used for individual risk assessment of skin cancer development in OTRs. Copyright © 2017. Published by Elsevier B.V.
Lower corticosteroid skin blanching response is associated with severe COPD.
Directory of Open Access Journals (Sweden)
Susan J M Hoonhorst
Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.
Directory of Open Access Journals (Sweden)
Franco Folli
2010-03-01
Full Text Available In type 1 diabetes (T1D vascular complications such as accelerated atherosclerosis and diffused macro-/microangiopathy are linked to chronic hyperglycemia with a mechanism that is not yet well understood. End-stage renal disease (ESRD worsens most diabetic complications, particularly, the risk of morbidity and mortality from cardiovascular disease is increased several fold.We evaluated protein regulation and expression in skin biopsies obtained from T1D patients with and without ESRD, to identify pathways of persistent cellular changes linked to diabetic vascular disease. We therefore examined pathways that may be normalized by restoration of normoglycemia with kidney-pancreas (KP transplantation. Using proteomic and ultrastructural approaches, multiple alterations in the expression of proteins involved in oxidative stress (catalase, superoxide dismutase 1, Hsp27, Hsp60, ATP synthase delta chain, and flavin reductase, aerobic and anaerobic glycolysis (ACBP, pyruvate kinase muscle isozyme, and phosphoglycerate kinase 1, and intracellular signaling (stratifin-14-3-3, S100-calcyclin, cathepsin, and PPI rotamase as well as endothelial vascular abnormalities were identified in T1D and T1D+ESRD patients. These abnormalities were reversed after KP transplant. Increased plasma levels of malondialdehyde were observed in T1D and T1D+ESRD patients, confirming increased oxidative stress which was normalized after KP transplant.Our data suggests persistent cellular changes of anti-oxidative machinery and of aerobic/anaerobic glycolysis are present in T1D and T1D+ESRD patients, and these abnormalities may play a key role in the pathogenesis of hyperglycemia-related vascular complications. Restoration of normoglycemia and removal of uremia with KP transplant can correct these abnormalities. Some of these identified pathways may become potential therapeutic targets for a new generation of drugs.
A study on the effect of the injected absolute ethanol and hot-saline in the normal liver of rat
International Nuclear Information System (INIS)
Rhim, Hyun Chul; Hong, Eun Kyung; Cho, On Koo; Song, Soon Young; Koh, Byung Hee; Seo, Heung Suk; Hahm, Chang Kok; Park, Hwon Kyum
1995-01-01
To compare the effect of local injection therapy with absolute ethanol and hot-saline in the normal liver of rat. An experimental study was performed with the normal liver of 52 rats. The resected livers were pathologically analyzed on three days, one week, two weeks, and four weeks after injection of 0.1 ml absolute ethanol and hot-saline. The assessment was done in view of 1) main pathologic changes on time, 2) pattern of inflammatory cell infiltration, 3) measurement of necrotic area, 4) effect on vascular and biliary tracts adjacent to necrotic area, and 5) extrahepatic peritoneal adhesion. The main pathologic changes were acute necrosis with inflammation for three days group and secondary regenerative fibrosis in all groups. The degree of necrosis was significantly more severe in absolute ethanol injection group, demonstrating larger necrotic area, than hot-saline injection group. The effect on vessels and bile ducts adjacent to the necrotic area was almost not seen in both groups. The extrahepatic peritoneal adhesion was noted in both groups, but the degree was more prominent in the absolute ethanol injection group than hot-saline injection group. Absolute ethanol is superior to hot-saline in the necrotic effect of percutaneous injection therapy. However, hot-saline could be applied in case of the borderline area between mass and adjacent normal liver or the subcapsular mass
Is skin penetration a determining factor in skin sensitization ...
Summary:Background. It is widely accepted that substances that cannot penetrate through the skin will not be sensitisers. Thresholds based on relevant physicochemical parameters such as a LogKow > 1 and a MW 1 is a true requirement for sensitisation.Methods. A large dataset of substances that had been evaluated for their skin sensitisation potential, together with measured LogKow values was compiled from the REACH database. The incidence of skin sensitisers relative to non-skin sensitisers below and above the LogKow = 1 threshold was evaluated. Results. 1482 substances with associated skin sensitisation outcomes and measured LogKow values were identified. 305 substances had a measured LogKow self-evident truth borne out from the widespread misconception that the ability to efficiently penetrate the stratum corneum is a key determinant of skin sensitisation potential and potency. Using the REACH data extracted to test out the validity of common assumptions in the skin sensitization AOP. Builds on trying to develop a proof of concept IATA
Epidemiology of "fragile skin": results from a survey of different skin types
Directory of Open Access Journals (Sweden)
Haftek M
2013-12-01
Full Text Available Marek Haftek,1 Christine Coutanceau,2 Charles Taïeb3 1Université Lyon 1, Laboratoire de Recherche Dermatologique, Faculté de Médecine et de Pharmacie, Lyon, 2Département Médical, Laboratoires Dermatologiques A-Derma, Lavaur, 3Public Health, Pierre Fabre SA, Paris, France Background: Epidemiologic information regarding the prevalence of "fragile skin" in different adult populations is currently limited. The objective of the current survey was to assess the occurrence of perceived "fragile skin" across different skin types in the general adult population. Methods: Individuals aged 15–65 years from five representative geographic regions (France, Spain, Sweden, Japan, and the US were interviewed and grouped into the following skin types: Caucasian North skin (n=1,218, Caucasian South skin (n=1,695, Asian skin (n=1,500, and Black skin (n=500. The main survey question was "In your opinion, do you have fragile skin?" Concepts relating to the nature and appearance of an individual's skin were also evaluated. Results: A total of 4,913 individuals were interviewed. Subjects in the Caucasian North, Caucasian South, Asian, and Black skin type groups responded positively to the question "In your opinion, do you have fragile skin?" in the following proportions: 24.44%, 29.71%, 52.67%, and 42.20%, respectively. With the exception of individuals in the Black skin group, "fragile skin" was prevalent in significantly more women than men (P<0.0001. Compared with other age categories, the prevalence of "fragile skin" was significantly higher in individuals aged 15–34 years (P<0.0001, regardless of skin type. In general, individuals reporting "fragile skin" were 2–3-fold more likely to respond positively to a series of questions relating to the nature and appearance of their skin. The prevalence of "fragile skin" was also higher in individuals who experienced dermatosis (skin lesions of any type in the previous 12 months. Conclusion: Whilst these
Early Verb Constructions in French: Adjacency on the Left Edge
Veneziano, Edy; Clark, Eve V.
2016-01-01
Children acquiring French elaborate their early verb constructions by adding adjacent morphemes incrementally at the left edge of core verbs. This hypothesis was tested with 2657 verb uses from four children between 1;3 and 2;7. Consistent with the Adjacency Hypothesis, children added clitic subjects frst only to present tense forms (as in…
Varkey, Mathew; Ding, Jie; Tredget, Edward E
2014-12-01
Fibrosis affects most organs, it results in replacement of normal parenchymal tissue with collagen-rich extracellular matrix, which compromises tissue architecture and ultimately causes loss of function of the affected organ. Biochemical pathways that contribute to fibrosis have been extensively studied, but the role of biomechanical signaling in fibrosis is not clearly understood. In this study, we assessed the effect keratinocytes have on the biomechanical characteristics and pore microstructure of tissue engineered skin made with superficial or deep dermal fibroblasts in order to determine any biomaterial-mediated anti-fibrotic influences on tissue engineered skin. Tissue engineered skin with deep dermal fibroblasts and keratinocytes were found to be less stiff and contracted and had reduced number of myofibroblasts and lower expression of matrix crosslinking factors compared to matrices with deep fibroblasts alone. However, there were no such differences between tissue engineered skin with superficial fibroblasts and keratinocytes and matrices with superficial fibroblasts alone. Also, tissue engineered skin with deep fibroblasts and keratinocytes had smaller pores compared to those with superficial fibroblasts and keratinocytes; pore size of tissue engineered skin with deep fibroblasts and keratinocytes were not different from those matrices with deep fibroblasts alone. A better understanding of biomechanical characteristics and pore microstructure of tissue engineered skin may prove beneficial in promoting normal wound healing over pathologic healing. Copyright © 2014 Elsevier Ltd. All rights reserved.
Borgogna, Cinzia; Lanfredini, Simone; Peretti, Alberto; De Andrea, Marco; Zavattaro, Elisa; Colombo, Enrico; Quaglia, Marco; Boldorini, Renzo; Miglio, Umberto; Doorbar, John; Bavinck, Jan N Bouwes; Quint, Koen D; de Koning, Maurits N C; Landolfo, Santo; Gariglio, Marisa
2014-08-01
The aim of this study was to determine whether detection of β-HPV gene products, as defined in epidermodysplasia verruciformis skin cancer, could also be observed in lesions from kidney transplant recipients alongside the viral DNA. A total of 111 samples, corresponding to 79 skin lesions abscised from 17 kidney transplant recipients, have been analyzed. The initial PCR analysis demonstrated that β-HPV-DNA was highly present in our tumor series (85%). Using a combination of antibodies raised against the E4 and L1 proteins of the β-genotypes, we were able to visualize productive infection in 4 out of 19 actinic keratoses, and in the pathological borders of 1 out of 14 squamous cell carcinomas and 1 out of 31 basal cell carcinomas. Increased expression of the cellular proliferation marker minichromosome maintenance protein 7 (MCM7), that extended into the upper epithelial layers, was a common feature of all the E4-positive areas, indicating that cells were driven into the cell cycle in areas of productive viral infections. Although the present study does not directly demonstrate a causal role of these viruses, the detection of E4 and L1 positivity in actinic keratosis and the adjacent pathological epithelium of skin cancer, clearly shows that β-HPV are actively replicating in the intraepidermal precursor lesions of kidney transplant recipients and can therefore cooperate with other carcinogenic agents, such as UVB, favoring skin cancer promotion.
Evaluation of trace elements contents in healthy and seborrhoeic skin samples by SRTXRF
International Nuclear Information System (INIS)
Soares, Julio C.A.C.; Anjos, Marcelino J.; Lopes, Ricardo T.
2009-01-01
The aim of this work is to evaluate the concentrations of trace elements content in seborrhoeic keratosis (SK) skin lesions as well in normal skin and compare them. These data was acquired by Synchrotron Radiation Total Reflection X-ray Fluorescence (SRTXRF). It focused elements with atomic number greater than 14. This stage of research was supported by LNLS - Brazilian Synchrotron Light Laboratory in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, from the same patient, has involved 5 males and females with ages varying from 34 to 80 years old. The results have shown the presence of P, S, Cl, K, Ca, Ti, Cr, Fe, Ni, Cu, and Zn in healthy skin. The comparison with lesion contents has revealed significant differences in contents of Fe, K, Cr, and Zn. (author)
Evaluation of trace elements contents in healthy and seborrhoeic skin samples by SRTXRF
Energy Technology Data Exchange (ETDEWEB)
Soares, Julio C.A.C.; Anjos, Marcelino J.; Lopes, Ricardo T., E-mail: marcelin@lin.ufrj.b, E-mail: ricardo@lin.ufrj.b [Federal University of Rio de Janeiro (UFRJ/COPPE), Rio de Janeiro, RJ (Brazil). Nuclear Engineering Program. Nuclear Instrumentation Lab.
2009-07-01
The aim of this work is to evaluate the concentrations of trace elements content in seborrhoeic keratosis (SK) skin lesions as well in normal skin and compare them. These data was acquired by Synchrotron Radiation Total Reflection X-ray Fluorescence (SRTXRF). It focused elements with atomic number greater than 14. This stage of research was supported by LNLS - Brazilian Synchrotron Light Laboratory in Campinas/Sao Paulo-Brazil. The collection of lesion and healthy skin samples, including papillary dermis and epidermis, from the same patient, has involved 5 males and females with ages varying from 34 to 80 years old. The results have shown the presence of P, S, Cl, K, Ca, Ti, Cr, Fe, Ni, Cu, and Zn in healthy skin. The comparison with lesion contents has revealed significant differences in contents of Fe, K, Cr, and Zn. (author)