Adenovirus-mediated truncated Bid overexpression induced by the Cre/LoxP system promotes the cell apoptosis of CD133+ ovarian cancer stem cells.

Science.gov (United States)

Long, Qifang; Yang, Ru; Lu, Weixian; Zhu, Weipei; Zhou, Jundong; Zheng, Cui; Zhou, Dongmei; Yu, Ling; Wu, Jinchang

2017-01-01

Cancer stem cells are a small subset of cancer cells that contribute to cancer progression, metastasis, chemoresistance and recurrence. CD133-positive (CD133+) ovarian cancer cells have been identified as ovarian cancer stem cells. Adenovirus-mediated gene therapy is an innovative therapeutic method for cancer treatment. In the present study, we aimed to develop a new gene therapy to specifically eliminate CD133+ ovarian cancer stem cells by targeting CD133. We used the Cre/LoxP system to augment the selective expression of the truncated Bid (tBid) gene as suicide gene therapy in CD133+ ovarian cancer stem cells. The adenovirus (Ad)-CD133-Cre expressing Cre recombinase under the control of the CD133 promoter and Ad-CMV-LoxP-Neo-LoxP-tBid expressing tBid under the control of the CMV promoter were successfully constructed using the Cre/LoxP switching system. The co-infection of Ad-CMV-LoxP-Neo-LoxP-tBid and Ad-CD133-Cre selectively induced tBid overexpression, which inhibited cell growth and triggered the cell apoptosis of CD133+ ovarian cancer stem cells. The Cre/LoxP system-mediated tBid overexpression activated the pro-apoptotic signaling pathway and augmented the cytotoxic effect of cisplatin in CD133+ ovarian cancer stem cells. Furthermore, in xenograft experiments, co-infection with the two recombinant adenoviruses markedly suppressed tumor growth in vivo and promoted cell apoptosis in tumor tissues. Taken together, the present study provides evidence that the adenovirus-mediated tBid overexpression induced by the Cre/LoxP system can effectively eliminate CD133+ ovarian cancer stem cells, representing a novel therapeutic strategy for the treatment of ovarian cancer.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

Science.gov (United States)

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

Science.gov (United States)

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

Adenovirus-mediated IL-12 gene therapy in combination with radiotherapy for murine liver cancer

International Nuclear Information System (INIS)

Wei Daoyan; Dai Bingbing; Wang Zhonghe; Chen Shishu

2001-01-01

Objective: To investigate the synergistic antitumor effects of adenovirus-mediated IL-12 gene therapy in combination with radiotherapy in mice bearing liver cancer. Methods: Balb/c mice bearing liver cancer received the treatment at day 1 with tumor local irradiation (TLI) of 20 Gy or mask irradiation when tumor size reached 0.6-1.0 cm. Within 1 hour after irradiation, adenovirus containing IL-12 gene or PBS was intra-tumor injected once a week. Forty-eight hours after the second injection, IFN-γ levels in sera and the supernatant of cultured spleen cells were assayed by ELISA, CTL activity of spleen cells was measured by 3 H-TdR release assay, and phenotypes of tumor-infiltrating lymphocytes were analysed by immunohistochemical staining. Results: The growth of tumors in animals treated with a combination of IL-12 gene therapy and TLI was inhibited more significantly than those with either single treatment (P + and CD8 + lymphocyte infiltration and tumor-specific cytolytic activities, and the levels of IFN-γ in sera were higher in IL-12 gene therapy and IL-12 gene therapy combined with TLI groups. Conclusion: These results suggest that IL-12 gene therapy combined with radiotherapy is more effective than both single treatment modalities and can induce specific antitumor immuno-response greatly

INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

Science.gov (United States)

2003-01-01

undergoing phase I trials for the potential treatment of lung, breast, ovarian, bladder, liver and brain cancers. Introgen and Aventis Pharma had signed a Cooperative Research and Development Agreement (CRADA) with the National Cancer Institute (NCI). NCI will sponsor clinical trials to evaluate and develop RPR/INGN 201 as a potential anticancer agent for these cancer indications. The trials conducted under a NCI-sponsored IND will evaluate RPR/INGN 201 alone and in combination with other anticancer agents. This agreement was originally signed by Rhône-Poulenc Rorer's Gencell. Introgen has completed three phase I clinical trials with INGN 201 in patients with bronchioalveolar cell lung carcinoma, ovarian cancer and recurrent glioblastomas, respectively. Intratumoural injection of RPR/INGN 201 in patients with recurrent glioblastomas was well tolerated and resulted in expression of the p53 protein. Direct administration of RPR/INGN 201 to the lower airways of patients with bronchioalveolar cell lung carcinoma resulted in symptomatic improvement and improved lung function in some patients. In February 2003, Introgen announced that the US Patent and Trademark Office has issued to The Board of Regents of The University of Texas System, patent No. 6,511,847 entitled "Recombinant p53 Adenovirus Methods and Compositions". Introgen Therapeutics is the exclusive licensee of this patent. The patent covers any adenoviral DNA molecules that encode the p53 gene positioned under the control of a promoter. Such a DNA molecule forms the genetic core of Introgen's ADVEXIN cancer therapy. Introgen's ADVEXIN therapy is now covered by up to ten separate US patents relevant to the product including compositions, therapeutic methods of administering the product in virtually any form, alone and in conjunction with the most widely used chemotherapeutic and radiation treatments, as well as its production. Introgen has a number of US patents that relate to the clinical use of ADVEXIN in cancer as

Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

Directory of Open Access Journals (Sweden)

Christian Bressy

2017-06-01

Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

Anti-tumor effect of adenovirus-mediated suicide gene therapy under control of tumor-specific and radio-inducible chimeric promoter in combination with γ-ray irradiation in vivo

International Nuclear Information System (INIS)

Sun Wenjie; Yu Haijun; Xiongjie; Xu Yu; Liao Zhengkai; Zhou Fuxiang; Xie Conghua; Zhou Yunfeng

2011-01-01

Objective: To detect the selective inhibitory effects of irradiation plus adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic acid (IAA) suicide gene system using tumor-specific and radio-inducible chimeric promoter on human hepatocellular carcinoma subcutaneously xenografted in nude mouse. Methods: Recombinant replicated-deficient adenovirus vector containing HRP gene and chimeric human telomerase reverse transcriptase (hTERT) promoter carrying 6 radio-inducible CArG elements was constructed. A human subcutaneous transplanting hepatocellular carcinoma (MHCC97 cell line) model was treated with γ-ray irradiation plus intra-tumor injections of adenoviral vector and intra-peritoneal injections of prodrug IAA. The change of tumor volume and tumor growth inhibiting rate, the survival time of nude mice, as well as histopathology of xenograft tumor and normal tissues were evaluated. Results: Thirty one days after the treatment, the relative tumor volumes in the negative, adenovirus therapy, irradiation, and combination groups were 49.23±4.55, 27.71±7.74, 28.53±10.48 and 11.58±3.23, respectively.There was a significantly statistical difference among them (F=16.288, P<0.01).The inhibition effect in the combination group was strongest as compared with that in other groups, and its inhibition ratio was 76.5%. The survival period extended to 43 d in the combination group, which showed a significantly difference with that in the control group (χ 2 =18.307, P<0.01). The area of tumors necrosis in the combination group was larger than that in the other groups, and the normal tissues showed no treatment-related toxic effect in all groups. However, multiple hepatocellular carcinoma metastases were observed in the liver in the control group, there were a few metastases in the monotherapy groups and no metastasis in the combination group. Conclusions: Adenovirus-mediated suicide gene therapy plus radiotherapy dramatically could inhibit tumor growth and prolong

Zoledronic acid produces combinatory anti-tumor effects with cisplatin on mesothelioma by increasing p53 expression levels.

Directory of Open Access Journals (Sweden)

Shinya Okamoto

Full Text Available We examined anti-tumor effects of zoledronic acid (ZOL, one of the bisphosphonates agents clinically used for preventing loss of bone mass, on human mesothelioma cells bearing the wild-type p53 gene. ZOL-treated cells showed activation of caspase-3/7, -8 and -9, and increased sub-G1 phase fractions. A combinatory use of ZOL and cisplatin (CDDP, one of the first-line anti-cancer agents for mesothelioma, synergistically or additively produced the cytotoxicity on mesothelioma cells. Moreover, the combination achieved greater anti-tumor effects on mesothelioma developed in the pleural cavity than administration of either ZOL or CDDP alone. ZOL-treated cells as well as CDDP-treated cells induced p53 phosphorylation at Ser 15, a marker of p53 activation, and up-regulated p53 protein expression levels. Down-regulation of p53 levels with siRNA however did not influence the ZOL-mediated cytotoxicity but negated the combinatory effects by ZOL and CDDP. In addition, ZOL treatments augmented cytotoxicity of adenoviruses expressing the p53 gene on mesothelioma. These data demonstrated that ZOL-mediated augmentation of p53, which was not linked with ZOL-induced cytotoxicity, played a role in the combinatory effects with a p53 up-regulating agent, and suggests a possible clinical use of ZOL to mesothelioma with anti-cancer agents.

BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

Directory of Open Access Journals (Sweden)

Liu Jun

2004-07-01

Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.

BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

International Nuclear Information System (INIS)

Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei

2004-01-01

BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies

Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

International Nuclear Information System (INIS)

Zhang, Y.; Woloschak, G.E.

1997-01-01

This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed

Preliminary studies on gene therapy with TGF β1 antisense gene/liposome complexes and adenovirus transfer vector in RPF rats

International Nuclear Information System (INIS)

Liu Chunjie; Wang Dewen; Zhang Zhaoshan; Gao Yabing; Xiong Chengqi; Long Jianyin; Wang Huixin; Peng Ruiyun; Cui Xuemei

2001-01-01

Objective: To observed the efficiency of gene therapy with TGF β1 antisense gene/liposome complexes and adenovirus transfer vector in RPF rats. Methods: TGFβ1 sense and antisense gene expression vectors and adenovirus transfer vector were introduced into rat bronchus by way of intratracheal instillation. Results: At day 1.5 after TGFβ1 sense and antisense gene transfer, PCR amplification using neo gene-specific primer from lung tissue DNA was all positive. After day 5.5, 67% (2/3) of lung tissue DNA was positive. RNA dot blot hybridization indicated that TGFβ1 mRNA content of lung tissue transfected with pMAMneo-antiTGFβ1 gene decreased. Detection of lung hydroxyproline (Hyp) content after day 35 of gene transfer showed that even in lung of rats received pMAMneo-AntiTGFβ1 lipid complexes it raised remarkably (P 9 pfu/ml were instilled into bronchus at 0.5 ml per rat. After day 2 day 6, the lung tissues of all six rats (three per each group )expressed the transfected luciferase gene by luminometer. Conclusion: Cationic lipid-mediated TGFβ1 antisense gene therapy was a simple and easy method. It can slow down the course of pathogenesis of lung fibrosis. Replication-deficient recombinant adenovirus-mediated gene therapy of lung diseases is a good and efficient method

Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

Science.gov (United States)

Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

2003-08-01

Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

Radioiodine uptake of undifferentiated thyroid cancer cells by adenovirus-mediated Na+/ I- symporter gene transfer

Energy Technology Data Exchange (ETDEWEB)

So, Y.; Lee, Y. J.; Shin, J. H.; Oh, H. J.; Chung, J. K.; Lee, M. C.; Cho, B. Y. [College of Medicine, Univ. of Seoul National, Seoul (Korea, Republic of); Lee, K. H. [Samsung Medical Center, Seoul (Korea, Republic of)

2003-07-01

To increase radioiodine uptake on undifferentiated thyroid cancer cell (ARO cells) by adenovirus-mediated human Na+/I- symporter (hNIS) gene transfer. Recombinant adenovirus Ad-hNIS was manufactured successfully. After transfecting Ad-hNIS on ARO cells, in vitro I-125 uptake and efflux studies were performed. For in vivo studies, 1.510'8 p.f.u. (50 1) of Ad-hNIS was injected into xenograft ARO tumors on the R thigh of BALB/c nu/nu mice (n=12), and same amount of normal saline was injected into xenograft ARO tumors on the L thigh. Two, 3, 4 and 6 days after intratumoral injection of Ad-hNIS, I-131 images (3 mice per day) were taken and xenograft tumors on both thighs were all excised. Total RNA was extracted from each tumor tissue and RT-PCR was performed to confirm the hNIS expression of Ad-hNIS injected xenograft ARO tumors. I-125 uptake of Ad-hNIS transfected ARO cells was increased up to 233 folds at 120 minutes in vitro. I-125 efflux study revealed rapid washout of I-125 from Ad-hNIS transfected ARO cells. On dynamic image, I-131 uptake of Ad-hNIS injected ARO tumor was continuously increased until 60 minutes. Mean count ratios of xenograft ARO tumors (R/L) of 60 minutes I-131 images at 2, 3, 4 and 6 days after Ad-hNIS injection were 2.85, 2.54, 2.31, and 2.18, each. On RT-PCR, hNIS expression of Ad-hNIS transfected ARO xenograft tumors was confirmed. Radioiodine uptake was successfully increased in ARO cells by adenovirus-mediated hNIs gene transfer both in vitro and in vivo.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

Science.gov (United States)

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

Science.gov (United States)

Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

2018-03-09

The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.

Science.gov (United States)

Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei

2016-11-01

Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

Science.gov (United States)

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

Directory of Open Access Journals (Sweden)

Simon Leuchs

Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

Evaluating the role of CRM1-mediated export for adenovirus gene expression

International Nuclear Information System (INIS)

Carter, Christoph C.; Izadpanah, Reza; Bridge, Eileen

2003-01-01

A complex of the Adenovirus (Ad) early region 1b 55-kDa (E1b-55kDa) and early region 4 ORF6 34-kDa (E4-34kDa) proteins promotes viral late gene expression. E1b-55kDa and E4-34kDa have leucine-rich nuclear export signals (NESs) similar to that of HIV Rev. It was proposed that E1b-55kDa and/or E4-34kDa might promote the export of Ad late mRNA via their Rev-like NESs, and the transport receptor CRM1. We treated infected cells with the cytotoxin leptomycin B to inhibit CRM1-mediated export; treatment initially delays the onset of late gene expression, but this activity completely recovers as the late phase progresses. We find that the E1b-55kDa NES is not required to promote late gene expression. Previous results showed that E4-34kDa-mediated late gene expression does not require an intact NES (J. Virol. 74 (2000), 6684-6688). Our results indicate that these Ad regulatory proteins promote late gene expression without intact NESs or active CRM1

Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

International Nuclear Information System (INIS)

Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

2008-01-01

Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

Replication-competent human adenovirus 11p vectors can propagate in Vero cells

International Nuclear Information System (INIS)

Gokumakulapalle, Madhuri; Mei, Ya-Fang

2016-01-01

The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.

Replication-competent human adenovirus 11p vectors can propagate in Vero cells

Energy Technology Data Exchange (ETDEWEB)

Gokumakulapalle, Madhuri; Mei, Ya-Fang, E-mail: ya-fang.mei@umu.se

2016-08-15

The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.

[Effect of topical application of a recombinant adenovirus carrying promyelocytic leukemia gene in a psoriasis-like mouse model].

Science.gov (United States)

Wang, Qiongyu; Zhang, Aijun; Ma, Huiqun; Wang, Shijie; Ma, Yunyun; Zou, Xingwei; Li, Ruilian

2013-03-01

To investigate the effects of topical treatment with adenovirus-mediated promyelocytic leukemia gene (PML) gene in a psoriasis-like mouse model. The effect of adenovirus-mediated PML gene on the granular layer of mouse tail scale epidermis and epithelial mitosis were observed on longitudinal histological sections prepared from the tail skin and vaginal epithelium of the mice. Adenovirus-mediated PML gene significantly inhibited mitosis of mouse vaginal epithelial cells and promoted the formation of granular layer in mouse tail scale epidermis. The therapeutic effect of PML gene in the psoriasis-like mouse model may be associated with increased granular cells and suppressed epidemic cell proliferation.

Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

Science.gov (United States)

Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

2005-04-01

The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

Therapeutic Response to Non-genotoxic Activation of p53 by Nutlin3a Is Driven by PUMA-Mediated Apoptosis in Lymphoma Cells

Directory of Open Access Journals (Sweden)

Liz J. Valente

2016-03-01

Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.

Imaging of human sodium-iodide symporter gene expression mediated by recombinant adenovirus in skeletal muscle of living rats

International Nuclear Information System (INIS)

Yang, Hyun Suk; Park, Seong-Wook; Lee, Heuiran; Kim, Sung Jin; Lee, Won Woo; Yang, You-Jung; Moon, Dae Hyuk

2004-01-01

We evaluated the feasibility of non-invasive imaging of recombinant adenovirus-mediated human sodium-iodide symporter (hNIS) gene expression by 99m TcO 4 - scintigraphy in skeletal muscle of rats. Replication-defective recombinant adenovirus encoding hNIS gene [Rad-CMV-hNIS 5 x 10 7 , 2 x 10 8 or 1 x 10 9 plaque forming units (pfu)] or β-galactosidase gene (Rad-CMV-LacZ 1 x 10 9 pfu) was injected into the right biceps femoris muscle of rats (n=5-6 for each group). Three days after gene transfer, scintigraphy was performed using a gamma camera 30 min after injection of 99m TcO 4 - (1.85 MBq). An additional two rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS underwent 99m TcO 4 - scintigraphy with sodium perchlorate. After the imaging studies, rats were sacrificed for assessment of the biodistribution of 99m TcO 4 - and measurement of hNIS mRNA expression. In all the rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS, hNIS expression was successfully imaged by 99m TcO 4 - scintigraphy, while rats injected with Rad-CMV-LacZ or lower doses of Rad-CMV-hNIS failed to show uptake. The biodistribution studies indicated that a significantly different amount of 99m TcO 4 - was retained in the liver (p 9 pfu of Rad-CMV-hNIS. The muscular hNIS mRNA level quantified by real-time reverse transcription-polymerase chain reaction was significantly higher in rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS (p 9 pfu of Rad-CMV-hNIS were specifically inhibited by sodium perchlorate. This study illustrated that 99m TcO 4 - scintigraphy can monitor Rad-CMV-hNIS-mediated gene expression in skeletal muscle of rats, non-invasively and quantitatively. (orig.)

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

Science.gov (United States)

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

Science.gov (United States)

Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

2018-03-01

Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

Directory of Open Access Journals (Sweden)

Krzysztof Puszynski

2014-12-01

Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

Science.gov (United States)

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Imaging of human sodium-iodide symporter gene expression mediated by recombinant adenovirus in skeletal muscle of living rats

Energy Technology Data Exchange (ETDEWEB)

Yang, Hyun Suk; Park, Seong-Wook [Department of Internal Medicine (Cardiology), Asan Medical Center, University of Ulsan College of Medicine, 388-1 Pungnap-dong, Songpa-gu, 138-736, Seoul (Korea); Lee, Heuiran; Kim, Sung Jin [Department of Microbiology, University of Ulsan College of Medicine, Seoul (Korea); Lee, Won Woo [Department of Nuclear Medicine, Seoul National University Bundang Hospital, Seongnam (Korea); Department of Nuclear Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea); Yang, You-Jung; Moon, Dae Hyuk [Department of Nuclear Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea)

2004-09-01

We evaluated the feasibility of non-invasive imaging of recombinant adenovirus-mediated human sodium-iodide symporter (hNIS) gene expression by {sup 99m}TcO{sub 4}{sup -} scintigraphy in skeletal muscle of rats. Replication-defective recombinant adenovirus encoding hNIS gene [Rad-CMV-hNIS 5 x 10{sup 7}, 2 x 10{sup 8} or 1 x 10{sup 9} plaque forming units (pfu)] or {beta}-galactosidase gene (Rad-CMV-LacZ 1 x 10{sup 9} pfu) was injected into the right biceps femoris muscle of rats (n=5-6 for each group). Three days after gene transfer, scintigraphy was performed using a gamma camera 30 min after injection of {sup 99m}TcO{sub 4}{sup -} (1.85 MBq). An additional two rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS underwent {sup 99m}TcO{sub 4}{sup -} scintigraphy with sodium perchlorate. After the imaging studies, rats were sacrificed for assessment of the biodistribution of {sup 99m}TcO{sub 4}{sup -} and measurement of hNIS mRNA expression. In all the rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS, hNIS expression was successfully imaged by {sup 99m}TcO{sub 4}{sup -} scintigraphy, while rats injected with Rad-CMV-LacZ or lower doses of Rad-CMV-hNIS failed to show uptake. The biodistribution studies indicated that a significantly different amount of {sup 99m}TcO{sub 4}{sup -} was retained in the liver (p<0.001) and the right muscle (p<0.05), with the highest uptake in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS. The muscular hNIS mRNA level quantified by real-time reverse transcription-polymerase chain reaction was significantly higher in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS (p<0.05), with a positive correlation with the imaging counts (r=0.810, p<0.05) and the biodistribution (r=0.847, p<0.001). Hot spots in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS were specifically inhibited by sodium perchlorate. This study illustrated that {sup 99m}TcO{sub 4}{sup -} scintigraphy can monitor Rad-CMV-hNIS-mediated gene expression in

Gene expression patterns associated with p53 status in breast cancer

International Nuclear Information System (INIS)

Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

2006-01-01

Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

Effect of p53 genotype on gene expression profiles in murine liver

International Nuclear Information System (INIS)

Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

2008-01-01

The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

Oncolytic Group B Adenovirus Enadenotucirev Mediates Non-apoptotic Cell Death with Membrane Disruption and Release of Inflammatory Mediators

Directory of Open Access Journals (Sweden)

Arthur Dyer

2017-03-01

Full Text Available Enadenotucirev (EnAd is a chimeric group B adenovirus isolated by bioselection from a library of adenovirus serotypes. It replicates selectively in and kills a diverse range of carcinoma cells, shows effective anticancer activity in preclinical systems, and is currently undergoing phase I/II clinical trials. EnAd kills cells more quickly than type 5 adenovirus, and speed of cytotoxicity is dose dependent. The EnAd death pathway does not involve p53, is predominantly caspase independent, and appears to involve a rapid fall in cellular ATP. Infected cells show early loss of membrane integrity; increased exposure of calreticulin; extracellular release of ATP, HSP70, and HMGB1; and influx of calcium. The virus also causes an obvious single membrane blister reminiscent of ischemic cell death by oncosis. In human tumor biopsies maintained in ex vivo culture, EnAd mediated release of pro-inflammatory mediators such as TNF-α, IL-6, and HMGB1. In accordance with this, EnAd-infected tumor cells showed potent stimulation of dendritic cells and CD4+ T cells in a mixed tumor-leukocyte reaction in vitro. Whereas many viruses have evolved for efficient propagation with minimal inflammation, bioselection of EnAd for rapid killing has yielded a virus with a short life cycle that combines potent cytotoxicity with a proinflammatory mechanism of cell death.

Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

International Nuclear Information System (INIS)

Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

2005-01-01

The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression

Directory of Open Access Journals (Sweden)

Shang-Jui Wang

2016-10-01

Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.

The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

Directory of Open Access Journals (Sweden)

Daniel Menendez

2011-03-01

Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

Effects of Adenovirus-Mediated Delivery of the Human Hepatocyte Growth Factor Gene in Experimental Radiation-Induced Heart Disease

International Nuclear Information System (INIS)

Hu Shunying; Chen Yundai; Li Libing; Chen Jinlong; Wu Bin; Zhou, Xiao; Zhi Guang; Li Qingfang; Wang Rongliang; Duan Haifeng; Guo Zikuan; Yang Yuefeng; Xiao Fengjun; Wang Hua; Wang Lisheng

2009-01-01

Purpose: Irradiation to the heart may lead to late cardiovascular complications. The purpose of this study was to investigate whether adenovirus-mediated delivery of the human hepatocyte growth factor gene could reduce post-irradiation damage of the rat heart and improve heart function. Methods and Materials: Twenty rats received single-dose irradiation of 20 Gy gamma ray locally to the heart and were randomized into two groups. Two weeks after irradiation, these two groups of rats received Ad-HGF or mock adenovirus vector intramyocardial injection, respectively. Another 10 rats served as sham-irradiated controls. At post-irradiation Day 120, myocardial perfusion was tested by myocardial contrast echocardiography with contrast agent injected intravenously. At post-irradiation Day 180, cardiac function was assessed using the Langendorff technique with an isolated working heart model, after which heart samples were collected for histological evaluation. Results: Myocardial blood flow was significantly improved in HGF-treated animals as measured by myocardial contrast echocardiography at post-irradiation Day 120 . At post-irradiation Day 180, cardiac function was significantly improved in the HGF group compared with mock vector group, as measured by left ventricular peak systolic pressure (58.80 ± 9.01 vs. 41.94 ± 6.65 mm Hg, p < 0.05), the maximum dP/dt (5634 ± 1303 vs. 1667 ± 304 mm Hg/s, p < 0.01), and the minimum dP/dt (3477 ± 1084 vs. 1566 ± 499 mm Hg/s, p < 0.05). Picrosirius red staining analysis also revealed a significant reduction of fibrosis in the HGF group. Conclusion: Based on the study findings, hepatocyte growth factor gene transfer can attenuate radiation-induced cardiac injury and can preserve cardiac function.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

Science.gov (United States)

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Targeted adenovirus mediated inhibition of NF-κB-dependent inflammatory gene expression in endothelial cells in vitro and in vivo.

Science.gov (United States)

Kułdo, J M; Ásgeirsdóttir, S A; Zwiers, P J; Bellu, A R; Rots, M G; Schalk, J A C; Ogawara, K I; Trautwein, C; Banas, B; Haisma, H J; Molema, G; Kamps, J A A M

2013-02-28

In chronic inflammatory diseases the endothelium expresses mediators responsible for harmful leukocyte infiltration. We investigated whether targeted delivery of a therapeutic transgene that inhibits nuclear factor κB signal transduction could silence the proinflammatory activation status of endothelial cells. For this, an adenovirus encoding dominant-negative IκB (dnIκB) as a therapeutic transgene was employed. Selectivity for the endothelial cells was achieved by introduction of antibodies specific for inflammatory endothelial adhesion molecules E-selectin or VCAM-1 chemically linked to the virus via polyethylene glycol. In vitro, the retargeted adenoviruses selectively infected cytokine-activated endothelial cells to express functional transgene. The comparison of transductional capacity of both retargeted viruses revealed that E-selectin based transgene delivery exerted superior pharmacological effects. Targeted delivery mediated dnIκB transgene expression in endothelial cells inhibited the induced expression of several inflammatory genes, including adhesion molecules, cytokines, and chemokines. In vivo, in mice suffering from glomerulonephritis, E-selectin-retargeted adenovirus selectively homed in the kidney to microvascular glomerular endothelium. Subsequent downregulation of endothelial adhesion molecule expression 2 days after induction of inflammation demonstrated the pharmacological potential of this gene therapy approach. The data justify further studies towards therapeutic virus design and optimization of treatment schedules to investigate their capacity to interfere with inflammatory disease progression. Copyright © 2012 Elsevier B.V. All rights reserved.

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

Directory of Open Access Journals (Sweden)

Rejane Mattar

2004-01-01

Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

Adenovirus gene transfer to amelogenesis imperfecta ameloblast-like cells.

Directory of Open Access Journals (Sweden)

Anton V Borovjagin

Full Text Available To explore gene therapy strategies for amelogenesis imperfecta (AI, a human ameloblast-like cell population was established from third molars of an AI-affected patient. These cells were characterized by expression of cytokeratin 14, major enamel proteins and alkaline phosphatase staining. Suboptimal transduction of the ameloblast-like cells by an adenovirus type 5 (Ad5 vector was consistent with lower levels of the coxsackie-and-adenovirus receptor (CAR on those cells relative to CAR-positive A549 cells. To overcome CAR -deficiency, we evaluated capsid-modified Ad5 vectors with various genetic capsid modifications including "pK7" and/or "RGD" motif-containing short peptides incorporated in the capsid protein fiber as well as fiber chimera with the Ad serotype 3 (Ad3 fiber "knob" domain. All fiber modifications provided an augmented transduction of AI-ameloblasts, revealed following vector dose normalization in A549 cells with a superior effect (up to 404-fold of pK7/RGD double modification. This robust infectivity enhancement occurred through vector binding to both α(vβ3/α(vβ5 integrins and heparan sulfate proteoglycans (HSPGs highly expressed by AI-ameloblasts as revealed by gene transfer blocking experiments. This work thus not only pioneers establishment of human AI ameloblast-like cell population as a model for in vitro studies but also reveals an optimal infectivity-enhancement strategy for a potential Ad5 vector-mediated gene therapy for AI.

Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination

Directory of Open Access Journals (Sweden)

Zhou Y

2018-04-01

Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had

p53 tumor suppressor gene: significance in neoplasia - a review

International Nuclear Information System (INIS)

Alam, J.M.

2000-01-01

p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

International Nuclear Information System (INIS)

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo

2016-01-01

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

Energy Technology Data Exchange (ETDEWEB)

Tomono, Takumi [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Kajita, Masahiro [Laboratory of Molecular Pharmaceutics and Technology, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Yano, Kentaro [Laboratory of Biopharmaceutics, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Ogihara, Takuo, E-mail: togihara@takasaki-u.ac.jp [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan)

2016-08-05

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.

Stimulation of autophagy by the p53 target gene Sestrin2.

Science.gov (United States)

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Cancer gene therapy with targeted adenoviruses.

Science.gov (United States)

Bachtarzi, Houria; Stevenson, Mark; Fisher, Kerry

2008-11-01

Clinical experience with adenovirus vectors has highlighted the need for improved delivery and targeting. This manuscript aims to provide an overview of the techniques currently under development for improving adenovirus delivery to malignant cells in vivo. Primary research articles reporting improvements in adenoviral gene delivery are described. Strategies include genetic modification of viral coat proteins, non-genetic modifications including polymer encapsulation approaches and pharmacological interventions. Reprogramming adenovirus tropism in vitro has been convincingly demonstrated using a range of genetic and physical strategies. These studies have provided new insights into our understanding of virology and the field is progressing. However, there are still some limitations that need special consideration before adenovirus-targeted cancer gene therapy emerges as a routine treatment in the clinical setting.

Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

International Nuclear Information System (INIS)

Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

2010-01-01

Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

Science.gov (United States)

Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

2015-01-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

Directory of Open Access Journals (Sweden)

Fuqiang Xing

Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

E1B-attenuated onco lytic adenovirus enhances antitumor effect of radionuclide therapy by P53-independent way: cellular basic for radionuclide-viral therapy

Energy Technology Data Exchange (ETDEWEB)

Zhenwei, Zhang [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai (China); Hua, Wu; Xuemei, Zhang [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Xinyuan, Liu [Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai (China)

2004-07-01

Purpose: Chemotherapy or external radiation therapy can potentiate the therapeutic effect of E1 B-attenuated oncolytic adenovirus. In this study, the antitumor efficacy of oncolytic adenovirus combined with internal radionuclide therapy was evaluated. Methods: Firstly, viral replication was examined by plaque assay and Southern blotting, after oncolytic adenovirus, ZD55, was exposed to iodine-131. Cell viability was evaluated qualitatively by crystal violet staining and quantitatively by MTT assay. FACS analysis was performed to determine the synergic proapoptotic effect of iodine-131 combined with ZD55. Results: Irradiation of iodine-131 does not influence ZD55 viral DNA replication. In combination with ZD55, iodine-131 can efficiently kill tumor cells in a p53-independent model. ZD55 augments the proapoptotic effect of iodine-131. Conclusion: Radionuclide-viral therapy might be a novel tool for treatment of hepatocarcinoma. (authors)

Cre/loxP-mediated adenovirus type 5 packaging signal excision demonstrates that core element VI is sufficient for virus packaging

International Nuclear Information System (INIS)

Maeda, Yasushi; Kimura, En; Uchida, Yuji; Nishida, Yasuto; Yamashita, Satoshi; Arima, Toshiyuki; Uchino, Makoto

2003-01-01

Previous analyses have demonstrated that packaging of the adenovirus type 5 (Ad5) genome is dependent on at least seven cis-acting elements, called AI to AVII, which are located in the left-end region of the genome. These elements have different packaging efficiencies, and without AI through AV, viral DNA cannot be packaged. Here we report the identification of the cis-acting Ad5 packaging domain in vivo by using the Cre/loxP system. We found that an adenoviral DNA fragment (nt 192 to nt 358), which includes elements AI to AV, is excised by Cre recombinase and packaged into capsids. Furthermore, this mutant adenovirus replicated so efficiently by repetitive propagation that its purification by CsCI equilibrium gradient was possible. This study clarified that the region from nt 358 to nt 454 on the viral genome is sufficient for packaging. Recently, the helper-dependent adenoviral vector (HDAd) construction system has been developed for the purpose of gene therapy. This system uses a helper virus with two parallel loxP sites flanking the packaging signal. This region is eliminated by Cre-mediated excision, which prevents helper virus packaging. Our data provide useful information regarding factors affecting efficient elimination

Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

International Nuclear Information System (INIS)

Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

2008-01-01

Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

International Nuclear Information System (INIS)

Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

2014-01-01

Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

Science.gov (United States)

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Efficacy and toxicity of replication-competent adenovirus-mediated double suicide gene therapy in combination with radiation therapy in an orthotopic mouse prostate cancer model

International Nuclear Information System (INIS)

Freytag, Svend O.; Paielli, Dell; Wing, Mark; Rogulski, Ken; Brown, Steve; Kolozsvary, Andy; Seely, John; Barton, Ken; Dragovic, Alek; Kim, Jae Ho

2002-01-01

Purpose: The purpose of this study was to evaluate the efficacy and toxicity of replication-competent adenovirus-mediated double suicide gene therapy in an adjuvant setting with external beam radiation therapy (EBRT) in an experimental prostate cancer model in preparation for a Phase I clinical study in humans. Methods: For efficacy studies, i.m. DU145 and intraprostatic LNCaP C4-2 tumors were established in immune-deficient mice. Tumors were injected with the lytic, replication-competent Ad5-CD/TKrep adenovirus containing a cytosine deaminase (CD)/herpes simplex virus thymidine kinase (HSV-1 TK) fusion gene. Two days later, mice were administered 1 week of 5-fluorocytosine + ganciclovir (GCV) prodrug therapy and fractionated doses of EBRT (trimodal therapy). Tumor control rate of trimodal therapy was compared to that of EBRT alone. For toxicology studies, immune-competent male mice received a single intraprostatic injection (10 10 vp) of the replication-competent Ad5-CD/TKrep adenovirus. Two days later, mice were administered 4 weeks of 5-fluorocytosine + GCV prodrug therapy and 56 Gy EBRT to the pelvic region. The toxicity of trimodal therapy was assessed by histopathologic analysis of major organs and clinical chemistries. Results: In both the i.m. DU145 and intraprostatic LNCaP C4-2 tumor models, trimodal therapy significantly improved primary tumor control beyond that of EBRT alone. In the DU145 model, trimodal therapy resulted in a tumor growth delay (70 days) that was more than twice that (32 days) of EBRT alone. Whereas EBRT failed to eradicate DU145 tumors, trimodal therapy resulted in 25% tumor cure. In the LNCaP C4-2 tumor model, EBRT slowed the growth of intraprostatic tumors, but resulted in no tumor cures, and 57% of the mice developed retroperitoneal lymph node metastases at 3 months. By contrast, trimodal therapy resulted in 44% tumor cure and reduced significantly the percentage (13%) of lymph node metastases relative to EBRT alone. Overall

Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

Directory of Open Access Journals (Sweden)

Ravshan Burikhanov

2014-01-01

Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

Science.gov (United States)

Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

2011-11-01

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

Transfection of wild type ADVP53 gene into human brain tumor cell lines has a radiosensitizing effect independent of apoptosis

International Nuclear Information System (INIS)

Geng, L.; Walter, S; Vaughan, A.T.M.

1997-01-01

Purpose: Despite attempts with a variety of therapeutic approaches there has been little impact on the survival of patients with Glioblastoma multiforme, with median survivals reported of approximately 12 months. In this study a replication restricted adenovirus vector is used to transfer the wild type p53 gene into two cell lines derived from a human astrocytoma U87MG or glioblastoma T98G, to determine its ability to act as a radiosensitizer in conjunction with conventional radiotherapy. Methods: An adenovirus vector containing the human wild type p53 (Advp53) gene was used in addition to a control vector containing the β-galactosidase (Advγgal) reporter gene. To achieve cellular incorporation both vectors were incubated with cells for 30 minutes - washed and returned to culture. The successful incorporation of each vector was determined by either a p53 assay using either a western blotting or flow cytometry techniques, or specific staining for β-galactosidase activity. The presence of each vector was assayed until the constructs were eliminated from the cell. To determine the effects of these vectors on cell survival sufficient vector was added to produce a measurable reduction in clonogenic survival and this value was used in subsequent irradiation experiments. To determine the ability of wild type p53 to induce apoptosis the cells were examined from 1 to 5 days after irradiation by H and E staining for the characteristic morphology indicating an apoptotic process. Results: Both the Advp53 and Advβgal vectors were successfully incorporated into each cell line. Expression of each gene was reduced to approximately half by 5 days and virtually eliminated by 15 days after transfection in both lines. At the doses used the wild type Advp53 adenovirus was toxic to both cell lines giving surviving fractions between 39-74%. When this toxicity was taken into account the presence of the Advp53 gene had a radiosensitizing effect in each cell line. To determine the

CD40-mediated apoptosis in murine B-lymphoma lines containing mutated p53

DEFF Research Database (Denmark)

Hollmann, Annette C; Gong, Qiaoke; Owens, Trevor

2002-01-01

Crosslinking CD40 induces normal B-cells to proliferate and differentiate but causes many tumor cell lines to undergo apoptosis. As p53 is required for many apoptotic pathways, we analyzed the effects of CD40 ligation and their correlation with p53 function in four murine B-lymphoma lines. A20...... of detectable p21 mRNA in A20 and M12 cells. P21 mRNA was increased to detectable levels in M12 cells upon CD40 ligation; however, blocking this effect with the p53 inhibitor pifithrin had no effect on CD40-mediated apoptosis. Sequencing showed that p53 in A20 and M12 cells contained point mutations leading...... to amino acid substitutions in DNA binding regions, but was unmutated in WEHI231 and WEHI 279. These results suggest that CD40-mediated apoptosis can occur in the absence of functional p53....

p53 as the focus of gene therapy: past, present and future.

Science.gov (United States)

Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

2018-01-15

Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

International Nuclear Information System (INIS)

Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun

2007-01-01

Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

Energy Technology Data Exchange (ETDEWEB)

Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)

2007-02-15

Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

Alterations in the K-ras and p53 genes in rat lung tumors

Energy Technology Data Exchange (ETDEWEB)

Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

1997-06-01

Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)

2015-11-01

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

International Nuclear Information System (INIS)

Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.

2015-01-01

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Methylation of PLCD1 and adenovirus-mediated PLCD1 overexpression elicits a gene therapy effect on human breast cancer

International Nuclear Information System (INIS)

Mu, Haixi; Wang, Na; Zhao, Lijuan; Li, Shuman; Li, Qianqian; Chen, Ling; Luo, Xinrong; Qiu, Zhu; Li, Lili; Ren, Guosheng; Xu, Yongzhu; Zhou, Xiangyang; Xiang, Tingxiu

2015-01-01

Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumor cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer

Methylation of PLCD1 and adenovirus-mediated PLCD1 overexpression elicits a gene therapy effect on human breast cancer

Energy Technology Data Exchange (ETDEWEB)

Mu, Haixi [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Wang, Na; Zhao, Lijuan; Li, Shuman; Li, Qianqian; Chen, Ling; Luo, Xinrong; Qiu, Zhu [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Ren, Guosheng [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Xu, Yongzhu [Chongqing Health Service Center, Chongqing 400020 (China); Zhou, Xiangyang [The Wistar Institute, Philadelphia, PA (United States); Xiang, Tingxiu, E-mail: xiangtx1@gmail.com [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)

2015-03-15

Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumor cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer.

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

Science.gov (United States)

Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

2010-11-01

Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

Science.gov (United States)

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

Directory of Open Access Journals (Sweden)

Ilin Chuang

Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

Science.gov (United States)

Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

1997-05-01

To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

TRIM65 negatively regulates p53 through ubiquitination

Energy Technology Data Exchange (ETDEWEB)

Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

2016-04-22

Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

Tip60 degradation by adenovirus relieves transcriptional repression of viral transcriptional activator EIA.

Science.gov (United States)

Gupta, A; Jha, S; Engel, D A; Ornelles, D A; Dutta, A

2013-10-17

Adenoviruses are linear double-stranded DNA viruses that infect human and rodent cell lines, occasionally transform them and cause tumors in animal models. The host cell challenges the virus in multifaceted ways to restrain viral gene expression and DNA replication, and sometimes even eliminates the infected cells by programmed cell death. To combat these challenges, adenoviruses abrogate the cellular DNA damage response pathway. Tip60 is a lysine acetyltransferase that acetylates histones and other proteins to regulate gene expression, DNA damage response, apoptosis and cell cycle regulation. Tip60 is a bona fide tumor suppressor as mice that are haploid for Tip60 are predisposed to tumors. We have discovered that Tip60 is degraded by adenovirus oncoproteins EIB55K and E4orf6 by a proteasome-mediated pathway. Tip60 binds to the immediate early adenovirus promoter and suppresses adenovirus EIA gene expression, which is a master regulator of adenovirus transcription, at least partly through retention of the virally encoded repressor pVII on this promoter. Thus, degradation of Tip60 by the adenoviral early proteins is important for efficient viral early gene transcription and for changes in expression of cellular genes.

The critical role of catalase in prooxidant and antioxidant function of p53

Science.gov (United States)

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

Recombinant adenovirus-mediated overexpression of PTEN and KRT10 improves cisplatin resistance of ovarian cancer in vitro and in vivo.

Science.gov (United States)

Wu, H; Wang, K; Liu, W; Hao, Q

2015-06-18

Drug resistance is a major cause of treatment failure in ovarian cancer patients, and novel therapeutic strategies are urgently needed. Overexpression of phosphatase and tensin homolog (PTEN) has been shown to preserve the cisplatin-resistance of ovarian cancer cells, while cisplatin-induced keratin 10 (KRT10) overexpression mediates the resistance-reversing effect of PTEN. However, whether overexpression of PTEN or KRT10 can improve the cisplatin resistance of ovarian cancer in vivo has not been investigated. Therefore, we investigated the effects of adenovirus-mediated PTEN or KRT10 overexpression on the cisplatin resistance of ovarian cancer in vivo. Recombinant adenoviruses carrying the gene for PTEN or KRT10 were constructed. The effects of overexpression of PTEN and KRT10 on cisplatin resistance of ovarian cancer cells were examined using the 3(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) and TdT-mediated dUTP nick-end labeling (TUNEL) assays in vitro. Subcutaneously transplanted nude mice, as a model of human ovarian cancer, were used to test the effects of PTEN and KRT10 on cisplatin resistance of ovarian cancer in vivo. The MTT assay showed that recombinant adenovirus-mediated overexpression of KRT10 and PTEN enhanced the proliferation inhibition effect of cisplatin on C13K cells. Recombinant adenovirus-mediated overexpression of KRT10 and PTEN also increased the cisplatin-induced apoptosis rate of C13K cells. Furthermore, recombinant adenovirus-mediated overexpression of KRT10 and PTEN enhanced the inhibitory effect of cisplatin on C13K xenograft tumor growth. Thus, recombinant adenovirus-mediated overexpression of KRT10 and PTEN may improve the cisplatin resistance of ovarian cancer in vitro and in vivo.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

International Nuclear Information System (INIS)

Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.

2009-01-01

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.

Isolation and characterization of DUSP11, a novel p53 target gene

DEFF Research Database (Denmark)

Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

2009-01-01

target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

A Rabbit Model for Testing Helper-Dependent Adenovirus-Mediated Gene Therapy for Vein Graft Atherosclerosis.

Science.gov (United States)

Bi, Lianxiang; Wacker, Bradley K; Bueren, Emma; Ham, Ervin; Dronadula, Nagadhara; Dichek, David A

2017-12-15

Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd) efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks) persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate-yet significant-pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.

Combination of adenovirus and cross-linked low molecular weight PEI improves efficiency of gene transduction

International Nuclear Information System (INIS)

Han Jianfeng; Zhao Dong; Zhong Zhirong; Zhang Zhirong; Gong Tao; Sun Xun

2010-01-01

Recombinant adenovirus (Ad)-mediated gene therapy is an exciting novel strategy in cancer treatment. However, poor infection efficiency with coxsackievirus and adenovirus receptor (CAR) down-regulated cancer cell lines is one of the major challenges for its practical and extensive application. As an alternative method of viral gene delivery, a non-viral carrier using cationic materials could compensate for the limitation of adenovirus. In our study, adenovectors were complexed with a new synthetic polymer PEI-DEG-bis-NPC (PDN) based on polyethylenimine (PEI), and then the properties of the vehicle were characterized by measurement of size distribution, zeta potential and transmission electron microscopy (TEM). Enhancement of gene transduction by Ad/PDN complexes was observed in both CAR-overexpressing cell lines (A549) and CAR-lacking cell lines (MDCK, CHO, LLC), as a result of facilitating binding and cell uptake of adenoviral particles by the cationic component. Ad/PDN complexes also promoted the inhibition of tumor growth in vivo and prolonged the survival time of tumor-bearing mice. These data suggest that a combination of viral and non-viral gene delivery methods may offer a new approach to successful cancer gene therapy.

Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

Directory of Open Access Journals (Sweden)

Paola De Feudis

2000-05-01

Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

Directory of Open Access Journals (Sweden)

Agnes C. Fett-Conte

2002-04-01

Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

Targeting GRP75 improves HSP90 inhibitor efficacy by enhancing p53-mediated apoptosis in hepatocellular carcinoma.

Directory of Open Access Journals (Sweden)

Weiwei Guo

Full Text Available Heat shock protein 90 (HSP90 inhibitors are potential drugs for cancer therapy. The inhibition of HSP90 on cancer cell growth largely through degrading client proteins, like Akt and p53, therefore, triggering cancer cell apoptosis. Here, we show that the HSP90 inhibitor 17-AAG can induce the expression of GRP75, a member of heat shock protein 70 (HSP70 family, which, in turn, attenuates the anti-growth effect of HSP90 inhibition on cancer cells. Additionally, 17-AAG enhanced binding of GRP75 and p53, resulting in the retention of p53 in the cytoplasm. Blocking GRP75 with its inhibitor MKT-077 potentiated the anti-tumor effects of 17-AAG by disrupting the formation of GRP75-p53 complexes, thereby facilitating translocation of p53 into the nuclei and leading to the induction of apoptosis-related genes. Finally, dual inhibition of HSP90 and GRP75 was found to significantly inhibit tumor growth in a liver cancer xenograft model. In conclusion, the GRP75 inhibitor MKT-077 enhances 17-AAG-induced apoptosis in HCCs and increases p53-mediated inhibition of tumor growth in vivo. Dual targeting of GRP75 and HSP90 may be a useful strategy for the treatment of HCCs.

Polymorphism at codon 36 of the p53 gene.

Science.gov (United States)

Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

1994-01-01

A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

International Nuclear Information System (INIS)

Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

2011-01-01

Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

Energy Technology Data Exchange (ETDEWEB)

Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

The absence of Ser389 phosphorylation in p53 affects the basal gene expression level of many p53-dependent genes and alters the biphasic response to UV exposure in mouse embryonic fibroblasts

NARCIS (Netherlands)

Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.

2008-01-01

Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the

OTUD5 regulates p53 stability by deubiquitinating p53.

Directory of Open Access Journals (Sweden)

Judong Luo

Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

SIAH1-induced p34SEI-1 polyubiquitination/degradation mediates p53 preferential vitamin C cytotoxicity.

Science.gov (United States)

Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok

2015-03-01

Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.

The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

Science.gov (United States)

Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

2009-05-01

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

Science.gov (United States)

White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

2014-08-01

The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

p53-Mediated Molecular Control of Autophagy in Tumor Cells

Directory of Open Access Journals (Sweden)

Maria Mrakovcic

2018-03-01

Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

Adenovirus small E1A employs the lysine acetylases p300/CBP and tumor suppressor Rb to repress select host genes and promote productive virus infection.

Science.gov (United States)

Ferrari, Roberto; Gou, Dawei; Jawdekar, Gauri; Johnson, Sarah A; Nava, Miguel; Su, Trent; Yousef, Ahmed F; Zemke, Nathan R; Pellegrini, Matteo; Kurdistani, Siavash K; Berk, Arnold J

2014-11-12

Oncogenic transformation by adenovirus small e1a depends on simultaneous interactions with the host lysine acetylases p300/CBP and the tumor suppressor RB. How these interactions influence cellular gene expression remains unclear. We find that e1a displaces RBs from E2F transcription factors and promotes p300 acetylation of RB1 K873/K874 to lock it into a repressing conformation that interacts with repressive chromatin-modifying enzymes. These repressing p300-e1a-RB1 complexes specifically interact with host genes that have unusually high p300 association within the gene body. The TGF-β, TNF-, and interleukin-signaling pathway components are enriched among such p300-targeted genes. The p300-e1a-RB1 complex condenses chromatin in a manner dependent on HDAC activity, p300 lysine acetylase activity, the p300 bromodomain, and RB K873/K874 and e1a K239 acetylation to repress host genes that would otherwise inhibit productive virus infection. Thus, adenovirus employs e1a to repress host genes that interfere with viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.

Restoration of mp53 to wtp53 by chemical chaperones restores p53-dependent apoptosis after radiotherapy

International Nuclear Information System (INIS)

Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.

2003-01-01

The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future

Production of Recombinant Adenovirus Containing Human Interlukin-4 Gene

OpenAIRE

Mojarrad, Majid; Abdolazimi, Yassan; Hajati, Jamshid; Modarressi, Mohammad Hossein

2011-01-01

Objective(s) Recombinant adenoviruses are currently used for a variety of purposes, including in vitro gene transfer, in vivo vaccination, and gene therapy. Ability to infect many cell types, high efficiency in gene transfer, entering both dividing and non dividing cells, and growing to high titers make this virus a good choice for using in various experiments. In the present experiment, a recombinant adenovirus containing human IL-4 coding sequence was made. IL-4 has several characteristics ...

Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

International Nuclear Information System (INIS)

Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

2001-01-01

Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Alterations in tumour suppressor gene p53 in human gliomas from ...

Indian Academy of Sciences (India)

Unknown

Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

A Rabbit Model for Testing Helper-Dependent Adenovirus-Mediated Gene Therapy for Vein Graft Atherosclerosis

Directory of Open Access Journals (Sweden)

Lianxiang Bi

2017-12-01

Full Text Available Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate—yet significant—pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.

Tp53 gene mediates distinct dopaminergic neuronal damage in different dopaminergic neurotoxicant models

Directory of Open Access Journals (Sweden)

Tao Lu

2017-01-01

Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.

Effect of the p53 gene status on the sensitivity of oral squamous cell carcinoma cells to boron neutron capture therapy

International Nuclear Information System (INIS)

Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.

2006-01-01

The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)

Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

International Nuclear Information System (INIS)

Irshad, S.; Nawaz, T.

2008-01-01

Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

Platelet-derived growth factor (PDGF)-signaling mediates radiation-induced apoptosis in human prostate cancer cells with loss of p53 function

International Nuclear Information System (INIS)

Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.

1997-01-01

Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo

Key Role of the Scavenger Receptor MARCO in Mediating Adenovirus Infection and Subsequent Innate Responses of Macrophages.

Science.gov (United States)

Maler, Mareike D; Nielsen, Peter J; Stichling, Nicole; Cohen, Idan; Ruzsics, Zsolt; Wood, Connor; Engelhard, Peggy; Suomalainen, Maarit; Gyory, Ildiko; Huber, Michael; Müller-Quernheim, Joachim; Schamel, Wolfgang W A; Gordon, Siamon; Jakob, Thilo; Martin, Stefan F; Jahnen-Dechent, Willi; Greber, Urs F; Freudenberg, Marina A; Fejer, György

2017-08-01

The scavenger receptor MARCO is expressed in several subsets of naive tissue-resident macrophages and has been shown to participate in the recognition of various bacterial pathogens. However, the role of MARCO in antiviral defense is largely unexplored. Here, we investigated whether MARCO might be involved in the innate sensing of infection with adenovirus and recombinant adenoviral vectors by macrophages, which elicit vigorous immune responses in vivo Using cells derived from mice, we show that adenovirus infection is significantly more efficient in MARCO-positive alveolar macrophages (AMs) and in AM-like primary macrophage lines (Max Planck Institute cells) than in MARCO-negative bone marrow-derived macrophages. Using antibodies blocking ligand binding to MARCO, as well as gene-deficient and MARCO-transfected cells, we show that MARCO mediates the rapid adenovirus transduction of macrophages. By enhancing adenovirus infection, MARCO contributes to efficient innate virus recognition through the cytoplasmic DNA sensor cGAS. This leads to strong proinflammatory responses, including the production of interleukin-6 (IL-6), alpha/beta interferon, and mature IL-1α. These findings contribute to the understanding of viral pathogenesis in macrophages and may open new possibilities for the development of tools to influence the outcome of infection with adenovirus or adenovirus vectors. IMPORTANCE Macrophages play crucial roles in inflammation and defense against infection. Several macrophage subtypes have been identified with differing abilities to respond to infection with both natural adenoviruses and recombinant adenoviral vectors. Adenoviruses are important respiratory pathogens that elicit vigorous innate responses in vitro and in vivo The cell surface receptors mediating macrophage type-specific adenovirus sensing are largely unknown. The scavenger receptor MARCO is expressed on some subsets of naive tissue-resident macrophages, including lung alveolar macrophages

Status and advances of p53-gene therapy and radiotherapy in malignant tumor

International Nuclear Information System (INIS)

Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

2006-01-01

Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

OpenAIRE

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases

Science.gov (United States)

Sauter, Bernhard V.; Martinet, Olivier; Zhang, Wei-Jian; Mandeli, John; Woo, Savio L. C.

2000-04-01

Inhibition of angiogenesis has been shown to be an effective strategy in cancer therapy in mice. However, its widespread application has been hampered by difficulties in the large-scale production of the antiangiogenic proteins. This limitation may be resolved by in vivo delivery and expression of the antiangiogenic genes. We have constructed a recombinant adenovirus that expresses murine endostatin that is biologically active both in vitro, as determined in endothelial cell proliferation assays, and in vivo, by suppression of angiogenesis induced by vascular endothelial growth factor 165. Persistent high serum levels of endostatin (605-1740 ng/ml; mean, 936 ng/ml) were achieved after systemic administration of the vector to nude mice, which resulted in significant reduction of the growth rates and the volumes of JC breast carcinoma and Lewis lung carcinoma (P < 0.001 and P < 0.05, respectively). In addition, the endostatin vector treatment completely prevented the formation of pulmonary micrometastases in Lewis lung carcinoma (P = 0.0001). Immunohistochemical staining of the tumors demonstrated a decreased number of blood vessels in the treatment group versus the controls. In conclusion, the present study clearly demonstrates the potential of vector-mediated antiangiogenic gene therapy as a component in cancer therapy.

SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

OpenAIRE

Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

2015-01-01

Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

Science.gov (United States)

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-08-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

Intravascular local gene transfer mediated by protein-coated metallic stent.

Science.gov (United States)

Yuan, J; Gao, R; Shi, R; Song, L; Tang, J; Li, Y; Tang, C; Meng, L; Yuan, W; Chen, Z

2001-10-01

To assess the feasibility, efficiency and selectivity of adenovirus-mediated gene transfer to local arterial wall by protein-coated metallic stent. A replication-defective recombinant adenovirus carrying the Lac Z reporter gene for nuclear-specific beta-galactosidase (Ad-beta gal) was used in this study. The coating for metallic stent was made by immersing it in a gelatin solution containing crosslinker. The coated stents were mounted on a 4.0 or 3.0 mm percutaneous transluminal coronary angioplasty (PTCA) balloon and submersed into a high-titer Ad-beta gal viral stock (2 x 10(10) pfu/ml) for 3 min, and then implanted into the carotid arteries in 4 mini-swines and into the left anterior descending branch of the coronary artery in 2 mini-swines via 8F large lumen guiding catheters. The animals were sacrificed 7 (n = 4), 14 (n = 1) and 21 (n = 1) days after implantation, respectively. The beta-galactosidase expression was assessed by X-gal staining. The results showed that the expression of transgene was detected in all animal. In 1 of carotid artery with an intact intima, the beta-gal expression was limited to endothelial cells. In vessels with denuded endothelium, gene expression was found in the sub-intima, media and adventitia. The transfection efficiency of medial smooth muscle cells was 38.6%. In 2 animals sacrificed 7 days after transfection, a microscopic examination of X-gal-stained samples did not show evidence of transfection in remote organs and arterial segments adjacent to the treated arterial site. Adenovirus-mediated arterial gene transfer to endothelial, smooth muscle cells and adventitia by protein-coated metallic stent is feasible. The transfection efficiency is higher. The coated stent may act as a good carrier of adenovirus-mediated gene transfer and have a potential to prevent restenosis following PTCA.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

Science.gov (United States)

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

Uptake of 131I-FIAU in BMSCs infected by adenovirus vector-mediated HSV1-TK

International Nuclear Information System (INIS)

Zhang Binqing; Wu Tao; Sun Xun; An Rui

2010-01-01

Report gene HSV1-TK and therapy gene were connected by IRES, and recombinant adenovirus vector Ad5-TK-IRES-BDNF-EGFP was constructed and infected with BMSCs at MOI of 0, 50, 100, 150, 200 and 250, with the control recombinant adenovirus vector of Ad5-EGFP. Green fluorescence cell positive rate was observed under the microscopy. MTT assay was used to determine the cell proliferation. bFGF and EGF were used to induce the BMSCs, and RQ-PCR to determine target gene expression in infection BMSCs. Uptake of 131 I-FIAU was assessed by gamma counter. The data were processed by SPSS11.code. Recombinant adenovirus at MOI 150 had high infectionefficiency and low toxic in BMSCs. There was a strong relation between the mRNA expression of TK and BDNF in infection BMSCs. The significance between the infection BMSCs and control BMSCs for uptake of 131 I-FIAU at all the time points was t=23.06-173.83 and P 131 I-FIAU. This suggests a suitable gene vector for tracing genetically modified stem cells. (authors)

Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2005-01-01

In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

Energy Technology Data Exchange (ETDEWEB)

Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

2012-07-13

Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

TAF6delta controls apoptosis and gene expression in the absence of p53.

Directory of Open Access Journals (Sweden)

Emmanuelle Wilhelm

Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.

Directory of Open Access Journals (Sweden)

Julius W Kim

Full Text Available Vectors based on human adenovirus serotype 5 (HAdV-5 continue to show promise as delivery vehicles for cancer gene therapy. Nevertheless, it has become clear that therapeutic benefit is directly linked to tumor-specific vector localization, highlighting the need for tumor-targeted gene delivery. Aberrant glycosylation of cell surface glycoproteins and glycolipids is a central feature of malignant transformation, and tumor-associated glycoforms are recognized as cancer biomarkers. On this basis, we hypothesized that cancer-specific cell-surface glycans could be the basis of a novel paradigm in HAdV-5-based vector targeting.As a first step toward this goal, we constructed a novel HAdV-5 vector encoding a unique chimeric fiber protein that contains the tandem carbohydrate binding domains of the fiber protein of the NADC-1 strain of porcine adenovirus type 4 (PAdV-4. This glycan-targeted vector displays augmented CAR-independent gene transfer in cells with low CAR expression. Further, we show that gene transfer is markedly decreased in cells with genetic glycosylation defects and by inhibitors of glycosylation in normal cells.These data provide the initial proof-of-concept for HAdV-5 vector-mediated gene delivery based on the presence of cell-surface carbohydrates. Further development of this new targeting paradigm could provide targeted gene delivery based on vector recognition of disease-specific glycan biomarkers.

Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

Science.gov (United States)

Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

2010-04-15

Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances

International Nuclear Information System (INIS)

Zawacka-Pankau, Joanna; Krachulec, Justyna; Grulkowski, Ireneusz; Bielawski, Krzysztof P.; Selivanova, Galina

2008-01-01

Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT

Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

International Nuclear Information System (INIS)

Tong, Ying; Smith, M.A.; Tucker, S.B.

1997-01-01

Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

Suppression of leaky expression of adenovirus genes by insertion of microRNA-targeted sequences in the replication-incompetent adenovirus vector genome

Directory of Open Access Journals (Sweden)

Kahori Shimizu

2014-01-01

Full Text Available Leaky expression of adenovirus (Ad genes occurs following transduction with a conventional replication-incompetent Ad vector, leading to an induction of cellular immunity against Ad proteins and Ad protein-induced toxicity, especially in the late phase following administration. To suppress the leaky expression of Ad genes, we developed novel Ad vectors by incorporating four tandem copies of sequences with perfect complementarity to miR-122a or miR-142-3p into the 3′-untranslated region (UTR of the E2A, E4, or pIX gene, which were mainly expressed from the Ad vector genome after transduction. These Ad vectors easily grew to high titers comparable to those of a conventional Ad vector in conventional 293 cells. The leaky expression of these Ad genes in mouse organs was significantly suppressed by 2- to 100-fold, compared with a conventional Ad vector, by insertion of the miRNA-targeted sequences. Notably, the Ad vector carrying the miR-122a–targeted sequences into the 3′-UTR of the E4 gene expressed higher and longer-term transgene expression and more than 20-fold lower levels of all the Ad early and late genes examined in the liver than a conventional Ad vector. miR-122a–mediated suppression of the E4 gene expression in the liver significantly reduced the hepatotoxicity which an Ad vector causes via both adaptive and non-adaptive immune responses.

p53 and ATF4 mediate distinct and additive pathways to skeletal muscle atrophy during limb immobilization

Science.gov (United States)

Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.

2014-01-01

Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282

Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

International Nuclear Information System (INIS)

Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

1996-01-01

Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

International Nuclear Information System (INIS)

Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

2004-01-01

We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

International Nuclear Information System (INIS)

Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

2010-01-01

To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

International Nuclear Information System (INIS)

Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

2006-01-01

In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

The effect of adenovirus-mediated gene expression of FHIT in small cell lung cancer cells

DEFF Research Database (Denmark)

Zandi, Roza; Xu, Kai; Poulsen, Hans S

2011-01-01

The candidate tumor suppressor fragile histidine traid (FHIT) is frequently inactivated in small cell lung cancer (SCLC). Mutations in the p53 gene also occur in the majority of SCLC leading to the accumulation of the mutant protein. Here we evaluated the effect of FHIT gene therapy alone...

BS69 : A novel adenovirus E1A-associated protein that inhibits E1A transactivation

NARCIS (Netherlands)

Hateboer, G.; Gennissen, A.M.C.; Ramos, Y.F.M.; Kerkhoven, R.; Sonntag-Buck, V.; Stunnenberg, H.G.; Bernards, R.A.

1995-01-01

The adenovirus ElA gene products are nuclear phosphoproteins that can transactivate the other adenovirus early genes as well as several cellular genes, and can transform primary rodent cells in culture. Transformation and transactivation by ElA proteins is most likely to be mediated through

Estrogen-Related Receptor Alpha Confers Methotrexate Resistance via Attenuation of Reactive Oxygen Species Production and P53 Mediated Apoptosis in Osteosarcoma Cells

Directory of Open Access Journals (Sweden)

Peng Chen

2014-01-01

Full Text Available Osteosarcoma (OS is a malignant tumor mainly occurring in children and adolescents. Methotrexate (MTX, a chemotherapy agent, is widely used in treating OS. However, treatment failures are common due to acquired chemoresistance, for which the underlying molecular mechanisms are still unclear. In this study, we report that overexpression of estrogen-related receptor alpha (ERRα, an orphan nuclear receptor, promoted cell survival and blocked MTX-induced cell death in U2OS cells. We showed that MTX induced ROS production in MTX-sensitive U2OS cells while ERRα effectively blocked the ROS production and ROS associated cell apoptosis. Our further studies demonstrated that ERRα suppressed ROS induction of tumor suppressor P53 and its target genes NOXA and XAF1 which are mediators of P53-dependent apoptosis. In conclusion, this study demonstrated that ERRα plays an important role in the development of MTX resistance through blocking MTX-induced ROS production and attenuating the activation of p53 mediated apoptosis signaling pathway, and points to ERRα as a novel target for improving osteosarcoma therapy.

Adenovirus-mediated interleukin-12 gene transfer combined with cytosine deaminase followed by 5-fluorocytosine treatment exerts potent antitumor activity in Renca tumor-bearing mice

International Nuclear Information System (INIS)

Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo

2005-01-01

Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers

SCO2 induces p53-mediated apoptosis by Thr845 phosphorylation of ASK-1 and dissociation of the ASK-1-Trx complex.

Science.gov (United States)

Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam

2013-04-01

p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.

Redirecting adenovirus tropism by genetic, chemical, and mechanical modification of the adenovirus surface for cancer gene therapy.

Science.gov (United States)

Yoon, A-Rum; Hong, Jinwoo; Kim, Sung Wan; Yun, Chae-Ok

2016-06-01

Despite remarkable advancements, clinical evaluations of adenovirus (Ad)-mediated cancer gene therapies have highlighted the need for improved delivery and targeting. Genetic modification of Ad capsid proteins has been extensively attempted. Although genetic modification enhances the therapeutic potential of Ad, it is difficult to successfully incorporate extraneous moieties into the capsid and the engineering process is laborious. Recently, chemical modification of the Ad surface with nanomaterials and targeting moieties has been found to enhance Ad internalization into the target by both passive and active mechanisms. Alternatively, external stimulus-mediated targeting can result in selective accumulation of Ad in the tumor and prevent dissemination of Ad into surrounding nontarget tissues. In the present review, we discuss various genetic, chemical, and mechanical engineering strategies for overcoming the challenges that hinder the therapeutic efficacy of Ad-based approaches. Surface modification of Ad by genetic, chemical, or mechanical engineering strategies enables Ad to overcome the shortcomings of conventional Ad and enhances delivery efficiency through distinct and unique mechanisms that unmodified Ad cannot mimic. However, although the therapeutic potential of Ad-mediated gene therapy has been enhanced by various surface modification strategies, each strategy still possesses innate limitations that must be addressed, requiring innovative ideas and designs.

Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage

Directory of Open Access Journals (Sweden)

Marie-Jo Halaby

2015-01-01

Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.

p53 in differentiation of thyroid cancer

International Nuclear Information System (INIS)

Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

1993-01-01

P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

Energy Technology Data Exchange (ETDEWEB)

Nishida, Tamotsu, E-mail: nishida@gene.mie-u.ac.jp [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan); Yamada, Yoshiji [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan)

2011-03-11

Research highlights: {yields} SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. {yields} SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. {yields} SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. {yields} We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

International Nuclear Information System (INIS)

Nishida, Tamotsu; Yamada, Yoshiji

2011-01-01

Research highlights: → SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. → SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. → SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. → We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

Science.gov (United States)

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

Science.gov (United States)

He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

2010-08-27

P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

Use of a temperature-sensitive p53 mutant to evaluate mechanisms of 5-fluorodeoxyuridine-mediated radiosensitization

International Nuclear Information System (INIS)

Naida, J.D.; Davis, M.A.; Lawrence, T.S.

1996-01-01

Purpose/Objective: Evidence exists that fluorodeoxyuridine (FdUrd)-mediated radiosensitization occurs in HT29 human colon carcinoma cells (which are p53 mutant) when these cells progress past the G 1 /S boundary in the presence of the drug. It has been demonstrated that wild type p53 levels increase following fluoropyrimidine treatment and that G 1 arrest is associated with increased p53 levels. We hypothesized that the restoration of wild type p53 function might restore G 1 /S arrest after FdUrd treatment, and that this would prevent FdUrd-mediated radiosensitization. Similarly, we hypothesized that cells containing wild type p53 would not be radiosensitized by FdUrd. Materials and Methods: Two clones of HT29 human colon cancer cells (ts29-A and ts29-G) containing murine temperature-sensitive p53 were constructed using electroporation and Geneticin selection. Incubation of these cells at the permissive temperature of 32 deg. C produces wild type p53 function and at the non permissive temperature of 38 deg. C causes mutant p53 function. A G418 resistant control cell line was also constructed (HT29neo). Cells were incubated at either 32 deg. C or 38 deg. C for 24 hours prior to irradiation and with FdUrd (100 nM) or medium only during the last 14 hours of the temperature shift. To assess progression into S phase, single-parameter (propidium iodide (PI)) and two-parameter (PI and bromodeoxyuridine) flow cytometry were performed at the end of drug exposure. A standard clonogenic assay was used. Results: We found that when ts29-A and ts29-G cells were incubated at the non-permissive (inactive p53 conformation) temperature, they progressed into S phase following exposure to FdUrd and were radiosensitized (enhancement ratio 1.5) to a degree similar to that seen in parental HT29 cells. Cells incubated at the permissive (wild-type p53 conformation) temperature demonstrated G 1 arrest, S phase depletion, and G2 arrest. In addition, FdUrd-mediated radiosensitization was

Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

International Nuclear Information System (INIS)

Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

1996-01-01

Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in

Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

Directory of Open Access Journals (Sweden)

Jeyran eShahbazi

2013-05-01

Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

Directory of Open Access Journals (Sweden)

Alfredo Ribeiro-Silva

2003-06-01

Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

MiR-192-Mediated Positive Feedback Loop Controls the Robustness of Stress-Induced p53 Oscillations in Breast Cancer Cells.

Directory of Open Access Journals (Sweden)

Richard Moore

2015-12-01

Full Text Available The p53 tumor suppressor protein plays a critical role in cellular stress and cancer prevention. A number of post-transcriptional regulators, termed microRNAs, are closely connected with the p53-mediated cellular networks. While the molecular interactions among p53 and microRNAs have emerged, a systems-level understanding of the regulatory mechanism and the role of microRNAs-forming feedback loops with the p53 core remains elusive. Here we have identified from literature that there exist three classes of microRNA-mediated feedback loops revolving around p53, all with the nature of positive feedback coincidentally. To explore the relationship between the cellular performance of p53 with the microRNA feedback pathways, we developed a mathematical model of the core p53-MDM2 module coupled with three microRNA-mediated positive feedback loops involving miR-192, miR-34a, and miR-29a. Simulations and bifurcation analysis in relationship to extrinsic noise reproduce the oscillatory behavior of p53 under DNA damage in single cells, and notably show that specific microRNA abrogation can disrupt the wild-type cellular phenotype when the ubiquitous cell-to-cell variability is taken into account. To assess these in silico results we conducted microRNA-perturbation experiments in MCF7 breast cancer cells. Time-lapse microscopy of cell-population behavior in response to DNA double-strand breaks, together with image classification of single-cell phenotypes across a population, confirmed that the cellular p53 oscillations are compromised after miR-192 perturbations, matching well with the model predictions. Our study via modeling in combination with quantitative experiments provides new evidence on the role of microRNA-mediated positive feedback loops in conferring robustness to the system performance of stress-induced response of p53.

Essentials in clinical application of p53 for tumors intervention-example of liver cancer

International Nuclear Information System (INIS)

Guan Yongsong; He Qing

2008-01-01

Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)

The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

Directory of Open Access Journals (Sweden)

Jennifer M. Smith

2007-12-01

Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

Science.gov (United States)

Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

2005-07-01

To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

Directory of Open Access Journals (Sweden)

Wei Xu

2010-08-01

Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

The Transcriptional Landscape of p53 Signalling Pathway

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2017-06-01

Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

Targeting the p53 Pathway in Ewing Sarcoma

Science.gov (United States)

Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

2011-01-01

The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

p53 and the pathogenesis of skin cancer

International Nuclear Information System (INIS)

Benjamin, Cara L.; Ananthaswamy, Honnavara N.

2007-01-01

The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

P53-mediated rapid induction of apoptosis conveys resistance to viral infection in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Bo Liu

2013-02-01

Full Text Available Arthropod-borne pathogens account for millions of deaths each year. Understanding the genetic mechanisms controlling vector susceptibility to pathogens has profound implications for developing novel strategies for controlling insect-transmitted infectious diseases. The fact that many viruses carry genes that have anti-apoptotic activity has long led to the hypothesis that induction of apoptosis could be a fundamental innate immune response. However, the cellular mechanisms mediating the induction of apoptosis following viral infection remained enigmatic, which has prevented experimental verification of the functional significance of apoptosis in limiting viral infection in insects. In addition, studies with cultured insect cells have shown that there is sometimes a lack of apoptosis, or the pro-apoptotic response happens relatively late, thus casting doubt on the functional significance of apoptosis as an innate immunity. Using in vivo mosquito models and the native route of infection, we found that there is a rapid induction of reaper-like pro-apoptotic genes within a few hours following exposure to DNA or RNA viruses. Recapitulating a similar response in Drosophila, we found that this rapid induction of apoptosis requires the function of P53 and is mediated by a stress-responsive regulatory region upstream of reaper. More importantly, we showed that the rapid induction of apoptosis is responsible for preventing the expression of viral genes and blocking the infection. Genetic changes influencing this rapid induction of reaper-like pro-apoptotic genes led to significant differences in susceptibility to viral infection.

The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.

Science.gov (United States)

Gong, Yi; Ju, Chenyu; Zhang, Xiaobo

2015-10-01

The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.

Innate Functions of Immunoglobulin M Lessen Liver Gene Transfer with Helper-Dependent Adenovirus

Science.gov (United States)

Unzu, Carmen; Morales-Kastresana, Aizea; Sampedro, Ana; Serrano-Mendioroz, Irantzu; Azpilikueta, Arantza; Ochoa, María Carmen; Dubrot, Juan; Martínez-Ansó, Eduardo

2014-01-01

The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA) vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors. PMID:24465560

Innate functions of immunoglobulin M lessen liver gene transfer with helper-dependent adenovirus.

Directory of Open Access Journals (Sweden)

Carmen Unzu

Full Text Available The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors.

An early function of the adenoviral E1B 55 kDa protein is required for the nuclear relocalization of the cellular p53 protein in adenovirus-infected normal human cells

International Nuclear Information System (INIS)

Cardoso, F.M.; Kato, Sayuri E.M.; Huang Wenying; Flint, S. Jane; Gonzalez, Ramon A.

2008-01-01

It is well established that the human subgroup C adenovirus type 5 (Ad5) E1B 55 kDa protein can regulate the activity and concentration of the cellular tumor suppressor, p53. However, the contribution(s) of these functions of the E1B protein to viral reproduction remains unclear. To investigate this issue, we examined properties of p53 in normal human cells infected by E1B mutant viruses that display defective entry into the late phase or viral late mRNA export. The steady-state concentrations of p53 were significantly higher in cells infected by the E1B 55 kDa null mutant Hr6 or three mutants carrying small insertions in the E1B 55 kDa protein coding sequence than in Ad5-infected cells. Nevertheless, none of the mutants induced apoptosis in infected cells. Rather, the localization of p53 to E1B containing nuclear sites observed during infection by Ad5 was prevented by mutations that impair interaction of the E1B protein with p53 and/or with the E4 Orf6 protein. These results indicate that the E1B protein fulfills an early function that correlates efficient entry into the late phase with the localization of E1B and p53 in the nucleus of Ad5-infected normal human cells

Integration of Genomic, Biologic, and Chemical Approaches to Target p53 Loss and Gain-of-Function in Triple Negative Breast Cancer

Science.gov (United States)

2016-09-01

in this progress report: p53 triple-negative breast cancer subtypes gene expression somatic cell genetics CRISPR / Cas 3. ACCOMPLISHMENTS Major...report, we described the creation of an isogenic p53 mutant TNBC cell line panel using CRISPR / Cas -mediated genome editing8 and the resultant...LOF null state. To validate that mutant p53 is directly responsible for this altered transcription, we will use the same CRISPR -mediated genome

The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

Science.gov (United States)

Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

2010-01-01

Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

[Construction and expression of a recombinant adenovirus with LZP3].

Science.gov (United States)

Chen, Bang-dang; Zhang, Fu-chun; Sun, Mei-yu; Li, Yi-jie; Ma, Zheng-hai

2007-08-01

To explore a new immunocontraceptive vaccine and construct an attenuated recombinant adenoviral vaccine against Lagurus lagurus zona pellucida 3(LZP3). LZP3 gene was subcloned into the shuttle vector pShuttle-CMV, and then a two-step transformation procedure was employed to construct a recombinant adenoviral plasmid with LZP3, which was digested with Pac I and transfected into HEK293 cells to package recombinant adenovirus particles. Finally, HeLa cells were infected by the recombinant adenovirus. LZP3 gene was detected from the recombinant virus by PCR, and its transcription and expression were analyzed by RT-PCR and Western blot. Recombinant adenovirus vector pAd-LZP3 with LZP3 gene was constructed by homologous recombination in E.coli, and a recombinant adenovirus was obtained by transfecting HEK293 cells with pAd-LZP3. PCR test indicated that LZP3 gene was successfully integrated into the adenoviral genome, and the titer of the recombinant adenovirus reached 1.2x10(10) pfu/L. The transcription and expression of LZP3 gene in the infected HeLa cells were confirmed by RT-PCR and Western blot. The recombinant adenovirus RAd-LZP3 can be successfully expressed in the infected HeLa cells, which lays the foundation for further researches into immunizing animals with RAd-LZP3.

The expanding universe of p53 targets.

Science.gov (United States)

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

Impact of Alu repeats on the evolution of human p53 binding sites

Directory of Open Access Journals (Sweden)

Sirotin Michael V

2011-01-01

Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu

Evidence of molecular evolution driven by recombination events influencing tropism in a novel human adenovirus that causes epidemic keratoconjunctivitis.

Directory of Open Access Journals (Sweden)

Michael P Walsh

2009-06-01

Full Text Available In 2005, a human adenovirus strain (formerly known as HAdV-D22/H8 but renamed here HAdV-D53 was isolated from an outbreak of epidemic keratoconjunctititis (EKC, a disease that is usually caused by HAdV-D8, -D19, or -D37, not HAdV-D22. To date, a complete change of tropism compared to the prototype has never been observed, although apparent recombinant strains of other viruses from species Human adenovirus D (HAdV-D have been described. The complete genome of HAdV-D53 was sequenced to elucidate recombination events that lead to the emergence of a viable and highly virulent virus with a modified tropism. Bioinformatic and phylogenetic analyses of this genome demonstrate that this adenovirus is a recombinant of HAdV-D8 (including the fiber gene encoding the primary cellular receptor binding site, HAdV-D22, (the epsilon determinant of the hexon gene, HAdV-D37 (including the penton base gene encoding the secondary cellular receptor binding site, and at least one unknown or unsequenced HAdV-D strain. Bootscanning analysis of the complete genomic sequence of this novel adenovirus, which we have re-named HAdV-D53, indicated at least five recombination events between the aforementioned adenoviruses. Intrahexon recombination sites perfectly framed the epsilon neutralization determinant that was almost identical to the HAdV-D22 prototype. Additional bootscan analysis of all HAdV-D hexon genes revealed recombinations in identical locations in several other adenoviruses. In addition, HAdV-D53 but not HAdV-D22 induced corneal inflammation in a mouse model. Serological analysis confirmed previous results and demonstrated that HAdV-D53 has a neutralization profile representative of the epsilon determinant of its hexon (HAdV-D22 and the fiber (HAdV-D8 proteins. Our recombinant hexon sequence is almost identical to the hexon sequences of the HAdV-D strain causing EKC outbreaks in Japan, suggesting that HAdV-D53 is pandemic as an emerging EKC agent. This documents

Deficiency of G1 regulators P53, P21Cip1 and/or pRb decreases hepatocyte sensitivity to TGFβ cell cycle arrest

Directory of Open Access Journals (Sweden)

Harrison David J

2007-11-01

Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of

Adenovirus-derived vectors for prostate cancer gene therapy

Czech Academy of Sciences Publication Activity Database

de Vrij, J.; Willemsen, R. A.; Lindholm, L.; Hoeben, R. C.; Bangma, Ch. H.; Barber, Ch.; Behr, J.-P.; Briggs, S.; Carlisle, R.; Cheng, W.-S.; Dautzenberg, I. J. C.; de Ridder, C.; Dzojic, H.; Erbacher, P.; Essand, M.; Fisher, K.; Frazier, A.; Georgopoulos, L. J.; Jennings, I.; Kochanek, S.; Koppers-Lalic, D.; Kraaij, R.; Kreppel, F.; Magnusson, M.; Maitland, N.; Neuberg, P.; Nugent, R.; Ogris, M.; Remy, J.-S.; Scaife, M.; Schenk, E.; Schooten, E.; Seymour, L.; Slade, M.; Szyjanowicz, P.; Totterman, T.; Uil, T. G.; Ulbrich, Karel; van der Weel, L.; van Weerden, W.; Wagner, E.; Zuber, G.

2010-01-01

Roč. 21, č. 7 (2010), s. 795-805 ISSN 1043-0342 EU Projects: European Commission(XE) 512087 - GIANT Keywords : adenovirus * gene delivery * prostate cancer Subject RIV: CD - Macromolecular Chemistry Impact factor: 4.829, year: 2010

Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

International Nuclear Information System (INIS)

Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil

2007-01-01

Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent

p53 downregulates the Fanconi anaemia DNA repair pathway.

Science.gov (United States)

Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

2016-04-01

Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

Exploring a minimal two-component p53 model

International Nuclear Information System (INIS)

Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

2010-01-01

The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

MicroRNA-mediated suppression of oncolytic adenovirus replication in human liver.

Directory of Open Access Journals (Sweden)

Erkko Ylösmäki

Full Text Available MicroRNAs (miRNAs are important and ubiquitous regulators of gene expression that can suppress their target genes by translational inhibition as well as mRNA destruction. Cell type-specific miRNA expression patterns have been successfully exploited for targeting the expression of experimental and therapeutic gene constructs, for example to reduce pathogenic effects of cancer virotherapy in normal tissues. In order to avoid liver damage associated with systemic or intrahepatic delivery of oncolytic adenoviruses we have introduced the concept of suppressing adenovirus replication in hepatic cells by inserting target elements for the liver-specific miR122 into the viral genome. Here we show using ex vivo cultured tissue specimens that six perfectly complementary miR122 target sites in the 3' untranslated region of the viral E1A gene are sufficient in the absence of any other genetic modifications to prevent productive replication of serotype 5 adenovirus (Ad5 in normal human liver. This modification did not compromise the replicative capacity of the modified virus in cancer tissue derived from a colon carcinoma liver metastasis or its oncolytic potency in a human lung cancer xenograft mouse model. Unlike wild-type Ad5, the modified virus did not result in increased serum levels of liver enzymes in infected mice. These results provide a strong preclinical proof of concept for the use of miR122 target sites for reducing the risk of liver damage caused by oncolytic adenoviruses, and suggest that ectopic miR122 target elements should be considered as an additional safety measure included in any therapeutic virus or viral vector posing potential hazard to the liver.

p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

Science.gov (United States)

Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

2002-04-10

We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

Directory of Open Access Journals (Sweden)

Kazuho Nishimura

2015-03-01

Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

p53 Gene (NY-CO-13 Levels in Patients with Chronic Myeloid Leukemia: The Role of Imatinib and Nilotinib

Directory of Open Access Journals (Sweden)

Hayder M. Al-kuraishy

2018-01-01

Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.

Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

Directory of Open Access Journals (Sweden)

Villiard Éric

2007-09-01

Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

Science.gov (United States)

Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

2009-01-01

Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Zhihong CHEN

2011-10-01

Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

Bladder-like graphical representation of p53 gene alterations in some human cancers

International Nuclear Information System (INIS)

Helal, N.L.; Dorrah, M.; LI, C.

2005-01-01

the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

miR-34 and p53: New Insights into a Complex Functional Relationship.

Directory of Open Access Journals (Sweden)

Francisco Navarro

Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

Science.gov (United States)

Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

2010-12-01

Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

International Nuclear Information System (INIS)

Milner, J.; Gamble, J.

1985-01-01

The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

International Nuclear Information System (INIS)

Hu, Duanmin; Su, Cunjin; Jiang, Min; Shen, Yating; Shi, Aiming; Zhao, Fenglun; Chen, Ruidong; Shen, Zhu; Bao, Junjie; Tang, Wen

2016-01-01

There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.

Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

Energy Technology Data Exchange (ETDEWEB)

Hu, Duanmin [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Su, Cunjin [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Jiang, Min [Department of Breast Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Yating [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shi, Aiming; Zhao, Fenglun [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Chen, Ruidong [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Zhu [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Bao, Junjie, E-mail: baojjsdfey@sina.com [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Tang, Wen, E-mail: sztangwen@163.com [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China)

2016-03-04

There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.

Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

NARCIS (Netherlands)

Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

1993-01-01

Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

CD95 is part of a let-7/p53/miR-34 regulatory network.

Directory of Open Access Journals (Sweden)

Annika Hau

Full Text Available The death receptor CD95 (APO-1/Fas mediates apoptosis induction upon ligation by its cognate ligand CD95L. Two types of CD95 signaling pathways have been identified, which are characterized by the absence (Type I or presence (Type II of mitochondrial involvement. Micro(miRNAs are small noncoding RNAs that negatively regulate gene expression. They are important regulators of differentiation processes and are found frequently deregulated in many human cancers. We recently showed that Type I cells express less of the differentiation marker miRNA let-7 and, hence, likely represent more advanced tumor cells than the let-7 high expressing Type II cells. We have now identified miR-34a as a selective marker for cells that are sensitive to CD95-mediated apoptosis. Both CD95 and miR-34a are p53 target genes, and consequently, both the sensitivity of cancer cells to CD95-mediated apoptosis and the ability to respond to p53 mediated DNA genotoxic stress are linked. Interestingly, while miR-34a was found to positively correlate with the ability of cells to respond to genotoxic stress, let-7 was negatively correlated. The expression level of CD95 inversely correlated with the expression of let-7 suggesting regulation of let-7 expression by CD95. To test a link between p53 and miR-34a, we altered the expression of CD95. This affected the ability of cells to activate p53 and to regulate miR-34a. Our data point to a novel regulatory network comprising p53, CD95, let-7, and miR-34a that affects cancer cell survival, differentiation, and sensitivity to apoptotic signals. The possible relevance of this regulatory network for cancer stem cells is discussed.

The genetic alteration of p53 in esophageal cancer

Energy Technology Data Exchange (ETDEWEB)

Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

1996-01-01

Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

Transcriptome profiling identifies genes and pathways deregulated upon floxuridine treatment in colorectal cancer cells harboring GOF mutant p53

Directory of Open Access Journals (Sweden)

Arindam Datta

2016-06-01

Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.

Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

International Nuclear Information System (INIS)

Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

2006-01-01

The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

Rapid detection of single nucleotide mutation in p53 gene based on ...

Indian Academy of Sciences (India)

mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

Chemical Variations on the p53 Reactivation Theme

Directory of Open Access Journals (Sweden)

Carlos J. A. Ribeiro

2016-05-01

Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

Science.gov (United States)

Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

1996-09-01

Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

Science.gov (United States)

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

International Nuclear Information System (INIS)

Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang

2006-01-01

HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties

Effect of radon and its progeny on the expression and mutation of p53 in lung tissues of mice

International Nuclear Information System (INIS)

Piao Chunnan; Tian Mei; Liu Jianxiang; Ruan Jianlei; Su Xu

2010-01-01

Objective: To explore the effect of radon and its progeny on the expression and mutations of p53 in lung tissue of mouse model. Methods: Apoptosis was detected by terminal deoxynucleotidy transferase-mediated dUTP-biotin nick end labeling. The expression of p53 gene was analyzed by immunohistochemistry, Western blot and realtime-PCR. PCR-SSCP was used to detect the mutation of p53 in lung tissues. Results: Compared with those in the control group, the apoptotic index were increased significantly in 30 WLM and 60 WLM groups (t=18.11, -10.30, P<0.05). The p53 protein was increased significantly (t=-11.08, P<0.05; t=-7.00, P<0.05) in 30 WLM and 60 WLM groups. The mutation of p53 gene was not detected in lungs of radon-exposure mice. Conclusions: Lung and bronchus might be the targets of radon and its progeny, and p53 gene plays an important role in the progression of radon-induced lung injury. (authors)

The PRR11-SKA2 Bidirectional Transcription Unit Is Negatively Regulated by p53 through NF-Y in Lung Cancer Cells

Directory of Open Access Journals (Sweden)

Yitao Wang

2017-03-01

Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.

Regulation of autophagy by cytoplasmic p53.

Science.gov (United States)

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

Energy Technology Data Exchange (ETDEWEB)

Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

2002-03-01

The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

Directory of Open Access Journals (Sweden)

Rashid Mir

2016-01-01

Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

p53 Acetylation: Regulation and Consequences

International Nuclear Information System (INIS)

Reed, Sara M.; Quelle, Dawn E.

2014-01-01

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

p53 Acetylation: Regulation and Consequences

Energy Technology Data Exchange (ETDEWEB)

Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

2014-12-23

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

NARCIS (Netherlands)

Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

1996-01-01

Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline

Directory of Open Access Journals (Sweden)

Noriko Mori

2004-10-01

Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.

Adenovirus-mediated sphingomyelin synthase 2 increases atherosclerotic lesions in ApoE KO mice

Directory of Open Access Journals (Sweden)

Zhao Yarui

2011-01-01

Full Text Available Abstract Background Sphingomyelin synthase 2 (SMS2 contributes to de novo sphingomyelin (SM biosynthesis. Its activity is related to SM levels in the plasma and the cell membrane. In this study, we investigated the possibility of a direct relationship between SMS and atherosclerosis. Methods The Adenovirus containing SMS2 gene was given into 10-week ApoE KO C57BL/6J mice by femoral intravenous injection. In the control group, the Adenovirus containing GFP was given. To confirm this model, we took both mRNA level examination (RT-PCR and protein level examination (SMS activity assay. Result We generated recombinant adenovirus vectors containing either human SMS2 cDNA (AdV-SMS2 or GFP cDNA (AdV-GFP. On day six after intravenous infusion of 2 × 1011 particle numbers into ten-week-old apoE KO mice, AdV-SMS2 treatment significantly increased liver SMS2 mRNA levels and SMS activity (by 2.7-fold, 2.3-fold, p Conclusions Our results present direct morphological evidence for the pro-atherogenic capabilities of SMS2. SMS2 could be a potential target for treating atherosclerosis.

Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

Science.gov (United States)

Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

2015-12-01

Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

Science.gov (United States)

Stępiński, Dariusz

2016-08-01

Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

International Nuclear Information System (INIS)

Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

2009-01-01

A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

Directory of Open Access Journals (Sweden)

Peiyuan Jia

Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?

International Nuclear Information System (INIS)

Blackburn, Anneke C; Jerry, D Joseph

2002-01-01

The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer

Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

Science.gov (United States)

Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

2013-01-01

Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

P53 Is Involved in a Three-Dimensional Architecture-Mediated Decrease in Chemosensitivity in Colon Cancer.

Science.gov (United States)

He, Jianming; Liang, Xi; Luo, Fen; Chen, Xuedan; Xu, Xueqing; Wang, Fengchao; Zhang, Zhenping

2016-01-01

Three-dimensional (3D) culture models represent a better approximation of solid tumor tissue architecture, especially cell adhesion, in vivo than two-dimensional (2D) cultures do. Here, we explored the role of architecture in chemosensitivity to platinum in colon cancer. Under the 3D culture condition, colon cancer cells formed multicellular spheroids, consisting of layers of cells. 3D cultures displayed significantly decreased sensitivity to platinum compared with 2D cultures. Platinum increased p53 in a dose-dependent and time-dependent manner. There was no detectable difference in basal p53 levels between 3D cultures and 2D cultures but cisplatin induced less p53 in both HCT116 3D cultures and LoVo 3D cultures. It was not due to cisplatin concentration because cisplatin induced similar γ-H2AX in 3D vs 2D. Knockdown of p53 significantly decreased sensitivity to platinum in 3D cultures. Knockdown of p53 decreased cleaved caspase 3 and apoptosis induced by cisplatin. These findings indicate that 3D architecture confers decreased chemosensitivity to platinum and p53 is involved in the mechanism. Knockdown of p53 decreased cisplatin's induction of c-Jun N-terminal kinase 1/2 (JNK1/2) activation, whereas inhibition of JNK1/2 activation increased chemosensitivity. Inhibition of p38 activation decreased cisplatin's induction of p53, but no difference in p38 activation by cisplatin was observed between 2D cultures and 3D cultures. Taken together, our results suggest that p53 is involved in a 3D architecture-mediated decrease in chemosensitivity to platinum in colon cancer. Mitogen-activated protein kinases (JNK1/2 and p38) do not play a dominant role in the mechanism.

Battle Against Cancer: An Everlasting Saga of p53

Directory of Open Access Journals (Sweden)

Qian Hao

2014-12-01

Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer

International Nuclear Information System (INIS)

Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong

2009-01-01

Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their

MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

Science.gov (United States)

Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

2016-01-07

The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

Adenovirus-mediated heme oxygenase-1 gene transfer into rabbit ocular tissues.

Science.gov (United States)

Abraham, N G; da Silva, J L; Lavrovsky, Y; Stoltz, R A; Kappas, A; Dunn, M W; Schwartzman, M L

1995-10-01

Heme oxygenase-1 (HO-1) is a stress protein induced up to 100-fold within a few hours after exposure to oxidative stress, and it has been shown to counteract oxidative injury induced by ultraviolet light or free radicals. The current study was undertaken to determine whether the HO-1 gene can be introduced into adult rabbit ocular tissues by microinjection of a recombinant replication-deficient adenovirus human HO-1 cDNA (Adv-HHO). Human HO-1 gene was used for transfection studies to differentiate endogenous from transfected HO. The purified Adv-HHO construct (10(8) pfu/ml) was mixed with lipofectamine and microinjected into the anterior chamber, vitreous cavity, and subretinal space of New Zealand rabbit eyes. After 2 weeks, total RNA was extracted from different ocular tissues, reverse transcription-polymerase chain reaction was performed using specific human HO-1 primers, and amplification products were subjected to Southern hybridization. Transfection with the Adv-HHO construct into rabbit corneal epithelial cells in culture resulted in a functional expression of the human HO-1 gene; the human HO-1 mRNA was detected, and enzyme activity increased threefold. Human HO-1 mRNA was detected in the retina after microinjection of the Adv-HHO construct into the subretinal space. Microinjection into the vitreous resulted in HO-1 mRNA expression in the corneal endothelium, iris, lens, and retina; after intracameral injection of the Adv-HHO construct, human HO-1 mRNA was detected in corneal epithelium and endothelium, ciliary body, lens, and iris. Regardless of the injection site, transfected human HO-1 mRNA was undetectable in tissues outside the eye, that is, brain, liver, and kidney. These results demonstrated a tissue-selective functional transfer of the human HO-1 gene into rabbit ocular tissues in vivo. This technique may be a promising means for delivering HO-1 gene in vivo as a protective mechanism against oxidative stress that contributes to the pathogenesis of

[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

Science.gov (United States)

Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

2012-01-01

In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

Directory of Open Access Journals (Sweden)