DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing
2011-12-01
Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang
2008-01-01
This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi
2015-01-01
Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
International Nuclear Information System (INIS)
Egami, Takuya; Ohuchida, Kenoki; Yasui, Takaharu; Onimaru, Manabu; Toma, Hiroki; Sato, Norihiro; Tanaka, Masao; Mizumoto, Kazuhiro; Matsumoto, Kunio
2009-01-01
Adenovirus-mediated gene therapy is a promising approach for the treatment of pancreatic cancer. We previously reported that radiation enhanced adenovirus-mediated gene expression in pancreatic cancer, suggesting that adenoviral gene therapy might be more effective in radioresistant pancreatic cancer cells. In the present study, we compared the transduction efficiency of adenovirus-delivered genes in radiosensitive and radioresistant cells, and investigated the underlying mechanisms. We used an adenovirus expressing the hepatocyte growth factor antagonist, NK4 (Ad-NK4), as a representative gene therapy. We established two radioresistant human pancreatic cancer cell lines using fractionated irradiation. Radiosensitive and radioresistant pancreatic cancer cells were infected with Ad-NK4, and NK4 levels in the cells were measured. In order to investigate the mechanisms responsible for the differences in the transduction efficiency between these cells, we measured expression of the genes mediating adenovirus infection and endocytosis. The results revealed that NK4 levels in radioresistant cells were significantly lower (P<0.01) than those in radiosensitive cells, although there were no significant differences in adenovirus uptake between radiosensitive cells and radioresistant cells. Integrin β3 was up-regulated and the Coxsackie virus and adenovirus receptor was down-regulated in radioresistant cells, and inhibition of integrin β3 promoted adenovirus gene transfer. These results suggest that inhibition of integrin β3 in radioresistant pancreatic cancer cells could enhance adenovirus-mediated gene therapy. (author)
Energy Technology Data Exchange (ETDEWEB)
Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying
2007-01-01
Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)
International Nuclear Information System (INIS)
Ichiba, Miho; Shimomura, Takashi; Murai, Rie; Hashiguchi, Koichi; Saeki, Toshiya; Yoshida, Yoko; Kanbe, Takamasa; Tanabe, Naotada; Tsuchiya, Hiroyuki; Miura, Norimasa; Tajima, Fumihito; Kurimasa, Akihiro; Hamada, Hirofumi; Shiota, Goshi
2005-01-01
Thrombopoietin (TPO) is the growth factor for megakaryocytes and platelets, however, it also acts as a potent regulator of stem cell proliferation. To examine the significance of TPO expression in proliferation of hepatic oval cells, the effect of adenovirus-mediated TPO gene transfer into livers of the Solt-Farber model, which mimics the condition where liver regeneration is impaired, was examined. Hepatic TPO mRNA peaked its expression at 2 days after gene transduction and then gradually decreased. The peripheral platelet number began to increase at 4 days (P < 0.05) and reached its plateau at 9 days (P < 0.01). Oval cells expressed c-Mpl, a receptor for TPO as well as immature hematopoietic and hepatocytic surface markers such as CD34 and AFP. The proliferating cell nuclear antigen-positive oval cells in rats into which adenovirus-TPO gene was transferred at 7 and 9 days were significantly greater than those in adenovirus-LacZ gene transferred (P < 0.05, each), and the total numbers of oval cells in the adenovirus-TPO gene transferred at 9 and 13 days were also significantly greater than those in adenovirus-LacZ gene transferred (P < 0.05, each). Expression of SCF protein was increased at 4, 7, and 9 days by TPO gene administration and that of c-Kit was increased at 4 and 7 days. These data suggest that adenovirus-mediated TPO gene transfer stimulated oval cell proliferation in liver as well as increasing peripheral platelet counts, emphasizing the significance of the TPO/c-Mpl system in proliferation of hepatic oval cells
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
International Nuclear Information System (INIS)
Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry
1997-01-01
Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the
The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy
International Nuclear Information System (INIS)
Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.
1996-01-01
cellular phenotypes, including the radioresistant phenotype. Pre-clinical studies suggest that these phenotypes may be reversed using adenovirus-mediated gene therapy or pharmacologic strategies designed to re-institute WTp53 protein function. Our analysis of the published data strongly argues for the use offunctional assays for the determination of WTp53 protein function in studies which attempt to correlate normal and tumour tissue radioresponse with p53 genotype, or p53 protein expression
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
Recombinant adenovirus-mediated gene transfer suppresses experimental arthritis
Directory of Open Access Journals (Sweden)
E. Quattrocchi
2011-09-01
Full Text Available Collagen Induced Arthritis (CIA is a widely studied animal model to develop and test novel therapeutic approaches for treating Rheumatoid Arthritis (RA in humans. Soluble Cytotoxic T-Lymphocyte Antigen 4 (CTLA4-Ig, which binds B7 molecule on antigen presenting cells and blocks CD28 mediated T-lymphocyte activation, has been shown to ameliorate experimental autoimmune diseases such as lupus, diabetes and CIA. Objective of our research was to investigate in vivo the effectiveness of blocking the B7/CD28 T-lymphocyte co-stimulatory pathway, utilizing a gene transfer technology, as a therapeutic strategy against CIA. Replication-deficient adenoviruses encoding a chimeric CTLA4-Ig fusion protein, or β-galactosidase as control, have been injected intravenously once at arthritis onset. Disease activity has been monitored by the assessment of clinical score, paw thickness and type II collagen (CII specific cellular and humoral immune responses for 21 days. The adenovirally delivered CTLA4-Ig fusion protein at a dose of 2×108 pfu suppressed established CIA, whereas the control β-galactosidase did not significantly affect the disease course. CII-specific lymphocyte proliferation, IFNg production and anti-CII antibodies were significantly reduced by CTLA4-Ig treatment. Our results demonstrate that blockade of the B7/CD28 co-stimulatory pathway by adenovirus-mediated CTLA4-Ig gene transfer is effective in treating established CIA suggesting its potential in treating RA.
Long, Qifang; Yang, Ru; Lu, Weixian; Zhu, Weipei; Zhou, Jundong; Zheng, Cui; Zhou, Dongmei; Yu, Ling; Wu, Jinchang
2017-01-01
Cancer stem cells are a small subset of cancer cells that contribute to cancer progression, metastasis, chemoresistance and recurrence. CD133-positive (CD133+) ovarian cancer cells have been identified as ovarian cancer stem cells. Adenovirus-mediated gene therapy is an innovative therapeutic method for cancer treatment. In the present study, we aimed to develop a new gene therapy to specifically eliminate CD133+ ovarian cancer stem cells by targeting CD133. We used the Cre/LoxP system to augment the selective expression of the truncated Bid (tBid) gene as suicide gene therapy in CD133+ ovarian cancer stem cells. The adenovirus (Ad)-CD133-Cre expressing Cre recombinase under the control of the CD133 promoter and Ad-CMV-LoxP-Neo-LoxP-tBid expressing tBid under the control of the CMV promoter were successfully constructed using the Cre/LoxP switching system. The co-infection of Ad-CMV-LoxP-Neo-LoxP-tBid and Ad-CD133-Cre selectively induced tBid overexpression, which inhibited cell growth and triggered the cell apoptosis of CD133+ ovarian cancer stem cells. The Cre/LoxP system-mediated tBid overexpression activated the pro-apoptotic signaling pathway and augmented the cytotoxic effect of cisplatin in CD133+ ovarian cancer stem cells. Furthermore, in xenograft experiments, co-infection with the two recombinant adenoviruses markedly suppressed tumor growth in vivo and promoted cell apoptosis in tumor tissues. Taken together, the present study provides evidence that the adenovirus-mediated tBid overexpression induced by the Cre/LoxP system can effectively eliminate CD133+ ovarian cancer stem cells, representing a novel therapeutic strategy for the treatment of ovarian cancer.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Adenovirus-mediated IL-12 gene therapy in combination with radiotherapy for murine liver cancer
International Nuclear Information System (INIS)
Wei Daoyan; Dai Bingbing; Wang Zhonghe; Chen Shishu
2001-01-01
Objective: To investigate the synergistic antitumor effects of adenovirus-mediated IL-12 gene therapy in combination with radiotherapy in mice bearing liver cancer. Methods: Balb/c mice bearing liver cancer received the treatment at day 1 with tumor local irradiation (TLI) of 20 Gy or mask irradiation when tumor size reached 0.6-1.0 cm. Within 1 hour after irradiation, adenovirus containing IL-12 gene or PBS was intra-tumor injected once a week. Forty-eight hours after the second injection, IFN-γ levels in sera and the supernatant of cultured spleen cells were assayed by ELISA, CTL activity of spleen cells was measured by 3 H-TdR release assay, and phenotypes of tumor-infiltrating lymphocytes were analysed by immunohistochemical staining. Results: The growth of tumors in animals treated with a combination of IL-12 gene therapy and TLI was inhibited more significantly than those with either single treatment (P + and CD8 + lymphocyte infiltration and tumor-specific cytolytic activities, and the levels of IFN-γ in sera were higher in IL-12 gene therapy and IL-12 gene therapy combined with TLI groups. Conclusion: These results suggest that IL-12 gene therapy combined with radiotherapy is more effective than both single treatment modalities and can induce specific antitumor immuno-response greatly
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
undergoing phase I trials for the potential treatment of lung, breast, ovarian, bladder, liver and brain cancers. Introgen and Aventis Pharma had signed a Cooperative Research and Development Agreement (CRADA) with the National Cancer Institute (NCI). NCI will sponsor clinical trials to evaluate and develop RPR/INGN 201 as a potential anticancer agent for these cancer indications. The trials conducted under a NCI-sponsored IND will evaluate RPR/INGN 201 alone and in combination with other anticancer agents. This agreement was originally signed by Rhône-Poulenc Rorer's Gencell. Introgen has completed three phase I clinical trials with INGN 201 in patients with bronchioalveolar cell lung carcinoma, ovarian cancer and recurrent glioblastomas, respectively. Intratumoural injection of RPR/INGN 201 in patients with recurrent glioblastomas was well tolerated and resulted in expression of the p53 protein. Direct administration of RPR/INGN 201 to the lower airways of patients with bronchioalveolar cell lung carcinoma resulted in symptomatic improvement and improved lung function in some patients. In February 2003, Introgen announced that the US Patent and Trademark Office has issued to The Board of Regents of The University of Texas System, patent No. 6,511,847 entitled "Recombinant p53 Adenovirus Methods and Compositions". Introgen Therapeutics is the exclusive licensee of this patent. The patent covers any adenoviral DNA molecules that encode the p53 gene positioned under the control of a promoter. Such a DNA molecule forms the genetic core of Introgen's ADVEXIN cancer therapy. Introgen's ADVEXIN therapy is now covered by up to ten separate US patents relevant to the product including compositions, therapeutic methods of administering the product in virtually any form, alone and in conjunction with the most widely used chemotherapeutic and radiation treatments, as well as its production. Introgen has a number of US patents that relate to the clinical use of ADVEXIN in cancer as
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
International Nuclear Information System (INIS)
Sun Wenjie; Yu Haijun; Xiongjie; Xu Yu; Liao Zhengkai; Zhou Fuxiang; Xie Conghua; Zhou Yunfeng
2011-01-01
Objective: To detect the selective inhibitory effects of irradiation plus adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic acid (IAA) suicide gene system using tumor-specific and radio-inducible chimeric promoter on human hepatocellular carcinoma subcutaneously xenografted in nude mouse. Methods: Recombinant replicated-deficient adenovirus vector containing HRP gene and chimeric human telomerase reverse transcriptase (hTERT) promoter carrying 6 radio-inducible CArG elements was constructed. A human subcutaneous transplanting hepatocellular carcinoma (MHCC97 cell line) model was treated with γ-ray irradiation plus intra-tumor injections of adenoviral vector and intra-peritoneal injections of prodrug IAA. The change of tumor volume and tumor growth inhibiting rate, the survival time of nude mice, as well as histopathology of xenograft tumor and normal tissues were evaluated. Results: Thirty one days after the treatment, the relative tumor volumes in the negative, adenovirus therapy, irradiation, and combination groups were 49.23±4.55, 27.71±7.74, 28.53±10.48 and 11.58±3.23, respectively.There was a significantly statistical difference among them (F=16.288, P<0.01).The inhibition effect in the combination group was strongest as compared with that in other groups, and its inhibition ratio was 76.5%. The survival period extended to 43 d in the combination group, which showed a significantly difference with that in the control group (χ 2 =18.307, P<0.01). The area of tumors necrosis in the combination group was larger than that in the other groups, and the normal tissues showed no treatment-related toxic effect in all groups. However, multiple hepatocellular carcinoma metastases were observed in the liver in the control group, there were a few metastases in the monotherapy groups and no metastasis in the combination group. Conclusions: Adenovirus-mediated suicide gene therapy plus radiotherapy dramatically could inhibit tumor growth and prolong
Directory of Open Access Journals (Sweden)
Shinya Okamoto
Full Text Available We examined anti-tumor effects of zoledronic acid (ZOL, one of the bisphosphonates agents clinically used for preventing loss of bone mass, on human mesothelioma cells bearing the wild-type p53 gene. ZOL-treated cells showed activation of caspase-3/7, -8 and -9, and increased sub-G1 phase fractions. A combinatory use of ZOL and cisplatin (CDDP, one of the first-line anti-cancer agents for mesothelioma, synergistically or additively produced the cytotoxicity on mesothelioma cells. Moreover, the combination achieved greater anti-tumor effects on mesothelioma developed in the pleural cavity than administration of either ZOL or CDDP alone. ZOL-treated cells as well as CDDP-treated cells induced p53 phosphorylation at Ser 15, a marker of p53 activation, and up-regulated p53 protein expression levels. Down-regulation of p53 levels with siRNA however did not influence the ZOL-mediated cytotoxicity but negated the combinatory effects by ZOL and CDDP. In addition, ZOL treatments augmented cytotoxicity of adenoviruses expressing the p53 gene on mesothelioma. These data demonstrated that ZOL-mediated augmentation of p53, which was not linked with ZOL-induced cytotoxicity, played a role in the combinatory effects with a p53 up-regulating agent, and suggests a possible clinical use of ZOL to mesothelioma with anti-cancer agents.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
Directory of Open Access Journals (Sweden)
Liu Jun
2004-07-01
Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
International Nuclear Information System (INIS)
Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei
2004-01-01
BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies
Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice
International Nuclear Information System (INIS)
Zhang, Y.; Woloschak, G.E.
1997-01-01
This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed
International Nuclear Information System (INIS)
Liu Chunjie; Wang Dewen; Zhang Zhaoshan; Gao Yabing; Xiong Chengqi; Long Jianyin; Wang Huixin; Peng Ruiyun; Cui Xuemei
2001-01-01
Objective: To observed the efficiency of gene therapy with TGF β1 antisense gene/liposome complexes and adenovirus transfer vector in RPF rats. Methods: TGFβ1 sense and antisense gene expression vectors and adenovirus transfer vector were introduced into rat bronchus by way of intratracheal instillation. Results: At day 1.5 after TGFβ1 sense and antisense gene transfer, PCR amplification using neo gene-specific primer from lung tissue DNA was all positive. After day 5.5, 67% (2/3) of lung tissue DNA was positive. RNA dot blot hybridization indicated that TGFβ1 mRNA content of lung tissue transfected with pMAMneo-antiTGFβ1 gene decreased. Detection of lung hydroxyproline (Hyp) content after day 35 of gene transfer showed that even in lung of rats received pMAMneo-AntiTGFβ1 lipid complexes it raised remarkably (P 9 pfu/ml were instilled into bronchus at 0.5 ml per rat. After day 2 day 6, the lung tissues of all six rats (three per each group )expressed the transfected luciferase gene by luminometer. Conclusion: Cationic lipid-mediated TGFβ1 antisense gene therapy was a simple and easy method. It can slow down the course of pathogenesis of lung fibrosis. Replication-deficient recombinant adenovirus-mediated gene therapy of lung diseases is a good and efficient method
Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.
Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick
2003-08-01
Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its
Energy Technology Data Exchange (ETDEWEB)
So, Y.; Lee, Y. J.; Shin, J. H.; Oh, H. J.; Chung, J. K.; Lee, M. C.; Cho, B. Y. [College of Medicine, Univ. of Seoul National, Seoul (Korea, Republic of); Lee, K. H. [Samsung Medical Center, Seoul (Korea, Republic of)
2003-07-01
To increase radioiodine uptake on undifferentiated thyroid cancer cell (ARO cells) by adenovirus-mediated human Na+/I- symporter (hNIS) gene transfer. Recombinant adenovirus Ad-hNIS was manufactured successfully. After transfecting Ad-hNIS on ARO cells, in vitro I-125 uptake and efflux studies were performed. For in vivo studies, 1.510'8 p.f.u. (50 1) of Ad-hNIS was injected into xenograft ARO tumors on the R thigh of BALB/c nu/nu mice (n=12), and same amount of normal saline was injected into xenograft ARO tumors on the L thigh. Two, 3, 4 and 6 days after intratumoral injection of Ad-hNIS, I-131 images (3 mice per day) were taken and xenograft tumors on both thighs were all excised. Total RNA was extracted from each tumor tissue and RT-PCR was performed to confirm the hNIS expression of Ad-hNIS injected xenograft ARO tumors. I-125 uptake of Ad-hNIS transfected ARO cells was increased up to 233 folds at 120 minutes in vitro. I-125 efflux study revealed rapid washout of I-125 from Ad-hNIS transfected ARO cells. On dynamic image, I-131 uptake of Ad-hNIS injected ARO tumor was continuously increased until 60 minutes. Mean count ratios of xenograft ARO tumors (R/L) of 60 minutes I-131 images at 2, 3, 4 and 6 days after Ad-hNIS injection were 2.85, 2.54, 2.31, and 2.18, each. On RT-PCR, hNIS expression of Ad-hNIS transfected ARO xenograft tumors was confirmed. Radioiodine uptake was successfully increased in ARO cells by adenovirus-mediated hNIs gene transfer both in vitro and in vivo.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei
2018-03-09
The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.
Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei
2016-11-01
Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Evaluating the role of CRM1-mediated export for adenovirus gene expression
International Nuclear Information System (INIS)
Carter, Christoph C.; Izadpanah, Reza; Bridge, Eileen
2003-01-01
A complex of the Adenovirus (Ad) early region 1b 55-kDa (E1b-55kDa) and early region 4 ORF6 34-kDa (E4-34kDa) proteins promotes viral late gene expression. E1b-55kDa and E4-34kDa have leucine-rich nuclear export signals (NESs) similar to that of HIV Rev. It was proposed that E1b-55kDa and/or E4-34kDa might promote the export of Ad late mRNA via their Rev-like NESs, and the transport receptor CRM1. We treated infected cells with the cytotoxin leptomycin B to inhibit CRM1-mediated export; treatment initially delays the onset of late gene expression, but this activity completely recovers as the late phase progresses. We find that the E1b-55kDa NES is not required to promote late gene expression. Previous results showed that E4-34kDa-mediated late gene expression does not require an intact NES (J. Virol. 74 (2000), 6684-6688). Our results indicate that these Ad regulatory proteins promote late gene expression without intact NESs or active CRM1
International Nuclear Information System (INIS)
Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong
2008-01-01
Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)
Replication-competent human adenovirus 11p vectors can propagate in Vero cells
International Nuclear Information System (INIS)
Gokumakulapalle, Madhuri; Mei, Ya-Fang
2016-01-01
The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.
Replication-competent human adenovirus 11p vectors can propagate in Vero cells
Energy Technology Data Exchange (ETDEWEB)
Gokumakulapalle, Madhuri; Mei, Ya-Fang, E-mail: ya-fang.mei@umu.se
2016-08-15
The use of continuous cell lines derived from the African green monkey kidney (AGMK) has led to major advances in virus vaccine development. However, to date, these cells have not been used to facilitate the creation of human adenoviruses because most human adenoviruses undergo abortive infections in them. Here, we report the susceptibility of AGMK-derived cells to adenovirus 11p (Ad11p) infection. First, we showed that CD46 molecules, which act as receptors for Ad11p, are expressed in AGMK cells. We then monitored Ad11p replication by measuring GFP expression as an indicator of viral transcription. We found that AGMK-derived cells were as capable as carcinoma cells at propagating full-length replication-competent Ad11p (RCAd11p) DNA. Of the AGMK cell lines tested, Vero cells had the greatest capacity for adenovirus production. Thus, AGMK cells can be used to evaluate RCAd11p-mediated gene delivery, and Vero cells can be used for the production of RCAd11pGFP vectors at relatively high yields. - Highlights: • Africa green monkey cell lines were monitored for human adenovirus 11p GFP vector infection. • Human CD46 molecules were detectable in these monkey cell lines. • Adenovirus 11p GFP vector can be propagated in Vero cells increases the safety of Ad11p-based vectors for clinical trials. • To use Vero cells for preparation of Ad11p vector avoids the potential inclusion of oncogenes from tumor cells.
Wang, Qiongyu; Zhang, Aijun; Ma, Huiqun; Wang, Shijie; Ma, Yunyun; Zou, Xingwei; Li, Ruilian
2013-03-01
To investigate the effects of topical treatment with adenovirus-mediated promyelocytic leukemia gene (PML) gene in a psoriasis-like mouse model. The effect of adenovirus-mediated PML gene on the granular layer of mouse tail scale epidermis and epithelial mitosis were observed on longitudinal histological sections prepared from the tail skin and vaginal epithelium of the mice. Adenovirus-mediated PML gene significantly inhibited mitosis of mouse vaginal epithelial cells and promoted the formation of granular layer in mouse tail scale epidermis. The therapeutic effect of PML gene in the psoriasis-like mouse model may be associated with increased granular cells and suppressed epidemic cell proliferation.
Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.
Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens
2005-04-01
The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.
Directory of Open Access Journals (Sweden)
Liz J. Valente
2016-03-01
Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.
International Nuclear Information System (INIS)
Yang, Hyun Suk; Park, Seong-Wook; Lee, Heuiran; Kim, Sung Jin; Lee, Won Woo; Yang, You-Jung; Moon, Dae Hyuk
2004-01-01
We evaluated the feasibility of non-invasive imaging of recombinant adenovirus-mediated human sodium-iodide symporter (hNIS) gene expression by 99m TcO 4 - scintigraphy in skeletal muscle of rats. Replication-defective recombinant adenovirus encoding hNIS gene [Rad-CMV-hNIS 5 x 10 7 , 2 x 10 8 or 1 x 10 9 plaque forming units (pfu)] or β-galactosidase gene (Rad-CMV-LacZ 1 x 10 9 pfu) was injected into the right biceps femoris muscle of rats (n=5-6 for each group). Three days after gene transfer, scintigraphy was performed using a gamma camera 30 min after injection of 99m TcO 4 - (1.85 MBq). An additional two rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS underwent 99m TcO 4 - scintigraphy with sodium perchlorate. After the imaging studies, rats were sacrificed for assessment of the biodistribution of 99m TcO 4 - and measurement of hNIS mRNA expression. In all the rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS, hNIS expression was successfully imaged by 99m TcO 4 - scintigraphy, while rats injected with Rad-CMV-LacZ or lower doses of Rad-CMV-hNIS failed to show uptake. The biodistribution studies indicated that a significantly different amount of 99m TcO 4 - was retained in the liver (p 9 pfu of Rad-CMV-hNIS. The muscular hNIS mRNA level quantified by real-time reverse transcription-polymerase chain reaction was significantly higher in rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS (p 9 pfu of Rad-CMV-hNIS were specifically inhibited by sodium perchlorate. This study illustrated that 99m TcO 4 - scintigraphy can monitor Rad-CMV-hNIS-mediated gene expression in skeletal muscle of rats, non-invasively and quantitatively. (orig.)
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.
Directory of Open Access Journals (Sweden)
Krzysztof Puszynski
2014-12-01
Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.
Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.
2012-01-01
During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738
Energy Technology Data Exchange (ETDEWEB)
Yang, Hyun Suk; Park, Seong-Wook [Department of Internal Medicine (Cardiology), Asan Medical Center, University of Ulsan College of Medicine, 388-1 Pungnap-dong, Songpa-gu, 138-736, Seoul (Korea); Lee, Heuiran; Kim, Sung Jin [Department of Microbiology, University of Ulsan College of Medicine, Seoul (Korea); Lee, Won Woo [Department of Nuclear Medicine, Seoul National University Bundang Hospital, Seongnam (Korea); Department of Nuclear Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea); Yang, You-Jung; Moon, Dae Hyuk [Department of Nuclear Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea)
2004-09-01
We evaluated the feasibility of non-invasive imaging of recombinant adenovirus-mediated human sodium-iodide symporter (hNIS) gene expression by {sup 99m}TcO{sub 4}{sup -} scintigraphy in skeletal muscle of rats. Replication-defective recombinant adenovirus encoding hNIS gene [Rad-CMV-hNIS 5 x 10{sup 7}, 2 x 10{sup 8} or 1 x 10{sup 9} plaque forming units (pfu)] or {beta}-galactosidase gene (Rad-CMV-LacZ 1 x 10{sup 9} pfu) was injected into the right biceps femoris muscle of rats (n=5-6 for each group). Three days after gene transfer, scintigraphy was performed using a gamma camera 30 min after injection of {sup 99m}TcO{sub 4}{sup -} (1.85 MBq). An additional two rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS underwent {sup 99m}TcO{sub 4}{sup -} scintigraphy with sodium perchlorate. After the imaging studies, rats were sacrificed for assessment of the biodistribution of {sup 99m}TcO{sub 4}{sup -} and measurement of hNIS mRNA expression. In all the rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS, hNIS expression was successfully imaged by {sup 99m}TcO{sub 4}{sup -} scintigraphy, while rats injected with Rad-CMV-LacZ or lower doses of Rad-CMV-hNIS failed to show uptake. The biodistribution studies indicated that a significantly different amount of {sup 99m}TcO{sub 4}{sup -} was retained in the liver (p<0.001) and the right muscle (p<0.05), with the highest uptake in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS. The muscular hNIS mRNA level quantified by real-time reverse transcription-polymerase chain reaction was significantly higher in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS (p<0.05), with a positive correlation with the imaging counts (r=0.810, p<0.05) and the biodistribution (r=0.847, p<0.001). Hot spots in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS were specifically inhibited by sodium perchlorate. This study illustrated that {sup 99m}TcO{sub 4}{sup -} scintigraphy can monitor Rad-CMV-hNIS-mediated gene expression in
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Directory of Open Access Journals (Sweden)
Arthur Dyer
2017-03-01
Full Text Available Enadenotucirev (EnAd is a chimeric group B adenovirus isolated by bioselection from a library of adenovirus serotypes. It replicates selectively in and kills a diverse range of carcinoma cells, shows effective anticancer activity in preclinical systems, and is currently undergoing phase I/II clinical trials. EnAd kills cells more quickly than type 5 adenovirus, and speed of cytotoxicity is dose dependent. The EnAd death pathway does not involve p53, is predominantly caspase independent, and appears to involve a rapid fall in cellular ATP. Infected cells show early loss of membrane integrity; increased exposure of calreticulin; extracellular release of ATP, HSP70, and HMGB1; and influx of calcium. The virus also causes an obvious single membrane blister reminiscent of ischemic cell death by oncosis. In human tumor biopsies maintained in ex vivo culture, EnAd mediated release of pro-inflammatory mediators such as TNF-α, IL-6, and HMGB1. In accordance with this, EnAd-infected tumor cells showed potent stimulation of dendritic cells and CD4+ T cells in a mixed tumor-leukocyte reaction in vitro. Whereas many viruses have evolved for efficient propagation with minimal inflammation, bioselection of EnAd for rapid killing has yielded a virus with a short life cycle that combines potent cytotoxicity with a proinflammatory mechanism of cell death.
Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression
Directory of Open Access Journals (Sweden)
Shang-Jui Wang
2016-10-01
Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
International Nuclear Information System (INIS)
Hu Shunying; Chen Yundai; Li Libing; Chen Jinlong; Wu Bin; Zhou, Xiao; Zhi Guang; Li Qingfang; Wang Rongliang; Duan Haifeng; Guo Zikuan; Yang Yuefeng; Xiao Fengjun; Wang Hua; Wang Lisheng
2009-01-01
Purpose: Irradiation to the heart may lead to late cardiovascular complications. The purpose of this study was to investigate whether adenovirus-mediated delivery of the human hepatocyte growth factor gene could reduce post-irradiation damage of the rat heart and improve heart function. Methods and Materials: Twenty rats received single-dose irradiation of 20 Gy gamma ray locally to the heart and were randomized into two groups. Two weeks after irradiation, these two groups of rats received Ad-HGF or mock adenovirus vector intramyocardial injection, respectively. Another 10 rats served as sham-irradiated controls. At post-irradiation Day 120, myocardial perfusion was tested by myocardial contrast echocardiography with contrast agent injected intravenously. At post-irradiation Day 180, cardiac function was assessed using the Langendorff technique with an isolated working heart model, after which heart samples were collected for histological evaluation. Results: Myocardial blood flow was significantly improved in HGF-treated animals as measured by myocardial contrast echocardiography at post-irradiation Day 120 . At post-irradiation Day 180, cardiac function was significantly improved in the HGF group compared with mock vector group, as measured by left ventricular peak systolic pressure (58.80 ± 9.01 vs. 41.94 ± 6.65 mm Hg, p < 0.05), the maximum dP/dt (5634 ± 1303 vs. 1667 ± 304 mm Hg/s, p < 0.01), and the minimum dP/dt (3477 ± 1084 vs. 1566 ± 499 mm Hg/s, p < 0.05). Picrosirius red staining analysis also revealed a significant reduction of fibrosis in the HGF group. Conclusion: Based on the study findings, hepatocyte growth factor gene transfer can attenuate radiation-induced cardiac injury and can preserve cardiac function.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Kułdo, J M; Ásgeirsdóttir, S A; Zwiers, P J; Bellu, A R; Rots, M G; Schalk, J A C; Ogawara, K I; Trautwein, C; Banas, B; Haisma, H J; Molema, G; Kamps, J A A M
2013-02-28
In chronic inflammatory diseases the endothelium expresses mediators responsible for harmful leukocyte infiltration. We investigated whether targeted delivery of a therapeutic transgene that inhibits nuclear factor κB signal transduction could silence the proinflammatory activation status of endothelial cells. For this, an adenovirus encoding dominant-negative IκB (dnIκB) as a therapeutic transgene was employed. Selectivity for the endothelial cells was achieved by introduction of antibodies specific for inflammatory endothelial adhesion molecules E-selectin or VCAM-1 chemically linked to the virus via polyethylene glycol. In vitro, the retargeted adenoviruses selectively infected cytokine-activated endothelial cells to express functional transgene. The comparison of transductional capacity of both retargeted viruses revealed that E-selectin based transgene delivery exerted superior pharmacological effects. Targeted delivery mediated dnIκB transgene expression in endothelial cells inhibited the induced expression of several inflammatory genes, including adhesion molecules, cytokines, and chemokines. In vivo, in mice suffering from glomerulonephritis, E-selectin-retargeted adenovirus selectively homed in the kidney to microvascular glomerular endothelium. Subsequent downregulation of endothelial adhesion molecule expression 2 days after induction of inflammation demonstrated the pharmacological potential of this gene therapy approach. The data justify further studies towards therapeutic virus design and optimization of treatment schedules to investigate their capacity to interfere with inflammatory disease progression. Copyright © 2012 Elsevier B.V. All rights reserved.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Adenovirus gene transfer to amelogenesis imperfecta ameloblast-like cells.
Directory of Open Access Journals (Sweden)
Anton V Borovjagin
Full Text Available To explore gene therapy strategies for amelogenesis imperfecta (AI, a human ameloblast-like cell population was established from third molars of an AI-affected patient. These cells were characterized by expression of cytokeratin 14, major enamel proteins and alkaline phosphatase staining. Suboptimal transduction of the ameloblast-like cells by an adenovirus type 5 (Ad5 vector was consistent with lower levels of the coxsackie-and-adenovirus receptor (CAR on those cells relative to CAR-positive A549 cells. To overcome CAR -deficiency, we evaluated capsid-modified Ad5 vectors with various genetic capsid modifications including "pK7" and/or "RGD" motif-containing short peptides incorporated in the capsid protein fiber as well as fiber chimera with the Ad serotype 3 (Ad3 fiber "knob" domain. All fiber modifications provided an augmented transduction of AI-ameloblasts, revealed following vector dose normalization in A549 cells with a superior effect (up to 404-fold of pK7/RGD double modification. This robust infectivity enhancement occurred through vector binding to both α(vβ3/α(vβ5 integrins and heparan sulfate proteoglycans (HSPGs highly expressed by AI-ameloblasts as revealed by gene transfer blocking experiments. This work thus not only pioneers establishment of human AI ameloblast-like cell population as a model for in vitro studies but also reveals an optimal infectivity-enhancement strategy for a potential Ad5 vector-mediated gene therapy for AI.
Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination
Directory of Open Access Journals (Sweden)
Zhou Y
2018-04-01
Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
International Nuclear Information System (INIS)
Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo
2016-01-01
P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.
Energy Technology Data Exchange (ETDEWEB)
Tomono, Takumi [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Kajita, Masahiro [Laboratory of Molecular Pharmaceutics and Technology, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Yano, Kentaro [Laboratory of Biopharmaceutics, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Ogihara, Takuo, E-mail: togihara@takasaki-u.ac.jp [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan)
2016-08-05
P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Cancer gene therapy with targeted adenoviruses.
Bachtarzi, Houria; Stevenson, Mark; Fisher, Kerry
2008-11-01
Clinical experience with adenovirus vectors has highlighted the need for improved delivery and targeting. This manuscript aims to provide an overview of the techniques currently under development for improving adenovirus delivery to malignant cells in vivo. Primary research articles reporting improvements in adenoviral gene delivery are described. Strategies include genetic modification of viral coat proteins, non-genetic modifications including polymer encapsulation approaches and pharmacological interventions. Reprogramming adenovirus tropism in vitro has been convincingly demonstrated using a range of genetic and physical strategies. These studies have provided new insights into our understanding of virology and the field is progressing. However, there are still some limitations that need special consideration before adenovirus-targeted cancer gene therapy emerges as a routine treatment in the clinical setting.
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Directory of Open Access Journals (Sweden)
Fuqiang Xing
Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.
Energy Technology Data Exchange (ETDEWEB)
Zhenwei, Zhang [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai (China); Hua, Wu; Xuemei, Zhang [Department of Nuclear Medicine, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Xinyuan, Liu [Shanghai Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai (China)
2004-07-01
Purpose: Chemotherapy or external radiation therapy can potentiate the therapeutic effect of E1 B-attenuated oncolytic adenovirus. In this study, the antitumor efficacy of oncolytic adenovirus combined with internal radionuclide therapy was evaluated. Methods: Firstly, viral replication was examined by plaque assay and Southern blotting, after oncolytic adenovirus, ZD55, was exposed to iodine-131. Cell viability was evaluated qualitatively by crystal violet staining and quantitatively by MTT assay. FACS analysis was performed to determine the synergic proapoptotic effect of iodine-131 combined with ZD55. Results: Irradiation of iodine-131 does not influence ZD55 viral DNA replication. In combination with ZD55, iodine-131 can efficiently kill tumor cells in a p53-independent model. ZD55 augments the proapoptotic effect of iodine-131. Conclusion: Radionuclide-viral therapy might be a novel tool for treatment of hepatocarcinoma. (authors)
International Nuclear Information System (INIS)
Maeda, Yasushi; Kimura, En; Uchida, Yuji; Nishida, Yasuto; Yamashita, Satoshi; Arima, Toshiyuki; Uchino, Makoto
2003-01-01
Previous analyses have demonstrated that packaging of the adenovirus type 5 (Ad5) genome is dependent on at least seven cis-acting elements, called AI to AVII, which are located in the left-end region of the genome. These elements have different packaging efficiencies, and without AI through AV, viral DNA cannot be packaged. Here we report the identification of the cis-acting Ad5 packaging domain in vivo by using the Cre/loxP system. We found that an adenoviral DNA fragment (nt 192 to nt 358), which includes elements AI to AV, is excised by Cre recombinase and packaged into capsids. Furthermore, this mutant adenovirus replicated so efficiently by repetitive propagation that its purification by CsCI equilibrium gradient was possible. This study clarified that the region from nt 358 to nt 454 on the viral genome is sufficient for packaging. Recently, the helper-dependent adenoviral vector (HDAd) construction system has been developed for the purpose of gene therapy. This system uses a helper virus with two parallel loxP sites flanking the packaging signal. This region is eliminated by Cre-mediated excision, which prevents helper virus packaging. Our data provide useful information regarding factors affecting efficient elimination
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Freytag, Svend O.; Paielli, Dell; Wing, Mark; Rogulski, Ken; Brown, Steve; Kolozsvary, Andy; Seely, John; Barton, Ken; Dragovic, Alek; Kim, Jae Ho
2002-01-01
Purpose: The purpose of this study was to evaluate the efficacy and toxicity of replication-competent adenovirus-mediated double suicide gene therapy in an adjuvant setting with external beam radiation therapy (EBRT) in an experimental prostate cancer model in preparation for a Phase I clinical study in humans. Methods: For efficacy studies, i.m. DU145 and intraprostatic LNCaP C4-2 tumors were established in immune-deficient mice. Tumors were injected with the lytic, replication-competent Ad5-CD/TKrep adenovirus containing a cytosine deaminase (CD)/herpes simplex virus thymidine kinase (HSV-1 TK) fusion gene. Two days later, mice were administered 1 week of 5-fluorocytosine + ganciclovir (GCV) prodrug therapy and fractionated doses of EBRT (trimodal therapy). Tumor control rate of trimodal therapy was compared to that of EBRT alone. For toxicology studies, immune-competent male mice received a single intraprostatic injection (10 10 vp) of the replication-competent Ad5-CD/TKrep adenovirus. Two days later, mice were administered 4 weeks of 5-fluorocytosine + GCV prodrug therapy and 56 Gy EBRT to the pelvic region. The toxicity of trimodal therapy was assessed by histopathologic analysis of major organs and clinical chemistries. Results: In both the i.m. DU145 and intraprostatic LNCaP C4-2 tumor models, trimodal therapy significantly improved primary tumor control beyond that of EBRT alone. In the DU145 model, trimodal therapy resulted in a tumor growth delay (70 days) that was more than twice that (32 days) of EBRT alone. Whereas EBRT failed to eradicate DU145 tumors, trimodal therapy resulted in 25% tumor cure. In the LNCaP C4-2 tumor model, EBRT slowed the growth of intraprostatic tumors, but resulted in no tumor cures, and 57% of the mice developed retroperitoneal lymph node metastases at 3 months. By contrast, trimodal therapy resulted in 44% tumor cure and reduced significantly the percentage (13%) of lymph node metastases relative to EBRT alone. Overall
Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4
Directory of Open Access Journals (Sweden)
Ravshan Burikhanov
2014-01-01
Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.
Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino
2011-11-01
Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.
International Nuclear Information System (INIS)
Geng, L.; Walter, S; Vaughan, A.T.M.
1997-01-01
Purpose: Despite attempts with a variety of therapeutic approaches there has been little impact on the survival of patients with Glioblastoma multiforme, with median survivals reported of approximately 12 months. In this study a replication restricted adenovirus vector is used to transfer the wild type p53 gene into two cell lines derived from a human astrocytoma U87MG or glioblastoma T98G, to determine its ability to act as a radiosensitizer in conjunction with conventional radiotherapy. Methods: An adenovirus vector containing the human wild type p53 (Advp53) gene was used in addition to a control vector containing the β-galactosidase (Advγgal) reporter gene. To achieve cellular incorporation both vectors were incubated with cells for 30 minutes - washed and returned to culture. The successful incorporation of each vector was determined by either a p53 assay using either a western blotting or flow cytometry techniques, or specific staining for β-galactosidase activity. The presence of each vector was assayed until the constructs were eliminated from the cell. To determine the effects of these vectors on cell survival sufficient vector was added to produce a measurable reduction in clonogenic survival and this value was used in subsequent irradiation experiments. To determine the ability of wild type p53 to induce apoptosis the cells were examined from 1 to 5 days after irradiation by H and E staining for the characteristic morphology indicating an apoptotic process. Results: Both the Advp53 and Advβgal vectors were successfully incorporated into each cell line. Expression of each gene was reduced to approximately half by 5 days and virtually eliminated by 15 days after transfection in both lines. At the doses used the wild type Advp53 adenovirus was toxic to both cell lines giving surviving fractions between 39-74%. When this toxicity was taken into account the presence of the Advp53 gene had a radiosensitizing effect in each cell line. To determine the
CD40-mediated apoptosis in murine B-lymphoma lines containing mutated p53
DEFF Research Database (Denmark)
Hollmann, Annette C; Gong, Qiaoke; Owens, Trevor
2002-01-01
Crosslinking CD40 induces normal B-cells to proliferate and differentiate but causes many tumor cell lines to undergo apoptosis. As p53 is required for many apoptotic pathways, we analyzed the effects of CD40 ligation and their correlation with p53 function in four murine B-lymphoma lines. A20...... of detectable p21 mRNA in A20 and M12 cells. P21 mRNA was increased to detectable levels in M12 cells upon CD40 ligation; however, blocking this effect with the p53 inhibitor pifithrin had no effect on CD40-mediated apoptosis. Sequencing showed that p53 in A20 and M12 cells contained point mutations leading...... to amino acid substitutions in DNA binding regions, but was unmutated in WEHI231 and WEHI 279. These results suggest that CD40-mediated apoptosis can occur in the absence of functional p53....
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
International Nuclear Information System (INIS)
Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun
2007-01-01
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Energy Technology Data Exchange (ETDEWEB)
Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)
2007-02-15
Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)
Alterations in the K-ras and p53 genes in rat lung tumors
Energy Technology Data Exchange (ETDEWEB)
Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others
1997-06-01
Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.
Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells
Energy Technology Data Exchange (ETDEWEB)
Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)
2015-11-01
Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.
Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells
International Nuclear Information System (INIS)
Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.
2015-01-01
Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
International Nuclear Information System (INIS)
Mu, Haixi; Wang, Na; Zhao, Lijuan; Li, Shuman; Li, Qianqian; Chen, Ling; Luo, Xinrong; Qiu, Zhu; Li, Lili; Ren, Guosheng; Xu, Yongzhu; Zhou, Xiangyang; Xiang, Tingxiu
2015-01-01
Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumor cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer
Energy Technology Data Exchange (ETDEWEB)
Mu, Haixi [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Wang, Na; Zhao, Lijuan; Li, Shuman; Li, Qianqian; Chen, Ling; Luo, Xinrong; Qiu, Zhu [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Ren, Guosheng [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Department of Endocrine and breast Surgery, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016 (China); Xu, Yongzhu [Chongqing Health Service Center, Chongqing 400020 (China); Zhou, Xiangyang [The Wistar Institute, Philadelphia, PA (United States); Xiang, Tingxiu, E-mail: xiangtx1@gmail.com [Molecular Oncology and Epigenetics Laboratory, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)
2015-03-15
Our previous study showed that PLCD1 significantly decreases cell proliferation and affects cell cycle progression in breast cancer cells. In the present study, we aimed to investigate its functional and molecular mechanisms, and whether or not can become a new target for gene therapies. We found reduced PLCD1 protein expression in breast tumor tissues compared with paired surgical margin tissues. PLCD1 promoter CpG methylation was detected in 55 of 96 (57%) primary breast tumors, but not in surgical-margin tissues and normal breast tissues. Ectopic expression of PLCD1 inhibited breast tumor cell proliferation in vivo by inducing apoptosis and suppressed tumor cell migration by regulating cytoskeletal reorganization proteins including RhoA and phospho-cofilin. Furthermore, we found that PLCD1 induced p53 accumulation, increased p27 and p21 protein levels, and cleaved PARP. Finally, we constructed an adenoviral vector expressing PLCD1 (AdH5-PLCD1), which exhibited strong cytotoxicity in breast cancer cells. Our findings provide insights into the development of PLCD1 gene therapies for breast cancer and perhaps, other human cancers. - Highlights: • PLCD1 is downregulated via hypermethylation in breast cancer. • PLCD1 suppressed cell migration by regulating cytoskeletal reorganization proteins. • Adenovirus AdHu5-PLCD1 may be a novel therapeutic option for breast cancer.
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong
2010-11-01
Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Directory of Open Access Journals (Sweden)
Ilin Chuang
Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection
Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H
1997-05-01
To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Gupta, A; Jha, S; Engel, D A; Ornelles, D A; Dutta, A
2013-10-17
Adenoviruses are linear double-stranded DNA viruses that infect human and rodent cell lines, occasionally transform them and cause tumors in animal models. The host cell challenges the virus in multifaceted ways to restrain viral gene expression and DNA replication, and sometimes even eliminates the infected cells by programmed cell death. To combat these challenges, adenoviruses abrogate the cellular DNA damage response pathway. Tip60 is a lysine acetyltransferase that acetylates histones and other proteins to regulate gene expression, DNA damage response, apoptosis and cell cycle regulation. Tip60 is a bona fide tumor suppressor as mice that are haploid for Tip60 are predisposed to tumors. We have discovered that Tip60 is degraded by adenovirus oncoproteins EIB55K and E4orf6 by a proteasome-mediated pathway. Tip60 binds to the immediate early adenovirus promoter and suppresses adenovirus EIA gene expression, which is a master regulator of adenovirus transcription, at least partly through retention of the virally encoded repressor pVII on this promoter. Thus, degradation of Tip60 by the adenoviral early proteins is important for efficient viral early gene transcription and for changes in expression of cellular genes.
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Wu, H; Wang, K; Liu, W; Hao, Q
2015-06-18
Drug resistance is a major cause of treatment failure in ovarian cancer patients, and novel therapeutic strategies are urgently needed. Overexpression of phosphatase and tensin homolog (PTEN) has been shown to preserve the cisplatin-resistance of ovarian cancer cells, while cisplatin-induced keratin 10 (KRT10) overexpression mediates the resistance-reversing effect of PTEN. However, whether overexpression of PTEN or KRT10 can improve the cisplatin resistance of ovarian cancer in vivo has not been investigated. Therefore, we investigated the effects of adenovirus-mediated PTEN or KRT10 overexpression on the cisplatin resistance of ovarian cancer in vivo. Recombinant adenoviruses carrying the gene for PTEN or KRT10 were constructed. The effects of overexpression of PTEN and KRT10 on cisplatin resistance of ovarian cancer cells were examined using the 3(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) and TdT-mediated dUTP nick-end labeling (TUNEL) assays in vitro. Subcutaneously transplanted nude mice, as a model of human ovarian cancer, were used to test the effects of PTEN and KRT10 on cisplatin resistance of ovarian cancer in vivo. The MTT assay showed that recombinant adenovirus-mediated overexpression of KRT10 and PTEN enhanced the proliferation inhibition effect of cisplatin on C13K cells. Recombinant adenovirus-mediated overexpression of KRT10 and PTEN also increased the cisplatin-induced apoptosis rate of C13K cells. Furthermore, recombinant adenovirus-mediated overexpression of KRT10 and PTEN enhanced the inhibitory effect of cisplatin on C13K xenograft tumor growth. Thus, recombinant adenovirus-mediated overexpression of KRT10 and PTEN may improve the cisplatin resistance of ovarian cancer in vitro and in vivo.
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Bi, Lianxiang; Wacker, Bradley K; Bueren, Emma; Ham, Ervin; Dronadula, Nagadhara; Dichek, David A
2017-12-15
Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd) efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks) persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate-yet significant-pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.
International Nuclear Information System (INIS)
Han Jianfeng; Zhao Dong; Zhong Zhirong; Zhang Zhirong; Gong Tao; Sun Xun
2010-01-01
Recombinant adenovirus (Ad)-mediated gene therapy is an exciting novel strategy in cancer treatment. However, poor infection efficiency with coxsackievirus and adenovirus receptor (CAR) down-regulated cancer cell lines is one of the major challenges for its practical and extensive application. As an alternative method of viral gene delivery, a non-viral carrier using cationic materials could compensate for the limitation of adenovirus. In our study, adenovectors were complexed with a new synthetic polymer PEI-DEG-bis-NPC (PDN) based on polyethylenimine (PEI), and then the properties of the vehicle were characterized by measurement of size distribution, zeta potential and transmission electron microscopy (TEM). Enhancement of gene transduction by Ad/PDN complexes was observed in both CAR-overexpressing cell lines (A549) and CAR-lacking cell lines (MDCK, CHO, LLC), as a result of facilitating binding and cell uptake of adenoviral particles by the cationic component. Ad/PDN complexes also promoted the inhibition of tumor growth in vivo and prolonged the survival time of tumor-bearing mice. These data suggest that a combination of viral and non-viral gene delivery methods may offer a new approach to successful cancer gene therapy.
Directory of Open Access Journals (Sweden)
Paola De Feudis
2000-05-01
Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.
Directory of Open Access Journals (Sweden)
Agnes C. Fett-Conte
2002-04-01
Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.
Directory of Open Access Journals (Sweden)
Weiwei Guo
Full Text Available Heat shock protein 90 (HSP90 inhibitors are potential drugs for cancer therapy. The inhibition of HSP90 on cancer cell growth largely through degrading client proteins, like Akt and p53, therefore, triggering cancer cell apoptosis. Here, we show that the HSP90 inhibitor 17-AAG can induce the expression of GRP75, a member of heat shock protein 70 (HSP70 family, which, in turn, attenuates the anti-growth effect of HSP90 inhibition on cancer cells. Additionally, 17-AAG enhanced binding of GRP75 and p53, resulting in the retention of p53 in the cytoplasm. Blocking GRP75 with its inhibitor MKT-077 potentiated the anti-tumor effects of 17-AAG by disrupting the formation of GRP75-p53 complexes, thereby facilitating translocation of p53 into the nuclei and leading to the induction of apoptosis-related genes. Finally, dual inhibition of HSP90 and GRP75 was found to significantly inhibit tumor growth in a liver cancer xenograft model. In conclusion, the GRP75 inhibitor MKT-077 enhances 17-AAG-induced apoptosis in HCCs and increases p53-mediated inhibition of tumor growth in vivo. Dual targeting of GRP75 and HSP90 may be a useful strategy for the treatment of HCCs.
Polymorphism at codon 36 of the p53 gene.
Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A
1994-01-01
A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.
2008-01-01
Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok
2015-03-01
Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M
2014-08-01
The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the
p53-Mediated Molecular Control of Autophagy in Tumor Cells
Directory of Open Access Journals (Sweden)
Maria Mrakovcic
2018-03-01
Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.
Ferrari, Roberto; Gou, Dawei; Jawdekar, Gauri; Johnson, Sarah A; Nava, Miguel; Su, Trent; Yousef, Ahmed F; Zemke, Nathan R; Pellegrini, Matteo; Kurdistani, Siavash K; Berk, Arnold J
2014-11-12
Oncogenic transformation by adenovirus small e1a depends on simultaneous interactions with the host lysine acetylases p300/CBP and the tumor suppressor RB. How these interactions influence cellular gene expression remains unclear. We find that e1a displaces RBs from E2F transcription factors and promotes p300 acetylation of RB1 K873/K874 to lock it into a repressing conformation that interacts with repressive chromatin-modifying enzymes. These repressing p300-e1a-RB1 complexes specifically interact with host genes that have unusually high p300 association within the gene body. The TGF-β, TNF-, and interleukin-signaling pathway components are enriched among such p300-targeted genes. The p300-e1a-RB1 complex condenses chromatin in a manner dependent on HDAC activity, p300 lysine acetylase activity, the p300 bromodomain, and RB K873/K874 and e1a K239 acetylation to repress host genes that would otherwise inhibit productive virus infection. Thus, adenovirus employs e1a to repress host genes that interfere with viral replication. Copyright © 2014 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Production of Recombinant Adenovirus Containing Human Interlukin-4 Gene
Mojarrad, Majid; Abdolazimi, Yassan; Hajati, Jamshid; Modarressi, Mohammad Hossein
2011-01-01
Objective(s) Recombinant adenoviruses are currently used for a variety of purposes, including in vitro gene transfer, in vivo vaccination, and gene therapy. Ability to infect many cell types, high efficiency in gene transfer, entering both dividing and non dividing cells, and growing to high titers make this virus a good choice for using in various experiments. In the present experiment, a recombinant adenovirus containing human IL-4 coding sequence was made. IL-4 has several characteristics ...
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
Alterations in tumour suppressor gene p53 in human gliomas from ...
Indian Academy of Sciences (India)
Unknown
Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.
Directory of Open Access Journals (Sweden)
Lianxiang Bi
2017-12-01
Full Text Available Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate—yet significant—pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.
Directory of Open Access Journals (Sweden)
Tao Lu
2017-01-01
Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.
International Nuclear Information System (INIS)
Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.
2006-01-01
The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)
Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer
International Nuclear Information System (INIS)
Irshad, S.; Nawaz, T.
2008-01-01
Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)
International Nuclear Information System (INIS)
Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.
1997-01-01
Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo
Maler, Mareike D; Nielsen, Peter J; Stichling, Nicole; Cohen, Idan; Ruzsics, Zsolt; Wood, Connor; Engelhard, Peggy; Suomalainen, Maarit; Gyory, Ildiko; Huber, Michael; Müller-Quernheim, Joachim; Schamel, Wolfgang W A; Gordon, Siamon; Jakob, Thilo; Martin, Stefan F; Jahnen-Dechent, Willi; Greber, Urs F; Freudenberg, Marina A; Fejer, György
2017-08-01
The scavenger receptor MARCO is expressed in several subsets of naive tissue-resident macrophages and has been shown to participate in the recognition of various bacterial pathogens. However, the role of MARCO in antiviral defense is largely unexplored. Here, we investigated whether MARCO might be involved in the innate sensing of infection with adenovirus and recombinant adenoviral vectors by macrophages, which elicit vigorous immune responses in vivo Using cells derived from mice, we show that adenovirus infection is significantly more efficient in MARCO-positive alveolar macrophages (AMs) and in AM-like primary macrophage lines (Max Planck Institute cells) than in MARCO-negative bone marrow-derived macrophages. Using antibodies blocking ligand binding to MARCO, as well as gene-deficient and MARCO-transfected cells, we show that MARCO mediates the rapid adenovirus transduction of macrophages. By enhancing adenovirus infection, MARCO contributes to efficient innate virus recognition through the cytoplasmic DNA sensor cGAS. This leads to strong proinflammatory responses, including the production of interleukin-6 (IL-6), alpha/beta interferon, and mature IL-1α. These findings contribute to the understanding of viral pathogenesis in macrophages and may open new possibilities for the development of tools to influence the outcome of infection with adenovirus or adenovirus vectors. IMPORTANCE Macrophages play crucial roles in inflammation and defense against infection. Several macrophage subtypes have been identified with differing abilities to respond to infection with both natural adenoviruses and recombinant adenoviral vectors. Adenoviruses are important respiratory pathogens that elicit vigorous innate responses in vitro and in vivo The cell surface receptors mediating macrophage type-specific adenovirus sensing are largely unknown. The scavenger receptor MARCO is expressed on some subsets of naive tissue-resident macrophages, including lung alveolar macrophages
Status and advances of p53-gene therapy and radiotherapy in malignant tumor
International Nuclear Information System (INIS)
Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong
2006-01-01
Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
Sauter, Bernhard V.; Martinet, Olivier; Zhang, Wei-Jian; Mandeli, John; Woo, Savio L. C.
2000-04-01
Inhibition of angiogenesis has been shown to be an effective strategy in cancer therapy in mice. However, its widespread application has been hampered by difficulties in the large-scale production of the antiangiogenic proteins. This limitation may be resolved by in vivo delivery and expression of the antiangiogenic genes. We have constructed a recombinant adenovirus that expresses murine endostatin that is biologically active both in vitro, as determined in endothelial cell proliferation assays, and in vivo, by suppression of angiogenesis induced by vascular endothelial growth factor 165. Persistent high serum levels of endostatin (605-1740 ng/ml; mean, 936 ng/ml) were achieved after systemic administration of the vector to nude mice, which resulted in significant reduction of the growth rates and the volumes of JC breast carcinoma and Lewis lung carcinoma (P < 0.001 and P < 0.05, respectively). In addition, the endostatin vector treatment completely prevented the formation of pulmonary micrometastases in Lewis lung carcinoma (P = 0.0001). Immunohistochemical staining of the tumors demonstrated a decreased number of blood vessels in the treatment group versus the controls. In conclusion, the present study clearly demonstrates the potential of vector-mediated antiangiogenic gene therapy as a component in cancer therapy.
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
Intravascular local gene transfer mediated by protein-coated metallic stent.
Yuan, J; Gao, R; Shi, R; Song, L; Tang, J; Li, Y; Tang, C; Meng, L; Yuan, W; Chen, Z
2001-10-01
To assess the feasibility, efficiency and selectivity of adenovirus-mediated gene transfer to local arterial wall by protein-coated metallic stent. A replication-defective recombinant adenovirus carrying the Lac Z reporter gene for nuclear-specific beta-galactosidase (Ad-beta gal) was used in this study. The coating for metallic stent was made by immersing it in a gelatin solution containing crosslinker. The coated stents were mounted on a 4.0 or 3.0 mm percutaneous transluminal coronary angioplasty (PTCA) balloon and submersed into a high-titer Ad-beta gal viral stock (2 x 10(10) pfu/ml) for 3 min, and then implanted into the carotid arteries in 4 mini-swines and into the left anterior descending branch of the coronary artery in 2 mini-swines via 8F large lumen guiding catheters. The animals were sacrificed 7 (n = 4), 14 (n = 1) and 21 (n = 1) days after implantation, respectively. The beta-galactosidase expression was assessed by X-gal staining. The results showed that the expression of transgene was detected in all animal. In 1 of carotid artery with an intact intima, the beta-gal expression was limited to endothelial cells. In vessels with denuded endothelium, gene expression was found in the sub-intima, media and adventitia. The transfection efficiency of medial smooth muscle cells was 38.6%. In 2 animals sacrificed 7 days after transfection, a microscopic examination of X-gal-stained samples did not show evidence of transfection in remote organs and arterial segments adjacent to the treated arterial site. Adenovirus-mediated arterial gene transfer to endothelial, smooth muscle cells and adventitia by protein-coated metallic stent is feasible. The transfection efficiency is higher. The coated stent may act as a good carrier of adenovirus-mediated gene transfer and have a potential to prevent restenosis following PTCA.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Uptake of 131I-FIAU in BMSCs infected by adenovirus vector-mediated HSV1-TK
International Nuclear Information System (INIS)
Zhang Binqing; Wu Tao; Sun Xun; An Rui
2010-01-01
Report gene HSV1-TK and therapy gene were connected by IRES, and recombinant adenovirus vector Ad5-TK-IRES-BDNF-EGFP was constructed and infected with BMSCs at MOI of 0, 50, 100, 150, 200 and 250, with the control recombinant adenovirus vector of Ad5-EGFP. Green fluorescence cell positive rate was observed under the microscopy. MTT assay was used to determine the cell proliferation. bFGF and EGF were used to induce the BMSCs, and RQ-PCR to determine target gene expression in infection BMSCs. Uptake of 131 I-FIAU was assessed by gamma counter. The data were processed by SPSS11.code. Recombinant adenovirus at MOI 150 had high infectionefficiency and low toxic in BMSCs. There was a strong relation between the mRNA expression of TK and BDNF in infection BMSCs. The significance between the infection BMSCs and control BMSCs for uptake of 131 I-FIAU at all the time points was t=23.06-173.83 and P 131 I-FIAU. This suggests a suitable gene vector for tracing genetically modified stem cells. (authors)
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.
Directory of Open Access Journals (Sweden)
Julius W Kim
Full Text Available Vectors based on human adenovirus serotype 5 (HAdV-5 continue to show promise as delivery vehicles for cancer gene therapy. Nevertheless, it has become clear that therapeutic benefit is directly linked to tumor-specific vector localization, highlighting the need for tumor-targeted gene delivery. Aberrant glycosylation of cell surface glycoproteins and glycolipids is a central feature of malignant transformation, and tumor-associated glycoforms are recognized as cancer biomarkers. On this basis, we hypothesized that cancer-specific cell-surface glycans could be the basis of a novel paradigm in HAdV-5-based vector targeting.As a first step toward this goal, we constructed a novel HAdV-5 vector encoding a unique chimeric fiber protein that contains the tandem carbohydrate binding domains of the fiber protein of the NADC-1 strain of porcine adenovirus type 4 (PAdV-4. This glycan-targeted vector displays augmented CAR-independent gene transfer in cells with low CAR expression. Further, we show that gene transfer is markedly decreased in cells with genetic glycosylation defects and by inhibitors of glycosylation in normal cells.These data provide the initial proof-of-concept for HAdV-5 vector-mediated gene delivery based on the presence of cell-surface carbohydrates. Further development of this new targeting paradigm could provide targeted gene delivery based on vector recognition of disease-specific glycan biomarkers.
Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina
2010-04-15
Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.
The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances
International Nuclear Information System (INIS)
Zawacka-Pankau, Joanna; Krachulec, Justyna; Grulkowski, Ireneusz; Bielawski, Krzysztof P.; Selivanova, Galina
2008-01-01
Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT
Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model
International Nuclear Information System (INIS)
Tong, Ying; Smith, M.A.; Tucker, S.B.
1997-01-01
Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab
Directory of Open Access Journals (Sweden)
Kahori Shimizu
2014-01-01
Full Text Available Leaky expression of adenovirus (Ad genes occurs following transduction with a conventional replication-incompetent Ad vector, leading to an induction of cellular immunity against Ad proteins and Ad protein-induced toxicity, especially in the late phase following administration. To suppress the leaky expression of Ad genes, we developed novel Ad vectors by incorporating four tandem copies of sequences with perfect complementarity to miR-122a or miR-142-3p into the 3′-untranslated region (UTR of the E2A, E4, or pIX gene, which were mainly expressed from the Ad vector genome after transduction. These Ad vectors easily grew to high titers comparable to those of a conventional Ad vector in conventional 293 cells. The leaky expression of these Ad genes in mouse organs was significantly suppressed by 2- to 100-fold, compared with a conventional Ad vector, by insertion of the miRNA-targeted sequences. Notably, the Ad vector carrying the miR-122a–targeted sequences into the 3′-UTR of the E4 gene expressed higher and longer-term transgene expression and more than 20-fold lower levels of all the Ad early and late genes examined in the liver than a conventional Ad vector. miR-122a–mediated suppression of the E4 gene expression in the liver significantly reduced the hepatotoxicity which an Ad vector causes via both adaptive and non-adaptive immune responses.
Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.
2014-01-01
Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282
Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation
International Nuclear Information System (INIS)
Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY
1996-01-01
Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
International Nuclear Information System (INIS)
Yue-Hua Wang; De-jie Chen; Tie-Nan Yi
2010-01-01
To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
The effect of adenovirus-mediated gene expression of FHIT in small cell lung cancer cells
DEFF Research Database (Denmark)
Zandi, Roza; Xu, Kai; Poulsen, Hans S
2011-01-01
The candidate tumor suppressor fragile histidine traid (FHIT) is frequently inactivated in small cell lung cancer (SCLC). Mutations in the p53 gene also occur in the majority of SCLC leading to the accumulation of the mutant protein. Here we evaluated the effect of FHIT gene therapy alone...
BS69 : A novel adenovirus E1A-associated protein that inhibits E1A transactivation
Hateboer, G.; Gennissen, A.M.C.; Ramos, Y.F.M.; Kerkhoven, R.; Sonntag-Buck, V.; Stunnenberg, H.G.; Bernards, R.A.
1995-01-01
The adenovirus ElA gene products are nuclear phosphoproteins that can transactivate the other adenovirus early genes as well as several cellular genes, and can transform primary rodent cells in culture. Transformation and transactivation by ElA proteins is most likely to be mediated through
Directory of Open Access Journals (Sweden)
Peng Chen
2014-01-01
Full Text Available Osteosarcoma (OS is a malignant tumor mainly occurring in children and adolescents. Methotrexate (MTX, a chemotherapy agent, is widely used in treating OS. However, treatment failures are common due to acquired chemoresistance, for which the underlying molecular mechanisms are still unclear. In this study, we report that overexpression of estrogen-related receptor alpha (ERRα, an orphan nuclear receptor, promoted cell survival and blocked MTX-induced cell death in U2OS cells. We showed that MTX induced ROS production in MTX-sensitive U2OS cells while ERRα effectively blocked the ROS production and ROS associated cell apoptosis. Our further studies demonstrated that ERRα suppressed ROS induction of tumor suppressor P53 and its target genes NOXA and XAF1 which are mediators of P53-dependent apoptosis. In conclusion, this study demonstrated that ERRα plays an important role in the development of MTX resistance through blocking MTX-induced ROS production and attenuating the activation of p53 mediated apoptosis signaling pathway, and points to ERRα as a novel target for improving osteosarcoma therapy.
International Nuclear Information System (INIS)
Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo
2005-01-01
Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers
Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam
2013-04-01
p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.
Yoon, A-Rum; Hong, Jinwoo; Kim, Sung Wan; Yun, Chae-Ok
2016-06-01
Despite remarkable advancements, clinical evaluations of adenovirus (Ad)-mediated cancer gene therapies have highlighted the need for improved delivery and targeting. Genetic modification of Ad capsid proteins has been extensively attempted. Although genetic modification enhances the therapeutic potential of Ad, it is difficult to successfully incorporate extraneous moieties into the capsid and the engineering process is laborious. Recently, chemical modification of the Ad surface with nanomaterials and targeting moieties has been found to enhance Ad internalization into the target by both passive and active mechanisms. Alternatively, external stimulus-mediated targeting can result in selective accumulation of Ad in the tumor and prevent dissemination of Ad into surrounding nontarget tissues. In the present review, we discuss various genetic, chemical, and mechanical engineering strategies for overcoming the challenges that hinder the therapeutic efficacy of Ad-based approaches. Surface modification of Ad by genetic, chemical, or mechanical engineering strategies enables Ad to overcome the shortcomings of conventional Ad and enhances delivery efficiency through distinct and unique mechanisms that unmodified Ad cannot mimic. However, although the therapeutic potential of Ad-mediated gene therapy has been enhanced by various surface modification strategies, each strategy still possesses innate limitations that must be addressed, requiring innovative ideas and designs.
Directory of Open Access Journals (Sweden)
Marie-Jo Halaby
2015-01-01
Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
Energy Technology Data Exchange (ETDEWEB)
Nishida, Tamotsu, E-mail: nishida@gene.mie-u.ac.jp [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan); Yamada, Yoshiji [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan)
2011-03-11
Research highlights: {yields} SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. {yields} SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. {yields} SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. {yields} We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.
International Nuclear Information System (INIS)
Nishida, Tamotsu; Yamada, Yoshiji
2011-01-01
Research highlights: → SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. → SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. → SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. → We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.
Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G
2000-03-01
Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
International Nuclear Information System (INIS)
Naida, J.D.; Davis, M.A.; Lawrence, T.S.
1996-01-01
Purpose/Objective: Evidence exists that fluorodeoxyuridine (FdUrd)-mediated radiosensitization occurs in HT29 human colon carcinoma cells (which are p53 mutant) when these cells progress past the G 1 /S boundary in the presence of the drug. It has been demonstrated that wild type p53 levels increase following fluoropyrimidine treatment and that G 1 arrest is associated with increased p53 levels. We hypothesized that the restoration of wild type p53 function might restore G 1 /S arrest after FdUrd treatment, and that this would prevent FdUrd-mediated radiosensitization. Similarly, we hypothesized that cells containing wild type p53 would not be radiosensitized by FdUrd. Materials and Methods: Two clones of HT29 human colon cancer cells (ts29-A and ts29-G) containing murine temperature-sensitive p53 were constructed using electroporation and Geneticin selection. Incubation of these cells at the permissive temperature of 32 deg. C produces wild type p53 function and at the non permissive temperature of 38 deg. C causes mutant p53 function. A G418 resistant control cell line was also constructed (HT29neo). Cells were incubated at either 32 deg. C or 38 deg. C for 24 hours prior to irradiation and with FdUrd (100 nM) or medium only during the last 14 hours of the temperature shift. To assess progression into S phase, single-parameter (propidium iodide (PI)) and two-parameter (PI and bromodeoxyuridine) flow cytometry were performed at the end of drug exposure. A standard clonogenic assay was used. Results: We found that when ts29-A and ts29-G cells were incubated at the non-permissive (inactive p53 conformation) temperature, they progressed into S phase following exposure to FdUrd and were radiosensitized (enhancement ratio 1.5) to a degree similar to that seen in parental HT29 cells. Cells incubated at the permissive (wild-type p53 conformation) temperature demonstrated G 1 arrest, S phase depletion, and G2 arrest. In addition, FdUrd-mediated radiosensitization was
International Nuclear Information System (INIS)
Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.
1996-01-01
Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Directory of Open Access Journals (Sweden)
Alfredo Ribeiro-Silva
2003-06-01
Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human
Directory of Open Access Journals (Sweden)
Richard Moore
2015-12-01
Full Text Available The p53 tumor suppressor protein plays a critical role in cellular stress and cancer prevention. A number of post-transcriptional regulators, termed microRNAs, are closely connected with the p53-mediated cellular networks. While the molecular interactions among p53 and microRNAs have emerged, a systems-level understanding of the regulatory mechanism and the role of microRNAs-forming feedback loops with the p53 core remains elusive. Here we have identified from literature that there exist three classes of microRNA-mediated feedback loops revolving around p53, all with the nature of positive feedback coincidentally. To explore the relationship between the cellular performance of p53 with the microRNA feedback pathways, we developed a mathematical model of the core p53-MDM2 module coupled with three microRNA-mediated positive feedback loops involving miR-192, miR-34a, and miR-29a. Simulations and bifurcation analysis in relationship to extrinsic noise reproduce the oscillatory behavior of p53 under DNA damage in single cells, and notably show that specific microRNA abrogation can disrupt the wild-type cellular phenotype when the ubiquitous cell-to-cell variability is taken into account. To assess these in silico results we conducted microRNA-perturbation experiments in MCF7 breast cancer cells. Time-lapse microscopy of cell-population behavior in response to DNA double-strand breaks, together with image classification of single-cell phenotypes across a population, confirmed that the cellular p53 oscillations are compromised after miR-192 perturbations, matching well with the model predictions. Our study via modeling in combination with quantitative experiments provides new evidence on the role of microRNA-mediated positive feedback loops in conferring robustness to the system performance of stress-induced response of p53.
Essentials in clinical application of p53 for tumors intervention-example of liver cancer
International Nuclear Information System (INIS)
Guan Yongsong; He Qing
2008-01-01
Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
Directory of Open Access Journals (Sweden)
Bo Liu
2013-02-01
Full Text Available Arthropod-borne pathogens account for millions of deaths each year. Understanding the genetic mechanisms controlling vector susceptibility to pathogens has profound implications for developing novel strategies for controlling insect-transmitted infectious diseases. The fact that many viruses carry genes that have anti-apoptotic activity has long led to the hypothesis that induction of apoptosis could be a fundamental innate immune response. However, the cellular mechanisms mediating the induction of apoptosis following viral infection remained enigmatic, which has prevented experimental verification of the functional significance of apoptosis in limiting viral infection in insects. In addition, studies with cultured insect cells have shown that there is sometimes a lack of apoptosis, or the pro-apoptotic response happens relatively late, thus casting doubt on the functional significance of apoptosis as an innate immunity. Using in vivo mosquito models and the native route of infection, we found that there is a rapid induction of reaper-like pro-apoptotic genes within a few hours following exposure to DNA or RNA viruses. Recapitulating a similar response in Drosophila, we found that this rapid induction of apoptosis requires the function of P53 and is mediated by a stress-responsive regulatory region upstream of reaper. More importantly, we showed that the rapid induction of apoptosis is responsible for preventing the expression of viral genes and blocking the infection. Genetic changes influencing this rapid induction of reaper-like pro-apoptotic genes led to significant differences in susceptibility to viral infection.
The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.
Gong, Yi; Ju, Chenyu; Zhang, Xiaobo
2015-10-01
The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.
Innate Functions of Immunoglobulin M Lessen Liver Gene Transfer with Helper-Dependent Adenovirus
Unzu, Carmen; Morales-Kastresana, Aizea; Sampedro, Ana; Serrano-Mendioroz, Irantzu; Azpilikueta, Arantza; Ochoa, María Carmen; Dubrot, Juan; Martínez-Ansó, Eduardo
2014-01-01
The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA) vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors. PMID:24465560
Innate functions of immunoglobulin M lessen liver gene transfer with helper-dependent adenovirus.
Directory of Open Access Journals (Sweden)
Carmen Unzu
Full Text Available The immune system poses obstacles to viral vectors, even in the first administration to preimmunized hosts. We have observed that the livers of B cell-deficient mice were more effectively transduced by a helper-dependent adenovirus serotype-5 (HDA vector than those of WT mice. This effect was T-cell independent as shown in athymic mice. Passive transfer of the serum from adenovirus-naïve WT to Rag1KO mice resulted in a reduction in gene transfer that was traced to IgM purified from serum of adenovirus-naïve mice. To ascribe the gene transfer inhibition activity to either adenoviral antigen-specific or antigen-unspecific functions of IgM, we used a monoclonal IgM antibody of unrelated specificity. Both the polyclonal and the irrelevant monoclonal IgM inhibited gene transfer by the HDA vector to either cultured hepatocellular carcinoma cells or to the liver of mice in vivo. Adsorption of polyclonal or monoclonal IgMs to viral capsids was revealed by ELISAs on adenovirus-coated plates. These observations indicate the existence of an inborn IgM mechanism deployed against a prevalent virus to reduce early post-infection viremia. In conclusion, innate IgM binding to adenovirus serotype-5 capsids restrains gene-transfer and offers a mechanism to be targeted for optimization of vector dosage in gene therapy with HDA vectors.
International Nuclear Information System (INIS)
Cardoso, F.M.; Kato, Sayuri E.M.; Huang Wenying; Flint, S. Jane; Gonzalez, Ramon A.
2008-01-01
It is well established that the human subgroup C adenovirus type 5 (Ad5) E1B 55 kDa protein can regulate the activity and concentration of the cellular tumor suppressor, p53. However, the contribution(s) of these functions of the E1B protein to viral reproduction remains unclear. To investigate this issue, we examined properties of p53 in normal human cells infected by E1B mutant viruses that display defective entry into the late phase or viral late mRNA export. The steady-state concentrations of p53 were significantly higher in cells infected by the E1B 55 kDa null mutant Hr6 or three mutants carrying small insertions in the E1B 55 kDa protein coding sequence than in Ad5-infected cells. Nevertheless, none of the mutants induced apoptosis in infected cells. Rather, the localization of p53 to E1B containing nuclear sites observed during infection by Ad5 was prevented by mutations that impair interaction of the E1B protein with p53 and/or with the E4 Orf6 protein. These results indicate that the E1B protein fulfills an early function that correlates efficient entry into the late phase with the localization of E1B and p53 in the nucleus of Ad5-infected normal human cells
2016-09-01
in this progress report: p53 triple-negative breast cancer subtypes gene expression somatic cell genetics CRISPR / Cas 3. ACCOMPLISHMENTS Major...report, we described the creation of an isogenic p53 mutant TNBC cell line panel using CRISPR / Cas -mediated genome editing8 and the resultant...LOF null state. To validate that mutant p53 is directly responsible for this altered transcription, we will use the same CRISPR -mediated genome
Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto
2010-01-01
Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012
[Construction and expression of a recombinant adenovirus with LZP3].
Chen, Bang-dang; Zhang, Fu-chun; Sun, Mei-yu; Li, Yi-jie; Ma, Zheng-hai
2007-08-01
To explore a new immunocontraceptive vaccine and construct an attenuated recombinant adenoviral vaccine against Lagurus lagurus zona pellucida 3(LZP3). LZP3 gene was subcloned into the shuttle vector pShuttle-CMV, and then a two-step transformation procedure was employed to construct a recombinant adenoviral plasmid with LZP3, which was digested with Pac I and transfected into HEK293 cells to package recombinant adenovirus particles. Finally, HeLa cells were infected by the recombinant adenovirus. LZP3 gene was detected from the recombinant virus by PCR, and its transcription and expression were analyzed by RT-PCR and Western blot. Recombinant adenovirus vector pAd-LZP3 with LZP3 gene was constructed by homologous recombination in E.coli, and a recombinant adenovirus was obtained by transfecting HEK293 cells with pAd-LZP3. PCR test indicated that LZP3 gene was successfully integrated into the adenoviral genome, and the titer of the recombinant adenovirus reached 1.2x10(10) pfu/L. The transcription and expression of LZP3 gene in the infected HeLa cells were confirmed by RT-PCR and Western blot. The recombinant adenovirus RAd-LZP3 can be successfully expressed in the infected HeLa cells, which lays the foundation for further researches into immunizing animals with RAd-LZP3.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Directory of Open Access Journals (Sweden)
Michael P Walsh
2009-06-01
Full Text Available In 2005, a human adenovirus strain (formerly known as HAdV-D22/H8 but renamed here HAdV-D53 was isolated from an outbreak of epidemic keratoconjunctititis (EKC, a disease that is usually caused by HAdV-D8, -D19, or -D37, not HAdV-D22. To date, a complete change of tropism compared to the prototype has never been observed, although apparent recombinant strains of other viruses from species Human adenovirus D (HAdV-D have been described. The complete genome of HAdV-D53 was sequenced to elucidate recombination events that lead to the emergence of a viable and highly virulent virus with a modified tropism. Bioinformatic and phylogenetic analyses of this genome demonstrate that this adenovirus is a recombinant of HAdV-D8 (including the fiber gene encoding the primary cellular receptor binding site, HAdV-D22, (the epsilon determinant of the hexon gene, HAdV-D37 (including the penton base gene encoding the secondary cellular receptor binding site, and at least one unknown or unsequenced HAdV-D strain. Bootscanning analysis of the complete genomic sequence of this novel adenovirus, which we have re-named HAdV-D53, indicated at least five recombination events between the aforementioned adenoviruses. Intrahexon recombination sites perfectly framed the epsilon neutralization determinant that was almost identical to the HAdV-D22 prototype. Additional bootscan analysis of all HAdV-D hexon genes revealed recombinations in identical locations in several other adenoviruses. In addition, HAdV-D53 but not HAdV-D22 induced corneal inflammation in a mouse model. Serological analysis confirmed previous results and demonstrated that HAdV-D53 has a neutralization profile representative of the epsilon determinant of its hexon (HAdV-D22 and the fiber (HAdV-D8 proteins. Our recombinant hexon sequence is almost identical to the hexon sequences of the HAdV-D strain causing EKC outbreaks in Japan, suggesting that HAdV-D53 is pandemic as an emerging EKC agent. This documents
Directory of Open Access Journals (Sweden)
Harrison David J
2007-11-01
Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of
Adenovirus-derived vectors for prostate cancer gene therapy
Czech Academy of Sciences Publication Activity Database
de Vrij, J.; Willemsen, R. A.; Lindholm, L.; Hoeben, R. C.; Bangma, Ch. H.; Barber, Ch.; Behr, J.-P.; Briggs, S.; Carlisle, R.; Cheng, W.-S.; Dautzenberg, I. J. C.; de Ridder, C.; Dzojic, H.; Erbacher, P.; Essand, M.; Fisher, K.; Frazier, A.; Georgopoulos, L. J.; Jennings, I.; Kochanek, S.; Koppers-Lalic, D.; Kraaij, R.; Kreppel, F.; Magnusson, M.; Maitland, N.; Neuberg, P.; Nugent, R.; Ogris, M.; Remy, J.-S.; Scaife, M.; Schenk, E.; Schooten, E.; Seymour, L.; Slade, M.; Szyjanowicz, P.; Totterman, T.; Uil, T. G.; Ulbrich, Karel; van der Weel, L.; van Weerden, W.; Wagner, E.; Zuber, G.
2010-01-01
Roč. 21, č. 7 (2010), s. 795-805 ISSN 1043-0342 EU Projects: European Commission(XE) 512087 - GIANT Keywords : adenovirus * gene delivery * prostate cancer Subject RIV: CD - Macromolecular Chemistry Impact factor: 4.829, year: 2010
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Exploring a minimal two-component p53 model
International Nuclear Information System (INIS)
Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei
2010-01-01
The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks
MicroRNA-mediated suppression of oncolytic adenovirus replication in human liver.
Directory of Open Access Journals (Sweden)
Erkko Ylösmäki
Full Text Available MicroRNAs (miRNAs are important and ubiquitous regulators of gene expression that can suppress their target genes by translational inhibition as well as mRNA destruction. Cell type-specific miRNA expression patterns have been successfully exploited for targeting the expression of experimental and therapeutic gene constructs, for example to reduce pathogenic effects of cancer virotherapy in normal tissues. In order to avoid liver damage associated with systemic or intrahepatic delivery of oncolytic adenoviruses we have introduced the concept of suppressing adenovirus replication in hepatic cells by inserting target elements for the liver-specific miR122 into the viral genome. Here we show using ex vivo cultured tissue specimens that six perfectly complementary miR122 target sites in the 3' untranslated region of the viral E1A gene are sufficient in the absence of any other genetic modifications to prevent productive replication of serotype 5 adenovirus (Ad5 in normal human liver. This modification did not compromise the replicative capacity of the modified virus in cancer tissue derived from a colon carcinoma liver metastasis or its oncolytic potency in a human lung cancer xenograft mouse model. Unlike wild-type Ad5, the modified virus did not result in increased serum levels of liver enzymes in infected mice. These results provide a strong preclinical proof of concept for the use of miR122 target sites for reducing the risk of liver damage caused by oncolytic adenoviruses, and suggest that ectopic miR122 target elements should be considered as an additional safety measure included in any therapeutic virus or viral vector posing potential hazard to the liver.
Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan
2002-04-10
We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Directory of Open Access Journals (Sweden)
Kazuho Nishimura
2015-03-01
Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
Directory of Open Access Journals (Sweden)
Hayder M. Al-kuraishy
2018-01-01
Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage
Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.
2009-01-01
Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133
Directory of Open Access Journals (Sweden)
Zhihong CHEN
2011-10-01
Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
International Nuclear Information System (INIS)
Hu, Duanmin; Su, Cunjin; Jiang, Min; Shen, Yating; Shi, Aiming; Zhao, Fenglun; Chen, Ruidong; Shen, Zhu; Bao, Junjie; Tang, Wen
2016-01-01
There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.
Energy Technology Data Exchange (ETDEWEB)
Hu, Duanmin [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Su, Cunjin [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Jiang, Min [Department of Breast Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Yating [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shi, Aiming; Zhao, Fenglun [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Chen, Ruidong [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Zhu [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Bao, Junjie, E-mail: baojjsdfey@sina.com [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Tang, Wen, E-mail: sztangwen@163.com [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China)
2016-03-04
There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.
Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.
1993-01-01
Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the
CD95 is part of a let-7/p53/miR-34 regulatory network.
Directory of Open Access Journals (Sweden)
Annika Hau
Full Text Available The death receptor CD95 (APO-1/Fas mediates apoptosis induction upon ligation by its cognate ligand CD95L. Two types of CD95 signaling pathways have been identified, which are characterized by the absence (Type I or presence (Type II of mitochondrial involvement. Micro(miRNAs are small noncoding RNAs that negatively regulate gene expression. They are important regulators of differentiation processes and are found frequently deregulated in many human cancers. We recently showed that Type I cells express less of the differentiation marker miRNA let-7 and, hence, likely represent more advanced tumor cells than the let-7 high expressing Type II cells. We have now identified miR-34a as a selective marker for cells that are sensitive to CD95-mediated apoptosis. Both CD95 and miR-34a are p53 target genes, and consequently, both the sensitivity of cancer cells to CD95-mediated apoptosis and the ability to respond to p53 mediated DNA genotoxic stress are linked. Interestingly, while miR-34a was found to positively correlate with the ability of cells to respond to genotoxic stress, let-7 was negatively correlated. The expression level of CD95 inversely correlated with the expression of let-7 suggesting regulation of let-7 expression by CD95. To test a link between p53 and miR-34a, we altered the expression of CD95. This affected the ability of cells to activate p53 and to regulate miR-34a. Our data point to a novel regulatory network comprising p53, CD95, let-7, and miR-34a that affects cancer cell survival, differentiation, and sensitivity to apoptotic signals. The possible relevance of this regulatory network for cancer stem cells is discussed.
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
International Nuclear Information System (INIS)
Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang
2006-01-01
The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)
Rapid detection of single nucleotide mutation in p53 gene based on ...
Indian Academy of Sciences (India)
mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E
1996-09-01
Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang
2006-01-01
HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties
Effect of radon and its progeny on the expression and mutation of p53 in lung tissues of mice
International Nuclear Information System (INIS)
Piao Chunnan; Tian Mei; Liu Jianxiang; Ruan Jianlei; Su Xu
2010-01-01
Objective: To explore the effect of radon and its progeny on the expression and mutations of p53 in lung tissue of mouse model. Methods: Apoptosis was detected by terminal deoxynucleotidy transferase-mediated dUTP-biotin nick end labeling. The expression of p53 gene was analyzed by immunohistochemistry, Western blot and realtime-PCR. PCR-SSCP was used to detect the mutation of p53 in lung tissues. Results: Compared with those in the control group, the apoptotic index were increased significantly in 30 WLM and 60 WLM groups (t=18.11, -10.30, P<0.05). The p53 protein was increased significantly (t=-11.08, P<0.05; t=-7.00, P<0.05) in 30 WLM and 60 WLM groups. The mutation of p53 gene was not detected in lungs of radon-exposure mice. Conclusions: Lung and bronchus might be the targets of radon and its progeny, and p53 gene plays an important role in the progression of radon-induced lung injury. (authors)
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
Directory of Open Access Journals (Sweden)
Rashid Mir
2016-01-01
Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.
1996-01-01
Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type
Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline
Directory of Open Access Journals (Sweden)
Noriko Mori
2004-10-01
Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.
Adenovirus-mediated sphingomyelin synthase 2 increases atherosclerotic lesions in ApoE KO mice
Directory of Open Access Journals (Sweden)
Zhao Yarui
2011-01-01
Full Text Available Abstract Background Sphingomyelin synthase 2 (SMS2 contributes to de novo sphingomyelin (SM biosynthesis. Its activity is related to SM levels in the plasma and the cell membrane. In this study, we investigated the possibility of a direct relationship between SMS and atherosclerosis. Methods The Adenovirus containing SMS2 gene was given into 10-week ApoE KO C57BL/6J mice by femoral intravenous injection. In the control group, the Adenovirus containing GFP was given. To confirm this model, we took both mRNA level examination (RT-PCR and protein level examination (SMS activity assay. Result We generated recombinant adenovirus vectors containing either human SMS2 cDNA (AdV-SMS2 or GFP cDNA (AdV-GFP. On day six after intravenous infusion of 2 × 1011 particle numbers into ten-week-old apoE KO mice, AdV-SMS2 treatment significantly increased liver SMS2 mRNA levels and SMS activity (by 2.7-fold, 2.3-fold, p Conclusions Our results present direct morphological evidence for the pro-atherogenic capabilities of SMS2. SMS2 could be a potential target for treating atherosclerosis.
Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.
Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M
2015-12-01
Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.
Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.
Stępiński, Dariusz
2016-08-01
Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.
Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression
International Nuclear Information System (INIS)
Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo
2009-01-01
A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.
The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.
Directory of Open Access Journals (Sweden)
Peiyuan Jia
Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
He, Jianming; Liang, Xi; Luo, Fen; Chen, Xuedan; Xu, Xueqing; Wang, Fengchao; Zhang, Zhenping
2016-01-01
Three-dimensional (3D) culture models represent a better approximation of solid tumor tissue architecture, especially cell adhesion, in vivo than two-dimensional (2D) cultures do. Here, we explored the role of architecture in chemosensitivity to platinum in colon cancer. Under the 3D culture condition, colon cancer cells formed multicellular spheroids, consisting of layers of cells. 3D cultures displayed significantly decreased sensitivity to platinum compared with 2D cultures. Platinum increased p53 in a dose-dependent and time-dependent manner. There was no detectable difference in basal p53 levels between 3D cultures and 2D cultures but cisplatin induced less p53 in both HCT116 3D cultures and LoVo 3D cultures. It was not due to cisplatin concentration because cisplatin induced similar γ-H2AX in 3D vs 2D. Knockdown of p53 significantly decreased sensitivity to platinum in 3D cultures. Knockdown of p53 decreased cleaved caspase 3 and apoptosis induced by cisplatin. These findings indicate that 3D architecture confers decreased chemosensitivity to platinum and p53 is involved in the mechanism. Knockdown of p53 decreased cisplatin's induction of c-Jun N-terminal kinase 1/2 (JNK1/2) activation, whereas inhibition of JNK1/2 activation increased chemosensitivity. Inhibition of p38 activation decreased cisplatin's induction of p53, but no difference in p38 activation by cisplatin was observed between 2D cultures and 3D cultures. Taken together, our results suggest that p53 is involved in a 3D architecture-mediated decrease in chemosensitivity to platinum in colon cancer. Mitogen-activated protein kinases (JNK1/2 and p38) do not play a dominant role in the mechanism.
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer
International Nuclear Information System (INIS)
Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong
2009-01-01
Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Adenovirus-mediated heme oxygenase-1 gene transfer into rabbit ocular tissues.
Abraham, N G; da Silva, J L; Lavrovsky, Y; Stoltz, R A; Kappas, A; Dunn, M W; Schwartzman, M L
1995-10-01
Heme oxygenase-1 (HO-1) is a stress protein induced up to 100-fold within a few hours after exposure to oxidative stress, and it has been shown to counteract oxidative injury induced by ultraviolet light or free radicals. The current study was undertaken to determine whether the HO-1 gene can be introduced into adult rabbit ocular tissues by microinjection of a recombinant replication-deficient adenovirus human HO-1 cDNA (Adv-HHO). Human HO-1 gene was used for transfection studies to differentiate endogenous from transfected HO. The purified Adv-HHO construct (10(8) pfu/ml) was mixed with lipofectamine and microinjected into the anterior chamber, vitreous cavity, and subretinal space of New Zealand rabbit eyes. After 2 weeks, total RNA was extracted from different ocular tissues, reverse transcription-polymerase chain reaction was performed using specific human HO-1 primers, and amplification products were subjected to Southern hybridization. Transfection with the Adv-HHO construct into rabbit corneal epithelial cells in culture resulted in a functional expression of the human HO-1 gene; the human HO-1 mRNA was detected, and enzyme activity increased threefold. Human HO-1 mRNA was detected in the retina after microinjection of the Adv-HHO construct into the subretinal space. Microinjection into the vitreous resulted in HO-1 mRNA expression in the corneal endothelium, iris, lens, and retina; after intracameral injection of the Adv-HHO construct, human HO-1 mRNA was detected in corneal epithelium and endothelium, ciliary body, lens, and iris. Regardless of the injection site, transfected human HO-1 mRNA was undetectable in tissues outside the eye, that is, brain, liver, and kidney. These results demonstrated a tissue-selective functional transfer of the human HO-1 gene into rabbit ocular tissues in vivo. This technique may be a promising means for delivering HO-1 gene in vivo as a protective mechanism against oxidative stress that contributes to the pathogenesis of
[CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].
Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G
2012-01-01
In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.
Directory of Open Access Journals (Sweden)
Reza Akhavan-Sigari
2014-08-01
Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.
Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest
Directory of Open Access Journals (Sweden)
Clarke Alan R
2002-11-01
Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.
Directory of Open Access Journals (Sweden)
Vladimir O. Pustylnyak
2015-01-01
Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.
International Nuclear Information System (INIS)
Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.
1997-01-01
Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis
International Nuclear Information System (INIS)
Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee
1996-12-01
The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs
Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao
2015-07-01
A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.
Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.
Directory of Open Access Journals (Sweden)
Damiano Conte
Full Text Available Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU. Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors.
International Nuclear Information System (INIS)
Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir
2016-01-01
The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression
Identification of the interleukin 4 receptor alpha gene as a direct target for p73.
Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi
2003-12-01
p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.
Directory of Open Access Journals (Sweden)
Zanatta Daniela B
2010-06-01
Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet
International Nuclear Information System (INIS)
Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E
2010-01-01
Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
International Nuclear Information System (INIS)
Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.
2002-01-01
The aim of this prospective trial was to evaluate the feasibility and outcome of breast conservation therapy for patients with locally advanced breast cancer after neoadjuvant chemotherapy. We studied also the value of p53 and MDR1 as predictors to neoadjuvant chemotherapy. Patients and methods: Bet ween August 1997 and May 2000, 58 patients with locally advanced breast carcinoma (stages IlIA and lllB) completed treatment consisting of 5 fluorouracil 600 mg/m 2 , epirubicin 60 mg/m 2 and cyclophosphamide 600 mg/m 2 (FEC) administered intravenously, at intervals of 3 weeks. The number of cycles of chemotherapy given depended on the clinical tumor response. Surgery (local excision if sufficiently down staged, or mastectomy if not, both with axillary dissection) was performed. Surgery was followed by radiation therapy and 4 more cycles of FEC chemotherapy as an adjuvant therapy. P53 and MDR1 were assessed in the initial tissue biopsy by means of reverse transcriptase-mediated polymerase chain reaction (RT-PCR). p53 and MDR1 findings were correlated with treatment response and linkage between p53 function and cellular response was assessed by terminal deoxynucleotidyl transferase-mediated nick end labeling assay. Results: The overall response (CR+PR) was 87.9%, with a clinical complete response rate of 29.3%. Six patients had a pathological complete response and 10 patients had only minimal residual disease. Median followup from the start of chemotherapy was 24 months (range 6 to 40). Twenty two patients (43%) underwent BCS with actuarial 3-year disease-free and overall survival of 58% and 75% respectively. Cosmetic results were good to excellent in 77.2% of the patients. Modified radical mastectomy was done in 29/51 (56.9%) patients with actuarial 3 year disease-free and overall survival of 60% and 78% respectively.In 13 out of 58 patients (22.4%), p53 mutations could be identified, including eight point mutations, three minor deletions and two complex deletions
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
Suppression of Oncolytic Adenovirus-Mediated Hepatotoxicity by Liver-Specific Inhibition of NF-κB
Directory of Open Access Journals (Sweden)
Mitsuhiro Machitani
2017-12-01
Full Text Available Telomerase-specific replication-competent adenoviruses (Ads, i.e., TRADs, which possess an E1 gene expression cassette driven by the human telomerase reverse transcriptase promoter, are promising agents for cancer treatment. However, even though oncolytic Ads, including TRAD, are intratumorally administered, they are disseminated from the tumor to systemic circulation, causing concern about oncolytic Ad-mediated hepatotoxicity (due mainly to leaky expression of Ad genes in liver. We reported that inhibition of nuclear factor-κB (NF-κB leads to the suppression of replication-incompetent Ad vector-mediated hepatotoxicity via reduction of the leaky expression of Ad genes in liver. Here, to develop a TRAD with an improved safety profile, we designed a TRAD that carries a liver-specific promoter-driven dominant-negative IκBα (DNIκBα expression cassette (TRAD-DNIκBα. Compared with a conventional TRAD, TRAD-DNIκBα showed hepatocyte-specific inhibition of NF-κB signaling and significantly reduced Ad gene expression and replication in the normal human hepatocyte cell line. TRAD-induced hepatotoxicity was largely suppressed in mice following intravenous administration of TRAD-DNIκBα. However, the replication profiles and oncolytic activities of TRAD-DNIκBα were comparable with those of the conventional TRAD in human non-hepatic tumor cells. These results indicate that oncolytic Ads containing the liver-specific DNIκBα expression cassette have improved safety profiles without inhibiting oncolytic activities.
Gene therapy of cancer and development of therapeutic target gene
Energy Technology Data Exchange (ETDEWEB)
Kim, Chang Min; Kwon, Hee Chung
1998-04-01
We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene.
Gene therapy of cancer and development of therapeutic target gene
International Nuclear Information System (INIS)
Kim, Chang Min; Kwon, Hee Chung
1998-04-01
We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Directory of Open Access Journals (Sweden)
Rouba Hage-Sleiman
Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-07-19
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
International Nuclear Information System (INIS)
Willers, H.; Powell, S.N.; Dahm-Daphi, J.
2003-01-01
Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function
Zhang, Yan; Fang, Lin; Zhang, Quan'an; Zheng, Qin; Tong, Jinlong; Fu, Xiaohui; Jiang, Xiaoqing; Su, Changqing; Zheng, Junnian
2013-06-01
Gene therapy and antibody approaches are crucial auxiliary strategies for hepatocellular carcinoma (HCC) treatment. Previously, we established a survivin promoter-regulated oncolytic adenovirus that has inhibitory effect on HCC growth. The human sulfatase-1 (hSulf-1) gene can suppress the growth factor signaling pathways, then inhibit the proliferation of cancer cells and enhance cellular sensitivity to radiotherapy and chemotherapy. I(131)-metuximab (I(131)-mab) is a monoclonal anti-HCC antibody that conjugated to I(131) and specifically recognizes the HAb18G/CD147 antigen on HCC cells. To integrate the oncolytic adenovirus-based gene therapy and the I(131)-mab-based radioimmunotherapy, this study combined the CArG element of early growth response-l (Egr-l) gene with the survivin promoter to construct a radiation-inducible enhanced promoter, which was used to recombine a radiation-inducible oncolytic adenovirus as hSulf-1 gene vector. When I(131)-mab was incorporated into the treatment regimen, not only could the antibody produce radioimmunotherapeutic effect, but the I(131) radiation was able to further boost adenoviral proliferation. We demonstrated that the CArG-enhanced survivin promoter markedly improved the proliferative activity of the oncolytic adenovirus in HCC cells, thereby augmenting hSulf-1 expression and inducing cancer cell apoptosis. This novel strategy that involved multiple, synergistic mechanisms, including oncolytic therapy, gene therapy and radioimmunotherapy, was demonstrated to exert an excellent anti-cancer outcome, which will be a promising approach in HCC treatment. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
The prognostic value of p53 mutation in pediatric marrow hypoplasia
Directory of Open Access Journals (Sweden)
Sharaf Alzahraa EA
2011-06-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Li Xie
Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...
Yang, Jian-kai; Song, Jian; Huo, Hao-ran; Zhao, Yin-long; Zhang, Guang-yu; Zhao, Zong-mao; Sun, Guo-zhu; Jiao, Bao-hua
2017-01-01
Background: Glioblastoma multiforme (GBM) is the most aggressive and deadly primary brain cancer that arises from astrocytes and classified as grade IV. Recently, exosomes have been reported as an essential mediator in diverse cancer carcinogenesis and metastasis. However, their role in GBM is still unclear. In this study, we aimed to investigate whether blood exosomes can be potential clinical diagnostic markers for GBM. Methods: We used a xenograft orthotopic mouse model to detect the differentially expressed genes in the brain and blood exosomes of original/recurrent GBM. Results: We found that recurrent GBM had stronger growth capacity and lethality than original GBM in the mouse model. A gene microarray of original tumors and blood exosomes from GBM orthotopic xenografts results showed that DNM3, p65 and CD117 expressions increased, whereas PTEN and p53 expressions decreased in both original tumors and blood exosomes. In the recurrent GBM tumor model, DNM3 and p65 showed increased expressions, whereas ST14 and p53 showed decreased expressions in tumor and blood exosomes of the recurrent GBM mouse model. Conclusion: In summary, we found that DNM3, p65 and p53 had a similar trend in brain and blood exosomes both for original and recurrent GBM, and could serve as potential clinical diagnostic markers for GBM. PMID:29449895
Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S
p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice
Rani, Reena; Li, Jie; Pang, Qishen
2008-01-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.
Rani, Reena; Li, Jie; Pang, Qishen
2008-12-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D
2014-01-01
TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
Directory of Open Access Journals (Sweden)
Hanqian Mao
2016-09-01
Full Text Available The exon junction complex (EJC is an RNA binding complex comprised of the core components Magoh, Rbm8a, and Eif4a3. Human mutations in EJC components cause neurodevelopmental pathologies. Further, mice heterozygous for either Magoh or Rbm8a exhibit aberrant neurogenesis and microcephaly. Yet despite the requirement of these genes for neurodevelopment, the pathogenic mechanisms linking EJC dysfunction to microcephaly remain poorly understood. Here we employ mouse genetics, transcriptomic and proteomic analyses to demonstrate that haploinsufficiency for each of the 3 core EJC components causes microcephaly via converging regulation of p53 signaling. Using a new conditional allele, we first show that Eif4a3 haploinsufficiency phenocopies aberrant neurogenesis and microcephaly of Magoh and Rbm8a mutant mice. Transcriptomic and proteomic analyses of embryonic brains at the onset of neurogenesis identifies common pathways altered in each of the 3 EJC mutants, including ribosome, proteasome, and p53 signaling components. We further demonstrate all 3 mutants exhibit defective splicing of RNA regulatory proteins, implying an EJC dependent RNA regulatory network that fine-tunes gene expression. Finally, we show that genetic ablation of one downstream pathway, p53, significantly rescues microcephaly of all 3 EJC mutants. This implicates p53 activation as a major node of neurodevelopmental pathogenesis following EJC impairment. Altogether our study reveals new mechanisms to help explain how EJC mutations influence neurogenesis and underlie neurodevelopmental disease.
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response
Directory of Open Access Journals (Sweden)
Toshinori Ozaki
2013-01-01
Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent
Directory of Open Access Journals (Sweden)
Nana Pei
Full Text Available Increased expression of angiotensin II type 2 receptor (AT2R induces apoptosis in numerous tumor cell lines, with either Angiotensin II-dependent or Angiotensin II-independent regulation, but its molecular mechanism remains poorly understood. Here, we used PCR Array analysis to determine the gene and microRNA expression profiles in human prostate cancer cell lines transduced with AT2R recombinant adenovirus. Our results demonstrated that AT2R over expression leads to up-regulation of 6 apoptosis-related genes (TRAIL-R2, BAG3, BNIPI, HRK, Gadd45a, TP53BP2, 2 cytokine genes (IL6 and IL8 and 1 microRNA, and down-regulation of 1 apoptosis-related gene TNFSF10 and 2 cytokine genes (BMP6, BMP7 in transduced DU145 cells. HRK was identified as an up-regulated gene in AT2R-transduced PC-3 cells by real-time RT-PCR. Next, we utilized siRNAs to silence the up-regulated genes to further determine their roles on AT2R overexpression mediated apoptosis. The results showed downregulation of Gadd45a reduced the apoptotic effect by ∼30% in DU145 cells, downregulation of HRK reduced AT2R-mediated apoptosis by more than 50% in PC-3 cells, while downregulation of TRAIL-R2 enhanced AT2R-mediated apoptosis more than 4 times in DU145 cells. We also found that the effects on AT2R-mediated apoptosis caused by downregulation of Gadd45a, TRAIL-R2 and HRK were independent in activation of p38 MAPK, p44/42 MAPK and p53. Taken together, our results demonstrated that TRAIL-R2, Gadd45a and HRK may be novel target genes for further study of the mechanism of AT2R-mediated apoptosis in prostate cancer cells.
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
Directory of Open Access Journals (Sweden)
Jacqueline Miranda de Lima
2006-03-01
Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.
Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen
2017-10-15
Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and
Directory of Open Access Journals (Sweden)
Suzanne M Quartuccio
Full Text Available Epithelial ovarian cancer is the most lethal gynecological malignancy among US women. The etiology of this disease, although poorly understood, may involve the ovarian surface epithelium or the epithelium of the fallopian tube fimbriae as the progenitor cell. Disruptions in the transforming growth factor beta (TGFβ pathway and p53 are frequently found in chemotherapy-resistant serous ovarian tumors. Transgenic mice expressing a dominant negative form of Smad2 (Smad2DN, a downstream transcription factor of the TGFβ signaling pathway, targeted to tissues of the reproductive tract were created on a FVB background. These mice developed epithelium-lined inclusion cysts, a potential precursor lesion to ovarian cancer, which morphologically resembled oviductal epithelium but exhibited protein expression more closely resembling the ovarian surface epithelium. An additional genetic "hit" of p53 deletion was predicted to result in ovarian tumors. Tissue specific deletion of p53 in the ovaries and oviducts alone was attempted through intrabursal or intraoviductal injection of Cre-recombinase expressing adenovirus (AdCreGFP into p53 (flox/flox mice. Ovarian bursal cysts were detected in some mice 6 months after intrabursal injection. No pathological abnormalities were detected in mice with intraoviductal injections, which may be related to decreased infectivity of the oviductal epithelium with adenovirus as compared to the ovarian surface epithelium. Bitransgenic mice, expressing both the Smad2DN transgene and p53 (flox/flox, were then exposed to AdCreGFP in the bursa and oviductal lumen. These mice did not develop any additional phenotypes. Exposure to AdCreGFP is not an effective methodology for conditional deletion of floxed genes in oviductal epithelium and tissue specific promoters should be employed in future mouse models of the disease. In addition, a novel phenotype was observed in mice with high expression of the Smad2DN transgene as validated
International Nuclear Information System (INIS)
Tierney, L.A.; Johnson, N.F.; Lechner, J.F.
1994-01-01
Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins
P53 Gene Mutagenesis in Breast Cancer
National Research Council Canada - National Science Library
Sommer, Steve S
2005-01-01
.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...
International Nuclear Information System (INIS)
Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.
2002-01-01
The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
International Nuclear Information System (INIS)
Ohnishi, Takeo
1997-01-01
I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)
Detection of enteric Adenoviruses in South-African waters using gene probes
CSIR Research Space (South Africa)
Genthe, Bettina
1995-01-01
Full Text Available Gene probes developed locally for both enteric Adenoviruses 40 and 41 were used to determine whether these viruses were present in both raw and treated waters. Approximately sixty water samples were concentrated by ultra filtration and analysed...
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Directory of Open Access Journals (Sweden)
Hui-Ching Chuang
Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia
2004-06-01
G --> T transversion mutations in the p53 tumor suppressor gene are characteristic of smoking-related lung tumors, suggesting that these genetic changes may result from exposure to tobacco carcinogens. It has been previously demonstrated that the diol epoxide metabolites of bay region polycyclic aromatic hydrocarbons present in tobacco smoke, e.g., benzo[a]pyrene diol epoxide (BPDE), preferentially bind to the most frequently mutated guanine nucleotides within p53 codons 157, 158, 248, and 273 [Denissenko, M. F., Pao, A., Tang, M., and Pfeifer, G. P. (1996) Science 274, 430-432]. However, the methodology used in that work (ligation-mediated polymerase chain reaction in combination with the UvrABC endonuclease incision assay) cannot establish the chemical structures and stereochemical identities of BPDE-guanine lesions. In the present study, we employ a stable isotope-labeling HPLC-MS/MS approach [Tretyakova, N., Matter, B., Jones, R., and Shallop, A. (2002) Biochemistry 41, 9535-9544] to analyze the formation of diastereomeric N(2)-BPDE-dG lesions within double-stranded oligodeoxynucleotides representing p53 lung cancer mutational hotspots and their surrounding DNA sequences. (15)N-labeled dG was placed at defined positions within DNA duplexes containing 5-methylcytosine at all physiologically methylated sites, followed by (+/-)-anti-BPDE treatment and enzymatic hydrolysis of the adducted DNA to 2'-deoxynucleosides. Capillary HPLC-ESI(+)-MS/MS was used to establish the amounts of (-)-trans-N(2)-BPDE-dG, (+)-cis-N(2)-BPDE-dG, (-)-cis-N(2)-BPDE-dG, and (+)-trans-N(2)-BPDE-dG originating from the (15)N-labeled bases. We found that all four N(2)-BPDE-dG diastereomers were formed preferentially at the methylated CG dinucleotides, including the frequently mutated p53 codons 157, 158, 245, 248, and 273. The contributions of individual diastereomers to the total adducts number at a given site varied between 70.8 and 92.9% for (+)-trans-N(2)-BPDE-dG, 5.6 and 16.7% for
Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53
International Nuclear Information System (INIS)
O'Hagan, Heather M.; Ljungman, Mats
2004-01-01
It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Directory of Open Access Journals (Sweden)
Gillian D McFeat
Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.
International Nuclear Information System (INIS)
Son, Young-Ok; Hitron, J. Andrew; Wang Xin; Chang Qingshan; Pan Jingju; Zhang Zhuo; Liu Jiankang; Wang Shuxia; Lee, Jeong-Chae; Shi Xianglin
2010-01-01
Cr(VI) compounds are known to cause serious toxic and carcinogenic effects. Cr(VI) exposure can lead to a severe damage to the skin, but the mechanisms involved in the Cr(VI)-mediated toxicity in the skin are unclear. The present study examined whether Cr(VI) induces cell death by apoptosis or necrosis using mouse skin epidermal cell line, JB6 Cl41 cells. We also investigated the cellular mechanisms of Cr(VI)-induced cell death. This study showed that Cr(VI) induced apoptotic cell death in a dose-dependent manner, as demonstrated by the appearance of cell shrinkage, the migration of cells into the sub-G1 phase, the increase of Annexin V positively stained cells, and the formation of nuclear DNA ladders. Cr(VI) treatment resulted in the increases of mitochondrial membrane depolarization and caspases activation. Electron spin resonance (ESR) and fluorescence analysis revealed that Cr(VI) increased intracellular levels of reactive oxygen species (ROS) such as hydrogen peroxide and superoxide anion radical in dose-dependent manner. Blockage of p53 by si-RNA transfection suppressed mitochondrial changes of Bcl-2 family composition, mitochondrial membrane depolarization, caspase activation and PARP cleavage, leading to the inhibition of Cr(VI)-induced apoptosis. Further, catalase treatment prevented p53 phosphorylation stimulated by Cr(VI) with the concomitant inhibition of caspase activation. These results suggest that Cr(VI) induced a mitochondrial-mediated and caspase-dependent apoptosis in skin epidermal cells through activation of p53, which are mainly mediated by reactive oxidants generated by the chemical.
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
Oka, Tetsuo; Kurozumi, Kazuhiko; Shimazu, Yosuke; Ichikawa, Tomotsugu; Ishida, Joji; Otani, Yoshihiro; Shimizu, Toshihiko; Tomita, Yusuke; Sakaguchi, Masakiyo; Watanabe, Masami; Nasu, Yasutomo; Kumon, Hiromi; Date, Isao
2016-09-01
Reduced expression in immortalized cells/Dickkopf-3 (REIC/Dkk-3) is a tumor suppressor and therapeutic gene in many human cancers. Recently, an adenovirus REIC vector with the super gene expression system (Ad-SGE-REIC) was developed to increase REIC/Dkk-3 expression and enhance therapeutic effects compared with the conventional adenoviral vector (Ad-CAG-REIC). In this study, we investigated the in vitro and in vivo effects of Ad-SGE-REIC on malignant glioma. In U87ΔEGFR and GL261 glioma cells, western blotting confirmed that robust upregulation of REIC/Dkk-3 expression occurred in Ad-SGE-REIC-transduced cells, most notably after transduction at a multiplicity of infection of 10. Cytotoxicity assays showed that Ad-SGE-REIC resulted in a time-dependent and significant reduction in the number of malignant glioma cells attaching to the bottom of culture wells. Xenograft and syngeneic mouse intracranial glioma models treated with Ad-SGE-REIC had significantly longer survival than those treated with the control vector Ad-LacZ or with Ad-CAG-REIC. This study demonstrated the anti-glioma effect of Ad-SGE-REIC, which may represent a promising strategy for the treatment of malignant glioma.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Kuhlmann, K.F.D.; Geer, M.A. van; Bakker, C.T.; Dekker, J.E.M.; Havenga, M.J.E.; Oude Elferink, R.P.J.; Gouma, D.J.; Bosma, P.J.; Wesseling, J.G.
2009-01-01
Survival of patients with pancreatic cancer is poor. Adenoviral (Ad) gene therapy employing the commonly used serotype 5 reveals limited transduction efficiency due to the low amount of coxsackie-adenovirus receptor on pancreatic cancer cells. To identify fiber-chimeric adenoviruses with improved
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
Development of an immunotherapeutic adenovirus targeting hormone-independent prostate cancer
Directory of Open Access Journals (Sweden)
Kim JS
2013-11-01
Full Text Available Jae Sik Kim,1 Sang Don Lee,2 Sang Jin Lee,3 Moon Kee Chung21Department of Urology, The Catholic University of Korea Incheon St Mary's Hospital, Incheon, 2Pusan National University Yangsan Hospital and Research Institute for Convergence of Biomedical Science and Technology, Yangsan, 3Genitourinary Cancer Branch, National Cancer Center, Goyang, KoreaBackground: To develop a targeting therapy for hormone-independent prostate cancer, we constructed and characterized conditionally replicating oncolytic adenovirus (Ad equipped with mRFP(monomeric red fluorescence protein/ttk (modified herpes simplex virus thymidine kinase This construct was then further modified to express both mRFP/ttk and a soluble form of cytokine FLT3L (fms-related tyrosine kinase 3 ligand simultaneously.Methods: To construct the recombinant oncolytic adenovirus, E1a and E4 genes, which are necessary for adenovirus replication, were controlled by the prostate-specific enhancer sequence (PSES targeting prostate cancer cells expressing prostate-specific antigen (PSA and prostate-specific membrane antigen (PSMA. Simultaneously, it expressed the mRFP/ttk fusion protein in order to be able to elicit the cytotoxic effect.Results: The Ad5/35PSES.mRFP/ttk chimeric recombinant adenovirus was generated successfully. When replication of Ad5/35PSES.mRFP/ttk was evaluated in prostate cancer cell lines under fluorescence microscopy, red fluorescence intensity increased more in LNCaP cells, suggesting that the mRFP/ttk fusion protein was folded functionally. In addition, the replication assay including wild-type adenovirus as a positive control showed that PSES-positive cells (LNCaP and CWR22rv permitted virus replication but not PSES-negative cells (DU145 and PC3. Next, we evaluated the killing activity of this recombinant adenovirus. The Ad5/35PSES.mRFP/ttk killed LNCaP and CWR22rv more effectively. Unlike PSES-positive cells, DU145 and PC3 were resistant to killing by this recombinant
Montazeri, Maryam; Pilehvar-Soltanahmadi, Younes; Mohaghegh, Mina; Panahi, Alireza; Khodi, Samaneh; Zarghami, Nosratollah; Sadeghizadeh, Majid
2017-01-01
The aim of this paper is to investigate the effect of dendrosomal curcumin (DNC) on the expression of p53 in both p53 mutant cell lines SKBR3/SW480 and p53 wild-type MCF7/HCT116 in both RNA and protein levels. Curcumin, derived from Curcumin longa, is recently considered in cancer related researches for its cell growth inhibition properties. p53 is a common tumor-suppressor gene involved in cancers and its mutation not only inhibits tumor suppressor activity but also promotes oncogenic activity. Here, p53 mutant/Wild-type cells were employed to study the toxicity of DNC using MTT assay, Flow cytometry and Annexin-V, Real-time PCR and Western blot were used to analyze p53, BAX, Bcl-2, p21 and Noxa changes after treatment. During the time, DNC increased the SubG1 cells and decreased G1, S and G2/M cells, early apoptosis also indicated the inhibition of cell growth in early phase. Real-Time PCR assay showed an increased mRNA of BAX, Noxa and p21 during the time with decreased Bcl-2. The expression of p53 mutant decreased in SKBR3/SW480, and the expression of p53 wild-type increased in MCF7/HCT116. Consequently, p53 plays an important role in mediating the survival by DNC, which can prevent tumor cell growth by modulating the expression of genes involved in apoptosis and proliferation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
International Nuclear Information System (INIS)
Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo
2003-01-01
The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Directory of Open Access Journals (Sweden)
Manujendra N Saha
Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with
RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.
Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh
2011-07-01
The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.
Li, Bowen; Sun, Lingbin; Cai, Jiali; Wang, Chonggang; Wang, Mengmeng; Qiu, Huiling; Zuo, Zhenghong
2015-01-01
The toxic effects of tributyltin (TBT) have been extensively documented in several types of cells, but the molecular mechanisms related to the genotoxic effects of TBT have still not been fully elucidated. Our study showed that exposure of human hepatoma G2 cells to 1-4 μmol/L TBT for 3 hr caused severe DNA damage in a concentration-dependent manner. Moreover, the expression levels of key DNA damage sensor genes such as the replication factor C, proliferating cell nuclear antigen and poly (ADP-ribose) polymerase-1 were inhabited in a concentration-dependent manner. We further demonstrated that TBT induced cell apoptosis via the p53-mediated pathway, which was most likely activated by the ataxia telangiectasia mutated and rad-3 related (ATR) protein kinase. The results also showed that cytochrome c, caspase-3, caspase-8, caspase-9, and the B-cell lymphoma 2 were involved in this process. Taken together, we demonstrated for the first time that the inhibition of the DNA repair system might be more responsible for TBT-induced genotoxic effects in cells. Then the generated DNA damage induced by TBT initiated ATR-p53-mediated apoptosis. Copyright © 2014. Published by Elsevier B.V.
Nász, I; Adám, E; Lengyel, A
2001-01-01
With the help of monoclonal antibodies the existence of at least 18 different earlier not known intertype (IT) specific epitopes were demonstrated in different numbers and combinations on the hexons of different adenovirus serotypes. The IT specific epitopes play an important role in the experimental gene therapy and in the recombinant adenovirus vaccination because of the harmful immune response of the recipient organisms directed against the many different epitopes of the adenovirus vector. For the elimination of harmful effect the authors suggest the use of multiple vectors, each prepared from different adenovirus serotypes showing the loosest antigenic relationship to each other. The vectors would be used sequentially when second or multiple administration is needed. For this purpose the authors determined and described 31 such adenovirus type-pairs, which are probably the best alternates for sequential use in experimental gene therapy.
Cancer-Targeted Oncolytic Adenoviruses for Modulation of the Immune System.
Cerullo, Vincenzo; Capasso, Cristian; Vaha-Koskela, Markus; Hemminki, Otto; Hemminki, Akseli
2018-01-01
Adenovirus is one of the most commonly used vectors for gene therapy and it is the first approved virus-derived drug for treatment of cancer. As an oncolytic agent, it can induce lysis of infected cells, but it can also engage the immune system, promoting activation and maturation of antigen- presenting cells (APCs). In essence, oncolysis combined with the associated immunostimulatory actions result in a "personalized in situ vaccine" for each patient. In order to take full advantage of these features, we should try to understand how adenovirus interacts with the immune system, what are the receptors involved in triggering subsequent signals and which kind of responses they elicit. Tackling these questions will give us further insight in how to manipulate adenovirus-mediated immune responses for enhancement of anti-tumor efficacy. In this review, we first highlight how oncolytic adenovirus interacts with the innate immune system and its receptors such as Toll-like receptors, nucleotide-binding and oligomerization domain (NOD)- like receptors and other immune sensors. Then we describe the effect of these interactions on the adaptive immune system and its cells, especially B and T lymphocytes. Finally, we summarize the most significant preclinical and clinical results in the field of gene therapy where researchers have engineered adenovirus to manipulate the host immune system by expressing cytokines and signalingmediators. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
Ets-2 and p53 mediate cAMP-induced MMP-2 expression, activity and trophoblast invasion
Directory of Open Access Journals (Sweden)
Goldman Shlomit
2009-11-01
Full Text Available Abstract Background We have previously shown that Matrix metalloproteinase (MMP -2 is a key-enzyme in early trophoblast invasion and that Protein Kinase A (PKA increases MMP-2 expression and trophoblast invasion. The aim of this study was to examine MMP -2 regulation by PKA in invasive trophoblasts: JAR choriocarcinoma cell-line and 6-8 w first trimester trophoblasts. Methods The effect of Forskolin (PKA on MMP-2 expression was assessed by Northern Blot and RT-PCR. Possible transcription factors binding to consensus MMP-2 promoter sequences in response to Forskolin, were detected by EMSA binding assay and their expression assessed by western blot analysis. Antisense transfection of relevant transcription factors was performed and the inhibitory effect assessed on MMP-2 expression (RT-PCR, secretion (zymography and trophoblast invasiveness (transwell migration assay. Results We found that Forskolin increased MMP-2 mRNA in JAR cells within 24 hours, and induced binding to p53, Ets, C/EBP and AP-2. Transcription factors Ets-2, phospho- p53, C/EBP epsilon, C/EBP lambda and AP-2 alpha bound to their respective binding sequences in response to Forskolin and the expressions of these transcription factors were all elevated in Forskolin- treated cells. Inhibition of Ets-2 and p53 reduced MMP-2 expression, secretion and invasiveness of Forskolin treated cells. Conclusion MMP-2 is regulated by PKA through several binding sites and transcription factors including Ets-2, p53, C/EBP, C/EBP lambda and AP-2 alpha. Ets-2 and p53 mediate cAMP- induced trophoblast invasiveness, through regulation of MMP-2.
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
Work, L M; Ritchie, N; Nicklin, S A; Reynolds, P N; Baker, A H
2004-08-01
Adenovirus (Ad)-mediated gene delivery is a promising approach for genetic manipulation of the vasculature and is being used in both preclinical models and clinical trials. However, safety concerns relating to infection of nontarget tissue and the poor infectivity of vascular cells compared to other cell types necessitates Ad vector refinement. Here, we combine a transductional targeting approach to improve vascular cell infectivity through RGD peptide insertion into adenovirus fibers, combined with transcriptional targeting to endothelial cells using a approximately 1 kb fragment of the fms-like tyrosine kinase receptor-1 (FLT-1) promoter. Single- and double-modified vectors were characterized in human cell lines that either support or have silenced FLT-1 expression. In rat hepatocytes and endothelial cells, the double modification substantially shifted transduction profiles toward vascular endothelial cells. Furthermore, in intact aortae derived from spontaneously hypertensive rats that display enhanced alphav integrin expression on dysfunctional endothelium, enhanced levels of transduction were observed using the double-modified vector but not in aortae derived from normotensive control rats. Our data indicate that Ad-mediated transduction can be beneficially modified in vitro and in vivo by combining fiber modification and a cell-selective promoter within a single-component vector system.
Directory of Open Access Journals (Sweden)
Rabia Johnson
2017-09-01
Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay
2015-11-15
When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.
A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation
Directory of Open Access Journals (Sweden)
Kumar Sonia
2011-02-01
Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Flamini, Valentina; Ghadiali, Rachel S; Antczak, Philipp; Rothwell, Amy; Turnbull, Jeremy E; Pisconti, Addolorata
2018-03-13
Satellite cells are adult muscle stem cells residing in a specialized niche that regulates their homeostasis. How niche-generated signals integrate to regulate gene expression in satellite cell-derived myoblasts is poorly understood. We undertook an unbiased approach to study the effect of the satellite cell niche on satellite cell-derived myoblast transcriptional regulation and identified the tumor suppressor p53 as a key player in the regulation of myoblast quiescence. After activation and proliferation, a subpopulation of myoblasts cultured in the presence of the niche upregulates p53 and fails to differentiate. When satellite cell self-renewal is modeled ex vivo in a reserve cell assay, myoblasts treated with Nutlin-3, which increases p53 levels in the cell, fail to differentiate and instead become quiescent. Since both these Nutlin-3 effects are rescued by small interfering RNA-mediated p53 knockdown, we conclude that a tight control of p53 levels in myoblasts regulates the balance between differentiation and return to quiescence. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Schoemaker, Marieke H.; Rots, Marianne G.; Beljaars, Leonie; Ypma, Arjen Y.; Jansen, Peter L. M.; Poelstra, Klaas; Moshage, Albert; Haisma, Hidde J.
2008-01-01
Chronic liver damage may lead to liver fibrosis. In this process, hepatic activated stellate cells are the key players. Thus, activated stellate cells are attractive targets for antifibrotic gene therapy. Recombinant, adenovirus is a promising vehicle for delivering therapeutic genes to liver cells.
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok
2015-10-26
Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós
2017-12-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.
Phylogenetic analysis of human Tp53 gene using computational ...
African Journals Online (AJOL)
The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...
The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma
International Nuclear Information System (INIS)
Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei
1999-01-01
Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53
Directory of Open Access Journals (Sweden)
Saki Kondo
Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.
Influence of X-ray on the P53 gene in human peripheral blood lymphocytes
International Nuclear Information System (INIS)
Jin Wenwei; Cai Ting
2002-01-01
Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation
Expression of p53/HGF/c-met/STAT3 signal in fetuses with neural tube defects.
Trovato, Maria; D'Armiento, Maria; Lavra, Luca; Ulivieri, Alessandra; Dominici, Roberto; Vitarelli, Enrica; Grosso, Maddalena; Vecchione, Raffaella; Barresi, Gaetano; Sciacchitano, Salvatore
2007-02-01
Neural tube defects (NTD) are morphogenetic alterations due to a defective closure of neural tube. Hepatocyte growth factor (HGF)/c-met system plays a role in morphogenesis of nervous system, lung, and kidney. HGF/c-met morphogenetic effects are mediated by signal transducers and activators of transcription (STAT)3 and both HGF and c-met genes are regulated from p53. The aim of our study was to analyze mRNA and protein expressions of p53, HGF, c-met, and STAT3 in fetuses with NTD. By reverse transcriptase-polymerase chain reaction and immunohistochemistry, we analyzed neural tissues from four NTD fetuses and the corresponding non-malformed lungs, kidneys and placentas. We found a reduced mRNA expression of HGF/c-met/STAT3 pathway, in the malformed nervous systems and placentas. The reduced expression of this pathway correlated with the absence of p53 in all these samples. On the contrary, detectable expression levels of p53, HGF, c-met, and STAT3 were observed in non-malformed lungs and kidneys obtained from the same fetuses. Comparable results were obtained by immunohistochemistry, with the exception of p53, which was undetected in all fetal tissues. In conclusion, in NTD fetuses, both the defective neural tube tissue and the placenta have a reduction in all components of the p53/HGF/c-met/STAT3 cascade. This raises the possibility of using the suppression of these genes for early diagnosis of NTD especially on chorionic villus sampling.
Prolonged peritoneal gene expression using a helper-dependent adenovirus.
Liu, Limin; Shi, Chang-Xin; Ghayur, Ayesha; Zhang, Claire; Su, Je Yen; Hoff, Catherine M; Margetts, Peter J
2009-01-01
Encapsulating peritoneal sclerosis (EPS) is a rare complication of peritoneal dialysis. The causes of EPS are not well defined and are likely multifactorial. A suitable animal model would facilitate research into the pathophysiology and treatment of EPS. We developed a helper-dependent adenovirus that expresses both green fluorescent protein (GFP) and active transforming growth factor-beta (TGF-beta1; HDAdTGF-beta1). Mice were administered HDAdTGF-beta1 via intraperitoneal injection and the response was compared with mice administered either first-generation adenovirus expressing TGF-beta1 (AdTGF-beta1) or control adenovirus (AdGFP). HDAdTGF-beta1-treated mice continued to express the GFP reporter transgene to day 74, the end of the observation period. Transgene expression lasted less than 28 days in the animals treated with first-generation adenoviruses. Animals treated with first-generation AdTGF-beta1 demonstrated submesothelial thickening and angiogenesis at day 7, with almost complete resolution by day 28. The HDAdTGF-beta1-treated mice demonstrated progressive peritoneal fibrosis with adhesion formation and encapsulation of bowels. Weight gain was significantly reduced in animals treated with HDAdTGF-beta1 compared to both the control-treated animals and the AdTGF-beta1-treated animals. Inflammation was not a major component of the fibroproliferative response. Peritoneal administration of a first-generation AdTGF-beta1 leads to transient gene expression, resulting in a resolving fibrotic response and histology similar to that seen in simple peritoneal sclerosis. Prolonged TGF-beta1 expression induced by the helper-dependent HDAdTGF-beta1 led to changes in peritoneal morphology resembling EPS. This suggests that TGF-beta1 may be a contributing factor in both simple peritoneal sclerosis and EPS. This model will be useful for elucidation of the mechanism of EPS and evaluation of potential treatment.
International Nuclear Information System (INIS)
Shu, H.-K.G.; Furman, Felix; Dee, Suzanne; Israel, Mark A.
1997-01-01
Purpose/Objective: Medulloblastoma cell lines readily undergo a p53-mediated apoptosis following exposure to ionizing radiation, while glioma cell lines do not undergo significant levels of apoptosis following irradiation. This study attempts to define some of the molecular events that characterize the differential ability medulloblastomas and gliomas to undergo radiation-induced apoptosis. Materials and Methods: The medulloblastoma cell lines D283 and D341 and the glioma cell lines U87, U343 and U563 were used in this study. All five cell lines were confirmed to have a wild type p53 by their ability to induce p21 protein levels and to undergo a cell-cycle arrest in G1 following treatment with ionizing radiation. Also, 3 clonal derivatives of D283 were used. Two of the clones were derived following transfection with an expression plasmid containing a dominant negative mutant p53 (Arg175 --> His) expressed from the CMV promoter (D283/53.6 and D283/53.7), while the remaining clone was derived following transfection with that same expression plasmid without mutant p53 (D283/vec). All irradiation experiments were performed on Phillips RT-250 X-ray unit using 250 Kvp X-rays. In each case, 5 Gy of ionizing radiation was given at a dose rate of 250 cGy/minute. Apoptosis was quantitated by staining fixed cells with propidium iodide and determining the percentage of cells with subdiploid DNA content by flow cytometry. Northern blot analysis was performed using standard methods. Results: The D283 and D341 cell lines exhibited a significant induction of apoptosis when assayed 2 days following treatment with radiation while the U87, U343 and U563 cell lines displayed only minimal induction of apoptosis when assayed following treatment at that time. RNA was prepared from the different cell lines that were unirradiated, 6 hours or 24 hours post-irradiation. Northern blots were made of the total RNAs and probed for bax, bcl-2 and bcl-x mRNA. This analysis detected no significant
Energy Technology Data Exchange (ETDEWEB)
Mei, Ya-Fang, E-mail: ya-fang.mei@umu.se [Department of Clinical Microbiology and Virology, Umeå University, SE-901 85 Umeå (Sweden); Wu, Haidong, E-mail: haidong.wu@umu.se [Department of Clinical Microbiology and Virology, Umeå University, SE-901 85 Umeå (Sweden); Hultenby, Kjell, E-mail: kjell.hultenby@ki.se [Division of Clinical Research Centre, Department of Laboratory Medicine, Karolinska Institute, SE-14186 Stockholm (Sweden); Silver, Jim, E-mail: jim.silver@umu.se [Department of Clinical Microbiology and Virology, Umeå University, SE-901 85 Umeå (Sweden)
2016-10-15
Conventional adenovirus vectors harboring E1 or E3 deletions followed by the insertion of an exogenous gene show considerably reduced virion stability. Here, we report strategies to generate complete replication-competent Ad11p(RCAd11p) vectors that overcome the above disadvantage. A GFP cassette was successfully introduced either upstream of E1A or in the E3A region. The resulting vectors showed high expression levels of the hexon and E1genes and also strongly induced the cytopathic effect in targeted cells. When harboring oversized genomes, the RCAd11pE1 and RCAd11pE3 vectors showed significantly improved heat stability in comparison to Ad11pwt;of the three, RCAd11pE3 was the most tolerant to heat treatment. Electron microscopy showed that RCAd11pE3, RCAd11pE1, Ad11pwt, and Ad11pE1 Delmanifested dominant, moderate, minimum, or no full virus particles after heat treatment at 47 °C for 5 h. Our results demonstrated that both genome size and the insertion site in the viral genome affect virion stability. -- Highlights: •Replicating adenovirus 11p GFP vectors at the E1 or E3 region were generated. •RCAd11pE3 and RCAd11pE1 vectors manifested significantly improved heat stability. •RCAd11pE3 and RCAd11pE1 showed more full viral particles than Ad11pwt after heating. •We demonstrated that both genome size and the insertion site affect virion stability.
International Nuclear Information System (INIS)
Mei, Ya-Fang; Wu, Haidong; Hultenby, Kjell; Silver, Jim
2016-01-01
Conventional adenovirus vectors harboring E1 or E3 deletions followed by the insertion of an exogenous gene show considerably reduced virion stability. Here, we report strategies to generate complete replication-competent Ad11p(RCAd11p) vectors that overcome the above disadvantage. A GFP cassette was successfully introduced either upstream of E1A or in the E3A region. The resulting vectors showed high expression levels of the hexon and E1genes and also strongly induced the cytopathic effect in targeted cells. When harboring oversized genomes, the RCAd11pE1 and RCAd11pE3 vectors showed significantly improved heat stability in comparison to Ad11pwt;of the three, RCAd11pE3 was the most tolerant to heat treatment. Electron microscopy showed that RCAd11pE3, RCAd11pE1, Ad11pwt, and Ad11pE1 Delmanifested dominant, moderate, minimum, or no full virus particles after heat treatment at 47 °C for 5 h. Our results demonstrated that both genome size and the insertion site in the viral genome affect virion stability. -- Highlights: •Replicating adenovirus 11p GFP vectors at the E1 or E3 region were generated. •RCAd11pE3 and RCAd11pE1 vectors manifested significantly improved heat stability. •RCAd11pE3 and RCAd11pE1 showed more full viral particles than Ad11pwt after heating. •We demonstrated that both genome size and the insertion site affect virion stability.
Directory of Open Access Journals (Sweden)
Youfeng Shen
2017-11-01
section after 38 days of gestation for genotyping. Finally, six live piglets and one stillborn piglet were collected from two recipients by caesarean section. Sequencing analyses of the target site confirmed the P53 biallelic knockout in all fetuses and piglets, consistent with the genotype of the donor cells. The qPCR analysis showed that the expression of the P53 mRNA had significant reduction in various tissues of the knockout piglets. Furthermore, confocal microscopy and western blotting analyses demonstrated that the fibroblast cells of Diannan miniature piglets with a P53 biallelic knockout were defective in mediating DNA damage when incubated with doxorubicin. Conclusion TALENs combined with SCNT was successfully used to generate P53 KO Diannan miniature pigs. Although these genetically engineered Diannan miniature pigs had no tumorigenic signs, the P53 gene was dysfunctional. We believe that these pigs will provide powerful new resources for preclinical oncology and basic cancer research.
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich
2015-07-10
The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.
Adenovirus E2F1 Overexpression Sensitizes LNCaP and PC3 Prostate Tumor Cells to Radiation In Vivo
International Nuclear Information System (INIS)
Udayakumar, Thirupandiyur S.; Stoyanova, Radka; Hachem, Paul; Ahmed, Mansoor M.; Pollack, Alan
2011-01-01
Purpose: We previously showed that E2F1 overexpression radiosensitizes prostate cancer cells in vitro. Here, we demonstrate the radiosensitization efficacy of adenovirus (Ad)-E2F1 infection in growing (orthotopic) LNCaP and (subcutaneous) PC3 nude mice xenograft tumors. Methods and Materials: Ad-E2F1 was injected intratumorally in LNCaP (3 x 10 8 plaque-forming units [PFU]) and PC3 (5 x 10 8 PFU) tumors treated with or without radiation. LNCaP tumor volumes (TV) were measured by magnetic resonance imaging, caliper were used to measure PC3 tumors, and serum prostate-specific antigen (PSA) levels were determined by enzyme-linked immunosorbent assay. Apoptosis was measured by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling, and key proteins involved in cell death signaling were analyzed by Western blotting. Results: Intracellular overexpression of Ad-E2F1 had a significant effect on the regression of TV and reduction of PSA levels relative to that of adenoviral luciferase (Ad-Luc)-infected control. The in vivo regressing effect of Ad-E2F1 on LNCaP tumor growth was significant (PSA, 34 ng/ml; TV, 142 mm 3 ) compared to that of Ad-Luc control (PSA, 59 ng/ml; TV, 218 mm 3 ; p 3 to Ad-Luc+RT/PSA, 42 ng/ml, and TV, 174 mm 3 , respectively; p <0.05). For PC3 tumors, the greatest effect was observed with Ad-E2F1 infection alone; there was little or no effect when radiotherapy (RT) was combined. However, addition of RT enhanced the level of in situ apoptosis in PC3 tumors. Molecularly, addition of Ad-E2F1 in a combination treatment abrogated radiation-induced BCL-2 protein expression and was associated with an increase in activated BAX, and together they caused a potent radiosensitizing effect, irrespective of p53 and androgen receptor functional status. Conclusions: We show here for the first time that ectopic overexpression of E2F1 in vivo, using an adenoviral vector, significantly inhibits orthotopic p53 wild-type LNCaP tumors and subcutaneous
Gharib, Ehsan; Montasser Kouhsari, Shideh; Izad, Maryam
2018-01-01
Reactive oxygen species (ROS) is an apoptosis inducer in pancreatic β-cells that stimulates p53/p65 mediated microRNA (miR)-145 expression. Punica granatum L. (pomegranate) is an antioxidant fruit that attenuates ROS generation. This study examines the effects of pomegranate fruit aqueous extract (PGE) on the levels of ROS, p53, p65, miR-145, and its target insulin receptor substrate 1 (irs-1) mRNA in Alloxan-diabetic male Wistar rats. In this experimental study, diabetic rats received different doses of PGE. The effects of the PGE polyphenols were examined through a long-term PGE treatment period model, followed by an evaluation of the plasma and tissue contents of free fatty acids (FFAs), triglycerides (TG), and glycogen compared with diabetic controls (DC) and normal controls (NC). We used real-time polymerase chain reaction (PCR) to investigate the modulation of p53, p65, miR-145, and irs-1 expression levels. There was a noticeable reduction in fasting blood glucose (FBG) and ROS generation compared to DC. We observed marked decreases in p53, p65, miR-145 expression levels followed by an elevated level of irs-1, which contributed to improvement in insulin sensitivity. PGE administration downregulated miR-145 levels in Alloxan-diabetic Wistar rats by suppression of ROS-mediated p53 and p65 overexpression. Copyright© by Royan Institute. All rights reserved.
Activation of the human beta interferon gene by the adenovirus type 12 E1B gene
International Nuclear Information System (INIS)
Shiroki, K.; Toth, M.
1988-01-01
The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
Freimuth, P; Anderson, C W
1993-03-01
The sequence of a 1158-base pair fragment of the human adenovirus serotype 12 (Ad12) genome was determined. This segment encodes the precursors for virion components Mu and VI. Both Ad12 precursors contain two sequences that conform to a consensus sequence motif for cleavage by the endoproteinase of adenovirus 2 (Ad2). Analysis of the amino terminus of VI and of the peptide fragments found in Ad12 virions demonstrated that these sites are cleaved during Ad12 maturation. This observation suggests that the recognition motif for adenovirus endoproteinases is highly conserved among human serotypes. The adenovirus 2 endoproteinase polypeptide requires additional co-factors for activity (C. W. Anderson, Protein Expression Purif., 1993, 4, 8-15). Synthetic Ad12 or Ad2 pVI carboxy-terminal peptides each permitted efficient cleavage of an artificial endoproteinase substrate by recombinant Ad2 endoproteinase polypeptide.
Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53
Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich
2011-01-01
Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600
Cao, Yu; Liu, Zhenhai; Xie, Yilin; Hu, Jingchao; Wang, Hua; Fan, Zhipeng; Zhang, Chunmei; Wang, Jingsong; Wu, Chu-Tse; Wang, Songlin
2015-12-15
Periodontitis is one of the most widespread infectious diseases in humans. We previously promoted significant periodontal tissue regeneration in swine models with the transplantation of autologous periodontal ligament stem cells (PDLSCs) and PDLSC sheet. We also promoted periodontal tissue regeneration in a rat model with a local injection of allogeneic bone marrow mesenchymal stem cells. The purpose of the present study is to investigate the roles of the hepatocyte growth factor (HGF) and human dental pulp stem cells (DPSCs) in periodontal tissue regeneration in swine. In the present study, we transferred an adenovirus that carried HGF gene into human DPSCs (HGF-hDPSCs) under good manufacturing practice (GMP) conditions. These cells were then transplanted into a swine model for periodontal regeneration. Twenty miniature pigs were used to generate periodontitis with bone defect of 5 mm in width, 7 mm in length, and 3 mm in depth. After 12 weeks, clinical, radiological, quantitative and histological assessment of regenerated periodontal tissues was performed to compare periodontal regeneration in swine treated with cell implantation. Our study showed that injecting HGF-hDPSCs into this large animal model could significantly improve periodontal bone regeneration and soft tissue healing. A hDPSC or HGF-hDPSC sheet showed superior periodontal tissue regeneration compared to the injection of dissociated cells. However, the sheets required surgical placement; thus, they were suitable for surgically-managed periodontitis treatments. The adenovirus-mediated transfer of the HGF gene markedly decreased hDPSC apoptosis in a hypoxic environment or in serum-free medium, and it increased blood vessel regeneration. This study indicated that HGF-hDPSCs produced under GMP conditions significantly improved periodontal bone regeneration in swine; thus, this method represents a potential clinical application for periodontal regeneration.
Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene
Directory of Open Access Journals (Sweden)
Nahed A Hussien
2014-01-01
Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.
Hormonal control of p53 and chemoprevention
International Nuclear Information System (INIS)
Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C
2002-01-01
Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer
Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah
2017-10-01
In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile
Inhibitory effect of recombinant adenovirus carrying immunocaspase-3 on hepatocellular carcinoma
Energy Technology Data Exchange (ETDEWEB)
Li, Xiaohua [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Fan, Rui [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Zou, Xue [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Gao, Lin [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Jin, Haifeng [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Du, Rui [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Xia, Lin [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China); Fan, Daiming [State Key Laboratory of Cancer Biology and Institute of Digestive Diseases, Xijing Hospital, The Fourth Military Medical University, 17 Changle Western Road, Xi' an 710032 (China)
2007-06-29
Previously, Srinivasula devised a contiguous molecule (C-cp-3 or immunocaspase-3) containing the small and large subunits similar to that in the active form of caspas-3 and found C-cp-3 had similar cleavage activity to the active form of caspase-3. To search for a new clinical application of C-cp-3 to treat hepatocellular carcinoma, recombinant adenoviruses carrying the C-cp-3 and a-fetoprotein (AFP) promoter (Ad-rAFP-C-cp-3) were constructed through a bacterial homologous recombinant system. The efficiency of adenovirus-mediated gene transfer and the inhibitory effect of Ad-rAFP-C-cp-3 on the proliferation of hepatocarcinoma cells were determined by X-gal stain and MTT assay, respectively. The tumorigenicity of hepatocarcinoma cells transfected by Ad-rAFP-C-cp-3 and the antitumor effect of Ad-rAFP-C-cp-3 on transplanted tumor in nude mice were detected in vivo. The results suggested that Ad-rAFP-C-cp-3 can inhibit specifically proliferation of AFP-producing human hepatocarcinoma cells in vitro and in vivo and adenovirus-mediated C-cp-3 transfer could be used as a new method to treat human hepatocarcinoma.
Inhibitory effect of recombinant adenovirus carrying immunocaspase-3 on hepatocellular carcinoma
International Nuclear Information System (INIS)
Li, Xiaohua; Fan, Rui; Zou, Xue; Gao, Lin; Jin, Haifeng; Du, Rui; Xia, Lin; Fan, Daiming
2007-01-01
Previously, Srinivasula devised a contiguous molecule (C-cp-3 or immunocaspase-3) containing the small and large subunits similar to that in the active form of caspas-3 and found C-cp-3 had similar cleavage activity to the active form of caspase-3. To search for a new clinical application of C-cp-3 to treat hepatocellular carcinoma, recombinant adenoviruses carrying the C-cp-3 and a-fetoprotein (AFP) promoter (Ad-rAFP-C-cp-3) were constructed through a bacterial homologous recombinant system. The efficiency of adenovirus-mediated gene transfer and the inhibitory effect of Ad-rAFP-C-cp-3 on the proliferation of hepatocarcinoma cells were determined by X-gal stain and MTT assay, respectively. The tumorigenicity of hepatocarcinoma cells transfected by Ad-rAFP-C-cp-3 and the antitumor effect of Ad-rAFP-C-cp-3 on transplanted tumor in nude mice were detected in vivo. The results suggested that Ad-rAFP-C-cp-3 can inhibit specifically proliferation of AFP-producing human hepatocarcinoma cells in vitro and in vivo and adenovirus-mediated C-cp-3 transfer could be used as a new method to treat human hepatocarcinoma
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.
Directory of Open Access Journals (Sweden)
Marisa R Buchakjian
Full Text Available Genetic mouse models of soft tissue sarcoma provide critical insights into disease pathophysiology, which are oftentimes unable to be extracted from human tumor samples or xenograft models. In this study we describe a mouse model of soft tissue sarcoma mediated by adenoviral-Cre recombinase injection into Trp53fl/fl/Ptenfl/fl lox-stop-lox luciferase mice. Injection of adenovirus expressing Cre recombinase, either subcutaneously or intramuscularly in two experimental groups, results in viral infection and gene recombination with 100% penetrance within the first 24 hours following injection. Luciferase expression measured by real-time bioluminescence imaging increases over time, with an initial robust increase following viral injection, followed by a steady rise over the next several weeks as primary tumors develop and grow. Intramuscular injections were more commonly associated with evidence of systemic viral distribution than subcutaneous injections. All mice developed soft tissue sarcomas at the primary injection site, with histological examination identifying 93% of tumors as invasive pleomorphic sarcomas based on microscopic morphology and immunohistochemical expression of sarcoma markers. A lymphocytic infiltrate was present in 64% of the sarcomas in this immunocompetent model and 71% of tumors expressed PD-L1. This is the first report of a viral-Cre mediated Trp53/Pten mouse model of undifferentiated pleomorphic sarcoma. The bioluminescence imaging feature, along with high penetrance of the model and its immunological characteristics, makes it suited for pre-clinical studies of soft tissue sarcoma.
The pro-survival function of p53 in HeLa cells
Energy Technology Data Exchange (ETDEWEB)
Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)
2014-11-15
The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
Correlation between p53 expression and clinical-pathological characteristics of gastric cancer
Directory of Open Access Journals (Sweden)
Radovanović Dragče
2011-01-01
Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
Alterations of the TP53 Gene in Gastric and Esophageal Carcinogenesis
Directory of Open Access Journals (Sweden)
Marilanda Ferreira Bellini
2012-01-01
Full Text Available TP53 genes is one of more important tumor suppressor gene, which acts as a potent transcription factor with fundamental role in the maintenance of genetic stability. The development of esophageal and gastric cancers is a multistep process resulting in successive accumulation of genetic alterations that culminates in the malignant transformation. Thus, this study highlights the participation of the main genetic alterations of the TP53 gene in esophageal and gastric carcinogenesis. Among these changes, high frequency of TP53 mutations, loss of heterozygosity (LOH, overexpression of the p53 protein, and consequently loss of p53 function, which would be early events in esophageal and gastric cancers, as well as an important biomarker of the prognosis and treatment response. Furthermore, Single Nucleotide Polymorphisms (SNPs of TP53 have been implicated in the development and prognosis of several cancers, mainly TP53 codon 72 polymorphism whose role has been extensively studied in relation to susceptibility for esophageal and gastric cancer development.
Caspase Activation and Aberrant Cell Growth in a p53+/+ Cell Line from a Li-Fraumeni Syndrome Family
Directory of Open Access Journals (Sweden)
Zaki A. Sherif
2015-01-01
Full Text Available Wild-type p53 is well known to induce cell cycle arrest and apoptosis to block aberrant cell growth. However, p53’s unique role in apoptosis and cell proliferation in Li-Fraumeni Syndrome (LFS has not been well elucidated. The aim of this study is to characterize the activity of wild-type p53 protein in LFS family dominated by a germline negative mutant p53. As expected, etoposide-treated wild-type p53-containing cell lines, LFS 2852 and control Jurkat, showed a greater rate of caspase- and annexin V-induced apoptotic cell death compared to the p53-mutant LFS 2673 cell line although mitochondrial and nuclear assays could not detect apoptosis in these organelles. The most intriguing part of the observation was the abnormal proliferation rate of the wild-type p53-containing cell line, which grew twice as fast as 2673 and Jurkat cells. This is important because apoptosis inducers acting through the mitochondrial death pathway are emerging as promising drugs against tumors where the role of p53 is not only to target gene regulation but also to block cell proliferation. This study casts a long shadow on the possible dysregulation of p53 mediators that enable cell proliferation. The deregulation of proliferation pathways represents an important anticancer therapeutic strategy for patients with the LFS phenotype.
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
Leopold, Philip L; Wendland, Rebecca L; Vincent, Theresa; Crystal, Ronald G
2006-10-01
Neutralization of adenovirus (Ad) by anti-Ad neutralizing antibodies in serum involves formation of Ad-immune complexes that prevent the virus from interacting with target cells. We hypothesized that Ad-immune complexes likely contain viable Ad vectors which, although no longer capable of gaining access to receptors on target cells, may be able to express transgenes in cells bearing Fc receptors for immunoglobulins, i.e., that antibody-based "neutralization" of Ad vectors may be circumvented by the Fc receptor pathway. To test this hypothesis, we expressed the Fcgamma receptor IIA (FcgammaR) in A549 lung epithelial cells or human dermal fibroblasts and evaluated gene transfer in the presence of human neutralizing anti-Ad serum. FcgammaR-expressing cells bound and internalized copious amounts of Ad, with a distinct population of internalized Ad trafficking to the nucleus. The dose-response curves for inhibition of gene transfer revealed that FcgammaR-expressing cells required a more-than-10-fold higher concentration of anti-Ad serum to achieve 50% inhibition of Ad-encoded beta-galactosidase expression compared with non-FcgammaR-expressing cells. The discrepancy between neutralization of Ad during infection of FcgammaR-expressing cells and neutralization of Ad during infection of non-FcgammaR-expressing cells occurred with either heat-inactivated or non-heat-inactivated sera, was blocked by addition of purified Fc domain protein, and did not require the cytoplasmic domain of FcgammaR, suggesting that immune complex internalization proceeded via endocytosis rather than phagocytosis. FcgammaR-mediated infection by Ad-immune complexes did not require expression of the coxsackie virus-Ad receptor (CAR) since similar data were obtained when CAR-deficient human dermal fibroblasts were engineered to express FcgammaR. However, interaction of the Ad penton base with cell surface integrins contributed to the difference in neutralization between FcgammaR-expressing and non
Energy Technology Data Exchange (ETDEWEB)
Lin, Chien-Ju [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China); Chen, Ta-Liang [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Tseng, Yuan-Yun [Department of Neurosurgery, Shuang-Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Wu, Gong-Jhe [Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Hsieh, Ming-Hui [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Lin, Yung-Wei [Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Chen, Ruei-Ming, E-mail: rmchen@tmu.edu.tw [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China)
2016-08-01
Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- and time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates
P53 expression in prostatic cancer: an immunohistochemical study
International Nuclear Information System (INIS)
Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.
2011-01-01
Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Directory of Open Access Journals (Sweden)
Ling Nie
2016-01-01
Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.
[Punish or cherish: p53, metabolism and tumor suppression].
Albagli, Olivier
2015-10-01
The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.
International Nuclear Information System (INIS)
Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen
2015-01-01
Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection
Energy Technology Data Exchange (ETDEWEB)
Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen, E-mail: dwtong@nwsuaf.edu.cn
2015-01-09
Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.
International Nuclear Information System (INIS)
Tierney, L.A.; Hahn, F.F.; Lechner, J.F.
1996-01-01
Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Powari, Manish; Varma, Neelam; Varma, Subhash; Marwaha, Ram Kumar; Sandhu, Harpreet; Ganguly, Nirmal Kumar
2002-06-01
To characterize the phenotype of acute leukemia cases using flow cytometry, to detect mixed lineage cases and to use DNA index determination, including S-phase fraction (SPF) and p53 detection, to find if there was any correlation of SPF and p53 expression with outcome. Fifty-five cases of acute leukemia were enrolled in this study. A complete hemogram and routine bone marrow examination, including cytochemistry, was done. Mycloperoxidase-negative cases were evaluated on a flow cytometer using monoclonal antibodies. DNA indices were determined by flow cytometry in all cases, and p53 was detected immunohistochemically using the alkaline phosphatase/antialkaline phosphatase technique. Acute myeloblastic leukemia (AML) was diagnosed in 32 cases; acute lymphoblastic leukemia (ALL) was diagnosed in 18 (14 B lineage and 4 T line age). Four cases showed mixed lineage leukemia, and undifferentiated acute leukemia was diagnosed in one case. The mean/range of SPF for these groups were 3.76/0.33-6.91, 6.25/0.15-21.4, 2.89/0.35-10.64, 2.60/0.72-6.94 and 7.34, respectively. Aneuploidy was detected in two cases of B-lineage ALL and tetraploidy in a case of AML-M7, while all others were diploid p53. Was detected in 6 of 55 cases (10.90%). Follow-up was available for 24 patients. Five patients relapsed, and four had B-cell type ALL and were diploid and expressed no p53 gene. SPF% did not show any correlation with outcome. These data suggest that within acute leukemia subtypes, there is a wide variation in SPF. SPF does not seem to correlate with outcome. Immunophenotyping is essential to determine the lineage in myeloperoxidase-negative cases. It is perhaps the only way to diagnose mixed lineage leukemia and aberrant expression of markers presently. The p53 gene was detected less frequently. However, more studies are required from different centers with longer follow-up to evaluate prognostic significance.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
An adaptive molecular timer in p53-meidated cell fate decision
Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei
The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
International Nuclear Information System (INIS)
Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio
2005-01-01
Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells
International Nuclear Information System (INIS)
Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua
2011-01-01
Highlights: → A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. → The promoter was characterized with radiation-inducibility and tumor-specificity. → Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. → Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Energy Technology Data Exchange (ETDEWEB)
Xu, Yu, E-mail: xuyu1001@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liu, Zhengchun, E-mail: l135027@126.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Kong, Haiyan, E-mail: suppleant@163.com [Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Sun, Wenjie, E-mail: wendy11240325@163.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Liao, Zhengkai, E-mail: fastbeta@gmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Zhou, Fuxiang, E-mail: happyzhoufx@sina.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); Xie, Conghua, E-mail: chxie_65@hotmail.com [Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, 169 Donghu Road, Wuhan 430071 (China); Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, 169 Donghu Road, Wuhan 430071 (China); and others
2011-09-09
Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.
Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity
International Nuclear Information System (INIS)
Meiller, A.
2004-03-01
Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein
Beta-Adrenergic gene therapy for cardiovascular disease
Directory of Open Access Journals (Sweden)
Koch Walter J
2000-10-01
Full Text Available Abstract Gene therapy using in vivo recombinant adenovirus-mediated gene transfer is an effective technique that offers great potential to improve existing drug treatments for the complex cardiovascular diseases of heart failure and vascular smooth muscle intimal hyperplasia. Cardiac-specific adenovirus-mediated transfer of the carboxyl-terminus of the β-adrenergic receptor kinase (βARKct, acting as a Gβγ-β-adrenergic receptor kinase (βARK1 inhibitor, improves basal and agonist-induced cardiac performance in both normal and failing rabbit hearts. In addition, βARKct adenovirus infection of vascular smooth muscle is capable of significantly diminishing neointimal proliferation after angioplasty. Therefore, further investigation is warranted to determine whether inhibition of βARK1 activity and sequestration of Gβγ via an adenovirus that encodes the βARKct transgene might be a useful clinical tool for the treatment of cardiovascular pathologies.
Directory of Open Access Journals (Sweden)
Raúl González
2015-08-01
Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.
Herr, D; Keck, C; Tempfer, C; Pietrowski, Detlef
2004-12-01
The ovarian corpus luteum plays a critical role in reproduction being the primary source of circulating progesterone. After ovulation the corpus luteum is build by avascular granulosa lutein cells through rapid vascularization regulated by gonadotropic hormones. The present study was performed to investigate whether this process might be influenced by the human chorionic gonadotropin (hCG)-dependent expression of different tumor suppressor genes and hypoxia dependent transcription factors. RNA was isolated from cultured granulosa lutein cells, transcribed into cDNA, and the transcript level of following genes were determined: RB-1, VHL, NF-1, NF-2, Wt-1, p53, APC, and hypoxia inducible factor-1 (HIF-1), -2, and -3alpha. Additionally, the influence of hCG on the expression of VHL, p53, and HIf2alpha were investigated. We demonstrate that in human granulosa lutein cells the tumor suppressor genes RB-1, VHL, NF-1, NF-2, Wt-1, p53, and APC and the hypoxia dependent transcription factors HIF-1alpha, -2alpha, and -3alpha are expressed. In addition, we showed that hCG regulates the expression of p53, VHL, and HIF-2alpha. Our results indicate that hCG may determine the growth and development of the corpus luteum by mediating hypoxic and apoptotic pathways in human granulosa lutein cells. Copyright 2004 Wiley-Liss, Inc.
Kreuzer, J; Denger, S; Reifers, F; Beisel, C; Haack, K; Gebert, J; Kübler, W
1996-07-01
Smooth muscle cells (SMC) are a central cell type involved in multiple processes of coronary artery diseases including restenosis and therefore are major target cells for different aspects of gene transfer. Previous attempts to transfect primary arterial cells using different techniques like liposomes, CaPO4 and electroporation resulted in only low transfection efficiency. The development of recombinant adenoviruses dramatically improved the delivery of foreign genes into different cell types including SMC. However, cloning and identification of recombinants remain difficult and time-consuming techniques. The present study demonstrates that a complex consisting of reporter plasmid encoding firefly luciferase (pLUC), polycationic liposomes and replication-deficient adenovirus was able to yield very high in vitro transfection of primary human smooth muscle cells under optimized conditions. The technique of adenovirus-assisted lipofection (AAL) increases transfer and expression of plasmid DNA in human smooth muscle cells in vitro up to 1000-fold compared to lipofection. To verify the applicability of AAL for gene transfer into human smooth muscle cells we studied a gene therapy approach to suppress proliferation of SMC in vitro, using the prokaryotic cytosine deaminase gene (CD) which enables transfected mammalian cells to deaminate 5-fluorocytosine (5-FC) to the highly toxic 5-fluorouracil (5-FU). The effect of a transient CD expression on RNA synthesis was investigated by means of a cotransfection with a RSV-CD expression plasmid and the luciferase reporter plasmid. Western blot analysis demonstrated high expression of CD protein in transfected SMC. Cotransfected SMC demonstrated two-fold less luciferase activity in the presence of 5-FC (5 mmol/l) after 48 h compared to cells transfected with a non-CD coding plasmid. The data demonstrate that a transient expression of CD could be sufficient to reduce the capacity of protein synthesis in human SMC. This simple and
Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.
Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles
2006-10-16
The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.
Czech Academy of Sciences Publication Activity Database
Congur, G.; Plucnara, Medard; Erdem, A.; Fojta, Miroslav
2015-01-01
Roč. 27, č. 7 (2015), s. 1579-1586 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : p53 Gene * Carbon nanotubes * Magnetic particles Subject RIV: BO - Biophysics Impact factor: 2.471, year: 2015
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Iizuka, Shunsuke; Sakurai, Fuminori; Tachibana, Masashi; Ohashi, Kazuo; Mizuguchi, Hiroyuki
2017-09-15
Gene therapy during neonatal and infant stages is a promising approach for hemophilia B, a congenital disorder caused by deficiency of blood coagulation factor IX (FIX). An adenovirus (Ad) vector has high potential for use in neonatal or infant gene therapy for hemophilia B due to its superior transduction properties; however, leaky expression of Ad genes often reduces the transduction efficiencies by Ad protein-mediated tissue damage. Here, we used a novel Ad vector, Ad-E4-122aT, which exhibits a reduction in the leaky expression of Ad genes in liver, in gene therapy studies for neonatal hemophilia B mice. Ad-E4-122aT exhibited significantly higher transduction efficiencies than a conventional Ad vector in neonatal mice. In neonatal hemophilia B mice, a single neonatal injection of Ad-E4-122aT expressing human FIX (hFIX) (Ad-E4-122aT-AHAFIX) maintained more than 6% of the normal plasma hFIX activity levels for approximately 100 days. Sequential administration of Ad-E4-122aT-AHAFIX resulted in more than 100% of the plasma hFIX activity levels for more than 100 days and rescued the bleeding phenotypes of hemophilia B mice. In addition, immunotolerance to hFIX was induced by Ad-E4-122aT-AHAFIX administration in neonatal hemophilia B mice. These results indicated that Ad-E4-122aT is a promising gene delivery vector for neonatal or infant gene therapy for hemophilia B.
Directory of Open Access Journals (Sweden)
Ge Q
2016-01-01
Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate
PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene
Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan
2009-01-01
Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Directory of Open Access Journals (Sweden)
Stefania Piersanti
Full Text Available Several studies have demonstrated the potential for vector-mediated gene transfer to the brain. Helper-dependent (HD human (HAd and canine (CAV-2 adenovirus, and VSV-G-pseudotyped self-inactivating HIV-1 vectors (LV effectively transduce human brain cells and their toxicity has been partly analysed. However, their effect on the brain homeostasis is far from fully defined, especially because of the complexity of the central nervous system (CNS. With the goal of dissecting the toxicogenomic signatures of the three vectors for human neurons, we transduced a bona fide human neuronal system with HD-HAd, HD-CAV-2 and LV. We analysed the transcriptional response of more than 47,000 transcripts using gene chips. Chip data showed that HD-CAV-2 and LV vectors activated the innate arm of the immune response, including Toll-like receptors and hyaluronan circuits. LV vector also induced an IFN response. Moreover, HD-CAV-2 and LV vectors affected DNA damage pathways--but in opposite directions--suggesting a differential response of the p53 and ATM pathways to the vector genomes. As a general response to the vectors, human neurons activated pro-survival genes and neuron morphogenesis, presumably with the goal of re-establishing homeostasis. These data are complementary to in vivo studies on brain vector toxicity and allow a better understanding of the impact of viral vectors on human neurons, and mechanistic approaches to improve the therapeutic impact of brain-directed gene transfer.
Energy Technology Data Exchange (ETDEWEB)
Freytag, Svend O., E-mail: sfreyta1@hfhs.org [Department of Radiation Oncology, Henry Ford Health System, Detroit, Michigan (United States); Stricker, Hans [Vattikuti Urology Institute, Henry Ford Health System, Detroit, Michigan (United States); Lu, Mei [Public Health Sciences, Henry Ford Health System, Detroit, Michigan (United States); Elshaikh, Mohamed; Aref, Ibrahim; Pradhan, Deepak; Levin, Kenneth; Kim, Jae Ho [Department of Radiation Oncology, Henry Ford Health System, Detroit, Michigan (United States); Peabody, James [Vattikuti Urology Institute, Henry Ford Health System, Detroit, Michigan (United States); Siddiqui, Farzan; Barton, Kenneth; Pegg, Jan; Zhang, Yingshu; Cheng, Jingfang [Department of Radiation Oncology, Henry Ford Health System, Detroit, Michigan (United States); Oja-Tebbe, Nancy; Bourgeois, Renee [Public Health Sciences, Henry Ford Health System, Detroit, Michigan (United States); Gupta, Nilesh; Lane, Zhaoli [Pathology, Henry Ford Health System, Detroit, Michigan (United States); Rodriguez, Ron [Urology, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); DeWeese, Theodore [Department of Radiation Oncology, Johns Hopkins University School of Medicine, Baltimore, Maryland (United States); and others
2014-06-01
Purpose: To assess the safety and efficacy of combining oncolytic adenovirus-mediated cytotoxic gene therapy (OAMCGT) with intensity modulated radiation therapy (IMRT) in intermediate-risk prostate cancer. Methods and Materials: Forty-four men with intermediate-risk prostate cancer were randomly assigned to receive either OAMCGT plus IMRT (arm 1; n=21) or IMRT only (arm 2; n=23). The primary phase 2 endpoint was acute (≤90 days) toxicity. Secondary endpoints included quality of life (QOL), prostate biopsy (12-core) positivity at 2 years, freedom from biochemical/clinical failure (FFF), freedom from metastases, and survival. Results: Men in arm 1 exhibited a greater incidence of low-grade influenza-like symptoms, transaminitis, neutropenia, and thrombocytopenia than men in arm 2. There were no significant differences in gastrointestinal or genitourinary events or QOL between the 2 arms. Two-year prostate biopsies were obtained from 37 men (84%). Thirty-three percent of men in arm 1 were biopsy-positive versus 58% in arm 2, representing a 42% relative reduction in biopsy positivity in the investigational arm (P=.13). There was a 60% relative reduction in biopsy positivity in the investigational arm in men with <50% positive biopsy cores at baseline (P=.07). To date, 1 patient in each arm exhibited biochemical failure (arm 1, 4.8%; arm 2, 4.3%). No patient developed hormone-refractory or metastatic disease, and none has died from prostate cancer. Conclusions: Combining OAMCGT with IMRT does not exacerbate the most common side effects of prostate radiation therapy and suggests a clinically meaningful reduction in positive biopsy results at 2 years in men with intermediate-risk prostate cancer.
International Nuclear Information System (INIS)
Freytag, Svend O.; Stricker, Hans; Lu, Mei; Elshaikh, Mohamed; Aref, Ibrahim; Pradhan, Deepak; Levin, Kenneth; Kim, Jae Ho; Peabody, James; Siddiqui, Farzan; Barton, Kenneth; Pegg, Jan; Zhang, Yingshu; Cheng, Jingfang; Oja-Tebbe, Nancy; Bourgeois, Renee; Gupta, Nilesh; Lane, Zhaoli; Rodriguez, Ron; DeWeese, Theodore
2014-01-01
Purpose: To assess the safety and efficacy of combining oncolytic adenovirus-mediated cytotoxic gene therapy (OAMCGT) with intensity modulated radiation therapy (IMRT) in intermediate-risk prostate cancer. Methods and Materials: Forty-four men with intermediate-risk prostate cancer were randomly assigned to receive either OAMCGT plus IMRT (arm 1; n=21) or IMRT only (arm 2; n=23). The primary phase 2 endpoint was acute (≤90 days) toxicity. Secondary endpoints included quality of life (QOL), prostate biopsy (12-core) positivity at 2 years, freedom from biochemical/clinical failure (FFF), freedom from metastases, and survival. Results: Men in arm 1 exhibited a greater incidence of low-grade influenza-like symptoms, transaminitis, neutropenia, and thrombocytopenia than men in arm 2. There were no significant differences in gastrointestinal or genitourinary events or QOL between the 2 arms. Two-year prostate biopsies were obtained from 37 men (84%). Thirty-three percent of men in arm 1 were biopsy-positive versus 58% in arm 2, representing a 42% relative reduction in biopsy positivity in the investigational arm (P=.13). There was a 60% relative reduction in biopsy positivity in the investigational arm in men with <50% positive biopsy cores at baseline (P=.07). To date, 1 patient in each arm exhibited biochemical failure (arm 1, 4.8%; arm 2, 4.3%). No patient developed hormone-refractory or metastatic disease, and none has died from prostate cancer. Conclusions: Combining OAMCGT with IMRT does not exacerbate the most common side effects of prostate radiation therapy and suggests a clinically meaningful reduction in positive biopsy results at 2 years in men with intermediate-risk prostate cancer
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage.
Directory of Open Access Journals (Sweden)
Chengwan Zhang
Full Text Available UTX is known as a general factor that activates gene transcription during development. Here, we demonstrate an additional essential role of UTX in the DNA damage response, in which it upregulates the expression of ku80 in Drosophila, both in cultured cells and in third instar larvae. We further showed that UTX mediates the expression of ku80 by the demethylation of H3K27me3 at the ku80 promoter upon exposure to ionizing radiation (IR in a p53-dependent manner. UTX interacts physically with p53, and both UTX and p53 are recruited to the ku80 promoter following IR exposure in an interdependent manner. In contrast, the loss of utx has little impact on the expression of ku70, mre11, hid and reaper, suggesting the specific regulation of ku80 expression by UTX. Thus, our findings further elucidate the molecular function of UTX.
Directory of Open Access Journals (Sweden)
Elizabeth B Liu
Full Text Available In February of 1996 a human adenovirus (formerly known as Ad-Cor-96-487 was isolated from the stool of an AIDS patient who presented with severe chronic diarrhea. To characterize this apparently novel pathogen of potential public health significance, the complete genome of this adenovirus was sequenced to elucidate its origin. Bioinformatic and phylogenetic analyses of this genome demonstrate that this virus, heretofore referred to as HAdV-D58, contains a novel hexon gene as well as a recombinant fiber gene. In addition, serological analysis demonstrated that HAdV-D58 has a different neutralization profile than all previously characterized HAdVs. Bootscan analysis of the HAdV-D58 fiber gene strongly suggests one recombination event.
Rao, Feng; Cha, Jiyoung; Xu, Jing; Xu, Risheng; Vandiver, M. Scott; Tyagi, Richa; Tokhunts, Robert; Koldobskiy, Michael A.; Fu, Chenglai; Barrow, Roxanne; Wu, Mingxuan; Fiedler, Dorothea; Barrow, James C.; Snyder, Solomon H.
2014-01-01
The apoptotic actions of p53 require its phosphorylation by a family of phosphoinositide-3-kinase-related-kinases (PIKKs), which include DNA-PKcs and ATM. These kinases are stabilized by the TTT (Tel2, Tti1, Tti2) co-chaperone family, whose actions are mediated by CK2 phosphorylation. The inositol pyrophosphates, such as 5-diphosphoinositol pentakisphosphate (IP7), are generated by a family of inositol hexakisphosphate kinases (IP6Ks) of which IP6K2 has been implicated in p53-associated cell death. In the present study we report a novel apoptotic signaling cascade linking CK2, TTT, the PIKKs, and p53. We demonstrate that IP7, formed by IP6K2, binds CK2 to enhance its phosphorylation of the TTT complex thereby stabilizing DNA-PKcs and ATM. This process stimulates p53 phosphorylation at serine-15 to activate the cell death program in human cancer cells and in murine B cells. PMID:24657168
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Synergistic anti-tumor effects of nitroreductase mutants and p53
Directory of Open Access Journals (Sweden)
Mahboobeh Razmkhah
2014-01-01
Conclusion: Combination of T41L/F70A NTR with p53 may have more advantages for treatment of different types of cancers compared to the other NTRs and p53 alone. The present study results may open new windows for getting desired outcome in gene therapy of different types of cancer.
Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu
2017-08-02
Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
Wang, H; Ma, L; Li, Y; Cho, C H
2000-04-01
Cigarette smoking is a major risk factor for gastric cancer and peptic ulcer. The aim of our study was to investigate the relationship between exposure to cigarette smoke and apoptosis in the rat gastric mucosa and the mechanism involved. Rats were exposed to different concentrations of cigarette smoke (0, 2, and 4%) once daily for a different number of 1 h periods (1, 3, 6, and 9 d). Apoptosis was identified by the terminal deoxy-transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) method and caspase-3 activity. The mucosal xanthine oxidase (XO) activity and p53 level were also measured. The results showed that exposure to cigarette smoke produced a time- and concentration-dependent increase in apoptosis in the rat gastric mucosa that was accompanied by an increase in XO activity. The increased apoptosis and XO activity could be detected after even a single exposure. In contrast, the level of p53 was elevated only in the later stage of cigarette smoke exposure. The apoptotic effect could be blocked by pretreatment with an XO inhibitor (allopurinol, 20 mg/kg intraperitoneally) or a hydroxyl free radical scavenger (DMSO, 0.2%, 1 ml/kg intravenously). However, neither of these treatments had any effect on the p53 level of the mucosa. In summary, we conclude that exposure to cigarette smoke can increase apoptosis in the rat gastric mucosa through a reactive oxygen species- (ROS) mediated and a p53-independent pathway.
Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres
International Nuclear Information System (INIS)
Ji, Qing; Hao, Xinbao; Meng, Yang; Zhang, Min; DeSano, Jeffrey; Fan, Daiming; Xu, Liang
2008-01-01
MicroRNAs (miRNAs), some of which function as oncogenes or tumor suppressor genes, are involved in carcinogenesis via regulating cell proliferation and/or cell death. MicroRNA miR-34 was recently found to be a direct target of p53, functioning downstream of the p53 pathway as a tumor suppressor. miR-34 targets Notch, HMGA2, and Bcl-2, genes involved in the self-renewal and survival of cancer stem cells. The role of miR-34 in gastric cancer has not been reported previously. In this study, we examined the effects of miR-34 restoration on p53-mutant human gastric cancer cells and potential target gene expression. Human gastric cancer cells were transfected with miR-34 mimics or infected with the lentiviral miR-34-MIF expression system, and validated by miR-34 reporter assay using Bcl-2 3'UTR reporter. Potential target gene expression was assessed by Western blot for proteins, and by quantitative real-time RT-PCR for mRNAs. The effects of miR-34 restoration were assessed by cell growth assay, cell cycle analysis, caspase-3 activation, and cytotoxicity assay, as well as by tumorsphere formation and growth. Human gastric cancer Kato III cells with miR-34 restoration reduced the expression of target genes Bcl-2, Notch, and HMGA2. Bcl-2 3'UTR reporter assay showed that the transfected miR-34s were functional and confirmed that Bcl-2 is a direct target of miR-34. Restoration of miR-34 chemosensitized Kato III cells with a high level of Bcl-2, but not MKN-45 cells with a low level of Bcl-2. miR-34 impaired cell growth, accumulated the cells in G1 phase, increased caspase-3 activation, and, more significantly, inhibited tumorsphere formation and growth. Our results demonstrate that in p53-deficient human gastric cancer cells, restoration of functional miR-34 inhibits cell growth and induces chemosensitization and apoptosis, indicating that miR-34 may restore p53 function. Restoration of miR-34 inhibits tumorsphere formation and growth, which is reported to be
p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.
Directory of Open Access Journals (Sweden)
Feng Yu
Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.
Getting genetic access to natural adenovirus genomes to explore vector diversity.
Zhang, Wenli; Ehrhardt, Anja
2017-10-01
Recombinant vectors based on the human adenovirus type 5 (HAdV5) have been developed and extensively used in preclinical and clinical studies for over 30 years. However, certain restrictions of HAdV5-based vectors have limited their clinical applications because they are rather inefficient in specifically transducing cells of therapeutic interest that lack the coxsackievirus and adenovirus receptor (CAR). Moreover, enhanced vector-associated toxicity and widespread preexisting immunity have been shown to significantly hamper the effectiveness of HAdV-5-mediated gene transfer. However, evolution of adenoviruses in the natural host is driving the generation of novel types with altered virulence, enhanced transmission, and altered tissue tropism. As a consequence, an increasing number of alternative adenovirus types were identified, which may represent a valuable resource for the development of novel vector types. Thus, researchers are focusing on the other naturally occurring adenovirus types, which are structurally similar but functionally different from HAdV5. To this end, several strategies have been devised for getting genetic access to adenovirus genomes, resulting in a new panel of adenoviral vectors. Importantly, these vectors were shown to have a host range different from HAdV5 and to escape the anti-HAdV5 immune response, thus underlining the great potential of this approach. In summary, this review provides a state-of-the-art overview of one essential step in adenoviral vector development.
Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi
2018-02-01
β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.
Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish
Directory of Open Access Journals (Sweden)
Seok-Hyung Kim
2013-07-01
Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.
Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma
International Nuclear Information System (INIS)
Frey, L. M.; Houben, R.; Brocker, E. B.
2011-01-01
Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.
Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.
Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido
2008-07-01
We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.
Fu, Peiliang; Zhang, Lei; Wu, Haishan; Cong, Ruijun; Chen, Song; Ding, Zheru; Hu, Kaimen
2013-03-01
To investigate the feasibility of rabbit synovial-derived mesenchymal stem cells (SMSCs) differentiating into fibrocartilage cells by the recombinant adenovirus vector mediated by bone morphogenetic protein 2/7 (BMP-2/7) genes in vitro. SMSCs were isolated and purified from 3-month-old New Zealand white rabbits [male or female, weighing (2.1 +/- 0.3) kg]; the morphology was observed; the cells were identified with immunocytological fluorescent staining, flow cytometry, and cell cycles. The adipogenic, osteogenic, and chondrogenic differentiations were detected. The recombinant plasmid of pAdTrack-BMP-2-internal ribosome entry site (IRES)-BMP-7 was constructed and then was used to infect SMSCs. The cell DNA content and the oncogenicity were tested to determine the safety. Then infected SMSCs were cultured in incomplete chondrogenic medium in vitro. Chondrogenic differentiation of infected SMSCs was detected by RT-PCR, immunofluorescent staining, and toluidine blue staining. SMSCs expressed surface markers of stem cells, and had multi-directional potential. The transfection efficiency of SMSCs infected by recombinant plasmid of pAdTrack-BMP-2-IRES-BMP-7 was about 70%. The safety results showed that infected SMSCs had normal double time, normal chromosome number, and normal DNA content and had no oncogenicity. At 21 days after cultured in incomplete chondrocyte medium, RT-PCR results showed SMSCs had increased expressions of collegan type I and collegan type II, particularly collegan type II; the expressions of RhoA and Sox-9 increased obviously. Immunofluorescent staining and toluidine blue staining showed differentiation of SMSCs into fibrocartilage cells. It is safe to use pAdTrack-BMP-2-IRES-BMP-7 for infecting SMSCs. SMSCs infected by pAdTrack-BMP-2-IRES-BMP-7 can differentiate into fibrocartilage cells spontaneously in vitro.
Teng, Zhi-Ping; Chen, Jing; Chau, Lee-Young; Galunic, Nicholas; Regan, Raymond F
2004-11-01
Heme oxygenase-1 (HO-1) is induced in the CNS after hemorrhage, and may have an effect on injury to surrounding tissue. Hemin, the preferred substrate of HO, is a neurotoxin that is present in intracranial hematomas. In a prior study, we observed that HO inhibitors increased the vulnerability of cultured cortical astrocytes to heme-mediated oxidative injury. To investigate the effect of HO more specifically, we used an adenoviral vector encoding the human HO-1 gene to specifically increase HO-1 expression. Incubation with 100 MOI of the HO-1 adenovirus (Adv-HHO-1) for 24 h increased both HO-1 protein and HO activity; a control adenovirus lacking the HO-1 gene had no effect. Using a DNA probe that was specific for human HO-1, 80.5 +/- 7.2% of astrocytes were observed to be infected by in situ hybridization. The cell death produced by 30-60 microM hemin was significantly reduced by pretreatment with 100 MOI Adv-HHO-1, as assessed by LDH release, propidium iodide exclusion, and MTT reduction assay. The threefold increase in cell protein oxidation produced by hemin was also attenuated in cultures pretreated with Adv-HHO-1. These results support the hypothesis that HO-1 protects astrocytes from heme-mediated oxidative injury. Specifically increasing astrocytic HO-1 by gene transfer may have a beneficial effect on hemorrhagic CNS injury.
Core labeling of adenovirus with EGFP
International Nuclear Information System (INIS)
Le, Long P.; Le, Helen N.; Nelson, Amy R.; Matthews, David A.; Yamamoto, Masato; Curiel, David T.
2006-01-01
The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expression vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology
Epstein-Barr virus nuclear antigen 3C stabilizes Gemin3 to block p53-mediated apoptosis.
Directory of Open Access Journals (Sweden)
Qiliang Cai
2011-12-01
Full Text Available The Epstein-Barr nuclear antigen 3C (EBNA3C, one of the essential latent antigens for Epstein-Barr virus (EBV-induced immortalization of primary human B lymphocytes in vitro, has been implicated in regulating cell proliferation and anti-apoptosis via interaction with several cellular and viral factors. Gemin3 (also named DDX20 or DP103 is a member of DEAD RNA helicase family which exhibits diverse cellular functions including DNA transcription, recombination and repair, and RNA metabolism. Gemin3 was initially identified as a binding partner to EBNA2 and EBNA3C. However, the mechanism by which EBNA3C regulates Gemin3 function remains unclear. Here, we report that EBNA3C directly interacts with Gemin3 through its C-terminal domains. This interaction results in increased stability of Gemin3 and its accumulation in both B lymphoma cells and EBV transformed lymphoblastoid cell lines (LCLs. Moreover, EBNA3C promotes formation of a complex with p53 and Gemin3 which blocks the DNA-binding affinity of p53. Small hairpin RNA based knockdown of Gemin3 in B lymphoma or LCL cells remarkably attenuates the ability of EBNA3C to inhibit the transcription activity of p53 on its downstream genes p21 and Bax, as well as apoptosis. These findings provide the first evidence that Gemin3 may be a common target of oncogenic viruses for driving cell proliferation and anti-apoptotic activities.
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
International Nuclear Information System (INIS)
Mirzayans, R.; Enns, L.; Dietrich, K.; Barley, R.D.C.; Paterson, M.C.; Alberta Univ., Edmonton, AB; Alberta Univ., Edmonton, AB
1996-01-01
Dermal fibroblast strains cultured from affected members of a cancer-prone family with Li-Fraumeni syndrome (LFS) harbor a point mutation in one allele of the p53 tumor suppressor gene, resulting in loss of normal p53-deficient strains to carry out the long-patch mode of excision repair, mediated by DNA polymerases delta and epsilon, after exposure to Co-60 gamma radiation or far ultraviolet (UV) (chiefly 254 mm) light. Repair was monitored by incubation of the irradiated cultures in the presence of aphidicolin (ape) or 1-beta-D-arabinofuranosylcytosine (araC), each a specific inhibitor of long-patch repair, followed by measurement of drug-induced DNA strand breaks (reflecting non-ligated strand incision events) by alkaline surcrose velocity sedimentation. The LFS strains displayed deficient repair capacity in response to both gamma rays and UV light. The repair anomaly in UV-irradiated LFS cultures was manifested not only in the overall genome, but also in the transcriptionally active, preferentially repaired c-myc gene. Using autoradiography we also assessed unscheduled DNA synthesis (UDS) after UV irradiation and found this conventional measure of repair replication to be deficient in LFS strains. Moreover, both ape and araC decreased the level of UV-induced UDS by similar to 75% in normal cells, but each had only a marginal effect on LFS cells. We further demonstrated that the LFS strains are impaired in the recovery of both RNA and replicative DNA syntheses after UV treatment, two molecular anomalies of the DNA repair deficiency disorders xeroderma pigmentosum and Cockayne's syndrome. Together these results imply a critical role for wild-type p53 protein in DNA polymerase delta/epsilon-mediated excision repair, both the mechanism operating on the entire genome and that acting on expressed genes. (Author)
CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.
Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng
2017-06-16
Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Directory of Open Access Journals (Sweden)
Sushma Kalmodia
2017-12-01
Full Text Available Inhibition of the interaction between p53 and HDM2 is an effective therapeutic strategy in cancers that harbor a wild-type p53 protein such as retinoblastoma (RB. Nanoparticle-based delivery of therapeutic molecules has been shown to be advantageous in localized delivery, including to the eye, by overcoming ocular barriers. In this study, we utilized biocompatible gold nanoparticles (GNPs to deliver anti-HDM2 peptide to RB cells. Characterization studies suggested that GNP-HDM2 was stable in biologically relevant solvents and had optimal cellular internalization capability, the primary requirement of any therapeutic molecule. GNP-HDM2 treatment in RB cells in vitro suggested that they function by arresting RB cells at the G2M phase of the cell cycle and initiating apoptosis. Analysis of molecular changes in GNP-HDM2-treated cells by qRT-PCR and western blotting revealed that the p53 protein was upregulated; however, transactivation of its downstream targets was minimal, except for the PUMA-BCl2 and Bax axis. Global gene expression and in silico bioinformatic analysis of GNP-HDM2-treated cells suggested that upregulation of p53 might presumptively mediate apoptosis through the induction of p53-inducible miRNAs.
ARF and ATM/ATR cooperate in p53-mediated apoptosis upon oncogenic stress
International Nuclear Information System (INIS)
Pauklin, Siim; Kristjuhan, Arnold; Maimets, Toivo; Jaks, Viljar
2005-01-01
Induction of apoptosis is pivotal for eliminating cells with damaged DNA or deregulated proliferation. We show that tumor suppressor ARF and ATM/ATR kinase pathways cooperate in the induction of apoptosis in response to elevated expression of c-myc, β-catenin or human papilloma virus E7 oncogenes. Overexpression of oncogenes leads to the formation of phosphorylated H2AX foci, induction of Rad51 protein levels and ATM/ATR-dependent phosphorylation of p53. Inhibition of ATM/ATR kinases abolishes both induction of Rad51 and phosphorylation of p53, and remarkably reduces the level of apoptosis induced by co-expression of oncogenes and ARF. However, the induction of apoptosis is downregulated in p53-/- cells and does not depend on activities of ATM/ATR kinases, indicating that efficient induction of apoptosis by oncogene activation depends on coordinated action of ARF and ATM/ATR pathways in the regulation of p53
Sidarala, Vaibhav; Kowluru, Anjaneyulu
2017-05-01
Chronic hyperglycemia (HG) promotes pancreatic islet dysfunction which leads to the onset of T2DM. This study is aimed at defining regulatory roles of Rac1, a small G-protein, in the activation of p53 and ATM kinase in pancreatic β-cells, under the duress of HG conditions. We report significant stimulatory effects of HG (20 mM; 24 h) on p53 activation in INS-1 832/13 cells, normal rodent and human islets. Pharmacological inhibition of Rac1 (EHT1864 or NSC23766) significantly suppressed HG-induced p53 activation in INS-1 832/13 cells and rat islets, suggesting novel roles for this small G-protein in the activation of p53. Inhibition of Rac1 geranylgeranylation with simvastatin or GGTI-2147, significantly attenuated HG-induced p53 activation, suggesting requisite roles for this signaling step in HG-mediated effects on β-cells. HG-induced p53 activation was also suppressed by SB203580, a known inhibitor of p38MAPK. Additionally, we observed increased activation of ATM kinase under HG conditions, which was blocked in presence of EHT1864. Furthermore, pharmacological inhibition of ATM kinase (KU55933) reduced activation of ATM kinase, but not p53, suggesting that HG-mediated activation of p53 and ATM could represent independent pro-apoptotic events. In conclusion, these data indicate that sustained activation of Rac1-p38MAPK signaling axis leads to activation of p53 leading to β-cell dysfunction under the duress of chronic hyperglycemic conditions.
Chung, Ki Wung; Choi, Yeon Ja; Park, Min Hi; Jang, Eun Ji; Kim, Dae Hyun; Park, Byung Hyun; Yu, Byung Pal; Chung, Hae Young
2015-08-01
Stresses, such as exposure to ultraviolet radiation and those associated with aging, are known to cause premature cellular senescence that is characterized by growth arrest and morphological and gene expression changes. This study was designed to investigate the protective effect of Sirtuin1 (SIRT1) on the UVB-induced premature senescence. Under in vitro experimental conditions, exposure to a subcytotoxic dose of UVB enhanced human skin fibroblasts senescence, as characterized by increased β-galactosidase activity and increased levels of senescence-associated proteins. However, adenovirus-mediated SIRT1 overexpression significantly protected fibroblasts from UVB-induced cellular deterioration. Exposure to UVB-induced cell senescence was associated with oxidative stress and p38 mitogen-activated protein kinase activation. Molecular analysis demonstrated that deacetylation of Forkhead box O3α (FOXO3α) by SIRT1 changed the transcriptional activity of FOXO3α and increased resistance to the oxidative stress. In addition, SIRT1 suppressed UVB-induced p53 acetylation and its transcriptional activity, which directly affected the cell cycle arrest induced by UVB. Further study demonstrated that SIRT1 activation inhibited cell senescence in the skin of the HR1 hairless mouse exposed to UVB. The study identifies a new role for SIRT1 in the UVB-induced senescence of skin fibroblats and provides a potential target for skin protection through molecuar insights into the mechanisms responsible for UVB-induced photoaging. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
HEXIM1, a New Player in the p53 Pathway
Energy Technology Data Exchange (ETDEWEB)
Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)
2013-07-04
Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.
Adenovirus-based vaccine against Listeria monocytogenes
DEFF Research Database (Denmark)
Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech
2013-01-01
The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... linked to Ii compared with vaccination with the unlinked vaccine. Studies using knockout mice demonstrated that CD8(+) T cells were largely responsible for this protection, which is mediated through perforin-dependent lysis of infected cells and IFN-γ production. Taking the concept a step further...
Recent advances in genetic modification of adenovirus vectors for cancer treatment.
Yamamoto, Yuki; Nagasato, Masaki; Yoshida, Teruhiko; Aoki, Kazunori
2017-05-01
Adenoviruses are widely used to deliver genes to a variety of cell types and have been used in a number of clinical trials for gene therapy and oncolytic virotherapy. However, several concerns must be addressed for the clinical use of adenovirus vectors. Selective delivery of a therapeutic gene by adenovirus vectors to target cancer is precluded by the widespread distribution of the primary cellular receptors. The systemic administration of adenoviruses results in hepatic tropism independent of the primary receptors. Adenoviruses induce strong innate and acquired immunity in vivo. Furthermore, several modifications to these vectors are necessary to enhance their oncolytic activity and ensure patient safety. As such, the adenovirus genome has been engineered to overcome these problems. The first part of the present review outlines recent progress in the genetic modification of adenovirus vectors for cancer treatment. In addition, several groups have recently developed cancer-targeting adenovirus vectors by using libraries that display random peptides on a fiber knob. Pancreatic cancer-targeting sequences have been isolated, and these oncolytic vectors have been shown by our group to be associated with a higher gene transduction efficiency and more potent oncolytic activity in cell lines, murine models, and surgical specimens of pancreatic cancer. In the second part of this review, we explain that combining cancer-targeting strategies can be a promising approach to increase the clinical usefulness of oncolytic adenovirus vectors. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Functional Significance of Mutant p53 in Breast Cancer
National Research Council Canada - National Science Library
O'Lear, Renee
2001-01-01
... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...
Liu, Rui; Tang, Jiajia; Ding, Chaodong; Liang, Weicheng; Zhang, Li; Chen, Tianke; Xiong, Yan; Dai, Xiaowei; Li, Wenfeng; Xu, Yunsheng; Hu, Jin; Lu, Liting; Liao, Wanqin; Lu, Xincheng
2017-04-01
Ataxia-telangiectasia mutated (ATM) protein kinase is a major guardian of genomic stability, and its well-established function in cancer is tumor suppression. Here, we report an oncogenic role of ATM. Using two isogenic sets of human colon cancer cell lines that differed only in their ATM status, we demonstrated that ATM deficiency significantly inhibits cancer cell proliferation, migration, and invasion. The tumor-suppressive function of ATM depletion is not modulated by the compensatory activation of ATR, but it is associated with B56γ2-mediated Chk1/p53/CD44 signaling pathways. Under normal growth conditions, the depletion of ATM prevents B56γ2 ubiquitination and degradation, which activates PP2A-mediated Chk1/p53/p21 signaling pathways, leading to senescence and cell cycle arrest. CD44 was validated as a novel ATM target based on its ability to rescue cell migration and invasion defects in ATM-depleted cells. The activation of p53 induced by ATM depletion suppresses CD44 transcription, thus resulting in epithelial-mesenchymal transition (EMT) and cell migration suppression. Our study suggests that ATM has tumorigenic potential in post-formed colon neoplasia, and it supports ATM as an appealing target for improving cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
L.M. Massoni Neto
2007-08-01
Full Text Available Malignancy of pulmonary large cell carcinomas (LCC increases from classic LCC through LCC with neuroendocrine morphology (LCCNM to large cell neuroendocrine carcinomas (LCNEC. However, the histological classification has sometimes proved to be difficult. Because the malignancy of LCC is highly dependent on proteins with functions in the cell cycle, DNA repair, and apoptosis, p53 has been targeted as a potentially useful biological marker. p53 mutations in lung cancers have been shown to result in expression and protein expression also occurs in the absence of mutations. To validate the importance of both p53 protein expression (by immunostaining and p53 gene mutations in lung LCC (by PCR-single strand conformational polymorphism analysis of exons 5, 6, 7, and 8 and to study their relationships with clinical factors and sub-classification we investigated the correlation of p53 abnormalities in 15 patients with LCC (5 classic LCC, 5 LCNEC, and 5 LCCNM who had undergone resection with curative intent. Of these patients, 5/15 expressed p53 and none had mutant p53 sequences. There was a negative survival correlation with positive p53 immunostaining (P = 0.05. After adjustment for stage, age, gender, chemotherapy, radiotherapy, and histological subtypes by multivariate analysis, p53 expression had an independent impact on survival. The present study indicates that p53 assessment may provide an objective marker for the prognosis of LCC irrespective of morphological variants and suggests that p53 expression is important for outcome prediction in patients with the early stages of LCC. The results reported here should be considered to be initial results because tumors from only 15 patients were studied: 5 each from LCC, LCNEC and LCCNM. This was due to the rarity of these specific diseases.
Directory of Open Access Journals (Sweden)
Kyoung-jin Min
2017-08-01
Full Text Available Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose polymerase (PARP, which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5 expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer
International Nuclear Information System (INIS)
Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P
2009-01-01
Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E
2014-07-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dong S
2013-10-01
were used to investigate the expressive changes of important genes related to the therapy. Results: The administration procedure proved safe for the rabbits' liver function, the p53 plus Rb LNT showed significantly better antitumoral effect and lower expression of malignant genes than the p53 or Rb LNT, although no significant difference was observed in animal survival when the p53 plus Rb LNT was compared with the p53 LNT. Conclusion: Rb works synergistically with p53 in combined therapy mediated by a poly-L-lysine-modified hydroxyapatite nanoparticle nanoplex to augment the antitumoral effect through the downregulated expression of important genes related to apoptosis, necrosis, growth, differentiation and multidrug resistance of tumor cells. LNT with p53 and Rb is potentially an effective antitumor therapy for hepatocellular carcinoma. Keywords: nanoparticles, gene-transfer techniques, targeting, combined therapy
Nam, Jae-Kook; Lee, Mi-Hyang; Seo, Hae-Hyun; Kim, Seok-Ki; Lee, Kang-Huyn; Kim, In-Hoo; Lee, Sang-Jin
2010-05-01
Tumor or tissue specific replicative adenovirus armed with a therapeutic gene has shown a promising anti-cancer therapeutic modality. However, because the genomic packaging capacity is constrained, only a few places inside it are available for transgene insertion. In the present study, we introduce a novel strategy utilizing the early E4 region for the insertion of therapeutic gene(s). We constructed the conditionally replication-competent adenovirus (CRAd), Ad5E4(mRFP) by: (i) replacing the E4/E1a promoter by the prostate-specific enhancer element; (ii) inserting mRFP inside the E4orf1-4 deletion region; and (iii) sub-cloning enhanced green fluorescent protein controlled by cytomegalovirus promoter in the left end of the viral genome. Subsequently, we evaluated its replication abilities and killing activities in vitro, as well as its in vivo anti-tumor efficacy in CWR22rv xenografts. When infected with Ad5E4(mRFP), the number and intensity of the mRFP gene products increased in a prostate cancer cell-specific manner as designed, suggesting that the mRFP gene and E4orfs other than E4orf1-4 were well synthesized from one transcript via alternative splicing as the recombinant adenovirus replicated. As expected from the confirmed virus replication capability, Ad5E4(mRFP) induced cell lysis as potent as the wild-type adenovirus and effectively suppressed tumor growth when tested in the CWR22rv xenografts in nude mice. Furthermore, Ad5E4(endo/angio) harboring an endostatin-angiostatin gene in E4orf1-4 was able to enhance CRAd by replacing mRFP with a therapeutic gene. The approach employed in the present study for the insertion of a therapeutic transgene in CRAd should facilitate the construction of CRAd containing multiple therapeutic genes in the viral genome that may have the potential to serve as highly potent cancer therapeutic reagents. Copyright (c) 2010 John Wiley & Sons, Ltd.
Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T
1993-10-01
A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.
P63 gene mutations and human developmental syndromes.
Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van
2002-01-01
The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
Functional Significance of Mutant p53 in Breast Cancer
National Research Council Canada - National Science Library
O'Lear, Rene
2002-01-01
... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...
Directory of Open Access Journals (Sweden)
Qingyu Qin
Full Text Available Perturbation of lipid metabolism, especially of cholesterol homeostasis, can be catastrophic to mammalian brain, as it has the highest level of cholesterol in the body. This notion is best illustrated by the severe progressive neurodegeneration in Niemann-Pick Type C (NPC disease, one of the lysosomal storage diseases, caused by mutations in the NPC1 or NPC2 gene. In this study, we found that growth cone collapse induced by genetic or pharmacological disruption of cholesterol egress from late endosomes/lysosomes was directly related to a decrease in axonal and growth cone levels of the phosphorylated form of the tumor suppressor factor p53. Cholesterol perturbation-induced growth cone collapse and decrease in phosphorylated p53 were reduced by inhibition of p38 mitogen-activated protein kinase (MAPK and murine double minute (Mdm2 E3 ligase. Growth cone collapse induced by genetic (npc1-/- or pharmacological modification of cholesterol metabolism was Rho kinase (ROCK-dependent and associated with increased RhoA protein synthesis; both processes were significantly reduced by P38 MAPK or Mdm2 inhibition. Finally, in vivo ROCK inhibition significantly increased phosphorylated p53 levels and neurofilaments in axons, and axonal bundle size in npc1-/- mice. These results indicate that NPC-related and cholesterol perturbation-induced axonal pathology is associated with an abnormal signaling pathway consisting in p38 MAPK activation leading to Mdm2-mediated p53 degradation, followed by ROCK activation. These results also suggest new targets for pharmacological treatment of NPC disease and other diseases associated with disruption of cholesterol metabolism.
International Nuclear Information System (INIS)
Jiang Xinqing; Chen Liang; Wu Hongzhen; Huang Jingjun; Wei Xinhua; Mo Lei; Yang Ruimeng; Xiao Xiangsheng
2012-01-01
Objective: To study the characteristics of DWI in nude mice models of hepatic Bel7402 tumors after treatment with adenovirus-mediated cytosine diaminase-thymidine kinase (Ad. CD-TK) double suicide gene therapy, and then to identify whether DWI can be used for assessing curative effect of postoperative tumors. Methods: Thirty nude mice models of hepatic Bel7402 tumors were successfully created using cell suspension method, after the tumor grew to more than 1 cm in diameter, 20 tumor models were treated by intratumoral administration of Ad. CD-TK for 3 days plus intraperitonea (i.p.) treatment with 5-Fc and GCV for the duration of the study.Then they were randomly divided into three groups during 5-Fc and GCV treatment. The remaining 10 tumor models were used as controls. MR scanning were performed in 10 th day before and after tumor implantation in all models by using EPI-SE series and SENSE technology for treatment group. Tumor volumes and ADC values were calculated pretreatment and posttreatment. Cell apoptosis were determined by using TUNEL method. Analyze the change of ADC and apoptosis index (AI) in different times, t test was used for comparison the difference of AI and ADC values respectively. Results: After 10 days,the tumor volumes of the treatment groups and controls were respectively (724.16 ±57.45) mm 3 , (754.57 ± 66.84) mm 3 , with no significant difference (t=0.488, P >0.05). The ADC values of the treatment groups were (0.98 ±0.11) × 10 -3 mm 2 /s,the ones of the control groups were (0.68 ±0.04) × 10 -3 mm 2 /s; AI of the treatment groups were (23.25 ±6.57)%, the ones of the control groups were (2.57 ± 0.58)%. There were difference in both groups (t=4.473, 5.874; P<0.01). Conclusion: DWI can be effectively to monitor the early pathological changes of hepatic Bel7402 tumors after Ad. CD-TK double suicide gene therapy, and provide experimental evidences for clinical application. (authors)
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Carey, John B; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V S; Draper, Simon J; Moore, Anne C
2014-08-21
Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP1₄₂, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP1₄₂ also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP1₄₂ using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies.
Carey, John B.; Vrdoljak, Anto; O'Mahony, Conor; Hill, Adrian V. S.; Draper, Simon J.; Moore, Anne C.
2014-01-01
Substantial effort has been placed in developing efficacious recombinant attenuated adenovirus-based vaccines. However induction of immunity to the vector is a significant obstacle to its repeated use. Here we demonstrate that skin-based delivery of an adenovirus-based malaria vaccine, HAdV5-PyMSP142, to mice using silicon microneedles induces equivalent or enhanced antibody responses to the encoded antigen, however it results in decreased anti-vector responses, compared to intradermal delivery. Microneedle-mediated vaccine priming and resultant induction of low anti-vector antibody titres permitted repeated use of the same adenovirus vaccine vector. This resulted in significantly increased antigen-specific antibody responses in these mice compared to ID-treated mice. Boosting with a heterologous vaccine; MVA-PyMSP142 also resulted in significantly greater antibody responses in mice primed with HAdV5-PyMSP142 using MN compared to the ID route. The highest protection against blood-stage malaria challenge was observed when a heterologous route of immunization (MN/ID) was used. Therefore, microneedle-mediated immunization has potential to both overcome some of the logistic obstacles surrounding needle-and-syringe-based immunization as well as to facilitate the repeated use of the same adenovirus vaccine thereby potentially reducing manufacturing costs of multiple vaccines. This could have important benefits in the clinical ease of use of adenovirus-based immunization strategies. PMID:25142082
Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation
International Nuclear Information System (INIS)
Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli
2004-01-01
Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)
Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia
International Nuclear Information System (INIS)
Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina
2003-01-01
The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence
Zhang, Erli; Guo, Qianyun; Gao, Haiyang; Xu, Ruixia; Teng, Siyong; Wu, Yongjian
2015-01-01
Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and how "metabolic memory" would affect endothelial senescence through SIRT1 signaling remains largely unknown. In this study, we investigated the involvement of SIRT1 axis as well as the protective effects of resveratrol (RSV) and metformin (MET), two potent SIRT1 activators, during the occurrence of "metabolic memory" of cellular senescence (senescent "memory"). Human umbilical vascular endothelial cells (HUVECs) were cultured in either normal glucose (NG)/high glucose (HG) media for 6 days, or 3 days of HG followed by 3 days of NG (HN), with or without RSV or MET treatment. It was shown that HN incubation triggered persistent downregulation of deacetylase SIRT1 and upregulation of acetyltransferase p300, leading to sustained hyperacetylation (at K382) and activation of p53, and subsequent p53/p21-mediated senescent "memory." In contrast, senescent "memory" was abrogated by overexpression of SIRT1 or knockdown of p300. Interestingly, we found that SIRT1 and p300 could regulate each other in response to HN stimulation, suggesting that a delicate balance between acetyltransferases and deacetylases may be particularly important for sustained acetylation and activation of non-histone proteins (such as p53), and eventually the occurrence of "metabolic memory." Furthermore, we found that RSV or MET treatment prevented senescent "memory" by modulating SIRT1/p300/p53/p21 pathway. Notably, early and continuous treatment of MET, but not RSV, was particularly important for preventing senescent "memory." In conclusion, short-term high glucose stimulation could induce sustained endothelial senescence via SIRT1/p300/p53/p21 pathway. RVS or MET
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
Mathematical Modeling of E6-p53 interactions in Cervical Cancer
Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar
2017-04-01
Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License
Sun, Yuan; Li, Hong-Yu; Tian, Da-Yong; Han, Qiu-Ying; Zhang, Xin; Li, Na; Qiu, Hua-Ji
2011-10-26
Low efficacy of gene-based vaccines due to inefficient gene delivery and expression has been major bottleneck of their applications. Efforts have been made to improve the efficacy, such as gene gun and electroporation, but the strategies are difficult to put into practical use. In this study, we developed and evaluated an adenovirus-delivered, alphavirus replicon-vectored vaccine (chimeric vector-based vaccine) expressing the E2 gene of classical swine fever virus (CSFV) (rAdV-SFV-E2). Rabbits immunized with rAdV-SFV-E2 developed CSFV-specific antibodies as early as 9 days and as long as 189 days and completely protected from challenge with C-strain. Pigs immunized with rAdV-SFV-E2 (n=5) developed robust humoral and cell-mediated responses to CSFV and were completely protected from subsequent lethal CSFV infection clinically and virologically. The level of immunity and protection induced by rAdV-SFV-E2 was comparable to that provided by the currently used live attenuated vaccine, C-strain. In contrast, both the conventional alphavirus replicon-vectored vaccine pSFV1CS-E2 and conventional adenovirus-vectored vaccine rAdV-E2 provided incomplete protection. The chimeric vector-based vaccine represents the first gene-based vaccine that is able to confer sterile immunity and complete protection against CSFV. The new-concept vaccination strategy may also be valuable in vaccine development against other pathogens. Copyright © 2011 Elsevier Ltd. All rights reserved.
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Møller, Michael Boe; Gerdes, A M; Skjødt, K
1999-01-01
screening for p53 gene mutations as a prognostic marker in a population-based group of B- and T-cell non-Hodgkin's lymphomas (NHLs). On the basis of p53 gene mutation status and immunohistochemically detected p53 and p21Waf1 expression in 34 lymphomas, we established an immunophenotype (delta p53......) correlating with p53 gene mutation. The immunohistochemical analysis was extended to encompass 199 lymphomas from a population-based registry and was correlated with clinical parameters. Delta p53 showed 100% concordance with p53 gene mutation and was detected in 42 cases (21%). Multivariate analysis...... of advanced stage lymphomas showed that delta p53 was independently associated with treatment failure (relative risk, 3.8; P = 0.001). Delta p53 predicted poor survival when analyzing all patients (P = 0.0001), as well as B-cell (P = 0.04) and T-cell NHL (P = 0.000002). In multivariate analysis, delta p53...
Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.
2015-01-01
Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...
p21(Waf1/Cip1) expression and the p53/MDM2 feedback loop in gastric carcinogenesis
Craanen, M. E.; Blok, P.; Offerhaus, G. J.; Meijer, G. A.; Dekker, W.; Kuipers, E. J.; Meuwissen, S. G.
1999-01-01
Data are non-existent regarding coincidental alterations in the expression of p53 and its downstream target genes MDM2 and p21(Waf1/Cip1) in gastric carcinogenesis. An immunohistochemical study was therefore performed to examine the interrelationships of p53, MDM2, and p21(Waf1/Cip1) expression in a
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
International Nuclear Information System (INIS)
Alphonse, Gersende; Maalouf, Mira; Battiston-Montagne, Priscillia; Ardail, Dominique; Beuve, Michaël; Rousson, Robert; Taucher-Scholz, Gisela; Fournier, Claudia; Rodriguez-Lafrasse, Claire
2013-01-01
To determine whether ceramide is responsible for the induction of p53-independent early or late apoptosis in response to high- and low-Linear-Energy-Transfer (LET) irradiation. Four cell lines displaying different radiosensitivities and p53-protein status were irradiated with photons or 33.4 or 184 keV/μm carbon ions. The kinetics of ceramide production was quantified by fluorescent microscopy or High-Performance-Liquid-Chromatogaphy and the sequence of events leading to apoptosis by flow cytometry. Regardless of the p53-status, both low and high-LET irradiation induced an early ceramide production in radiosensitive cells and late in the radioresistant. This production strongly correlated with the level of early apoptosis in radiosensitive cells and delayed apoptosis in the radioresistant ones, regardless of radiation quality, tumor type, radiosensitivity, or p53-status. Inhibition of caspase activity or ceramide production showed that, for both types of radiation, ceramide is essential for the initiation of early apoptosis in radiosensitive cells and late apoptosis following mitotic catastrophe in radioresistant cells. Ceramide is a determining factor in the onset of early and late apoptosis after low and high-LET irradiation and is the mediator of the p53-independent-apoptotic pathway. We propose that ceramide is the molecular bridge between mitotic catastrophe and the commitment phase of delayed apoptosis in response to irradiation
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Directory of Open Access Journals (Sweden)
Iva Simeonova
2013-06-01
Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.
International Nuclear Information System (INIS)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee
2011-01-01
Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.
Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis.
Directory of Open Access Journals (Sweden)
Adriana Rodríguez-Marí
2010-07-01
Full Text Available The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafish fancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafish fancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53 mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA-repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination.
Pax3 stimulates p53 ubiquitination and degradation independent of transcription.
Directory of Open Access Journals (Sweden)
Xiao Dan Wang
Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.
Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M
2004-11-01
Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
Directory of Open Access Journals (Sweden)
Othman A. Al-Shabanah
2012-01-01
Full Text Available Interaction of doxorubicin DOX with iron and the consequent generation of reactive oxygen species (ROS is a major player in DOX-induced cardiomyopathy. Accordingly, this study has been initiated to investigate the preventive effect of the iron chelator, desferrioxamine (DFX, against DOX-induced acute cardiotoxicity in rats. Male Wistar albino rats were divided into four groups and were injected intraperitoneally (I.P. with normal saline, a single dose of DOX (15 mg/kg, a single dose of DFX (250 mg/kg and a combined treatment with DFX (250 mg/kg 30 min prior to a single dose of DOX, (15 mg/kg. A single dose of DOX significantly increased mRNA expression of TGF-β, Smad2, Smad4, CDKN2A and p53 and significantly decreased Samd7 and Mdm2 mRNA expression levels. Administration of DFX prior to DOX resulted in a complete reversal of DOX-induced alteration in cardiac enzymes and gene expression to normal levels. Data from this study suggest that (1 DOX induces its acute cardiotoxicity secondary to increasing genes expression of TGF-β/Smad pathway. (2 DOX increases apoptosis through upregulation of CDKN2A and p53 and downregulation of Mdm2 gene expression. (3 The preventive effect of DFX against DOX-induced cardiotoxicity is mediated via the TGF-β1/Smad pathway.
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
Directory of Open Access Journals (Sweden)
Luciano de Souza Santos
2017-01-01
Full Text Available Xylopine is an aporphine alkaloid that has cytotoxic activity to cancer cells. In this study, the underlying mechanism of xylopine cytotoxicity was assessed in human colon carcinoma HCT116 cells. Xylopine displayed potent cytotoxicity in different cancer cell lines in monolayer cultures and in a 3D model of cancer multicellular spheroids formed from HCT116 cells. Typical morphology of apoptosis, cell cycle arrest in the G2/M phase, increased internucleosomal DNA fragmentation, loss of the mitochondrial transmembrane potential, and increased phosphatidylserine externalization and caspase-3 activation were observed in xylopine-treated HCT116 cells. Moreover, pretreatment with a caspase-3 inhibitor (Z-DEVD-FMK, but not with a p53 inhibitor (cyclic pifithrin-α, reduced xylopine-induced apoptosis, indicating induction of caspase-mediated apoptosis by the p53-independent pathway. Treatment with xylopine also caused an increase in the production of reactive oxygen/nitrogen species (ROS/RNS, including hydrogen peroxide and nitric oxide, but not superoxide anion, and reduced glutathione levels were decreased in xylopine-treated HCT116 cells. Application of the antioxidant N-acetylcysteine reduced the ROS levels and xylopine-induced apoptosis, indicating activation of ROS-mediated apoptosis pathway. In conclusion, xylopine has potent cytotoxicity to different cancer cell lines and is able to induce oxidative stress and G2/M phase arrest, triggering caspase-mediated apoptosis by the p53-independent pathway in HCT116 cells.
Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms.
Malkin, D; Li, F P; Strong, L C; Fraumeni, J F; Nelson, C E; Kim, D H; Kassel, J; Gryka, M A; Bischoff, F Z; Tainsky, M A
1990-11-30
Familial cancer syndromes have helped to define the role of tumor suppressor genes in the development of cancer. The dominantly inherited Li-Fraumeni syndrome (LFS) is of particular interest because of the diversity of childhood and adult tumors that occur in affected individuals. The rarity and high mortality of LFS precluded formal linkage analysis. The alternative approach was to select the most plausible candidate gene. The tumor suppressor gene, p53, was studied because of previous indications that this gene is inactivated in the sporadic (nonfamilial) forms of most cancers that are associated with LFS. Germ line p53 mutations have been detected in all five LFS families analyzed. These mutations do not produce amounts of mutant p53 protein expected to exert a trans-dominant loss of function effect on wild-type p53 protein. The frequency of germ line p53 mutations can now be examined in additional families with LFS, and in other cancer patients and families with clinical features that might be attributed to the mutation.
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
Adenovirus DNA binding protein inhibits SrCap-activated CBP and CREB-mediated transcription
International Nuclear Information System (INIS)
Xu Xiequn; Tarakanova, Vera; Chrivia, John; Yaciuk, Peter
2003-01-01
The SNF2-related CBP activator protein (SrCap) is a potent activator of transcription mediated by CBP and CREB. We have previously demonstrated that the Adenovirus 2 DNA Binding Protein (DBP) binds to SrCap and inhibits the transcription mediated by the carboxyl-terminal region of SrCap (amino acids 1275-2971). We report here that DBP inhibits the ability of full-length SrCap (1-2971) to activate transcription mediated by Gal-CREB and Gal-CBP. In addition, DBP also inhibits the ability of SrCap to enhance Protein Kinase A (PKA) activated transcription of the enkaphalin promoter. DBP was found to dramatically inhibit transcription of a mammalian two-hybrid system that was dependent on the interaction of SrCap and CBP binding domains. We also found that DBP has no effect on transcription mediated by a transcriptional activator that is not related to SrCap, indicating that our reported transcriptional inhibition is specific for SrCap and not due to nonspecific effects of DBP's DNA binding activity on the CAT reporter plasmid. Taken together, these results suggest a model in which DBP inhibits cellular transcription mediated by the interaction between SrCap and CBP
Directory of Open Access Journals (Sweden)
C.R.O. Lima
2016-06-01
Full Text Available ABSTRACT The canine transmissible venereal tumor (TVT affects the external genitalia of dogs by the natural transplant of viable tumor cells. Thus, this research aimed to diagnose and characterize TVT morphological patterns, identify the insertion of the LINE-1 element in C-MYC gene, by means of the polymerase chain reaction (PCR, and evaluate the immunohistochemical expression of C-MYC, p53, p21 and p27 proteins. The relationship between C-MYC and p53 proteins and their interference on the expression of p21 and p27 were also studied. For that, 20 samples of naturally occurring TVT were used, subjected to cytopathological, histopathological and immunohistochemical analysis, and to molecular diagnosis of neoplasia. The increased tissue expression and the correlation among C-MYC, p53, p21 and p27 proteins indicate reduction and/or loss of their functionality in the TVT microenvironment, with consequent apoptotic suppression, maintenance of cell growth and progression of neoplasia.
Enhanced transduction and replication of RGD-fiber modified adenovirus in primary T cells.
Directory of Open Access Journals (Sweden)
Sadhak Sengupta
2011-03-01
Full Text Available Adenoviruses are often used as vehicles to mediate gene delivery for therapeutic purposes, but their research scope in hematological cells remains limited due to a narrow choice of host cells that express the adenoviral receptor (CAR. T cells, which are attractive targets for gene therapy of numerous diseases, remain resistant to adenoviral infection because of the absence of CAR expression. Here, we demonstrate that this resistance can be overcome when murine or human T cells are transduced with an adenovirus incorporating the RGD-fiber modification (Ad-RGD.A luciferase-expressing replication-deficient Ad-RGD infected 3-fold higher number of activated primary T cells than an adenovirus lacking the RGD-fiber modification in vitro. Infection with replication-competent Ad-RGD virus also caused increased cell cycling, higher E1A copy number and enriched hexon antigen expression in both human and murine T cells. Transduction with oncolytic Ad-RGD also resulted in higher titers of progeny virus and enhanced the killing of T cells. In vivo, 35-45% of splenic T cells were transduced by Ad-RGD.Collectively, our results prove that a fiber modified Ad-RGD successfully transduces and replicates in primary T cells of both murine and human origin.
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1
Directory of Open Access Journals (Sweden)
Olsson Hans
2013-01-01
Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in
Energy Technology Data Exchange (ETDEWEB)
Yi, Jung-Yeon; Han, Jeong-Hee; Yoon, Byung-Il [Kangwon National University, School of Veterinary Medicine, Chuncheon, Gangwon (Korea); Hirabayashi, Yoko; Kodama, Yukio; Kanno, Jun [National Institute of Health Sciences, Division of Cellular and Molecular Toxicology, Center for Biological Safety and Research, Tokyo (Japan); Choi, Yang-Kyu [Konkuk University, College of Veterinary Medicine, Seoul (Korea); Inoue, Tohru [National Institute of Health Sciences, Biological Safety and Research Center, Tokyo (Japan)
2009-08-15
Benzene is a well-known environmental pollutant that can induce hematotoxicity, aplastic anemia, acute myelogenous leukemia, and lymphoma. However, although benzene metabolites are known to induce oxidative stress and disrupt the cell cycle, the mechanism underlying lympho/leukemogenicity is not fully understood. Caspase-4 (alias caspase-11) and -12 are inflammatory caspases implicated in inflammation and endoplasmic reticulum stress-induced apoptosis. The objectives of this study were to investigate the altered expression of caspase-4 and -12 in mouse bone marrow after benzene exposure and to determine whether their alterations are associated with benzene-induced bone marrow toxicity, especially cellular apoptosis. In addition, we evaluated whether the p53 gene is involved in regulating the mechanism, using both wild-type (WT) mice and mice lacking the p53 gene. For this study, 8-week-old C57BL/6 mice [WT and p53 knockout (KO)] were administered a benzene solution (150 mg/kg diluted in corn oil) via oral gavage once daily, 5 days/week, for 1 or 2 weeks. Blood and bone marrow cells were collected and cell counts were measured using a Coulter counter. Total mRNA and protein extracts were prepared from the harvested bone marrow cells. Then qRT-PCR and Western blotting were performed to detect changes in the caspases at the mRNA and protein level, respectively. A DNA fragmentation assay and Annexin-V staining were carried out on the bone marrow cells to detect apoptosis. Results indicated that when compared to the control, leukocyte number and bone marrow cellularity decreased significantly in WT mice. The expression of caspase-4 and -12 mRNA increased significantly after 12 days of benzene treatment in the bone marrow cells of benzene-exposed p53KO mice. However, apoptosis detection assays indicated no evidence of apoptosis in p53KO or WT mice. In addition, no changes of other apoptosis-related caspases, such as caspase-3 and -9, were found in WT or p53KO mice at the
Yu, Ji-Yeon; Zheng, Zhong-Hua; Son, Young-Ok; Shi, Xianglin; Jang, Young-Oh; Lee, Jeong-Chae
2011-12-01
Zearalenone (ZEN) is commonly found in many food commodities and is known to cause reproductive disorders and genotoxic effects. However, the mode of ZEN-induced cell death of macrophages and the mechanisms by which ZEN causes cytotoxicity remain unclear. The present study shows that ZEN treatment reduces viability of RAW264.7 cells in a dose-dependent manner. ZEN causes predominantly necrotic and late apoptotic cell death. ZEN treatment also results in the loss of mitochondrial membrane potential (MMP), mitochondrial changes in Bcl-2 and Bax proteins, and cytoplasmic release of cytochrome c and apoptosis-inducing factor (AIF). Pre-treatment of the cells with either z-VAD-fmk or z-IETD-fmk does not attenuate ZEN-mediated cell death, whereas catalase suppresses the ZEN-induced decrease in viability in RAW264.7 cells. Treating the cells with c-Jun N-terminal kinase (JNK), p38 mitogen-activated protein kinase (MAPK), or p53 inhibitor prevented ZEN-mediated changes, such as MMP loss, cellular reactive oxygen species (ROS) increase, and cell death. JNK or p38 MAPK inhibitor inhibited mitochondrial alterations of Bcl-2 and Bax proteins with attendant decreases in cellular ROS levels. Knockdown of AIF via siRNA transfection also diminished ZEN-induced cell death. Further, adenosine triphosphate was markedly depleted in the ZEN-exposed cells. Collectively, these results suggest that ZEN induces cytotoxicity in RAW264.7 cells via AIF- and ROS-mediated signaling, in which the activations of p53 and JNK/p38 play a key role. Copyright © 2011 Elsevier Ltd. All rights reserved.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
International Nuclear Information System (INIS)
Li Xia; Wu, William K.K.; Sun Bin; Cui Min; Liu Shanshan; Gao Jian; Lou Hongxiang
2011-01-01
Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G 2 /M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine, suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21 Waf1/Cip1 . In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B 1 , a cyclin required for progression through the G 2 /M phase. Taken together, DHA induces G 2 /M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.
Adrenal gland infection by serotype 5 adenovirus requires coagulation factors.
Directory of Open Access Journals (Sweden)
Lucile Tran
Full Text Available Recombinant, replication-deficient serotype 5 adenovirus infects the liver upon in vivo, systemic injection in rodents. This infection requires the binding of factor X to the capsid of this adenovirus. Another organ, the adrenal gland is also infected upon systemic administration of Ad, however, whether this infection is dependent on the cocksackie adenovirus receptor (CAR or depends on the binding of factor X to the viral capsid remained to be determined. In the present work, we have used a pharmacological agent (warfarin as well as recombinant adenoviruses lacking the binding site of Factor X to elucidate this mechanism in mice. We demonstrate that, as observed in the liver, adenovirus infection of the adrenal glands in vivo requires Factor X. Considering that the level of transduction of the adrenal glands is well-below that of the liver and that capsid-modified adenoviruses are unlikely to selectively infect the adrenal glands, we have used single-photon emission computed tomography (SPECT imaging of gene expression to determine whether local virus administration (direct injection in the kidney could increase gene transfer to the adrenal glands. We demonstrate that direct injection of the virus in the kidney increases gene transfer in the adrenal gland but liver transduction remains important. These observations strongly suggest that serotype 5 adenovirus uses a similar mechanism to infect liver and adrenal gland and that selective transgene expression in the latter is more likely to be achieved through transcriptional targeting.
Nuclear localization signal of ING4 plays a key role in its binding to p53
International Nuclear Information System (INIS)
Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang
2005-01-01
ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53