WorldWideScience

Sample records for adenocarcinoma cell strains

  1. Comparative Proteomic Analysis of Human Lung Adenocarcinoma Cisplatin-resistant Cell Strain A549/CDDP

    Directory of Open Access Journals (Sweden)

    Sien SHI

    2009-11-01

    Full Text Available Background and objective Chemotherapy plays an important role in the comprehensive therapy of lung cancer. However, the drug-resistance often causes the failure of the chemotherapy. The aim of this study is to identify differently expressed protein before and after cisplatin resistance of human lung adenocarcinoma cell A549 by proteomic analysis. Methods Cisplatin-resistant cell strain A549/CDDP was established by combining gradually increasing concentration of cisplatin with large dosage impact. Comparative proteomic analysis of A549 and A549/CDDP were carried out by means of two-dimensional gel electrophoresis. The differentially expressed proteins were detected and identified by MALDI-TOF mass spectrometry. Results Eighty-two differentially expressed proteins were screened by analysis the electrophoretic maps of A549 and A549/CDDP. Six differential proteins were analyzed by peptide mass fingerprinting. Glucose regulating protein 75, ribosomal protein S4, mitochondrial ATP synthase F1 complex beta subunit and immunoglobulin heavy chain variable region were identified. All four differentially expressed proteins were over-expressed in A549/CDDP, whereas low-expressed or no-expressed in A549. Conclusion These differentially expressed proteins give some clues to elucidate the mechanism of lung cancer cell resistant of cisplatin, providing the basis of searching for potential target of chemotherapy of lung cancer.

  2. Extracellular Signals of a Human Epithelial Colorectal Adenocarcinoma (Caco-2) Cell Line Facilitate the Penetration of Pseudomonas aeruginosa PAO1 Strain through the Mucin Layer.

    Science.gov (United States)

    Hayashi, Naoki; Yokotani, Atsushi; Yamamoto, Masami; Kososhi, Mariko; Morita, Mayu; Fukunishi, Chiaki; Nishizawa, Nagisa; Gotoh, Naomasa

    2017-01-01

    Pseudomonas aeruginosa can penetrate the layer of mucus formed by host intestinal epithelial cells, often resulting in sepsis in immunocompromised patients. We have previously demonstrated that P. aeruginosa can penetrate the mucin layer by flagellar motility and the degradation of the mucin layer. However, it remains unclear how P. aeruginosa initially recognizes epithelial cells. Using the human epithelial colorectal adenocarcinoma (Caco-2) cell line, we investigated extracellular signaling that could facilitate the penetration of P. aeruginosa through the mucin layer. The supernatant from Caco-2 cell cultures increased penetration of P. aeruginosa through an artificial mucin layer. The Caco-2 cell supernatant increased bacterial flagella-dependent swarming motility, but it did not influence P. aeruginosa growth or protease activity. Filtering of the Caco-2 cell supernatant indicated that proteins weighing Caco-2 cell supernatant attracted P. aeruginosa cells. Finally, we identified that growth-regulated oncogene-α (GRO-α) secreted by Caco-2 cells was a factor facilitating flagellar filament rotation and swarming motility, although it did not attract the bacteria. We conclude that penetration of the mucin layer by P. aeruginosa is facilitated by small proteins (Caco-2 cells, both by inducing acceleration of flagellar motility and increasing chemotaxis.

  3. Endorectal ultrasonography, strain elastography and MRI differentiation of rectal adenomas and adenocarcinomas

    DEFF Research Database (Denmark)

    Waage, Jo Erling Riise; Leh, Sabine; Røsler, Cornelia

    2015-01-01

    adenomas from adenocarcinomas. ERUS and MRI were performed according to standard routine at the institution, defining T0 as adenomas and T1-4 as adenocarcinomas. Subsequent histopathology was used as reference standard. RESULTS: Histopathological evaluation revealed 21 adenomas and 99 adenocarcinomas...... confirms that the elastography SR assessment accurately differentiates sessile adenomas from adenocarcinomas. SR assessment has a superior ability to differentiate adenomas and adenocarcinomas when compared with ERUS and MRI. MRI examination seems unable to recognize adenomas, and should be interpreted......AIM: Strain elastography is a method for recording tissue hardness. Strain in different areas may be compared using strain ratio (SR). The aims of this study were to validate a previously proposed SR cut-off value of 1.25 for differentiating adenocarcinomas from adenomas and to compare...

  4. A cystic fibrosis pancreatic adenocarcinoma cell line.

    Science.gov (United States)

    Schoumacher, R A; Ram, J; Iannuzzi, M C; Bradbury, N A; Wallace, R W; Hon, C T; Kelly, D R; Schmid, S M; Gelder, F B; Rado, T A

    1990-05-01

    We established a pancreatic adenocarcinoma cell line (CFPAC-1) from a patient with cystic fibrosis (CF) and assessed some of its properties. The cells show epithelial morphology and express cytokeratin and oncofetal antigens characteristic of pancreatic duct cells. Basal and stimulated levels of cAMP and cAMP-dependent protein kinase and the biophysical properties of single Cl- channels in CFPAC-1 are similar to those of airway and sweat gland primary cultures and Cl(-)-secreting epithelial cell lines. Anion transport and single Cl- channel activity was stimulated by Ca2+ ionophores but not by forskolin, cAMP analogs, or phosphodiesterase inhibitors. The cells express the CF gene and manifest the most common CF mutation, deletion of three nucleotides resulting in a phenylalanine-508 deletion. These properties have been stable through greater than 80 passages (24 months), suggesting that CFPAC-1 can serve as a continuous cell line that displays the CF defect.

  5. Chylous ascites due to signet ring cell gastric adenocarcinoma | de ...

    African Journals Online (AJOL)

    “Chylous ascites is a rare presentation of peritoneal effusion. The signet ring cell gastric adenocarcinoma is also relatively rare presentation of gastric cancer. We present a quite rare case of chylous ascites associated with signet ring cell gastric adenocarcinoma. Case report: a 47-years-old Caucasian man presented to our ...

  6. Molecular mechanisms of bortezomib resistant adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Erika Suzuki

    Full Text Available Bortezomib (Velcade™ is a reversible proteasome inhibitor that is approved for the treatment of multiple myeloma (MM. Despite its demonstrated clinical success, some patients are deprived of treatment due to primary refractoriness or development of resistance during therapy. To investigate the role of the duration of proteasome inhibition in the anti-tumor response of bortezomib, we established clonal isolates of HT-29 adenocarcinoma cells adapted to continuous exposure of bortezomib. These cells were ~30-fold resistant to bortezomib. Two novel and distinct mutations in the β5 subunit, Cys63Phe, located distal to the binding site in a helix critical for drug binding, and Arg24Cys, found in the propeptide region were found in all resistant clones. The latter mutation is a natural variant found to be elevated in frequency in patients with MM. Proteasome activity and levels of both the constitutive and immunoproteasome were increased in resistant cells, which correlated to an increase in subunit gene expression. These changes correlated with a more rapid recovery of proteasome activity following brief exposure to bortezomib. Increased recovery rate was not due to increased proteasome turnover as similar findings were seen in cells co-treated with cycloheximide. When we exposed resistant cells to the irreversible proteasome inhibitor carfilzomib we noted a slower rate of recovery of proteasome activity as compared to bortezomib in both parental and resistant cells. Importantly, carfilzomib maintained its cytotoxic potential in the bortezomib resistant cell lines. Therefore, resistance to bortezomib, can be overcome with irreversible inhibitors, suggesting prolonged proteasome inhibition induces a more potent anti-tumor response.

  7. Clonality analysis of neuroendocrine cells in gastric adenocarcinoma

    Science.gov (United States)

    Wang, Ling-Ling; Yao, Gen-You; Zhao, Zhong-Sheng; Wei, Xiao-Li; Xu, Ru-Jun

    2013-01-01

    AIM: To achieve a better understanding of the origination of neuroendocrine (NE) cells in gastric adenocarcinoma. METHODS: In this study, 120 cases of gastric adenocarcinoma were obtained. First, frozen section-immunohistochemistrical samples were selected from a large quantity of neuroendocrine cells. Second, laser capture microdissection was used to get target cells from gastric adenocarcinoma and whole genome amplification was applied to get a large quantity of DNA for further study. Third, genome-wide microsatellite abnormalities [microsatellite instability (MSI), loss of heterozygosity (LOH)] and p53 mutation were detected by polymerase chain reaction (PCR)-single-strand conformation polymer- phism-silver staining and PCR-sequencing in order to identify the clonality of NE cells. RESULTS: The total incidence rate of MSI was 27.4%, while LOH was 17.9%. Ten cases had a highest concordance for the two types of cells. The other samples had similar microsatellite changes, except for cases 7 and 10. Concordant p53 mutations exhibited in sample 4, 14, 21 and 27, and there were different mutations between two kinds of cells in case 7. In case 17, mutation took place only in adenocarcinoma cells. p53 mutation was closely related with degree of differentiation, tumor-node-metastasis stage, vessel invasion and lymph node metastasis. In brief, NE and adenocarcinoma cells showed the same MSI, LOH or p53 mutation in most cases (27/30). In the other three cases, different MSI, LOH or p53 mutation occurred. CONCLUSION: NE and the gastric adenocarcinoma cells may mainly derive from the same stem cells, but the remaining cases showing different origin needs further investigation. PMID:23983439

  8. Sirt3 is a tumor suppressor in lung adenocarcinoma cells.

    Science.gov (United States)

    Xiao, Kui; Jiang, Jiehan; Wang, Wei; Cao, Shan; Zhu, Liming; Zeng, Huihui; Ouyang, Ruoyun; Zhou, Rui; Chen, Ping

    2013-09-01

    Sirt3, a member of the mammalian sirtuin family protein that is localized to mitochondria, is a NAD+-dependent deacetylase and plays an important role in the control of metabolic activity. Recently, several studies have shown the potential role of Sirt3 in certain types of tumors such as breast cancer and hepatocellular carcinoma. However, the role of Sirt3 in lung adenocarcinoma has never been studied. In the present study, we found that Sirt3 protein expression was downregulated in human lung adenocarcinoma tissue when compared with that in adjacent normal tissue. Overexpression of Sirt3 using adenovirus significantly inhibited the growth of the A549 lung adenocarcinoma cell line. In this cell line, overexpression of Sirt3 induced apoptosis, which was evidenced by Annexin V + PI assay and cleaved caspase-3 immunoblotting. Furthermore, overexpression of Sirt3 increased the bax/bcl-2 and bad/bcl-x/L ratios, and promoted AIF translocation to the nucleus. Finally, Sirt3 overexpression upregulated p53 and p21 protein levels, and decreased intracellular ROS levels. Collectively, our data suggest that Sirt3 is a tumor suppressor in lung adenocarcinoma development and progression and may be a promising therapeutic target for lung adenocarcinoma.

  9. Myxoma virus is oncolytic for human pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Woo, Yanghee; Kelly, Kaitlyn J; Stanford, Marianne M; Galanis, Charles; Chun, Yun Shin; Fong, Yuman; McFadden, Grant

    2008-08-01

    Viral oncolytic therapy, which seeks to exploit the use of live viruses to treat cancer, has shown promise in the treatment of cancers resistant to conventional anticancer therapies. Among the most difficult to treat cancers is advanced pancreatic adenocarcinoma. Our study investigates the ability of a novel oncolytic agent, myxoma virus, to infect, productively replicate in, and kill human pancreatic cancer cells in vitro. The myxoma virus vMyxgfp was tested against a panel of human pancreatic adenocarcinoma cell lines. Infectivity, viral proliferation, and tumor cell kill were assessed. Infection of tumor cells was assessed by expression of the marker gene enhanced green fluorescent protein (e-GFP). vMyxgfp had the ability to infect all pancreatic cancer cell lines tested. Killing of tumor cells varied among the 6 cell lines tested, ranging from >90% cell kill at 7 days for the most sensitive Panc-1 cells, to 39% in the most resistant cell line Capan-2. Sensitivity correlated to replication of virus, and was found to maximally exhibit a four-log increase in foci-forming units for the most sensitive Panc-1 cells within 72 h. Our study demonstrates for the first time the ability of the myxoma virus to productively infect, replicate in, and lyse human pancreatic adenocarcinoma cells in vitro. These data encourage further investigation of this virus, which is pathogenic only in rabbits, for treatment of this nearly uniformly fatal cancer.

  10. Expression heterogeneity research of ITGB3 and BCL-2 in lung adenocarcinoma tissue and adenocarcinoma cell line.

    Science.gov (United States)

    Xia, Zong-Jiang; Hu, Wei; Wang, Yue-Bin; Zhou, Kun; Sun, Guo-Ju

    2014-06-01

    To analyze expression heterogeneity of Integrin beta 3 (ITGB3) and B-cell lymphoma 2 (BCL-2) in lung adenocarcinoma tissue and adenocarcinoma cell line and further provide theoretical direction for molecular biological research of lung adenocarcinoma. Tissue microarray was used to observe relation among expression, heterogeneitpy and clinical characteristics of ITGB3 and BCL-2 in lung cancer. ITGB3 and BCL-2 increased significantly in A549 cells in CAFs group withβ-actin as control; the expression level of BCL-2 also increased in ITGB3 transfected cells with GFP plasmid transfected A549 cells as control; immunohistochemistry staining showed that positive rates of ITGB3, ITGB1 and BCL-2 in normal lung tissues were 0, the positive rates in lung adenocarcinoma were 7.04%, 84.51% and 4.23%, respectively; in the results of immunohistochemistry staining, the expression of Girdin protein in lung adenocarcinoma was homogeneous, however protein expression of ITGB3, ITGB1 and BCL-2 showed different patterns in the same location with significant heterogeneity; majority of ITGB3, ITGB1 or BCL-2 positive tissue showed heterogeneity that expression in trailing edge was higher than that of trailing edge in lung adenocarcinoma tissue, the patients with BCL-2 heterogeneity showed higher lymph node metastasis ratio and lower clinical stage (P0.05). Expression of ITGB3 and BCL-2 in lung adenocarcinoma and adenocarcinoma cell line showed heterogeneity that expression in trailing edge was higher than that of trailing edge, which may play an important role in promoting tumor lymph node metastasis and vascular invasion, and provides a new research direction for exploration of lung adenocarcinoma metastasis mechanism. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  11. Characterization and properties of nine human ovarian adenocarcinoma cell lines.

    Science.gov (United States)

    Langdon, S P; Lawrie, S S; Hay, F G; Hawkes, M M; McDonald, A; Hayward, I P; Schol, D J; Hilgers, J; Leonard, R C; Smyth, J F

    1988-11-01

    Four series of cell lines have been derived from patients with ovarian adenocarcinoma. Nine cell lines have been established at one from a solid metastasis. Six lines were derived from the ascites or pleural effusion of patients with poorly differentiated adenocarcinoma: PEO1, PEO4, and PEO6 from one patient, PEA1 and PEA2 from a second, and PEO16 from a third. Three lines (PEO14 and PEO23 from ascites and TO14 from a solid metastasis) were derived from a patient with a well-differentiated serous adenocarcinoma. Each set of cell lines was morphologically distinct. The five cell lines PEO1, PEO4, PEO6, PEA1, and PEA2 had cloning efficiencies on plastic of 1-2% and only a few cells in these lines expressed alkaline phosphatase or vimentin. Only a low percentage of these cells reacted with the monoclonal antibodies 123C3 and 123A8 but most reacted with OC125. Conversely the cell lines PEO14, TO14, PEO23, and PEO16 were characterized by low cloning efficiency values (less than 0.05%), marked expression of alkaline phosphatase and vimentin, and good reaction with 123C3 and 123A8 but not OC125. These four cell lines also exhibited dome formation. Four of the cell lines, PEO1, PEO4, PEO6, and PEO16, have been xenografted into immune-deprived mice and found to be tumorigenic.

  12. Establishment and characterization of eight feline mammary adenocarcinoma cell lines.

    Science.gov (United States)

    Uyama, Rina; Hong, Sung-Hyeok; Nakagawa, Takayuki; Yazawa, Mitsuhiro; Kadosawa, Tsuyoshi; Mochizuki, Manabu; Tsujimoto, Hajime; Nishimura, Ryohei; Sasaki, Nobuo

    2005-12-01

    Eight new feline mammary adenocarcinoma cell lines derived from either primary or metastatic lesions were established. The morphology of all the cell lines was epithelioid and round to spindle in shape, with cell growth occurring in a monolayer fashion. On immunohistochemistry, these cells reacted with anti-keratin and anti-vimentin antisera. The doubling time of these cells was between 19 and 54 hr. Tumor masses were developed in nude mice by subcutaneous inoculation of the cells that were histologically identical to their original mammary tumor lesions. Telomerase activities measured using the telomeric repeat amplification protocol assay revealed high telemetric activity in all of the cells.

  13. A case with primary signet ring cell adenocarcinoma of the prostate and review of the literature

    Directory of Open Access Journals (Sweden)

    Orcun Celik

    2014-06-01

    Full Text Available Primary signet cell carcinoma of the prostate is a rare histological variant of prostate malignancies. It is commonly originated from the stomach, colon, pancreas, and less commonly in the bladder. Prognosis of the classical type is worse than the adenocarcinoma of the prostate. Primary signet cell adenocarcinoma is diagnosed by eliminating the adenocarcinomas of other organs such as gastrointestinal tract organs. In this case report, we present a case with primary signet cell adenocarcinoma of the prostate who received docetaxel chemotherapy because of short prostate specific antigen doubling time.

  14. A Study of Appendiceal Crypt Cell Adenocarcinoma (So-Called Goblet Cell Carcinoid and Its Related Adenocarcinoma).

    Science.gov (United States)

    Nonaka, Daisuke; Papaxoinis, George; Lamarca, Angela; Fulford, Paul; Valle, Juan; Chakrabarty, Bipasha

    2017-08-17

    Goblet cell carcinoids (GCCs) of the appendix are rare tumors, characterized by a carcinoid-like organoid growth pattern. Despite the term carcinoid, neuroendocrine features are inconspicuous, and its behavior is distinct from carcinoid. Its high grade counterpart is designated as adenocarcinoma ex GCC. We conducted a retrospective study of 105 tumors to find prognostic values of a variety of clinico-pathologic features. The tumors were subclassified as low grade, equivalent to classic type, and high grade, defined as loss of organoid pattern, and a proportion (%) of low and high grades were documented in each tumor. Correlations between survival and various clinico-pathologic parameters were investigated. One-third were pure low grade while the remainder contained variable high grade component ranging 5-95%. Neuroendocrine cell component ranged 0-90% (median 5) while mucus cell component ranged 5-100% (median 70). By univariate analysis, size, stage, high grade component, nuclear grade, surgery and chemotherapy correlated with cancer-related survival (CSS), and by multivariate analysis, stage (P=.001), high grade component (P=.008) and tumor size (P=.005) correlated with CSS. There was significant difference in CSS when the cases were grouped in high grade component <40%, 40-90 and ≤90% (P<.001). Our results indicate that staging and proportion of high grade histology may provide important prognostic information. Neuroendocrine component was insignificant in both low and high grade areas. In light of our findings, this tumor type is best regarded as a variant of adenocarcinoma, and the term crypt cell adenocarcinoma more appropriately reflects the nature and origin of this tumor group. Copyright © 2017. Published by Elsevier Inc.

  15. Immunohistochemical expression of MYB in salivary gland basal cell adenocarcinoma and basal cell adenoma.

    Science.gov (United States)

    Rooney, Sydney L; Robinson, Robert A

    2017-10-01

    Basal cell predominant salivary gland neoplasms can be difficult to separate histologically. One of the most aggressive of basaloid salivary gland neoplasms is adenoid cystic carcinoma. MYB expression by immunohistochemistry has been documented in adenoid cystic carcinoma. Some investigators have suggested that using this expression can help in establishing the diagnosis of adenoid cystic carcinoma. Utilizing tissue microarrays, we studied a group of basal cell adenocarcinomas and basal cell adenomas to determine: (i) whether either tumor expressed MYB and (ii) the frequency of any expression in either tumors. Seventeen salivary gland basal cell adenocarcinomas and 30 salivary gland basal cell adenomas were used to construct microarrays. These tissue microarrays were used to assess for immunohistochemical MYB expression. Fifty-three percent (nine of 17) of salivary gland basal cell adenocarcinomas and 57% (17 of 30) of salivary gland basal cell adenomas showed MYB overexpression. For comparison, we studied 11 adenoid cystic carcinomas for MYB expression and found that 64% (seven of 11) overexpressed MYB. We found no relation to clinical course for basal adenomas or basal cell adenocarcinomas that overexpressed MYB vs those that did not. MYB expression does not help separate basal cell adenocarcinomas from basal cell adenomas, and our data suggest it does not differentiate between either of these neoplasms and adenoid cystic carcinoma. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Clear Cell Adenocarcinoma of the Urethra: Review of the Literature

    Directory of Open Access Journals (Sweden)

    Anthony Kodzo-Grey Venyo

    2015-01-01

    Full Text Available Background. Clear cell adenocarcinoma of the urethra (CCAU is extremely rare and a number of clinicians may be unfamiliar with its diagnosis and biological behaviour. Aims. To review the literature on CCAU. Methods. Various internet databases were used. Results/Literature Review. (i CCAU occurs in adults and in women in the great majority of cases. (ii It has a particular association with urethral diverticulum, which has been present in 56% of the patients; is indistinguishable from clear cell adenocarcinoma of the female genital tract but is not associated with endometriosis; and probably does not arise by malignant transformation of nephrogenic adenoma. (iii It is usually, readily distinguished from nephrogenic adenoma because of greater cytological a-typicality and mitotic activity and does not stain for prostate-specific antigen or prostatic acid phosphatase. (iv It has been treated by anterior exenteration in women and cystoprostatectomy in men and at times by radiotherapy; chemotherapy has rarely been given. (v CCAU is aggressive with low 5-year survival rates. (vi There is no consensus opinion of treatment options that would improve the prognosis. Conclusions. Few cases of CCAU have been reported. Urologists, gynaecologists, pathologists, and oncologists should report cases of CCAU they encounter and enter them into a multicentric trial to determine the best treatment options that would improve the prognosis.

  17. [Isolation and identification of side population cells in human lung adenocarcinoma cell line A549].

    Science.gov (United States)

    Xie, Tong; Li, Li; Li, Dan-rong; Mao, Nai-quan; Liu, De-seng; Zuo, Chuan-tian; Zhang, Wei; Huang, Ding-ming

    2011-02-01

    To isolate and characterize the side population cells (SP cells) in the lung adenocarcinomas cell line A549. The protein expression of ABCG2 in human lung adenocarcinoma cell line A549 was detected by immunohistochemistry. SP and NSP cells in the cell line A549 were isolated by FACS, and their differentiation was analysed. ABCG2 expression in the two cell subsets was detected by RT-PCR. The cell growth curves, cell division indexes, cell cycles, plate clone formation tests, migration and invasion assays, chemotherapeutic susceptibility tests, tests of the intracellular drug levels, and the tumor cell implantation experiments on nude mice were applied to study the biological properties of the two cell subsets. The expression of ABCG2 in the transplanted tumor in nude mice was detected by immunohistochemistry and RT-PCR. The positive rate of ABCG2 expression in the A549 cells by immunohistochemistry was 2.13%. SP and NSP cells were isolated by FACS. The SP cells could produce both SP and NSP cells, while NSP cells only produced NSP cells. SP cells expressed ABCG2, but NSP cells did not. The proliferation and migration abilities of the two cell subsets were similar, but the invasion and tumorigenic ability of SP cells was significantly higher than that of NSP cells. The susceptibilities to DDP and its intracellular levels of the two cell subsets were similar, but the susceptibilities to 5-FU, VP16, NVB and GEM and their intracellular levels of NSP cells were significantly higher than those of the SP cells. SP cells in the human lung adenocarcinomas cell line A549 is enriched with tumor stem cells. An effective way to get lung adenocarcinomas stem cells is to isolate SP cells by FACS.

  18. Early human prostate adenocarcinomas harbor androgen-independent cancer cells.

    Directory of Open Access Journals (Sweden)

    Rita R Fiñones

    Full Text Available Although blockade of androgen receptor (AR signaling represents the main treatment for advanced prostate cancer (PrCa, many patients progress to a lethal phenotype of "Castration-Resistant" prostate cancer (CR-PrCa. With the hypothesis that early PrCa may harbor a population of androgen-unresponsive cancer cells as precursors to CR-recurrent disease, we undertook the propagation of androgen-independent cells from PrCa-prostatectomy samples of early, localized (Stage-I cases. A collection of 120 surgical specimens from prostatectomy cases was established, among which 54 were adenocarcinomas. Hormone-free cell culture conditions were developed allowing routine propagation of cells expressing prostate basal cell markers and stem/progenitor cell markers, and which proliferated as spheres/spheroids in suspension cultures. Colonies of androgen-independent epithelial cells grew out from 30/43 (70% of the adenocarcinoma cases studied in detail. Fluorescence microscopy and flow cytometry showed that CR-PrCa cells were positive for CD44, CD133, CK5/14, c-kit, integrin α2β1, SSEA4, E-Cadherin and Aldehyde Dehydrogenase (ALDH. All 30 CR-PrCa cell cultures were also TERT-positive, but negative for TMPRSS2-ERG. Additionally, a subset of 22 of these CR-PrCa cell cultures was examined by orthotopic xenografting in intact and castrated SCID mice, generating histologically typical locally-invasive human PrCa or undifferentiated cancers, respectively, in 6-8 weeks. Cultured PrCa cells and orthotopically-induced in vivo cancers lacked PSA expression. We report here the propagation of Cancer Initiating Cells (CIC directly from Stage I human PrCa tissue without selection or genetic manipulation. The propagation of stem/progenitor-like CR-PrCa cells derived from early human prostate carcinomas suggests the existence of a subpopulation of cells resistant to androgen-deprivation therapy and which may drive the subsequent emergence of disseminated CR-PrCa.

  19. File list: DNS.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  20. File list: Unc.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  1. File list: ALL.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143598,SRX1143596,SRX1143599,SRX1143597 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  2. File list: His.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  3. File list: Unc.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  4. File list: Unc.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  5. File list: InP.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  6. File list: Pol.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  7. File list: ALL.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  8. File list: His.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143597,SRX1143599,SRX1143598,SRX1143596 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  9. File list: InP.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  10. File list: ALL.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  11. File list: His.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  12. File list: ALL.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143597,SRX1143599,SRX1143598,SRX1143596 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  13. File list: Pol.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  14. File list: NoD.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 No description Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  15. File list: Unc.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  16. File list: Oth.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  17. File list: Oth.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  18. File list: Pol.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  19. File list: Pol.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  20. File list: Oth.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  1. File list: NoD.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 No description Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  2. File list: DNS.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  3. File list: NoD.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 No description Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  4. File list: Oth.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  5. File list: His.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143598,SRX1143596,SRX1143599,SRX1143597 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  6. File list: InP.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  7. File list: DNS.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  8. File list: DNS.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  9. File list: InP.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  10. NFAT5 promotes proliferation and migration of lung adenocarcinoma cells in part through regulating AQP5 expression

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Kai, E-mail: gk161@163.com [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China); Department of Respiration, 161th Hospital, PLA, Wuhan 430015 (China); Jin, Faguang, E-mail: jinfag@fmmu.edu.cn [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China)

    2015-09-25

    The osmoregulated transcription factor nuclear factor of activated T-cells 5(NFAT5), has been found to play important roles in the development of many kinds of human cancers, including breast cancer, colon carcinoma, renal cell carcinoma and melanoma. The aim of the present study was to determine whether NFAT5 is involved in the proliferation and migration of lung adenocarcinoma cells. We found that NFAT5 was upregulated in lung adenocarcinoma cells and knockdown of NFAT5 decreased proliferation and migration of the cells, accompanied by a significant reduction in the expression of AQP5. AQP5 was upregulated in lung adenocarcinoma cells and knockdown of AQP5 also inhibited proliferation and migration of the cells as knockdown of NFAT5 did. Moreover, overexpression of NFAT5 promoted proliferation and migration of lung adenocarcinoma cells, accompanied by a significant increase in the expression of AQP5. These results indicate that NFAT5 plays important roles in proliferation and migration of human lung adenocarcinoma cells through regulating AQP5 expression, providing a new therapeutic option for lung adenocarcinoma therapy. - Highlights: • NFAT5 expression is higher in lung adenocarcinoma cells compared with normal cells. • NFAT5 knockdown decreases proliferation and migration of lung adenocarcinoma cells. • Knockdown of NFAT5 reduces AQP5 expression in human lung adenocarcinoma cells. • Overexpression of NFAT5 promotes proliferation and migration of lung adenocarcinoma cells. • Overexpression of NFAT5 increases AQP5 expression in human lung adenocarcinoma cells.

  11. Clear Cell Adenocarcinoma Arising from Abdominal Wall Endometriosis

    Directory of Open Access Journals (Sweden)

    Thouraya Achach

    2008-01-01

    Full Text Available Endometriosis is a frequent benign disorder. Malignancy arising in extraovarian endometriosis is a rare event. A 49-year-old woman is presented with a large painful abdominal wall mass. She underwent a myomectomy, 20 years before, for uterus leiomyoma. Computed tomography suggested that this was a desmoid tumor and she underwent surgery. Histological examination showed a clear cell adenocarcinoma associated with endometriosis foci. Pelvic ultrasound, computed tomography, and endometrial curettage did not show any malignancy or endometriosis in the uterus and ovaries. Adjuvant chemotherapy was recommended, but the patient was lost to follow up. Six months later, she returned with a recurrence of the abdominal wall mass. She was given chemotherapy and then she was reoperated.

  12. [Establishment and Characterization of a Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang2 in Immunodeficient Mice.].

    Science.gov (United States)

    Yang, Shunfang; Su, Jianzhong; Shi, Meiping; Zhao, Lanxiang; Zhang, Peiling; Cao, Jie; Lu, Jianying; Xie, Wenhui

    2009-10-20

    The recurrence, metastasis and multidrug resistance (MDR) in lung cancer are the tough problems worldwide. This study was to establish a novel chinese lung adenocarcinoma cell line with high metastasis potential for exploring the mechanism of reccurrence, development and MDR in lung cancer. The cell came from the abdominal dropsy of a fifty-six years old female patient with lung adenocarcinoma and the tumor markers CA125, CYFRA21-1, CEA, NSE were detected to be higher secretion by radioimmunoassay in the abdominal dropsy. Tumorigenicity of immunodeficient mice was confirmed in 8th passage. The cell growth curve was mapped. Analysis of chromosome karyotype was tested. The gene expression was measured by real-time quantitative PCR. The tumorigenesis rate started at 8th passage in 3/10 immunodeficient mice via subcutaneously and the fully tumorigenicity was at 11th passage as well as later passages. Under the microscope, the cell showed oval-shap and adherence. The chromosome karyotype analysis of the cells was sub-triploid. Approximately 1*10(6) and 1.5*10(6) cancerous cells were injected into left cardiac ventricle and tail vein of immunodeficient mice respectively. The results showed multiorgan metastasis in the mice after three-four weeks, including mandible, scapula, humerus, vertebral column, femur, rib and brain, liver, adrenal gland, pulmonary in the mice after inoculation. The bone metastasis rate was 100% in the tumor bearing mice by bone scintigraphy and pathology. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR genes were overexpressed. The novel cell was named CPA-Yang2 The characteristics of novel strain CPA-Yang2 is a highly metastasis cell line of Chinese lung adenocarcinoma. It has stable traits, highly metastasis ability and maybe is a MDR lung cancerous cell line. Of course, it's a good experimental model for lung cancer research.

  13. Effects of adrenaline in human colon adenocarcinoma HT-29 cells.

    Science.gov (United States)

    Wong, Helen P S; Ho, Judy W C; Koo, Marcel W L; Yu, Le; Wu, William K K; Lam, Emily K Y; Tai, Emily K K; Ko, Joshua K S; Shin, Vivian Y; Chu, Kent Man; Cho, Chi Hin

    2011-06-20

    Stress has been implicated in the development of cancers. Adrenaline levels are increased in response to stress. The effects of adrenaline on colon cancer are largely unknown. The aims of the study are to determine the effects of adrenaline in human colon adenocarcinoma HT-29 cells and the possible underlying mechanisms involved. The effect of adrenaline on HT-29 cell proliferation was determined by [(3)H] thymidine incorporation assay. Expression of cyclooxygenase-2 (COX-2) and vascular endothelial growth factor (VEGF) were detected by Western blot. Matrix metalloproteinase-9 (MMP-9) activity and prostaglandin E(2) (PGE(2)) release were determined by zymography and enzyme immunoassay, respectively. Adrenaline stimulated HT-29 cell proliferation. This was accompanied by the enhanced expression of COX-2 and VEGF in HT-29 cells. Adrenaline also upregulated MMP-9 activity and PGE(2) release. Adrenaline stimulated HT-29 cell proliferation which was reversed by COX-2 inhibitor sc-236. COX-2 inhibitor also reverted the action of adrenaline on VEGF expression and MMP-9 activity. Further study was performed to determine the involvement of β-adrenoceptors. The stimulatory action of adrenaline on colon cancer growth was blocked by atenolol and ICI 118,551, a β(1)- and β(2)-selective antagonist, respectively. This signified the role of β-adrenoceptors in this process. In addition, both antagonists also abrogated the stimulating actions of adrenaline on COX-2, VEGF expression, MMP-9 activity and PGE(2) release in HT-29 cells. These results suggest that adrenaline stimulates cell proliferation of HT-29 cells via both β(1)- and β(2)-adrenoceptors by a COX-2 dependent pathway. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. The HSP90 Inhibitor Ganetespib Radiosensitizes Human Lung Adenocarcinoma Cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Casal, Roberto; Bhattacharya, Chitralekha [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Medicine, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Epperly, Michael W. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Radiation Oncology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Basse, Per H. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Immunology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Wang, Hong [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Biostatistics, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Wang, Xinhui [Harvard Medical School, Harvard University, 25 Shattuck Street, Boston, MA 02115 (United States); Proia, David A. [Synta Pharmaceuticals Corp., 45 Hartwell Avenue, Lexington, MA 02421 (United States); Greenberger, Joel S. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Radiation Oncology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Socinski, Mark A.; Levina, Vera, E-mail: levinav@upmc.edu [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Medicine, The University of Pittsburgh, Pittsburgh, PA 15213 (United States)

    2015-05-22

    The molecular chaperone HSP90 is involved in stabilization and function of multiple client proteins, many of which represent important oncogenic drivers in NSCLC. Utilization of HSP90 inhibitors as radiosensitizing agents is a promising approach. The antitumor activity of ganetespib, HSP90 inhibitor, was evaluated in human lung adenocarcinoma (AC) cells for its ability to potentiate the effects of IR treatment in both in vitro and in vivo. The cytotoxic effects of ganetespib included; G2/M cell cycle arrest, inhibition of DNA repair, apoptosis induction, and promotion of senescence. All of these antitumor effects were both concentration- and time-dependent. Both pretreatment and post-radiation treatment with ganetespib at low nanomolar concentrations induced radiosensitization in lung AC cells in vitro. Ganetespib may impart radiosensitization through multiple mechanisms: such as down regulation of the PI3K/Akt pathway; diminished DNA repair capacity and promotion of cellular senescence. In vivo, ganetespib reduced growth of T2821 tumor xenografts in mice and sensitized tumors to IR. Tumor irradiation led to dramatic upregulation of β-catenin expression in tumor tissues, an effect that was mitigated in T2821 xenografts when ganetespib was combined with IR treatments. These data highlight the promise of combining ganetespib with IR therapies in the treatment of AC lung tumors.

  15. Influence of mast cells on two murine mammary adenocarcinomas.

    Science.gov (United States)

    de Cidre, L L; Eijan, A M; Bertolesi, G; Isturiz, M; Sacerdote de Lustig, E

    1996-01-01

    A high content of mast cells (MC) is considered characteristic of neoplasias. Some researchers postulate MC as enhancers of tumor development, others as inhibitors. The purpose of this study was to evaluate the ability of peritoneal cavity MC to modulate the in vivo and in vitro growth of two murine mammary adenocarcinomas with low (M3) and high (MM3) metastatic capacity. MC from the peritoneal cavity of normal (NMC) or tumor-bearing mice (TMC) were used. TMC, which by histochemical methods appeared degranulated, were not able to modify the tumorigenicity of both tumors. NMC, in contrast, decreased M3 tumor incidence and cell proliferation in vitro and increased the latency period of only MM3 tumors. No changes in the number of spontaneous lung metastases could be seen in experiments carried out either with NMC or TMC. We conclude that NMC, which are rich in chemical mediators, can modulate some of the first steps of tumor development. Once tumor-mediated degranulation occurs, MC become unable to regulate it.

  16. Effects of the Spider Venom on proliferation of Human Lung Adenocarcinoma Cell A549

    Directory of Open Access Journals (Sweden)

    Zengxiang HU

    2010-10-01

    Full Text Available Background and objective The spider venom may inspire new drugs to treat cancer. The aim of this study is to investigate the effects and mechanisms of spider venom on lung adenocarcinoma cell A549. Methods The proliferation of lung adenocarcinoma A549 cells was detected by MTT. The apoptosis rate was observed with MTT assay and flow cytometer. The activity of catalase was detected by colorimetry. The malondialdehyde (MDA content was determined by improved thiobarbituric acid fluorometric method. The expression of P38MAPK protein was analyzed with Western blot. Results Spider venom can remarkably inhibite the proliferation of lung adenocarcinoma A549 cells, increased activity of catalase and MDA content, down-regulated expression of P38MAPK compared with the control group. Conclusion The reduced proliferation of lung adenocarcinoma A549 cells by spider venom is may be associated with the increased of activity of catalase and MDA content and decreased expression of P38MAPK.

  17. The Progression of Nephrogenic Metaplasia of the Urinary Bladder to Clear Cell Adenocarcinoma: A Case Report

    OpenAIRE

    Dhaliwal, Catharine A.; Fineron, Paul W.

    2012-01-01

    Nephrogenic metaplasia (or nephrogenic adenoma) and clear cell adenocarcinoma of the bladder are uncommon lesions that cause diagnostic dilemmas for pathologists due to their similar morphologic features. Nephrogenic metaplasia describes a lesion in the lower urinary tract that is composed of small tubules resembling renal medullary tubules. It has been suggested that nephrogenic metaplasia may progress to clear cell adenocarcinoma but this possibility is not widely accepted. We present a cas...

  18. Effects of the Spider Venom on proliferation of Human Lung Adenocarcinoma Cell A549

    OpenAIRE

    Zengxiang HU; Du, Yulei; Quanxi LIU; Wang, Yuan

    2010-01-01

    Background and objective The spider venom may inspire new drugs to treat cancer. The aim of this study is to investigate the effects and mechanisms of spider venom on lung adenocarcinoma cell A549. Methods The proliferation of lung adenocarcinoma A549 cells was detected by MTT. The apoptosis rate was observed with MTT assay and flow cytometer. The activity of catalase was detected by colorimetry. The malondialdehyde (MDA) content was determined by improved thiobarbituric acid fluorometric met...

  19. Cytomorphological features of ALK-positive lung adenocarcinomas: psammoma bodies and signet ring cells.

    Science.gov (United States)

    Pareja, Fresia; Crapanzano, John P; Mansukhani, Mahesh M; Bulman, William A; Saqi, Anjali

    2015-03-01

    Correlation between histology and genotype has been described in lung adenocarcinomas. For example, studies have demonstrated that adenocarcinomas with an anaplastic lymphoma kinase (ALK) gene rearrangement may have mucinous features. The objective of the current study was to determine whether a similar association can be identified in cytological specimens. A retrospective search for ALK-rearranged cytopathology (CP) and surgical pathology (SP) lung carcinomas was conducted. Additional ALK-negative (-) lung adenocarcinomas served as controls. For CP and SP cases, the clinical data (i.e., age, sex, and smoking history), architecture, nuclear features, presence of mucin-containing cells (including signet ring cells), and any additional salient characteristics were evaluated. The search yielded 20 ALK-positive (+) adenocarcinomas. Compared with patients with ALK(-) lung adenocarcinomas (33 patients; 12 with epidermal growth factor receptor [EGFR]-mutation, 11 with Kristen rat sarcoma [KRAS]-mutation, and 10 wild-type adenocarcinomas), patients with ALK(+) adenocarcinoma presented at a younger age; and there was no correlation noted with sex or smoking status. The most common histological pattern in SP was papillary/micropapillary. Mucinous features were associated with ALK rearrangement in SP specimens. Signet ring cells and psammoma bodies were evident in and significantly associated with ALK(+) SP and CP specimens. However, psammoma bodies were observed in rare adenocarcinomas with an EGFR mutation. Both the ALK(+) and ALK(-) groups had mostly high nuclear grade. Salient features, including signet ring cells and psammoma bodies, were found to be significantly associated with ALK(+) lung adenocarcinomas and are identifiable on CP specimens. Recognizing these may be especially helpful in the molecular triage of scant CP samples. © 2014 American Cancer Society.

  20. Circulating Tumor Cells in the Adenocarcinoma of the Esophagus

    Directory of Open Access Journals (Sweden)

    Giulia Gallerani

    2016-08-01

    Full Text Available Circulating tumor cells (CTCs are elements of indisputable significance as they seem to be responsible for the onset of metastasis. Despite this, research into CTCs and their clinical application have been hindered by their rarity and heterogeneity at the molecular and cellular level, and also by a lack of technical standardization. Esophageal adenocarcinoma (EAC is a highly aggressive cancer that is often diagnosed at an advanced stage. Its incidence has increased so much in recent years that new diagnostic, prognostic and predictive biomarkers are urgently needed. Preliminary findings suggest that CTCs could represent an effective, non-invasive, real-time assessable biomarker in all stages of EAC. This review provides an overview of EAC and CTC characteristics and reports the main research results obtained on CTCs in this setting. The need to carry out further basic and translational research in this area to confirm the clinical usefulness of CTCs and to provide oncologists with a tool to improve therapeutic strategies for EAC patients was herein highlighted.

  1. Clear cell adenocarcinoma of the ulterine cervix in a 15 year old girl: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seung Joon; Kim, Jee Eun; KIm, Hyung Sik; Choi, Hye Young [Dept. of Radiology, Gachon University Gil Hospital, Incheon (Korea, Republic of)

    2013-10-15

    Cervical cancer is rare in the pediatric population. In cases of cervical cancer, adenocarcinoma is predominantly reported. Clear cell adenocarcinoma (CCAC) of the uterine cervix is a very rare tumor and accounts for only 4% of all adenocarcinomas of the uterine cervix. Risk factors and pathogenesis of this disease are not exactly revealed. The intrauterine exposure to diethylstilbestrol (DES) and associated non-steroidal estrogen during pregnancy before 18 weeks is the only known risk factor. This study reports the imaging finding of primary uterine cervical tumor in a 15-year-old girl, who was finally diagnosed with CCAC, with no maternal history of DES exposure in utero.

  2. Primary mucinous adenocarcinoma of the bladder with signet-ring cells: case report

    Directory of Open Access Journals (Sweden)

    Marcelo Lorenzi Marques

    Full Text Available CONTEXT: Primary adenocarcinomas of the bladder are uncommon and usually occur by contiguity with or hematogenic dissemination of other adenocarcinomas such as colorectal, prostate and gynecological tract carcinomas. Mucinous and signet-ring cell histological patterns are even rarer and it is often difficult to morphologically distinguish them from metastatic colorectal adenocarcinoma. CASE REPORT: We present and discuss a rare case of primary mucinous adenocarcinoma of the bladder with signet-ring cells in a 57-year-old male patient. Other primary sites for the tumor had been excluded and, in the absence of digestive tract tumor and for confirmation that it was a primary bladder tumor, an immunohistochemistry study was performed.

  3. Combined choriocarcinoma, neuroendocrine cell carcinoma and tubular adenocarcinoma in the stomach

    Science.gov (United States)

    Hirano, Yasumitsu; Hara, Takuo; Nozawa, Hiroshi; Oyama, Kaeko; Ohta, Naohiro; Omura, Kenji; Watanabe, Go; Niwa, Hideki

    2008-01-01

    We described a patient with adenocarcinoma of the stomach combined with choriocarcinoma and neuroendocrine cell carcinoma. An 85-year-old man visited our hospital because of appetite loss. Gastric fiberscopy revealed a large tumor occupying the cardial region and anterior wall of the gastric body. The patient underwent total gastrectomy with lymphnode dissection and partial resection of the liver. Choriocarcinoma, small cell carcinoma and tubular adenocarcinoma existed in the gastric tumor. The choriocarcinomatous foci contained cells positive for beta-subunit of human chorionic gonadotropin (B-hCG) and human placental lactogen mainly in syncytiotrophoblastic cells. The small cell carcinomatous foci contained cells positive for synaptophysin, neuron-specific enolase (NSE), and chromogranin A. The prognosis for gastric adenocarcinoma with choriocarcinoma and neuroendocrine cell carcinoma is exceedingly poor. This patient died about 2 mo after the first complaint from hepatic failure. This is the first reported case of gastric cancer with these three pathological features. PMID:18506939

  4. Gene Methylation Profiling in Sinonasal Adenocarcinoma and Squamous Cell Carcinoma.

    Science.gov (United States)

    Costales, Maria; López-Hernández, Alejandro; García-Inclán, Cristina; Vivanco, Blanca; López, Fernando; Llorente, José Luis; Hermsen, Mario A

    2016-11-01

    To identify epigenetic events in intestinal-type sinonasal adenocarcinoma (ITAC) and sinonasal squamous cell carcinoma (SNSCC) and to evaluate their relation to clinicopathologic features and follow-up data. Retrospective study. Academic research hospital. The methylation status of 23 genes in 50 ITACs and 32 SNSCCs was analyzed by methylation-specific multiplex ligation-dependent probe amplification and its relation to clinicopathologic features and follow-up data. Gene methylation was observed in 50% of all tumors. Recurrent methylated genes in SNSCC were RASSF1 and CDH13 (for both, 6 of 32 cases), CHFR (4 of 32 cases), and TIMP3 (2 of 32 cases). None of these genes showed significant correlation to clinicopathologic features or overall survival. In ITAC, recurrent methylated genes were CDH13 (18 of 50 cases), ESR1 (13 of 50 cases), APC (7 of 50 cases), TIMP3 (5 of 50 cases), CASP8 (3 of 50 cases), and HIC1 and RASSF1 (for both, 2 of 50 cases). Papillary and colonic ITAC subtypes carried a mean of 1.26 gene methylations per tumor versus 0.63 in solid and mucinous subtypes. Methylation of TIMP3 was associated with a significantly worse survival in ITAC patients. ITAC carries a higher number and a different profile of gene methylations as compared with SNSCC. Gene methylation plays a greater role in papillary and colonic ITAC subtypes, which may indicate a different tumorigenic pathway for these ITAC subtypes. These findings could be used as prognosticators and may have implications for future individualized therapies based on epigenetic changes. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2016.

  5. Dynamics of regulatory networks in gastrin-treated adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Naresh Doni Jayavelu

    Full Text Available Understanding gene transcription regulatory networks is critical to deciphering the molecular mechanisms of different cellular states. Most studies focus on static transcriptional networks. In the current study, we used the gastrin-regulated system as a model to understand the dynamics of transcriptional networks composed of transcription factors (TFs and target genes (TGs. The hormone gastrin activates and stimulates signaling pathways leading to various cellular states through transcriptional programs. Dysregulation of gastrin can result in cancerous tumors, for example. However, the regulatory networks involving gastrin are highly complex, and the roles of most of the components of these networks are unknown. We used time series microarray data of AR42J adenocarcinoma cells treated with gastrin combined with static TF-TG relationships integrated from different sources, and we reconstructed the dynamic activities of TFs using network component analysis (NCA. Based on the peak expression of TGs and activity of TFs, we created active sub-networks at four time ranges after gastrin treatment, namely immediate-early (IE, mid-early (ME, mid-late (ML and very late (VL. Network analysis revealed that the active sub-networks were topologically different at the early and late time ranges. Gene ontology analysis unveiled that each active sub-network was highly enriched in a particular biological process. Interestingly, network motif patterns were also distinct between the sub-networks. This analysis can be applied to other time series microarray datasets, focusing on smaller sub-networks that are activated in a cascade, allowing better overview of the mechanisms involved at each time range.

  6. Dynamics of regulatory networks in gastrin-treated adenocarcinoma cells.

    Science.gov (United States)

    Doni Jayavelu, Naresh; Bar, Nadav

    2014-01-01

    Understanding gene transcription regulatory networks is critical to deciphering the molecular mechanisms of different cellular states. Most studies focus on static transcriptional networks. In the current study, we used the gastrin-regulated system as a model to understand the dynamics of transcriptional networks composed of transcription factors (TFs) and target genes (TGs). The hormone gastrin activates and stimulates signaling pathways leading to various cellular states through transcriptional programs. Dysregulation of gastrin can result in cancerous tumors, for example. However, the regulatory networks involving gastrin are highly complex, and the roles of most of the components of these networks are unknown. We used time series microarray data of AR42J adenocarcinoma cells treated with gastrin combined with static TF-TG relationships integrated from different sources, and we reconstructed the dynamic activities of TFs using network component analysis (NCA). Based on the peak expression of TGs and activity of TFs, we created active sub-networks at four time ranges after gastrin treatment, namely immediate-early (IE), mid-early (ME), mid-late (ML) and very late (VL). Network analysis revealed that the active sub-networks were topologically different at the early and late time ranges. Gene ontology analysis unveiled that each active sub-network was highly enriched in a particular biological process. Interestingly, network motif patterns were also distinct between the sub-networks. This analysis can be applied to other time series microarray datasets, focusing on smaller sub-networks that are activated in a cascade, allowing better overview of the mechanisms involved at each time range.

  7. Growth Hormone differentially modulates chemoresistance in human endometrial adenocarcinoma cell lines.

    Science.gov (United States)

    Gentilin, Erica; Minoia, Mariella; Bondanelli, Marta; Tagliati, Federico; Degli Uberti, Ettore C; Zatelli, Maria Chiara

    2017-06-01

    Growth Hormone may influence neoplastic development of endometrial epithelium towards endometrial adenocarcinoma, which is one of the most occurring tumors in acromegalic patients. Since chemoresistance often develops in advanced endometrial adenocarcinoma, we investigated whether Growth Hormone might influence the development of chemoresistance to drugs routinely employed in endometrial adenocarcinoma treatment, such as Doxorubicin, Cisplatin, and Paclitaxel. Growth Hormone and Growth Hormone receptor expression was assessed by immunofluorescence in two endometrial adenocarcinoma cell lines, AN3 CA and HEC-1-A cells. Growth Hormone effects were assessed investigating cell viability, caspase3/7 activation, ERK1/2, and protein kinase C delta protein expression. AN3 CA and HEC-1-A cells display Growth Hormone and Growth Hormone receptor. Growth Hormone does not influence cell viability in both cells lines, but significantly reduces caspase 3/7 activation in AN3 CA cells, an effect blocked by a Growth Hormone receptor antagonist. Growth Hormone rescues AN3 CA cells from the inhibitory effects of Doxorubicin and Cisplatin on cell viability, while it has no effect on Paclitaxel. Growth Hormone does not influence the pro-apoptotic effects of Doxorubicin, but is capable of rescuing AN3 CA cells from the pro-apoptotic effects of Cisplatin. On the other hand, Growth Hormone did not influence the effects of Doxorubicin and Paclitaxel on HEC-1A cell viability. The protective action of Growth Hormone towards the effects of Doxorubicin may be mediated by ERK1/2 activation, while the pro-apoptotic effects of Cisplatin may be mediated by protein kinase C delta inhibition. All together our results indicate that Growth Hormone may differentially contribute to endometrial adenocarcinoma chemoresistance. This may provide new insights on novel therapies against endometrial adenocarcinoma chemoresistant aggressive tumors.

  8. Clear Cell Adenocarcinoma of the Renal Pelvis in a Male Patient

    Directory of Open Access Journals (Sweden)

    Sarawut Kongkarnka

    2013-01-01

    Full Text Available Carcinoma of the renal pelvis is an uncommon renal neoplasm. Clear cell adenocarcinoma in the urinary tract is rare and has a histomorphology resembling that of the female genital tract. We herein present a case of clear cell adenocarcinoma of the renal pelvis, which is the first example in a male patient to our knowledge. A 54-year-old man presented with right flank pain. The tumor was associated with renal stones and hydronephrosis and invaded into the peripelvic fat tissue with regional lymph node metastasis. The patient died of metastatic disease six months postoperatively. Histologically, the tumor showed complex papillary architecture lined with clear and hobnail cells. Clear cell adenocarcinoma of the renal pelvis may pose a diagnostic challenge on histological grounds, particularly in the distinction from renal cell carcinoma. The immunohistochemical stains could help confirm the diagnosis. Due to its rarity, an effective treatment regimen remains to be determined.

  9. Impact of laparoscopy on the biological behavior and gene expression of endometrial adenocarcinoma cells.

    Science.gov (United States)

    Huang, Shouguo; Qin, Jie; Chen, Jin; Cheng, Hong; Meng, Qiu; Zhang, Jing; Wang, Haiyan

    2017-11-01

    The current study investigated the effect of laparoscopy on the biological behavior and gene expression of endometrial adenocarcinoma cells. Totally, 40 patients with stage I endometrial adenocarcinoma and 20 patients with benign uterine diseases were enrolled in this study. For patients with endometrial adenocarcinoma, laparoscopy was performed in 20 cases and laparotomy was carried out in the other 20 cases. Total laparoscopic hysterectomy was performed in patients with benign diseases. Cell apoptotic rate and the gene expression of N-myc, Fas, metastasis-associated protein 1 (MTA1), and nm23-H1 were determined in the normal and cancerous endometrial tissues both preoperatively and postoperatively. For endometrial adenocarcinoma cells, laparoscopy, instead of laparotomy, promoted the apoptosis of endometrial adenocarcinoma cells, down-regulated the expression of apoptosis suppressor gene N-myc and metastasis-promoting gene MTA1, up-regulated the expression of apoptosis-promoting gene Fas and metastasis suppressor gene nm23-H1. However, laparoscopy did not affect the apoptotic rate and gene expression in normal endometrial cells. Laparoscopy may be used as a safe and effective intervention for endometrial cancer.

  10. The significance of programmed cell death ligand 1 expression in resected lung adenocarcinoma.

    Science.gov (United States)

    Wu, Shafei; Shi, Xiaohua; Sun, Jian; Liu, Yuanyuan; Luo, Yufeng; Liang, Zhiyong; Wang, Jinghui; Zeng, Xuan

    2017-03-07

    Lung adenocarcinoma (AD) is a common variant of non-small cell lung cancer (NSCLC). Programmed cell death protein 1/programmed cell death ligand 1 (PD1/PD-L1) are promising immunotherapy targets and its expression may be an important biomarker of predicting clinical response. In this study, we evaluated PD-L1 expression in conjunction with clinicopathological characteristics and outcomes in resected lung adenocarcinoma. This study included 133 cases of lung adenocarcinoma. PD-L1 expression rate in lung adenocarcinoma was 16.5% at the mRNA level and 13.5% at the protein level, and the kappa coefficient of the two examination methods was 0.824 (P = 0.219, highly correlated). PD-L1 was highly expressed in male patients and smokers with lung adenocarcinoma (P = 0.019 and 0.002, respectively), while no associations were identified between PD-L1 expression and age, tumor size, clinical stage, positive pleural invasion, lymph node metastasis, or therapy methods. Overexpression of PD-L1 was a significant indicator of shorter recurrence free survival time and overall survival (P = 0.000 and 0.000, respectively). Multivariate analysis revealed that PD-L1 expression was an independent risk factor for poor recurrence free survival and overall survival (P = 0.009 and 0.016, respectively). Expression of PD-L1 was examined with immunohistochemistry, using the VENTANA PD-L1 (SP263) rabbit monoclonal antibody. mRNA levels of PD-L1 were evaluated using in situ hybridization. PD-L1 overexpression is more frequently observed in male patients and smokers in lung adenocarcinoma. PD-L1 expression is an indicator of worse prognosis in surgically resected lung adenocarcinoma patients.

  11. Nuclear expression of claudin-3 in human colorectal adenocarcinoma cell lines and tissues.

    Science.gov (United States)

    Tokuhara, Yasunori; Morinishi, Tatsuya; Matsunaga, Toru; Sakai, Manabu; Sakai, Takayoshi; Ohsaki, Hiroyuki; Kadota, Kyuichi; Kushida, Yoshio; Haba, Reiji; Hirakawa, Eiichiro

    2018-01-01

    Claudins are members of a large family of transmembrane proteins, which are essential for the formation of tight junctions and have a significant effect on the biological behavior of tumor progression. Previous studies have demonstrated that several claudins show aberrant expression patterns in numerous types of cancer. The present study investigated the expression and localization of claudin-3 and claudin-7 in human colorectal adenocarcinoma cell lines and tissues. The protein expression levels of claudin-3 and claudin-7 were determined using immunocytochemical and immunohistochemical staining. Claudin-3, but not claudin-7, exhibited nuclear localization in the human colorectal adenocarcinoma Caco-2 and SW620 cell lines. Surgically resected colorectal adenocarcinoma tissue specimens were obtained, and the associations between the expression of claudin-3 or claudin-7 and various clinicopathological parameters were analyzed. The membranous expression rates of claudin-3 and claudin-7 were 58.0 and 50.0%, while their nuclear expression rates were 22.0 and 2.0%, respectively. The membranous expression of claudin-3 and claudin-7 was not associated with any clinicopathological factors, whereas the nuclear expression of claudin-3 was associated with histological type and was significantly increased in colorectal mucinous adenocarcinomas compared with that in well- to moderately-differentiated colorectal adenocarcinomas (P<0.01). However, no associations were observed between the nuclear expression of claudin-7 and any clinicopathological parameter. In conclusion, the nuclear expression of claudin-3 in colorectal mucinous adenocarcinoma may be involved in the biological transformation of tumors. The results from the present study indicated that claudin-3 is an important protein associated with histological type and has potential as a prognostic marker. Although the mechanisms underlying the nuclear localization of claudin-3 in tumorigenesis have not yet been elucidated in

  12. Establishment and Characterization of a Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang2 in Immunodeficient Mice

    Directory of Open Access Journals (Sweden)

    Shunfang YANG

    2009-10-01

    Full Text Available Background and objective The recurrence, metastasis and multidrug resistance (MDR in lung cancer are the tough problems worldwide. This study was to establish a novel chinese lung adenocarcinoma cell line with high metastasis potential for exploring the mechanism of reccurrence, development and MDR in lung cancer. Methods The cell came from the abdominal dropsy of a fifty-six years old female patient with lung adenocarcinoma and the tumor markers CA125, CYFRA21-1, CEA, NSE were detected to be higher secretion by radioimmunoassay in the abdominal dropsy. Tumorigenicity of immunodeficient mice was confirmed in 8th passage. The cell growth curve was mapped. Analysis of chromosome karyotype was tested. The gene expression was measured by real-time quantitative PCR. Results The tumorigenesis rate started at 8th passage in 3/10 immunodeficient mice via subcutaneously and the fully tumorigenicity was at 11th passage as well as later passages. Under the microscope, the cell showed oval-shap and adherence. The chromosome karyotype analysis of the cells was sub-triploid. Approximately 1×106 and 1.5×106 cancerous cells were injected into left cardiac ventricle and tail vein of immunodeficient mice respectively. The results showed multiorgan metastasis in the mice after three-four weeks, including mandible, scapula, humerus, vertebral column, femur, rib and brain, liver, adrenal gland, pulmonary in the mice after inoculation. The bone metastasis rate was 100% in the tumor bearing mice by bone scintigraphy and pathology. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR genes were overexpressed. The novel cell was named CPA-Yang2. Conclusion The characteristics of novel strain CPA-Yang2 is a highly metastasis cell line of Chinese lung adenocarcinoma. It has stable traits, highly metastasis ability and maybe is a MDR lung cancerous cell line. Of course, it’s a good experimental

  13. Clear Cell Adenocarcinoma of the Renal Pelvis in a Male Patient

    OpenAIRE

    Sarawut Kongkarnka; Pruit Kitirattakarn; Hironori Katayama; Surapan Khunamornpong

    2013-01-01

    Carcinoma of the renal pelvis is an uncommon renal neoplasm. Clear cell adenocarcinoma in the urinary tract is rare and has a histomorphology resembling that of the female genital tract. We herein present a case of clear cell adenocarcinoma of the renal pelvis, which is the first example in a male patient to our knowledge. A 54-year-old man presented with right flank pain. The tumor was associated with renal stones and hydronephrosis and invaded into the peripelvic fat tissue with regional ly...

  14. Prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma.

    Science.gov (United States)

    Che, Keying; Zhao, Yang; Qu, Xiao; Pang, Zhaofei; Ni, Yang; Zhang, Tiehong; Du, Jiajun; Shen, Hongchang

    2017-01-01

    Gastric carcinoma (GC) is a highly aggressive cancer and one of the leading causes of cancer-related deaths worldwide. Histopathological evaluation pertaining to invasiveness is likely to provide additional information in relation to patient outcome. In this study, we aimed to evaluate the prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma. Hematoxylin and eosin-stained slides generated from 296 gastric adenocarcinoma patients with full clinical and pathological and follow-up information were systematically reviewed. The patients were grouped on the basis of tumor budding, single cell invasion, large cell invasion, mitotic count, and fibrosis. The association between histopathological parameters, different classification systems, and overall survival (OS) was statistically analyzed. Among the 296 cases that were analyzed, high-grade tumor budding was observed in 49.0% (145) of them. Single cell invasion and large cell invasion were observed in 62.8% (186) and 16.9% (50) of the cases, respectively. Following univariate analysis, patients with high-grade tumor budding had shorter OS than those with low-grade tumor budding (hazard ratio [HR]: 2.260, Ptumor budding and single cell invasion were observed to be independent risk factors for gastric adenocarcinoma (PTumor budding and single cell invasion in gastric adenocarcinoma are associated with an unfavorable prognosis.

  15. Aryl hydrocarbon receptor protects lung adenocarcinoma cells against cigarette sidestream smoke particulates-induced oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Ya-Hsin [Graduate Institute of Basic Medical Science, School of Medicine, China Medical University, Taichung 40402, Taiwan, ROC (China); Huang, Su-Chin; Lin, Chun-Ju; Cheng, Li-Chuan [Division of Environmental Health and Occupational Medicine, National Health Research Institutes, Zhunan, Miaoli 35053, Taiwan, ROC (China); Li, Lih-Ann, E-mail: lihann@nhri.org.tw [Division of Environmental Health and Occupational Medicine, National Health Research Institutes, Zhunan, Miaoli 35053, Taiwan, ROC (China)

    2012-03-15

    Environmental cigarette smoke has been suggested to promote lung adenocarcinoma progression through aryl hydrocarbon receptor (AhR)-signaled metabolism. However, whether AhR facilitates metabolic activation or detoxification in exposed adenocarcinoma cells remains ambiguous. To address this question, we have modified the expression level of AhR in two human lung adenocarcinoma cell lines and examined their response to an extract of cigarette sidestream smoke particulates (CSSP). We found that overexpression of AhR in the CL1-5 cell line reduced CSSP-induced ROS production and oxidative DNA damage, whereas knockdown of AhR expression increased ROS level in CSSP-exposed H1355 cells. Oxidative stress sensor Nrf2 and its target gene NQO1 were insensitive to AhR expression level and CSSP treatment in human lung adenocarcinoma cells. In contrast, induction of AhR expression concurrently increased mRNA expression of xenobiotic-metabolizing genes CYP1B1, UGT1A8, and UGT1A10 in a ligand-independent manner. It appeared that AhR accelerated xenobiotic clearing and diminished associated oxidative stress by coordinate regulation of a set of phase I and II metabolizing genes. However, the AhR-signaled protection could not shield cells from constant oxidative stress. Prolonged exposure to high concentrations of CSSP induced G0/G1 cell cycle arrest via the p53–p21–Rb1 signaling pathway. Despite no effect on DNA repair rate, AhR facilitated the recovery of cells from growth arrest when CSSP exposure ended. AhR-overexpressing lung adenocarcinoma cells exhibited an increased anchorage-dependent and independent proliferation when recovery from exposure. In summary, our data demonstrated that AhR protected lung adenocarcinoma cells against CSSP-induced oxidative stress and promoted post-exposure clonogenicity. -- Highlights: ► AhR expression level influences cigarette sidestream smoke-induced ROS production. ► AhR reduces oxidative stress by coordinate regulation of

  16. Innate Immune Landscape in Early Lung Adenocarcinoma by Paired Single-Cell Analyses.

    Science.gov (United States)

    Lavin, Yonit; Kobayashi, Soma; Leader, Andrew; Amir, El-Ad David; Elefant, Naama; Bigenwald, Camille; Remark, Romain; Sweeney, Robert; Becker, Christian D; Levine, Jacob H; Meinhof, Klaus; Chow, Andrew; Kim-Shulze, Seunghee; Wolf, Andrea; Medaglia, Chiara; Li, Hanjie; Rytlewski, Julie A; Emerson, Ryan O; Solovyov, Alexander; Greenbaum, Benjamin D; Sanders, Catherine; Vignali, Marissa; Beasley, Mary Beth; Flores, Raja; Gnjatic, Sacha; Pe'er, Dana; Rahman, Adeeb; Amit, Ido; Merad, Miriam

    2017-05-04

    To guide the design of immunotherapy strategies for patients with early stage lung tumors, we developed a multiscale immune profiling strategy to map the immune landscape of early lung adenocarcinoma lesions to search for tumor-driven immune changes. Utilizing a barcoding method that allows a simultaneous single-cell analysis of the tumor, non-involved lung, and blood cells, we provide a detailed immune cell atlas of early lung tumors. We show that stage I lung adenocarcinoma lesions already harbor significantly altered T cell and NK cell compartments. Moreover, we identified changes in tumor-infiltrating myeloid cell (TIM) subsets that likely compromise anti-tumor T cell immunity. Paired single-cell analyses thus offer valuable knowledge of tumor-driven immune changes, providing a powerful tool for the rational design of immune therapies. VIDEO ABSTRACT. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. NR4A2 is regulated by gastrin and influences cellular responses of gastric adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Kristine Misund

    Full Text Available The peptide hormone gastrin is known to play a role in differentiation, growth and apoptosis of cells in the gastric mucosa. In this study we demonstrate that gastrin induces Nuclear Receptor 4A2 (NR4A2 expression in the adenocarcinoma cell lines AR42J and AGS-GR, which both possess the gastrin/CCK2 receptor. In vivo, NR4A2 is strongly expressed in the gastrin responsive neuroendocrine ECL cells in normal mucosa, whereas gastric adenocarcinoma tissue reveals a more diffuse and variable expression in tumor cells. We show that NR4A2 is a primary early transient gastrin induced gene in adenocarcinoma cell lines, and that NR4A2 expression is negatively regulated by inducible cAMP early repressor (ICER and zinc finger protein 36, C3H1 type-like 1 (Zfp36l1, suggesting that these gastrin regulated proteins exert a negative feedback control of NR4A2 activated responses. FRAP analyses indicate that gastrin also modifies the nucleus-cytosol shuttling of NR4A2, with more NR4A2 localized to cytoplasm upon gastrin treatment. Knock-down experiments with siRNA targeting NR4A2 increase migration of gastrin treated adenocarcinoma AGS-GR cells, while ectopically expressed NR4A2 increases apoptosis and hampers gastrin induced invasion, indicating a tumor suppressor function of NR4A2. Collectively, our results uncover a role of NR4A2 in gastric adenocarcinoma cells, and suggest that both the level and the localization of NR4A2 protein are of importance regarding the cellular responses of these cells.

  18. NR4A2 is regulated by gastrin and influences cellular responses of gastric adenocarcinoma cells.

    Science.gov (United States)

    Misund, Kristine; Selvik, Linn-Karina Myrland; Rao, Shalini; Nørsett, Kristin; Bakke, Ingunn; Sandvik, Arne K; Lægreid, Astrid; Bruland, Torunn; Prestvik, Wenche S; Thommesen, Liv

    2013-01-01

    The peptide hormone gastrin is known to play a role in differentiation, growth and apoptosis of cells in the gastric mucosa. In this study we demonstrate that gastrin induces Nuclear Receptor 4A2 (NR4A2) expression in the adenocarcinoma cell lines AR42J and AGS-GR, which both possess the gastrin/CCK2 receptor. In vivo, NR4A2 is strongly expressed in the gastrin responsive neuroendocrine ECL cells in normal mucosa, whereas gastric adenocarcinoma tissue reveals a more diffuse and variable expression in tumor cells. We show that NR4A2 is a primary early transient gastrin induced gene in adenocarcinoma cell lines, and that NR4A2 expression is negatively regulated by inducible cAMP early repressor (ICER) and zinc finger protein 36, C3H1 type-like 1 (Zfp36l1), suggesting that these gastrin regulated proteins exert a negative feedback control of NR4A2 activated responses. FRAP analyses indicate that gastrin also modifies the nucleus-cytosol shuttling of NR4A2, with more NR4A2 localized to cytoplasm upon gastrin treatment. Knock-down experiments with siRNA targeting NR4A2 increase migration of gastrin treated adenocarcinoma AGS-GR cells, while ectopically expressed NR4A2 increases apoptosis and hampers gastrin induced invasion, indicating a tumor suppressor function of NR4A2. Collectively, our results uncover a role of NR4A2 in gastric adenocarcinoma cells, and suggest that both the level and the localization of NR4A2 protein are of importance regarding the cellular responses of these cells.

  19. Selective gene delivery toward gastric and esophageal adenocarcinoma cells via EpCAM-targeted adenoviral vectors

    NARCIS (Netherlands)

    Heideman, DAM; Snijders, PJF; Craanen, ME; Bloemena, E; Meijer, CJLM; Meuwissen, SGM; van Beusechem, VW; Pinedo, HM; Curiel, DT; Haisma, HJ; Gerritsen, WR

    Application of recombinant adenoviral vectors for cancer gene therapy is currently limited due to lack of specificity for tumor cells. For gastric and esophageal adenocarcinoma, we present here that the relative abundant expression of the primary adenovirus receptor, coxsackie/adenovirus receptor

  20. Interfacing polymeric scaffolds with primary pancreatic ductal adenocarcinoma cells to develop 3D cancer models

    NARCIS (Netherlands)

    Ricci, C.; Mota, C.M.; Moscato, S.; D' Alessandro, D.; Ugel, S.; Sartoris, S.; Bronte, V.; Boggi, U.; Campani, D.; Funel, N.; Moroni, Lorenzo; Danti, S.

    2014-01-01

    We analyzed the interactions between human primary cells from pancreatic ductal adenocarcinoma (PDAC) and polymeric scaffolds to develop 3D cancer models useful for mimicking the biology of this tumor. Three scaffold types based on two biocompatible polymeric formulations, such as poly(vinyl

  1. Iron overload of human colon adenocarcinoma cells studied by synchrotron-based X-ray techniques

    NARCIS (Netherlands)

    Mihucz, Victor G.; Meirer, Florian; Polgári, Zsófia; Réti, Andrea; Pepponi, Giancarlo; Ingerle, Dieter; Szoboszlai, Norbert; Streli, Christina

    2016-01-01

    Fast- and slow-proliferating human adenocarcinoma colorectal cells, HT-29 and HCA-7, respectively, overloaded with transferrin (Tf), Fe(III) citrate, Fe(III) chloride and Fe(II) sulfate were studied by synchrotron radiation total-reflection X-ray spectrometry (TXRF), TXRF-X-ray absorption near edge

  2. A rare tumoral combination, synchronous lung adenocarcinoma and mantle cell lymphoma of the pleura

    Directory of Open Access Journals (Sweden)

    Foroulis Christophoros N

    2008-12-01

    Full Text Available Abstract Background Coexistence of adenocarcinoma and mantle cell lymphoma in the same or different anatomical sites is extremely rare. We present a case of incidental discovery of primary lung adenocarcinoma and mantle cell lymphoma involving the pleura, during an axillary thoracotomy performed for a benign condition. Case presentation A 73-year old male underwent bullectomy and apical pleurectomy for persistent pneumothorax. A bulla of the lung apex was resected en bloc with a scar-like lesion of the lung, which was located in proximity with the bulla origin, by a wide wedge resection. Histologic examination of the stripped-off parietal pleura and of the bullectomy specimen revealed the synchronous occurrence of two distinct neoplasms, a lymphoma infiltrating the pleura and a primary, early lung adenocarcinoma. Immunohistochemical and fluorescence in situ hybridization assays were performed. The morphologic, immunophenotypic and genetic findings supported the diagnosis of primary lung adenocarcinoma (papillary subtype coexisting with a non-Hodgkin, B-cell lineage, mantle cell lymphoma involving both, visceral and parietal pleura and without mediastinal lymph node involvement. The neoplastic lymphoid cells showed the characteristic immunophenotype of mantle cell lymphoma and the translocation t(11;14. The patient received 6 cycles of chemotherapy, while pulmonary function tests precluded further pulmonary parenchyma resection (lobectomy for his adenocarcinoma. The patient is alive and without clinical and radiological findings of local recurrence or distant relapse from both tumors 14 months later. Conclusion This is the first reported case of a rare tumoral combination involving simultaneously lung and pleura, emphasizing at the incidental discovery of the two coexisting neoplasms during a procedure performed for a benign condition. Any tissue specimen resected during operations performed for non-tumoral conditions should be routinely sent for

  3. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-06-01

    Full Text Available Weiyi Huang,* Haihua Huang,* Lei Wang, Jiong Hu, Weifeng Song Department of Oncology, The First People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Cytoskeleton is critical for carcinoma cell proliferation, migration, and invasion. Sad-1 and UNC-84 domain containing 1 (SUN1 is one of the core linkers of nucleoskeleton and cytoskeleton. However, the functions of SUN1 in lung adenocarcinoma are largely unknown.Methods: In this study, we first transduced the lentivirus delivering the short hairpin RNA (shRNA against SUN1 to lung adenocarcinoma cells (A549 and 95D cells with high efficiency. After lentivirus infection, quantitative real-time polymerase chain reaction and Western blotting were used to detect the expressions of SUN1 mRNA and protein. The cell proliferation and colony formation were detected by MTT assay and colony formation assay, respectively. The cell distribution in the cell cycle was analyzed by flow cytometry.Results: Both mRNA and protein levels of SUN1 were significantly decreased in A549 and 95D cells after lentivirus infection, as indicated by quantitative real-time polymerase chain reaction and Western blot. Next, we found that cell proliferation and colony formation were markedly reduced in SUN1 silenced cells. Moreover, suppression of SUN1 led to cell cycle arrest at G0/G1 phase. Furthermore, Cyclin D1, CDK6, and CDK2 expressions were obviously reduced in A549 cells after SUN1 silencing.Conclusion: These results suggest that SUN1 plays an essential role in proliferation of lung adenocarcinoma cells in vitro and may be used as a potential therapeutic target for the treatment of lung adenocarcinoma in the future. Keywords: SUN1, lung cancer, proliferation

  4. MicroRNA-29a suppresses the growth, migration, and invasion of lung adenocarcinoma cells by targeting carcinoembryonic antigen-related cell adhesion molecule 6.

    Science.gov (United States)

    Han, Hye Sook; Son, Seung-Myoung; Yun, Jieun; Jo, Yeong Nang; Lee, Ok-Jun

    2014-10-16

    Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) is an important regulator of cell adhesion, invasion, and metastasis. The aim of this study was to evaluate the functional roles of CEACAM6 in lung adenocarcinoma and to identify miRNAs that inhibit the growth, migration, and invasion of lung adenocarcinoma cells by targeting CEACAM6. CEACAM6 expression is associated with poor prognosis of patients with lung adenocarcinoma, and CEACAM6 has important functional roles in controlling the growth, migration, and invasion of lung adenocarcinoma cells in vitro and in vivo. Furthermore, miR-29a can suppress the growth, migration, and invasion of lung adenocarcinoma cells by targeting CEACAM6. Therefore, miR-29a/CEACAM6 axis represents a potential therapeutic target for treatment of lung adenocarcinoma. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  5. MiR-373-3p Promotes Invasion and Metastasis of Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Aibing WU

    2015-07-01

    Full Text Available Background and objective Lung cancer is the leading cause of cancer-related deaths worldwide, and metastasis is the major cause of death in lung cancer patients. MiR-373 is closely associated with invasion and metastasis in other tumor cells. This study explored the expression of miR-373-3p in non-small cell lung cancer (NSCLC and its effect on the invasive and metastatic capabilities of lung adenocarcinoma cells, as well as their mechanisms of action. Methods The expression of miR-373-3p in NSCLC tissues and lung adenocarcinoma cell lines was detected by quantitative reverse transcription polymerase chain reaction. The roles of miR-373-3p in regulating lung adenocarcinoma cell invasion and metastatic properties were analyzed with miR-373-3p mimic/inhibitor-transfected cells via Transwell chamber assay. Matrix metalloproteinase MMP-9 and MMP-14 protein levels were detected by Western blot in lung cancer cells after transfection. Results MiR-373-3p was upregulated in 51 NSCLC tissues and 5 NSCLC cell lines. Gain-of-function and loss-of-function studies showed that overexpression of miR-373-3p promoted H1299 cell migration and invasion, which resulted in upregulation of MMP-9 and MMP-14. By contrast, miR-373-3p knockdown inhibited these processes in A549 cells and downregulated the expression of MMP-9 and MMP-14. Conclusion Our results demonstrated that miR-373-3p participated in the invasion and metastasis of lung adenocarcinoma cells, partly by upregulation of MMP-9 and MMP-14.

  6. Prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Che K

    2017-02-01

    Full Text Available Keying Che,1,* Yang Zhao,2,3,* Xiao Qu,1 Zhaofei Pang,1 Yang Ni,4 Tiehong Zhang,4 Jiajun Du,1,5 Hongchang Shen4 1Institute of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, 2Department of Breast Surgery, Key Laboratory of Breast Cancer in Shanghai, Collaborative Innovation Center of Cancer Medicine, Fudan University Shanghai Cancer Center, 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 4Department of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, 5Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, People’s Republic of China *These authors contributed equally to this work Purpose: Gastric carcinoma (GC is a highly aggressive cancer and one of the leading causes of cancer-related deaths worldwide. Histopathological evaluation pertaining to invasiveness is likely to provide additional information in relation to patient outcome. In this study, we aimed to evaluate the prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma.Materials and methods: Hematoxylin and eosin-stained slides generated from 296 gastric adenocarcinoma patients with full clinical and pathological and follow-up information were systematically reviewed. The patients were grouped on the basis of tumor budding, single cell invasion, large cell invasion, mitotic count, and fibrosis. The association between histopathological parameters, different classification systems, and overall survival (OS was statistically analyzed.Results: Among the 296 cases that were analyzed, high-grade tumor budding was observed in 49.0% (145 of them. Single cell invasion and large cell invasion were observed in 62.8% (186 and 16.9% (50 of the cases, respectively. Following univariate analysis, patients with high-grade tumor budding had shorter OS than those with low-grade tumor budding (hazard ratio [HR]: 2.260, P<0

  7. Deregulation of the CEACAM expression pattern causes undifferentiated cell growth in human lung adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Bernhard B Singer

    Full Text Available CEACAM1, CEA/CEACAM5, and CEACAM6 are cell adhesion molecules (CAMs of the carcinoembryonic antigen (CEA family that have been shown to be deregulated in lung cancer and in up to 50% of all human cancers. However, little is known about the functional impact of these molecules on undifferentiated cell growth and tumor progression. Here we demonstrate that cell surface expression of CEACAM1 on confluent A549 human lung adenocarcinoma cells plays a critical role in differentiated, contact-inhibited cell growth. Interestingly, CEACAM1-L, but not CEACAM1-S, negatively regulates proliferation via its ITIM domain, while in proliferating cells no CEACAM expression is detectable. Furthermore, we show for the first time that CEACAM6 acts as an inducer of cellular proliferation in A549 cells, likely by interfering with the contact-inhibiting signal triggered by CEACAM1-4L, leading to undifferentiated anchorage-independent cell growth. We also found that A549 cells expressed significant amounts of non-membrane anchored variants of CEACAM5 and CEACAM6, representing a putative source for the increased CEACAM5/6 serum levels frequently found in lung cancer patients. Taken together, our data suggest that post-confluent contact inhibition is established and maintained by CEACAM1-4L, but disturbances of CEACAM1 signalling by CEACAM1-4S and other CEACAMs lead to undifferentiated cell growth and malignant transformation.

  8. Cryptolepine, isolated from Sida acuta, sensitizes human gastric adenocarcinoma cells to TRAIL-induced apoptosis.

    Science.gov (United States)

    Ahmed, Firoj; Toume, Kazufumi; Ohtsuki, Takashi; Rahman, Mahmudur; Sadhu, Samir Kumar; Ishibashi, Masami

    2011-01-01

    Bioassay guided separation of Sida acuta whole plants led to the isolation of an alkaloid, cryptolepine (1), along with two kaempferol glycosides (2-3). Compound 1 showed strong activity in overcoming TRAIL-resistance in human gastric adenocarcinoma (AGS) cells at 1.25, 2.5 and 5 μm. Combined treatment of 1 and TRAIL sensitized AGS cells to TRAIL-induced apoptosis at the aforementioned concentrations. Copyright © 2010 John Wiley & Sons, Ltd.

  9. Subcellular distribution and expression of cofilin and ezrin in human colon adenocarcinoma cell lines with different metastatic potential

    Directory of Open Access Journals (Sweden)

    D. Nowak

    2010-04-01

    Full Text Available The dynamic reorganization of the actin cytoskeleton is regulated by a number of actin binding proteins (ABPs. Four human colon adenocarcinoma cell lines – parental and three selected sublines, which differ in motility and metastatic potential, were used to investigate the expression level and subcellular localization of selected ABPs. Our interest was focused on cofilin and ezrin. These proteins are essential for cell migration and adhesion. The data received for the three more motile adenocarcinoma sublines (EB3, 3LNLN, 5W were compared with those obtained for the parental LS180 adenocarcinoma cells and fibroblastic NRK cells. Quantitative densitometric analysis and confocal fluorescence microscopy were used to examine the expression levels and subcellular distribution of the selected ABPs. Our data show distinct increase in the level of cofilin in adenocarcinoma cells accompanied by the reduction of inactive phosphorylated form of cofilin. In more motile cells, cofilin was accumulated at cellular periphery in co-localization with actin filaments. Furthemore, we indicated translocation of ezrin towards the cell periphery within more motile cells in comparison with NRK and parental adenocarcinoma cells. In summary, our data indicate the correlation between migration ability of selected human colon adenocarcinoma sublines and subcellular distribution as well as the level of cofilin and ezrin. Therefore these proteins might be essential for the higher migratory activity of invasive tumor cells.

  10. MiRNA-145 suppresses lung adenocarcinoma cell invasion and migration by targeting N-cadherin.

    Science.gov (United States)

    Mo, Dongping; Yang, Daheng; Xiao, Xuelian; Sun, Ruihong; Huang, Lei; Xu, Jian

    2017-05-01

    To investigate the roles of miR-145 in lung adenocarcinoma (LAC) and to clarify the regulation of N-cadherin by miR-145. In 57 paired clinical LAC tissues, diminished miR-145 was significantly correlated with the lymph node metastasis and was negatively correlated with N-cadherin mRNA level expression. Wound healing and transwell assays revealed a reduced capability of tumor metastasis induced by miR-145 in LAC. miR-145 negatively regulated the invasion of cell lines through targeting N-cadherin by directly binding to its 3'-untranslated region. Silencing of N-cadherin inhibited invasion and migration of LAC cell lines similar to miR-145 overexpression. MiR-145 could inhibit invasion and migration of lung adenocarcinoma cell lines by directly targeting N-cadherin.

  11. Roles of histamine on the expression of aldehyde dehydrogenase 1 in endometrioid adenocarcinoma cell line

    Science.gov (United States)

    Wang, Yi; Jiang, Yang; Ikeda, Jun-ichiro; Tian, Tian; Sato, Atsushi; Ohtsu, Hiroshi; Morii, Eiichi

    2014-01-01

    Cancer-initiating cells (CICs) are a limited number of cells that are essential for maintenance, recurrence, and metastasis of tumors. Aldehyde dehydrogenase 1 (ALDH1) has been recognized as a marker of CICs. We previously reported that ALDH1-high cases of uterine endometrioid adenocarcinoma showed poor prognosis, and that ALDH1 high population was more tumorigenic, invasive, and resistant to apoptosis than ALDH1 low population. Histamine plays a critical role in cancer cell proliferation, migration, and invasion. Here, we examined the effect of histamine on ALDH1 expression in endometrioid adenocarcinoma cell line. The addition of histamine increased ALDH1 high population, which was consistent with the result that histamine enhanced the invasive ability and the resistance to anticancer drug. Among 4 types of histamine receptors, histamine H1 and H2 receptor (H1R and H2R) were expressed in endometrioid adenocarcinoma cell line. The addition of H1R agonist but not H2R agonist increased ALDH1. The antagonist H1R but not H2R inhibited the effect of histamine on ALDH1 expression. These results indicated that histamine increased the expression of ALDH1 via H1R but not H2R. These findings may provide the evidence for exploring a new strategy to suppress CICs by inhibiting ALDH1 expression with histamine. PMID:25045085

  12. Clear Cell Adenocarcinoma of the Colon: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Christian Daniel Barrera-Maldonado

    2014-01-01

    Full Text Available Clear cell adenocarcinoma of the colon has been described scarcely in the literature. It affects elderly men more commonly than women and usually appears in the left side of the colon. A Hispanic 41-year-old female came to the emergency room with abdominal pain, vomiting, and distension. Physical exam revealed generalized tenderness without peritoneal signs. Laboratory data was unremarkable. A CT scan showed an apple-core lesion in the distal colon. A flexible sigmoidoscopy revealed an obstructive mass that made further evaluation impossible. Exploratory surgery revealed a hard mass obstructing the descending colon, which was resected. Histopathology analysis with immunohistochemistry staining was positive for cytokeratin 20, cytokeratin 10, CDX2, and villin, while it was negative for cytokeratin 7, RCC, vimentin, and CD31. These results confirmed the clear cell variant of the adenocarcinoma. Clear cell adenocarcinomas usually arise from the kidneys and Müllerian organs. Immunohistochemistry is crucial for establishing the origin of these neoplastic cells. A cytokeratin 20+/7− with positive CDX2 is highly specific and sensitive for intestinal neoplastic origin. The main treatment has been surgery alone with moderately good results. More research and information about this malignancy is needed, especially in regard to prognosis and in order to provide the best treatment option.

  13. Multisystem Langerhans cell histiocytosis coexisting with metastasizing adenocarcinoma of the lung: A case report

    Directory of Open Access Journals (Sweden)

    Lovrenski Aleksandra

    2013-01-01

    Full Text Available Introduction. Langerhans cell histiocytosis (LCH is an uncommon disease of unknown etiology characterized by uncontrolled proliferation and infiltration of various organs by Langerhans cells. Case report. We presented a 54-year-old man, heavy smoker, with dyspnea, cough, hemoptysis, headache and ataxia, who died shortly after admission to our hospital. On the autopsy, tumor was found in the posterior segment of the right upper pulmonary lobe as well as a right-sided occipitoparietal lesion which penetrated into the right ventricle resulting in internal and external hematocephalus. Histologically and immunohistohemically, the diagnosis of primary lung adenocarcinoma with brain metastasis was made (tumor cells showed positivity for CK7 and TTF-1 which confirmed the diagnosis. In the lung parenchyma around the tumor, as well as in brain tissue around the metastatic adenocarcinoma histiocytic lesions were found. Light microscopic examination of the other organs also showed histiocytic lesions involving the pituitary gland, hypothalamus, spleen and mediastinal lymph nodes. Immunohistochemical studies revealed CD68, S-100 and CD1a immunoreactivity within the histiocytes upon which the diagnosis of Langerhans' cells histiocytosis was made. Conclusion. The multisystem form of LCH with extensive organ involvement was an incidental finding, while metastatic lung adenocarcinoma to the brain that led to hematocephalus was the cause of death.

  14. Gastrin activates autophagy and increases migration and survival of gastric adenocarcinoma cells.

    Science.gov (United States)

    Rao, Shalini V; Solum, Guri; Niederdorfer, Barbara; Nørsett, Kristin G; Bjørkøy, Geir; Thommesen, Liv

    2017-01-21

    The peptide hormone gastrin exerts a growth-promoting effect in both normal and malignant gastrointestinal tissue. Gastrin mediates its effect via the cholecystokinin 2 receptor (CCKBR/CCK2R). Although a substantial part of the gastric adenocarcinomas express gastrin and CCKBR, the role of gastrin in tumor development is not completely understood. Autophagy has been implicated in mechanisms governing cytoprotection, tumor growth, and contributes to chemoresistance. This study explores the role of autophagy in response to gastrin in gastric adenocarcinoma cell lines. Immunoblotting, survival assays and the xCELLigence system were used to study gastrin induced autophagy. Chemical inhibitors of autophagy were utilized to assess the role of this process in the regulation of cellular responses induced by gastrin. Further, knockdown studies using siRNA and immunoblotting were performed to explore the signaling pathways that activate autophagy in response to gastrin treatment. We demonstrate that gastrin increases the expression of the autophagy markers MAP1LC3B-II and SQSTM1 in gastric adenocarcinoma cells. Gastrin induces autophagy via activation of the STK11-PRKAA2-ULK1 and that this signaling pathway is involved in increased migration and cell survival. Furthermore, gastrin mediated increase in survival of cells treated with cisplatin is partially dependent on induced autophagy. This study reveals a novel role of gastrin in the regulation of autophagy. It also opens up new avenues in the treatment of gastric cancer by targeting CCKBR mediated signaling and/or autophagy in combination with conventional cytostatic drugs.

  15. Primary Clear Cell Adenocarcinoma of a Urethral Diverticulum Treated with Multidisciplinary Robotic Anterior Pelvic Exenteration

    Directory of Open Access Journals (Sweden)

    Dane Scantling

    2013-01-01

    Full Text Available Primary urethral carcinoma is extremely rare and is marked by a variety of clinical symptoms. Primary carcinoma of a urethral diverticulum is still rarer and clear cell adenocarcinoma of the urethra is particularly uncommon (Swartz et al., 2006. Such infrequency has led to inadequate management guidance in the literature for a disease that is often late in presentation and carries substantial morbidity and mortality. This treatable but grave disease deserves definitive curative treatment. We present the first published instance in which it was treated with robotic anterior exenteration. In our case, a 47-year-old female was referred to the urology service for investigation of recurring urinary tract infections. During the workup, the patient was found to have an advanced clear cell urethral adenocarcinoma originating in a urethral diverticulum. We discuss the natural history of this condition, its consequences, and the first instance of its treatment using robotic anterior pelvic exenteration.

  16. Demographic, Clinical, and Prognostic Factors of Ovarian Clear Cell Adenocarcinomas According to Endometriosis Status

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard

    2017-01-01

    to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher......OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...

  17. Establishment and Characterization of a Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang2 in Immunodeficient Mice

    OpenAIRE

    Shunfang YANG; Su, Jianzhong; Meiping SHI; Lanxiang ZHAO; Zhang, Peiling; Cao, Jie; Lu, Jianying; Xie, Wenhui

    2009-01-01

    Background and objective The recurrence, metastasis and multidrug resistance (MDR) in lung cancer are the tough problems worldwide. This study was to establish a novel chinese lung adenocarcinoma cell line with high metastasis potential for exploring the mechanism of reccurrence, development and MDR in lung cancer. Methods The cell came from the abdominal dropsy of a fifty-six years old female patient with lung adenocarcinoma and the tumor markers CA125, CYFRA21-1, CEA, NSE were detected to b...

  18. A clear cell adenocarcinoma of the gallbladder with hepatoid differentiation: case report and review of literature

    Directory of Open Access Journals (Sweden)

    Zhang C

    2016-09-01

    Full Text Available Chengsheng Zhang,1,2 Wei Zhang,1,2 Dianbin Mu,1 Xuetao Shi,1 Lei Zhao1,2 1Department of Hepatobiliary Surgery, Shandong Cancer Hospital affiliated to Shandong University, Shandong Academy of Medical Science, 2School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong Province, People’s Republic of China Abstract: An 80-year-old male was referred to our department for a gallbladder mass. He denied any history of alcohol consumption or cholecystitis and smoking. Hepatitis B surface antigen test and antihepatitis C antibody test were found to be negative. Serum carbohydrate antigen 19-9 (CA19-9 and carcinoembryonic antigen were elevated (CA19-9 was 59.92 U/mL and carcinoembryonic antigen was 12.64 ng/mL, whereas alpha-fetoprotein was below the normal limit (2.46 ng/mL. Computed tomography scan revealed a solid mass with measurements of 4.6×5.6×7.1 cm, which nearly filled the whole gallbladder space. Radical cholecystectomy, including segments IV B and V of the liver and lymphadenectomy, was performed. The neoplasm in gallbladder was completely resected, and the patient obtained a negative margin. Histological and immunohistochemical profile suggested a clear cell adenocarcinoma of the gallbladder with hepatoid differentiation. After reviewing the literature, we reported that this case is the first identified case of cell adenocarcinoma of the gallbladder with extensive hepatoid differentiation. However, clinical features of clear cell adenocarcinoma with hepatoid differentiation remain unclear due to the extremely rare incidence. There was no indication of adjuvant chemotherapy and no literature has been reported on the application of chemotherapy. This case showed a promising clinical outcome after curative resection, which indicated that surgical treatment could be potentially considered for suitable patients. Keywords: gallbladder, clear cell adenocarcinoma, hepatoid differentiation 

  19. Anal metastasis of rectal cancer-adenocarcinoma of squamous cells: a case report and literature review.

    Science.gov (United States)

    Sasaki, Shun; Sugiyama, Masahiko; Nakaji, Yu; Nakanishi, Ryota; Nakashima, Yuichiro; Saeki, Hiroshi; Oki, Eiji; Oda, Yoshinao; Maehara, Yoshihiko

    2017-12-01

    Anal metastasis of colorectal cancer is very rare and is usually associated with a history of anal disease, including anal fistula, fissure, hemorrhoidectomy, and anastomotic injury. We report a case of rectal cancer with a synchronous anal metastasis consisting of adenocarcinoma of squamous cells without a history of anal disease. A 60-year-old woman had a chief complaint of melena. She had a 1.5-cm anal tumor on the perianal skin, and a Bollman type 2 rectal tumor on the Ra portion was found on colonoscopy. Biopsy of both tumors revealed a similar histology of well- to moderately differentiated adenocarcinoma. There was no sign of metastases in lymph nodes or other organs. For the purpose of diagnosis and treatment, transperineal local resection of the anal tumor was performed, and it was histologically identified as adenocarcinoma of squamous cells with no invasion to muscles, lymph ducts, or microvessels. The pathological margin was free. Then, to achieve radical cure, laparoscopic low anterior resection (LAR) with D3 lymphadenectomy was performed. The histological diagnosis of the anal tumor was adenocarcinoma of squamous cells without invasion to muscles, lymph ducts, or vessels. The surgical margin was completely free. Immunohistochemical analysis of both tumors revealed similar staining patterns, and the final diagnosis was rectal cancer with metastasis to the anal skin. The patient received no postoperative therapy, and no recurrences have been observed 12 months after surgery. We expect that our sphincter-preserving surgical strategy provided a good prognosis for the synchronous rectal cancer and anal metastasis. This is a rare report of a case with an anal metastasis of colorectal cancer on perianal squamous cells without a history of anal disease that was resected while preserving anal function.

  20. Undifferentiated pulmonary adenocarcinoma of clear cells associated to hypertrophic osteopathy in a dog

    OpenAIRE

    Rossetto, Victor José Vieira [UNESP; Rahal, Sheila Canevese [UNESP; Pardini, Luciana Moura Campos [UNESP; Fabris, Viciany Erique [UNESP; Mamprim, Maria Jaqueline [UNESP; Ribeiro, Sergio Marrone [UNESP

    2015-01-01

    Background: Most of the primary pulmonary tumors in dogs are malignant and from epithelial origin, being bronchioalveolar tumors more prevalent. Adenocarcinoma of clear cells, however, is a very rare pulmonary tumor and its origin is still unknown. It is related to several clinical abnormalities, including hypertrophic osteopathy, an unusual paraneoplastic syndrome characterized by a periosteal reaction along the shaft of long bones. Because of the unusual presentation of the pulmonary adenoc...

  1. Molecular Analysis of Motility in Metastatic Mammary Adenocarcinoma Cells

    Science.gov (United States)

    1996-09-01

    elements of epidermoid carcinoma (A43 1) cells. J. Cell. Biol. 103: 87-94 Winkler, M. (1988). Translational regulation in sea urchin eggs: a complex...response range of changes in cell motility and morphology after stimulation with EGF using time-lapse video microscopy. This determines the appropriate...importance in mediating changes in cell motility or morphology after stimulation, and identify or acquire clones for the rat gene for the most important proten

  2. Intratumoral Immune Cell Densities Are Associated with Lung Adenocarcinoma Gene Alterations.

    Science.gov (United States)

    Mansuet-Lupo, Audrey; Alifano, Marco; Pécuchet, Nicolas; Biton, Jérôme; Becht, Etienne; Goc, Jeremy; Germain, Claire; Ouakrim, Hanane; Régnard, Jean-François; Cremer, Isabelle; Laurent-Puig, Pierre; Dieu-Nosjean, Marie-Caroline; Blons, Hélène; Damotte, Diane

    2016-12-01

    Tumor-infiltrating immune cells affect lung cancer outcome. However, the factors that influence the composition and function of the tumor immune environment remain poorly defined and need investigation, particularly in the era of immunotherapy. To determine whether the tumoral immune environment is related to lung adenocarcinoma mutations. This retrospective cohort included 316 consecutive patients with lung adenocarcinoma (225 men; 258 smokers) studied from 2001 to 2005 in a single center. We investigated the association of densities of intratumoral mature dendritic cells (mDCs), CD8(+) T cells, neutrophils, and macrophages with clinical and pathological variables and tumor cell mutation profiles obtained by next-generation sequencing. In 282 tumors, we found 460 mutations, mainly in TP53 (59%), KRAS (40%), STK11 (24%), and EGFR (14%). Intratumoral CD8(+) T-cell density was high in smokers (P = 0.02) and TP53-mutated tumors (P = 0.02) and low in BRAF-mutated tumors (P = 0.005). Intratumoral mDC density was high with low pathological tumor stage (P = 0.01) and low with STK11 mutation (P = 0.004). Intratumoral neutrophil density was high and low with BRAF mutation (P = 0.04) and EGFR mutation (P = 0.02), respectively. Intratumoral macrophage density was low with EGFR mutation (P = 0.01). Intratumoral CD8(+) T-cell and mDC densities remained strong independent markers of overall survival (P = 0.001 and P = 0.02, respectively). Intratumoral immune cell densities (mDCs, CD8(+) T cells, neutrophils, macrophages) were significantly associated with molecular alterations in adenocarcinoma underlying the interactions between cancer cells and their microenvironment.

  3. Cyclopedic protein expression analysis of cultured canine mammary gland adenocarcinoma cells from six tumours.

    Science.gov (United States)

    Nakagawa, T; Watanabe, M; Ohashi, E; Uyama, R; Takauji, S; Mochizuki, M; Nishimura, R; Ogawa, H; Sugano, S; Sasaki, N

    2006-06-01

    We characterised cultured canine mammary gland adenocarcinoma cells by exhaustive step protein expression analysis to identify factors associated with tumour progression or metastasis of canine mammary gland tumour. Cultured adenocarcinoma cells derived from a total of 3 primary and 3 metastatic lesions from 3 dogs (CHMp/m, CIPp/m and CNMp/m, where CHM, CIP, and CNM indicate the 3 animals) were used in this study. The expression of 24 proteins reported to be related to tumourigenesis or malignancy of human breast cancers were examined by Western blot analysis using 24 antibodies. The expression of sialyl Lewis X [sLe(x)] was only observed in CHMm cells, which were derived from pleural effusion. This expression was further confirmed by immunohistochemistry. The levels of some factors, such as 14-3-3sigma, cyclinD1 and Rb, differed among cells or between the primary and metastatic cells in the pair. Though the difference in their expression was not consistent within the cells from primary and metastatic origin, this characterisation should provide useful information for further molecular analysis of these cultured cells. Since some of the factors, such as sLe(x), 14-3-3sigma, cyclinD1 and Rb, showed different levels of expression in the pair, these cultured cells might be meaningful tools for clarification of distant metastasis in canine mammary gland tumours.

  4. Self-renewing Pten-/- TP53-/- protospheres produce metastatic adenocarcinoma cell lines with multipotent progenitor activity.

    Directory of Open Access Journals (Sweden)

    Wassim Abou-Kheir

    Full Text Available Prostate cancers of luminal adenocarcinoma histology display a range of clinical behaviors. Although most prostate cancers are slow-growing and indolent, a proportion is aggressive, developing metastasis and resistance to androgen deprivation treatment. One hypothesis is that a portion of aggressive cancers initiate from stem-like, androgen-independent tumor-propagating cells. Here we demonstrate the in vitro creation of a mouse cell line, selected for growth as self-renewing stem/progenitor cells, which manifests many in vivo properties of aggressive prostate cancer. Normal mouse prostate epithelium containing floxed Pten and TP53 alleles was subjected to CRE-mediated deletion in vitro followed by serial propagation as protospheres. A polyclonal cell line was established from dissociated protospheres and subsequently a clonal daughter line was derived. Both lines demonstrate a mature luminal phenotype in vitro. The established lines contain a stable minor population of progenitor cells with protosphere-forming ability and multi-lineage differentiation capacity. Both lines formed orthotopic adenocarcinoma tumors with metastatic potential to lung. Intracardiac inoculation resulted in brain and lung metastasis, while intra-tibial injection induced osteoblastic bone formation, recapitulating the bone metastatic phenotype of human prostate cancer. The cells showed androgen receptor dependent growth in vitro. Importantly, in vivo, the deprivation of androgens from established orthotopic tumors resulted in tumor regression and eventually castration-resistant growth. These data suggest that transformed prostate progenitor cells preferentially differentiate toward luminal cells and recapitulate many characteristics of the human disease.

  5. Aptamer based electrochemical sensor for detection of human lung adenocarcinoma A549 cells

    Science.gov (United States)

    Sharma, Rachna; Varun Agrawal, Ved; Sharma, Pradeep; Varshney, R.; Sinha, R. K.; Malhotra, B. D.

    2012-04-01

    We report results of the studies relating to development of an aptamer-based electrochemical biosensor for detection of human lung adenocarcinoma A549 cells. The aminated 85-mer DNA aptamer probe specific for the A549 cells has been covalently immobilized onto silane self assembled monolayer (SAM) onto ITO surface using glutaraldehyde as the crosslinker. The results of cyclic voltammetry and differential pulse voltammetry studies reveal that the aptamer functionalized bioelectrode can specifically detect lung cancer cells in the concentration range of 103 to 107 cells/ml with detection limit of 103 cells/ml within 60 s. The specificity studies of the bioelectrode have been carried out with control KB cells. No significant change in response is observed for control KB cells as compared to that of the A549 target cells.

  6. Mixed Large Cell Neuroendocrine Carcinoma and Adenocarcinoma with Spindle Cell and Clear Cell Features in the Extrahepatic Bile Duct

    Directory of Open Access Journals (Sweden)

    John Wysocki

    2014-01-01

    Full Text Available Mixed adenoneuroendocrine carcinomas, spindle cell carcinomas, and clear cell carcinomas are all rare tumors in the biliary tract. We present the first case, to our knowledge, of an extrahepatic bile duct carcinoma composed of all three types. A 65-year-old man with prior cholecystectomy presented with painless jaundice, vomiting, and weight loss. CA19-9 and alpha-fetoprotein (AFP were elevated. Cholangioscopy revealed a friable mass extending from the middle of the common bile duct to the common hepatic duct. A bile duct excision was performed. Gross examination revealed a 3.6 cm intraluminal polypoid tumor. Microscopically, the tumor had foci of conventional adenocarcinoma (CK7-positive and CA19-9-postive surrounded by malignant-appearing spindle cells that were positive for cytokeratins and vimentin. Additionally, there were separate areas of large cell neuroendocrine carcinoma (LCNEC. Foci of clear cell carcinoma merged into both the LCNEC and the adenocarcinoma. Tumor invaded through the bile duct wall with extensive perineural and vascular invasion. Circumferential margins were positive. The patient’s poor performance status precluded adjuvant therapy and he died with recurrent and metastatic disease 5 months after surgery. This is consistent with the reported poor survival rates of biliary mixed adenoneuroendocrine carcinomas.

  7. Low-Dose Cadmium Upregulates VEGF Expression in Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Fuhong Liu

    2015-08-01

    Full Text Available Cadmium (Cd is a heavy metal and environmental toxin. Exposure to Cd has been associated with a variety of human cancers. In this study, we performed in vitro assays to examine the effects of cadmium chloride (CdCl2 on A549 cells, a human lung adenocarcinoma cell line. Cd does not affect proliferation, migration, or apoptosis of A549 cells at concentrations of 0.1–10 μM. At 0.5 and 1 μM, Cd increases the expression of vascular endothelial growth factor (VEGF (p < 0.05, p < 0.01, respectively, but not basic fibroblast growth factor (b-FGF in A549 cells. The conditioned media were collected from the A549 cells treated with 1 μM Cd and were co-cultured with human umbilical vein endothelial cells (HUVECs. Upon treatment with the conditioned media, the proliferation and migration of HUVECs significantly increased (p < 0.01, p < 0.05, respectively, while apoptosis remained unchanged. In addition, 1 μM Cd increases the level of hypoxia inducible factor 1-α (HIF1-α, which is a positive regulator of VEGF expression. Although low-dose Cd does not directly affect the growth of lung adenocarcinoma cells, it might facilitate the development of tumors through its pro-angiogenic effects.

  8. Hypoxia Upregulates the Expression of Annexin A1 in Lung Adenocarcinoma A549 Cells

    Directory of Open Access Journals (Sweden)

    Zhenhong HU

    2012-05-01

    Full Text Available Background and objective The growth of tumor often faced up with lackness of blood and oxygen, and it has been reported that Annexin A1 may be involved in tumor. The aim of this investigation is to explore the characteristics of expression of Annexin A1 in lung adenocarcinoma A549 cells after hypoxia. Methods A549 cells were exposured to either normoxia (21%O2 or hypoxia (1%O2 condition for 4 h, 12 h, 24 h. The expressions of Annexin A1 mRNA levels were measured by RT-PCR. The expressions of Annexin 1 protein were investigaged by Western blot. The relative content of reactive oxygen species (ROS were assayed by special kit. The expressions of nuclear translocation of NF-κB was assayed by Western blot; After been treated with ROS scavenger NAC and PDTC, the levels of Annexin 1 protein of A549 cells were measured by Western blot. Results Compared with normoxia group, the Annexin A1 mRNA in hypoxia group increased after 4 h, and then decreased gradually; Moreover, Annexin 1 protein levels of A549 cells were also increased when treated with hypoxia. An increaing of ROS production in cells exprosed to hypoxia was detected. NAC and PDTC inhibited hypoxia-induced Annexin A1 increase. Conclusion Hypoxia upregulates the expression of Annexin A1 in lung adenocarcinoma A549 cells, in which process ROS-NF-κB may paticipate in.

  9. In vivo gene transfer targeting in pancreatic adenocarcinoma with cell surface antigens

    Directory of Open Access Journals (Sweden)

    Lafitte Marie

    2012-10-01

    Full Text Available Abstract Background Pancreatic ductal adenocarcinoma is a deadly malignancy resistant to current therapies. It is critical to test new strategies, including tumor-targeted delivery of therapeutic agents. This study tested the possibility to target the transfer of a suicide gene in tumor cells using an oncotropic lentiviral vector. Results Three cell surface markers were evaluated to target the transduction of cells by lentiviruses pseudotyped with a modified glycoprotein from Sindbis virus. Only Mucin-4 and the Claudin-18 proteins were found efficient for targeted lentivirus transductions in vitro. In subcutaneous xenografts of human pancreatic cancer cells models, Claudin-18 failed to achieve efficient gene transfer but Mucin-4 was found very potent. Human pancreatic tumor cells were modified to express a fluorescent protein detectable in live animals by bioimaging, to perform a direct non invasive and costless follow up of the tumor growth. Targeted gene transfer of a bicistronic transgene bearing a luciferase gene and the herpes simplex virus thymidine kinase gene into orthotopic grafts was carried out with Mucin-4 oncotropic lentiviruses. By contrast to the broad tropism VSV-G carrying lentivirus, this oncotropic lentivirus was found to transduce specifically tumor cells, sparing normal pancreatic cells in vivo. Transduced cells disappeared after ganciclovir treatment while the orthotopic tumor growth was slowed down. Conclusion This work considered for the first time three aspect of pancreatic adenocarcinoma targeted therapy. First, lentiviral transduction of human pancreatic tumor cells was possible when cells were grafted orthotopically. Second, we used a system targeting the tumor cells with cell surface antigens and sparing the normal cells. Finally, the TK/GCV anticancer system showed promising results in vivo. Importantly, the approach presented here appeared to be a safer, much more specific and an as efficient way to perform gene

  10. Bax is not involved in the resveratrol-induced apoptosis in human lung adenocarcinoma cells

    Science.gov (United States)

    Zhang, Wei-wei; Wang, Zhi-ping; Chen, Tong-sheng

    2010-02-01

    Resveratrol (RV) is a natural plant polyphenol widely present in foods such as grapes, wine, and peanuts. Previous studies indicate that RV has an ability to inhibit various stages of carcinogenesis and eliminate preneoplastic cells in vitro and in vivo. However, little is known about the molecular mechanism of RV-induced apoptosis in human lung adenocarcinoma (ASTC-a-1) cell. In this report, we analyzed whether Bax translocation from cytoplasm to mitochondria during RV-induced apoptosis in single living cell using onfocal microscopey. Cells were transfected with GFP-Bax plasmid. Cell counting kit (CCK-8) assay was used to assess the inhibition of RV on the cells viability. Apoptotic activity of RV was detected by Hoechst 33258 and propidium iodide (PI) staining. Our results showed that RV induced a dose-dependent apoptosis in which Bax did not translocate to mitochondrias.

  11. Expression of C4.4A in precursor lesions of pulmonary adenocarcinoma and squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Santoni-Rugiu, Eric; Illemann, Martin

    2012-01-01

    The protein C4.4A, a structural homologue of the urokinase-type plasminogen activator receptor, is a potential new biomarker in non-small cell lung cancer, with high levels of expression recently shown to correlate to poor survival of adenocarcinoma patients. In this study, C4.4A immunoreactivity...... in precursor lesions of lung squamous cell carcinoma and adenocarcinoma was investigated by stainings with a specific anti-C4.4A antibody. In the transformation from normal bronchial epithelium to squamous cell carcinoma, C4.4A was weakly expressed in basal cell hyperplasia but dramatically increased...... finding that C4.4A expression levels do not provide prognostic information on the survival of squamous cell carcinoma patients. In the progression from normal alveolar epithelium to peripheral adenocarcinoma, we observed an unexpected, distinct cytoplasmic staining for C4.4A in a fraction of atypical...

  12. Inhibitory effect of piperine on Helicobacter pylori growth and adhesion to gastric adenocarcinoma cells.

    Science.gov (United States)

    Tharmalingam, Nagendran; Kim, Sa-Hyun; Park, Min; Woo, Hyun Jun; Kim, Hyun Woo; Yang, Ji Yeong; Rhee, Ki-Jong; Kim, Jong Bae

    2014-01-01

    Piperine is a compound comprising 5-9% of black pepper (Piper nigrum), which has a variety of biological roles related to anticancer activities. Helicobacter pylori has been classified as a gastric carcinogen, because it causes gastritis and gastric cancer by injecting the virulent toxin CagA and translocating VacA. The present study investigated the inhibitory action of piperine on H. pylori growth and adhesion. Inhibition of H. pylori growth was determined by the broth macrodilution method, and adhesion to gastric adenocarcinoma cells validated by urease assay. Motility test was performed by motility agar and the expression of adhesion gene and flagellar gene in response to the piperine treatment was assessed by RT-PCR and immunoblotting. Administrated piperine suppressed the level of H. pylori adhesion to gastric adenocarcinoma cells in a dose dependent manner and the inhibition was statistically significant as determined by Student's t-test. In addition, piperine treatment effects on the flagellar hook gene flgE and integral membrane component of the export apparatus gene flhA expression to be suppressed and piperine diminished the H. pylori motility. flhA, encodes an integral membrane component of the export apparatus, which is also one of the regulatory protein in the class 2 genes expression and flgE is one of them that encodes hook part of the flagella. Suppression of both genes, leads to less motility results in the organism attracted less towards to the gastric epithelial cells might be the possible reason in the adhesion inhibition. To our knowledge, this is the first report published on the inhibitory effects of piperine against the adhesion of H. pylori to gastric adenocarcinoma cells.

  13. Sulforaphane-induced apoptosis in Xuanwei lung adenocarcinoma cell line XWLC-05.

    Science.gov (United States)

    Zhou, Lan; Yao, Qian; Li, Yan; Huang, Yun-Chao; Jiang, Hua; Wang, Chuan-Qiong; Fan, Lei

    2017-01-01

    Xuanwei district in Yunnan Province has the highest incidence of lung cancer in China, especially among non-smoking women. Cruciferous vegetables can reduce lung cancer risk by prompting a protective mechanism against respiratory tract inflammation caused by air pollution, and are rich in sulforaphane, which can induce changes in gene expression. We investigated the effect of sulforaphane-induced apoptosis in Xuanwei lung adenocarcinoma cell line (XWCL-05) to explore the value of sulforaphane in lung cancer prevention and treatment. Cell growth inhibition was determined by methyl thiazolyl tetrazolium assay; cell morphology and apoptosis were observed under transmission electron microscope; cell cycle and apoptosis rates were detected using flow cytometry; B-cell lymphoma 2 (Bcl-2) and Bcl-2-like protein 4 (Bax) messenger RNA expression were determined by quantitative PCR; and p53, p73, p53 upregulated modulator of apoptosis (PUMA), Bax, Bcl-2, and caspase-9 protein expression were detected by Western blotting. Sulforaphane inhibited XWLC-05 cell growth with inhibitory concentration (IC)50 of 4.04, 3.38, and 3.02 μg/mL at 24, 48, and 72 hours, respectively. Sulforaphane affected the XWLC-05 cell cycle as cells accumulated in the G2/M phase. The proportion of apoptotic cells observed was 27.6%. Compared with the control, the sulforaphane group showed decreased Bcl-2 and p53 expression, and significantly increased p73, PUMA, Bax, and caspase-9 protein expression (P Sulforaphane induces Xuanwei lung adenocarcinoma cell apoptosis. Its possible mechanism may involve the upregulation of p73 expression and its effector target genes PUMA and Bax in lung cancer cells, downregulation of the anti-apoptotic gene B cl -2, and activation of caspase-9. It may also involve downregulation of the mutant p53 protein. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  14. Different molecular organization of two carotenoids, lutein and zeaxanthin, in human colon epithelial cells and colon adenocarcinoma cells

    Science.gov (United States)

    Grudzinski, Wojciech; Piet, Mateusz; Luchowski, Rafal; Reszczynska, Emilia; Welc, Renata; Paduch, Roman; Gruszecki, Wieslaw I.

    2018-01-01

    Two cell lines, human normal colon epithelial cells (CCD 841 CoTr) and human colon adenocarcinoma cells (HT-29) were cultured in the presence of exogenous carotenoids, either zeaxanthin or lutein. Both carotenoids demonstrated cytotoxicity with respect to cancer cells but not to normal cells. Cells from both the cell lines were analyzed with application of fluorescence lifetime imaging microscopy and Raman scattering microscopy. Both imaging techniques show effective incorporation of carotenoid molecules into growing cells. Comparison of the Raman scattering and fluorescence lifetime characteristics reveals different molecular organization of carotenoids in the carcinoma and normal cells. The main difference consists in a carotenoid aggregation level which is substantially lower in the carcinoma cells as compared to the normal cells. Different molecular organization of carotenoids was interpreted in terms of a different metabolism of normal and carcinoma cells and has been concluded to provide a possibility of cancer diagnosis based on spectroscopic analyses.

  15. Echinophora platyloba DC (Apiaceae crude extract induces apoptosis in human prostate adenocarcinoma cells (PC 3

    Directory of Open Access Journals (Sweden)

    Fatemeh Zare Shahneh

    2014-10-01

    Full Text Available Background: Prostate cancer is the second leading malignancy worldwide and the second prominent cause of cancer-related deaths among men. Therefore, there is a serious necessity for finding advanced alternative therapeutic measures against this lethal malignancy. In this article, we report the cytotoxicity and the mechanism of cell death of the methanolic extract prepared from Echinophora platyloba DC plant against human prostate adenocarcinoma PC 3 cell line and Human Umbilical Vein Endothelial Cells HUVEC cell line. Methods: Cytotoxicity and viability of the methanolic extract were assessed by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and dye exclusion assay. Cell death enzyme-linked immunosorbent assay (ELISA was employed to quantify the nucleosome production resulting from nuclear DNA fragmentation during apoptosis and determine whether the mechanism involves induction of apoptosis or necrosis. The cell death was identified as apoptosis using terminal deoxynucleotidyl transferase (TdT-mediated dUTP nick end labeling (TUNEL assay and DNA fragmentation gel electrophoresis. Results: E. platyloba could decrease cell viability in malignant cells in a dose- and time-dependent manner. The IC50 values against PC 3 were determined as 236.136 ± 12.4, 143.400 ± 7.2, and 69.383 ± 1.29 μg/ml after 24, 36, and 48 h, respectively, but there was no significant activity in HUVEC normal cell (IC50 > 800 μg/ml. Morphological characterizations and DNA laddering assay showed that the methanolic extract treated cells displayed marked apoptotic characteristics such as nuclear fragmentation, appearance of apoptotic bodies, and DNA laddering fragment. Increase in an early apoptotic population was observed in a dose-dependent manner. PC 3 cell death elicited by the extract was found to be apoptotic in nature based a clear indication of TUNEL assay and gel electrophoresis DNA fragmentation, which is a hallmark of apoptosis

  16. Infrared light-absorbing gold/gold sulfide nanoparticles induce cell death in esophageal adenocarcinoma

    Science.gov (United States)

    Li, Yan; Gobin, Andre M; Dryden, Gerald W; Kang, Xinqin; Xiao, Deyi; Li, Su Ping; Zhang, Guandong; Martin, Robert CG

    2013-01-01

    Gold nanoparticles and near infrared-absorbing light are each innocuous to tissue but when combined can destroy malignant tissue while leaving healthy tissue unharmed. This study investigated the feasibility of photothermal ablation therapy for esophageal adenocarcinoma using chitosan-coated gold/gold sulfide (CS-GGS) nanoparticles. A rat esophagoduodenal anastomosis model was used for the in vivo ablation study, and three human esophageal cell lines were used to study the response of cancer cells and benign cells to near infrared light after treatment with CS-GGS. The results indicate that both cancerous tissue and cancer cells took up more gold nanoparticles and were completely ablated after exposure to near infrared light. The benign tissue and noncancerous cells showed less uptake of these nanoparticles, and remained viable after exposure to near infrared light. CS-GGS nanoparticles could provide an optimal endoluminal therapeutic option for near infrared light ablation of esophageal cancer. PMID:23818775

  17. A case of clear cell adenocarcinoma arising from the urethral diverticulum: Utility of urinary cytology and immunohistochemistry

    Directory of Open Access Journals (Sweden)

    Shin-ichi Nakatsuka

    2012-01-01

    Full Text Available Carcinomas rarely arise from the urethral diverticulum. In this report, we present a case of clear cell adenocarcinoma arising from the urethral diverticulum. A 42-year-old woman complained of bloody discharge and lower back pain. Imaging studies showed a tumor involving the region surrounding the urethra and cystourethroscopy showed papillary and villous tumors in the urethral diverticula. Cytology of the urine sediment showed papillary or spherical clusters of atypical cells, some of which had clear abundant cytoplasm and formed mirror ball-like clusters, suggesting adenocarcinoma. Although histological diagnosis was indeterminate by biopsy and transurethral resection (TUR because of absence of stromal invasion, surgically resected specimen via cysturethrectomy revealed that the tumor was clear cell carcinoma. Urinary cytological findings and immunohistochemical analysis for CD15, Ki-67, and p53 might be useful for accurate diagnosis of clear cell adenocarcinoma that arises from the urethral diverticulum when sufficient materials are not available by biopsy and TUR.

  18. MicroRNA-449a enhances radiosensitivity in CL1-0 lung adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Yi-Jyun Liu

    Full Text Available Lung cancer is the leading cause of cancer-related mortality worldwide. Radiotherapy is often applied for treating lung cancer, but it often fails because of the relative non-susceptibility of lung cancer cells to radiation. MicroRNAs (miRNAs have been reported to modulate the radiosensitivity of lung cancer cells and have the potential to improve the efficacy of radiotherapy. The purpose of this study was to identify a miRNA that can adjust radiosensitivity in lung adenocarcinoma cells. Two lung adenocarcinoma cell lines (CL1-0 and CL1-5 with different metastatic ability and radiosensitivity were used. In order to understand the regulatory mechanisms of differential radiosensitivity in these isogenic tumor cells, both CL1-0 and CL1-5 were treated with 10 Gy radiation, and were harvested respectively at 0, 1, 4, and 24 h after radiation exposure. The changes in expression of miRNA upon irradiation were examined using Illumina Human microRNA BeadChips. Twenty-six miRNAs were identified as having differential expression post-irradiation in CL1-0 or CL1-5 cells. Among these miRNAs, miR-449a, which was down-regulated in CL1-0 cells at 24 h after irradiation, was chosen for further investigation. Overexpression of miR-449a in CL1-0 cells effectively increased irradiation-induced DNA damage and apoptosis, altered the cell cycle distribution and eventually led to sensitization of CL1-0 to irradiation.

  19. An embryonic stem cell-like signature identifies poorly differentiated lung adenocarcinoma but not squamous cell carcinoma.

    Science.gov (United States)

    Hassan, Khaled A; Chen, Guoan; Kalemkerian, Gregory P; Wicha, Max S; Beer, David G

    2009-10-15

    An embryonic stem cell (ESC) profile correlates with poorly differentiated breast, bladder, and glioma cancers. In this article, we assess the correlation between the ESC profile and clinical variables in lung cancer. Microarray gene expression analysis was done using Affymetrix Human Genome U133A on 443 samples of human lung adenocarcinoma and 130 samples of squamous cell carcinoma (SCC). To identify gene set enrichment patterns, we used the Genomica software. Our analysis showed that an increased expression of the ESC gene set and a decreased expression of the Polycomb target gene set identified poorly differentiated lung adenocarcinoma. In addition, this gene expression signature was associated with markers of poor prognosis and worse overall survival in lung adenocarcinoma. However, there was no correlation between this ESC gene signature and any histologic or clinical variable assessed in lung SCC. This work suggests that not all poorly differentiated non-small cell lung cancers exhibit a gene expression profile similar to that of ESC, and that other characteristics may play a more important role in the determination of differentiation and survival in SCC of the lung.

  20. Role of coagulation in the recruitment of colon adenocarcinoma cells to thrombus under shear.

    Science.gov (United States)

    Baker-Groberg, Sandra M; Itakura, Asako; Gruber, András; McCarty, Owen J T

    2013-11-01

    Colorectal cancer metastases can appear on the peritoneum and in lymph nodes, liver, and lungs, suggesting both hematogenous and lymphatic spreading of the primary tumor. While antithrombotic agents have been shown to reduce both long-term incidence and metastasis, the role of coagulation in facilitating metastasis is ill defined. We investigated the kinetics and molecular mechanisms of metastatic colon adenocarcinoma cell recruitment to thrombi under shear flow, ex vivo. Platelet aggregates were formed by perfusing citrated anticoagulated whole blood over immobilized fibrinogen or fibrillar collagen. Thrombi were formed by perfusing recalcified whole blood over fibrinogen or fibrillar collagen in the presence of coagulation. Cultured colon adenocarcinoma cells (SW620) were perfused either during or following platelet aggregate or thrombus formation. The degree of transient tumor cell interactions (recruitment, rolling, and release) and the number of firmly adhered tumor cells were quantified using fluorescence microscopy. Platelet aggregates and thrombi formed on either fibrinogen- or fibrillar-collagen supported SW620 cell interactions and adhesion under shear. Thrombi or fibrin supported a greater degree of SW620 cell interactions and adhesion compared with platelet aggregates or fibrinogen, respectively, demonstrating that coagulation promoted SW620 cell recruitment under shear. Interestingly, in the absence of anticoagulation, we observed SW620 preferentially binding to thrombus-bound polymorphonuclear leukocytes (PMNs). The addition of purified PMNs to thrombi resulted in a doubling of the number of interacting and bound SW620 cells. Since thrombi often accumulate and activate leukocytes, our findings suggest that leukocytes may play a role in localizing metastases to sites of thrombogenesis.

  1. Inverse Relationship Between Leydig Cell Density and Metastatic Potential of Prostatic Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    W. John Wang

    1999-01-01

    Full Text Available Purpose: Evaluate the relationship between metastatic potential of prostatic adenocarcinoma (PC and testicular Leydig cell density. Materials and methods: Tissue samples from 111 men, age 52–85, with PC and bilateral orchiectomy were evaluated for Leydig cell density. The patients were divided into two groups: Group A were patients with metastasis (n=36 and Group B were patients without metastasis (n=75. Leydig cell density was determined by direct manual microscopic cell count on the tissue sections. The means of cell counts by four pathologists, expressed as cell/0.78 mm2 were used for analysis. The normally distributed data were analyzed by two‐tail Student’s t‐test. Thirty‐eight age‐compatible autopsy cases who died of unrelated causes served as normal controls. Results: The mean of Leydig cell count in group A patients was 14.43 (14.43 ± 1.19 SE. Mean of Group B was 47.05 (47.05 ± 4.05 SE whereas normal controls displayed a mean of 48.66 (48.66 ± 2.94 SE. Group A was significantly different from control (p0.75. Conclusions: Patients with metastatic adenocarcinoma of prostate, as a group, have a significantly lower Leydig cell density than patients without metastasis or patients without PC in compatible age groups. The hormonal relationship between this observation is however unknown. One possible explanation is that PC subpopulation with metastatic potential may require different level of endogenous androgen or are androgen‐independent.

  2. [Long-term survival of metastatic clear cell adenocarcinoma of the female urethra by multidisciplinary treatment: a case report].

    Science.gov (United States)

    Suzuki, Takahisa; Furuse, Hiroshi; Kurita, Yutaka; Imanishi, Takeshi; Tamura, Keita; Otsuka, Atsushi; Mugiya, Soichi; Ozono, Seiichiro

    2013-05-01

    We report a case of clear cell adenocarcinoma of the female urethra. A 57-year-old woman presented with complaint of gross hematuria. Abdominal ultrasonography, cystourethroscopy, computed tomography (CT) and magnetic resonance imaging (MRI) revealed the urethral tumor was invasive to bladder neck. Clinical stage was determined as cT3N1M0, then anterior pelvic exenteration and ileal conduit formation were performed. The pathological diagnosis was clear cell adenocarcinoma of urethra and the stage was pT3N1. The patient received TS-1 and cisplatin for postoperative recurrence, but she died from multiple lung metastasis 54 months after the operation. Clear cell adenocarcinoma of the female urethra is rare case in the Japanese literatures. Pathogenesis and management of this rare condition are discussed.

  3. Plant extracts as natural photosensitizers in photodynamic therapy: in vitro activity against human mammary adenocarcinoma MCF-7 cells

    Directory of Open Access Journals (Sweden)

    Rigo Baluyot Villacorta

    2017-04-01

    Conclusions: Two of the plant extracts used, L. racemosa and A. procera were toxic and induced apoptosis to mammary cell adenocarcinoma, MCF-7 when photoactivated. These extracts were also more toxic to human cancer than non-cancer cell lines.

  4. Cell-free DNA promoter hypermethylation in plasma as a diagnostic marker for pancreatic adenocarcinoma.

    Science.gov (United States)

    Henriksen, Stine Dam; Madsen, Poul Henning; Larsen, Anders Christian; Johansen, Martin Berg; Drewes, Asbjørn Mohr; Pedersen, Inge Søkilde; Krarup, Henrik; Thorlacius-Ussing, Ole

    2016-01-01

    Pancreatic cancer has a 5-year survival rate of only 5-7%. Difficulties in detecting pancreatic cancer at early stages results in the high mortality and substantiates the need for additional diagnostic tools. Surgery is the only curative treatment and unfortunately only possible in localized tumours. A diagnostic biomarker for pancreatic cancer will have a major impact on patient survival by facilitating early detection and the possibility for curative treatment. DNA promoter hypermethylation is a mechanism of early carcinogenesis, which can cause inactivation of tumour suppressor genes. The aim of this study was to examine promoter hypermethylation in a panel of selected genes from cell-free DNA, as a diagnostic marker for pancreatic adenocarcinoma. Patients with suspected or biopsy-verified pancreatic cancer were included prospectively and consecutively. Patients with chronic/acute pancreatitis were included as additional benign control groups. Based on an optimized accelerated bisulfite treatment protocol, methylation-specific PCR of a 28 gene panel was performed on plasma samples. A diagnostic prediction model was developed by multivariable logistic regression analysis using backward stepwise elimination. Patients with pancreatic adenocarcinoma ( n  = 95), chronic pancreatitis ( n  = 97) and acute pancreatitis ( n  = 59) and patients screened, but negative for pancreatic adenocarcinoma ( n  = 27), were included. The difference in mean number of methylated genes in the cancer group (8.41 (95% CI 7.62-9.20)) vs the total control group (4.74 (95% CI 4.40-5.08)) was highly significant ( p  diagnostic prediction model (age >65, BMP3 , RASSF1A , BNC1 , MESTv2 , TFPI2 , APC , SFRP1 and SFRP2 ) had an area under the curve of 0.86 (sensitivity 76%, specificity 83%). The model performance was independent of cancer stage. Cell-free DNA promoter hypermethylation has the potential to be a diagnostic marker for pancreatic adenocarcinoma and differentiate

  5. Synchronous double primary squamous cell carcinoma and adenocarcinoma of the extrahepatic bile duct: a case report.

    Science.gov (United States)

    Yoo, Youngsun; Mun, Seongpyo

    2015-05-19

    Synchronous double cancers of the bile duct are exceptionally rare. We here report a case of synchronous squamous cell carcinoma and adenocarcinoma of the extrahepatic bile duct. A 67-year-old Asian man visited our clinic complaining of jaundice and dark urine. Direct hyperbilirubinemia and an elevated cancer antigen 19-9 level were detected. Preoperative abdominal computed tomography and positron emission tomography showed two masses at the bifurcation of the common hepatic duct and at the distal common bile duct. After biliary drainage, we performed radical pylorus-preserving pancreaticoduodenectomy, without resection margin involvement. Pathological findings revealed that the proximal lesion was a squamous cell carcinoma and that the distal lesion was an adenocarcinoma. Both cholangiocarcinomas were confined to the fibromuscular layer, and there was no communication between the two tumors. Multiple conglomerated metastatic tumors were detected in his liver 3 months after surgery. He died 8 months after diagnosis. The disease displayed very aggressive behavior and a very poor prognosis. The only chance for long-term survival is treatment with radical resection. Preoperative positron emission tomography-computed tomography is useful in detecting occult cancer.

  6. High fluence laser irradiation induces reactive oxygen species generation in human lung adenocarcinoma cells

    Science.gov (United States)

    Wang, Fang; Xing, Da; Chen, Tong-Sheng

    2006-09-01

    Low-power laser irradiation (LPLI) has been used for therapies such as curing spinal cord injury, healing wound et al. Yet, the mechanism of LPLI remains unclear. Our previous study showed that low fluences laser irradiation induces human lung adenocarcinoma cells (ASTC-a-1) proliferation, but high fluences induced apoptosis and caspase-3 activation. In order to study the mechanism of apoptosis induced by high fluences LPLI further, we have measured the dynamics of generation of reactive oxygen species (ROS) using H IIDCFDA fluorescence probes during this process. ASTC-a-1 cells apoptosis was induced by He-Ne laser irradiation at high fluence of 120J/cm2. A confocal laser scanning microscope was used to perform fluorescence imaging. The results demonstrated that high fluence LPLI induced the increase of mitochondria ROS. Our studies contribute to clarify the biological mechanism of high fluence LPLI-induced cell apoptosis.

  7. Telomere maintenance in laser capture microdissection-purified Barrett's adenocarcinoma cells and effect of telomerase inhibition in vivo

    Science.gov (United States)

    Shammas, Masood A; Qazi, Aamer; Batchu, Ramesh B; Bertheau, Robert C; Wong, Jason YY; Rao, Manjula Y; Prasad, Madhu; Chanda, Diptiman; Ponnazhagan, Selvarangan; Anderson, Kenneth C; Steffes, Christopher P; Munshi, Nikhil C; De Vivo, Immaculata; Beer, David G.; Gryaznov, Sergei; Weaver, Donald W; Goyal, Raj K

    2009-01-01

    Purpose: The aims of this study were to investigate telomere function in normal and Barrett's esophageal adenocarcinoma (BEAC) cells purified by laser capture microdissection (LCM) and to evaluate the impact of telomerase inhibition in cancer cells in vitro and in vivo. Experimental Design: Epithelial cells were purified from surgically resected esophagi. Telomerase activity was measured by modified “Telomeric Repeat Amplification Protocol” and telomere length determined by Real-Time PCR assay. To evaluate the impact of telomerase inhibition, adenocarcinoma cell lines were continuously treated with a specific telomerase inhibitor (GRN163L) and live cell number determined weekly. Apoptosis was evaluated by annexin labeling and senescence by beta-galactosidase staining. For in vivo studies, SCID-mice were subcutaneously inoculated with adenocarcinoma cells and following appearance of palpable tumors, injected intraperitoneally with saline or GRN163L. Results: Telomerase activity was significantly elevated whereas telomeres were shorter in BEAC cells relative to normal esophageal epithelial cells. The treatment of adenocarcinoma cells with telomerase inhibitor, GRN163L, led to loss of telomerase activity, reduction in telomere length, and growth arrest through induction of both the senescence and apoptosis. GRN163L induced cell death could also be expedited by addition of chemotherapeutic agents, doxorubicin and ritonavir. Finally, the treatment with GRN163L led to a significant reduction in tumor volume in a subcutaneous tumor model. Conclusions: We show that telomerase activity is significantly elevated whereas telomeres are shorter in BEAC and suppression of telomerase inhibits proliferation of adenocarcinoma cells both in vitro and in vivo. PMID:18676772

  8. Establishment of A Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang3 and Its Real Bone Metastasis Clone CPA-Yang3BM in Immunodeficient Mice

    Directory of Open Access Journals (Sweden)

    Shunfang YANG

    2011-02-01

    Full Text Available Background and objective The recurrence and metastasis of lung cancer is a tough problem worldwide. The aim of this study is to establish a novel Chinese lung adenocarcinoma cell line and its real bone-seeking clone sub-line for exploring the molecular mechanism of lung cancer metastasis. Methods The cells came from the pleural effusion of a sixtyfive years old female patient with lung adenocarcinoma and supraclavicular lymph node metastases. The gene expression was detected by real-time quantitative PCR. Intracardiac injection of the cells into nude mice was performed and in vivo imaging was obtained by bone scintigraphy and conventional radiography. Bone metastases were determined on bone scintigraphy and then the lesions were resected under deep anesthesia for bone metastasis cancer cell culture. The process was repeated for four cycles to obtain a real bone-seeking clone. Results The tumorigenesis rate started at 4th passage in immunodeficient mice via subcutaneously and as well as later passages. Approximately 1×106 cancer cells were injected into left cardiac ventricle of immunodeficient mice resulted bone metastasis sites were successfully revealed by bone scintigraphy and pathological diagnosis, the mandible (100%, scapula (33%, humerus (50%, vertebral column (50%, femur (66.7% and accompanied invasion with other organs, the adrenal gland (17%, pulmonary (33%, liver (50%, submaxillary gland (33% in the mice after inoculation two-three weeks. The chromosome karyotype analysis of the cells was subdiploid. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR, SVIL, FN1 genes were overexpress. The novel cell was named CPA-Yang3. The femur metastasis cell was repeated in vivo-in vitro-in vivo with three cycles and harvested a real bone metastasis clone. It was named CPA-Yang3BM. Conclusion Tne characteristics of novel strain CPAYang3 is a highly metastasis cell line of

  9. Detection of Merkel cell polyomavirus in cervical squamous cell carcinomas and adenocarcinomas from Japanese patients

    Directory of Open Access Journals (Sweden)

    Imajoh Masayuki

    2012-08-01

    Full Text Available Abstract Background Merkel cell polyomavirus (MCPyV was identified originally in Merkel cell carcinoma (MCC, a rare form of human skin neuroendocrine carcinoma. Evidence of MCPyV existence in other forms of malignancy such as cutaneous squamous cell carcinomas (SCCs is growing. Cervical cancers became the focus of our interest in searching for potentially MCPyV-related tumors because: (i the major histological type of cervical cancer is the SCC; (ii the uterine cervix is a common site of neuroendocrine carcinomas histologically similar to MCCs; and (iii MCPyV might be transmitted during sexual interaction as demonstrated for human papillomavirus (HPV. In this study, we aimed to clarify the possible presence of MCPyV in cervical SCCs from Japanese patients. Cervical adenocarcinomas (ACs were also studied. Results Formalin-fixed paraffin-embedded tissue samples from 48 cervical SCCs and 16 cervical ACs were examined for the presence of the MCPyV genome by polymerase chain reaction (PCR and sequencing analyses. PCR analysis revealed that 9/48 cervical SCCs (19% and 4/16 cervical ACs (25% were positive for MCPyV DNA. MCPyV-specific PCR products were sequenced to compare them with reference sequences. The nucleotide sequences in the MCPyV large T (LT-sequenced region were the same among MCPyV-positive cervical SCCs and AC. Conversely, in the MCPyV viral protein 1 (VP1-sequenced region, two cervical SCCs and three cervical ACs showed several nucleotide substitutions, of which three caused amino acid substitutions. These sequencing results suggested that three MCPyV variants of the VP1 were identified in our cases. Immunohistochemistry showed that the LT antigen was expressed in tumor cells in MCPyV-positive samples. Genotyping of human HPV in the MCPyV-positive samples revealed that infected HPVs were HPV types 16, 31 and 58 for SCCs and HPV types 16 and 18 for ACs. Conclusions This study provides the first observation that MCPyV coexists in a subset

  10. Detection of Merkel cell polyomavirus in cervical squamous cell carcinomas and adenocarcinomas from Japanese patients.

    Science.gov (United States)

    Imajoh, Masayuki; Hashida, Yumiko; Nemoto, Yuiko; Oguri, Hiroyoshi; Maeda, Nagamasa; Furihata, Mutsuo; Fukaya, Takao; Daibata, Masanori

    2012-08-09

    Merkel cell polyomavirus (MCPyV) was identified originally in Merkel cell carcinoma (MCC), a rare form of human skin neuroendocrine carcinoma. Evidence of MCPyV existence in other forms of malignancy such as cutaneous squamous cell carcinomas (SCCs) is growing. Cervical cancers became the focus of our interest in searching for potentially MCPyV-related tumors because: (i) the major histological type of cervical cancer is the SCC; (ii) the uterine cervix is a common site of neuroendocrine carcinomas histologically similar to MCCs; and (iii) MCPyV might be transmitted during sexual interaction as demonstrated for human papillomavirus (HPV). In this study, we aimed to clarify the possible presence of MCPyV in cervical SCCs from Japanese patients. Cervical adenocarcinomas (ACs) were also studied. Formalin-fixed paraffin-embedded tissue samples from 48 cervical SCCs and 16 cervical ACs were examined for the presence of the MCPyV genome by polymerase chain reaction (PCR) and sequencing analyses. PCR analysis revealed that 9/48 cervical SCCs (19%) and 4/16 cervical ACs (25%) were positive for MCPyV DNA. MCPyV-specific PCR products were sequenced to compare them with reference sequences. The nucleotide sequences in the MCPyV large T (LT)-sequenced region were the same among MCPyV-positive cervical SCCs and AC. Conversely, in the MCPyV viral protein 1 (VP1)-sequenced region, two cervical SCCs and three cervical ACs showed several nucleotide substitutions, of which three caused amino acid substitutions. These sequencing results suggested that three MCPyV variants of the VP1 were identified in our cases. Immunohistochemistry showed that the LT antigen was expressed in tumor cells in MCPyV-positive samples. Genotyping of human HPV in the MCPyV-positive samples revealed that infected HPVs were HPV types 16, 31 and 58 for SCCs and HPV types 16 and 18 for ACs. This study provides the first observation that MCPyV coexists in a subset of HPV-associated cervical cancers from

  11. ATRA and Genistein synergistically inhibit the metastatic potential of human lung adenocarcinoma cells.

    Science.gov (United States)

    Cheng, Ji; Qi, Jun; Li, Xue-Tao; Zhou, Kun; Xu, Jing-Han; Zhou, Yong; Zhang, Guo-Qiang; Xu, Jian-Ping; Zhou, Ren-Jie

    2015-01-01

    This study was to investigate the effects of all-trans retinoic acid (ATRA) in combination with Genistein on the proliferation, expression of apoptosis related proteins and adhesion molecules (MUC1 and ICAM-1) and invasiveness of A549 cells, aiming to investigate whether combined therapy of ATRA and Genistein is superior to monotherapy in suppressing metastasis of lung cancer cells. ATRA, Genistein and both were used to treat human lung adenocarcinoma cells (A549 cells). Immunohistochemistry was done for MUC1 expression, flow cytometry for ICAM-1 expression, fluorescence quantitative PCR for MUC1 expression and Western blot assay for the expressions of cell cycle related proteins (CDK4, Rb and p-ERK1/2) and apoptosis related proteins (Bax and Bcl-2). Cells were seeded into Matrigel pre-coated Transwell chambers, and the migrating cells were counted. Combined treatment with ATRA and Genistein was able to reduce the expressions of Bcl-2, MUC1 and ICAM-1 and exerted synergistic effects to inhibit the invasion of A549 cells. ATRA and Genistein may synergistically inhibit MUC1 and ICAM-1 expressions and affect the expressions of cell cycle related proteins (CDK4, Rb and p-ERK1/2) and apoptosis related proteins (Bax and Bcl-2), inhibit the metastatic potential of lung cancer A549 cells.

  12. Isolation and characterization of stromal progenitor cells from ascites of patients with epithelial ovarian adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Ho Chih-Ming

    2012-02-01

    Full Text Available Abstract Background At least one-third of epithelial ovarian cancers are associated with the development of ascites containing heterogeneous cell populations, including tumor cells, inflammatory cells, and stromal elements. The components of ascites and their effects on the tumor cell microenvironment remain poorly understood. This study aimed to isolate and characterize stromal progenitor cells from the ascites of patients with epithelial ovarian adenocarcinoma (EOA. Methods Seventeen ascitic fluid samples and 7 fresh tissue samples were collected from 16 patients with EOA. The ascites samples were then cultured in vitro in varying conditions. Flow cytometry and immunocytochemistry were used to isolate and characterize 2 cell populations with different morphologies (epithelial type and mesenchymal type deriving from the ascites samples. The in vitro cell culture model was established using conditional culture medium. Results The doubling times of the epithelial type and mesenchymal type cells were 36 h and 48 h, respectively, indicating faster growth of the epithelial type cells compared to the mesenchymal type cells. Cultured in vitro, these ascitic cells displayed the potential for self-renewal and long-term proliferation, and expressed the typical cancer stem/progenitor cell markers CD44high, CD24low, and AC133+. These cells also demonstrated high BMP-2, BMP4, TGF-β, Rex-1, and AC133 early gene expression, and expressed EGFR, integrin α2β1, CD146, and Flt-4, which are highly associated with tumorigenesis and metastasis. The epithelial type cells demonstrated higher cytokeratin 18 and E-cadherin expression than the mesenchymal type cells. The mesenchymal type cells, in contrast, demonstrated higher AC133, CD73, CD105, CD117, EGFR, integrin α2β1, and CD146 surface marker expression than the epithelial type cells. Conclusion The established culture system provides an in vitro model for the selection of drugs that target cancer

  13. Isolation and characterization of stromal progenitor cells from ascites of patients with epithelial ovarian adenocarcinoma.

    Science.gov (United States)

    Ho, Chih-Ming; Chang, Shwu-Fen; Hsiao, Chih-Chiang; Chien, Tsai-Yen; Shih, Daniel Tzu-Bi

    2012-02-14

    At least one-third of epithelial ovarian cancers are associated with the development of ascites containing heterogeneous cell populations, including tumor cells, inflammatory cells, and stromal elements. The components of ascites and their effects on the tumor cell microenvironment remain poorly understood. This study aimed to isolate and characterize stromal progenitor cells from the ascites of patients with epithelial ovarian adenocarcinoma (EOA). Seventeen ascitic fluid samples and 7 fresh tissue samples were collected from 16 patients with EOA. The ascites samples were then cultured in vitro in varying conditions. Flow cytometry and immunocytochemistry were used to isolate and characterize 2 cell populations with different morphologies (epithelial type and mesenchymal type) deriving from the ascites samples. The in vitro cell culture model was established using conditional culture medium. The doubling times of the epithelial type and mesenchymal type cells were 36 h and 48 h, respectively, indicating faster growth of the epithelial type cells compared to the mesenchymal type cells. Cultured in vitro, these ascitic cells displayed the potential for self-renewal and long-term proliferation, and expressed the typical cancer stem/progenitor cell markers CD44(high), CD24(low), and AC133(+). These cells also demonstrated high BMP-2, BMP4, TGF-β, Rex-1, and AC133 early gene expression, and expressed EGFR, integrin α2β1, CD146, and Flt-4, which are highly associated with tumorigenesis and metastasis. The epithelial type cells demonstrated higher cytokeratin 18 and E-cadherin expression than the mesenchymal type cells. The mesenchymal type cells, in contrast, demonstrated higher AC133, CD73, CD105, CD117, EGFR, integrin α2β1, and CD146 surface marker expression than the epithelial type cells. The established culture system provides an in vitro model for the selection of drugs that target cancer-associated stromal progenitor cells, and for the development of ovarian

  14. Effects of non-thermal mobile phone radiation on breast adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Zen Fourie

    2011-09-01

    Full Text Available Mobile phone usage currently exceeds landline communication in Africa. The extent of this usage has raised concerns about the long-term health effects of the ongoing use of mobile phones. To assess the physiological effects of radiation from mobile phones in vitro, MCF-7 breast adenocarcinoma cells were exposed to 2W/kg non-thermal 900-MHz mobile phone radiation. The effects investigated were those on metabolic activity, cell morphology, cell cycle progression, phosphatidylserine (PS externalisation and the generation of reactive oxygen species and nitrogen species. Statistically insignificant increases in mitochondrial dehydrogenase activity were observed in irradiated cells when compared to controls. Fluorescent detection of F-actin demonstrated an increase in F-actin stress fibre formation in irradiated MCF-7 cells. Cell cycle progression revealed no statistically significant variation. A small increase in early and late apoptotic events in irradiated MCF-7 cells was observed. No statistically significant changes were observed in reactive oxygen and reactive nitrogen species generation. In addition, quantitative and qualitative analyses of cell cycle activity and nuclear and cytosolic changes, respectively, revealed no significant changes. In conclusion, exposure to 1 h of 900-MHz irradiation induced an increase in PS externalisation and an increase in the formation of F-actin stress fibres in MCF-7 cells. Data obtained from this study, and their correlation with other studies, provides intriguing links between radio frequency radiation and cellular events and warrant further investigation.

  15. Contributions of microRNA dysregulation to cisplatin resistance in adenocarcinoma cells.

    Science.gov (United States)

    Pouliot, Lynn M; Shen, Ding-Wu; Suzuki, Toshihiro; Hall, Matthew D; Gottesman, Michael M

    2013-02-15

    Cisplatin resistance in cancer cells is due to a pleiotropic phenotype transition that allows cells to resist cell death. miRNAs have been shown to be reliable markers of phenotype, critical in cell differentiation, and dysregulated in cancer and other pathologies. Here we investigate the influence of miRNA on cisplatin resistance in KB adenocarcinoma cells. Silencing both DICER and TRBP2 in the miRNA biosynthesis pathway in KB-3-1 (sensitive parental), KB-CP.5 (cisplatin-resistant), and KB-CP20 (highly cisplatin-resistant) cells resulted in the reversal of cisplatin resistance, with no effect on cell viability in the absence of cisplatin. We found miR-181 expression differences in the cell lines using RT-PCR, with several members of the miR-181 family overexpressed in two KB cisplatin-resistant lines and in two cisplatin-resistant lung cancer lines, compared to their respective parental cells. Functional assays showed minimal effects of miR-181 on cisplatin resistance. We conclude that the miRNA biosynthesis pathway is critical for maintaining the cisplatin-resistant phenotype, but that it is difficult to determine the precise miRNAs involved in cisplatin resistance simply using expression profiles of individual miRNA species. Functional assays are needed to determine the influence of a specific miRNA and different members of the same miRNA family may have opposite effects. Published by Elsevier Inc.

  16. Clotrimazole decreases glycolysis and the viability of lung carcinoma and colon adenocarcinoma cells.

    Science.gov (United States)

    Penso, Julia; Beitner, Rivka

    2002-09-20

    Glycolysis is known to be the primary energy source in most cancer cells. We investigated here the effect of clotrimazole (1-(alpha-2-chlorotrityl)imidazole), the antifungal azole derivative, which was recently recognized as calmodulin antagonist, on the levels of glucose 1,6-bisphosphate and fructose 1,6-bisphosphate, the two stimulatory signal molecules of glycolysis, and on ATP content and cell viability in LL/2 Lewis lung carcinoma cells and CT-26 colon adenocarcinoma cells. We found that clotrimazole induced a significant, dose- and time-dependent reduction in the levels of glucose 1,6-bisphosphate, fructose 1,6-bisphosphate, ATP, and cell viability. These findings suggest that clotrimazole causes a reduction in glycolysis and ATP levels, which eventually leads to cell destruction after 3 h of treatment. Since cell proliferation was also reported to be inhibited by calmodulin antagonists, this substance is most promising agent in treatment of cancer by inhibiting both cell proliferation and the glycolytic supply of ATP required for cancer cell growth. Copyright 2002 Elsevier Science B.V.

  17. In vitro cytotoxicity screening of wild plant extracts from Saudi Arabia on human breast adenocarcinoma cells.

    Science.gov (United States)

    Ali, M A; Abul Farah, M; Al-Hemaid, F M; Abou-Tarboush, F M

    2014-05-23

    This study investigated the in vitro anticancer activities of a total of 14 wild angiosperms collected in Saudi Arabia. The cytotoxic activity of each extract was assessed against human breast adenocarcinoma (MCF-7) cell lines by using the MTT assay. Among the plants screened, the potential cytotoxic activity exhibited by the extract of Lavandula dentata (Lamiaceae) was identified, and we analyzed its anticancer potential by testing antiproliferative and apoptotic activity. Our results clearly show that ethanolic extract of L. dentata exhibits promising cytotoxic activity with an IC50 value of 39 μg/mL. Analysis of cell morphological changes, DNA fragmentation and apoptosis (using an Annexin V assay) also confirmed the apoptotic effect of L. dentata extract, and thus, our data call for further investigations to determine the active chemical constituent(s) and their mechanisms of inducing apoptosis.

  18. Bilateral Basal Cell Adenocarcinoma of the Parotid Gland: In a Recipient of Kidney Transplant

    Directory of Open Access Journals (Sweden)

    Mari Markkanen-Leppänen

    2010-01-01

    Full Text Available We report a rare case of bilateral basal cell adenocarcinoma (BcAC of the parotid gland in a male patient 30 years after kidney transplantation and continuous administration of immunosuppressive therapy. BcAC is a salivary gland malignancy first recognized as a distinct neoplastic entity in WHO classification of salivary gland tumours in 1991. Over 90% of BcACs are detected in the parotid gland. The most important differential diagnosis is basal cell adenoma. Infiltrative growth is the distinguishing feature of BcAC. Administration of immunosuppressive medication to this patient for three decades may have contributed to development of this rare neoplasia. To our knowledge, similar cases of BcAC have not been reported previously.

  19. [Two Cases of Urethral Clear Cell Adenocarcinoma with Suspected Recurrence of Uterine Cancer].

    Science.gov (United States)

    Okuno, Masato; Kusuda, Yuji; Taguchi, Isao; Kawabata, Gaku

    2017-08-01

    Herein, we report two cases of urethral clear cell carcinoma in two patients who had previously undergone radical hysterectomyfor utetine cancer. Case 1 presented with bloodyvaginal discharge and case 2 presented with acute urinaryretention. Magnetic resonance imaging revealed a periurethral tumor in both cases. Both cases were suspected to be recurrence at first. However, pathological findings of the transurethral resection-biopsyshowed clear cell adenocarcinoma in both cases. Subsequentlyradical cystourethrectomy and pelvic lymphadenectomy were performed in both cases. Surgical findings showed tumor invasion of the vaginal muscularis in case 1 and invasion of the anterior wall of the vagina and bladder neck in case 2. Although adjuvant postoperative therapywas not performed, there has been no evidence of recurrence to date.

  20. Apoptotic-like tumor cells and apoptotic neutrophils in mitochondrion-rich gastric adenocarcinomas: a comparative study with light and electronmicroscopy between these two forms of cell death

    Directory of Open Access Journals (Sweden)

    Antonio Venuti

    2013-04-01

    Full Text Available Mitochondrion-rich adenocarcinomas represent a rare variant of gastric adenocarcinomas composed predominantly of columnar adenocarcinoma cells with eosinophilic cytoplasm, a strong supranuclear immunoreactivity for antimitochondrial antibody, and a marked neutrophil infiltration associated to tumor cell death. The purpose of this work is to investigate, using correlated light and electron microscopy, mitochondrion-rich gastric adenocarcinomas focusing on the nature of the death in neoplastic cells and in infiltrating neutrophils. Adenocarcinoma cells, single or in small clusters, showed convoluted nuclei, irregularly condensed chromatin, loss of microvilli, and nuclear envelope dilatation. No nuclear fragmentation was observed in these dying cells and the plasma membrane did not show signs of disruption. These ultrastructural findings represent intermediate aspects between apoptosis and necrosis and are compatible with apoptosis-like programmed cell death. By contrast, some infiltrating neutrophils showed ultrastructural signs of classic apoptosis such as chromatin condensation into compact geometric (globular, crescent-shaped figures, tightly packed cytoplasmic granules and intact cell membrane. Our study provides ultrastructural evidence of apoptosis-like tumour cell death in mitochondrion-rich gastric carcinomas and confirms that stereotyped outcome either as apoptosis or necrosis of tumor cells cannot always be expected in human neoplasms.

  1. Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.

    Science.gov (United States)

    Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke

    2013-12-15

    The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.

  2. Cytotoxic and apoptotic effects of chalcone derivatives of 2-acetyl thiophene on human colon adenocarcinoma cells.

    Science.gov (United States)

    de Vasconcelos, Alana; Campos, Vinicius Farias; Nedel, Fernanda; Seixas, Fabiana Kömmling; Dellagostin, Odir A; Smith, Kevin R; de Pereira, Cláudio Martin Pereira; Stefanello, Francieli Moro; Collares, Tiago; Barschak, Alethéa Gatto

    2013-06-01

    Recent studies report that chalcones exhibit cytotoxicity to human cancer cell lines. Typically, the form of cell death induced by these compounds is apoptosis. In the context of the discovery of new anticancer agents and in light of the antitumour potential of several chalcone derivatives, in the present study, we synthesized and tested the cytotoxicity of six chalcone derivatives on human colon adenocarcinoma cells. Six derivatives of 3-phenyl-1-(thiophen-2-yl) prop-2-en-1-one were prepared and characterized on the basis of their (1) H and (13) C NMR spectra. HT-29 cells were treated with synthesized chalcones on two concentrations by three different incubation times. Cells were evaluated by cell morphology, Tetrazolium dye (MTT) colorimetric assay, live/dead, flow cytometry (annexin V) and gene expression analyses to determine the cytotoxic way. Chalcones 3-(4-bromophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C06) and 3-(2-nitrophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C09) demonstrated higher cytotoxicity than other chalcones as shown by cell morphology, live/dead and MTT assays. In addition, C06 induced apoptosis on flow cytometry annexin V assay. These data were confirmed by a decreased expression of anti-apoptotic genes and increased pro-apoptotic genes. Our findings indicate in summary that the cytotoxic activity of chalcone C06 on colorectal carcinoma cells occurs by apoptosis. Copyright © 2012 John Wiley & Sons, Ltd.

  3. Effects of ozone exposure on human epithelial adenocarcinoma and normal fibroblasts cells.

    Science.gov (United States)

    Poma, Anna; Colafarina, Sabrina; Aruffo, Eleonora; Zarivi, Osvaldo; Bonfigli, Antonella; Di Bucchianico, Sebastiano; Di Carlo, Piero

    2017-01-01

    Previous studies show variable ozone cytotoxicity and genotoxicity in cell cultures, laboratory animals and humans directly exposed to tropospheric ozone. The aim of this study was therefore to investigate and compare the cyto and genotoxic effects of ozone using adenocarcinoma human alveolar basal epithelial cells A549 and normal human fibroblasts Hs27. A cell culture chamber with controlled atmosphere (a simulation reactor) was built to inject a flow of 120 ppb of ozone, which is two times the threshold value for the protection of human health, fixed by the EU legislation. Cell proliferation was evaluated by a luminescent cell viability assay while we assessed the genotoxic potential of ozone by the induction of micronuclei as well as evaluating DNA strand breaks by the induction of micronuclei evaluated by means of the cytokinesis-block micronucleus (CBMN) assay as well as evaluating DNA strand breaks by Alkaline Comet Assay (CA) or Comet Assay. A549 cells viability decreases significantly at 24 hours treatment with 120 ppb of O3 while at 48 hours and 72 hours O3 treated cells viability doesn't differ in respect to the control. However a significative decrease of A549 viability is shown at 72 hours vs. 48 hours in both treated and not-treated cells. The viability trend in the Hs27 cells did not show any significant changes in treated samples compared to the control in all conditions. The two genotoxicity biomarkers, the micronucleus and the comet tests, showed in both the cell types exposed to ozone, a significant increase in the number of micronuclei and in the tail DNA % in respect to the control even if at different times/cell type. Moreover, we found that O3 provokes genotoxic effects more evident in A549 cancer cells than in normal fibroblasts Hs27 ones. We applied a cell growth simulation model referred to ozone treated or not cell lines to confirm that the ozone exposure causes a slackening in the cells replication.

  4. Rutamarin, an Active Constituent from Ruta angustifolia Pers., Induced Apoptotic Cell Death in the HT29 Colon Adenocarcinoma Cell Line.

    Science.gov (United States)

    Suhaimi, Shafinah Ahmad; Hong, Sok Lai; Abdul Malek, Sri Nurestri

    2017-07-01

    : ACN: Acetonitrile, ANOVA: One-way analysis of variance, BrdU: Bromodeoxyuridine, 13C-NMR: Carbon-13 Nuclear magnetic resonance, CAD: Caspase-activated endonuclease, CCD-18Co: Human colon normal, DLD1: Human Duke's type C colorectal adenocarcinoma, DMRT: Duncan's multiple range test, DMSO: Dimethyl sulfoxide, DNA: Deoxyribonucleic acid, DR4/5: Death receptor 4/5 protein, EMEM: Eagle's minimum essential media, FBS: Fetal bovine serum, FITC Annexin V: Annexin V conjugated with fluorescein isothiocyanate, FITC-DEVD-FMK: Fluorescein isothiocyanate conjugate of caspase inhibitor Asp-Glu-Val-Asp-fluoromethyl ketone, FITC-IETD-FMK: Fluorescein isothiocyanate conjugate of caspase inhibitor Ile-Glu-Thr-Asp-fluoromethyl ketone, FITC-LEHD-FMK: Fluorescein isothiocyanate conjugate of caspase inhibitor Leu-Glu-His-Asp-fluoromethyl ketone, G0: Quiescent phase of cell cycle, G1: Gap 1 phase of cell cycle, G2: Gap 2 phase of cell cycle, GC-MS: Gas chromatography-mass spectrometry, HeLa: Human cervical adenocarcinoma, HPLC: High performance liquid chromatography, HT29: Human colon adenocarcinoma, Huh7.5: Human hepatocellular carcinoma, IC50: Half maximal inhibitory concentration, KSHV: Kaposi's sarcoma-associated herpesvirus, M phase: Mitotic phase of cell cycle, MCF7: Human breast adenocarcinoma, NMR: Nuclear magnetic resonance, PBS: Phosphate-buffered saline, PI: Propidium iodide, RNase: Ribonuclease, rt: Retention time, S phase: Synthesis phase of cell cycle, SD: Standard deviation, SRB: Sulforhodamine B, TCA: Trichloroacetic acid, TLC: Thin layer chromatography, TNF-R1: Tumor necrosis factor receptor 1 protein, TUNEL: Terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling, UV: Ultraviolet.

  5. Gene expression changes associated with Barrett's esophagus and Barrett's-associated adenocarcinoma cell lines after acid or bile salt exposure

    Directory of Open Access Journals (Sweden)

    Sahbaie Peyman

    2007-06-01

    Full Text Available Abstract Background Esophageal reflux and Barrett's esophagus represent two major risk factors for the development of esophageal adenocarcinoma. Previous studies have shown that brief exposure of the Barrett's-associated adenocarcinoma cell line, SEG-1, or primary cultures of Barrett's esophageal tissues to acid or bile results in changes consistent with cell proliferation. In this study, we determined whether similar exposure to acid or bile salts results in gene expression changes that provide insights into malignant transformation. Methods Using previously published methods, Barrett's-associated esophageal adenocarcinoma cell lines and primary cultures of Barrett's esophageal tissue were exposed to short pulses of acid or bile salts followed by incubation in culture media at pH 7.4. A genome-wide assessment of gene expression was then determined for the samples using cDNA microarrays. Subsequent analysis evaluated for statistical differences in gene expression with and without treatment. Results The SEG-1 cell line showed changes in gene expression that was dependent on the length of exposure to pH 3.5. Further analysis using the Gene Ontology, however, showed that representation by genes associated with cell proliferation is not enhanced by acid exposure. The changes in gene expression also did not involve genes known to be differentially expressed in esophageal adenocarcinoma. Similar experiments using short-term primary cultures of Barrett's esophagus also did not result in detectable changes in gene expression with either acid or bile salt exposure. Conclusion Short-term exposure of esophageal adenocarcinoma SEG-1 cells or primary cultures of Barrett's esophagus does not result in gene expression changes that are consistent with enhanced cell proliferation. Thus other model systems are needed that may reflect the impact of acid and bile salt exposure on the esophagus in vivo.

  6. Inflammatory cells contribute to the generation of an angiogenic phenotype in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Esposito, I; Menicagli, M; Funel, N; Bergmann, F; Boggi, U; Mosca, F; Bevilacqua, G; Campani, D

    2004-06-01

    Inflammatory cells contribute to the growth and spread of human malignancies by producing molecules that enhance tumour invasiveness. To characterise the inflammatory infiltrate in pancreatic ductal adenocarcinoma and to analyse its contribution to angiogenesis and its prognostic relevance. Immunohistochemistry was used to identify inflammatory cells and evaluate the expression of proangiogenic and prolymphangiogenic molecules (vascular endothelial growth factor A (VEGF-A), VEGF-C, and basic fibroblast growth factor (bFGF)) by inflammatory and cancer cells in 137 pancreatic cancers. Intratumorous microvessel density (IMD) was assessed using CD34 as an endothelial cell marker. There were significantly more mast cells and macrophages in pancreatic cancers than in normal pancreas and the number of mast cells directly correlated with the presence of lymph node metastases. However, there was no relation between numbers of infiltrating inflammatory cells and the presence of chronic pancreatitis (CP)-like changes in the parenchyma surrounding the tumour. Double immunostaining revealed that both pancreatic mast cells and macrophages express VEGF-A, VEGF-C, and bFGF. These factors were also expressed in the tumour cells in many cases. The numbers of VEGF-A expressing tumour cells and bFGF expressing tumour and inflammatory cells significantly correlated with IMD. Moreover, tumours with higher IMD had higher numbers of infiltrating mast cells and macrophages. Mononuclear inflammatory cells of the non-specific immune response are recruited to pancreatic cancer tissues independent of the presence of CP-like changes, may influence the metastatic capacity of the cancer cells, and may contribute to the development of tumours with high angiogenic activity.

  7. Cells as strain-cued automata

    Science.gov (United States)

    Cox, Brian N.; Snead, Malcolm L.

    2016-02-01

    We argue in favor of representing living cells as automata and review demonstrations that autonomous cells can form patterns by responding to local variations in the strain fields that arise from their individual or collective motions. An autonomous cell's response to strain stimuli is assumed to be effected by internally-generated, internally-powered forces, which generally move the cell in directions other than those implied by external energy gradients. Evidence of cells acting as strain-cued automata have been inferred from patterns observed in nature and from experiments conducted in vitro. Simulations that mimic particular cases of pattern forming share the idealization that cells are assumed to pass information among themselves solely via mechanical boundary conditions, i.e., the tractions and displacements present at their membranes. This assumption opens three mechanisms for pattern formation in large cell populations: wavelike behavior, kinematic feedback in cell motility that can lead to sliding and rotational patterns, and directed migration during invasions. Wavelike behavior among ameloblast cells during amelogenesis (the formation of dental enamel) has been inferred from enamel microstructure, while strain waves in populations of epithelial cells have been observed in vitro. One hypothesized kinematic feedback mechanism, "enhanced shear motility", accounts successfully for the spontaneous formation of layered patterns during amelogenesis in the mouse incisor. Directed migration is exemplified by a theory of invader cells that sense and respond to the strains they themselves create in the host population as they invade it: analysis shows that the strain fields contain positional information that could aid the formation of cell network structures, stabilizing the slender geometry of branches and helping govern the frequency of branch bifurcation and branch coalescence (the formation of closed networks). In simulations of pattern formation in

  8. A comparative analysis by SAGE of gene expression profiles of esophageal adenocarcinoma and esophageal squamous cell carcinoma

    NARCIS (Netherlands)

    van Baal, Jantine W. P. M.; Milana, Francesco; Rygiel, Agnieszka M.; Sondermeijer, Carine M. T.; Spek, C. Arnold; Bergman, Jacques J. G. H. M.; Peppelenbosch, Maikel P.; Krishnadath, Kausilia K.

    2008-01-01

    Esophageal adenocarcinoma (EA) and esophageal squamous cell carcinoma (ESCC) are the two main types of esophageal cancer. Despite extensive research the exact molecular basis of these cancers is unclear. Therefore we evaluated the transcriptome of EA in comparison to non-dysplastic Barrett's

  9. Demographic Clinical and Prognostic Factors of Primary Ovarian Adenocarcinomas of Serous and Clear Cell Histology—A Comparative Study

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte

    2016-01-01

    OBJECTIVE: To compare clinical demographic and prognostic factors as well as overall survival in a nationwide cohort of patients diagnosed with ovarian clear cell carcinoma (oCCC) and high grade ovarian serous adenocarcinoma (oSAC) during 2005 to 2013. MATERIALS AND METHODS: Population-based pros...

  10. Salt-inducible kinase 1 (SIK1 is induced by gastrin and inhibits migration of gastric adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Linn-Karina M Selvik

    Full Text Available Salt-inducible kinase 1 (SIK1/Snf1lk belongs to the AMP-activated protein kinase (AMPK family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome in cancers, and that this involves an invasive cellular phenotype with increased metastatic potential. However, the molecular mechanism(s regulated by SIK1 in cancer cells is not well explored. The peptide hormone gastrin regulates cellular processes involved in oncogenesis, including proliferation, apoptosis, migration and invasion. The aim of this study was to examine the role of SIK1 in gastrin responsive adenocarcinoma cell lines AR42J, AGS-GR and MKN45. We show that gastrin, known to signal through the Gq/G11-coupled CCK2 receptor, induces SIK1 expression in adenocarcinoma cells, and that transcriptional activation of SIK1 is negatively regulated by the Inducible cAMP early repressor (ICER. We demonstrate that gastrin-mediated signalling induces phosphorylation of Liver Kinase 1B (LKB1 Ser-428 and SIK1 Thr-182. Ectopic expression of SIK1 increases gastrin-induced phosphorylation of histone deacetylase 4 (HDAC4 and enhances gastrin-induced transcription of c-fos and CRE-, SRE-, AP1- and NF-κB-driven luciferase reporter plasmids. We also show that gastrin induces phosphorylation and nuclear export of HDACs. Next we find that siRNA mediated knockdown of SIK1 increases migration of the gastric adenocarcinoma cell line AGS-GR. Evidence provided here demonstrates that SIK1 is regulated by gastrin and influences gastrin elicited signalling in gastric adenocarcinoma cells. The results from the present study are relevant for the understanding of molecular mechanisms involved in gastric adenocarcinomas.

  11. Salt-inducible kinase 1 (SIK1) is induced by gastrin and inhibits migration of gastric adenocarcinoma cells.

    Science.gov (United States)

    Selvik, Linn-Karina M; Rao, Shalini; Steigedal, Tonje S; Haltbakk, Ildri; Misund, Kristine; Bruland, Torunn; Prestvik, Wenche S; Lægreid, Astrid; Thommesen, Liv

    2014-01-01

    Salt-inducible kinase 1 (SIK1/Snf1lk) belongs to the AMP-activated protein kinase (AMPK) family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome in cancers, and that this involves an invasive cellular phenotype with increased metastatic potential. However, the molecular mechanism(s) regulated by SIK1 in cancer cells is not well explored. The peptide hormone gastrin regulates cellular processes involved in oncogenesis, including proliferation, apoptosis, migration and invasion. The aim of this study was to examine the role of SIK1 in gastrin responsive adenocarcinoma cell lines AR42J, AGS-GR and MKN45. We show that gastrin, known to signal through the Gq/G11-coupled CCK2 receptor, induces SIK1 expression in adenocarcinoma cells, and that transcriptional activation of SIK1 is negatively regulated by the Inducible cAMP early repressor (ICER). We demonstrate that gastrin-mediated signalling induces phosphorylation of Liver Kinase 1B (LKB1) Ser-428 and SIK1 Thr-182. Ectopic expression of SIK1 increases gastrin-induced phosphorylation of histone deacetylase 4 (HDAC4) and enhances gastrin-induced transcription of c-fos and CRE-, SRE-, AP1- and NF-κB-driven luciferase reporter plasmids. We also show that gastrin induces phosphorylation and nuclear export of HDACs. Next we find that siRNA mediated knockdown of SIK1 increases migration of the gastric adenocarcinoma cell line AGS-GR. Evidence provided here demonstrates that SIK1 is regulated by gastrin and influences gastrin elicited signalling in gastric adenocarcinoma cells. The results from the present study are relevant for the understanding of molecular mechanisms involved in gastric adenocarcinomas.

  12. Antiproliferative effects and mechanisms of liver X receptor ligands in pancreatic ductal adenocarcinoma cells.

    Science.gov (United States)

    Candelaria, Nicholes R; Addanki, Sridevi; Zheng, Jine; Nguyen-Vu, Trang; Karaboga, Husna; Dey, Prasenjit; Gabbi, Chiara; Vedin, Lise-Lotte; Liu, Ka; Wu, Wanfu; Jonsson, Philip K; Lin, Jean Z; Su, Fei; Bollu, Lakshmi Reddy; Hodges, Sally E; McElhany, Amy L; Issazadeh, Mehdi A; Fisher, William E; Ittmann, Michael M; Steffensen, Knut R; Gustafsson, Jan-Åke; Lin, Chin-Yo

    2014-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is difficult to detect early and is often resistant to standard chemotherapeutic options, contributing to extremely poor disease outcomes. Members of the nuclear receptor superfamily carry out essential biological functions such as hormone signaling and are successfully targeted in the treatment of endocrine-related malignancies. Liver X receptors (LXRs) are nuclear receptors that regulate cholesterol homeostasis, lipid metabolism, and inflammation, and LXR agonists have been developed to regulate LXR function in these processes. Intriguingly, these compounds also exhibit antiproliferative activity in diverse types of cancer cells. In this study, LXR agonist treatments disrupted proliferation, cell-cycle progression, and colony-formation of PDAC cells. At the molecular level, treatments downregulated expression of proteins involved in cell cycle progression and growth factor signaling. Microarray experiments further revealed changes in expression profiles of multiple gene networks involved in biological processes and pathways essential for cell growth and proliferation following LXR activation. These results establish the antiproliferative effects of LXR agonists and potential mechanisms of action in PDAC cells and provide evidence for their potential application in the prevention and treatment of PDAC.

  13. Antiproliferative effects and mechanisms of liver X receptor ligands in pancreatic ductal adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Nicholes R Candelaria

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC is difficult to detect early and is often resistant to standard chemotherapeutic options, contributing to extremely poor disease outcomes. Members of the nuclear receptor superfamily carry out essential biological functions such as hormone signaling and are successfully targeted in the treatment of endocrine-related malignancies. Liver X receptors (LXRs are nuclear receptors that regulate cholesterol homeostasis, lipid metabolism, and inflammation, and LXR agonists have been developed to regulate LXR function in these processes. Intriguingly, these compounds also exhibit antiproliferative activity in diverse types of cancer cells. In this study, LXR agonist treatments disrupted proliferation, cell-cycle progression, and colony-formation of PDAC cells. At the molecular level, treatments downregulated expression of proteins involved in cell cycle progression and growth factor signaling. Microarray experiments further revealed changes in expression profiles of multiple gene networks involved in biological processes and pathways essential for cell growth and proliferation following LXR activation. These results establish the antiproliferative effects of LXR agonists and potential mechanisms of action in PDAC cells and provide evidence for their potential application in the prevention and treatment of PDAC.

  14. Apoptosis signal-regulating kinase 1 mediates denbinobin-induced apoptosis in human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Pan Shiow-Lin

    2009-05-01

    Full Text Available Abstract In the present study, we explore the role of apoptosis signal-regulating kinase 1 (ASK1 in denbinobin-induced apoptosis in human lung adenocarcinoma (A549 cells. Denbinobin-induced cell apoptosis was attenuated by an ASK1 dominant-negative mutant (ASK1DN, two antioxidants (N-acetyl-L-cysteine (NAC and glutathione (GSH, a c-Jun N-terminal kinase (JNK inhibitor (SP600125, and an activator protein-1 (AP-1 inhibitor (curcumin. Treatment of A549 cells with denbinobin caused increases in ASK1 activity and reactive oxygen species (ROS production, and these effects were inhibited by NAC and GSH. Stimulation of A549 cells with denbinobin caused JNK activation; this effect was markedly inhibited by NAC, GSH, and ASK1DN. Denbinobin induced c-Jun phosphorylation, the formation of an AP-1-specific DNA-protein complex, and Bim expression. Bim knockdown using a bim short interfering RNA strategy also reduced denbinobin-induced A549 cell apoptosis. The denbinobin-mediated increases in c-Jun phosphorylation and Bim expression were inhibited by NAC, GSH, SP600125, ASK1DN, JNK1DN, and JNK2DN. These results suggest that denbinobin might activate ASK1 through ROS production to cause JNK/AP-1 activation, which in turn induces Bim expression, and ultimately results in A549 cell apoptosis.

  15. Second cancers after squamous cell carcinoma and adenocarcinoma of the cervix

    DEFF Research Database (Denmark)

    Chaturvedi, Anil K; Kleinerman, Ruth A; Hildesheim, Allan

    2008-01-01

    PURPOSE: Although cervical squamous cell carcinoma (SCC) and adenocarcinoma (AC) are both caused by human papillomavirus (HPV) infection, they differ in cofactors such as cigarette smoking. We assessed whether these cofactor differences translate into differences in second cancer risk. PATIENTS...... AND METHODS: We assessed second cancer risk among 85,109 cervical SCC and 10,280 AC survivors reported to population-based cancer registries in Denmark, Finland, Norway, Sweden, and the United States. Risks compared to the general population were assessed using standardized incidence ratios (SIR). RESULTS......: Overall cancer risk was significantly increased among both cervical SCC survivors (n = 10,559 second cancers; SIR, 1.31; 95% CI, 1.29 to 1.34) and AC survivors (n = 920 second cancers; SIR, 1.29; 95% CI, 1.22 to 1.38). Risks of HPV-related and radiation-related cancers were increased to a similar extent...

  16. Clinicopathologic and Molecular Features of Colorectal Adenocarcinoma with Signet-Ring Cell Component.

    Directory of Open Access Journals (Sweden)

    Qing Wei

    Full Text Available We performed a retrospective study to assess the clinicopathological characters, molecular alterations and multigene mutation profiles in colorectal cancer patients with signet-ring cell component.Between November 2008 and January 2015, 61 consecutive primary colorectal carcinomas with signet-ring cell component were available for pathological confirmation. RAS/BRAF status was performed by direct sequencing. 14 genes associated with hereditary cancer syndromes were analyzed by targeted gene sequencing.A slight male predominance was detected in these patients (59.0%. Colorectal carcinomas with signet-ring cell component were well distributed along the large intestine. A frequently higher TNM stage at the time of diagnosis was observed, compared with the conventional adenocarcinoma. Family history of malignant tumor was remarkable with 49.2% in 61 cases. The median OS time of stage IV patients in our study was 14 months. RAS mutations were detected in 22.2% (12/54 cases with KRAS mutations in 16.7% (9/54 cases and Nras mutations in 5.4%(3/54 cases. BRAF V600E mutation was detected in 3.7% (2/54 cases. As an exploration, we analyzed 14 genes by targeted gene sequencing. These genes were selected based on their biological role in association with hereditary cancer syndromes. 79.6% cases carried at least one pathogenic mutation. Finally, the patients were classified by the percentage of signet-ring cell. 39 (63.9% cases were composed of ≥50% signet-ring cells; 22 (36.1% cases were composed of <50% signet-ring cells. We compared clinical parameters, molecular and genetic alterations between the two groups and found no significant differences.Colorectal adenocarcinoma with signet-ring cell component is characterized by advanced stage at diagnosis with remarkable family history of malignant tumor. It is likely a negative prognostic factor and tends to affect male patients with low rates of RAS /BRAF mutation. Colorectal patients with any component of

  17. miR-145 Inhibits Lung Adenocarcinoma Stem Cells Proliferation by Targeting OCT4 Gene

    Directory of Open Access Journals (Sweden)

    Shuai ZHANG

    2011-04-01

    Full Text Available Background and objective MiR-145 functions as a protective miRNA identified in tumor tissues of lung adenocarcinoma patients. The aim of this study is to investigate the relationship between miR-145 and proliferation of lung cancer stem cells and involved molecular mechanisms in human lung adenocarcinaoma A549 cell line. Methods MicroRNA microarray technology was conducted to compare miRNA signature between tumor and adjacent normal tissue of lung adenocarcinaoma. The potential target gene of miR-145 was predicted by online bioinformatic softwares. Pre-miR-145 mimics and anti-miR-145 inhibitor were transfected into A549 cell line by lipofectamine 2000. miR-145 expression in each group was detected by real time PCR. The OCT4 protein level was analyzed by Western blot. The predicted miR-145 binding site in OCT4 3’-untranslated region (UTR was validated by dual-luciferase reporter gene assay. CCK-8 assay was employed to observe the proliferation activity of A549 cells. The ratio of CD133 positive cells in each group was analyzed by flow cytometry. Results miR-145 expression was significantly down-regulated in lung adenocarcinoma compared with ajacent normal tissue. OCT4 is a potential target gene of miR-145 predicted by miRanda. Compared with control group, miR-145 was significantly up-regulated and down-regulated in the pre-miR-145 mimics and anti-miR-145 inhibitor groups respectively. Overexpression of miR-145 inhibited the proliferation of A549 cells. Both the OCT4 protein level and CD133 positive ratio were remarkably decreased in the pre-miR-145 mimics group, whereas significantly increased in the anti-miR-145 inhibitor group. Dual-luciferase reporter gene assay validated the predicted miR-145 binding site of OCT4 3’UTR. Conclusion MiR-145 can inhibit the proliferation of lung cancer stem cells in A549 cell line via down-regulating OCT4 expression. MiR-145 is a potential protective miRNA of lung cancer.

  18. Radiation induced esophageal adenocarcinoma in a woman previously treated for breast cancer and renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Raissouni Soundouss

    2012-08-01

    Full Text Available Abstract Background Secondary radiation-induced cancers are rare but well-documented as long-term side effects of radiation in large populations of breast cancer survivors. Multiple neoplasms are rare. We report a case of esophageal adenocarcinoma in a patient treated previously for breast cancer and clear cell carcinoma of the kidney. Case presentation A 56 year-old non smoking woman, with no alcohol intake and no familial history of cancer; followed in the National Institute of Oncology of Rabat Morocco since 1999 for breast carcinoma, presented on consultation on January 2011 with dysphagia. Breast cancer was treated with modified radical mastectomy, 6 courses of chemotherapy based on CMF regimen and radiotherapy to breast, inner mammary chain and to pelvis as castration. Less than a year later, a renal right mass was discovered incidentally. Enlarged nephrectomy realized and showed renal cell carcinoma. A local and metastatic breast cancer recurrence occurred in 2007. Patient had 2 lines of chemotherapy and 2 lines of hormonotherapy with Letrozole and Tamoxifen assuring a stable disease. On January 2011, the patient presented dysphagia. Oesogastric endoscopy showed middle esophagus stenosing mass. Biopsy revealed adenocarcinoma. No evidence of metastasis was noticed on computed tomography and breast disease was controlled. Palliative brachytherapy to esophagus was delivered. Patient presented dysphagia due to progressive disease 4 months later. Jejunostomy was proposed but the patient refused any treatment. She died on July 2011. Conclusion We present here a multiple neoplasm in a patient with no known family history of cancers. Esophageal carcinoma is most likely induced by radiation. However the presence of a third malignancy suggests the presence of genetic disorders.

  19. Effects of NVP-BEZ235 on the proliferation, migration, apoptosis and autophagy in HT-29 human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Yu, Yang; Yu, Xiaofeng; Ma, Jianxia; Tong, Yili; Yao, Jianfeng

    2016-07-01

    The phosphoinositide 3 kinase (PI3K)/Akt/mammalian target of the rapamycin (mTOR) pathway plays a significant role in colorectal adenocarcinoma. NVP-BEZ235 (dactolisib) is a novel dual inhibitor of PI3K/mTOR. The effects of NVP-BEZ235 in human colorectal adenocarcinoma are still unclear. In the present study, we aimed to explore the proliferation, migration, apoptosis and autophagy in HT-29 human colorectal adenocarcinoma cells. HT-29 human colorectal adenocarcinoma cells were treated with NVP-BEZ235 (0, 0.001, 0.01, 0.1, 1 and 3 µM) for 24 and 48 h, respectively. Cells were also treated with NVP-BEZ235 (0.1 µM), DDP (100, 300 and 1,000 µM), and NVP-BEZ235 (0.1 µM) combined with DDP (100, 300 and 1,000 µM) respectively, and cultured for 24 h after treatment. MTT assay was utilized to evaluate the effects of NVP-BEZ235 alone or NVP-BEZ235 combined with cis-diamminedichloroplatinum (DDP) on proliferation of HT-29 cells. Cell wound-scratch assay was used detect cell migration. In addition, expression of microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B and LC3B) in HT-29 cells was detected by immunofluorescence at 48 h after NVP-BEZ235 (1 µM) treatment. Expression of proteins involved in cell cycle and proliferation (p-Akt, p-mTOR and cyclin D1), apoptosis (cleaved caspase-3), and autophagy (cleaved LC3B and Beclin-1) were detected by western blot analysis. NVP-BEZ235 inhibited the proliferation and migration of HT-29 human colorectal adenocarcinoma cells. NVP-BEZ235 decreased protein expression of p-Akt, p-mTOR and cyclin D1, and increased protein expression of cleaved caspase-3, cleaved LC3B and Beclin-1 as the concentrations and the incubation time of NVP-BEZ235 increased. In addition, NVP-BEZ235 and DDP had synergic effects in inhibiting cell proliferation and migration. The expression of protein involved in apoptosis (cleaved caspase-3) was higher in drug combination group compared to the NVP-BEZ235 single treatment group. NVP-BEZ235

  20. TROP2 overexpression promotes proliferation and invasion of lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zanhua [Medical School of Nanchang University (China); The Chest Hospital of Jiangxi Province Department of Respiration (China); Jiang, Xunsheng [Department of Respiration, Medical School of Nanchang University (China); Zhang, Wei, E-mail: weizhangncu@gmail.com [Department of Respiration, The First Affiliated Hospital of Nanchang University (China)

    2016-01-29

    Recent studies suggest that the human trophoblast cell-surface antigen TROP2 is highly expressed in a number of tumours and is correlated with poor prognosis. However, its role in non-small cell lung carcinoma (NSCLC) remains largely unknown. Here we examined TROP2 expression by immunohistochemistry in a series of 68 patients with adenocarcinoma (ADC). We found significantly elevated TROP2 expression in ADC tissues compared with normal lung tissues (P < 0.05), and TROP2 overexpression was significantly associated with TNM (tumour, node, metastasis) stage (P = 0.012), lymph node metastasis (P = 0.038), and histologic grade (P = 0.013). Kaplan–Meier survival analysis revealed that high TROP2 expression correlated with poor prognosis (P = 0.046). Multivariate analysis revealed that TROP2 expression was an independent prognostic marker for overall survival of ADC patients. Moreover, TROP2 overexpression enhanced cell proliferation, migration, and invasion in the NSCLC cell line A549, whereas knockdown of TROP2 induced apoptosis and impaired proliferation, migration, and invasion in the PC-9 cells. Altogether, our data suggest that TROP2 plays an important role in promoting ADC and may represent a novel prognostic biomarker and therapeutic target for the disease.

  1. Dihydroartemisinin (DHA induces caspase-3-dependent apoptosis in human lung adenocarcinoma ASTC-a-1 cells

    Directory of Open Access Journals (Sweden)

    Sun Lei

    2009-02-01

    Full Text Available Abstract Background Dihydroartemisinin (DHA, a semi-synthetic derivative of artemisinin, isolated from the traditional Chinese herb Artemisia annua, is recommended as the first-line anti-malarial drug with low toxicity. DHA has been shown to possess promising anticancer activities and induce cancer cell death through apoptotic pathways, although the molecular mechanisms are not well understood. Methods In this study, cell counting kit (CCK-8 assay was employed to evaluate the survival of DHA-treated ASTC-a-1 cells. The induction of apoptosis was detected by Hoechst 33258 and PI staining as well as flow cytometry analysis. Collapse of mitochondrial transmembrane potential (ΔΨm was measured by dynamic detection under a laser scanning confocal microscope and flow cytometry analysis using Rhodamine123. Caspase-3 activities measured with or without Z-VAD-fmk (a broad spectrum caspase inhibitor pretreatment by FRET techniques, caspase-3 activity measurement, and western blotting analysis. Results Our results indicated that DHA induced apoptotic cell death in a dose- and time-dependent manner, which was accompanied by mitochondrial morphology changes, the loss of ΔΨm and the activation of caspase-3. Conclusion These results show for the first time that DHA can inhibit proliferation and induce apoptosis via caspase-3-dependent mitochondrial death pathway in ASTC-a-1 cells. Our work may provide evidence for further studies of DHA as a possible anticancer drug in the clinical treatment of lung adenocarcinoma.

  2. Cytoplasmic Overexpression of CD95L in Esophageal Adenocarcinoma Cells Overcomes Resistance to CD95-Mediated Apoptosis

    Directory of Open Access Journals (Sweden)

    Gregory A. Watson

    2011-03-01

    Full Text Available Introduction: The CD95/CD95L pathway plays a critical role in tissue homeostasis and immune system regulation; however, the function of this pathway in malignancy remains poorly understood. We hypothesized that CD95L expression in esophageal adenocarcinoma confers advantages to the neoplasm other than immune privilege. Methods: CD95L expression was characterized in immortalized squamous esophagus (HET-1A and Barrett esophagus (BAR-T cells; adenocarcinoma cell lines FLO-1, SEG-1, and BIC-1, and MDA468 (- control; and KFL cells (+ control. Analyses included reverse transcription-polymerase chain reaction, immunoblots of whole cell and secretory vesicle lysates, FACScan analysis, laser scanning confocal microscopy of native proteins and fluorescent constructs, and assessment of apoptosis and ERK1/2 pathways. Results: Cleaved, soluble CD95L is expressed at both the RNA and protein levels in these cell lines derived from esophageal adenocarcinoma and other human tissues. CD95L was neither trafficked to the cell membrane nor secreted into the media or within vesicles, rather the protein seems to be sequestered in the cytoplasm. CD95 and CD95L colocalize by immunofluorescence, but an interaction was not proven by immunoprecipitation. Overexpression of CD95L in the adenocarcinoma cell lines induced robust apoptosis and, under conditions of pan-caspase inhibition, resulted in activation of ERK signaling. Conclusions: CD95L localization in EA cells is inconsistent with the conference of immune privilege and is more consistent with a function that promotes tumor growth through alternative CD95 signaling. Reduced cell surface expression of CD95 affects cell sensitivity to extracellular apoptotic signals more significantly than alterations in downstream modulators of apoptosis.

  3. Adenocarcinoma ex-goblet cell carcinoid (appendiceal-type crypt cell adenocarcinoma) is a morphologically distinct entity with highly aggressive behavior and frequent association with peritoneal/intra-abdominal dissemination: an analysis of 77 cases

    OpenAIRE

    Reid, Michelle D.; Basturk, Olca; Shaib, Walid L; Xue, Yue; Balci, Serdar; Choi, Hye-Jeong; Akkas, Gizem; Memis, Bahar; Brian S Robinson; Bassel F. El-Rayes; Staley, Charles A.; Staley, Christopher A; Winer, Joshua H.; Russell, Maria C; Knight, Jessica H

    2016-01-01

    High-grade versions of appendiceal goblet cell carcinoids (?adenocarcinoma ex-goblet cell carcinoids?) are poorly characterized. We herein document 77 examples. Tumors occurred predominantly in females (74%), mean age 55 years (29?84), most with disseminated abdominal (77% peritoneal, 58% gynecologic tract involvement) and stage IV (65%) disease. Many presented to gynecologic oncologists, and nine had a working diagnosis of ovarian carcinoma. Metastases to liver (n =3) and lung (n =1) were un...

  4. Seminal plasma enhances cervical adenocarcinoma cell proliferation and tumour growth in vivo.

    Directory of Open Access Journals (Sweden)

    Jason R Sutherland

    Full Text Available Cervical cancer is one of the leading causes of cancer-related death in women in sub-Saharan Africa. Extensive evidence has shown that cervical cancer and its precursor lesions are caused by Human papillomavirus (HPV infection. Although the vast majority of HPV infections are naturally resolved, failure to eradicate infected cells has been shown to promote viral persistence and tumorigenesis. Furthermore, following neoplastic transformation, exposure of cervical epithelial cells to inflammatory mediators either directly or via the systemic circulation may enhance progression of the disease. It is well recognised that seminal plasma contains an abundance of inflammatory mediators, which are identified as regulators of tumour growth. Here we investigated the role of seminal plasma in regulating neoplastic cervical epithelial cell growth and tumorigenesis. Using HeLa cervical adenocarcinoma cells, we found that seminal plasma (SP induced the expression of the inflammatory enzymes, prostaglandin endoperoxide synthase (PTGS1 and PTGS2, cytokines interleukin (IL -6, and -11 and vascular endothelial growth factor-A (VEGF-A. To investigate the role of SP on tumour cell growth in vivo, we xenografted HeLa cells subcutaneously into the dorsal flank of nude mice. Intra-peritoneal administration of SP rapidly and significantly enhanced the tumour growth rate and size of HeLa cell xenografts in nude mice. As observed in vitro, we found that SP induced expression of inflammatory PTGS enzymes, cytokines and VEGF-A in vivo. Furthermore we found that SP enhances blood vessel size in HeLa cell xenografts. Finally we show that SP-induced cytokine production, VEGF-A expression and cell proliferation are mediated via the induction of the inflammatory PTGS pathway.

  5. p, p'-Dichlorodiphenyldichloroethylene induces colorectal adenocarcinoma cell proliferation through oxidative stress.

    Directory of Open Access Journals (Sweden)

    Li Song

    Full Text Available p, p'-Dichlorodiphenyldichloroethylene (DDE, the major metabolite of Dichlorodiphenyltrichloroethane (DDT, is an organochlorine pollutant and associated with cancer progression. The present study investigated the possible effects of p,p'-DDE on colorectal cancer and the involved molecular mechanism. The results indicated that exposure to low concentrations of p,p'-DDE from 10(-10 to 10(-7 M for 96 h markedly enhanced proliferations of human colorectal adenocarcinoma cell lines. Moreover, p,p'-DDE exposure could activate Wnt/β-catenin and Hedgehog/Gli1 signaling cascades, and the expression level of c-Myc and cyclin D1 was significantly increased. Consistently, p,p'-DDE-induced cell proliferation along with upregulated c-Myc and cyclin D1 were impeded by β-catenin siRNA or Gli1 siRNA. In addition, p,p'-DDE was able to activate NADPH oxidase, generate reactive oxygen species (ROS and reduce GSH content, superoxide dismutase (SOD and calatase (CAT activities. Treatment with antioxidants prevented p,p'-DDE-induced cell proliferation and signaling pathways of Wnt/β-catenin and Hedgehog/Gli1. These results indicated that p,p'-DDE promoted colorectal cancer cell proliferation through Wnt/β-catenin and Hedgehog/Gli1 signalings mediated by oxidative stress. The finding suggests an association between p,p'-DDE exposure and the risk of colorectal cancer progression.

  6. p, p'-Dichlorodiphenyldichloroethylene induces colorectal adenocarcinoma cell proliferation through oxidative stress.

    Science.gov (United States)

    Song, Li; Liu, Jianxin; Jin, Xiaoting; Li, Zhuoyu; Zhao, Meirong; Liu, Weiping

    2014-01-01

    p, p'-Dichlorodiphenyldichloroethylene (DDE), the major metabolite of Dichlorodiphenyltrichloroethane (DDT), is an organochlorine pollutant and associated with cancer progression. The present study investigated the possible effects of p,p'-DDE on colorectal cancer and the involved molecular mechanism. The results indicated that exposure to low concentrations of p,p'-DDE from 10(-10) to 10(-7) M for 96 h markedly enhanced proliferations of human colorectal adenocarcinoma cell lines. Moreover, p,p'-DDE exposure could activate Wnt/β-catenin and Hedgehog/Gli1 signaling cascades, and the expression level of c-Myc and cyclin D1 was significantly increased. Consistently, p,p'-DDE-induced cell proliferation along with upregulated c-Myc and cyclin D1 were impeded by β-catenin siRNA or Gli1 siRNA. In addition, p,p'-DDE was able to activate NADPH oxidase, generate reactive oxygen species (ROS) and reduce GSH content, superoxide dismutase (SOD) and calatase (CAT) activities. Treatment with antioxidants prevented p,p'-DDE-induced cell proliferation and signaling pathways of Wnt/β-catenin and Hedgehog/Gli1. These results indicated that p,p'-DDE promoted colorectal cancer cell proliferation through Wnt/β-catenin and Hedgehog/Gli1 signalings mediated by oxidative stress. The finding suggests an association between p,p'-DDE exposure and the risk of colorectal cancer progression.

  7. A Potential Daidzein Derivative Enhances Cytotoxicity of Epirubicin on Human Colon Adenocarcinoma Caco-2 Cells

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    2012-12-01

    Full Text Available In this study, we evaluated the effects of 8-hydroxydaidzein (8HD, an isoflavone isolated from fermented soy germ koji, and epirubicin (Epi, an antineoplastic agent, on the production of reactive oxygen species (ROS. We subsequently correlated the ROS levels to the anticancer mechanisms of Epi and 8HD in human colon adenocarcinoma Caco-2 cells. 8HD enhanced cytotoxicity of Epi and generated a synergistic effect. Epi and/or 8HD treatments increased the hydrogen peroxide and superoxide levels. Combined treatment markedly decreased mRNA expression levels of multidrug resistance protein 1 (MDR1, MDR-associated protein (MRP 1, and MRP2. 8HD significantly intensified Epi intracellular accumulation in Caco-2 cells. 8HD and/or Epi-induced apoptosis, as indicated by the reduced mitochondrial membrane potential and increased sub-G1 phase in cell cycle. Moreover, 8HD and Epi significantly enhanced the mRNA expressions of Bax, p53, caspases-3, -8, and -9. To our best knowledge, this study verifies for the first time that 8HD effectively circumvents MDR in Caco-2 cells through the ROS-dependent inhibition of efflux transporters and p53-mediated activation of both death receptor and mitochondrial pathways of apoptosis. Our findings of 8HD shed light on the future search for potential biotransformed isoflavones to intensify the cytotoxicity of anticancer drugs through simultaneous reversal of pump and nonpump resistance.

  8. Lung Adenocarcinoma and Squamous Cell Carcinoma Gene Expression Subtypes Demonstrate Significant Differences in Tumor Immune Landscape.

    Science.gov (United States)

    Faruki, Hawazin; Mayhew, Gregory M; Serody, Jonathan S; Hayes, D Neil; Perou, Charles M; Lai-Goldman, Myla

    2017-06-01

    Molecular subtyping of lung adenocarcinoma (AD) and lung squamous cell carcinoma (SCC) reveal biologically diverse tumors that vary in their genomic and clinical attributes. Published immune cell signatures and several lung AD and SCC gene expression data sets, including The Cancer Genome Atlas, were used to examine immune response in relation to AD and SCC expression subtypes. Expression of immune cell populations and other immune related genes, including CD274 molecule gene (CD274) (programmed death ligand 1), was investigated in the tumor microenvironment relative to the expression subtypes of the AD (terminal respiratory unit, proximal proliferative, and proximal inflammatory) and SCC (primitive, classical, secretory, and basal) subtypes. Lung AD and SCC expression subtypes demonstrated significant differences in tumor immune landscape. The proximal proliferative subtype of AD demonstrated low immune cell expression among ADs whereas the secretory subtype showed elevated immune cell expression among SCCs. Tumor expression subtype was a better predictor of immune cell expression than CD274 (programmed death ligand 1) in SCC tumors but was a comparable predictor in AD tumors. Nonsilent mutation burden was not correlated with immune cell expression across subtypes; however, major histocompatibility complex class II gene expression was highly correlated with immune cell expression. Increased immune and major histocompatibility complex II gene expression was associated with improved survival in the terminal respiratory unit and proximal inflammatory subtypes of AD and in the primitive subtype of SCC. Molecular expression subtypes of lung AD and SCC demonstrate key and reproducible differences in immune host response. Evaluation of tumor expression subtypes as potential biomarkers for immunotherapy should be investigated. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  9. Spatial distribution of B cells predicts prognosis in human pancreatic adenocarcinoma.

    Science.gov (United States)

    Castino, Giovanni Francesco; Cortese, Nina; Capretti, Giovanni; Serio, Simone; Di Caro, Giuseppe; Mineri, Rossana; Magrini, Elena; Grizzi, Fabio; Cappello, Paola; Novelli, Francesco; Spaggiari, Paola; Roncalli, Massimo; Ridolfi, Cristina; Gavazzi, Francesca; Zerbi, Alessandro; Allavena, Paola; Marchesi, Federica

    2016-04-01

    B-cell responses are emerging as critical regulators of cancer progression. In this study, we investigated the role of B lymphocytes in the microenvironment of human pancreatic ductal adenocarcinoma (PDAC), in a retrospective consecutive series of 104 PDAC patients and in PDAC preclinical models. Immunohistochemical analysis revealed that B cells occupy two histologically distinct compartments in human PDAC, either scatteringly infiltrating (CD20-TILs), or organized in tertiary lymphoid tissue (CD20-TLT). Only when retained within TLT, high density of B cells predicted longer survival (median survival 16.9 mo CD20-TLThi vs. 10.7 mo CD20-TLTlo; p = 0.0085). Presence of B cells within TLT associated to a germinal center (GC) immune signature, correlated with CD8-TIL infiltration, and empowered their favorable prognostic value. Immunotherapeutic vaccination of spontaneously developing PDAC (KrasG12D-Pdx1-Cre) mice with α-enolase (ENO1) induced formation of TLT with active GCs and correlated with increased recruitment of T lymphocytes, suggesting induction of TLT as a strategy to favor mobilization of immune cells in PDAC. In contrast, in an implanted tumor model devoid of TLT, depletion of B cells with an anti-CD20 antibody reinstated an antitumor immune response. Our results highlight B cells as an essential element of the microenvironment of PDAC and identify their spatial organization as a key regulator of their antitumor function. A mindfully evaluation of B cells in human PDAC could represent a powerful prognostic tool to identify patients with distinct clinical behaviors and responses to immunotherapeutic strategies.

  10. Identification of crucial microRNAs and genes in hypoxia-induced human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Geng Y

    2016-07-01

    Full Text Available Ying Geng,1,* Lili Deng,2,* Dongju Su,1 Jinling Xiao,1 Dongjie Ge,3 Yongxia Bao,1 Hui Jing4 1Department of Respiratory, 2Department of Oncology, The Second Affiliated Hospital of Harbin Medical University, 3Department of Respiratory, The First Hospital of Harbin, 4Department of Emergency, The Second Affiliated Hospital of Harbin Medical University Harbin, Heilongjiang, People’s Republic of China *These authors contributed equally to this work Background: Variations of microRNA (miRNA expression profile in hypoxic lung cancer cells have not been studied so far. Therefore, using miRNA microarray technology, this study aimed to study the miRNA expression profile and investigate the potential crucial miRNAs and their target genes in hypoxia-induced human lung adenocarcinoma cells.Materials and methods: Based on miRNA microarray, miRNA expression profiling of hypoxia-induced lung adenocarcinoma A549 cells was obtained. After identification of differentially expressed miRNAs (DE-miRNAs in hypoxic cells, target genes of DE-miRNAs were predicted, and functional enrichment analysis of targets was conducted. Furthermore, the expression levels of DE-miRNAs and their target genes were validated by real-time quantitative polymerase chain reaction. In addition, using miRNA mimics, the effect of overexpressed DE-miRNAs on A549 cell behaviors (cell proliferation, cell cycle, and apoptosis was evaluated.Results: In total, 14 DE-miRNAs (nine upregulated miRNAs and five downregulated miRNAs were identified in hypoxic cells, compared with normoxic cells. Target genes of both upregulated and downregulated miRNAs were enriched in the functions such as chromatin modification, and pathways such as Wnt signaling pathway and transforming growth factor (TGF-β signaling pathway. The expression levels of several miRNAs and their target genes were confirmed, including hsa-miR-301b/FOXF2, hsa-miR-148b-3p/WNT10B, hsa-miR-769-5p/(SMAD2, ARID1A, and hsa-miR-622. Among them

  11. Molecular Characterization of an Endometrial Endometrioid Adenocarcinoma Metastatic to a Thyroid Hürthle Cell Adenoma Showing Cancerization of Follicles.

    Science.gov (United States)

    Afrogheh, Amir H; Meserve, Emily; Sadow, Peter M; Stephen, Antonia E; Nosé, Vânia; Berlin, Suzanne; Faquin, William C

    2016-09-01

    Tumor-to-tumor metastasis is rare. Herein, we present a unique case of endometrial endometrioid adenocarcinoma metastatic to a thyroid Hürthle cell adenoma 9 years after initial diagnosis. On histologic examination of the thyroid, the malignant endometrioid glands and single cells (donor tumor) were dispersed within the Hürthle cell adenoma (recipient tumor). In several sections of the adenoma with still preserved microfollicular architecture, malignant endometrial adenocarcinoma cells were admixed within oncocytic adenomatous epithelium (so-called "cancerization of the follicles"). This unusual phenomenon, to our knowledge, is a novel finding in the thyroid gland. Immunohistochemistry, subsequently elicited clinical history, and morphologic comparison of the tumor in the thyroid to the primary endometrial tumor confirmed the origin of the donor tumor cells. Molecular analysis of both the metastatic and primary endometrial tumors demonstrated PIK3CA and PTEN mutations in both tumors, as is characteristic of well-differentiated endometrioid tumors of the endometrium. Amplification of chromosome 1q was detected in both sites; however, only the metastatic tumor showed loss of chromosomes 2, 9, and 22. The morphologic differential diagnosis of metastatic endometrioid adenocarcinoma in the thyroid includes columnar cell variant of papillary thyroid carcinoma (CCVPTC) arising in a preexisting adenoma, endocrine glandular atypia within an adenoma, and metastasis from other anatomic sites. Histomorphologic differences among these entities may be subtle; therefore, knowledge of and morphologic comparison with prior malignancies and immunohistochemistry can be helpful in rendering the correct diagnosis.

  12. Needle tract implantation after fine needle aspiration biopsy (FNAB) of transitional cell carcinoma of the urinary bladder and adenocarcinoma of the lung.

    Science.gov (United States)

    Vignoli, M; Rossi, F; Chierici, C; Terragni, R; De Lorenzi, D; Stanga, M; Olivero, D

    2007-07-01

    This paper reports three clinical cases of needle tract implantation of neoplastic cells on the abdominal and thoracic wall after ultrasound (US) fine needle aspiration biopsy (FNAB). Primary tumors were two transitional cell carcinomas of the urinary bladder (2 dogs) and one pulmonary adenocarcinoma (1 cat). All three masses grew up along the needle tract. To our knowledge, the seeding of pulmonary adenocarcinoma cells after FNAB on the thoracic wall has never been reported in veterinary medicine.

  13. Characterization of Cancer Stem Cells in Colon Adenocarcinoma Metastasis to the Liver.

    Science.gov (United States)

    Humphries, Hugo N; Wickremesekera, Susrutha K; Marsh, Reginald W; Brasch, Helen D; Mehrotra, Shreeja; Tan, Swee T; Itinteang, Tinte

    2017-01-01

    Fifty percent of colorectal cancer (CRC) patients develop liver metastasis. This study identified and characterized cancer stem cells (CSCs) within colon adenocarcinoma metastasis to the liver (CAML). 3,3-Diaminobenzidine immunohistochemical (IHC) staining was performed on nine CAML samples for embryonic stem cell (ESC) markers OCT4, SOX2, NANOG, c-Myc, and KLF4. Immunofluorescence (IF) IHC staining was performed to investigate coexpression of two markers. NanoString mRNA expression analysis and colorimetric in situ hybridization (CISH) were performed on four snap-frozen CAML tissue samples for transcript expression of these ESC markers. Cells stained positively and negatively for each marker by IHC and CISH staining were counted and analyzed. 3,3-Diaminobenzidine IHC staining, and NanoString and CISH mRNA analyses demonstrated the expression of OCT4, SOX2, NANOG, c-Myc, and KLF4 within in all nine CAML samples, except for SOX2 which was below detectable levels on NanoString mRNA analysis. IF IHC staining showed the presence of a SOX2 + /NANOG + /KLF4 + /c-Myc + /OCT - CSC subpopulation within the tumor nests, and a SOX2 + /NANOG + /KLF4 + /c-Myc + /OCT4 - CSC subpopulation and a SOX2 + /NANOG + /KLF4 + /c-Myc + /OCT4 + CSC subpopulation within the peritumoral stroma. The novel finding of three CSC subpopulations within CAML provides insights into the biology of CRC.

  14. Human Adenocarcinoma Cell Line Sensitivity to Essential Oil Phytocomplexes from Pistacia Species: a Multivariate Approach.

    Science.gov (United States)

    Buriani, Alessandro; Fortinguerra, Stefano; Sorrenti, Vincenzo; Dall'Acqua, Stefano; Innocenti, Gabbriella; Montopoli, Monica; Gabbia, Daniela; Carrara, Maria

    2017-08-11

    Principal component analysis (PCA) multivariate analysis was applied to study the cytotoxic activity of essential oils from various species of the Pistacia genus on human tumor cell lines. In particular, the cytotoxic activity of essential oils obtained from P. lentiscus, P. lentiscus var. chia (mastic gum), P. terebinthus, P. vera, and P. integerrima, was screened on three human adenocarcinoma cell lines: MCF-7 (breast), 2008 (ovarian), and LoVo (colon). The results indicate that all the Pistacia phytocomplexes, with the exception of mastic gum oil, induce cytotoxic effects on one or more of the three cell lines. PCA highlighted the presence of different cooperating clusters of bioactive molecules. Cluster variability among species, and even within the same species, could explain some of the differences seen among samples suggesting the presence of both common and species-specific mechanisms. Single molecules from one of the most significant clusters were tested, but only bornyl-acetate presented cytotoxic activity, although at much higher concentrations (IC50 = 138.5 µg/mL) than those present in the essential oils, indicating that understanding of the full biological effect requires a holistic vision of the phytocomplexes with all its constituents.

  15. Mastic Oil Inhibits the Metastatic Phenotype of Mouse Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Heleni Loutrari

    2011-02-01

    Full Text Available Mastic oil from Pistacia lentiscus variation chia, a natural combination of bioactive terpenes, has been shown to exert anti-tumor growth effects against a broad spectrum of cancers including mouse Lewis lung adenocarcinomas (LLC. However, no studies have addressed its anti-metastatic actions. In this study, we showed that treatment of LLC cells with mastic oil within a range of non-toxic concentrations (0.01–0.04% v/v: (a abrogated their Matrigel invasion and migration capabilities in transwell assays; (b reduced the levels of secreted MMP-2; (c restricted phorbol ester-induced actin remodeling and (d limited the length of neo-vessel networks in tumor microenvironment in the model of chick embryo chorioallantoic membrane. Moreover, exposure of LLC and endothelial cells to mastic oil impaired their adhesive interactions in a co-culture assay and reduced the expression of key adhesion molecules by endothelial cells upon their stimulation with tumor necrosis factor-alpha. Overall, this study provides novel evidence supporting a multipotent role for mastic oil in prevention of crucial processes related to cancer metastasis.

  16. Mastic Oil Inhibits the Metastatic Phenotype of Mouse Lung Adenocarcinoma Cells

    Energy Technology Data Exchange (ETDEWEB)

    Loutrari, Heleni, E-mail: elloutrar@med.uoa.gr; Magkouta, Sophia [“G.P. Livanos and M. Simou Laboratories”, Evangelismos Hospital, Department of Critical Care and Pulmonary Services, School of Medicine, University of Athens, 3 Ploutarchou Street, 10675 Athens (Greece); Papapetropoulos, Andreas [Laboratory of Molecular Pharmacology, Department of Pharmacy, University of Patras, 26504 Patras (Greece); Roussos, Charis [“G.P. Livanos and M. Simou Laboratories”, Evangelismos Hospital, Department of Critical Care and Pulmonary Services, School of Medicine, University of Athens, 3 Ploutarchou Street, 10675 Athens (Greece)

    2011-02-23

    Mastic oil from Pistacia lentiscus variation chia, a natural combination of bioactive terpenes, has been shown to exert anti-tumor growth effects against a broad spectrum of cancers including mouse Lewis lung adenocarcinomas (LLC). However, no studies have addressed its anti-metastatic actions. In this study, we showed that treatment of LLC cells with mastic oil within a range of non-toxic concentrations (0.01–0.04% v/v): (a) abrogated their Matrigel invasion and migration capabilities in transwell assays; (b) reduced the levels of secreted MMP-2; (c) restricted phorbol ester-induced actin remodeling and (d) limited the length of neo-vessel networks in tumor microenvironment in the model of chick embryo chorioallantoic membrane. Moreover, exposure of LLC and endothelial cells to mastic oil impaired their adhesive interactions in a co-culture assay and reduced the expression of key adhesion molecules by endothelial cells upon their stimulation with tumor necrosis factor-alpha. Overall, this study provides novel evidence supporting a multipotent role for mastic oil in prevention of crucial processes related to cancer metastasis.

  17. Net expression inhibits the growth of pancreatic ductal adenocarcinoma cell PL45 in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Baiwen Li

    Full Text Available Pancreatic ductal adenocarcinoma has a poor prognosis due to late diagnosis and a lack of effective therapeutic options. Thus, it is important to better understand its molecular mechanisms and to develop more effective treatments for the disease. The ternary complex factor Net, which exerts its strong inhibitory function on transcription of proto-oncogene gene c-fos by forming ternary complexes with a second transcription factor, has been suspected of being involved in pancreatic cancer and other tumors biology. In this study, we found that the majority of pancreatic ductal adenocarcinoma tissues and cell lines had weak or no expression of Net, whereas significantly high level of Net expression occurred in paired adjacent normal tissues we studied. Furthermore, using in vitro and in vivo model systems, we found that overexpression of Net inhibited cell growth and survival and induced cell apoptosis in human pancreatic ductal adenocarcinoma cell PL45; the mechanisms by which Net inhibited the cell cycle progression were mainly through P21-Cyclin D1/CDK4 Pathway. Our data thus suggested that Net might play an important role in pancreatic carcinogenesis, possibly by acting as a tumor suppressor gene.

  18. The study of optimal condition of SPIO labeling human lung adenocarcinoma cell line (SPC-A-1)

    Science.gov (United States)

    Yu, Ming-xi; Chen, Wen-li; Zhou, Quan; Xing, Da; Tang, Yong-hong

    2008-02-01

    Propose: To study the optimal concentration and time of incubation of human lung adenocarcinoma cell line (SPC-A-1) labeled with superparamagnetic iron oxide (SPIO) particles in vitro. Methods: Human lung adenocarcinoma cell line (SPC-A-1) was cultured with different concenration of SPIO and different time of incubation (labeled with media containing Fe-PLL: 25μg /mL, 100μg /mL, and 200 μg /mL, and for 30min, 90min, 180min. The phagocytosis of the cells was observed by laser scanning confocal microscopy (LSCM) to determine particle uptake and their distribution in cells. Results: Human lung adenocarcinoma cells(SPC-A-1) have taken up a large amount of SPIO particles within the first 3h. Conclusion: In this study, the concentration of iron with 25μg/ml SPIO and time of incubation for 30min is the optimal condition for labeling the SPC-A-1 with SPIO.

  19. In Vitro Effects of Phthalate Mixtures on Colorectal Adenocarcinoma Cell Lines.

    Science.gov (United States)

    Yurdakok Dikmen, Begum; Alpay, Merve; Kismali, Gorkem; Filazi, Ayhan; Kuzukiran, Ozgur; Sireli, Ufuk Tansel

    2015-01-01

    Among endocrine-disrupting chemicals, phthalates are an important concern because of their wide-spread exposure in humans and environmental contamination. Even though the use of some phthalates has been restricted for toys, some plastics, and food contact materials, exposure to the mixture of these contaminants at very low concentrations in various matrices are still being reported. In the current research, the effects of the mixture of some phthalates were studied. Di-n-butyl phthalate (DBP), n-butyl benzyl phthalate (BBP), di-2-ethylhexyl phthalate (DEHP), diisononyl phthalate (DiNP), di-n-octyl phthalate (DNOP), and diisodecyl phthalate (DiDP) were tested on two colorectal adenocarcinoma cell lines; DLD-1 and HT29 were studied as described before. Cells were treated with increasing log concentrations (0.33 ppt to 33.33 ppb) of the phthalate mixture; cell viability/proliferation was measured by MTT and staining with neutral red and crystal violet; lactate dehydrogenase (LDH) activity was measured following 24-h exposure. Cell viability/proliferation increased from phthalate treatment at concentrations less than 33.33 ppt. The phthalate mixture induced increases in HT29 proliferation of 10.94% at 33.33 ppt and 60.87% at 3.33 ppt, whereas this proliferation relation at lower concentrations was not found for DLD1 cells. The present study demonstrates preliminary information regarding the low dose induction of proliferation of the cancer cells by phthalate mixtures. Because non-monotonic dose responses are still being debated, further studies are required to re-evaluate the reference doses defined by governments for phthalates.

  20. Inositol Hexakisphosphate Mediates Apoptosis in Human Breast Adenocarcinoma MCF-7 Cell Line via Intrinsic Pathway

    Science.gov (United States)

    Agarwal, Rakhee; Ali, Nawab

    2010-04-01

    Inositol polyphosphates (InsPs) are naturally occurring compounds ubiquitously present in plants and animals. Inositol hexakisphosphate (InsP6) is the most abundant among all InsPs and constitutes the major portion of dietary fiber in most cereals, legumes and nuts. Certain derivatives of InsPs also regulate cellular signaling mechanisms. InsPs have also been shown to reduce tumor formation and induce apoptosis in cancerous cells. Therefore, in this study, the effects of InsPs on apoptosis were studied in an attempt to investigate their potential anti-cancer therapeutic application and understand their mechanism of action. Acridine orange and ethidium bromide staining suggested that InsP6 dose dependently induced apoptosis in human breast adenocarcinoma MCF-7 cells. Among InsPs tested (InsP3, InsP4, InsP5, and InsP6), InsP6 was found to be the most effective in inducing apoptosis. Furthermore, effects of InsP6 were found most potent inducing apoptosis. Etoposide, the drug known to induce apoptosis in both in vivo and in vitro, was used as a positive control. Western blotting experiments using specific antibodies against known apoptotic markers suggested that InsP6 induced apoptotic changes were mediated via an intrinsic apoptotic pathway.

  1. Enhancement of Radiation Effects by Ursolic Acid in BGC-823 Human Adenocarcinoma Gastric Cancer Cell Line.

    Directory of Open Access Journals (Sweden)

    Yang Yang

    Full Text Available Recent research has suggested that certain plant-derived polyphenols, i.e., ursolic acid (UA, which are reported to have antitumor activities, might be used to sensitize tumor cells to radiation therapy by inhibiting pathways leading to radiation therapy resistance. This experiment was designed to investigate the effects and possible mechanism of radiosensitization by UA in BGC-823 cell line from human adenocarcinoma gastric cancer in vitro. UA caused cytotoxicity in a dose-dependent manner, and we used a sub-cytotoxicity concentration of UA to test radioenhancement efficacy with UA in gastric cancer. Radiosensitivity was determined by clonogenic survival assay. Surviving fraction of the combined group with irradiation and sub-cytotoxicity UA significantly decreased compared with the irradiation group. The improved radiosensitization efficacy was associated with enhanced G2/M arrest, increased reactive oxygen species (ROS, down-regulated Ki-67 level and improved apoptosis. In conclusion, as UA demonstrated potent antiproliferation effect and synergistic effect, it could be used as a potential drug sensitizer for the application of radiotherapy.

  2. Promoter Methylation status of HIN-1 associated with outcomes of ovarian clear cell adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Ho Chih-Ming

    2012-08-01

    Full Text Available Abstract Background This study is to analyze promoter methylation of various tumor suppressor genes in different types of ovarian carcinoma and to identify potential therapeutic targets of ovarian clear cell adenocarcinoma (OCCA. Materials and methods The promoter methylation statuses of 40 genes in primary ovarian carcinomas including 47 clear- and 63 non-clear-cell type tissues, 6 OCCA cell lines, 29 benign ovarian endometriotic cysts, and 31 normal controls were analyzed by methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA. The MS-MLPA results were correlated with clinicopathological features and outcomes of 47 OCCA patients. Functions of the target genes were further explored by Western Blot Analysis, apoptosis assay, and caspase-3/7 activity analysis. Results Frequencies of methylated RASSF1A, CDH13, CACNA1A, HIN-1, and sFRP5 genes in OCCA tissues were significantly higher than those in non-OCCA cancerous tissues and benign endometriotic cysts. The expected OS for patients with methylated promoters of HIN-1 was significantly worse than those for patients without methylated HIN-1 (30% vs. 62%, p = 0.002. The HIN-1 gene was over-expressed in ES2 cells, a significant reduction in cell growth and induction of apoptosis, and increasing paclitaxel sensitivity by reducing phosphorylation of Akt were observed. Conclusions Methylation of HIN-1 promoter is a novel epigenetic biomarker associated with poor outcomes in OCCA patients. Ectopic expression of the HIN-1 gene increased paclitaxel sensitivity which is partly through Akt pathway.

  3. Human pancreatic stellate cells modulate 3D collagen alignment to promote the migration of pancreatic ductal adenocarcinoma cells.

    Science.gov (United States)

    Drifka, Cole R; Loeffler, Agnes G; Esquibel, Corinne R; Weber, Sharon M; Eliceiri, Kevin W; Kao, W John

    2016-12-01

    A hallmark of pancreatic ductal adenocarcinoma (PDAC) is the ability for cancer cells to aggressively infiltrate and navigate through a dense stroma during the metastatic process. Key features of the PDAC stroma include an abundant population of activated pancreatic stellate cells (PSCs) and highly aligned collagen fibers; however, important questions remain regarding how collagen becomes aligned and what the biological manifestations are. To better understand how PSCs, aligned collagen, and PDAC cells might cooperate during the transition to invasion, we utilized a microchannel-based in vitro tumor model and advanced imaging technologies to recreate and examine in vivo-like heterotypic interactions. We found that PSCs participate in a collaborative process with cancer cells by orchestrating the alignment of collagen fibers that, in turn, are permissive to enhanced cell migration. Additionally, direct contact between PSCs, collagen, and PDAC cells is critical to invasion and co-migration of both cell types. This suggests PSCs may accompany and assist in navigating PDAC cells through the stromal terrain. Together, our data provides a new role for PSCs in stimulating the metastatic process and underscores the importance of collagen alignment in cancer progression.

  4. Early-Onset Signet-Ring Cell Adenocarcinoma of the Colon: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Maliha Khan

    2017-01-01

    Full Text Available Colorectal cancer (CRC remains the second leading cause of cancer-related deaths in the United States. While a decline has been observed in the older population, the occurrence of CRC in the adolescent and young adult (AYA population has increased over the past two decades. The histopathologic characteristics and clinical behavior of CRC in AYA patients have been shown to be distinct from those of CRC in older adults. The rarer subtypes of CRC such as mucinous adenocarcinoma and signet-ring cell carcinoma are associated with a poorer prognosis compared to the more common subtypes. Here we report a case of a 20-year-old man who was diagnosed with stage IVB (T4 N2 M1, with peritoneal carcinomatosis signet-ring cell adenocarcinoma of the colon. The scarcity of information on these rarer subtypes merits further study and investigation.

  5. Spontaneously Arising Concurrent Ileocaecal Adenocarcinoma and Renal Pelvis Transitional Cell Carcinoma in a Rhesus Macaque (Macaca mulatta)

    Science.gov (United States)

    Gumber, S.; Wood, J. S.; Jones, A. C.; Strobert, E.

    2015-01-01

    Summary A 25-year-old, female rhesus macaque presented with a history of weight loss despite a normal appetite and supportive care. The animal was humanely destroyed due to poor prognosis. Post-mortem examination revealed a focally extensive, firm, white annular constriction at the ileocaecal junction and an incidental finding of a pale white nodule approximately 0.8 cm in diameter in the left renal pelvis. Based on the microscopical findings, ileocaecal adenocarcinoma and renal pelvis transitional cell carcinoma (TCC) was diagnosed. The use of cytokeratin (CK)-7 and-20 and uroplakin III as potential renal TCC markers was evaluated. The neoplastic cells were labelled intensely with antibodies to uroplakin III, but not to CK-7 or -20. Spontaneous intestinal adenocarcinoma has been documented in the rhesus macaque, but concurrent renal pelvis TCC is highly unusual. PMID:24016782

  6. Long Noncoding RNA RGMB-AS1 Indicates a Poor Prognosis and Modulates Cell Proliferation, Migration and Invasion in Lung Adenocarcinoma

    Science.gov (United States)

    Li, Ping; Zhang, Guojun; Li, Juan; Yang, Rui; Chen, Shanshan; Wu, Shujun; Zhang, Furui; Bai, Yong; Zhao, Huasi; Wang, Yuanyuan; Dun, Shaozhi; Chen, Xiaonan; Sun, Qianqian; Zhao, Guoqiang

    2016-01-01

    Lung cancer is the most common cause of cancer-related mortality worldwide. It is a complex disease involving multiple genetic and epigenetic alterations. The development of transcriptomics revealed the important role of long non-coding RNAs (lncRNAs) in lung cancer occurrence and development. Here, microarray analysis of lung adenocarcinoma tissues showed the abnormal expression of lncRNA RGMB-AS1. However, the role of lncRNA RGMB-AS1 in lung adenocarcinoma remains largely unknown. We showed that upregulation of lncRNA RGMB-AS1 was significantly correlated with differentiation, TNM stage, and lymph node metastasis. In lung adenocarcinoma cells, downregulation of lncRNA RGMB-AS1 inhibited cell proliferation, migration, invasion, and caused cell cycle arrest at the G1/G0 phase. In vivo experiments showed that lncRNA RGMB-AS1 downregulation significantly suppressed the growth of lung adenocarcinoma. The expression of lncRNA RGMB-AS1 was inversely correlated with that of repulsive guidance molecule b (RGMB) in lung adenocarcinoma tissues, and UCSC analysis and fluorescence detection assay indicated that lncRNA RGMB-AS1 may be involved in the development of human lung adenocarcinoma by regulating RGMB expression though exon2 of RGMB. In summary, our findings indicate that lncRNA RGMB-AS1 may play an important role in lung adenocarcinoma and may serve as a potential therapeutic target. PMID:26950071

  7. The tumor suppressor gene RBM5 inhibits lung adenocarcinoma cell growth and induces apoptosis

    Directory of Open Access Journals (Sweden)

    Shao Chen

    2012-08-01

    Full Text Available Abstract Background The loss of tumor suppressor gene (TSG function is a critical step in the pathogenesis of human lung cancer. RBM5 (RNA-binding motif protein 5, also named H37/LUCA-15 gene from chromosome 3p21.3 demonstrated tumor suppressor activity. However, the role of RBM5 played in the occurrence and development of lung cancer is still not well understood. Method Paired non-tumor and tumor tissues were obtained from 30 adenocarcinomas. The expression of RBM5 mRNA and protein was examined by RT-PCR and Western blot. A549 cell line was used to determine the apoptotic function of RBM5 in vitro. A549 cells were transiently transfected with pcDNA3.1-RBM5. AnnexinV analysis was performed by flow cytometry. Expression of Bcl-2, cleaved caspase-3, caspase-9 and PAPP proteins in A549 lung cancer cells and the A549 xenograft BALB/c nude mice model was determined by Western blot. Tumor suppressor activity of RBM5 was also examined in the A549 xenograft model treated with pcDNA3.1-RBM5 plasmid carried by attenuated Salmonella typhi Ty21a. Result The expression of RBM5 mRNA and protein was decreased significantly in adenocarcinoma tissues compared to that in the non-tumor tissues. In addition, as compared to the vector control, a significant growth inhibition of A549 lung cancer cells was observed when transfected with pcDNA3.1-RBM5 as determined by cell proliferation assay. We also found that overexpression of RBM5 induced both early and late apoptosis in A549 cells using AnnexinV/PI staining as determined by flow cytometry. Furthermore, the expression of Bcl-2 protein was decreased, whereas the expression of cleaved caspase-3, caspase-9 and PARP proteins was significantly increased in the RBM5 transfected cells; similarly, expression of decreased Bcl-2 and increased cleaved caspase-3 proteins was also examined in the A549 xenograft model. More importantly, we showed that accumulative and stable overexpression of RBM5 in the A549 xenograft BALB

  8. Expression of RNA-binding motif 10 is associated with advanced tumor stage and malignant behaviors of lung adenocarcinoma cancer cells.

    Science.gov (United States)

    Guan, Guofang; Li, Ranwei; Tang, Wenfang; Liu, Tiecheng; Su, Zhenzhong; Wang, Yan; Tan, Jingjin; Jiang, Shan; Wang, Ke

    2017-03-01

    This study assessed RNA-binding motif 10 expression in lung adenocarcinoma tissues and examined the role and mechanism of RNA-binding motif 10 in the regulation of lung adenocarcinoma malignancy. Lung adenocarcinoma and corresponding adjacent non-tumor lung tissues from 41 patients were subjected to reverse transcription-polymerase chain reaction and Western blot assessment to detect RNA-binding motif 10 expression. Recombinant lentivirus carrying RNA-binding motif 10 complementary DNA was used to infect lung adenocarcinoma cell lines, A549 and H1299 cells. Complementary DNA microarray was used to profile RNA-binding motif 10-regulated genes. Levels of RNA-binding motif 10 messenger RNA and protein were significantly lower in lung adenocarcinoma tissues than those in paired non-tumor tissues (p lung adenocarcinoma cell lines and induced cell-cycle arrest at G0/G1 phase in A549 cells and at S phase in H1299 cells. Complementary DNA microarray analysis identified 304 upregulated and 386 downregulated genes induced by RNA-binding motif 10 overexpression, which may be involved in cancer, focal adhesion, peroxisome proliferator-activated receptor-regulated gene pathway, cytokine-cytokine receptor interaction, mitogen-activated protein kinase signaling, complement and coagulation cascades, platelet amyloid precursor protein pathway, extracellular matrix-receptor interaction, and small cell lung cancer-related genes. Expression of FGF2, EGFR, WNT5A, NF-κB, and RAP1A was downregulated, whereas expression of AKT2, BIRC3, and JUN was upregulated. RNA-binding motif 10 messenger RNA and protein were reduced in lung adenocarcinoma tissues, and RNA-binding motif 10 overexpression inhibited lung adenocarcinoma cancer cell malignant behavior in vitro. Molecularly, RNA-binding motif 10 regulates many gene pathways involving in the tumor development or progression.

  9. Xenon decreases cell migration and secretion of a pro-angiogenesis factor in breast adenocarcinoma cells: comparison with sevoflurane.

    Science.gov (United States)

    Ash, S A; Valchev, G I; Looney, M; Ni Mhathuna, A; Crowley, P D; Gallagher, H C; Buggy, D J

    2014-07-01

    While volatile agents have been implicated in metastasis-enhancing effects on cancer cells, the effects of xenon are unknown. We investigated xenon- and sevoflurane-mediated effects on migration and expression of angiogenesis biomarkers in human breast adenocarcinoma cells. MDA-MB-231 and MCF-7 cells were exposed to xenon 70% with O2 25%, CO2 5%; control gas containing O2 25%, CO2 5%, N2 70%; or sevoflurane 2.5 vol% administered in O2 60%, N2 37%, or control gas. Cell viability was determined by the MTT assay. Migration at 24 h was determined using the Oris™ Cell Migration Assay. Secretion of angiogenesis factors was measured using a membrane-based immunoassay array. Xenon reduced MDA-MB-231 migration to 59 (13%) after 1-h exposure (P=0.02), 64 (10%) after 3 h (P=0.01), and 71 (9%) after 5 h (P=0.04) compared with control gas, without affecting viability. Similarly, MCF-7 migration was significantly reduced at all timepoints [to 58 (12%) at 1 h, 65 (12%) at 3 h, and 65% (12%) at 5 h]. Sevoflurane did not affect migration when delivered in control gas. Glycine, an N-methyl-d-aspartate receptor co-agonist, antagonized the effects of xenon on migration. Expression of the pro-angiogenesis factor regulated on activation, normal T cell expressed and secreted (RANTES) was reduced in conditioned medium from xenon-exposed MDA-MB-231 cells compared with cells exposed to either control gas or sevoflurane [mean dot density 2.0 (0.2) compared with 3.0 (0.1) and 3.1 (0.3), respectively (P=0.02)]. Xenon, but not sevoflurane, inhibited migration in both oestrogen receptor positive and negative breast adenocarcinoma cells. Furthermore, xenon decreased release of the pro-angiogenic factor RANTES from MDA-MB-231 cells. © The Author [2014]. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. ALDH1-high ovarian cancer stem-like cells can be isolated from serous and clear cell adenocarcinoma cells, and ALDH1 high expression is associated with poor prognosis.

    Directory of Open Access Journals (Sweden)

    Takafumi Kuroda

    Full Text Available Cancer stem-like cells (CSCs/cancer-initiating cells (CICs are defined as a small population of cancer cells that have high tumorigenicity. Furthermore, CSCs/CICs are resistant to several cancer therapies, and CSCs/CICs are therefore thought to be responsible for cancer recurrence after treatment and distant metastasis. In epithelial ovarian cancer (EOC cases, disease recurrence after chemotherapy is frequently observed, suggesting ovarian CSCs/CICs are involved. There are four major histological subtypes in EOC, and serous adenocarcinoma and clear cell adenocarcinoma are high-grade malignancies. We therefore analyzed ovarian CSCs/CICs from ovarian carcinoma cell lines (serous adenocarcinoma and clear cell adenocarcinoma and primary ovarian cancer cells in this study. We isolated ovarian CSCs/CICs as an aldehyde dehydrogenase 1 high (ALDH1(high population from 6 EOC cell lines (3 serous adenocarcinomas and 3 clear cell adenocarcinomas by the ALDEFLUOR assay. ALDH1(high cells showed greater sphere-forming ability, higher tumorigenicity and greater invasive capability, indicating that ovarian CSCs/CICs are enriched in ALDH1(high cells. ALDH1(high cells could also be isolated from 8 of 11 primary ovarian carcinoma samples. Immunohistochemical staining revealed that higher ALDH1 expression levels in ovary cancer cases are related to poorer prognosis in both serous adenocarcinoma cases and clear cell adenocarcinoma cases. Taken together, the results indicate that ALDH1 is a marker for ovarian CSCs/CICs and that the expression level of ALDH1 might be a novel biomarker for prediction of poor prognosis.

  11. Inhibitory Effects of the Survivin siRNA Transfection on Human Lung Adenocarcinoma Cells SPCA1 and SH77

    Directory of Open Access Journals (Sweden)

    Quanxi LIU

    2011-01-01

    Full Text Available Background and objective Survivin, a member of the inhibitor of apoptosis (IAP protein family, has been demonstrated as a potential new target for apoptosis-based therapy in cancer and lymphoma. The aim of this study is to investigate effects and mechanisms of survivin siRNA transfection on lung adenocarcinoma cell lines SPCA1 and SH77. Methods A siRNA plasmid expression vector and pSi scrambled against survivin were constructed and transfected into SPCA1 and SH77 cells with Lipofectamine 2000. The proliferations of lung adenocarcinoma SPCA1 and SH77 cells were detected by MTT. The apoptotic rate and cell cycle were detected by flow cytometer. The activity of survivin mRNA and protein expression were analyzed with RT-PCR and Western blot. Results Survivin siRNA reduced the proliferation of SPCA1 and SH77 cells. Cell cycle was inhibited in G0/G1. Expressions of survivin siRNA mRNA and protein were reduced in transfected cells compared with the control cells. Conclusion siRNA targeted against survivin can effectively suppress SPCA1 and SH77 cells proliferation and significantly induce SPCA1 and SH77 cells apoptosis.

  12. ATM Deficiency Generating Genomic Instability Sensitizes Pancreatic Ductal Adenocarcinoma Cells to Therapy-Induced DNA Damage.

    Science.gov (United States)

    Perkhofer, Lukas; Schmitt, Anna; Romero Carrasco, Maria Carolina; Ihle, Michaela; Hampp, Stephanie; Ruess, Dietrich Alexander; Hessmann, Elisabeth; Russell, Ronan; Lechel, André; Azoitei, Ninel; Lin, Qiong; Liebau, Stefan; Hohwieler, Meike; Bohnenberger, Hanibal; Lesina, Marina; Algül, Hana; Gieldon, Laura; Schröck, Evelin; Gaedcke, Jochen; Wagner, Martin; Wiesmüller, Lisa; Sipos, Bence; Seufferlein, Thomas; Reinhardt, Hans Christian; Frappart, Pierre-Olivier; Kleger, Alexander

    2017-10-15

    Pancreatic ductal adenocarcinomas (PDAC) harbor recurrent functional mutations of the master DNA damage response kinase ATM, which has been shown to accelerate tumorigenesis and epithelial-mesenchymal transition. To study how ATM deficiency affects genome integrity in this setting, we evaluated the molecular and functional effects of conditional Atm deletion in a mouse model of PDAC. ATM deficiency was associated with increased mitotic defects, recurrent genomic rearrangements, and deregulated DNA integrity checkpoints, reminiscent of human PDAC. We hypothesized that altered genome integrity might allow synthetic lethality-based options for targeted therapeutic intervention. Supporting this possibility, we found that the PARP inhibitor olaparib or ATR inhibitors reduced the viability of PDAC cells in vitro and in vivo associated with a genotype-selective increase in apoptosis. Overall, our results offered a preclinical mechanistic rationale for the use of PARP and ATR inhibitors to improve treatment of ATM-mutant PDAC. Cancer Res; 77(20); 5576-90. ©2017 AACR. ©2017 American Association for Cancer Research.

  13. A Petiveria alliacea standardized fraction induces breast adenocarcinoma cell death by modulating glycolytic metabolism.

    Science.gov (United States)

    Hernández, John Fredy; Urueña, Claudia Patricia; Cifuentes, Maria Claudia; Sandoval, Tito Alejandro; Pombo, Luis Miguel; Castañeda, Diana; Asea, Alexzander; Fiorentino, Susana

    2014-05-14

    Folk medicine uses aqueous and alcoholic extracts from Petiveria alliacea (Phytolaccaceae) in leukemia and breast cancer treatment in the Caribbean, Central and South America. Herein, we validated the biological activity of a Petiveria alliacea fraction using a metastatic breast adenocarcinoma model (4T1). Petiveria alliacea fraction biological activity was determined estimating cell proliferation, cell colony growth capacity and apoptosis (caspase-3 activity, DNA fragmentation and mitochondrial membrane potential) in 4T1 cells. Petiveria alliacea was used at IC₅₀ concentration (29 µg/mL) and 2 dilutions below, doxorubicin at 0.27 µg/mL (positive control) and dibenzyl disulfide at 2.93 µg/mL (IC50 fraction marker compound). Proteomic estimations were analyzed by LC-MS-MS. Protein level expression was confirmed by RT-PCR. Glucose and lactate levels were measured by enzymatic assays. LD50 was established in BALB/c mice and antitumoral activity evaluated in mice transplanted with GFP-tagged 4T1 cells. Mice were treated with Petiveria alliacea fraction via I.P (182 mg/kg corresponding to 1/8 of LD₅₀ and 2 dilutions below). Petiveria alliacea fraction in vitro induces 4T1 cells apoptosis, caspase-3 activation, DNA fragmentation without mitochondria membrane depolarization, and decreases cell colony growth capacity. Also, changes in glycolytic enzymes expression cause a decrease in glucose uptake and lactate production. Fraction also promotes breast primary tumor regression in BALB/c mice transplanted with GFP-tagged 4T1 cells. A fraction of Petiveria alliacea leaves and stems induces in vitro cell death and in vivo tumor regression in a murine breast cancer model. Our results validate in partly, the traditional use of Petiveria alliacea in breast cancer treatment, revealing a new way of envisioning Petiveria alliacea biological activity. The fraction effect on the glycolytic pathway enzymes contributes to explain the antiproliferative and antitumor activities

  14. Characterization of Cancer Stem Cells in Colon Adenocarcinoma Metastasis to the Liver

    Directory of Open Access Journals (Sweden)

    Hugo N. Humphries

    2018-01-01

    Full Text Available BackgroundFifty percent of colorectal cancer (CRC patients develop liver metastasis. This study identified and characterized cancer stem cells (CSCs within colon adenocarcinoma metastasis to the liver (CAML.Methods3,3-Diaminobenzidine immunohistochemical (IHC staining was performed on nine CAML samples for embryonic stem cell (ESC markers OCT4, SOX2, NANOG, c-Myc, and KLF4. Immunofluorescence (IF IHC staining was performed to investigate coexpression of two markers. NanoString mRNA expression analysis and colorimetric in situ hybridization (CISH were performed on four snap-frozen CAML tissue samples for transcript expression of these ESC markers. Cells stained positively and negatively for each marker by IHC and CISH staining were counted and analyzed.Results3,3-Diaminobenzidine IHC staining, and NanoString and CISH mRNA analyses demonstrated the expression of OCT4, SOX2, NANOG, c-Myc, and KLF4 within in all nine CAML samples, except for SOX2 which was below detectable levels on NanoString mRNA analysis. IF IHC staining showed the presence of a SOX2+/NANOG+/KLF4+/c-Myc+/OCT− CSC subpopulation within the tumor nests, and a SOX2+/NANOG+/KLF4+/c-Myc+/OCT4− CSC subpopulation and a SOX2+/NANOG+/KLF4+/c-Myc+/OCT4+ CSC subpopulation within the peritumoral stroma.ConclusionThe novel finding of three CSC subpopulations within CAML provides insights into the biology of CRC.

  15. Adenocarcinoma of the Lung Acquiring Resistance to Afatinib by Transformation to Small Cell Carcinoma: A Case Report

    Directory of Open Access Journals (Sweden)

    Jun Nishimura

    2017-07-01

    Full Text Available A 65-year-old woman visited our hospital due to right chest pain and dyspnea on exertion. Chest radiography revealed decreased permeability of the right lung. Computed tomography demonstrated a huge mass in the right upper lobe and right pleural effusion. Right pleural effusion cytology yielded a diagnosis of adenocarcinoma and was positive for mutation of epidermal growth factor receptor (EGFR; exon 21 L858R. Afatinib was selected for the initial treatment. Multiple tumors regressed remarkably, but then rapidly progressed 3 months later. We performed re-biopsy to detect the mechanism of resistance to afatinib. Histopathology revealed a mixture of small cell carcinoma (SCC and adenocarcinoma harboring same EGFR mutation. To the best of our knowledge, this is the first report of transformation to SCC after treatment with afatinib.

  16. Galectin-1 is overexpressed in CD133+ human lung adenocarcinoma cells and promotes their growth and invasiveness

    Science.gov (United States)

    Zhou, Xuefeng; Li, Dan; Wang, Xianguo; Zhang, Bo; Zhu, Hua; Zhao, Jinping

    2015-01-01

    Previous studies demonstrated that a subpopulation of cancer cells, which are CD133 positive (CD133+) feature higher invasive and metastatic abilities, are called cancer stem cells (CSCs). By using tumor cells derived from patients with lung adenocarcinoma, we found that galectin-1 is highly overexpressed in the CD133+ cancer cells as compared to the normal cancer cells (CD133−) from the same patients. We overexpressed galectin-1 in CD133− cancer cells and downregulated it in CSCs. We found that overexpression of galectin-1 promoted invasiveness of CD133− cells, while knockdown of galectin-1 suppressed proliferation, colony formation and invasiveness of CSCs. Furthermore, tumor growth was significantly inhibited in CSCs xenografts with knockdown of galectin-1 as compared to CSCs treated with scramble siRNAs. Biochemical studies revealed that galectin-1 knockdown led to the suppression of COX-2/PGE2 and AKT/mTOR pathways, indicating galectin-1 might control the phenotypes of CSCs by regulating these signaling pathways. Finally, a retrospective study revealed that galectin-1 levels in blood circulation negatively correlates with overall survival and positively correlates with lymph node metastasis of the patients. Taken together, these findings suggested that galectin-1 plays a major role on the tumorigenesis and invasiveness of CD133+ cancer cells and might serve as a potential therapeutic target for treatment of human patients with lung adenocarcinoma. PMID:25605013

  17. Mechanism study of low-energy laser irradiation-induced lung adenocarcinoma cell proliferation by FRET in living cell

    Science.gov (United States)

    Wang, Fang; Chen, Xiao-Chuan; Xing, Da

    2004-07-01

    Low-energy laser irradiation (LELI) has been shown to promote cell proliferation in various cell types, yet the mechanism of which has not been fully clarified. The Ras/Raf/MEK (mitogen-activated protein kinase)ERK kinase)/ERK (extracellular-signal-regulated kinase) signaling pathway is a network that govern proliferation, differentiation and cell survival. Recent studies suggested that Ras/Raf/MEK/ERK pathway is involved in the LELI-induced cell proliferation. Here, we utilized fluorescence resonance energy transfer (FRET) technique to investigate the effect of LELI on Ras/Raf signaling pathway in living cells. Raichu-Ras reporter plasmid was utilized which consisted of fusions of H-ras, the Ras-binding domain of Raf(RafRBD), a cyan fluorescent protein (CFP) and a yellow fluorescent protein (YFP), so that intramolecular binding of GTP-Ras to RafRBD brings CFP close to YFP and increases FRET between CFP and YFP. Human lung adenocarcinoma cell line (ASTC-a-1) were transfected with the plasmid (pRaichu-Ras) and then were treated by LELI. The living cell imaging showed the increase of FRET at different time points after LELI at the dose of 1.8 J/cm2, which corresponds to the Ras/Raf activation assayed by Western Blotting. Furthermore, this dose of LELI enhanced the proliferation of ASTC-a-1 cells. Taken together, these in vivo imaging data provide direct evidences with temporal or spatial resolution that Ras/Raf/MEK/ pathway plays an important role in LELI-promoted cell proliferation.

  18. Adenocarcinoma of the rectum in patients under age 40 is increasing: impact of signet-ring cell histology.

    Science.gov (United States)

    Tawadros, Patrick S; Paquette, Ian M; Hanly, Ann M; Mellgren, Anders F; Rothenberger, David A; Madoff, Robert D

    2015-05-01

    Overall, the incidence of colorectal cancer appears to be stable or diminishing. However, based on our practice pattern, we observed that the incidence of rectal cancer in patients under 40 is increasing and may be associated with a prominence of signet-ring cell histology. The aim of this study was to verify the rising trend in rectal cancer in patients under 40 and describe the histology prominent in that cohort. This is a retrospective cohort study. We performed a retrospective cohort study of all patients diagnosed with rectal adenocarcinoma from 1980 to 2010 using the Surveillance, Epidemiology, and End Results cancer registry. Rectal cancer incidence, histology, and associated staging characteristics were the primary outcomes measured. Although the incidence of rectal cancer for all ages remained stable from 1980 to 2010, we observed an annual percent change of +3.6% in the incidence of rectal cancer in patients under 40. The prevalence of signet cell histology in patients under 40 was significantly greater than in patients over 40 (3% vs 0.87%, p < 0.01). A multivariate regression analysis revealed an adjusted odds ratio of 3.6 (95% CI, 2.6-5.1) for signet cell histology in rectal adenocarcinoma under age 40. Signet cell histology was also significantly associated with a more advanced stage at presentation, poorly differentiated tumor grade, and worse prognosis compared with mucinous and nonmucinous rectal adenocarcinoma. The study was limited by its retrospective nature and the information available in the Surveillance, Epidemiology, and End Results database. Despite a stable incidence of rectal cancer for all ages, the incidence in patients under 40 has quadrupled since 1980, and cancers in this group are 3.6 times more likely to have signet cell histology. Given the worse outcomes associated with signet cell histology, these data highlight a need for thorough evaluation of young patients with rectal symptoms.

  19. Estrogen and cigarette sidestream smoke particulate matter exhibit ERα-dependent tumor-promoting effects in lung adenocarcinoma cells.

    Science.gov (United States)

    Kuo, Lun-Cheng; Cheng, Li-Chuan; Lee, Chia-Huei; Lin, Chun-Ju; Chen, Pei-Yu; Li, Lih-Ann

    2017-09-01

    Estrogen and secondhand smoke are key risk factors for nonsmoking female lung cancer patients who frequently have lung adenocarcinoma and show tumor estrogen receptor α (ERα) expression. We speculated that estrogen and secondhand smoke might cause harmful effects via ERα signaling. Our results showed that 17β-estradiol (E2), the primary form of endogenous estrogen, exacerbated proliferation, migration, and granzyme B resistance of lung adenocarcinoma cells in an ERα-dependent manner. Cigarette sidestream smoke particulate matter (CSSP), the major component of secondhand smoke, could activate ERα activity dose dependently in human lung adenocarcinoma cells. The estrogenic activity of CSSP was abolished by an ERα-selective antagonist. CSSP regulated the nuclear entry, phosphorylation, and turnover of ERα similarly to E2. Furthermore, CSSP enhanced E2-stimulated ERα activity and Ser118 phosphorylation even when ERα became saturated with E2. Activation of ERα by CSSP required GSK3β activity, but not involving polycyclic aromatic hydrocarbons, reactive oxygen species, calcium, epidermal growth factor receptor, and PI3K/Akt. Although CSSP possessed cytotoxicity, ERα-expressing cells grew and migrated faster than nonexpressing cells on recovery from CSSP exposure as observed in E2-pretreated cells. Knockdown of ERα by siRNA diminished E2- and CSSP-stimulated cell migration. Twenty-one genes, including SERPINB9, were identified to be upregulated by both E2 and CSSP via ERα. Increased SERPINB9 expression was accompanied with increased resistance to granzyme B-mediated apoptosis. This study demonstrates that estrogen has ERα-dependent tumor-promoting activity. CSSP acts like estrogen and shows a potential to enhance estrogen-induced ERα action. Copyright © 2017 the American Physiological Society.

  20. LAP TGF-Beta Subset of CD4+CD25+CD127− Treg Cells is Increased and Overexpresses LAP TGF-Beta in Lung Adenocarcinoma Patients

    Directory of Open Access Journals (Sweden)

    Lorenzo Islas-Vazquez

    2015-01-01

    Full Text Available Lung cancer is the leading cause of cancer death worldwide. Adenocarcinoma, the most commonly diagnosed histologic type of lung cancer, is associated with smoking. Cigarette smoke promotes inflammation on the airways, which might be mediated by Th17 cells. This inflammatory environment may contribute to tumor development. In contrast, some reports indicate that tumors may induce immunosuppressive Treg cells to dampen immune reactivity, supporting tumor growth and progression. Thus, we aimed to analyze whether chronic inflammation or immunosuppression predominates at the systemic level in lung adenocarcinoma patients, and several cytokines and Th17 and Treg cells were studied. Higher proportions of IL-17-producing CD4+ T-cells were found in smoking control subjects and in lung adenocarcinoma patients compared to nonsmoking control subjects. In addition, lung adenocarcinoma patients increased both plasma concentrations of IL-2, IL-4, IL-6, and IL-10, and proportions of Latency Associated Peptide (LAP TGF-β subset of CD4+CD25+CD127− Treg cells, which overexpressed LAP TGF-β. This knowledge may lead to the development of immunotherapies that could inhibit the suppressor activity mediated by the LAP TGF-β subset of CD4+CD25+CD127− Treg cells to promote reactivity of immune cells against lung adenocarcinoma cells.

  1. [Expression of a new lung cancer drug resistance-related gene in lung cancer tissues and lung cancer cell strains].

    Science.gov (United States)

    Liu, Ling-Zhi; Qian, Gui-Sheng; Zhou, Xiang-Dong

    2003-02-01

    A new drug resistance-related gene fragment which was 494 bp long was found using suppression subtractive hybridization (SSH) and its full-length cDNA fragment was cloned by the authors. This study was designed to determine the expression of this lung cancer drug resistance-related gene (LCDRG) in lung cancer tissues, juxtacancerous tissues, and five lung cancer cell strains. The expression of LCDRG was determined by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) method in 38 lung cancer tissues,12 juxtacancerous tissues, and 5 lung cancer cell strains. The expression of LCDRG in cancer tissues was significantly higher than that in juxtacancerous tissue (Pcancer cell strains, the expression levels of LCDRG in adenocarcinoma cell strains SPC-A-1 and A549, big cell lung cancer cell strain H460, small cell lung cancer cell strains H446 and SH77 were decreased gradually. LCDRG is closely related to lung cancer and may be involved in the pathogenesis of lung cancer.

  2. Eriocalyxin B induces apoptosis and cell cycle arrest in pancreatic adenocarcinoma cells through caspase- and p53-dependent pathways

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lin [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Yue, Grace G.L. [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Lau, Clara B.S. [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); Sun, Handong [State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, CAS, Yunnan (China); Fung, Kwok Pui [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Leung, Ping Chung [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Han, Quanbin, E-mail: simonhan@hkbu.edu.hk [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); School of Chinese Medicine, The Hong Kong Baptist University, Hong Kong (China); Leung, Po Sing, E-mail: psleung@cuhk.edu.hk [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China)

    2012-07-01

    Pancreatic cancer is difficult to detect early and responds poorly to chemotherapy. A breakthrough in the development of new therapeutic agents is urgently needed. Eriocalyxin B (EriB), isolated from the Isodon eriocalyx plant, is an ent-kaurane diterpenoid with promise as a broad-spectrum anti-cancer agent. The anti-leukemic activity of EriB, including the underlying mechanisms involved, has been particularly well documented. In this study, we demonstrated for the first time EriB's potent cytotoxicity against four pancreatic adenocarcinoma cell lines, namely PANC-1, SW1990, CAPAN-1, and CAPAN-2. The effects were comparable to that of the chemotherapeutic camptothecin (CAM), but with much lower toxicity against normal human liver WRL68 cells. EriB's cytoxicity against CAPAN-2 cells was found to involve caspase-dependent apoptosis and cell cycle arrest at the G2/M phase. Moreover, the p53 pathway was found to be activated by EriB in these cells. Furthermore, in vivo studies showed that EriB inhibited the growth of human pancreatic tumor xenografts in BALB/c nude mice without significant secondary adverse effects. These results suggest that EriB should be considered a candidate for pancreatic cancer treatment. -- Highlights: ► We study Eriocalyxin B (EriB)'s cytotoxic effects on pancreatic cancer cell lines. ► EriB inhibits cell proliferation via mediation of apoptosis and cell cycle arrest. ► The effects are involved in caspase-dependent apoptosis and p53 pathway. ► In vivo study also shows EriB inhibits the growth of human pancreatic tumor. ► EriB can be a good candidate for chemotherapy in pancreatic cancer.

  3. Targeting of [[sup 111]In]biocytin to cultured ovarian adenocarcinoma cells using covalent monoclonal antibody -streptavidin conjugates

    Energy Technology Data Exchange (ETDEWEB)

    Sheldon, K.; Marks, A. (Toronto Univ., ON (Canada). Banting and Best Dept. of Medical Research); Baumal, R. (Hospital for Sick Children, Toronto, ON (Canada). Dept. of Pathology)

    1992-11-01

    Three monoclonal antibodies (mAb) directed against the human ovarian adenocarcinoma cell line HEY, were substituted with maleimide and covalently bonded to thiolated streptavidin. The conjugates were separated from unreacted reagents by successive affinity chromatography on protein A-Sepharose and iminobiotin columns. Purified conjugates consisted of an immunoglobulin (Ig) monomer bound to a streptavidin tetramer through a covalent bond between the Ig molecule and one of the streptavidin subunits. The conjugates were able to specifically target [[sup 111]In]biocytin to HEY cells in vitro in the presence of human serum and ascitic fluid from ovarian cancer patients. (Author).

  4. The Synergistic Effects of Low Dose Fluorouracil and TRAIL on TRAIL-Resistant Human Gastric Adenocarcinoma AGS Cells

    Directory of Open Access Journals (Sweden)

    Hong Zhu

    2013-01-01

    Full Text Available The TNF-related apoptosis-inducing ligand (TRAIL is a TNF family member which has been under intense focus because of its remarkable ability to induce apoptosis in malignant human cells while leaving normal cells unscathed. However, many cancer cells remain resistant to TRAIL. In this study, we had investigated the synergistic effects of low dose fluorouracil (5-Fu and TRAIL on TRAIL-resistant human gastric adenocarcinoma AGS cells and explored the potential mechanisms. Cell viability was analyzed by sulforhodamine B (SRB assay and the synergistic effects were evaluated by Jin’s formula and confirmed by both morphological changes under inverted microscope and flow cytometry. The expression of TRAIL-R1 (death receptor 4, DR4, TRAIL-R2 (DR5, TRAIL-R3 (decoy receptor, DcR1, TRAIL-R4 (DcR2, procaspase-3, procaspase-8, and procaspase-9 was detected by western blotting. Our results showed that there were significant synergistic effects of low dose 5-Fu and TRAIL on TRAIL-resistant AGS cells, and this effect was supposed to be mediated by decreasing DcR2 expression and increasing DR5 expression. The extrinsic and intrinsic apoptosis pathways were both activated. The data suggest that combined treatment of low dose 5-Fu and TRAIL can be an effective therapeutic approach for gastric adenocarcinoma.

  5. NMR metabolomics of human lung tumours reveals distinct metabolic signatures for adenocarcinoma and squamous cell carcinoma.

    Science.gov (United States)

    Rocha, Cláudia M; Barros, António S; Goodfellow, Brian J; Carreira, Isabel M; Gomes, Ana; Sousa, Vitor; Bernardo, João; Carvalho, Lina; Gil, Ana M; Duarte, Iola F

    2015-01-01

    Lung tumour subtyping, particularly the distinction between adenocarcinoma (AdC) and squamous cell carcinoma (SqCC), is a critical diagnostic requirement. In this work, the metabolic signatures of lung carcinomas were investigated through (1)H NMR metabolomics, with a view to provide additional criteria for improved diagnosis and treatment planning. High Resolution Magic Angle Spinning Nuclear Magnetic Resonance (NMR) spectroscopy was used to analyse matched tumour and adjacent control tissues from 56 patients undergoing surgical excision of primary lung carcinomas. Multivariate modeling allowed tumour and control tissues to be discriminated with high accuracy (97% classification rate), mainly due to significant differences in the levels of 13 metabolites. Notably, the magnitude of those differences were clearly distinct for AdC and SqCC: major alterations in AdC were related to phospholipid metabolism (increased phosphocholine, glycerophosphocholine and phosphoethanolamine, together with decreased acetate) and protein catabolism (increased peptide moieties), whereas SqCC had stronger glycolytic and glutaminolytic profiles (negatively correlated variations in glucose and lactate and positively correlated increases in glutamate and alanine). Other tumour metabolic features were increased creatine, glutathione, taurine and uridine nucleotides, the first two being especially prominent in SqCC and the latter in AdC. Furthermore, multivariate analysis of AdC and SqCC profiles allowed their discrimination with a 94% classification rate, thus showing great potential for aiding lung tumours subtyping. Overall, this study has provided new, clear evidence of distinct metabolic signatures for lung AdC and SqCC, which can potentially impact on diagnosis and provide important leads for future research on novel therapeutic targets or imaging tracers. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Cartilage oligomeric matrix protein (COMP)-mediated cell differentiation to proteolysis mechanism networks from human normal adjacent tissues to lung adenocarcinoma.

    Science.gov (United States)

    Wang, Lin; Huang, Juxiang; Jiang, Minghu; Diao, Haizhen; Zhou, Huilei; Li, Xiaohe; Chen, Qingchun; Jiang, Zhenfu; Feng, Haitao; Wolfl, Stefan

    2013-01-01

    To understand cartilage oligomeric matrix protein (COMP) mechanism network from human normal adjacent tissues to lung adenocarcinoma. COMP complete different activated (all no positive correlation, Pearson CC lung adenocarcinoma compared with lower human normal adjacent tissues from the corresponding COMP-stimulated (≥0.25) or inhibited (Pearson CC ≤ -0.25) overlapping molecules of Pearson correlation coefficient (CC) and GRNInfer, respectively. COMP complete different activated and inhibited (all no positive correlation, Pearson CC lung adenocarcinoma and lower human normal adjacent tissues were constructed by integration of Pearson CC, GRNInfer and GO. As visualized by integration of GO, KEGG, GenMAPP, BioCarta and Disease, we deduced COMP complete different activated and inhibited network in higher lung adenocarcinoma and lower human normal adjacent tissues. As visualized by GO, KEGG, GenMAPP, BioCarta and disease database integration, we proposed mainly that the mechanism and function of COMP complete different activated network in higher lung adenocarcinoma was involved in COMP activation with matrix-localized insulin-like factor coupling carboxypeptidase to metallopeptidase-induced proteolysis, whereas the corresponding inhibited network in lower human normal adjacent tissues participated in COMP inhibition with nucleus-localized vasculogenesis, B and T cell differentiation and neural endocrine factors coupling pyrophosphatase-mediated proteolysis. However, COMP complete different inhibited network in higher lung adenocarcinoma included COMP inhibition with nucleus-localized chromatin maintenance, licensing and assembly factors coupling phosphatase-inhibitor to cytokinesis regulators-mediated cell differentiation, whereas the corresponding activated network in lower human normal adjacent tissues contained COMP activation with cytolplasm-localized translation elongation factor coupling fucosyltransferase to ubiquitin-protein ligase-induced cell

  7. Cuminaldehyde from Cinnamomum verum Induces Cell Death through Targeting Topoisomerase 1 and 2 in Human Colorectal Adenocarcinoma COLO 205 Cells

    Directory of Open Access Journals (Sweden)

    Kuen-daw Tsai

    2016-05-01

    Full Text Available Cinnamomum verum, also called true cinnamon tree, is employed to make the seasoning cinnamon. Furthermore, the plant has been used as a traditional Chinese herbal medication. We explored the anticancer effect of cuminaldehyde, an ingredient of the cortex of the plant, as well as the molecular biomarkers associated with carcinogenesis in human colorectal adenocarcinoma COLO 205 cells. The results show that cuminaldehyde suppressed growth and induced apoptosis, as proved by depletion of the mitochondrial membrane potential, activation of both caspase-3 and -9, and morphological features of apoptosis. Moreover, cuminaldehyde also led to lysosomal vacuolation with an upregulated volume of acidic compartment and cytotoxicity, together with inhibitions of both topoisomerase I and II activities. Additional study shows that the anticancer activity of cuminaldehyde was observed in the model of nude mice. Our results suggest that the anticancer activity of cuminaldehyde in vitro involved the suppression of cell proliferative markers, topoisomerase I as well as II, together with increase of pro-apoptotic molecules, associated with upregulated lysosomal vacuolation. On the other hand, in vivo, cuminaldehyde diminished the tumor burden that would have a significant clinical impact. Furthermore, similar effects were observed in other tested cell lines. In short, our data suggest that cuminaldehyde could be a drug for chemopreventive or anticancer therapy.

  8. Tramadol regulates proliferation, migration and invasion via PTEN/PI3K/AKT signaling in lung adenocarcinoma cells.

    Science.gov (United States)

    Xia, M; Tong, J-H; Ji, N-N; Duan, M-L; Tan, Y-H; Xu, J-G

    2016-06-01

    Tramadol is used mainly for the treatment of moderate to severe chronic cancer pain. However, the effect of tramadol on lung cancer remains unclear. Therefore, it is important to explore the mechanism accounting for the function of tramadol on lung cancer. We investigated the effects of tramadol on the proliferation, migration and invasion in human lung adenocarcinoma cells in vitro by CCK-8 assay, wound healing assay and Transwell assay, respectively. We also explored the potential mechanism of tramadol on lung cancer cells by Western blotting. A549 and PC-9 cells were incubated with 2 µM tramadol for different time (0, 7, 14 and 28 d). The in vitro experiments showed that tramadol treatment significantly inhibited cell proliferation, migration and invasion in a time-dependent manner. Moreover, administration of tramadol suppressed tumor growth in vivo. The data also revealed that tramadol could up-regulate the protein expression level of PTEN and consistently inhibit the phosphorylation level of PI3K and Akt, whereas the total level of PI3K and Akt remain unchanged. These findings indicated that tramadol inhibited proliferation, migration and invasion of human lung adenocarcinoma cells through elevation of PTEN and inactivation of PI3K/Akt signaling.

  9. Germ Cell Tumor Targeting Chemotherapy in Gastric Adenocarcinoma with an Endodermal Sinus Tumor Component: A Case Report.

    Science.gov (United States)

    Choi, Jung Eun; Choe, A Reum; Yoon, Sang Eun; Nam, Eun Mi; Park, Heejung; Lee, Kyoung Eun

    2017-01-01

    The most common sites for extragonadal germ cell tumors are the midline mediastinum, retroperitoneum and, much less frequently, the stomach. The stomach-originated primary germ cell tumor carries a poor prognosis, especially when metastasis occurs to the liver, with a mean survival time of 1 month. We describe the case of a 77-year-old male who presented with usual symptoms of gastric malignancy. Gastrectomy was performed. Histopathology of surgically resected tissue revealed a mixture of adenocarcinoma and endodermal sinus tumor components with α-fetoprotein production. After liver metastasis was identified, oxaliplatin and capecitabine were administered as palliative chemotherapy. The response was poor. For the second-line therapy, bleomycin, etoposide, and cisplatin (BEP) therapy was initiated. The overall response to these drugs was a partial response and the residual liver lesion was considered to be resectable. The patient died of pneumonia 11 months following the BEP session, representing an overall survival time of 22 months. Gastric adenocarcinoma with a germ cell tumor component is uncommon and an effective combination of chemotherapeutic agents is not yet clear. In this case, the patient received germ cell tumor-targeting chemotherapy and showed a durable response. Hence, germ cell-targeting cytotoxic agents have potential as the 'front-line regimen'. © 2016 S. Karger AG, Basel.

  10. Silencing of Receptor Tyrosine Kinase ROR1 Inhibits Tumor-Cell Proliferation via PI3K/AKT/mTOR Signaling Pathway in Lung Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Yanchun Liu

    Full Text Available Receptor tyrosine kinase ROR1, an embryonic protein involved in organogenesis, is expressed in certain hematological malignancies and solid tumors, but is generally absent in adult tissues. This makes the protein an ideal drug target for cancer therapy. In order to assess the suitability of ROR1 as a cell surface antigen for targeted therapy of lung adenocarcinoma, we carried out a comprehensive analysis of ROR1 protein expression in human lung adenocarcinoma tissues and cell lines. Our data show that ROR1 protein is selectively expressed on lung adenocarcinoma cells, but do not support the hypothesis that expression levels of ROR1 are associated with aggressive disease. However silencing of ROR1 via siRNA treatment significantly down-regulates the activity of the PI3K/AKT/mTOR signaling pathway. This is associated with significant apoptosis and anti-proliferation of tumor cells. We found ROR1 protein expressed in lung adenocarcinoma but almost absent in tumor-adjacent tissues of the patients. The finding of ROR1-mediated proliferation signals in both tyrosine kinase inhibitor (TKI-sensitive and -resistant tumor cells provides encouragement to develop ROR1-directed targeted therapy in lung adenocarcinoma, especially those with TKI resistance.

  11. Telomerase inhibition by siRNA causes senescence and apoptosis in Barrett's adenocarcinoma cells: mechanism and therapeutic potential

    Directory of Open Access Journals (Sweden)

    Batchu Ramesh B

    2005-07-01

    Full Text Available Abstract Background In cancer cells, telomerase induction helps maintain telomere length and thereby bypasses senescence and provides enhanced replicative potential. Chemical inhibitors of telomerase have been shown to reactivate telomere shortening and cause replicative senescence and apoptotic cell death of tumor cells while having little or no effect on normal diploid cells. Results We designed siRNAs against two different regions of telomerase gene and evaluated their effect on telomere length, proliferative potential, and gene expression in Barrett's adenocarcinoma SEG-1 cells. The mixture of siRNAs in nanomolar concentrations caused a loss of telomerase activity that appeared as early as day 1 and was essentially complete at day 3. Inhibition of telomerase activity was associated with marked reduction in median telomere length and complete loss of detectable telomeres in more than 50% of the treated cells. Telomere loss caused senescence in 40% and apoptosis in 86% of the treated cells. These responses appeared to be associated with activation of DNA sensor HR23B and subsequent activation of p53 homolog p73 and p63 and E2F1. Changes in these gene regulators were probably the source of observed up-regulation of cell cycle inhibitors, p16 and GADD45. Elevated transcript levels of FasL, Fas and caspase 8 that activate death receptors and CARD 9 that interacts with Bcl10 and NFKB to enhance mitochondrial translocation and activation of caspase 9 were also observed. Conclusion These studies show that telomerase siRNAs can cause effective suppression of telomerase and telomere shortening leading to both cell cycle arrest and apoptosis via mechanisms that include up-regulation of several genes involved in cell cycle arrest and apoptosis. Telomerase siRNAs may therefore be strong candidates for highly selective therapy for chemoprevention and treatment of Barrett's adenocarcinoma.

  12. In vitro evaluation of the cellular effect of indium tin oxide nanoparticles using the human lung adenocarcinoma A549 cells.

    Science.gov (United States)

    Tabei, Yosuke; Sonoda, Akinari; Nakajima, Yoshihiro; Biju, Vasudevanpillai; Makita, Yoji; Yoshida, Yasukazu; Horie, Masanori

    2015-05-01

    Indium tin oxide (ITO) is widely used in liquid crystal displays (LCDs) or plasma and mobile phone displays. Elevated production and usage of ITO in such displays have led to increased concerns over the safety of industrial workers exposed to particulate aerosols produced during cutting, grinding and polishing of these materials. However, the cellular effects of ITO nanoparticles (NPs) are still unclear, although it has been reported that micro-scale ITO particles induce cytotoxicity. The aim of this study was to examine the potential of ITO NPs to induce cytotoxicity, oxidative stress, and DNA damage using human lung adenocarcinoma A549 cells. Here, stable dispersions of a medium containing ITO NPs were obtained using pre-adsorption and centrifugal fractionation methods, and the A549 cells were incubated in this medium. The ITO NPs showed low cytotoxic effects as shown by the WST-1 and LDH assays. Transmission electron microscopy observations showed the cellular uptake of ITO NPs. The ITO NPs increased the intracellular level of reactive oxygen species and the expression of the heme oxygenase 1 gene. Further, the results of alkaline comet assays showed that ITO NPs induced DNA damage. Thus, these results suggest that ITO NPs possess a genotoxic potential on human lung adenocarcinoma A549 cells.

  13. Amplification and expression of a cellular oncogene (c-myc) in human gastric adenocarcinoma cells.

    Science.gov (United States)

    Shibuya, M; Yokota, J; Ueyama, Y

    1985-01-01

    Three of 16 human gastric adenocarcinoma samples, maintained as solid tumors in nude mice, were found to carry amplified c-myc genes. In two samples with a high degree of c-myc DNA amplification (15- to 30-fold), double minute chromosomes were observed in karyotype analysis. The level of c-myc RNA was markedly elevated in a rapidly growing and poorly differentiated tumor, whereas it was only slightly elevated in a slowly growing and more differentiated tumor. Images PMID:2579323

  14. Evaluating the effect of four extracts of avocado fruit on esophageal squamous carcinoma and colon adenocarcinoma cell lines in comparison with peripheral blood mononuclear cells.

    Science.gov (United States)

    Vahedi Larijani, Laleh; Ghasemi, Maryam; AbedianKenari, Saeid; Naghshvar, Farshad

    2014-01-01

    Most patients with gastrointestinal cancers refer to the health centers at advanced stages of the disease and conventional treatments are not significantly effective for these patients. Therefore, using modern therapeutic approaches with lower toxicity bring higher chance for successful treatment and reduced adverse effects in such patients. The aim of this study is to evaluate the effect of avocado fruit extracts on inhibition of the growth of cancer cells in comparison with normal cells. In an experimental study, ethanol, chloroform, ethyl acetate, and petroleum extracts of avocado (Persea americana) fruit were prepared. Then, the effects if the extracts on the growth of esophageal squamous cell carcinoma and colon adenocarcinoma cell lines were evaluated in comparison with the control group using the MTT test in the cell culture medium. Effects of the four extracts of avocado fruit on three cells lines of peripheral blood mononuclear cells, esophageal squamous cell carcinoma, and colon adenocarcinoma were tested. The results showed that avocado fruit extract is effective in inhibition of cancer cell growth in comparison with normal cells (PAvocado fruit is rich in phytochemicals, which play an important role in inhibition of growth of cancer cells. The current study for the first time demonstrates the anti-cancer effect of avocado fruit extracts on two cancers common in Iran. Therefore, it is suggested that the fruit extracts can be considered as appropriate complementary treatments in treatment of esophageal and colon cancers.

  15. The cornerstone K-RAS mutation in pancreatic adenocarcinoma: From cell signaling network, target genes, biological processes to therapeutic targeting.

    Science.gov (United States)

    Jonckheere, Nicolas; Vasseur, Romain; Van Seuningen, Isabelle

    2017-03-01

    RAS belongs to the super family of small G proteins and plays crucial roles in signal transduction from membrane receptors in the cell. Mutations of K-RAS oncogene lead to an accumulation of GTP-bound proteins that maintains an active conformation. In the pancreatic ductal adenocarcinoma (PDAC), one of the most deadly cancers in occidental countries, mutations of the K-RAS oncogene are nearly systematic (>90%). Moreover, K-RAS mutation is the earliest genetic alteration occurring during pancreatic carcinogenetic sequence. In this review, we discuss the central role of K-RAS mutations and their tremendous diversity of biological properties by the interconnected regulation of signaling pathways (MAPKs, NF-κB, PI3K, Ral…). In pancreatic ductal adenocarcinoma, transcriptome analysis and preclinical animal models showed that K-RAS mutation alters biological behavior of PDAC cells (promoting proliferation, migration and invasion, evading growth suppressors, regulating mucin pattern, and miRNA expression). K-RAS also impacts tumor microenvironment and PDAC metabolism reprogramming. Finally we discuss therapeutic targeting strategies of K-RAS that have been developed without significant clinical success so far. As K-RAS is considered as the undruggable target, targeting its multiple effectors and target genes should be considered as potential alternatives. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. The Anticancer Effects of Radachlorin-mediated Photodynamic Therapy in the Human Endometrial Adenocarcinoma Cell Line HEC-1-A.

    Science.gov (United States)

    Kim, Su-Mi; Rhee, Yun-Hee; Kim, Jong-Soo

    2017-11-01

    We investigated the effect of photodynamic therapy (PDT) using radachlorin on invasion, vascular formation and apoptosis by targeting epidermal growth factor receptor (EGFR)/vascular endothelial growth factor receptor 2 (VEGFR2) signaling pathways in the HEC-1-A endometrial adenocarcinoma cell line. To investigate the apoptotic pathway, we performed the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay, and western blot analysis. We also evaluated the effects of PDT on tubular capillary formation in and invasion by HEC-1-A cells with a tube formation assay, invasion assay, prostaglandin E2 (PGE2) assay, and western blot analysis. PDT had anticancer effects on HEC-1-A through activation of the intrinsic pathway of apoptosis via caspase-9 and poly-(ADP-ribose) polymerase (PARP). PDT also inhibited tubular capillary formation in and invasion by HEC-1-A under VEGF pretreatment, that resulted from down-regulation of VEGFR2, EGFR, Ras homolog gene family/ member A (RhoA) and PGE2. These results are indicative of the specificity of radachlorin-mediated PDT to VEGF. The major advantage of radachlorin-mediated PDT is its selectivity for cancer tissue while maintaining adjacent normal endometrial tissue. Therefore, radachlorin-mediated PDT might offer high anticancer efficacy for endometrial adenocarcinoma and an especially useful modality for preserving fertility. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  17. Small cell lung cancer transformation from EGFR-mutated lung adenocarcinoma: A case report and literatures review.

    Science.gov (United States)

    Liu, Yangyang

    2018-02-20

    Epithelial growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) have markedly improved the response of non-small cell lung cancer (NSCLC) with EGFR-mutant patients. However, these patients inevitably come cross acquired resistance to EGFR-TKIs. The transformation of lung adenocarcinoma to small cell lung cancer (SCLC) following treatment with EGFR-TKIs is rare, which leads to resistance to EGFR-TKIs. The present case concerns a case of a 38-year-old man presenting with cough and dyspnea. Radical resection was performed and confirmed an EGFR exon 21 L858R lung adenocarcinoma. However, the patient suffered pleural metastasis after successful treatment with surgery and adjuvant treatment. So, erlotinib was administered with 18 months. Because of enlarged pleural nodule, repeat biopsy identified an SCLC and chemotherapy was started. However, despite the brief success of chemotherapy, our patient suffered brain metastasis. Our case emaphsizes both the profile of transformation from NSCLC to SCLC and the importance of repeat biopsy dealing with drug resistance. We also summarize the clinical characteristics, mechanisms, predictors of SCLC transformation, treatment after transformation and other types of transformation to SCLC.

  18. In Vitro Incorporation of Radioiodinated Eugenol on Adenocarcinoma Cell Lines (Caco2, MCF7, and PC3).

    Science.gov (United States)

    Dervis, Emine; Yurt Kilcar, Ayfer; Medine, Emin Ilker; Tekin, Volkan; Cetkin, Buse; Uygur, Emre; Muftuler, Fazilet Zumrut Biber

    2017-04-01

    Recently, the synthesis of radiolabeled plant origin compounds has been increased due to their high uptake on some cancer cell lines. Eugenol (EUG), a phenolic natural compound in the essential oils of different spices such as Syzygium aromaticum (clove), Pimenta racemosa (bay leaves), and Cinnamomum verum (cinnamon leaf), has been exploited for various medicinal applications. EUG has antiviral, antioxidant, and anti-inflammatory functions and several anticancer properties. The objective of this article is to synthesize radioiodinated (131I) EUG and investigate its effect on Caco2, MCF7, and PC3 adenocarcinoma cell lines. It is observed that radioiodinated EUG would have potential on therapy and imaging due to its notable uptakes in studied cells.

  19. Melatonin inhibits the migration of human lung adenocarcinoma A549 cell lines involving JNK/MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Qiaoyun Zhou

    Full Text Available OBJECTIVE: Melatonin, an indolamine produced and secreted predominately by the pineal gland, exhibits a variety of physiological functions, possesses antioxidant and antitumor properties. But, the mechanisms for the anti-cancer effects are unknown. The present study explored the effects of melatonin on the migration of human lung adenocarcinoma A549 cells and its mechanism. METHODS: MTT assay was employed to measure the viability of A549 cells treated with different concentrations of melatonin. The effect of melatonin on the migration of A549 cells was analyzed by wound healing assay. Occludin location was observed by immunofluorescence. The expression of occludin, osteopontin (OPN, myosin light chain kinase (MLCK and phosphorylation of myosin light chain (MLC, JNK were detected by western blots. RESULTS: After A549 cells were treated with melatonin, the viability and migration of the cells were inhibited significantly. The relative migration rate of A549 cells treated with melatonin was only about 20% at 24 h. The expression level of OPN, MLCK and phosphorylation of MLC of A549 cells were reduced, while the expression of occludin was conversely elevated, and occludin located on the cell surface was obviously increased. The phosphorylation status of JNK in A549 cells was also reduced when cells were treated by melatonin. CONCLUSIONS: Melatonin significantly inhibits the migration of A549 cells, and this may be associated with the down-regulation of the expression of OPN, MLCK, phosphorylation of MLC, and up-regulation of the expression of occludin involving JNK/MAPK pathway.

  20. Urachal Adenocarcinoma

    African Journals Online (AJOL)

    Cancer. 1991; 67:2165-72. 6. Thali-Schwab CM, Woodward PJ, Wagner BJ. Computed tomographic appearance of urachal adenocarcinomas: review of 25 cases. Eur Radiol. 2005; 15:79-84. 7. Wong-You-Cheong JJ, Woodward PJ, Manning. MA, et al. Neoplasms of the urinary bladder: radiologic-pathologic correlation.

  1. Curcumin inhibits growth potential by G1 cell cycle arrest and induces apoptosis in p53-mutated COLO 320DM human colon adenocarcinoma cells.

    Science.gov (United States)

    Dasiram, Jade Dhananjay; Ganesan, Ramamoorthi; Kannan, Janani; Kotteeswaran, Venkatesan; Sivalingam, Nageswaran

    2017-02-01

    Curcumin, a natural polyphenolic compound and it is isolated from the rhizome of Curcuma longa, have been reported to possess anticancer effect against stage I and II colon cancer. However, the effect of curcumin on colon cancer at Dukes' type C metastatic stage III remains still unclear. In the present study, we have investigated the anticancer effects of curcumin on p53 mutated COLO 320DM human colon adenocarcinoma cells derived from Dukes' type C metastatic stage. The cellular viability and proliferation were assessed by trypan blue exclusion assay and MTT assay, respectively. The cytotoxicity effect was examined by lactate dehydrogenase (LDH) cytotoxicity assay. Apoptosis was analyzed by DNA fragmentation analysis, Hoechst and propidium iodide double fluorescent staining and confocal microscopy analysis. Cell cycle distribution was performed by flow cytometry analysis. Here we have observed that curcumin treatment significantly inhibited the cellular viability and proliferation potential of p53 mutated COLO 320DM cells in a dose- and time-dependent manner. In addition, curcumin treatment showed no cytotoxic effects to the COLO 320DM cells. DNA fragmentation analysis, Hoechst and propidium iodide double fluorescent staining and confocal microscopy analysis revealed that curcumin treatment induced apoptosis in COLO 320DM cells. Furthermore, curcumin caused cell cycle arrest at the G1 phase, decreased the cell population in the S phase and induced apoptosis in COLO 320DM colon adenocarcinoma cells. Together, these data suggest that curcumin exerts anticancer effects and induces apoptosis in p53 mutated COLO 320DM human colon adenocarcinoma cells derived from Dukes' type C metastatic stage. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Cell cycle arrest by the isoprenoids perillyl alcohol, geraniol, and farnesol is mediated by p21(Cip1) and p27(Kip1) in human pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Wiseman, Dean A; Werner, Sean R; Crowell, Pamela L

    2007-03-01

    Pancreatic cancer, the fourth leading cause of cancer-associated mortality in the United States, usually presents in an advanced stage and is generally refractory to chemotherapy. As such, there is a great need for novel therapies for this disease. The naturally derived isoprenoids perillyl alcohol, farnesol, and geraniol have chemotherapeutic potential in pancreatic and other tumor types. However, their mechanisms of action in these systems are not completely defined. In this study, we investigated isoprenoid effects on the cell cycle and observed a similar antiproliferative mechanism of action among the three compounds. First, when given in combination, the isoprenoids exhibited an additive antiproliferative effect against MIA PaCa-2 human pancreatic cancer cells. Furthermore, all three compounds induced a G(0)/G(1) cell cycle arrest that coincided with an increase in the expression of the cyclin kinase inhibitor proteins p21(Cip1) and p27(Kip1) and a reduction in cyclin A, cyclin B1, and cyclin-dependent kinase (Cdk) 2 protein levels. Immunoprecipitation studies demonstrated increased association of both p21(Cip1) and p27(Kip1) with Cdk2 as well as diminished Cdk2 kinase activity after isoprenoid exposure, indicating a cell cycle-inhibitory role for p21(Cip1) and p27(Kip1) in pancreatic adenocarcinoma cells. When siRNA was used to inhibit expression of p21(Cip1) and p27(Kip1) proteins in MIA PaCa-2 cells, conditional resistance to all three isoprenoid compounds was evident. Given similar findings in this cell line and in BxPC-3 human pancreatic adenocarcinoma cells, we conclude that the chemotherapeutic isoprenoid compounds perillyl alcohol, farnesol, and geraniol invoke a p21(Cip1)- and p27(Kip1)-dependent antiproliferative mechanism in human pancreatic adenocarcinoma cells.

  3. N-Hydroxycinnamide derivatives of osthole presenting genotoxicity and cytotoxicity against human colon adenocarcinoma cells in vitro and in vivo.

    Science.gov (United States)

    Liu, Ling-Yu; Huang, Wei-Jan; Lin, Ren-Jye; Lin, Shyr-Yi; Liang, Yu-Chih

    2013-11-18

    Osthole is extracted from the Chinese herbs Cnidium monnieri and Angelica pubescens, and it was found to have antitumor activity in vitro and in vivo. A series of osthole derivatives have been synthesized, and the N-hydroxycinnamide derivatives of osthole, WJ1376-1 and WJ1398-1 were found to have the greatest potential against human colon adenocarcinoma cells. In contrast to the parental osthole, both WJ1376-1 and WJ1398-1 were found to induce multinucleation and polyploidy by microscopic observation and flow cytometry. WJ1376-1 and WJ1398-1 significantly activated ataxia telangiectasia and rad3 related (ATR) kinase, which triggered activation of the checkpoint kinase 2 (Chk2) signaling pathway and then down regulated Cdc25 phosphatase and Cdc2/cyclin B kinase activities. WJ1376-1 and WJ1398-1 also inhibited the phosphorylation of Aurora A kinase, which is associated with important processes during mitosis. The presence of a "comet" DNA fragment and phosphorylation of p53 at Ser 15 clearly indicated that DNA damage occurred with WJ1376-1 and WJ1398-1 treatment. WJ1376-1 and WJ1398-1 ultimately induced apoptosis as evidenced by the upregulation of Bad and activation of caspases-3, -7, and -9. Furthermore, WJ1376-1 and WJ1398-1 also showed a great effect in attenuating tumor growth without affecting the body weight of xenograft nude mice. Taken together, these results suggest that the toxic activities of WJ1376-1 and WJ1398-1 were dissimilar to that of the parental osthole, which can induce cell polyploidy and G2/M cell cycle arrest in colon adenocarcinoma cells and may provide a potential therapeutic target for colon cancer treatment in the future.

  4. Expression profiles of cancer stem cell markers: CD133, CD44, Musashi-1 and EpCAM in the cardiac mucosa-Barrett's esophagus-early esophageal adenocarcinoma-advanced esophageal adenocarcinoma sequence.

    Science.gov (United States)

    Mokrowiecka, Anna; Veits, Lothar; Falkeis, Christina; Musial, Jacek; Kordek, Radzislaw; Lochowski, Mariusz; Kozak, Jozef; Wierzchniewska-Lawska, Agnieszka; Vieth, Michael; Malecka-Panas, Ewa

    2017-03-01

    Barrett's esophagus (BE), which develops as a result of gastroesophageal reflux disease, is a preneoplastic condition for esophageal adenocarcinoma (EAC). A new hypothesis suggests that cancer is a disease of stem cells, however, their expression and pathways in BE - EAC sequence are not fully elucidated yet. We used a panel of putative cancer stem cells markers to identify stem cells in consecutive steps of BE-related cancer progression. Immunohistochemistry was performed on formalin-fixed, paraffin-embedded blocks from 58 patients with normal cardiac mucosa (n=5), BE (n=14), early EAC (pT1) from mucosal resection (n=17) and advanced EAC (pT1-T4) from postoperative specimens (n=22). Expression of the CD133, CD44, Musashi-1 and EpCAM was analyzed using respective monoclonal antibodies. All markers showed a heterogeneous expression pattern, mainly at the base of the crypts of Barrett's epithelium and EAC, with positive stromal cells in metaplastic and dysplastic lesions. Immuno-expression of EpCAM, CD44 and CD133 in cardiac mucosa was significantly lower (mean immunoreactivity score (IRS)=1.2; 0.0; 0.4; respectively) compared to their expression in Barrett's metaplasia (mean IRS=4.3; 0.14; 0.7; respectively), in early adenocarcinoma (mean IRS=4.4; 0.29; 1.3; respectively) and in advanced adenocarcinoma (mean IRS=6.6; 0.7; 2.7; respectively) (p<0.05). On the contrary, Musashi-1 expression was higher in BE and early ADC compared to GM and advanced ADC (NS). Our results suggest that the stem cells could be present in premalignant lesions. EpCAM, CD44 and CD133 expression could be candidate markers for BE progression, whereas Musashi-1 may be a marker of the small intestinal features of Barrett's mucosa. Copyright © 2016 Elsevier GmbH. All rights reserved.

  5. Pancreatic adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Schima, Wolfgang; Ba-Ssalamah, Ahmed; Koelblinger, Claus; Kulinna-Cosentini, Christiane [Medical University of Vienna, Department of Radiology, Vienna (Austria); Puespoek, Andreas [Medical University of Vienna, Department of Internal Medicine 4, Division of Gastroenterology and Hepatology, Vienna (Austria); Goetzinger, Peter [Medical University of Vienna, Austria, Department of Surgery, Vienna (Austria)

    2007-03-15

    Adenocarcinoma is the most common malignant pancreatic tumor, affecting the head of the pancreas in 60-70% of cases. By the time of diagnosis, at least 80% of tumors are unresectable. Helical computed tomography (CT) is very effective in detecting and staging adenocarcinoma, with a sensitivity of up to 90% for detection and an accuracy of 80-90% for staging, but it has limitations in detecting small cancers. Moreover, it is not very accurate for determining nonresectability because small liver metastases, peritoneal carcinomatosis, and subtle signs of vascular infiltration may be missed. Multidetector-row CT (MDCT) has brought substantial improvements with its inherent ability to visualize vascular involvement in three dimensions. MDCT has been found to be at least equivalent to contrast-enhanced magnetic resonance imaging (MRI) for detecting adenocarcinoma. MRI can be used as a problem-solving tool in equivocal CT: MRI may help rule out pitfalls, such as inflammatory pseudotumor, focal lipomatosis, abscess, or cystic tumors. Mangafodipir-enhanced MRI reveals a very high tumor-pancreas contrast, which helps in diagnosing small cancers. Endosonography is, if available, also a very accurate tool for detecting small cancers, with a sensitivity of up to 98%. It is the technique of choice for image-guided biopsy if a histologic diagnosis is required for further therapy. (orig.)

  6. Curcumin Effect on the Expressional Profile of OCT4, Nanog and Nucleostemin Genes in AGS (Adenocarcinoma Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Fahmideh Bagrezaei

    2016-07-01

    Full Text Available Background Curcumin is the natural yellow pigment in turmeric isolated from the rhizome of the plant Curcuma longa. Curcumin inhibits formation and invasive cancer cells and destroys cancer cells resistant to chemotherapeutic drugs. Objectives The purpose of this study was the survey of effects of different concentrations of alcoholic curcumin on the octamer-binding transcription factor 4 (OCT4 Nanog and Nucleostemin genes in the AGS (human gastric adenocarcinoma cell line. Materials and Methods In this experimental study the AGS cell line was cultured in RPMI-1640, supplemented with penicillin/streptomycin (100 U/mL and 100 mg/mL, respectively and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. In 60 - 70% cell confluence, the cells were treated with curcumin concentration (20, 40, 100 μL and incubated for 24, 48 and 72 hours. Finally, total RNA were extracted and cDNA were synthesized and the expression of mentioned genes was detected. The data were analyzed by excel software. Results Expression rate of OCT4A, OCT4B, Nanog and Nucleostemin (GLN3 at concentrations less than 20 μg/mL were reduced but OCT4B1 expression showed increased by hours respectively. Conclusions The results showed that curcumin inhibited cell division; also, this study could be the basis for more extensive studies on the anti-cancer effect of the combined plants.

  7. Methanolic Extracts from Brown Seaweeds Dictyota cilliolata and Dictyota menstrualis Induce Apoptosis in Human Cervical Adenocarcinoma HeLa Cells

    Directory of Open Access Journals (Sweden)

    Dayanne Lopes Gomes

    2015-04-01

    Full Text Available Carcinoma of the uterine cervix is the second most common female tumor worldwide, surpassed only by breast cancer. Natural products from seaweeds evidencing apoptotic activity have attracted a great deal of attention as new leads for alternative and complementary preventive or therapeutic anticancer agents. Here, methanol extracts from 13 species of tropical seaweeds (Rhodophytas, Phaeophyta and Chlorophyta collected from the Northeast of Brazil were assessed as apoptosis-inducing agents on human cervical adenocarcinoma (HeLa. All extracts showed different levels of cytotoxicity against HeLa cells; the most potent were obtained from the brown alga Dictyota cilliolata (MEDC and Dictyota menstrualis (MEDM. In addition, MEDC and MEDM also inhibits SiHa (cervix carcinoma cell proliferation. Studies with these two extracts using flow cytometry and fluorescence microscopy showed that HeLa cells exposed to MEDM and MEDC exhibit morphological and biochemical changes that characterize apoptosis as shown by loss of cell viability, chromatin condensation, phosphatidylserine externalization, and sub-G1 cell cycle phase accumulation, also MEDC induces cell cycle arrest in cell cycle phase S. Moreover, the activation of caspases 3 and 9 by these extracts suggests a mitochondria-dependent apoptosis route. However, other routes cannot be ruled out. Together, these results point out the methanol extracts of the brown algae D. mentrualis and D. cilliolata as potential sources of molecules with antitumor activity.

  8. Uptake and cytotoxicity of poly(D,L-lactide-co-glycolide) nanoparticles in human colon adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Katsikari, A. [Laboratory of General Microbiology, Department of Genetics, Development and Molecular Biology, School of Biology, Faculty of Sciences and Mathematics, Aristotle University of Thessaloniki, Thessaloniki 54124 (Greece); Patronidou, Chr.; Kiparissides, C. [Section of Analysis, Design and Control of Chemical Processes and Plants, Department of Chemical Engineering, Aristotle University of Thessaloniki, Thessaloniki 54124 (Greece); Arsenakis, M., E-mail: arsenaki@bio.auth.g [Laboratory of General Microbiology, Department of Genetics, Development and Molecular Biology, School of Biology, Faculty of Sciences and Mathematics, Aristotle University of Thessaloniki, Thessaloniki 54124 (Greece)

    2009-12-15

    The main objectives of the present study were to evaluate the cytotoxicity and the mechanisms of uptake of biodegradable lactic acid-glycolic acid copolymer (PLGA) nanoparticle carrier systems in vitro using the human colon adenocarcinoma cell line Caco2. Nanoparticles (NPs) (PLGA 75:25) with an average diameter of 299.5 nm containing bovine serum albumin labeled with fluorescein isothiocyanate (BSA-FITC) as a fluorescent model protein marker were formulated by the double emulsion technique. Various parameters influencing the internalization process by Caco2 cells including concentration of NPs, duration of contact time and cell culture conditions were studied. After overnight exposure of NPs to cells at 37 deg. C, the cell uptake capacity varied in accord with NP concentration, over the 25-800 mug/ml concentration range tested. Maximal uptake of nanoparticles at 37 deg. C occurred at 4 h and was inhibited significantly at 4 deg. C. The extent of NPs internalization was evaluated by confocal laser scanning microscopy. Potential NP toxicity evaluated by modified MTS and lactate dehydrogenase (LDH) colorimetric cytotoxicity tests, measuring mitochondrial activity and membrane integrity respectively, showed that cell viability is significantly reduced at PLGA nanoparticle concentrations greater than 700 mug/ml after 24 and 48 h respectively. The results obtained in vitro for BSA-FITC loaded PLGA nanoparticles underline their potential as carriers for peptide delivery and their utility for the study of NP cell transport and trafficking mechanisms.

  9. Short-Chain Fatty Acids Stimulate Angiopoietin-Like 4 Synthesis in Human Colon Adenocarcinoma Cells by Activating Peroxisome Proliferator-Activated Receptor γ

    DEFF Research Database (Denmark)

    Alex, Sheril; Lange, Katja; Amolo, Tom

    2013-01-01

    with the notion that fermentation leads to PPAR activation in vivo, feeding mice a diet rich in inulin induced PPAR target genes and pathways in the colon. We conclude that (i) SCFA potently stimulate ANGPTL4 synthesis in human colon adenocarcinoma cells and (ii) SCFA transactivate and bind to PPARγ. Our data...

  10. Enterococcus faecalis Infection and Reactive Oxygen Species Down-Regulates the miR-17-92 Cluster in Gastric Adenocarcinoma Cell Culture

    DEFF Research Database (Denmark)

    Strickertsson, Jesper A B; Rasmussen, Lene Juel; Friis-Hansen, Lennart

    2014-01-01

    of many human diseases including gastric cancer. Here we studied the impact of infection by the gram-positive bacteria Enterococcus faecalis (E. faecalis) on global miRNA expression as well as the effect of ROS on selected miRNAs. Human gastric adenocarcinoma cell line MKN74 was infected with living E...

  11. ESOPHAGEAL CARCINOMA: IS SQUAMOUS CELL CARCINOMA DIFFERENT DISEASE COMPARED TO ADENOCARCINOMA? A transversal study in a quaternary high volume hospital in Brazil

    Directory of Open Access Journals (Sweden)

    Francisco TUSTUMI

    Full Text Available ABSTRACT Background Esophageal cancer is one of the leading causes of mortality among the neoplasms that affect the gastrointestinal tract. There are several factors that contribute for development of an epidemiological esophageal cancer profile in a population. Objective This study aims to describe both clinically and epidemiologically the population of patients with diagnosis of esophageal cancer treated in a quaternary attention institute for cancer from January, 2009 to December, 2011, in Sao Paulo, Brazil. Methods The charts of all patients diagnosed with esophageal cancer from January, 2009, to December, 2011, in a Sao Paulo (Brazil quaternary oncology institute were retrospectively reviewed. Results Squamous cell cancer made up to 80% of the cases of esophageal cancer. Average age at diagnosis was 60.66 years old for esophageal adenocarcinoma and 62 for squamous cell cancer, average time from the beginning of symptoms to the diagnosis was 3.52 months for esophageal adenocarcinoma and 4.2 months for squamous cell cancer. Average time for initiating treatment when esophageal cancer is diagnosed was 4 months for esophageal adenocarcinoma and 4.42 months for squamous cell cancer. There was a clear association between squamous cell cancer and head and neck cancers, as well as certain habits, such as smoking and alcoholism, while adenocarcinoma cancer showed more association with gastric cancer and gastroesophageal reflux disease. Tumoral bleeding and pneumonia were the main causes of death. No difference in survival rate was noted between the two groups. Conclusion Adenocarcinoma and squamous cell carcinoma are different diseases, but both are diagnosed in advanced stages in Brazil, compromising the patients' possibilities of cure.

  12. Bad is not involved in DHA-induced apoptosis in human lung adenocarcinoma ASTC-a-1 cells

    Science.gov (United States)

    Yu, Huai-na; Lu, Ying-ying; Chen, Tong-sheng

    2011-03-01

    Dihydroartemisinin (DHA), a first-line anti-malarial drug with low toxicity, has been shown to possess promising anticancer activities and induce cancer cell death through apoptotic pathway, but the molecular mechanisms are not well understood. In this paper, we focus on whether Bad, a BH3-only pro-apoptotic protein, is involved in apoptotic cell death in DHA-treated human lung adenocarcinoma (ASTC-a-1) cells. Confocal fluorescence microscope imaging was used to monitor the temporal and spatial distribution of Bad in single living cells. Our results indicate that Bad is still located in cytoplasm and does not translocate to mitochondria after treatment with DHA for 24 h, while only a small proportion of Bad located in cytoplasm in the STS-treated cells for 6 h. These results show for the first time that Bad is not involved in DHA-induced apoptosis in ASTC-a-1 cells, which could give more evidence for the molecular mechanisms of apoptosis induced by DHA.

  13. Emission spectral analysis of caspase-3 activation during artesunate (ART)-induced apoptosis of human lung adenocarcinoma cell

    Science.gov (United States)

    Pan, Wen-liang; Chen, Tong-sheng; Qu, Junle

    2009-02-01

    Artesunate (ART), a semi-synthetic derivative of the sesquiterpene artemisinin extracted from the Chinese herb Artemisia annua, exerts a broad spectrum of clinical activity against human cancers. Artemisinin-derivative combination chemotherapy is recommended by WHO since it acts rapidly and is well tolerated and particularly effective. In present investigation, we used CKK-8 assay to assess the inhibitory effects of ART on human lung adenocarcinoma (ASTC-a-1) cells. Apoptotic activity of ART in ASTC-a-1 cells was detected by means of nuclear staining with Hoechst33258. In order to monitor the activity of caspase-3 during ART-induced ASTC-a-1 cells apoptosis, the dynamical emission spectra of SCAT3, a FRET plasmid based on GFPs, were performed inside living cell expressed stably with SCAT3 after ART treatment. The results showed that (1) ART could inhibit ASTC-a-1 cells proliferation in a dose-dependent manner; (2) chromatin condensation was observed after ART treatment for 48 h; (3) the SCAT3 inside living cells were cleaved after ART treatment for 48 h, implying that caspase-3 was involved in the ART-induced apoptosis.

  14. Anticancer function of α-solanine in lung adenocarcinoma cells by inducing microRNA-138 expression.

    Science.gov (United States)

    Zhang, Furui; Yang, Rui; Zhang, Guojun; Cheng, Ruirui; Bai, Yong; Zhao, Huasi; Lu, Xinhua; Li, Hui; Chen, Shanshan; Li, Juan; Wu, Shujun; Li, Ping; Chen, Xiaonan; Sun, Qianqian; Zhao, Guoqiang

    2016-05-01

    Currently, lung cancer is still a main cause of malignancy-associated death worldwide. Even though various methods for prevention and treatment of lung cancer have been improved in recent decades, the 5-year survival rate has remained very low. Insights into the anticancer function of small-molecule anticancer compounds have opened our visual field about cancer therapy. α-Solanine has been well studied for its antitumor properties, but its effect in lung cancer and associated molecular mechanisms have not yet been evaluated. To explore the anticancer function of α-solanine, we performed an MTT assay, Transwell arrays, colony-forming survival assay, quantitative reverse transcription PCR (qRT-PCR), Western blotting, and dual luciferase reporter assays in A549 and H1299 cells. We found that α-solanine not only inhibited cell migration and invasion ability but also enhanced the chemosensitivity and radiosensitivity of A549 and H1299 cells. Moreover, we discovered that α-solanine could affect the expression of miR-138 and focal adhesion kinase (FAK), both of which were also found to affect the chemosensitivity and radiosensitivity of A549 and H1299 cells. In conclusion, α-solanine could affect miR-138 and FAK expression to restrict cell migration and invasion and enhance the chemosensitivity and radiosensitivity of A549 and H1299 cells. The α-solanine/miR-138/FAK cascade can probably be a potential therapy target against lung adenocarcinoma.

  15. The pseudogene-derived long noncoding RNA SFTA1P is down-regulated and suppresses cell migration and invasion in lung adenocarcinoma.

    Science.gov (United States)

    Zhang, Hua; Xiong, Yaqiong; Xia, Rui; Wei, Chenchen; Shi, Xuefei; Nie, Fengqi

    2017-02-01

    Pseudogenes were once considered to be genomic fossils without biological function. Interestingly, recent evidence showed that a lot of pseudogenes are transcribed in human cancers, and their alterations contribute to multiple cancer development and progression. It is apparent that many pseudogenes transcribe noncoding RNAs and contribute to the role noncoding genome plays in human cancers. On this basis, some pseudogene transcripts are currently ranked among the classes of long noncoding RNAs. In this study, we identified a new pseudogene-derived long noncoding RNA termed SFTA1P by analyzing the microarray data of non-small cell lung cancer from Gene Expression Omnibus datasets. We found that SFTA1P expression was significantly decreased in non-small cell lung cancer tissues compared with normal tissues in non-small cell lung cancer microarray data. Moreover, decreased SFTA1P expression is only correlated with lung adenocarcinoma patients' poor survival time but not with lung squamous cell carcinoma patients' survival. In addition, gain-of-function studies including growth curves, migration, invasion assays, and in vivo studies were performed to verify the tumor suppressor role of SFTA1P in non-small cell lung cancer. Finally, the potential underlying pathways involved in SFTA1P were investigated by analyzing the SFTA1P-correlated genes in The Cancer Genome Atlas lung adenocarcinoma and normal tissues RNA sequencing data. Taken together, these findings demonstrate that pseudogene-derived long noncoding RNA SFTA1P exerts the tumor suppressor functions in human lung adenocarcinoma. Our investigation reveals the novel roles of pseudogene in lung adenocarcinoma, which may serve as a new target for lung adenocarcinoma diagnosis and therapy.

  16. Normalizing genes for quantitative RT-PCR in differentiating human intestinal epithelial cells and adenocarcinomas of the colon.

    Science.gov (United States)

    Dydensborg, Anders Bondo; Herring, Elizabeth; Auclair, Joëlle; Tremblay, Eric; Beaulieu, Jean-Francois

    2006-05-01

    As for other mRNA measurement methods, quantitative RT-PCR results need to be normalized relative to stably expressed genes. Widely used normalizing genes include beta-actin and glyceraldehyde-3-phosphate dehydrogenase. It has, however, become clear that these and other normalizing genes can display modulated patterns of expression across tissue types and during complex cellular processes such as cell differentiation and cancer progression. Our objective was to set the basis for identifying normalizing genes that displayed stable expression during enterocytic differentiation and between healthy tissue and adenocarcinomas of the human colon. We thus identified novel potential normalizing genes using previously generated cDNA microarray data and examined the alterations of expression of two of these genes as well as seven commonly used normalizing genes during the enterocytic differentiation process and between matched pairs of resection margins and primary carcinomas of the human colon using real-time RT-PCR. We found that ribosomal phosphoprotein P0 was particularly stable in all intestinal epithelial cell extracts, thereby representing a particularly robust housekeeping reference gene for the assessment of gene expression during the human enterocytic differentiation process. On the other hand, beta-2-microglobulin generated the best score as a normalizing gene for comparing human colon primary carcinomas with their corresponding normal mucosa of the resection margin, although others were found to represent acceptable alternatives. In conclusion, we identified and characterized specific normalizing genes that should significantly improve quantitative mRNA studies related to both the differentiation process of the human intestinal epithelium and adenocarcinomas of the human colon. This approach should also be useful to validate normalizing genes in other intestinal contexts.

  17. Antitumor activity of a Trans-thiosemicarbazone schiff base palladium (II) complex on human gastric adenocarcinoma cells.

    Science.gov (United States)

    Zhang, Bingchang; Luo, Haiqing; Xu, Qinjuan; Lin, Lirong; Zhang, Bing

    2017-02-21

    The development of transition-metal-based antitumor drug candidates increases the metallopharmaceuticals study dramatically. Two trans-thiosemicarbazone-based, Schiff base palladium (Pd) (II) complexes, DMABTSPd (TSPd) and DMABPTSPd (PTSPd), were prepared and characterized as described in our previous study. Here, we investigated whether the two complexes have antitumor effect on human gastric adenocarcinoma cell lines, BGC-823 and SGC-7901, compared with normal human gastric mucosal epithelial cell line, Ges-1. The results show that the Pd complex with the bare amino group (DMABTSPd(TSPd)) can inhibit cell viabilities and induce apoptosis in human gastric carcinoma cells, rather than the Pd complex without the bare amino group (DMABPTSPd (PTSPd)). This occurs via a mitochondrial-related pathway by down-regulating the level of Bcl-2 expression and up-regulating the level of Bid expression. Meanwhile, DMABTSPd (TSPd) suppressed tumor growth via a mitochondrial-related pathway in a nude mouse tumor xenograft model derived from BGC-823 cells. These findings demonstrate that DMABTSPd (TSPd) is worthy of further structural optimization and representing a promising Pd complex for the development of a new antitumor therapeutic agent.

  18. Glucose-regulated protein 58 modulates β-catenin protein stability in a cervical adenocarcinoma cell line.

    Science.gov (United States)

    Liao, Chia-Jung; Wu, Tzu-I; Huang, Ya-Hui; Chang, Ting-Chang; Lai, Chyong-Huey; Jung, Shih-Ming; Hsueh, Chuen; Lin, Kwang-Huei

    2014-08-01

    Cervical cancer continues to threaten women's health worldwide, and the incidence of cervical adenocarcinoma (AD) is rising in the developed countries. Previously, we showed that glucose-regulated protein 58 (Grp58) served as an independent factor predictive of poor prognosis of patients with cervical AD. However, the molecular mechanism underlying the involvement of Grp58 in cervical carcinogenesis is currently unknown. DNA microarray and enrichment analysis were used to identify the pathways disrupted by knockdown of Grp58 expression. Among the pathway identified, the WNT signaling pathway was one of those that were significantly associated with knockdown of Grp58 expression in HeLa cells. Our experiments showed that β-catenin, a critical effector of WNT signaling, was stabilized thereby accumulated in stable Grp58 knockdown cells. Membrane localization of β-catenin was observed in Grp58 knockdown, but not control cells. Using a transwell assay, we found that accumulated β-catenin induced by Grp58 knockdown or lithium chloride treatment inhibited the migration ability of HeLa cells. Furthermore, an inverse expression pattern of Grp58 and β-catenin was observed in cervical tissues. Our results demonstrate that β-catenin stability is negatively regulated by Grp58 in HeLa cells. Overexpression of Grp58 may be responsible for the loss of or decrease in membranous β-catenin expression in cervical AD.

  19. Mitochondrial thiol modification by a targeted electrophile inhibits metabolism in breast adenocarcinoma cells by inhibiting enzyme activity and protein levels

    Directory of Open Access Journals (Sweden)

    M. Ryan Smith

    2016-08-01

    Full Text Available Many cancer cells follow an aberrant metabolic program to maintain energy for rapid cell proliferation. Metabolic reprogramming often involves the upregulation of glutaminolysis to generate reducing equivalents for the electron transport chain and amino acids for protein synthesis. Critical enzymes involved in metabolism possess a reactive thiolate group, which can be modified by certain oxidants. In the current study, we show that modification of mitochondrial protein thiols by a model compound, iodobutyl triphenylphosphonium (IBTP, decreased mitochondrial metabolism and ATP in MDA-MB 231 (MB231 breast adenocarcinoma cells up to 6 days after an initial 24 h treatment. Mitochondrial thiol modification also depressed oxygen consumption rates (OCR in a dose-dependent manner to a greater extent than a non-thiol modifying analog, suggesting that thiol reactivity is an important factor in the inhibition of cancer cell metabolism. In non-tumorigenic MCF-10A cells, IBTP also decreased OCR; however the extracellular acidification rate was significantly increased at all but the highest concentration (10 µM of IBTP indicating that thiol modification can have significantly different effects on bioenergetics in tumorigenic versus non-tumorigenic cells. ATP and other adenonucleotide levels were also decreased by thiol modification up to 6 days post-treatment, indicating a decreased overall energetic state in MB231 cells. Cellular proliferation of MB231 cells was also inhibited up to 6 days post-treatment with little change to cell viability. Targeted metabolomic analyses revealed that thiol modification caused depletion of both Krebs cycle and glutaminolysis intermediates. Further experiments revealed that the activity of the Krebs cycle enzyme, aconitase, was attenuated in response to thiol modification. Additionally, the inhibition of glutaminolysis corresponded to decreased glutaminase C (GAC protein levels, although other protein levels were

  20. Close relation of large cell carcinoma to adenocarcinoma by hierarchical cluster analysis: implications for histologic typing of lung cancer on biopsies.

    Science.gov (United States)

    Hammer, Stephan H; Prall, Friedrich

    2015-09-01

    Determining histologic types of lung cancer on biopsies can be difficult. This study addresses the role of immunohistochemistry in histologic typing, using a tissue microarray (TMA) as "model biopsies," and presents a classification generated by an unsupervised hierarchical cluster analysis. A TMA was made from resection specimens of a consecutive series of 165 lung tumors. In a "tissue-spot review" with hematoxylin and eosin sections all the large cell carcinomas (N=22) were assigned to the noncommittal class of non-small cell lung cancer (NSCLC), as were an additional 37 tumors of defined histologic types. Adenocarcinomas and squamous cell carcinomas included with these NSCLC could be diagnosed by immunohistochemistry with antibodies against TTF-1, Napsin A, cytokeratin (CK)7, p40, p63, and CK5/6 with moderate to good sensitivities and specificities. Unsupervised hierarchical clustering was done with these data and additional high-molecular-weight cytokeratins, CD56, synaptophysin, and chromogranin immunohistochemistry. This delineated separate clusters for adenocarcinomas, large cell carcinomas, neuroendocrine tumors, and squamous cell carcinomas. Notably, adenocarcinoma and large cell carcinoma clusters were closely related and clearly set off from the squamous cell carcinoma cluster. As would be expected for a clinically well-staged series CDX2, GATA3, estrogen, and progesterone receptor immunohistochemistry remained negative in the vast majority of the tumors and, if positive, were restricted to very few cells. These results, the clustering data in particular, underpin the pragmatic recommendation canvassed with the IASLC/ATS/ERS classification of lung cancers that adenocarcinoma-type molecular studies should include NSCLC with a nonsquamous cell carcinoma immunophenotype.

  1. Targeting the mRNA-binding protein HuR impairs malignant characteristics of pancreatic ductal adenocarcinoma cells

    Science.gov (United States)

    Jimbo, Masaya; Blanco, Fernando F.; Screnci, Brad A.; Cosma, Gabriela L.; Alexeev, Vitali; Gonye, Gregory E.; Yeo, Charles J.; Sawicki, Janet A.; Winter, Jordan M.; Brody, Jonathan R.

    2015-01-01

    Post-transcriptional regulation is a powerful mediator of gene expression, and can rapidly alter the expression of numerous transcripts involved in tumorigenesis. We have previously shown that the mRNA-binding protein HuR (ELAVL1) is elevated in human pancreatic ductal adenocarcinoma (PDA) specimens compared to normal pancreatic tissues, and its cytoplasmic localization is associated with increased tumor stage. To gain a better insight into HuR’s role in PDA biology and to assess it as a candidate therapeutic target, we altered HuR expression in PDA cell lines and characterized the resulting phenotype in preclinical models. HuR silencing by short hairpin and small interfering RNAs significantly decreased cell proliferation and anchorage-independent growth, as well as impaired migration and invasion. In comparison, HuR overexpression increased migration and invasion, but had no significant effects on cell proliferation and anchorage-independent growth. Importantly, two distinct targeted approaches to HuR silencing showed marked impairment in tumor growth in mouse xenografts. NanoString nCounter® analyses demonstrated that HuR regulates core biological processes, highlighting that HuR inhibition likely thwarts PDA viability through post-transcriptional regulation of diverse signaling pathways (e.g. cell cycle, apoptosis, DNA repair). Taken together, our study suggests that targeted inhibition of HuR may be a novel, promising approach to the treatment of PDA. PMID:26314962

  2. A Distinct Slow-Cycling Cancer Stem-like Subpopulation of Pancreatic Adenocarcinoma Cells is maintained in Vivo

    Energy Technology Data Exchange (ETDEWEB)

    Dembinski, Jennifer L., E-mail: jennifer.dembinski@rr-research.no; Krauss, Stefan [Cellular and Genetic Therapy, Department of Microbiology, Cancer Stem Cell Innovation Center (CAST), Oslo University Hospital, Rikshospitalet, Oslo (Norway)

    2010-11-29

    Pancreatic adenocarcinoma has the worst prognosis of any major malignancy, with <5% of patients surviving five years. This can be contributed to the often late diagnosis, lack of sufficient treatment and metastatic spread. Heterogeneity within tumors is increasingly becoming a focus in cancer research, as novel therapies are required to target the most aggressive subpopulations of cells that are frequently termed cancer stem cells (CSCs). In the current study, we describe the identification of a slow-cycling cancer stem-like population of cells in vivo in BxPC-3 and Panc03.27 xenografts. A distinct slow-cycling label-retaining population of cells (DiI+/SCC) was found both at the edge of tumors, and in small circumscribed areas within the tumors. DiI+/SCC in these areas display an epithelial-to-mesenchymal transition (EMT) fingerprint, including an upregulation of the mesenchymal markers vimentin and N-cadherin and a loss of the epithelial marker E-cadherin. DiI+/SCC also displayed a critical re-localization of beta-catenin from the membrane to the nucleus. Additionally, the DiI+/SCC population was found to express the developmental signaling molecule sonic hedgehog. This study represents a novel step in defining the biological activities of a tumorigenic subpopulation within the heterogeneous tumor microenvironment in vivo. Understanding the interactions and functions of a CSC population within the context of the tumor microenvironment is critical to design targeted therapeutics.

  3. Antioxidant potential of buffalo and cow milk Cheddar cheeses to tackle human colon adenocarcinoma (Caco-2 cells

    Directory of Open Access Journals (Sweden)

    Nuzhat Huma

    2018-02-01

    Full Text Available Objective The aim of present study was to assess the anti-oxidant potential of water-soluble peptides (WSPs extract derived from buffalo and cow milk Cheddar cheeses at different stages of ripening. Methods The antioxidant potential of WSPs extract was assessed through 2,2’-azinobis-3-ethylbenzothiazoline-6sulfonic acid (ABTS-radical scavenging activity. In addition, impact of WSPs extract on cell viability and production of reactive oxygen species (ROS in human colon adenocarcinoma Caco-2 (tert-butylhydroperoxide-induced cell lines was also evaluated. Results The ABTS-radical scavenging activity increased progressively with ripening period and dose-dependently in both cheeses. However, peptide extract from buffalo milk Cheddar cheese demonstrated relatively higher activity due to higher contents of water-soluble nitrogen. Intracellular ROS production in Caco-2 cells decreased significantly (p<0.05 till 150th day of cheese ripening and remained constant thereafter. Additionally, dose-dependent response of WSPs extract on antioxidant activity was noticed in the Caco-2 cell line. Conclusion On the basis of current in vitro study, the Cheddar cheese WSPs extract can protect intestinal epithelium against oxidative stress due to their antioxidant activity.

  4. Okadaic acid inhibits cell multiplication and induces apoptosis in a549 cells, a human lung adenocarcinoma cell line.

    Science.gov (United States)

    Wang, Renjun; Lv, Lili; Zhao, Yunfeng; Yang, Nana

    2014-01-01

    This essay aims to research the effect of okadaic acid (OA) on A549 cell multiplication, and cell apoptosis induced by OA was observed by cell morphology. MTT assay, trypan blue exclusion test (TBET), Giemsa staining method and acridine orange (AO) fluorescence staining assay were applied. The results of cell survival evaluated by TBET and colorimetric assay with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) showed: The number of A549 cells was decreased in a dose-dependent manner. Cytomorphology observation of okadaic acid-treated cells showed that cells became shrinkage and turned round, some cells floated in the nutrient medium with nucleus agglutination broken, resulting in apoptotic bodies. Above-mentioned results indicated that OA exerted significantly inhibitory effect on A549 cell multiplication due to the apoptosis induced by OA.

  5. In vitro cytotoxicity of silver nanoparticles and zinc oxide nanoparticles to human epithelial colorectal adenocarcinoma (Caco-2) cells

    Energy Technology Data Exchange (ETDEWEB)

    Song, Yijuan [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Guan, Rongfa, E-mail: rongfaguan@163.com [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Lyu, Fei [Department of Food Science and Technology, Zhejiang University of Technology, Hangzhou 310014 (China); Kang, Tianshu; Wu, Yihang [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Chen, Xiaoqiang [Hubei University of Technology, Wuhan 430068 (China)

    2014-11-15

    Highlights: • The characterization of Ag NPs and ZnO NPs. • The various morphologies of Caco-2 cells stained with AO/EB. • The viability of Caco-2 cells after Ag NPs and ZnO NPs exposure. • The cytotoxicity of Ag NPs and ZnO NPs on Caco-2 cells by oxidative stress assays. - Abstract: With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200 μg/mL of Ag NPs and ZnO NPs (90 nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0–200 μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD{sub 50} of ZnO NPs in Caco-2 cells is 0.431 mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells’ antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50 μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials

  6. NONO and RALY proteins are required for YB-1 oxaliplatin induced resistance in colon adenocarcinoma cell lines

    Directory of Open Access Journals (Sweden)

    Tsofack Serges P

    2011-11-01

    Full Text Available Abstract Background YB-1 is a multifunctional protein that affects transcription, splicing, and translation. Overexpression of YB-1 in breast cancers causes cisplatin resistance. Recent data have shown that YB-1 is also overexpress in colorectal cancer. In this study, we tested the hypothesis that YB-1 also confers oxaliplatin resistance in colorectal adenocarcinomas. Results We show for the first time that transfection of YB-1 cDNA confers oxaliplatin resistance in two colorectal cancer cell lines (SW480 and HT29 cell lines. Furthermore, we identified by mass spectrometry analyses important YB-1 interactors required for such oxaliplatin resistance in these colorectal cancer cell lines. A tagged YB-1 construct was used to identify proteins interacting directly to YB-1 in such cells. We then focused on proteins that are potentially involved in colorectal cancer progression based on the Oncomine microarray database. Genes encoding for these YB-1 interactors were also examined in the public NCBI comparative genomic hybridization database to determine whether these genes are localized to regions of chromosomes rearranged in colorectal cancer tissues. From these analyses, we obtained a list of proteins interacting with YB-1 and potentially involved in oxaliplatin resistance. Oxaliplatin dose response curves of SW480 and HT29 colorectal cancer cell lines transfected with several siRNAs corresponding to each of these YB-1 interactors were obtained to identify proteins significantly affecting oxaliplatin sensitivity upon gene silencing. Only the depletion of either NONO or RALY sensitized both colorectal cancer cell lines to oxaliplatin. Furthermore, depletion of NONO or RALY sensitized otherwise oxaliplatin resistant overexpressing YB-1 SW480 or HT29 cells. Conclusion These results suggest knocking down NONO or RALY significant counteracts oxaliplatin resistance in colorectal cancers overexpressing the YB-1 protein.

  7. Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway.

    Science.gov (United States)

    Pan, Yan; Chen, Jing; Tao, Leilei; Zhang, Kai; Wang, Rui; Chu, Xiaoyuan; Chen, Longbang

    2017-05-16

    Emerging evidence indicates that the dysregulation of long non-coding RNAs (lncRNAs) contributes to the development and progression of lung adenocarcinoma (LAD), however the underlying mechanism of action of lncRNAs remains unclear. It is well known that the effective treatment of cancers has been hindered by drug resistance in the clinical setting. Epithelial-mesenchymal transition (EMT) has been recognized to be involved in acquiring drug resistance, cell migration and invasion properties in several types of cancer. Docetaxel-resistant LAD cells established previously in our lab present chemoresistant and mesenchymal features. Long intergenic non-protein coding RNA, regulator of reprogramming (linc-ROR), was first discovered in induced pluripotent stem cells (iPSCs) and was upregulated in docetaxel-resistant LAD cells. In this study, we tried to make clarification of lincRNA-related mechanisms underlying EMT followed by acquired resistance to chemotherapy in LAD. In order to hit the mark, we made use of multiple methods including microarray analysis, qRT-PCR, western blotting analysis, loss/gain-of-function analysis, luciferase assays, drug sensitivity assays, wound-healing assay and invasion assay. We found that decreased expression of linc-ROR effectively reversed EMT in docetaxel-resistant LAD cells and sensitized them to chemotherapy. The function of linc-ROR exerted in LAD cells depended on the sponging of miR-145, therefore, releasing the miR-145 target FSCN1, and thus contributing to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant LAD cells. Our findings revealed that linc-ROR might act as potential therapeutic target to overcome chemotherapy resistance in LAD.

  8. Deleterious effects on MDAMB-231 breast adenocarcinoma cell lineage submitted to Ho-166 radioactive seeds at very low activity

    Energy Technology Data Exchange (ETDEWEB)

    Falcao, Patricia L.; Campos, Tarcisio P.R., E-mail: campos@nuclear.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear; Sarmento, Eduardo V. [Centro de Desenvolvimento de Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Cuperschmid, Ethel M. [Universidade Federal de Minas Gerais (CEMEMOR/UFMG), Belo Horizonte, BR (Brazil). Fac. de Medicina. Centro de Memoria da Medicina

    2011-07-01

    Herein, the deleterious effect of ionizing radiation provided by Ho-166 radioactive seeds at low activity were addressed, based on experimental in vitro assays at the MDA MB231 cell lineage, a breast adenocarcinoma, compared to PBMC - peripheral blood cells. The methodology involves of the MDBMB-231 and PBMC expansion in culture in suitable environment in 30mm well plates and T-25 flasks. Seeds were synthesized with Ho-165 incorporated and characterized previously. Activation was processed at IPR1 reactor at the peripheral table, at 8h exposition. Three groups of seeds were tested: 0,34 mCi, 0,12 mCi activity, and control group. Such seeds were placed on culture and held to a period of 05 half-lives of the radionuclide. The biological responses at these exposure were documented by inverse microscopic photographic in time. Also, MTT essay were performed. A fast response in producing deleterious effects at cancer cell was observed even if for the low activity seeds. Also, a biological response dependent to a radial distance of the seed was observed. At conclusion, viability clonogenic control of MDAMB231 is identified at the exposition to Ho-166 ceramic seeds, even if at low activity of 0,1 to 0,3mCi. (author)

  9. Cyto- and genotoxicity assessment of Gold nanoparticles obtained by laser ablation in A549 lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Bucchianico, Sebastiano Di [Karolinska Institutet, Institute of Environmental Medicine (Sweden); Migliore, Lucia [University of Pisa, Department of Translational Research and New Technologies in Medicine and Surgery, Division of Medical Genetics (Italy); Marsili, Paolo [Institute of Complex Systems (ISC-CNR) (Italy); Vergari, Chiara [Plasma Diagnostics and Technologies s.r.l. (Italy); Giammanco, Francesco [University of Pisa, Department of Physics “E. Fermi” (Italy); Giorgetti, Emilia, E-mail: emilia.giorgetti@fi.isc.cnr.it [Institute of Complex Systems (ISC-CNR) (Italy)

    2015-05-15

    Gold nanoparticles have attracted enormous interest in biomedical applications, based on their unique optical properties. However, their toxicity on human tissues is still an open issue. Beyond the potential intrinsic toxicity of nanostructured gold, a non-negligible contribution of stabilizers or reaction by-products related to current wet chemical synthesis procedures can be expected. Aimed at isolating gold contribution from that of any other contaminant, we produced colloidal suspensions of Gold nanoparticles having average size <10 nm in deionized water or acetone by pulsed laser ablation, that permits preparation of uncoated and highly stable Gold nanoparticles in pure solvents. Subsequently, we investigated the role of surface chemistry, size, and dispersivity of synthesized Gold nanoparticles in exerting toxicity in a cell model system of deep respiratory tract, representing the main route of exposure to NPs, namely adenocarcinoma epithelial A549 cells. Gold nanoparticles prepared in water showed no particular signs of cytotoxicity, cytostasis, and/or genotoxicity as assessed by MTT colorimetric viability test and Cytokinesis-block micronucleus cytome assay up to concentrations of the order of 5 μg/mL. In contrast, Gold nanoparticles produced in pure acetone and then transferred into deionized water showed impaired cell viability, apoptosis responses, micronuclei, and dicentric chromosomes induction as well as nuclear budding, as a function of the amount of surface contaminants like amorphous carbon and enolate ions.

  10. IL-8-Positive Tumor-Infiltrating Inflammatory Cells Are a Novel Prognostic Marker in Pancreatic Ductal Adenocarcinoma Patients.

    Science.gov (United States)

    Fang, Yuan; Saiyin, Hexige; Zhao, Xinping; Wu, Yanhua; Han, Xu; Lou, Wenhui

    2016-01-01

    Tumor-infiltrating inflammatory cells (TIICs) in pancreatic ductal adenocarcinoma (PDAC) are reported to initiate and exacerbate invasion and metastasis. Interleukin-8 (IL-8), a proinflammatory cytokine, is expressed in both neoplastic cells and TIICs in PDAC tissues and increased in patient serum. The aim of this study is to evaluate the values of IL-8 expression profiles in tumor tissues and predict the source of serum IL-8 in PDAC patients. We used 2 independent groups of PDAC patient samples that included 240 cases. Tissue expression profiles of cytokines were evaluated with immunohistochemistry and serum levels with human IL-8 assay. The prognostic values of the variables were assessed by Kaplan-Meier or Cox regression analysis. Higher levels of IL-8-positive TIICs but not tumor cells in PDAC patients correlated with worse prognosis (P = 0.009) and higher blood serum IL-8 levels (P = 0.002). Controlling other independent factors, the relative hazard ratio for PDAC with higher IL-8-positive TIIC levels compared with those with lower TIIC levels was 1.588 (95% confidence interval, 1.04-2.42). Higher IL-8-positive TIIC levels in PDAC tumors indicate poorer prognosis and positively correlate with serum IL-8 concentrations and vice versa. These data suggested that IL-8 might have a potential target for PDAC therapies.

  11. Nintedanib: A Review of Its Use as Second-Line Treatment in Adults with Advanced Non-Small Cell Lung Cancer of Adenocarcinoma Histology.

    Science.gov (United States)

    Dhillon, Sohita

    2015-06-01

    Nintedanib (Vargatef®) is a triple angiokinase inhibitor that potently blocks the proangiogenic pathways mediated by vascular endothelial growth factor receptors, platelet-derived growth factor receptors and fibroblast growth factor receptors. In the EU, nintedanib in combination with docetaxel is indicated for adults with locally advanced, metastatic or locally recurrent non-small cell lung cancer (NSCLC) of adenocarcinoma tumour histology after first-line chemotherapy. Nintedanib in combination with docetaxel relative to placebo plus docetaxel significantly prolonged progression-free survival (PFS), but did not increase overall survival (OS), in the overall population of patients with advanced NSCLC in the phase III LUME-Lung 1 study. Notably, the subgroup of patients with adenocarcinoma histology experienced a significant improvement in both PFS and OS with nintedanib plus docetaxel, with a greater benefit seen in patients with rapidly progressing disease. Nintedanib is the first antiangiogenic agent to have shown a survival benefit in the second-line treatment of these patients. Health-related quality of life (HR-QOL) was not adversely affected with the addition of nintedanib to docetaxel in the overall population or in the adenocarcinoma subgroup. Nintedanib combination therapy had a generally manageable tolerability profile. Adverse events typically associated with antiangiogenic agents (e.g. bleeding and hypertension) were not greatly increased with nintedanib plus docetaxel relative to placebo plus docetaxel. To conclude, nintedanib in combination with docetaxel is an effective treatment option for patients with advanced NSCLC of adenocarcinoma histology after first-line chemotherapy.

  12. Differences between gastric signet-ring cell carcinoma and poorly differentiated adenocarcinoma: A comparison of histopathologic features determined by mucin core protein and trefoil factor family peptide immunohistochemistry.

    Science.gov (United States)

    Fujimoto, Ai; Ishikawa, Yukio; Ishii, Toshiharu; Yamada, Akihiro; Igarashi, Yoshinori; Ohmoto, Yasukazu; Kaise, Mitsuru

    2017-08-01

    We investigated differences between the pathological features of gastric signet-ring cell carcinoma (sig) and poorly differentiated adenocarcinoma (por) by examining the expressions of the trefoil factor family peptides (TFFs) and mucin core proteins (MUCs). Ninety-seven tissues of 97 gastric cancer patients were selected for this study. After gastrectomy, the major histopathologic types were determined to be sig, solid-type poorly differentiated adenocarcinoma (por1), non-solid type poorly differentiated adenocarcinoma (por2), and well-differentiated tubular adenocarcinoma (tub1). We evaluated the prevalence of positive staining for MUCs (MUC5AC and MUC2) and TFFs (TFF1 and TFF3) and assessed the correlation between MUCs and TFFs in each histopathological type. The rate of MUC2 expression significantly differed between sig and por2 (50.0% vs 11.7%, P = 0.011). TFF3 expression in sig significantly differed from TFF3 expression in both por2 (100% vs 17.6%, P sig (r = 0.593, P = 0.040). The expression and correlation patterns of the TFFs and MUCs suggest that the histopathologic features of gastric sig differ from those of por. © 2017 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  13. Serous papillary adenocarcinoma possibly related to the presence of primitive oocyte-like cells in the adult ovarian surface epithelium: a case report

    Directory of Open Access Journals (Sweden)

    Virant-Klun Irma

    2011-08-01

    Full Text Available Abstract Introduction The presence of oocytes in the ovarian surface epithelium has already been confirmed in the fetal ovaries. We report the presence of SSEA-4, SOX-2, VASA and ZP2-positive primitive oocyte-like cells in the adult ovarian surface epithelium of a patient with serous papillary adenocarcinoma. Case presentation Ovarian tissue was surgically retrieved from a 67-year old patient. Histological analysis revealed serous papillary adenocarcinoma. A proportion of ovarian cortex sections was deparaffinized and immunohistochemically stained for the expression of markers of pluripotency SSEA-4 and SOX-2 and oocyte-specific markers VASA and ZP2. The analysis confirmed the presence of round, SSEA-4, SOX-2, VASA and ZP2-positive primitive oocyte-like cells in the ovarian surface epithelium. These cells were possibly related to the necrotic malignant tissue. Conclusion Primitive oocyte-like cells present in the adult ovarian surface epithelium persisting probably from the fetal period of life or developed from putative stem cells are a pathological condition which is not observed in healthy adult ovaries, and might be related to serous papillary adenocarcinoma manifestation in the adult ovarian surface epithelium. This observation needs attention to be further investigated.

  14. LFG-500, a novel synthetic flavonoid, suppresses epithelial-mesenchymal transition in human lung adenocarcinoma cells by inhibiting NLRP3 in inflammatory microenvironment.

    Science.gov (United States)

    Yang, Dan; Cao, Xin; Wang, Fan; Jiang, Haijing; Feng, Dingding; Guo, Hao; Du, Lei; Jin, Yingliang; Chen, Yansu; Yin, Xiaoxing; Li, Chenglin

    2017-08-01

    Increasing evidence indicates that inflammatory microenvironment facilitates tumor metastasis. Here, we found that LFG-500, a novel synthetic flavonoid, significantly inhibited epithelial-mesenchymal transition (EMT) in human lung adenocarcinoma A549 and H1299 cells co-cultured with LPS-challenged THP-1 cells or cultured in THP-1 cell-derived conditioned medium. Moreover, we found that TNF-α is a direct and decisive factor for promoting EMT and LFG-500 suppressed TNF-α-induced EMT and cell motility. NLRP3 knockdown inactivated NLRP3 inflammasome, which subsequently inhibited EMT and blocked cell migration, indicating that TNF-α-induced EMT requires the NLRP3 inflammasome. LFG-500 inhibited the activation of the NLRP3 inflammasome, thus inhibiting EMT. Moreover, LFG-500 treatment significantly inhibited metastasis in vivo by downregulating NLRP3 expression. Importantly, we found that NLRP3 was highly expressed in high-grade lung adenocarcinoma and that its expression was correlated with lymph node metastasis. NLRP3 and vimentin levels were significantly increased in matched metastatic lymph nodes. Moreover, a significant positive correlation was observed between their levels. Together, these results suggest that LFG-500 markedly suppresses EMT by inhibiting the NLRP3 inflammasome in the inflammatory microenvironment and that NLRP3 is a potential biomarker of lung adenocarcinoma metastasis. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Lycopene Inhibits Metastasis of Human Liver Adenocarcinoma SK-Hep-1 Cells by Downregulation of NADPH Oxidase 4 Protein Expression.

    Science.gov (United States)

    Jhou, Bo-Yi; Song, Tuzz-Ying; Lee, Inn; Hu, Miao-Lin; Yang, Nae-Cherng

    2017-08-16

    NADPH oxidase 4 (NOX4), with the sole function to produce reactive oxygen species (ROS), can be a molecular target for disrupting cancer metastasis. Several studies have indicated that lycopene exhibited anti-metastatic actions in vitro and in vivo. However, the role of NOX4 in the anti-metastatic action of lycopene remains unknown. Herein, we first confirmed the anti-metastatic effect of lycopene (0.1-5 μM) on human liver adenocarcinoma SK-Hep-1 cells. We showed that lycopene significantly inhibited NOX4 protein expression, with the strongest inhibition of 64.3 ± 10.2% (P lycopene. Lycopene also significantly inhibited NOX4 mRNA expression, NOX activity, and intracellular ROS levels in SK-Hep-1 cells. We then determined the effects of lycopene on transforming growth factor β (TGF-β)-induced metastasis. We found that TGF-β (5 ng/mL) significantly increased migration, invasion, and adhesion activity, the intracellular ROS level, matrix metalloproteinase 9 (MMP-9) and MMP-2 activities, the level of NOX4 protein expression, and NOX activity. All these TGF-β-induced effects were antagonized by the incubation of SK-Hep-1 cells with lycopene (2.5 μM). Using transient transfection of siRNA against NOX4, we found that the downregulation of NOX4 could mimic lycopene by inhibiting cell migration and the activities of MMP-9 and MMP-2 during the incubation with or without TGF-β on SK-Hep-1 cells. The results demonstrate that the downregulation of NOX4 plays a crucial role in the anti-metastatic action of lycopene in SK-Hep-1 cells.

  16. Gastrin upregulates the prosurvival factor secretory clusterin in adenocarcinoma cells and in oxyntic mucosa of hypergastrinemic rats.

    Science.gov (United States)

    Fjeldbo, Christina Sæten; Bakke, Ingunn; Erlandsen, Sten Even; Holmseth, Jannicke; Lægreid, Astrid; Sandvik, Arne K; Thommesen, Liv; Bruland, Torunn

    2012-01-01

    We show that the gastric hormone gastrin induces the expression of the prosurvival secretory clusterin (sCLU) in rat adenocarcinoma cells. Clusterin mRNA was still upregulated in the presence of the protein synthesis inhibitor cycloheximide, although at a lower level. This indicates that gastrin induces clusterin transcription independently of de novo protein synthesis but requires de novo protein synthesis of signal transduction pathway components to achieve maximal expression level. Luciferase reporter assay indicates that the AP-1 transcription factor complex is involved in gastrin-mediated activation of the clusterin promoter. Gastrin-induced clusterin expression and subsequent secretion is dependent on sustained treatment, because removal of gastrin after 1-2 h abolished the response. Neutralization of secreted clusterin by a specific antibody abolished the antiapoptotic effect of gastrin on serum starvation-induced apoptosis, suggesting that extracellular clusterin is involved in gastrin-mediated inhibition of apoptosis. The clusterin response to gastrin was validated in vivo in hypergastrinemic rats, showing increased clusterin expression in the oxyntic mucosa, as well as higher levels of clusterin in plasma. In normal rat oxyntic mucosa, clusterin protein was strongly expressed in chromogranin A-immunoreactive neuroendocrine cells, of which the main cell type was the histidine decarboxylase-immunoreactive enterochromaffin-like (ECL) cell. The association of clusterin with neuroendocrine differentiation was further confirmed in human gastric ECL carcinoids. Interestingly, in hypergastrinemic rats, clusterin-immunoreactive cells formed distinct groups of diverse cells at the base of many glands. Our results suggest that clusterin may contribute to gastrin's growth-promoting effect on the oxyntic mucosa.

  17. Claudin-1 promotes TNF-α-induced epithelial-mesenchymal transition and migration in colorectal adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, Ajaz A. [Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ahmad, Rizwan; Uppada, SrijayaPrakash B. [Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Singh, Amar B. [From the Department of Veterans Affairs, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Dhawan, Punita, E-mail: punita.dhawan@unmc.edu [From the Department of Veterans Affairs, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE 68022 (United States)

    2016-11-15

    Epithelial-mesenchymal transition (EMT) is an important mechanism in cancer progression and malignancy including colorectal cancer (CRC). Importantly, inflammatory mediators are critical constituents of the local tumor environment and an intimate link between CRC progression and inflammation is now validated. We and others have reported key role of the deregulated claudin-1 expression in colon carcinogenesis including colitis-associated colon cancer (CAC). However, the causal association between claudin-1 expression and inflammation-induced colon cancer progression remains unclear. Here we demonstrate, TNF-α, a pro-inflammatory cytokine, regulates claudin-1 to modulate epithelial to mesenchymal transition (EMT) and migration in colon adenocarcinoma cells. Importantly, colon cancer cells cultured in the presence of TNF-α (10 ng/ml), demonstrated a sharp decrease in E-cadherin expression and an increase in vimentin expression (versus control cells). Interestingly, TNF-α treatment also upregulated (and delocalized) claudin-1 expression in a time-dependent manner accompanied by increase in proliferation and wound healing. Furthermore, similar to our previous observation that claudin-1 overexpression in CRC cells induces ERK1/2 and Src- activation, signaling associated with colon cancer cell survival and transformation, TNF-α-treatment induced upregulation of phospho-ERK1/2 and -Src expression. The shRNA-mediated inhibition of claudin-1 expression largely abrogated the TNF-α-induced changes in EMT, proliferation, migration, p-Erk and p-Src expression. Taken together, our data demonstrate TNF-α mediated regulation of claudin-1 and tumorigenic abilities of colon cancer cells and highlights a key role of deregulated claudin-1 expression in inflammation-induced colorectal cancer growth and progression, through the regulation of the ERK and Src-signaling.

  18. Epithelial-to-mesenchymal transition in pancreatic ductal adenocarcinoma: Characterization in a 3D-cell culture model.

    Science.gov (United States)

    Gagliano, Nicoletta; Celesti, Giuseppe; Tacchini, Lorenza; Pluchino, Stefano; Sforza, Chiarella; Rasile, Marco; Valerio, Vincenza; Laghi, Luigi; Conte, Vincenzo; Procacci, Patrizia

    2016-05-14

    To analyze the effect of three-dimensional (3D)-arrangement on the expression of epithelial-to-mesenchymal transition markers in pancreatic adenocarcinoma (PDAC) cells. HPAF-II, HPAC, and PL45 PDAC cells were cultured in either 2D-monolayers or 3D-spheroids. Ultrastructure was analyzed by transmission electron microscopy. The expression of E-cadherin, β-catenin, N-cadherin, collagen type I (COL-I), vimentin, α-smooth muscle actin (αSMA), and podoplanin was assayed by confocal microscopy in cells cultured on 12-mm diameter round coverslips and in 3D-spheroids. Gene expression for E-cadherin, Snail, Slug, Twist, Zeb1, and Zeb2 was quantified by real-time PCR. E-cadherin protein level and its electrophoretic pattern were studied by Western blot in cell lysates obtained from cells grown in 2D-monolayers and 3D-spheroids. The E-cadherin/β-catenin complex was expressed in a similar way in plasma membrane cell boundaries in both 2D-monolayers and 3D-spheroids. E-cadherin increased in lysates obtained from 3D-spheroids, while cleavage fragments were more evident in 2D-monolayers. N-cadherin expression was observed in very few PDAC cells grown in 2D-monolayers, but was more evident in 3D-spheroids. Some cells expressing COL-I were observed in 3D-spheroids. Podoplanin, expressed in collectively migrating cells, and αSMA were similarly expressed in both experimental conditions. The concomitant maintenance of the E-cadherin/β-catenin complex at cell boundaries supports the hypothesis of a collective migration for these cells, which is consistent with podoplanin expression. We show that a 3D-cell culture model could provide deeper insight into understanding the biology of PDAC and allow for the detection of marked differences in the phenotype of PDAC cells grown in 3D-spheroids.

  19. The in vitro photodynamic effect of laser activated gallium, indium and iron phthalocyanine chlorides on human lung adenocarcinoma cells.

    Science.gov (United States)

    Maduray, K; Odhav, B

    2013-11-05

    Metal-based phthalocyanines currently are utilized as a colorant for industrial applications but their unique properties also make them prospective photosensitizers. Photosensitizers are non-toxic drugs, which are commonly used in photodynamic therapy (PDT), for the treatment of various cancers. PDT is based on the principle that, exposure to light shortly after photosensitizer administration predominately leads to the production of reactive oxygen species for the eradication of cancerous cells and tissue. This in vitro study investigated the photodynamic effect of gallium (GaPcCl), indium (InPcCl) and iron (FePcCl) phthalocyanine chlorides on human lung adenocarcinoma cells (A549). Experimentally, 2 × 10(4)cells/ml were seeded in 24-well tissue culture plates and allowed to attach overnight, after which cells were treated with different concentrations of GaPcCl, InPcCl and FePcCl ranging from 2 μg/ml to 100 μg/ml. After 2h, cells were irradiated with constant light doses of 2.5 J/cm(2), 4.5 J/cm(2) and 8.5 J/cm(2) delivered from a diode laser (λ = 661 nm). Post-irradiated cells were incubated for 24h before cell viability was measured using the MTT Assay. At 24h after PDT, irradiation with a light dose of 2.5 J/cm(2) for each photosensitizing concentration of GaPcCl, InPcCl and FePcCl produced a significant decrease in cell viability, but when the treatment light dose was further increased to 4.5 J/cm(2) and 8.5 J/cm(2) the cell survival was less than 40%. Results also showed that photoactivated FePcCl decreased cell survival of A549 cells to 0% with photosensitizing concentrations of 40 μg/ml and treatment light dose of 2.5 J/cm(2). A 20 μg/ml photosensitizing concentration of FePcCl in combination with an increased treatment light dose of either 4.5 J/cm(2) or 8.5 J/cm(2) also resulted in 0% cell survival. This PDT study concludes that low concentrations on GaPcCl, InPcCl and FePcCl activated with low level light doses can be used for the effective in

  20. In vitro cytotoxicity of silver nanoparticles and zinc oxide nanoparticles to human epithelial colorectal adenocarcinoma (Caco-2) cells.

    Science.gov (United States)

    Song, Yijuan; Guan, Rongfa; Lyu, Fei; Kang, Tianshu; Wu, Yihang; Chen, Xiaoqiang

    2014-11-01

    With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200μg/mL of Ag NPs and ZnO NPs (90nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0-200μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD50 of ZnO NPs in Caco-2 cells is 0.431mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells' antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials than ZnO NPs. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Role of ATM in bystander signaling between human monocytes and lung adenocarcinoma cells.

    Science.gov (United States)

    Ghosh, Somnath; Ghosh, Anu; Krishna, Malini

    2015-12-01

    The response of a cell or tissue to ionizing radiation is mediated by direct damage to cellular components and indirect damage mediated by radiolysis of water. Radiation affects both irradiated cells and the surrounding cells and tissues. The radiation-induced bystander effect is defined by the presence of biological effects in cells that were not themselves in the field of irradiation. To establish the contribution of the bystander effect in the survival of the neighboring cells, lung carcinoma A549 cells were exposed to gamma-irradiation, 2Gy. The medium from the irradiated cells was transferred to non-irradiated A549 cells. Irradiated A549 cells as well as non-irradiated A549 cells cultured in the presence of medium from irradiated cells showed decrease in survival and increase in γ-H2AX and p-ATM foci, indicating a bystander effect. Bystander signaling was also observed between different cell types. Phorbol-12-myristate-13-acetate (PMA)-stimulated and gamma-irradiated U937 (human monocyte) cells induced a bystander response in non-irradiated A549 (lung carcinoma) cells as shown by decreased survival and increased γ-H2AX and p-ATM foci. Non-stimulated and/or irradiated U937 cells did not induce such effects in non-irradiated A549 cells. Since ATM protein was activated in irradiated cells as well as bystander cells, it was of interest to understand its role in bystander effect. Suppression of ATM with siRNA in A549 cells completely inhibited bystander effect in bystander A549 cells. On the other hand suppression of ATM with siRNA in PMA stimulated U937 cells caused only a partial inhibition of bystander effect in bystander A549 cells. These results indicate that apart from ATM, some additional factor may be involved in bystander effect between different cell types. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Scaffold-Free Coculture Spheroids of Human Colonic Adenocarcinoma Cells and Normal Colonic Fibroblasts Promote Tumorigenicity in Nude Mice

    Directory of Open Access Journals (Sweden)

    Jong-il Park

    2016-02-01

    Full Text Available The aim of this study was to form a scaffold-free coculture spheroid model of colonic adenocarcinoma cells (CACs and normal colonic fibroblasts (NCFs and to use the spheroids to investigate the role of NCFs in the tumorigenicity of CACs in nude mice. We analysed three-dimensional (3D scaffold-free coculture spheroids of CACs and NCFs. CAC Matrigel invasion assays and tumorigenicity assays in nude mice were performed to examine the effect of NCFs on CAC invasive behaviour and tumorigenicity in 3D spheroids. We investigated the expression pattern of fibroblast activation protein-α (FAP-α by immunohistochemical staining. CAC monocultures did not form densely-packed 3D spheroids, whereas cocultured CACs and NCFs formed 3D spheroids. The 3D coculture spheroids seeded on a Matrigel extracellular matrix showed higher CAC invasiveness compared to CACs alone or CACs and NCFs in suspension. 3D spheroids injected into nude mice generated more and faster-growing tumors compared to CACs alone or mixed suspensions consisting of CACs and NCFs. FAP-α was expressed in NCFs-CACs cocultures and xenograft tumors, whereas monocultures of NCFs or CACs were negative for FAP-α expression. Our findings provide evidence that the interaction between CACs and NCFs is essential for the tumorigenicity of cancer cells as well as for tumor propagation.

  3. Santamarine Inhibits NF-κB Activation and Induces Mitochondrial Apoptosis in A549 Lung Adenocarcinoma Cells via Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Xuefeng Wu

    2017-01-01

    Full Text Available Santamarine (STM, a sesquiterpene lactone component of Magnolia grandiflora and Ambrosia confertiflora, has been shown to possess antimicrobial, antifungal, antibacterial, anti-inflammatory, and anticancer activities. However, no study has yet been conducted to investigate the molecular mechanism of STM-mediated anticancer activity. In the present study, we found that STM inhibits growth and induces apoptosis in A549 lung adenocarcinoma cells through induction of oxidative stress. STM induces oxidative stress by promoting reactive oxygen species (ROS generation, depleting intracellular glutathione (GSH, and inhibiting thioredoxin reductase (TrxR activity in a dose-dependent manner. Further mechanistic study demonstrated that STM induces apoptosis by modulation of Bax/Bcl-2 expressions, disruption of mitochondrial membrane potential, activation of caspase-3, and cleavage of PARP in a dose-dependent manner. Moreover, STM inhibited the constitutive and inducible translocation of NF-κBp65 into the nucleus. IKK-16 (I-κB kinase inhibitor augmented the STM-induced apoptosis, indicating that STM induces apoptosis in A549 cells at least in part through NF-κB inhibition. Finally, STM-induced apoptosis and expressions of apoptosis regulators were effectively inhibited by thiol antioxidant N-acetyl-L-cysteine (NAC, indicating that STM exerts its anticancer effects mainly through oxidative stress. To the best of our knowledge, this is the first report providing evidence of anticancer activity and molecular mechanism of STM.

  4. Cyto- and genotoxicity assessment of Gold nanoparticles obtained by laser ablation in A549 lung adenocarcinoma cells

    Science.gov (United States)

    Di Bucchianico, Sebastiano; Migliore, Lucia; Marsili, Paolo; Vergari, Chiara; Giammanco, Francesco; Giorgetti, Emilia

    2015-05-01

    Gold nanoparticles have attracted enormous interest in biomedical applications, based on their unique optical properties. However, their toxicity on human tissues is still an open issue. Beyond the potential intrinsic toxicity of nanostructured gold, a non-negligible contribution of stabilizers or reaction by-products related to current wet chemical synthesis procedures can be expected. Aimed at isolating gold contribution from that of any other contaminant, we produced colloidal suspensions of Gold nanoparticles having average size adenocarcinoma epithelial A549 cells. Gold nanoparticles prepared in water showed no particular signs of cytotoxicity, cytostasis, and/or genotoxicity as assessed by MTT colorimetric viability test and Cytokinesis-block micronucleus cytome assay up to concentrations of the order of 5 μg/mL. In contrast, Gold nanoparticles produced in pure acetone and then transferred into deionized water showed impaired cell viability, apoptosis responses, micronuclei, and dicentric chromosomes induction as well as nuclear budding, as a function of the amount of surface contaminants like amorphous carbon and enolate ions.

  5. Quantitative assessment of viable cells of Lactobacillus plantarum strains in single, dual and multi-strain biofilms.

    Science.gov (United States)

    Fernández Ramírez, Mónica D; Kostopoulos, Ioannis; Smid, Eddy J; Nierop Groot, Masja N; Abee, Tjakko

    2017-03-06

    Biofilms of Lactobacillus plantarum are a potential source for contamination and recontamination of food products. Although biofilms have been mostly studied using single species or even single strains, it is conceivable that in a range of environmental settings including food processing areas, biofilms are composed of multiple species with each species represented by multiple strains. In this study six spoilage related L. plantarum strains FBR1-FBR6 and the model strain L. plantarum WCFS1 were characterised in single, dual and multiple strain competition models. A quantitative PCR approach was used with added propidium monoazide (PMA) enabling quantification of intact cells in the biofilm, representing the viable cell fraction that determines the food spoilage risk. Our results show that the performance of individual strains in multi-strain cultures generally correlates with their performance in pure culture, and relative strain abundance in multi-strain biofilms positively correlated with the relative strain abundance in suspended (planktonic) cultures. Performance of individual strains in dual-strain biofilms was highly influenced by the presence of the secondary strain, and in most cases no correlation between the relative contributions of viable planktonic cells and viable cells in the biofilm was noted. The total biofilm quantified by CV staining of the dual and multi-strain biofilms formed was mainly correlated to CV values of the dominant strain obtained in single strain studies. However, the combination of strain FBR5 and strain WCFS1 showed significantly higher CV values compared to the individual performances of both strains indicating that total biofilm formation was higher in this specific condition. Notably, L. plantarum FBR5 was able to outgrow all other strains and showed the highest relative abundance in dual and multi-strain biofilms. All the dual and multi-strain biofilms contained a considerable number of viable cells, representing a potential

  6. Cell Factory Stability and Genetic Circuits for Improved Strain Development

    DEFF Research Database (Denmark)

    Rugbjerg, Peter

    systems can challenge the stability of strain designs. A metabolite-­producing Escherichia coli strain was long-­term cultured to study production stability and the dynamic effects of mutations within the cell population. A genetic error landscape of pathway disruptions was identified including particular......, recurring error modes. Driven by a gain in fitness, these errors within 70 generations led to a transformation of the strain to a population of genetic non-­‐producer cells. Knowledge about these mechanisms and the applied simple mathematical model may likely serve to realizemore stable microbial cell......Development of new chemical-­‐producing microbial cell factories is an iterative trial-­and-­error process, and to screen candidate cells at high throughput, genetic biosensor systems are appealing. Each biosensor has distinct biological parameters, making modular tuning networks attractive...

  7. Effect of Magnetic Field on L-Strain Cells

    CERN Document Server

    Ulakoglu, G; Atak, C; Rzakoulieva, A; Danilov, V I; Alikamanoglu, S

    2000-01-01

    The effects of electromagnetic and magnetic fields are currently being made useful in many fields, especially in medicine. In this research work, L-Strain cells which are a type of fibrosarcoma cells were exposed to a magnetic flow of 2-26 mT in periods of 1, 2, 3 and 4 minutes. The L-Strain cells, which were exposed to the magnetic field for these periods, were counted after 24 and 48 hours, when compared with the controls, it was observed that in groups of 1 and 4 minutes exposure a significant decrease (P < 0.05) in the number of cells occurred. The per cent of labelling index of L-Strain cells exposed to the magnetic field for 1 and 4 minutes decreased significantly also in comparison to the controls.

  8. Prostatic adenocarcinoma (PCa metastasizing to renal cell carcinoma (RCC with periureteral tumor deposit: A case of tumor-to-tumor metastasis (TTM

    Directory of Open Access Journals (Sweden)

    Jenissa Amor Dionisio Arceño, MD

    2017-06-01

    Full Text Available Renal cell carcinoma (RCC and prostatic adenocarcinoma (PCa, occurring as a double primary is uncommon, but well documented. However, metastatic PCa in a RCC is quite rare. We report a case of an 81-year old male chemical engineer with history of hematuria and prostatomegaly suspicious for carcinoma, who underwent left radical nephrectomy for a renal mass. Histopathology revealed RCC that harbored an undiagnosed PCa. Periureteral tumor deposit likewise showed combined metastasis of RCC and PCa.

  9. Successful Salvage Chemotherapy with FOLFIRINOX for Recurrent Mixed Acinar Cell Carcinoma and Ductal Adenocarcinoma of the Pancreas in an Adolescent Patient

    Directory of Open Access Journals (Sweden)

    Sarah Pfrommer

    2013-09-01

    Full Text Available Pancreatic tumors are rare in children and adolescents. Here, we report the case of a 15-year-old boy who presented with a mixed acinar cell carcinoma/ductal adenocarcinoma with blastomatous components. He received multimodal treatment including various chemotherapy regimens and multistep surgery including liver transplantation. Introduction of FOLFIRINOX after relapse repeatedly achieved a durable metabolic and clinical response with good quality of life.

  10. Evaluating the Number of Stages in Development of Squamous Cell and Adenocarcinomas across Cancer Sites Using Human Population-Based Cancer Modeling

    OpenAIRE

    Julia Kravchenko; Igor Akushevich; Abernethy, Amy P; Kim Lyerly, H.

    2012-01-01

    BACKGROUND: Adenocarcinomas (ACs) and squamous cell carcinomas (SCCs) differ by clinical and molecular characteristics. We evaluated the characteristics of carcinogenesis by modeling the age patterns of incidence rates of ACs and SCCs of various organs to test whether these characteristics differed between cancer subtypes. METHODOLOGY/PRINCIPAL FINDINGS: Histotype-specific incidence rates of 14 ACs and 12 SCCs from the SEER Registry (1973-2003) were analyzed by fitting several biologically mo...

  11. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  12. Phospho-ERK1/2 levels in cancer cell nuclei predict responsiveness to radiochemotherapy of rectal adenocarcinoma

    DEFF Research Database (Denmark)

    Holck, Susanne; phw435, phw435; Pedersen, Niels

    2015-01-01

    Locally advanced rectal adenocarcinoma is treated with radiochemotherapy (RCT) before surgery. The response to RCT is heterogeneous and consensus regarding reliable predictors is lacking. Since the ERK pathway is implicated in radioprotection, we examined pretreatment biopsies from 52 patients...

  13. Metastatic appendiceal goblet cell carcinoid masquerading as mucinous adenocarcinoma in effusion cytology: A diagnostic pitfall

    Directory of Open Access Journals (Sweden)

    Anuja Gupta

    2013-01-01

    Full Text Available Goblet cell carcinoids are rare tumors of appendix having a mixed phenotype, with partial neuroendocrine differentiation and intestinal type goblet cell morphology. The reported incidence of this tumor is still limited. Till now, only two cases of metastatic goblet cell appendiceal carcinoid on effusion cytology have been reported in literature. We describe the clinico-pathological details and lay stress on fluid cytology of metastatic goblet cell carcinoid to ascitic fluid.

  14. Survey of radiosensitivity in a variety of human cell strains

    Energy Technology Data Exchange (ETDEWEB)

    Arlett, C.F.; Harcourt, S.A.

    1980-03-01

    Gamma-ray sensitivity for cell killing was assayed in 54 human cell strains, including some derived from individuals suffering from certain hereditary diseases. The overall range of Do values in this study was 38 to 180 rads, indicating a considerable range of variability in humans. The normal sensitivity was described by a range of Do values of 97 to 180 rads. All ten ataxia telangiectasia cell strains tested proved radiosensitive and gave a mean Do value of 57 +- 15 (S.E.) rads, and these represent the most radiosensitive human skin fibroblasts currently available. Representative cell strains from familial retinoblastoma, Fanconi's anemia, and Hutchinson-Gilford progeria occupied positions of intermediate sensitivity, as did one of two ataxia telangiectasia heterozygotes. Six xeroderma pigmentosum cell strains together with two Cockayne's syndrome cell strains (all known to be sensitive to ultraviolet light) fell into the normal range, indicating an absence of cross-sensitivity between ultraviolet light and gamma-irradiation.

  15. Fra-1 induces morphological transformation and increases in vitro invasiveness and motility of epithelioid adenocarcinoma cells

    DEFF Research Database (Denmark)

    Kustikova, O.; Kramerov, D.; Grigorian, M.

    1998-01-01

    Two cell lines originating from a common ancestral tumor, CSML0 and CSML100, were used as a model to study AP-1 transcription factors at different steps of tumor progression. CSML0 cells have an epithelial morphology; they express epithelial but not mesenchymal markers and are invasive neither...... component, namely, JunD, detected in both cell lines. We found that the enhanced level of AP-1 in CSML100 cells was due to high expression of Fra-1 and Fra-2 proteins, which were undetectable in CSML0 nuclear extracts. Analysis of the transcription of different AP-1 members in various cell lines derived...... from tumors of epithelial origin revealed a correlation of fra-1 expression with mesenchymal characteristics of carcinoma cells. Moreover, we show here for the first time that the expression of exogenous Fra-1 in epithelioid cells results in morphological changes that resemble fibroblastoid conversion...

  16. Cytological Study of Grade 3 Endometrioid Adenocarcinoma of Endometrial Origin: Cytoarchitecture and Features of Cell Clusters Assessed With Endometrial Brushing Cytology--Focusing on a comparison with endometrioid adenocarcinoma Grade 1, 2.

    Science.gov (United States)

    Matsui, Naruaki; Kajiwara, Hiroshi; Morishita, Akihiro; Tsukada, Hitomi; Nakazawa, Kazumi; Miyazawa, Masaki; Mikami, Mikio; Nakamura, Naoya; Sato, Shinkichi

    2015-06-20

    Aim of study was to clarify the cytological characteristics of grade 3 endometrioid adenocarcinoma of endometrial origin (G3 EA) by endometrial brushing cytology. The subjects were 11 patients in whom G3 EA was diagnosed by review of preoperative cytological specimens obtained at our hospital and related institutions between 2000 and 2010. These patients were investigated with respect to the preoperative cytological diagnosis, background changes, cell cluster patterns, and individual cellular findings. Background changes were classified as inflammatory or tumorous, while cell clusters were classified as overlapping cell cluster, sheet-like cell cluster, clump of high dense gland, papillary, or other cell cluster. Cellular findings were investigated by comparing the incidence of squamous and clear cell metaplasia, the nuclear rounding rate, and the nuclear area with the findings in a control group (35 patients with G1-2 EA). Background changes were classified as inflammatory in 63.6% and necrotic in 36.4%. The cell clusters were classified as overlapping cell cluster in 44.8%, cell cluster in 21.7%, clump of high dense gland in 10.0%, papillary in 4.0%, and other cell cluster in 19.5%. The incidence of squamous and clear cell metaplasia was 27.2% and 18.1%, respectively. The mean nuclear rounding rate was 0.97, and the mean nuclear area was 55.98 µm2. Investigation of the cytoarchitecture of G3 EA with endometrial brushing cytology revealed overlapping cell cluster and tumor cells of a relatively uniform size. These findings suggest that it is necessary to recognize that there are differences between the cytological findings of G3 EA and the usual features of G1-2 EA.

  17. CLCA2 as a Novel Immunohistochemical Marker for Differential Diagnosis of Squamous Cell Carcinoma from Adenocarcinoma of the Lung

    Directory of Open Access Journals (Sweden)

    Kazuya Shinmura

    2014-01-01

    Full Text Available Recent progress in targeted therapy for lung cancer has revealed that accurate differential diagnosis between squamous cell carcinoma (SCC and adenocarcinoma (ADC of the lung is essential. To identify a novel immunohistochemical marker useful for differential diagnosis between the two subtypes of lung cancer, we first selected 24 SCC-specific genes and 6 ADC-specific genes using data (case number, 980 from the Cancer Genome Atlas (TCGA database. Among the genes, we chose the CLCA2 gene, which is involved in chloride conductance and whose protein expression in lung cancer is yet to be characterized, and evaluated its protein expression status in 396 cases of primary lung cancer at Hamamatsu University Hospital. Immunohistochemical analysis revealed a significantly higher CLCA2 expression level in the SCCs than in the ADCs (P<0.0001 and also a significantly higher frequency of CLCA2 protein expression in the SCCs (104/161, 64.6% as compared with that in the ADCs (2/235, 0.9% (P<0.0001; sensitivity 64.6%, specificity 99.1%. The CLCA2 protein expression status was associated with the histological tumor grade in the SCCs. These results suggest that CLCA2 might be a novel excellent immunohistochemical marker for differentiating between primary SCC and primary ADC of the lung.

  18. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  19. The extracellular matrix and focal adhesion kinase signaling regulate cancer stem cell function in pancreatic ductal adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Asma Begum

    Full Text Available Cancer stem cells (CSCs play an important role in the clonogenic growth and metastasis of pancreatic ductal adenocarcinoma (PDAC. A hallmark of PDAC is the desmoplastic reaction, but the impact of the tumor microenvironment (TME on CSCs is unknown. In order to better understand the mechanisms, we examined the impact of extracellular matrix (ECM proteins on PDAC CSCs. We quantified the effect of ECM proteins, β1-integrin, and focal adhesion kinase (FAK on clonogenic PDAC growth and migration in vitro and tumor initiation, growth, and metastasis in vivo in nude mice using shRNA and overexpression constructs as well as small molecule FAK inhibitors. Type I collagen increased PDAC tumor initiating potential, self-renewal, and the frequency of CSCs through the activation of FAK. FAK overexpression increased tumor initiation, whereas a dominant negative FAK mutant or FAK kinase inhibitors reduced clonogenic PDAC growth in vitro and in vivo. Moreover, the FAK inhibitor VS-4718 extended the anti-tumor response to gemcitabine and nab-paclitaxel in patient-derived PDAC xenografts, and the loss of FAK expression limited metastatic dissemination of orthotopic xenografts. Type I collagen enhances PDAC CSCs, and both kinase-dependent and independent activities of FAK impact PDAC tumor initiation, self-renewal, and metastasis. The anti-tumor impact of FAK inhibitors in combination with standard chemotherapy support the clinical testing of this combination.

  20. A comparative Analysis by SAGE of Gene Expression Profiles of Esophageal Adenocarcinoma and Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Jantine W. P. M. van Baal

    2008-01-01

    Full Text Available Esophageal adenocarcinoma (EA and esophageal squamous cell carcinoma (ESCC are the two main types of esophageal cancer. Despite extensive research the exact molecular basis of these cancers is unclear. Therefore we evaluated the transcriptome of EA in comparison to non-dysplastic Barrett’s esophagus (BE, the metaplastic epithelium that predisposes for EA, and compared the transcriptome of ESCC to normal esophageal squamous epithelium. For obtaining the transcriptomes tissue biopsies were used and serial analysis of gene expression (SAGE was applied. Validation of results by RT-PCR and immunoblotting was performed using tissues of an additional 23 EA and ESCC patients. Over 58,000 tags were sequenced. Between EA and BE 1013, and between ESCC and normal squamous epithelium 1235 tags were significantly differentially expressed (p < 0.05. The most up-regulated genes in EA compared to BE were SRY-box 4 and Lipocalin2, whereas the most down-regulated genes in EA were Trefoil factors and Annexin A10. The most up-regulated genes in ESCC compared to normal squamous epithelium were BMP4, E-Cadherin and TFF3. The results could suggest that the BE expression profile is closer related to normal squamous esophagus then to EA. In addition, several uniquely expressed genes are identified.

  1. Differential role of gene hypermethylation in adenocarcinomas, squamous cell carcinomas and cervical intraepithelial lesions of the uterine cervix.

    Science.gov (United States)

    Blanco-Luquin, Idoia; Guarch, Rosa; Ojer, Amaya; Pérez-Janices, Noemí; Martín-Sánchez, Esperanza; Maria-Ruiz, Sergio; Monreal-Santesteban, Iñaki; Blanco-Fernandez, Laura; Pernaut-Leza, Eduardo; Escors, David; Guerrero-Setas, David

    2015-09-01

    Cervical cancer is the third most common cancer in women worldwide. The hypermethylation of P16, TSLC-1 and TSP-1 genes was analyzed in squamous cell carcinomas (SCC), cervical intraepithelial lesions (CIN) and adenocarcinomas (ADC) of the uterine cervix (total 181 lesions). Additionally human papillomavirus (HPV) type, EPB41L3, RASSF1 and RASSF2 hypermethylation were tested in ADC and the results were compared with those obtained previously by our group in SCC. P16, TSLC-1 and TSP-1 hypermethylation was more frequent in SCCs than in CINs. These percentages and the corresponding ones for EPB41L3, RASSF1 and RASSF2 genes were also higher in SCCs than in ADCs, except for P16. The presence of HPV in ADCs was lower than reported previously in SCC and CIN. Patients with RASSF1A hypermethylation showed significantly longer disease-free survival (P = 0.015) and overall survival periods (P = 0.009) in ADC patients. To our knowledge, this is the first description of the EPB41L3 and RASSF2 hypermethylation in ADCs. These results suggest that the involvement of DNA hypermethylation in cervical cancer varies depending on the histological type, which might contribute to explaining the different prognosis of patients with these types of tumors. © 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  2. Effects of fatty acids on benzo[a]pyrene uptake and metabolism in human lung adenocarcinoma A549 cells.

    Directory of Open Access Journals (Sweden)

    Rola Barhoumi

    Full Text Available Dietary supplementation with natural chemoprotective agents is receiving considerable attention because of health benefits and lack of toxicity. In recent in vivo and in vitro experimental studies, diets rich in n-3 polyunsaturated fatty acids have been shown to provide significant anti-tumor action. In this investigation, the effects of control fatty acids (oleic acid (OA, linoleic acid (LA and n-3 PUFA, e.g., docosahexaenoic acid (DHA on the uptake and metabolism of the carcinogenic polycyclic aromatic hydrocarbon, benzo[a]pyrene (BaP was investigated in A549 cells, a human adenocarcinoma alveolar basal epithelial cell line. A549 cells activate BaP through the cytochrome P450 enzyme system to form reactive metabolites, a few of which covalently bind to DNA and proteins. Therefore, multiphoton microscopy spectral analysis combined with linear unmixing was used to identify the parent compound and BaP metabolites formed in cells, in the presence and absence of fatty acids. The relative abundance of select metabolites was associated with altered P450 activity as determined using ethoxyresorufin-O-deethylase activity in cells cultured in the presence of BSA-conjugated fatty acids. In addition, the parent compound within cellular membranes increases significantly in the presence of each of the fatty acids, with the greatest accumulation observed following DHA treatment. DHA treated cells exhibit significantly lower pyrene-like metabolites indicative of lower adducts including DNA adducts compared to control BSA, OA or LA treated cells. Further, DHA reduced the abundance of the proximate carcinogen BaP 7,8-dihydrodiol and the 3-hydroxybenzo[a]pyrene metabolites compared to other treatments. The significant changes in BaP metabolites in DHA treated cells may be mediated by the effects on the physicochemical properties of the membrane known to affect enzyme activity related to phase I and phase II metabolism. In summary, DHA is a highly bioactive chemo

  3. Overexpression of miR-519d in lung adenocarcinoma inhibits cell proliferation and invasion via the association of eIF4H.

    Science.gov (United States)

    Bai, Yong; Lu, Chunya; Zhang, Guojun; Hou, Yu; Guo, Yanjie; Zhou, Heqi; Ma, Xiaojingnan; Zhao, Guoqiang

    2017-03-01

    Lung cancer is one of the deadliest types of cancer worldwide due to its high mortality rate. Adenocarcinoma constitutes 20%-30% of all lung cancers. In recent years, studies on the mechanisms of lung tumorigenesis and development have in part focused on the microRNAs for their crucial role in the progress of different cancers. As for our study, we demonstrated that miR-519d was differently downregulated and eIF4H was significantly overexpressed in lung adenocarcinoma via the detection of quantitative real-time polymerase chain reaction compared with the adjacent normal tissues. Furthermore, Cell Counting Kit-8 assay, colony formation assay, xenograft tumor experiment, Ki67 immunohistochemistry assay and transwell assay were performed to explain that the upregulated miR-519d could inhibit the proliferation and invasion of A549 and H1299 cells. To further advance our understanding of the mechanisms of miR-519d, we performed the bioinformatics analysis and the luciferase report assay. The results from these procedures revealed eIF4H to be one of the targets of miR-519d. Downregulated eIF4H was analogous to the overexpressed miR-519d obtained from miR-519d agomir and si-eIF4H transfection. In summary, it can be concluded that miR-519d targets eIF4H in lung adenocarcinoma to inhibit cell proliferation and invasion. This mechanism may offer new insights into the tumorigenesis and development of lung adenocarcinoma.

  4. Sulforaphane down-regulates SKP2 to stabilize p27(KIP1) for inducing antiproliferation in human colon adenocarcinoma cells.

    Science.gov (United States)

    Chung, Yuan-Kai; Chi-Hung Or, Richard; Lu, Chien-Hsing; Ouyang, Wei-Ting; Yang, Shu-Yi; Chang, Chia-Che

    2015-01-01

    Sulforaphane is a cruciferous vegetable-derived isothiocyanate with promising chemopreventive and therapeutic activities. Induction of proliferation arrest and apoptosis principally contribute to sulforaphane's anticancer activity, but the precise molecular mechanisms remain elusive. The oncoprotein SKP2 is a key component of the SKP1-CULLIN1-F-box (SCF) E3 ligase complex and is responsible for directing SCF-mediated degradation of cyclin-dependent kinase inhibitor p27(KIP1) to promote cell proliferation. We herein provide the first evidence supporting the critical involvement of the SKP2-p27(KIP1) axis in sulforaphane-induced antiproliferation in various human colon adenocarcinoma cell lines. Specifically, sulforaphane markedly suppressed the levels of bromodeoxyuridine (BrdU) incorporation and clonogenicity in all tested cell lines, illustrating the antiproliferative effect of sulforaphane. Of note, sulforaphane-induced antiproliferation was accompanied with down-regulation of SKP2, leading to the stabilization and thus up-regulation of p27(KIP1). Additionally, sulforaphane was found to down-regulate SKP2 mainly through transcriptional repression, as sulforaphane lowered SKP2 mRNA expression and the SKP2 promoter activity. Furthermore, sulforaphane treatment led to the activation of both AKT and ERK, thus ruling out the possibility that sulforaphane down-regulates SKP2 by inhibiting AKT or ERK. Notably, sulforaphane-elicited suppression of BrdU incorporation and clonogenicity were significantly rescued in the context of SKP2 overexpression or p27(KIP1) depletion, therefore highlighting the important role of SKP2 down-regulation and the ensuing stabilization of p27(KIP1) in sulforaphane-induced antiproliferation. Collectively, these data expand our molecular understanding about how sulforaphane elicits proliferation arrest, but also implicate the application of sulforaphane in therapeutic modalities targeting SKP2. Copyright © 2014 The Society for Biotechnology

  5. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells

    OpenAIRE

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-01-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF o...

  6. [Effect of RNA interference targeting HIF-1α gene on biological behavior of human esophageal squamous cell carcinoma and gastric adenocarcinoma cells in vitro].

    Science.gov (United States)

    Zeng, Kai-feng; Jin, Hai-lin; Zhang, Wei-feng; Xiao, Bin; Zhu, Hong; Hao, Bo; Shi, Rui-hua

    2011-04-01

    To investigate the effect of hypoxia inducible factor-1α (HIF-1α) on the proliferation, migration and vasculogenic mimicry(VM) in human esophageal squamous cell carcinoma cell line Eca-109 and gastric adenocarcinoma cell line SGC-7901 in vitro. The recombinant plasmid pGCsi-shHIF-1α was transfected into Eca-109 and SGC-7901 cells by Lipofectamine(TM) 2000. The inhibitory effect of HIF-1α was measured at protein level by Western blot under normoxia and hypoxia. The cell proliferation was detected by colony formation and MTT assays. The migration of transfected cells was assayed using Transwell chambers. Whether Eca-109 and SGC-7901 cells could form the capillary tube-like structures (TLSs) was observed by 3-dimensional culture, and the tube formation of transfected cells was detected by tube-like structure formation assay. The expression of HIF-1α protein in each group of transfected cells was significantly suppressed under normoxia and hypoxia (Eca-109: 0.00, 0.74 ± 0.05; 0.00, 1.11 ± 0.06; SGC-7901: 0.00, 0.60 ± 0.05; 0.00, 0.96 ± 0.07, P groups (104.7 ± 9.6, 151.7 ± 4.5; 88.3 ± 5.1, 128.3 ± 6.7, P Eca-109 and SGC-7901 cells could form TLSs when cultured on matrigel, and the number of tubules was significantly increased under hypoxia (30.8 ± 3.9, 34.3 ± 3.4; 26.2 ± 3.4, 30.1 ± 4.1, P groups was significantly inhibited under normoxia and hypoxia (Eca-109: 3.7 ± 2.8, 30.8 ± 3.9; 3.9 ± 2.7, 34.3 ± 3.4; SGC-7901: 4.9 ± 3.5, 26.2 ± 3.4; 5.3 ± 3.6, 30.1 ± 4.1, P Eca-109 and gastric adenocarcinoma cell line SGC-7901 are capable of forming vasculogenic mimicry structures in vitro. The recombinant plasmid pGCsi-shHIF-1α can efficiently suppress their proliferation, migration and vasculogenic mimicry formation.

  7. Genetic and Epigenetic Determinants of Lung Cancer Subtype: Adenocarcinoma to Small Cell Conversion

    Science.gov (United States)

    2016-10-01

    these objectives in mind , the specific aims of this grant are to comprehensively define the genomic sequence alterations (Aim 1) and epigenomic DNA...the Institutional Animal Care and Use Committee at Massachusetts General Hospital. Cell viability assays. Cell viability assays were carried out in a

  8. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells.

    Science.gov (United States)

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-03-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF on AGS cells was observed in a dose-dependent manner. Exposure to OHF (100 μg/mL) significantly induced (Pgenes associated with cell cycle progression (Cdk4, Cdk2, and cyclin E) was significantly downregulated (P<0.05) by the OHF treatment. Moreover, the expression of Bax and caspase-3 in OHF treated cells was higher (P<0.05) than in the control. These findings suggest that OHF induces the G1 phase cell cycle arrest and activation of mitochondria-mediated apoptosis pathway in AGS human gastric cancer cells.

  9. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seon Young; Jang, Soo Hwa [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of); Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su [Soongsil University, Department of Chemistry (Korea, Republic of); Lee, Kangtaek [Yonsei University, Department of Chemical and Biomolecular Engineering (Korea, Republic of); Yang, Sung Ik [Kyung Hee University, College of Environment and Applied Chemistry (Korea, Republic of); Joo, Sang-Woo, E-mail: sjoo@ssu.ac.kr [Soongsil University, Department of Chemistry (Korea, Republic of); Ryu, Pan Dong; Lee, So Yeong, E-mail: leeso@snu.ac.kr [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of)

    2012-12-15

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  10. Bax translocation into mitochondria during dihydroartemisinin(DHA)-induced apoptosis in human lung adenocarcinoma cells

    Science.gov (United States)

    Lu, Ying-ying; Chen, Tong-sheng; Qu, Jun-Le

    2009-02-01

    Dihydroartemisinin (DHA), a semi-synthetic derivative of artemisinin, isolated from the traditional Chinese herb Artemisia annua, has been shown to possess promising anticancer activities and induce cancer cell death through apoptotic pathways. However, the molecular mechanisms are not well understood. This study was investigated in human lung adenocarconoma ASTC-a-1 cell line and aimed to determine whether the apoptotic process was mediated by Bax activation and translocation during DHA-induced apoptosis. In this study, DHA induced a time-dependent apoptotic cell death, which was assayed by Cell Counting Kit (CCK-8) and Hoechst 33258 staining. Detection of Bax aggregation and translocation to mitochondria was observed in living cells which were co-transfected with GFP-Bax and Dsred-mito plasmid using confocal fluorescence microscope technique. Overall, these results demonstrated that Bax activation and translocation to mitochondria occurred during DHA-induced apoptosis.

  11. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    Science.gov (United States)

    Choi, Seon Young; Jang, Soo Hwa; Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su; Lee, Kangtaek; Yang, Sung Ik; Joo, Sang-Woo; Ryu, Pan Dong; Lee, So Yeong

    2012-12-01

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  12. Murine pancreatic adenocarcinoma reduces Ikaros expression and disrupts T cell homeostasis.

    Directory of Open Access Journals (Sweden)

    Nadine Nelson

    Full Text Available Maintenance of T cell immune homeostasis is critical for adequate anti-tumor immunity. The transcription factor Ikaros is essential for lymphocyte development including T cells. Alterations in Ikaros expression occur in blood malignancies in humans and mice. In this study, we investigated the role of Ikaros in regulating T cell immune balance in pancreatic cancer mouse models.Using our Panc02 tumor-bearing (TB mouse model, western blot analysis revealed a reduction in Ikaros proteins while qRT-PCR showed no differences in Ikaros mRNA levels in TB splenocytes compared to control. Treatment of naïve splenocytes with the proteasomal inhibitor, MG132, stabilized Ikaros expression and prevented Ikaros downregulation by Panc02 cells, in vitro. Western blot analyses showed a reduction in protein phosphatase 1 (PP1 and protein kinase CK2 expression in TB splenocytes while CK2 activity was increased. Immunofluorescence microscopy revealed altered punctate staining of Ikaros in TB splenocytes. Flow cytometry revealed a significant decrease in effector CD4+ and CD8+ T cell percentages but increased CD4+CD25+ regulatory T cells in TB splenocytes. Similar alterations in T cell percentages, as well as reduced Ikaros and CK2 but not PP1 expression, were observed in a transgenic, triple mutant (TrM pancreatic cancer model. Ikaros expression was also reduced in enriched TB CD3+ T cells. MG132 treatment of naïve CD3+ T cells stabilized Ikaros expression in the presence of Panc02 cells. Western blots showed reduced PP1 and CK2 expression in TB CD3+ T cells.The results of this study suggest that the pancreatic tumor microenvironment may cause proteasomal degradation of Ikaros, possibly via dysregulation of PP1 and CK2 expression and activity, respectively. This loss of Ikaros expression may contribute to an imbalance in T cell percentages. Ikaros may potentially be a therapeutic target to restore T cell homeostasis in pancreatic cancer hosts, which may be

  13. [Successful treatment of a patient with recurrent ovarian clear cell adenocarcinoma under combination chemotherapy of 5-FU (civ) and low-dose CDDP (i.v.)].

    Science.gov (United States)

    Sakaihara, M; Sakai, K; Hara, Y; Kataoka, S; Tabata, M; Hanatani, K; Hareyama, H

    2000-01-01

    Resistance to conventional chemotherapy including CDDP is the most important therapeutic problem in ovarian cancer. The combination chemotherapy of 5-FU (civ) and low-dose CDDP (i.v.) was applied to a patient with recurrent ovarian clear cell adenocarcinoma (stage IIa), which is often more resistant to systemic chemotherapy than other ovarian adenocarcinomas and is a poor prognostic factor. The patient underwent cytoreductive surgery. Then, 5-FU 375 mg/m2/day civ (days 1-5, 8-12, 15-19, 22-26) and CDDP 3.75 mg/m2/day i.v. (days 1-5, 8-12, 15-19, 22-26) were administered. After four courses of this treatment, there is no sign of recurrence. This result indicates that the combination of 5-FU and CDDP is useful in the treatment of recurrent ovarian cancers.

  14. Anticancer Effects of Sinulariolide-Conjugated Hyaluronan Nanoparticles on Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Kuan Yin Hsiao

    2016-03-01

    Full Text Available Lung cancer is one of the most clinically challenging malignant diseases worldwide. Sinulariolide (SNL, extracted from the farmed coral species Sinularia flexibilis, has been used for suppressing malignant cells. For developing anticancer therapeutic agents, we aimed to find an alternative for non-small cell lung cancer treatment by using SNL as the target drug. We investigated the SNL bioactivity on A549 lung cancer cells by conjugating SNL with hyaluronan nanoparticles to form HA/SNL aggregates by using a high-voltage electrostatic field system. SNL was toxic on A549 cells with an IC50 of 75 µg/mL. The anticancer effects of HA/SNL aggregates were assessed through cell viability assay, apoptosis assays, cell cycle analyses, and western blotting. The size of HA/SNL aggregates was approximately 33–77 nm in diameter with a thin continuous layer after aggregating numerous HA nanoparticles. Flow cytometric analysis revealed that the HA/SNL aggregate-induced apoptosis was more effective at a lower SNL dose of 25 µg/mL than pure SNL. Western blotting indicated that caspases-3, -8, and -9 and Bcl-xL and Bax played crucial roles in the apoptotic signal transduction pathway. In summary, HA/SNL aggregates exerted stronger anticancer effects on A549 cells than did pure SNL via mitochondria-related pathways.

  15. CytoregR inhibits growth and proliferation of human adenocarcinoma cells via induction of apoptosis

    Directory of Open Access Journals (Sweden)

    Hassanhi M

    2006-01-01

    Full Text Available Abstract Background Cancer is one of the devastating neovascular diseases that incapacitate so many people the world over. Recent reports from the National Cancer Institute indicate some significant gain therapy and cancer management as seen in the increase in the 5-year survival rate over the past two decades. Although near-perfect cure rate have been reported in the early-stage disease, these data reveal high recurrence rate and serious side effects including second malignancies and fatalities. Most of the currently used anticancer agents are only effective against proliferating cancer cells. Thus attention has been focused on potential anti-cancer agents capable of killing cancer cells independent of the cell cycle state, to ensure effective elimination of most cancer cells. The objective of this study was to test the chemosensitivity and potential mechanism of action of a novel cancer drug, CytoregR, in a panel of human cancer cells. Methods the study was performed using a series of bioassays including Trypan blue exclusion, MTS Growth inhibition, LDH-cytotoxicity, TUNEL-Terminal DNA fragmentation Apoptosis Assay, and the Caspase protease CPP32 activity assays. Results CytoregR induced significant dose- and time-dependent inhibition of growth in all the cells; with significant differences in chemosensitivity (P < 0.05 between the target cells becoming more apparent at 48 hr exposure. CytoregR showed no significant effect on normal cells relative to the tumor cells. Growth inhibition in all the cells was due to induction of apoptosis at lower concentrations of cytoregR (> 1:300. CytoregR-induced caspase protease-3 (CPP32 activation significantly and positively correlated with apoptosis induction and growth inhibition; thus implicating CPP32 as the principal death pathway in cytoregR-induced apoptosis. Conclusion CytoregR exerted a dose-and time-dependent growth inhibitory effect in all the target cells through induction of apoptosis via the

  16. Patterns of PD-L1 expression and CD8 T cell infiltration in gastric adenocarcinomas and associated immune stroma.

    Science.gov (United States)

    Thompson, Elizabeth D; Zahurak, Marianna; Murphy, Adrian; Cornish, Toby; Cuka, Nathan; Abdelfatah, Eihab; Yang, Stephen; Duncan, Mark; Ahuja, Nita; Taube, Janis M; Anders, Robert A; Kelly, Ronan J

    2017-05-01

    Recent data supports a significant role for immune checkpoint inhibitors in the treatment of solid tumours. Here, we evaluate gastric and gastro-oesophageal junction (G/GEJ) adenocarcinomas for their expression of programmed death-ligand 1 (PD-L1), infiltration by CD8+ T cells and the relationship of both factors to patient survival. Thirty-four resections of primary invasive G/GEJ were stained by immunohistochemistry for PD-L1 and CD8 and by DNA in situ hybridisation for Epstein-Barr virus (EBV). CD8+ T cell densities both within tumours and at the tumour-stromal interface were analysed using whole slide digital imaging. Patient survival was evaluated according to PD-L1 status and CD8 density. 12% of resections showed tumour cell membranous PD-L1 expression and 44% showed expression within the immune stroma. Two cases (6%) were EBV positive, with one showing membranous PD-L1 positivity. Increasing CD8+ densities both within tumours and immune stroma was associated with increasing percentage of tumour (p=0.027) and stromal (p=0.005) PD-L1 expression. Both tumour and immune stromal PD-L1 expression and high intratumoral or stromal CD8+ T cell density (>500/mm(2)) were associated with worse progression-free survival (PFS) and overall survival (OS). PD-L1 is expressed on both tumour cells and in the immune stroma across all stages and histologies of G/GEJ. Surprisingly, we demonstrate that increasing CD8 infiltration is correlated with impaired PFS and OS. Patients with higher CD8+ T cell densities also have higher PD-L1 expression, indicating an adaptive immune resistance mechanism may be occurring. Further characterisation of the G/GEJ immune microenvironment may highlight targets for immune-based therapy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  17. Increased numbers of Foxp3-positive regulatory T cells in gastritis, peptic ulcer and gastric adenocarcinoma.

    Science.gov (United States)

    Cheng, Hsin-Hung; Tseng, Guan-Ying; Yang, Hsiao-Bai; Wang, Hung-Jung; Lin, Hwai-Jeng; Wang, Wen-Ching

    2012-01-07

    To determine the number of regulatory T cells (Tregs) in gastric mucosa of patients with gastritis, peptic ulcers and gastric cancer. This study was a retrospective analysis of gastric antrum biopsy specimens from healthy controls (n = 22) and patients with gastritis (n = 30), peptic ulcer (n = 83), or gastric cancer (n = 32). Expression of CD4, CD25 and Foxp3 was determined by immunohistochemistry in three consecutive sections per sample. Compared with healthy controls, there was an increased number of CD25(+) and Foxp3(+) cells in patients with gastritis (P = 0.004 and P = 0.008), peptic ulcer (P acute inflammation, chronic inflammation, lymphoid follicle number, and Helicobacter pylori infection. The number of CD4(+), CD25(+) and Foxp3(+) cells, and the ratio of CD25(+)/CD4(+) and Foxp3(+)/CD4(+) cells, were negatively associated with intestinal metaplasia among gastritis (P gastritis and peptic ulcer groups.

  18. Proteomic inventory of "anchorless" proteins on the colon adenocarcinoma cell surface.

    NARCIS (Netherlands)

    Tjalsma, H.; Pluk, W.J.G.; Heuvel, L.P.W.J. van den; Peters, W.H.M.; Roelofs, R.H.W.M.; Swinkels, D.W.

    2006-01-01

    Surface proteins play important pathophysiological roles in health and disease, and accumulating proteomics-based studies suggest that several "non-membrane" proteins are sorted to the cell surface by unconventional mechanisms. Importantly, these proteins may comprise attractive therapeutic targets

  19. Urokinase plasminogen activator receptor on invasive cancer cells: A prognostic factor in distal gastric adenocarcinoma

    DEFF Research Database (Denmark)

    Alpizar, Warner Enrique Alpizar; Christensen, Ib Jarle; Santoni-Rugiu, Eric

    2012-01-01

    Gastric cancer is the second cancer causing death worldwide. The five-year survival for this malignancy is below 25% and few parameters have shown an impact on the prognosis of the disease. The receptor for urokinase plasminogen activator (uPAR) is involved in extracellular matrix degradation...... by mediating cell surface associated plasminogen activation, and its presence on gastric cancer cells is linked to micrometastasis and poor prognosis. Using immunohistochemistry, the prognostic significance of uPAR was evaluated in tissue samples from a retrospective series of 95 gastric cancer patients. u...... association between the expression of uPAR on tumor cells in the peripheral invasion zone and overall survival of gastric cancer patients (HR = 2.16; 95% CI: 1.13-4.14; p = 0.02). Multivariate analysis showed that uPAR immunoreactivity in cancer cells at the invasive front is an independent prognostic factor...

  20. A comparison study of pancreatic acinar cell carcinoma with ductal adenocarcinoma using computed tomography in Chinese patients

    Directory of Open Access Journals (Sweden)

    Wang Q

    2016-09-01

    Full Text Available Qingbing Wang,1,2 Xiaolin Wang,1,2 Rongfang Guo,2,3 Guoping Li1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Department of Radiology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China Abstract: Pancreatic acinar cell carcinoma (ACC is a rare tumor that is difficult to diagnose preoperatively. The aim of this study was to evaluate and describe the computed tomography (CT features of ACC and compare the results with pancreatic ductal adenocarcinoma (DAC for improving preoperative diagnosis. The control group consisted of 34 patients with DAC collected from the pathology electronic database. The CT imaging from nine patients with pathologically confirmed ACC was retrospectively reviewed. Two radiologists independently assessed the tumor location, size, texture, and enhancement patterns. We found that 64.3% (9/14 of ACC tumors were homogeneous and 35.7% (5/14 had necrosis. The percentage of common bile duct and pancreatic ductal dilation was 14.3% (2/14 and 7.1% (1/14, respectively. The mean size of ACC was 50.1±24.2 mm. The mean attenuation of ACC was 35.4±3.9 Hounsfield unit (HU before enhancement, 73.1±42.9 HU in arterial phase, and 71.8±15.6 HU in port venous phase. It is difficult to distinguish ACC from DAC preoperatively only based on CT findings. However, compared with DAC, we found that ACC tumors are likely to be larger and contain more heterogeneous intratumoral necrotic hypovascular regions, and less pancreatic ductal and common biliary dilation. Keywords: acinar cell carcinoma, computed tomography, pancreatic ductal carcinoma, pancreas

  1. [Effects of AS1411 on the apoptosis of taxol-resistant lung adenocarcinoma A549 cell].

    Science.gov (United States)

    Zhou, Wei; Zhao, Zitong; Liu, Lingyan; Zhan, Qimin; Song, Yongmei

    2014-05-13

    To explore the effects of AS1411 on the apoptosis of taxol-resistant lung adenocarinoma A549 cell (A549/T cell). A549/T cells were treated with AS1411 at a concentration gradient of 0-20.0 µmol/L. The assays of methyl tolyl sulfide (MTS) and colony formation were used to detect the cellular vitality (absorbance value (A490 nm)) and proliferation. The apoptotic effects were detected by flow cytometer and the relevant apoptotic signaling proteins detected by Western blot. A549/T cells exhibited some characteristics of epithelial mesenchymal transition (EMT) and a negative expression of epidermal growth factor receptor (EGFR). After a treatment of 5.0 µmol/L AS1411, compared to the control sequence, cell vitality was inhibited (A490 nm: 0.185 ± 0.009 vs 0.272 ± 0.006, P AS1411 concentration, A549/T cells vitality decreased in a dose-dependent manner. After a 48-hour treatment of 20.0 µmol/L AS1411, the ratio of apoptosis ((19.9 ± 2.6)%) had significant difference (P = 0.002) with the control sequence group ((8.8 ± 1.3)%). Compared to the control sequence group, the expressions of protein kinase B (AKT), extracellular regulated protein kinases 1/2 (ERK1/2) and B-cell lymphoma 2 (Bcl-2) protein declined (0.353 ± 0.003, 0.432 ± 0.015, 0.294 ± 0.015 vs 0.688 ± 0.003, 0.911 ± 0.019, 0.422 ± 0.018, all P AS1411 may induce the apoptosis of A549/T cells through inhibiting the AKT-ERK pathways.

  2. Primary clear cell ductal adenocarcinoma of the pancreas: A case report and clinicopathologic literature review

    Directory of Open Access Journals (Sweden)

    Yashpal Modi

    2014-01-01

    Full Text Available We present a very rare, interesting case of a carcinoma of the pancreas with predominantly abundant clear cell morphology. According to the WHO classification, primary clear cell carcinoma of the pancreas is classified as a rare "miscellaneous" carcinoma. The tumor was observed in the distal body and tail of the pancreas of a 74-year-old woman. The histopathology of tumor cells showed well-defined cell membranes, clear cytoplasm, and prominent cell boundaries. Immunohistochemical (IHC staining showed positive reactions to antibodies against vimentin, cytokeratin 7 (CK-7, mucicarmine (MUC-1, periodic acid-Schiff (PAS, periodic acid-Schiff with diastase (PASD, carcinoembryonic antigen (CEA, and Carbohydrate Antigen 19-9 (CA 19-9. On the other hand, IHC staining was negative for alpha-fetoprotein (AFP, cytokeratin 20 (CK-20, HMB45, chromogranin, and synaptophysin. The patient was subsequently diagnosed with a primary solid-type pancreatic clear cell carcinoma with hepatic metastasis. Herein, we report this rare case and include a review of the current literature of this tumor.

  3. Curcuminoids and ω-3 fatty acids with anti-oxidants potentiate cytotoxicity of natural killer cells against pancreatic ductal adenocarcinoma cells and inhibit interferon γ production

    Directory of Open Access Journals (Sweden)

    Milan eFiala

    2015-05-01

    Full Text Available Pancreatic cancer has a poor prognosis attributed in part to immune suppression and deactivation of natural killer (NK cells. Curcuminoids have a potential for improving the therapy of pancreatic cancer given promising results in cancer models and a clinical trial, but their oral absorption is limited. Our objective in this study is to show curcuminoid anti-oncogenic effects alone and together with human NK cells. We tested curcuminoids in an emulsion of ω-3 fatty acids and anti-oxidants (Smartfish regarding their direct cytocidal effect and enhancement of the cytocidal activity of NK cells in pancreatic ductal adenocarcinoma (PDAC cells (Mia Paca 2 and L3.6. Curcuminoids (at > 10 microM with ω-3 fatty acids and anti-oxidants or with the lipidic mediator resolvin D1 (RvD1 (26 nM induced high caspase-3 activity in PDAC cells. Importantly, curcuminoids with ω-3 fatty acids and anti-oxidants or with RvD1 significantly potentiated NK cell cytocidal function and protected them against degradation. In a co-culture of cancer cells with NK cells, interferon-γ ( IFN-γ production by NK cells was not altered by ω-3 fatty acids with anti-oxidants or by RvD1 but was inhibited by curcuminoids. The inhibition was not eliminated by ω-3 fatty acids or RvD1 but was relieved by removing curcuminoids after adding NK cells. In conclusion, curcuminoids with ω-3 fatty acids and anti-oxidants or with RvD1 have increased cytotoxic activity on PDAC cells alone and with NK cells. The effects of curcuminoids with ω-3 fatty acids and anti-oxidants on pancreatic cancer will be investigated in a mouse model with humanized immune system.

  4. Epithelial cell adhesion molecule aptamer functionalized PLGA-lecithin-curcumin-PEG nanoparticles for targeted drug delivery to human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Li, Lei; Xiang, Dongxi; Shigdar, Sarah; Yang, Wenrong; Li, Qiong; Lin, Jia; Liu, Kexin; Duan, Wei

    2014-01-01

    To improve the efficacy of drug delivery, active targeted nanotechnology-based drug delivery systems are gaining considerable attention as they have the potential to reduce side effects, minimize toxicity, and improve efficacy of anticancer treatment. In this work CUR-NPs (curcumin-loaded lipid-polymer-lecithin hybrid nanoparticles) were synthesized and functionalized with ribonucleic acid (RNA) Aptamers (Apts) against epithelial cell adhesion molecule (EpCAM) for targeted delivery to colorectal adenocarcinoma cells. These CUR-encapsulated bioconjugates (Apt-CUR-NPs) were characterized for particle size, zeta potential, drug encapsulation, stability, and release. The in vitro specific cell binding, cellular uptake, and cytotoxicity of Apt-CUR-NPs were also studied. The Apt-CUR-NP bioconjugates exhibited increased binding to HT29 colon cancer cells and enhancement in cellular uptake when compared to CUR-NPs functionalized with a control Apt (Pcells with Apt-CUR-NP bioconjugates. The encapsulation of CUR in Apt-CUR-NPs resulted in the increased bioavailability of delivered CUR over a period of 24 hours compared to that of free CUR in vivo. These results show that the EpCAM Apt-functionalized CUR-NPs enhance the targeting and drug delivery of CUR to colorectal cancer cells. Further development of CUR-encapsulated, nanosized carriers will lead to improved targeted delivery of novel chemotherapeutic agents to colorectal cancer cells.

  5. An increased expression of long non-coding RNA PANDAR promotes cell proliferation and inhibits cell apoptosis in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Jiang, Yuehong; Feng, Enhang; Sun, Lifang; Jin, Wei; You, Yuhong; Yao, Yue; Xu, Yi

    2017-11-01

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive malignancies worldwide. Emerging evidence indicates that aberrantly expressed long non-coding RNAs (lncRNAs) act as imperative roles in tumorigenesis and progression. PANDAR (promoter of CDKN1A antisense DNA damage activated RNA) is a novel lncRNA that contributes to the development of various cancers. However, its clinical significance and potential effects on PDAC remains unknown. In the present study, qRT-PCR was performed to explore the expression levels of PANDAR in PDAC tissues and corresponding non-tumor tissues, the correlation between PANDAR expression and clinicopathological characteristics was also analyzed. The functional roles of lncRNA PANDAR in PDAC cells were evaluated both in vitro and in vivo. The results indicated that PANDAR was aberrantly overexpressed in PDAC tissues and cell lines, and this overexpression was closely associated with tumor stage and vascular invasion in PDAC patients. Besides, silencing of PANDAR exerted tumor suppressive effect via reducing cell proliferation, colony-forming ability, inducing cell cycle G0/G1 arrest and apoptosis in PANC1 and Capan-2 cells. Further in vivo study confirmed the oncogenesis role of PANDAR in PDAC cells. Overall, our findings may help to develop a potential therapeutic target for the patients with PDAC. Copyright © 2017. Published by Elsevier Masson SAS.

  6. [To evaluate the clinicopathologic characteristics and outcome of tumor cells spreading through air spaces in patients with adenocarcinoma of lung].

    Science.gov (United States)

    Sun, P L; Liu, J N; Cao, L Q; Yao, M; Gao, H W

    2017-05-08

    Objective: To investigate the clinicopathologic features, molecular characteristics and prognosis of spread through air space (STAS) in patients with adenocarcinoma of the lung. Methods: Two hundred and eighty-eight lung adenocarcinoma patients with complete clinicopathologic and follow-up data were included. The patients were divided into STAS positive (178 cases) and negative (110 cases) groups.EGFR and KRAS gene mutations were detected by amplification refractory mutation system (ARMS), and ALK and ROS1 gene fusion were detected by fluorescence in situ hybridization method. The relationship between STAS and clinicopathologic, molecular features, and patient outcome was analyzed. Results: STAS was present in 61.8%(178/288) of lung adenocarcinomas. The positive rate of STAS in tumors >3 cm was significantly higher than that in tumors ≤3 cm (P=0.009), and was significantly higher in tumors with pleural invasion (Padenocarcinomas, respectively. In addition, the positive rates of STAS in tumor with micropapillary (>5%) and without micropapillary pattern were 80.9%(55/68) and 55.9%(123/220), respectively (Plung adenocarcinoma patients (HR: 2.749, 95%CI: 1.550-4.876, P=0.001). Conclusions: The presence of STAS in lung adenocarcinoma suggests high risk of recurrence and invasion and is thus an important prognostic factor. In addition, STAS is associated with EGFR mutation, ALK and ROS1 gene rearrangement.

  7. Binase Immobilized on Halloysite Nanotubes Exerts Enhanced Cytotoxicity toward Human Colon Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Vera Khodzhaeva

    2017-09-01

    Full Text Available Many ribonucleases (RNases are considered as promising tools for antitumor therapy because of their selective cytotoxicity toward cancer cells. Binase, the RNase from Bacillus pumilus, triggers apoptotic response in cancer cells expressing RAS oncogene which is mutated in a large percentage of prevalent and deadly malignancies including colorectal cancer. The specific antitumor effect of binase toward RAS-transformed cells is due to its direct binding of RAS protein and inhibition of downstream signaling. However, the delivery of proteins to the intestine is complicated by their degradation in the digestive tract and subsequent loss of therapeutic activity. Therefore, the search of new systems for effective delivery of therapeutic proteins is an actual task. This study is aimed to the investigation of antitumor effect of binase immobilized on natural halloysite nanotubes (HNTs. Here, we have developed the method of binase immobilization on HNTs and optimized the conditions for the enzyme loading and release (i; we have found the non-toxic concentration of pure HNTs which allows to distinguish HNTs- and binase-induced cytotoxic effects (ii; using dark-field and fluorescent microscopy we have proved the absorption of binase-loaded HNTs on the cell surface (iii and demonstrated that binase-halloysite nanoformulations possessed twice enhanced cytotoxicity toward tumor colon cells as compared to the cytotoxicity of binase itself (iv. The enhanced antitumor activity of biocompatible binase-HNTs complex confirms the advisability of its future development for clinical practice.

  8. Monocarboxylate transporters MCT1 and MCT4 regulate migration and invasion of pancreatic ductal adenocarcinoma cells

    DEFF Research Database (Denmark)

    Kong, Su Chii; Nøhr-Nielsen, Asbjørn; Zeeberg, Katrine

    2016-01-01

    and MCT4 (messenger RNA, protein) were robustly expressed in all PDAC lines, localizing to the plasma membrane. Lactate influx capacity was highest in AsPC-1 cells and lowest in HPDE cells and was inhibited by the MCT inhibitor α-cyano-4-hydroxycinnamate (4-CIN), MCT1/MCT2 inhibitor AR-C155858......, or knockdown of MCT1 or MCT4. PDAC cell migration was largely unaffected by MCT1/MCT2 inhibition or MCT1 knockdown but was reduced by 4-CIN and by MCT4 knockdown (BxPC-3). Invasion measured in Boyden chamber (BxPC-3, Panc-1) and spheroid outgrowth (BxPC-3) assays was attenuated by 4-CIN and AR-C155858...

  9. Therapeutic potential of antiviral drugs targeting chemorefractory colorectal adenocarcinoma cells overexpressing endogenous retroviral elements.

    Science.gov (United States)

    Díaz-Carballo, David; Acikelli, Ali Haydar; Klein, Jacqueline; Jastrow, Holger; Dammann, Philipp; Wyganowski, Thomas; Guemues, Cihan; Gustmann, Sebastian; Bardenheuer, Walter; Malak, Sascha; Tefett, Nora Sophia; Khosrawipour, Veria; Giger-Pabst, Urs; Tannapfel, Andrea; Strumberg, Dirk

    2015-08-12

    Endoretroviruses account for circa 8 % of all transposable elements found in the genome of humans and other animals. They represent a genetic footprint of ancestral germ-cell infections of exoviruses that is transmittable to the progeny by Mendelian segregation. Traces of human endogenous retroviruses are physiologically expressed in ovarial, testicular and placental tissues as well as in stem cells. In addition, a number of these fossil viral elements have also been related to carcinogenesis. However, a relation between endoretroviruses expression and chemoresistance has not been reported yet. Twenty colorectal carcinoma patient samples were scrutinized for HERV-WE1 and HERV-FRD1 endoretroviruses using immunohistochemical approaches. In order to search for differential expression of these elements in chemotherapy refractory cells, a resistant HCT8 colon carcinoma subline was developed by serial etoposide exposure. Endoretroviral elements were detected by immunocytochemical staining, qPCR and ELISA. IC50-values of antiviral and cytostatic drugs in HCT8 cells were determined by MTT proliferation assay. The antivirals-cytostatics interaction was evaluated by the isobologram method. In this work, we show for the first time that HERV-WE1, HERV-FRD1, HERV-31, and HERV-V1 are a) simultaneously expressed in treatment-naïve colon carcinoma cells and b) upregulated after cytostatic exposure, suggesting that these retroviral elements are intimately related to chemotherapy resistance. We found a number of antiviral drugs to have cytotoxic activity and the ability to force the downregulation of HERV proteins in vitro. We also demonstrate that the use of different antiviral compounds alone or in combination with anticancer agents results in a synergistic antiproliferative effect and downregulation of different endoretroviral elements in highly chemotherapy-resistant colorectal tumor cells. Enhanced HERV-expression is associated with chemoresistance in colon carcinomas which

  10. MicroRNA-1254 inhibits the migration of colon adenocarcinoma cells by targeting PSMD10.

    Science.gov (United States)

    Chu, Yi Min; Peng, Hai Xia; Xu, Ying; Yang, Da Ming; Zhou, Feng Li; Li, Ji; Kuai, Rong; Lin, Yong

    2017-03-01

    MicroRNA-1254 (miR-1254) has not been studied in colorectal cancer (CRC) to date. This study aimed to investigate the inhibitory mechanism of miR-1254 in CRC tumorigenesis. MiR-1254 expression was examined using real-time polymerase chain reaction in CRC and adjacent non-tumorous tissues. The correlation between miR-1254 expressions and proliferation and migration of cancer cells was determined using the CCK-8 and transwell assays. RNA sequencing was used to identify differentially expressed genes downstream from miR-1254. A luciferase reporter assay was used to confirm the direct interaction between miR-1254 and its predicted target gene, PSMD10. Moreover, PSMD10 was either overexpressed or silenced in colon carcinoma cells overexpressing miR-1254 to determine whether their interaction contributed to CRC migration and epithelial-mesenchymal transition (EMT). Significantly lower miR-1254 expressions were observed in CRC tissues than in adjacent non-tumorous tissues. Exogenous miR-1254 expression suppressed the migration of colon carcinoma cell lines SW1116 and HCT116. RNA sequencing and luciferase assays revealed that miR-1254 directly binded to the 3'-untranslated region of PSMD10, an important regulator of EMT and cell migration. PSMD10 knockdown inhibited EMT and colon cancer cell migration, whereas PSMD10 overexpression reversed the inhibition of EMT and cell migration caused by miR-1254. MiR-1254 may act as a tumor suppressor in CRC and may inhibit CRC migration by directly targeting PSMD10 to suppress the EMT process. © 2017 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

  11. Integrins are not essential for entry of coxsackievirus A9 into SW480 human colon adenocarcinoma cells.

    Science.gov (United States)

    Heikkilä, Outi; Merilahti, Pirjo; Hakanen, Marika; Karelehto, Eveliina; Alanko, Jonna; Sukki, Maria; Kiljunen, Saija; Susi, Petri

    2016-10-18

    Coxsackievirus A9 (CV-A9) is a pathogenic enterovirus type within the family Picornaviridae. CV-A9 infects A549 human epithelial lung carcinoma cells by attaching to the αVβ6 integrin receptor through a highly conserved Arg-Gly-Asp (RGD) motif, which is located at the exposed carboxy-terminus of the capsid protein VP1 detected in all studied clinical isolates. However, genetically-modified CV-A9 that lacks the RGD motif (CV-A9-RGDdel) has been shown to be infectious in some cell lines but not in A549, suggesting that RGD-mediated integrin binding is not always essential for efficient entry of CV-A9. Two cell lines, A549 and SW480, were used in the study. SW480 was the study object for the integrin-independent entry and A549 was used as the control for integrin-dependent entry. Receptor levels were quantitated by cell sorting and quantitative PCR. Antibody blocking assay and siRNA silencing of receptor-encoding genes were used to block virus infection. Peptide phage display library was used to identify peptide binders to CV-A9. Immunofluorescence and confocal microscopy were used to visualize the virus infection in the cells. We investigated the receptor use and early stages of CV-A9 internalization to SW480 human epithelial colon adenocarcinoma cells. Contrary to A549 infection, we showed that both CV-A9 and CV-A9-RGDdel internalized into SW480 cells and that function-blocking anti-αV integrin antibodies had no effect on the binding and entry of CV-A9. Whereas siRNA silencing of β6 integrin subunit had no influence on virus infection in SW480, silencing of β2-microglobulin (β2M) inhibited the virus infection in both cell lines. By using a peptide phage display screening, the virus-binding peptide identical to the N-terminal sequence of HSPA5 protein was identified and shown to block the virus infection in both A549 and SW480 cell lines. HSPA5 was also found to co-localize with CV-A9 at the SW480 cell periphery during the early stages of infection by confocal

  12. Stretching of red blood cells at high strain rates

    Science.gov (United States)

    Mancuso, J. E.; Ristenpart, W. D.

    2017-10-01

    Most work on the mechanical behavior of red blood cells (RBCs) in flow has focused on simple shear flows. Relatively little work has examined RBC deformations in the physiologically important extensional flow that occurs at the entrance to a constriction. In particular, previous work suggests that RBCs rapidly stretch out and then retract upon entering the constriction, but to date no model predicts this behavior for the extremely high strain rates typically experienced there. In this Rapid Communication, we use high speed video to perform systematic measurements of the dynamic stretching behavior of RBCs as they enter a microfluidic constriction. We demonstrate that both the Kelvin-Voigt and Skalak viscoelastic models capture the observed stretching dynamics, up to strain rates as high as 2000 s-1. The results indicate that the effective elastic modulus of the RBC membrane at these strain rates is an order of magnitude larger than moduli measured by micropipette aspiration or other low strain rate techniques.

  13. DAG/PKCδ and IP3/Ca2+/CaMK IIβ Operate in Parallel to Each Other in PLCγ1-Driven Cell Proliferation and Migration of Human Gastric Adenocarcinoma Cells, through Akt/mTOR/S6 Pathway

    Science.gov (United States)

    Dai, Lianzhi; Zhuang, Luhua; Zhang, Bingchang; Wang, Fen; Chen, Xiaolei; Xia, Chun; Zhang, Bing

    2015-01-01

    Phosphoinositide specific phospholipase Cγ (PLCγ) activates diacylglycerol (DAG)/protein kinase C (PKC) and inositol 1,4,5-trisphosphate (IP3)/Ca2+/calmodulin-dependent protein kinase II (CaMK II) axes to regulate import events in some cancer cells, including gastric adenocarcinoma cells. However, whether DAG/PKCδ and IP3/Ca2+/CaMK IIβ axes are simultaneously involved in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells and the underlying mechanism are not elucidated. Here, we investigated the role of DAG/PKCδ or CaMK IIβ in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells, using the BGC-823 cell line. The results indicated that the inhibition of PKCδ and CaMK IIβ could block cell proliferation and migration of BGC-823 cells as well as the effect of inhibiting PLCγ1, including the decrease of cell viability, the increase of apoptotic index, the down-regulation of matrix metalloproteinase (MMP) 9 expression level, and the decrease of cell migration rate. Both DAG/PKCδ and CaMK IIβ triggered protein kinase B (Akt)/mammalian target of rapamycin (mTOR)/S6 pathway to regulate protein synthesis. The data indicate that DAG/PKCδ and IP3/Ca2+/CaMK IIβ operate in parallel to each other in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells through Akt/mTOR/S6 pathway, with important implication for validating PLCγ1 as a molecular biomarker in early gastric cancer diagnosis and disease surveillance. PMID:26633375

  14. DAG/PKCδ and IP3/Ca2+/CaMK IIβ Operate in Parallel to Each Other in PLCγ1-Driven Cell Proliferation and Migration of Human Gastric Adenocarcinoma Cells, through Akt/mTOR/S6 Pathway

    Directory of Open Access Journals (Sweden)

    Lianzhi Dai

    2015-12-01

    Full Text Available Phosphoinositide specific phospholipase Cγ (PLCγ activates diacylglycerol (DAG/protein kinase C (PKC and inositol 1,4,5-trisphosphate (IP3/Ca2+/calmodulin-dependent protein kinase II (CaMK II axes to regulate import events in some cancer cells, including gastric adenocarcinoma cells. However, whether DAG/PKCδ and IP3/Ca2+/CaMK IIβ axes are simultaneously involved in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells and the underlying mechanism are not elucidated. Here, we investigated the role of DAG/PKCδ or CaMK IIβ in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells, using the BGC-823 cell line. The results indicated that the inhibition of PKCδ and CaMK IIβ could block cell proliferation and migration of BGC-823 cells as well as the effect of inhibiting PLCγ1, including the decrease of cell viability, the increase of apoptotic index, the down-regulation of matrix metalloproteinase (MMP 9 expression level, and the decrease of cell migration rate. Both DAG/PKCδ and CaMK IIβ triggered protein kinase B (Akt/mammalian target of rapamycin (mTOR/S6 pathway to regulate protein synthesis. The data indicate that DAG/PKCδ and IP3/Ca2+/CaMK IIβ operate in parallel to each other in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells through Akt/mTOR/S6 pathway, with important implication for validating PLCγ1 as a molecular biomarker in early gastric cancer diagnosis and disease surveillance.

  15. Curcumin promotes apoptosis in A549/DDP multidrug-resistant human lung adenocarcinoma cells through an miRNA signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jian, E-mail: zhangjian197011@yahoo.com [Department of Respiratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Zhang, Tao [Department of Thoracic Surgery, Tangdu Hospital, The Fourth Military Medical University, Xi' an 710038 (China); Ti, Xinyu; Shi, Jieran; Wu, Changgui; Ren, Xinling [Department of Respiratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Yin, Hong, E-mail: yinnhong@yahoo.com [The Medical Image Center, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China)

    2010-08-13

    Research highlights: {yields} Curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells {yields} Curcumin promotes apoptosis in A549/DDP cells through a miRNA signaling pathway {yields} Curcumin induces A549/DDP cell apoptosis by downregulating miR-186* {yields} miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin -- Abstract: Curcumin extracted from the rhizomes of Curcuma longa L. has been shown to have inhibitory effects on cancers through its anti-proliferative and pro-apoptotic activities. Emerging evidence demonstrates that curcumin can overcome drug resistance to classical chemotherapies. Thus, the mechanisms underlying the anti-tumor activities of curcumin require further study. In our study, we first demonstrated that curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells. Further studies showed that curcumin altered miRNA expression; in particular, significantly downregulated the expression of miR-186* in A549/DDP. In addition, transfection of cells with a miR-186* inhibitor promoted A549/DDP apoptosis, and overexpression of miR-186* significantly inhibited curcumin-induced apoptosis in A549/DDP cells. These observations suggest that miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin.

  16. Increased numbers of Foxp3-positive regulatory T cells in gastritis, peptic ulcer and gastric adenocarcinoma

    Science.gov (United States)

    Cheng, Hsin-Hung; Tseng, Guan-Ying; Yang, Hsiao-Bai; Wang, Hung-Jung; Lin, Hwai-Jeng; Wang, Wen-Ching

    2012-01-01

    AIM: To determine the number of regulatory T cells (Tregs) in gastric mucosa of patients with gastritis, peptic ulcers and gastric cancer. METHODS: This study was a retrospective analysis of gastric antrum biopsy specimens from healthy controls (n = 22) and patients with gastritis (n = 30), peptic ulcer (n = 83), or gastric cancer (n = 32). Expression of CD4, CD25 and Foxp3 was determined by immunohistochemistry in three consecutive sections per sample. RESULTS: Compared with healthy controls, there was an increased number of CD25+ and Foxp3+ cells in patients with gastritis (P = 0.004 and P = 0.008), peptic ulcer (P gastritis (P gastritis and peptic ulcer groups. PMID:22228968

  17. C4.4A as a biomarker in pulmonary adenocarcinoma and squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Kriegbaum, Mette Camilla; Santoni-Rugiu, Eric

    2014-01-01

    The high prevalence and mortality of lung cancer, together with a poor 5-year survival of only approximately 15%, emphasize the need for prognostic and predictive factors to improve patient treatment. C4.4A, a member of the Ly6/uPAR family of membrane proteins, qualifies as such a potential...... informative biomarker in non-small cell lung cancer. Under normal physiological conditions, it is primarily expressed in suprabasal layers of stratified squamous epithelia. Consequently, it is absent from healthy bronchial and alveolar tissue, but nevertheless appears at early stages in the progression...... to invasive carcinomas of the lung, i.e., in bronchial hyperplasia/metaplasia and atypical adenomatous hyperplasia. In the stages leading to pulmonary squamous cell carcinoma, expression is sustained in dysplasia, carcinoma in situ and invasive carcinomas, and this pertains to the normal presence of C4.4A...

  18. Photodynamic therapy using methylene blue in lung adenocarcinoma xenograft and hamster cheek pouch induced squamous cell carcinoma.

    Science.gov (United States)

    Obstoy, Bérengère; Salaun, Mathieu; Bohn, Pierre; Veresezan, Liana; Sesboué, Richard; Thiberville, Luc

    2016-09-01

    Photodynamic therapy (PDT) is used to treat early proximal bronchial cancer during a flexible bronchoscopy. The technique relies on the excitation of a photosensitizer by an appropriate wavelength, which is delivered into the bronchus in close contact with the tumor. To assess methylene blue (MB) as a PDT agent for the treatment of respiratory tract cancer in animal models. MB-induced PDT was performed on 7 subcutaneous NCI-H460 lung adenocarcinoma xenografts in nude mice and 9 induced squamous cell cancer in the hamster cheek pouch model. In mice, PDT was carried out on right-sided tumors after intratumoral injection of methylene blue 1% (w/v) and illumination at 630nm at 200J/cm (Diomed PDT 630), with the left tumor used as control (illumination alone or MB alone). The tumoral volume was assessed before and 15 days after PDT. Fourteen xenografts were treated in mice, including seven treated with MB-PDT, producing a 52% mean tumor volume regression (1568mm(3)vs. 544mm(3)) compared to seven control cases in which tumor volume increased (p=0.007; Mann-Whitney test). Nine cheek pouch induced carcinomas were treated in the hamster group, with a mean volume decrease of 85.8% (from 44.8% to 100%) (initial mean volume=210mm(3)vs. post PDT mean volume=97mm(3)). Histology analysis showed 4/9 complete responses. Intratumoral MB appears efficient as PDT agent for cancer treatment in animal models. Further studies are needed to assess the safety and efficacy of MB-associated PDT for the treatment of lung cancer in humans. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  19. The Effects of Interfering COX-2 Gene Expression on Malignant Proliferation of Human Lung Adenocarcinoma A2 Cell in vitro

    Directory of Open Access Journals (Sweden)

    Weiying LI

    2009-02-01

    Full Text Available Background and objective COX-2 was highly expressed in many tumor tissues and was involved in the initiation and development of tumors. The RNAi technique is a method to inhibit gene expression economically, quickly, efficiently and specifically. This study used RNAi technique to explore the interfering effect of COX-2 geneexpression and the influence on the malignant proliferation of A2 cells after quenching COX-2 in vitro . Methods Three COX-2 siRNA expression vectors with human U6 promoter were constructed. The COX-2 siRNA vectors and the vacant vector (pEGFP were transfected into A2 cells with lipofectamine respectively. The cell strains transfected were selected. The change of COX-2 expression levels was examined by Western blot and RT-PCR. The effects on the proliferationof A2 cells after silencing COX-2 were detected by cell growth curve and clonogenic assay in vitro . Results The three siRNA and U6 promoter cloned into pEGFP plasmid were validated by PCR, restriction endonucleases identification, DNA sequencing and BLAST alignment. The cell strains transfected were coded as A2-3, A2-7, A2-10 and A2-p respectively. Green fluorescence was seen in A2-p cells and not in A2-3, A2-7 and A2-10 cells in 24 h, 48 h and 72 hafter transfected. The results of RT-PCR and Western blot showed the three siRNA expression vectors acted effectively and the expression of COX-2 was inhibited in different extent. In contrast to A2 cells, COX-2 mRNA levels of A2-3, A2-7 and A2-10 cells were reduced 15.6%, 20.4% and 64.2% respectively, and COX-2 protein expressions of them were reduced 23.7%, 36.7% and 60.2% respectively. The results of cell growth curve and clonogenic assay showed the growth of A2-10 cell slowed and the clonal formation rate was reduced. However the growth of A2-3 and A2-7 cells had no obvious changes vs controls (A2 and A2-p. Conclusion Silencing COX-2 gene in vitro by RNAi technique can significantly inhibit the malignant proliferation of A2

  20. MicroRNA alterations in Barrett′s esophagus, esophageal adenocarcinoma, and esophageal adenocarcinoma cell lines following cranberry extract treatment: Insights for chemoprevention

    Directory of Open Access Journals (Sweden)

    Laura A Kresty

    2011-01-01

    Full Text Available Background: Aberrant expression of small noncoding endogenous RNA molecules known as microRNAs (miRNAs is documented to occur in multiple cancer types including esophageal adencarcinoma (EAC and its only known precursor, Barrett′s esophagus (BE. Recent studies have linked dysregulation of specific miRNAs to histological grade, neoplastic progression and metastatic potential. Materials and Methods: Herein, we present a summary of previously reported dysregulated miRNAs in BE and EAC tissues as well as EAC cell lines and evaluate a cranberry proanthocyanidin rich extract′s (C-PAC ability to modulate miRNA expression patterns of three human EAC cell lines (JHEso-Ad-1, OE33 and OE19. Results: A review of 13 published studies revealed dysregulation of 87 miRNAs in BE and EAC tissues, whereas 52 miRNAs have been reported to be altered in BE or EAC cell lines, with 48% overlap with miRNA changes reported in tissues. We report for the first time C-PAC-induced modulation of five miRNAs in three EAC cell lines resulting in 26 validated gene targets and identification of key signaling pathways including p53, angiogenesis, T-cell activation and apoptosis. Additionally, mutiple cancer related networks were ideintified as modulated by C-PAC utilizing Kyoto Encyclopedia of Genes and Genomes (KEGG, Protein Analysis Through Evolutionary Relationships (PANTHER, and MetaCore analysis tools. Conclusions: Study results support the cancer inhibitory potential of C-PAC is in part attributable to C-PAC′s ability to modify miRNA profiles within EAC cells. A number of C-PAC-modulated miRNAs have been been identified as dysregulated in BE and EAC. Further insights into miRNA dysregulation and modulation by select cancer preventive agents will support improved targeted interventions in high-risk cohorts.

  1. Change from lung adenocarcinoma to small cell lung cancer as a mechanism of resistance to afatinib.

    Science.gov (United States)

    Manca, Paolo; Russano, Marco; Pantano, Francesco; Tonini, Giuseppe; Santini, Daniele

    2017-08-29

    We report the case of a patient affected by advanced EGFR mutation-positive lung who experienced resistance to therapy during treatment with Afatinib through the occurrence of a switch of tumor histotype to small cell lung cancer (SCLC) with features of a G3 neuroendocrine carcinoma. Unexpectedly, the switch to SCLC histotype occurred in the only site not responsive to afatinib and subsequently the most responsive to chemotherapy. Our case shows that occurrence of switch to SCLC is a possible mechanism of resistance during treatment with Afatinib.

  2. Drug exposure in a metastatic human lung adenocarcinoma cell line gives rise to cells with differing adhesion, proliferation, and gene expression: Implications for cancer chemotherapy.

    Science.gov (United States)

    Li, Huiling; He, Jianxing; Zhong, Nanshan; Hoffman, Robert M

    2015-09-01

    The Am1010 cell line was previously established from a metastatic deposit in an arm muscle from a patient with lung adenocarcinoma who had undergone four cycles of chemotherapy with cisplatin and taxol. Am1010 cells were labeled with red fluorescent protein or green fluorescent protein. A total of eight sublines were isolated following in vitro exposure to cisplatin or taxol. The sublines differed with regard to their adhesion and proliferation properties, with certain sublines exhibiting an increased proliferation rate and/or decreased surface adhesion. Gene expression assays demonstrated that tenascin C; cyclin D1; collagen, type 1, α2; integrin α1; related RAS viral (r‑ras) oncogene homolog 2; platelet‑derived growth factor C; and Src homolog 2 domain containing in the focal adhesion pathway, and intercellular adhesion molecule 1, F11 receptor, claudin 7 and cadherin 1 in the cell adhesion pathway, varied in expression among the sublines. The results of the present study suggested that drug exposure may alter the aggressiveness and metastatic potential of cancer cells, which has important implications for cancer chemotherapy.

  3. Cell Surface-associated Proteins of Gastrointestinal Strains of Lactobacilli

    OpenAIRE

    Chagnaud, P.; Jenkinson, H. F.; Tannock, G. W.

    2011-01-01

    Twenty-eight strains of gastrointestinal lactobacilli, comprising isolates classified as Lactobacillus reuteri, L. acidophilus, L. delbrueckii, L. fermentum, L. gasseri and L. salivarius, were examined for the presence of cell-surface polypeptides. Whole cells were radioactively labelled with 125I using lactoperoxidase or chloramine T as catalyst, proteins were extracted with sodium dodecyl sulphate (SDS) and separated by SDS-polyacrylamide gel electrophoresis. All lactobacilli tested had bet...

  4. Effects of proton beam irradiation on mitochondrial biogenesis in a human colorectal adenocarcinoma cell line.

    Science.gov (United States)

    Ha, Byung Geun; Jung, Sung Suk; Shon, Yun Hee

    2017-09-01

    Proton beam therapy has recently been used to improve local control of tumor growth and reduce side-effects by decreasing the global dose to normal tissue. However, the regulatory mechanisms underlying the physiological role of proton beam radiation are not well understood, and many studies are still being conducted regarding these mechanisms. To determine the effects of proton beams on mitochondrial biogenesis, we investigated: mitochondrial DNA (mtDNA) mass; the gene expression of mitochondrial transcription factors, functional regulators, and dynamic-related regulators; and the phosphorylation of the signaling molecules that participate in mitochondrial biogenesis. Both the mtDNA/nuclear DNA (nDNA) ratio and the mitochondria staining assays showed that proton beam irradiation increases mitochondrial biogenesis in 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced aggressive HT-29 cells. Simultaneously, proton beam irradiation increases the gene expression of the mitochondrial transcription factors PGC-1α, NRF1, ERRα, and mtTFA, the dynamic regulators DRP1, OPA1, TIMM44, and TOM40, and the functional regulators CytC, ATP5B and CPT1-α. Furthermore, proton beam irradiation increases the phosphorylation of AMPK, an important molecule involved in mitochondrial biogenesis that is an energy sensor and is regulated by the AMP/ATP ratio. Based on these findings, we suggest that proton beam irradiation inhibits metastatic potential by increasing mitochondrial biogenesis and function in TPA-induced aggressive HT-29 cells.

  5. Hopping between Differentiation States in Lung Adenocarcinoma

    OpenAIRE

    Watanabe, Hideo; Meyerson, Matthew

    2013-01-01

    The work by Cheung et al., published in this issue of Cancer Cell, demonstrates another example of how lineage-specific transcriptional regulators of differentiation, GATA6 and HOPX, can control the fate of lung adenocarcinoma progression.

  6. [Intestinal linitis plastica: late metastasis from gastric signet ring cell adenocarcinoma].

    Science.gov (United States)

    Rodríguez Ortega, María; Carabias Hernández, Alberto; Rodríguez Barbero, José María; Garaulet González, Paloma; Limones Esteban, Manuel

    2006-09-01

    Linitis plastica is a malignant disease that usually occurs in the stomach, although it can affect any segment of the alimentary tract. Typically, this entity shows slow progression and insidious clinical course. We present the case of a patient with a previous diagnosis of signet ring cell cancer of the stomach that had been treated with curative intent 12 years before the clinical onset of small and large bowel linitis plastica. The diagnosis was obtained as an incidental pathological finding after urgent surgery for intestinal obstruction. No gastric mass was found. Linitis plastica should be considered in the differential diagnosis of patients with symptoms of obstruction after resection of a gastric carcinoma, especially if there are macroscopic surgical findings of circumferential narrowing. A long interval after diagnosis and treatment of the primary disease does not allow malignancy to be ruled out.

  7. Antiproliferative activity of New Zealand propolis and phenolic compounds vs human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Catchpole, Owen; Mitchell, Kevin; Bloor, Stephen; Davis, Paul; Suddes, Amanda

    2015-10-01

    New Zealand propolis is a "European" type propolis obtained by honey bees mainly from exudates of poplar. European type propolis is known to have anti-inflammatory and anti-cancer properties and this activity has been attributed to some of the main constituents such as chrysin and CAPE (caffeic acid phenethyl ester). As part of our studies on how New Zealand propolis might benefit gastro-intestinal health, we carried out in vitro bioactivity-guided fractionation of "Bio30™" propolis using both anti-inflammatory (TNF-α, COX-1, COX-2) and anti-colon cancer (DLD-1 colon cancer cell viability) assays; and determined the phenolic compounds responsible for the activity. The New Zealand wax-free Bio30™ propolis tincture solids had very high levels of the dihydroflavonoids pinocembrin and pinobanksin-3-O-acetate, and high levels of the dimethylallyl, benzyl and 3-methyl-3-butenyl caffeates relative to CAPE. The DLD-1 assays identified strong anti-proliferative activity associated with these components as well as chrysin, galangin and CAPE and a number of lesser known or lower concentration compounds including benzyl ferulate, benzyl isoferulate, pinostrobin, 5-phenylpenta-2,4-dienoic acid and tectochrysin. The phenolic compounds pinocembrin, pinobanksin-3-O-acetate, tectochrysin, dimethylallyl caffeate, 3-methyl-3-butenyl caffeate, benzyl ferulate and benzyl isoferulate also showed good broad spectrum activity in anti-proliferative assays against three other gastro-intestinal cancer cell lines; HCT-116 colon carcinoma, KYSE-30 oesophageal squamous cancer, and NCI-N87 gastric carcinoma. Activity is also observed in anti-inflammatory assays although it appears to be limited to one of the first cytokines in the inflammatory cascade, TNF-α. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Upregulation of Yes-associated protein and transcriptional co-activator with PDZ-binding motif influences the behavior of LOVO human colon adenocarcinoma cells.

    Science.gov (United States)

    Li, Yu; Li, Lan; Zhu, Min; Ye, Limin; Yang, Qian

    2017-10-01

    The present study aimed to investigate the role of Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) in the LOVO human colon adenocarcinoma cell line and explore the underlying mechanisms. First, the expression levels of YAP and TAZ were detected in LOVO cells using reverse-transcription quantitative PCR, and the results suggested that YAP and TAZ were faintly expressed in LOVO cells. To investigate the exact role of YAP and TAZ in LOVO cells, stable YAP- and/or TAZ-overexpressing LOVO cell lines were established using YAP and/or TAZ expression plasmids. An MTT assay and flow cytometry were used to assess cell proliferation and apoptosis, respectively. The results indicated that compared with the control, YAP or TAZ overexpression significantly increased the proliferation ability of LOVO cells, while apoptosis was significantly decreased. Furthermore, the expression of the tumor-associated proteins connective tissue growth factor and cysteine-rich angiogenic inducer 61, which have critical roles in facilitating cancer cell proliferation, migration and invasion, were found to be upregulated following upregulation of YAP and TAZ. In addition, the expression of cell apoptosis-associated protein B-cell lymphoma 2 (Bcl-2) was significantly increased, while Bcl-2-associated X protein and caspase-3 were inhibited by YAP or TAZ overexpression. All of these effects were amplified when YAP and TAZ were co-overexpressed. In conclusion, YAP and TAZ function as tumor promoters in human colon carcinoma, and upregulation of YAP and TAZ influences the behavior of LOVO colon adenocarcinoma cells via regulating tumor-associated gene expression.

  9. Synergistic antitumor activity of pro-apoptotic agent PAC-1 with cisplatinum by the activation of CASP3 in pulmonary adenocarcinoma cell line H1299.

    Science.gov (United States)

    Huang, Jian-qing; Liang, Hong-ling; Zhang, Xu-chao; Xie, Zhi; Jin, Tian-en

    2016-03-01

    Evasion of apoptosis is a hallmark of human cancer cells. We sought to explore the potential synergistic antitumor activity and underlying mechanisms of the pro-apoptotic agent PAC-1 plus cisplatinum (Cis) in non-small cell lung cancer (NSCLC) cell lines. The adenocarcinoma cell lines H1299, A549, PC9, H1650 and H1975 were used as in vitro models. Colorimetric MTT assays, Western blotting and flow cytometry were used to evaluate the anti-growth effects of PAC-1 and/or Cis and apoptosis status. The activated form of CASP3 (C-CASP3) was assessed by immunofluorescent staining. Single-agent Cis and PAC-1 were able to inhibit the cancer cell growth in certain dose ranges, with IC50 values of 1.9-11.7 and 5.6-14.8 μM, respectively. Sequential Cis→PAC-1 or concurrent Cis + PAC-1, but not PAC-1→Cis combinations showed synergistic effects on cell growth inhibition in H1299 cells (combination index, CI ≤ 0.6). In contrast, other combination modes mostly showed seemingly antagonistic effects (CI > 1.0). Flow cytometric analysis showed that Cis→PAC-1 sequential combination showed strong pro-apoptotic effects in H1299 cells. Western blots showed that in H1299, PC9 and H1975 cells, PAC-1 promoted the C-CASP3, but only in H1299 cells was there a synergistic effect with Cis on the CASP3 activation. PAC-1 showed anti-tumor activity in NSCLCs in vitro and a synergistic effect with cisplatin in EGFR(wt)KRAS(wt) H1299 cells. Our data suggest a potential treatment approach using cisplatin plus a pro-apoptotic agent acting via CASP3 activation for this subgroup of pulmonary adenocarcinomas. © 2015 The Authors. Asia-Pacific Journal of Clinical Oncology Published by Wiley Publishing Asia Pty Ltd.

  10. MicroRNA-650 was a prognostic factor in human lung adenocarcinoma and confers the docetaxel chemoresistance of lung adenocarcinoma cells via regulating Bcl-2/Bax expression.

    Directory of Open Access Journals (Sweden)

    Jia-Yuan Huang

    Full Text Available Increasing evidence shows that dysregulation of microRNAs (miRNAs is involved in malignant transformation. We investigated the clinical significance of miR-650 and its involvement in chemoresistance to docetaxel. Our results showed that the relative expression level of miR-650 was significantly higher in LAD tissues than in corresponding nontumor tissues and high level of miR-650 expression was found to be significantly associated with high incidence of lymph node metastasis, advanced clinical stage and poor prognosis of LAD patients. Univariate and multivariate analyses indicated that high miR-650 expression was an independent prognostic factor for survival. Also, we found that the level of miR-650 in LAD tissues was correlated with the response of patients to docetaxel-based chemotherapy. Silencing of miR-650 could increase the in vitro sensitivity of docetaxel-resistant LAD cells to docetaxel, while upregulation of miR-650 decreased the sensitivity of parental LAD cells to docetaxel both in vitro and in vivo. Additionally, silencing of miR-650 could enhance the caspase-3-dependent apoptosis, which might be correlated with the decreased ratio of Bcl-2/Bax. Further researches suggested that inhibitor of growth 4 (ING4 was a direct target of miR-650. Downregulated or upregulated ING4 expression could partially rescue the effects of miR-650 inhibitor or mimics in docetaxel-resistant or parental LAD cells. Furthermore, we found that ING4 was upregulated in docetaxel-responding LAD tissues, and its expression was inversely correlated with miR-650. Thus, miR-650 is a novel prognostic marker in LAD and its expression is a potential indicator of chemosensitivity to docetaxel-based chemotherapy regimen.

  11. In vitro and in vivo antitumour effects of phenylboronic acid against mouse mammary adenocarcinoma 4T1 and squamous carcinoma SCCVII cells.

    Science.gov (United States)

    Marasovic, Maja; Ivankovic, Sinisa; Stojkovic, Ranko; Djermic, Damir; Galic, Borivoj; Milos, Mladen

    2017-12-01

    The cytotoxic activity of phenylboroxine acid was evaluated in vitro on mouse mammary adenocarcinoma 4T1, mouse squamous cell carcinoma SCCVII, hamster lung fibroblast V79 and mouse dermal fibroblasts L929 cell lines. The cytotoxic effects were dose dependent for all tested tumour and non-tumour cell lines. Under in vivo conditions, three application routes of phenylboronic acid were studied: intra-peritoneal (i.p.), intra-tumour (i.t.) and per-oral. After tumour transplantation in syngeneic mice, phenylboronic acid was shown to slow the growth of both tumour cell lines (4T1 and SCCVII) compared with the control. The inhibitory effects were pronounced during the application of phenylboronic acid. For both tested tumour cell lines, the most prominent antitumour effect was obtained by intraperitoneal administration, followed significantly by oral administration.

  12. Neferine augments therapeutic efficacy of cisplatin through ROS- mediated non-canonical autophagy in human lung adenocarcinoma (A549 cells).

    Science.gov (United States)

    Kalai Selvi, Sivalingam; Vinoth, Amirthalingam; Varadharajan, Thiyagarajan; Weng, Ching Feng; Vijaya Padma, Viswanadha

    2017-05-01

    Combination of dietary components with chemotherapy drugs is an emerging new strategy for cancer therapy to increase antitumor responses. Neferine, major bisbenzylisoquinoline alkaloid isolated from the seed embryo of Nelumbo nucifera (Lotus). In the present study, we investigated the efficacy of the combinatorial regimen of neferine and cisplatin compared to cisplatin high dose in human lung adenocarcinoma (A549) cells. Co-treatment with neferine enhanced cisplatin-induced autophagy in A549 cells was accompanied by Acidic vesicular accumulation (AVO), enhanced generation of reactive oxygen species (ROS) and depletion of intracellular glutathione (GSH), down regulation of PI3K/AKT/mTOR pathway, conversion of LC3B-I to LC3B-II. This enhanced autophagy developed via a non-canonical mechanism that did not require Beclin-1, PI3KCIII. In conclusion, these results suggest that neferine enhances cisplatin -induced autophagic cancer cell death through downregulation of PI3K/Akt/mTOR signaling pro-survival pathway and ROS- mediated Beclin-1 and PI3K CIII independent autophagy in human lung adenocarcinoma (A549 cells). Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Invasion of Porphyromonas gingivalis strains into vascular cells and tissue

    Directory of Open Access Journals (Sweden)

    Ingar Olsen

    2015-08-01

    Full Text Available Porphyromonas gingivalis is considered a major pathogen in adult periodontitis and is also associated with multiple systemic diseases, for example, cardiovascular diseases. One of its most important virulence factors is invasion of host cells. The invasion process includes attachment, entry/internalization, trafficking, persistence, and exit. The present review discusses these processes related to P. gingivalis in cardiovascular cells and tissue. Although most P. gingivalis strains invade, the invasion capacity of strains and the mechanisms of invasion including intracellular trafficking among them differ. This is consistent with the fact that there are significant differences in the pathogenicity of P. gingivalis strains. P. gingivalis invasion mechanisms are also dependent on types of host cells. Although much is known about the invasion process of P. gingivalis, we still have little knowledge of its exit mechanisms. Nevertheless, it is intriguing that P. gingivalis can remain viable in human cardiovascular cells and atherosclerotic plaque and later exit and re-enter previously uninfected host cells.

  14. Natural Escherichia coli strains undergo cell-to-cell plasmid transformation.

    Science.gov (United States)

    Matsumoto, Akiko; Sekoguchi, Ayuka; Imai, Junko; Kondo, Kumiko; Shibata, Yuka; Maeda, Sumio

    2016-12-02

    Horizontal gene transfer is a strong tool that allows bacteria to adapt to various environments. Although three conventional mechanisms of horizontal gene transfer (transformation, transduction, and conjugation) are well known, new variations of these mechanisms have also been observed. We recently reported that DNase-sensitive cell-to-cell transfer of nonconjugative plasmids occurs between laboratory strains of Escherichia coli in co-culture. We termed this phenomenon "cell-to-cell transformation." In this report, we found that several combinations of Escherichia coli collection of reference (ECOR) strains, which were co-cultured in liquid media, resulted in DNase-sensitive cell-to-cell transfer of antibiotic resistance genes. Plasmid isolation of these new transformants demonstrated cell-to-cell plasmid transfer between the ECOR strains. Natural transformation experiments, using a combination of purified plasmid DNA and the same ECOR strains, revealed that cell-to-cell transformation occurs much more frequently than natural transformation under the same culture conditions. Thus, cell-to-cell transformation is both unique and effective. In conclusion, this study is the first to demonstrate cell-to-cell plasmid transformation in natural E. coli strains. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Establishment of an experimental human lung adenocarcinoma cell line SPC-A-1BM with high bone metastases potency by {sup 99m}Tc-MDP bone scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yang Shunfang [Department of Nuclear Medicine, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China)], E-mail: yzyg@sh163.net; Dong Qianggang [Laboratory of Mol-diagnosis, Shanghai Cancer Institute of Shanghai Jiaotong University, Shanghai 200032 (China); Yao Ming [Laboratory of Pathology, Shanghai Cancer Institute of Shanghai Jiaotong University, Shanghai 200032 (China); Shi Meiping [Department of Pathology, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Ye Jianding [Department of Radiology, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Zhao Langxiang [Department of Pathology, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Su Jianzhong; Gu Weiyong [Shanghai Thoracic Tumor Institute, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Xie Wenhui [Department of Nuclear Medicine, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Wang Kankan; Du Yanzhi [State Key Laboratory of Medical Genomics, Ruijin Hospital of Shanghai Jiaotong University, Shanghai 200025 (China); Li Yao [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433 (China); Huang Yan [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433 (China)], E-mail: huangyan@fudan.edu.cn

    2009-04-15

    Background: Bone metastasis is one of the most common clinical phenomena of late stage lung cancer. A major impediment to understanding the pathogenesis of bone metastasis has been the lack of an appropriate animal and cell model. This study aims to establish human lung adenocarcinoma cell line with highly bone metastases potency with {sup 99m}Tc-MDP bone scintigraphy. Methods: The human lung adenocarcinoma cancer cells SPC-A-1 were injected into the left cardiac ventricle of NIH-Beige-Nude-XID (NIH-BNX) immunodeficient mice. The metastatic lesions of tumor-bearing mice were imaged with {sup 99m}Tc-MDP bone scintigraphy on a Siemens multi-single photon emission computed tomography. Pinhole images were acquired on a GZ-B conventional gamma camera with a self-designed pinhole collimator. The mice with bone metastasis were sacrificed under deep anesthesia, and the lesions were resected. Bone metastatic cancer cells in the resected lesions were subjected for culture and then reinoculated into the NIH-BNX mice through left cardiac ventricle. The process was repeated for eight cycles to obtain a novel cell subline SPC-A-1BM. Real-time polymerase chain reaction (PCR) was used to compare the gene expression differences in the parental and SPC-A-1BM cells. Results: The bone metastasis sites were successfully revealed by bone scintigraphy. The established bone metastasis cell line SPC-A-1BM had a high potential to metastasize in bone, including mandible, humerus, thoracic vertebra, lumbar, femur, patella, ilium and cartilage rib. The expression level of vascular endothelial growth factor gene family, Bcl-2 and cell adhesion-related genes ECM1, ESM1, AF1Q, SERPINE2 and FN1 were examined. Gene expression difference was found between parental and bone-seeking metastasis cell SPC-A-1BM, which indicates SPC-A-1BM has metastatic capacity vs. its parental cells. Conclusion: SPC-A-1BM is a bone-seeking metastasis human lung adenocarcinoma cell line. Bone scintigraphy may be used as

  16. [Clinical Assessment of Chemosensitivity Test in Xeno-free Culture of Autologous 
Malignant Effusion Cells from Patients with Advanced Lung Adenocarcinoma].

    Science.gov (United States)

    Chen, Liang; Yang, Shunfang; Jiang, Jinqi; Zhang, Ying; Feng, Hui; Cao, Jie; Ge, Xinyue; Xie, Wenhui

    2016-09-20

    A great individual differences to chemotherapeutic effects existed in the patient with advanced lung cancer. How to choose the optimum regimens to achieve the individuation and maximum effect of chemotherapy for lung cancer is worth exploring. The study was designed to examine the effect of ex vitro chemo-sensitivity assay in xeno-free culture of autologous malignant effusion cells from patients with advanced lung adenocarcinoma. The 50 treatment-naive patients with lung adenocarcinoma complicated with malignant pleural or pericardial effusions were enrolled. Effusions of all cases had been controlled by closed drainage and 300 mL-500 mL of which were retained under sterile condition from 25 cases (Chemo-sensitivity group). Primary malignant effusion cells were isolated from autologous effusions of the patients. Then, xeno-free culture (average 11 days) were intervened with 8 chemotherapeutic drugs commonly used in clinical practice and were determined by CCK-8 assay. Optimum regimens were selected for chemotherapy based on the results of chemosensitivity test. As a contrast, chemotherapy regimens for the other 25 patients (Control group) were on the basis of physician's clinical experience. After four cycles of chemotherapy, in Chemo-sensitivity group, 17 (68.0%) cases were determined for partial response (PR), 5 (20.0%) cases for stable disease (SD), and the objective response rate (ORR) was 68.0%, the disease control rate (DCR) was 88.0%. Meanwhile, in Control group, 9 (36.0%) cases were determined for PR, 7 (28.0%) cases for SD, and, the ORR was 36.0%, the DCR was 64.0%. There were significant differences between the two groups in ORR and DCR (Pfree survival (PFS) in Chemo-sensitivity group and Control group respectively were 10.0 months and 5.8 months, and the mean overall survival (OS) in the two groups were 30.2 months and 21.2 months respectively. There were also significant differences between the two groups in PFS and OS (Pfree culture of autologous

  17. Orthopoxvirus species and strain differences in cell entry.

    Science.gov (United States)

    Bengali, Zain; Satheshkumar, P S; Moss, Bernard

    2012-11-25

    Vaccinia virus (VACV) enters cells by a low pH endosomal route or by direct fusion with the plasma membrane. We previously found differences in entry properties of several VACV strains: entry of WR was enhanced by low pH, reduced by bafilomycin A1 and relatively unaffected by heparin, whereas entry of IHD-J, Copenhagen and Elstree were oppositely affected. Since binding and entry modes may have been selected by specific conditions of in vitro propagation, we now examined the properties of three distinct, recently isolated cowpox viruses and a monkeypox virus as well as additional VACV and cowpox virus strains. The recent isolates were more similar to WR than to other VACV strains, underscoring the biological importance of endosomal entry by orthopoxviruses. Sequence comparisons, gene deletions and gene swapping experiments indicated that viral determinants, other than or in addition to the A26 and A25 "fusion-suppressor" proteins, impact entry properties. Published by Elsevier Inc.

  18. Orthopoxvirus species and strain differences in cell entry

    Energy Technology Data Exchange (ETDEWEB)

    Bengali, Zain; Satheshkumar, P.S. [Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-3210 (United States); Moss, Bernard, E-mail: bmoss@nih.gov [Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-3210 (United States)

    2012-11-25

    Vaccinia virus (VACV) enters cells by a low pH endosomal route or by direct fusion with the plasma membrane. We previously found differences in entry properties of several VACV strains: entry of WR was enhanced by low pH, reduced by bafilomycin A1 and relatively unaffected by heparin, whereas entry of IHD-J, Copenhagen and Elstree were oppositely affected. Since binding and entry modes may have been selected by specific conditions of in vitro propagation, we now examined the properties of three distinct, recently isolated cowpox viruses and a monkeypox virus as well as additional VACV and cowpox virus strains. The recent isolates were more similar to WR than to other VACV strains, underscoring the biological importance of endosomal entry by orthopoxviruses. Sequence comparisons, gene deletions and gene swapping experiments indicated that viral determinants, other than or in addition to the A26 and A25 'fusion-suppressor' proteins, impact entry properties.

  19. Comparative proteome analysis of three mouse lung adenocarcinoma CMT cell lines with different metastatic potential by two-dimensional gel electrophoresis and mass spectrometry

    DEFF Research Database (Denmark)

    Zhang, Kelan; Wrzesinski, Krzysztof; Stephen, J Fey

    2008-01-01

    Metastasis is a lethal attribute of a cancer and presents a continuing therapeutic challenge. Metastasis is a highly complex process and more knowledge about the mechanisms behind metastasis is highly desirable. Isogenic CMT cell lines were selected from a spontaneous mouse lung adenocarcinoma...... to be significantly up- or down-regulated between cell lines with different metastatic potential at passages 5 and 15, respectively. These proteins were identified by MS and most of them have previously been reported to be related to cancer development and/or metastasis. Bioinformatics analysis indicated that several...... of the proteins were involved in proteasome, cell-cycle and cell-communication pathways. Among them, some keratins, 14-3-3 proteins and 26S proteasome proteins were identified and their aberrant expression may be directly or indirectly involved in cancer development and metastasis. In conclusion, our...

  20. Augmentation of the cytotoxic effects of zinc oxide nanoparticles by MTCP conjugation: Non-canonical apoptosis and autophagy induction in human adenocarcinoma breast cancer cell lines.

    Science.gov (United States)

    Mozdoori, Najmeh; Safarian, Shahrokh; Sheibani, Nader

    2017-09-01

    Zinc oxide nanoparticles are very toxic, but their agglomeration reduces their lethal cytotoxic effects. Here we tested the hypothesis that conjugation of ZnO nanoparticles via Meso-Tetra (4-Carboxyphenyl) Porphyrin (MTCP) could provide electrostatic or steric stabilization of ZnO nanoparticles and increase their cytotoxic effects. The cytotoxicity and cell death induction were assessed using two human breast adenocarcinoma cell lines (MCF-7 and MDA-MB-468). The MTT results indicated that the toxicity of ZnO nanoparticles was significantly increased upon MTCP conjugation. Annexin/PI and real time RT-PCR results demonstrated that the ZnO-MTCP nanoparticles induced cell death via different non-canonical pathways that are under ca2+ control. Calcium signaling could regulate lysosomal dependent apoptosis and death autophagy, and killing of the two selected types of breast cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Obligate progression precedes lung adenocarcinoma dissemination.

    Science.gov (United States)

    Caswell, Deborah R; Chuang, Chen-Hua; Yang, Dian; Chiou, Shin-Heng; Cheemalavagu, Shashank; Kim-Kiselak, Caroline; Connolly, Andrew; Winslow, Monte M

    2014-07-01

    Despite its clinical importance, very little is known about the natural history and molecular underpinnings of lung cancer dissemination and metastasis. Here, we used a genetically engineered mouse model of metastatic lung adenocarcinoma in which cancer cells are fluorescently marked to determine whether dissemination is an inherent ability or a major acquired phenotype during lung adenocarcinoma metastasis. We find very little evidence for dissemination from oncogenic KRAS-driven hyperplasias or most adenocarcinomas. p53 loss is insufficient to drive dissemination but rather enables rare cancer cells in a small fraction of primary adenocarcinomas to gain alterations that drive dissemination. Molecular characterization of disseminated tumor cells indicates that downregulation of the transcription factor Nkx2-1 precedes dissemination. Finally, we show that metastatic primary tumors possess a highly proliferative subpopulation of cells with characteristics matching those of disseminating cells. We propose that dissemination is a major hurdle during the natural course of lung adenocarcinoma metastasis. Because of its aggressively metastatic nature, lung cancer is the top cancer killer of both men and women in the United States. We show that, unlike in other cancer types, lung cancer dissemination is a major initial barrier to metastasis. Our findings provide insight into the effect of p53 deficiency and downregulation of Nkx2-1 during lung adenocarcinoma progression. ©2014 American Association for Cancer Research.

  2. Osthole inhibits the invasive ability of human lung adenocarcinoma cells via suppression of NF-κB-mediated matrix metalloproteinase-9 expression

    Energy Technology Data Exchange (ETDEWEB)

    Kao, Shang-Jyh [Department of Chest Medicine, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Su, Jen-Liang [Graduate Institute of Cancer Biology, College of Medicine, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung, Taiwan (China); Department of Biotechnology, Asia University, Taichung, Taiwan (China); Chen, Chi-Kuan [Graduate Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Yu, Ming-Chih; Bai, Kuan-Jen; Chang, Jer-Hua [Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Bien, Mauo-Ying [School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Yang, Shun-Fa [Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Research, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Chien, Ming-Hsien, E-mail: mhchien1976@gmail.com [Graduate Institute of Clinical Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2012-05-15

    The induction of matrix metalloproteinase (MMP)-9 is particularly important for the invasiveness of various cancer cells. Osthole, a natural coumarin derivative extracted from traditional Chinese medicines, is known to inhibit the proliferation of a variety of tumor cells, but the effect of osthole on the invasiveness of tumor cells is largely unknown. This study determines whether and by what mechanism osthole inhibits invasion in CL1-5 human lung adenocarcinoma cells. Herein, we found that osthole effectively inhibited the migratory and invasive abilities of CL1-5 cells. A zymographic assay showed that osthole inhibited the proteolytic activity of MMP-9 in CL1-5 cells. Inhibition of migration, invasion, and MMP2 and/or MMP-9 proteolytic activities was also observed in other lung adenocarcinoma cell lines (H1299 and A549). We further found that osthole inhibited MMP-9 expression at the messenger RNA and protein levels. Moreover, a chromatin immunoprecipitation assay showed that osthole inhibited the transcriptional activity of MMP-9 by suppressing the DNA binding activity of nuclear factor (NF)-κB in the MMP-9 promoter. Using reporter assays with point-mutated promoter constructs further confirmed that the inhibitory effect of osthole requires an NF-κB binding site on the MMP-9 promoter. Western blot and immunofluorescence assays demonstrated that osthole inhibited NF-κB activity by inhibiting IκB-α degradation and NF-κB p65 nuclear translocation. In conclusion, we demonstrated that osthole inhibits NF-κB-mediated MMP-9 expression, resulting in suppression of lung cancer cell invasion and migration, and osthole might be a potential agent for preventing the invasion and metastasis of lung cancer. -- Highlights: ► Osthole treatment inhibits lung adenocarcinoma cells migration and invasion. ► Osthole reduces the expression and proteolytic activity of MMP-9. ► Osthole inhibits MMP-9 transcription via suppression of NF-κB binding activity. ► Osthole

  3. A novel combination of multiple primary carcinomas: Urinary bladder transitional cell carcinoma, prostate adenocarcinoma and small cell lung carcinoma- report of a case and review of the literature

    Directory of Open Access Journals (Sweden)

    Giannikaki Elpida

    2005-07-01

    Full Text Available Abstract Background The incidence of multiple primary malignant neoplasms increases with age and they are encountered more frequently nowadays than before, the phenomenon is still considered to be rare. Case presentation We report a case of a man in whom urinary bladder transitional cell carcinoma, metachronous prostate adenocarcinoma and small cell lung carcinoma were diagnosed within an eighteen-month period. The only known predisposing factor was that he was heavy smoker (90–100 packets per year. The literature on the phenomenon of multiple primary malignancies in a single patient is reviewed and the data is summarized. Conclusion It is important for the clinicians to keep in mind the possibility of a metachronous (successive or a synchronous (simultaneous malignancy in a cancer patient. It is worthy mentioning this case because clustering of three primary malignancies (synchronous and metachronous is of rare occurrence in a single patient, and, to our knowledge, this is the first report this combination of three carcinomas appearing in the same patient.

  4. Follistatin is a novel biomarker for lung adenocarcinoma in humans.

    Directory of Open Access Journals (Sweden)

    Fangfang Chen

    Full Text Available Follistatin (FST, a single chain glycoprotein, is originally isolated from follicular fluid of ovary. Previous studies have revealed that serum FST served as a biomarker for pregnancy and ovarian mucinous tumor. However, whether FST can serve as a biomarker for diagnosis in lung adenocarcinoma of humans remains unclear.The study population consisted of 80 patients with lung adenocarcinoma, 40 patients with ovarian adenocarcinoma and 80 healthy subjects. Serum FST levels in patients and healthy subjects were measured using ELISA. The results showed that the positive ratio of serum FST levels was 51.3% (41/80, which was comparable to the sensitivity of FST in 40 patients with ovarian adenocarcinoma (60%, 24/40 using the 95th confidence interval for the healthy subject group as the cut-off value. FST expressions in lung adenocarcinoma were examined by immunohistochemical staining, we found that lung adenocarcinoma could produce FST and there was positive correlation between the level of FST expression and the differential degree of lung adenocarcinoma. Furthermore, the results showed that primary cultured lung adenocarcinoma cells could secrete FST, while cells derived from non-tumor lung tissues almost did not produce FST. In addition, the results of CCK8 assay and flow cytometry showed that using anti-FST monoclonal antibody to neutralize endogenous FST significantly augmented activin A-induced lung adenocarcinoma cells apoptosis.These data indicate that lung adenocarcinoma cells can secret FST into serum, which may be beneficial to the survival of adenocarcinoma cells by neutralizing activin A action. Thus, FST can serve as a promising biomarker for diagnosis of lung adenocarcinoma and a useful biotherapy target for lung adenocarcinoma.

  5. Follistatin Is a Novel Biomarker for Lung Adenocarcinoma in Humans

    Science.gov (United States)

    Feng, Ye; Liu, Haiyan; Sun, Yang; Liu, Zhonghui; Ge, Jingyan; Cui, Xueling

    2014-01-01

    Background Follistatin (FST), a single chain glycoprotein, is originally isolated from follicular fluid of ovary. Previous studies have revealed that serum FST served as a biomarker for pregnancy and ovarian mucinous tumor. However, whether FST can serve as a biomarker for diagnosis in lung adenocarcinoma of humans remains unclear. Methods and Results The study population consisted of 80 patients with lung adenocarcinoma, 40 patients with ovarian adenocarcinoma and 80 healthy subjects. Serum FST levels in patients and healthy subjects were measured using ELISA. The results showed that the positive ratio of serum FST levels was 51.3% (41/80), which was comparable to the sensitivity of FST in 40 patients with ovarian adenocarcinoma (60%, 24/40) using the 95th confidence interval for the healthy subject group as the cut-off value. FST expressions in lung adenocarcinoma were examined by immunohistochemical staining, we found that lung adenocarcinoma could produce FST and there was positive correlation between the level of FST expression and the differential degree of lung adenocarcinoma. Furthermore, the results showed that primary cultured lung adenocarcinoma cells could secrete FST, while cells derived from non-tumor lung tissues almost did not produce FST. In addition, the results of CCK8 assay and flow cytometry showed that using anti-FST monoclonal antibody to neutralize endogenous FST significantly augmented activin A-induced lung adenocarcinoma cells apoptosis. Conclusions These data indicate that lung adenocarcinoma cells can secret FST into serum, which may be beneficial to the survival of adenocarcinoma cells by neutralizing activin A action. Thus, FST can serve as a promising biomarker for diagnosis of lung adenocarcinoma and a useful biotherapy target for lung adenocarcinoma. PMID:25347573

  6. Pancreatic adenocarcinoma upregulated factor (PAUF) confers resistance to pancreatic cancer cells against oncolytic parvovirus H-1 infection through IFNA receptor-mediated signaling

    Energy Technology Data Exchange (ETDEWEB)

    Kaowinn, Sirichat; Cho, Il-Rae; Moon, Jeong; Jun, Seung Won; Kim, Chang Seok [BK21+, Department of Cogno-Mechatronics Engineering, Pusan National University, Busan 609-736 (Korea, Republic of); Kang, Ho Young [Department of Microbiology, Pusan National University, Busan 609-736 (Korea, Republic of); Kim, Manbok [Department of Medical Science, Dankook University College of Medicine, Cheonan 330-714 (Korea, Republic of); Koh, Sang Seok [Department of Biological Sciences, Dong-A University, Busan 604-714 (Korea, Republic of); Chung, Young-Hwa, E-mail: younghc@pusan.ac.kr [BK21+, Department of Cogno-Mechatronics Engineering, Pusan National University, Busan 609-736 (Korea, Republic of)

    2015-04-03

    Pancreatic adenocarcinoma upregulated factor (PAUF), a novel oncogene, plays a crucial role in the development of pancreatic cancer, including its metastasis and proliferation. Therefore, PAUF-expressing pancreatic cancer cells could be important targets for oncolytic virus-mediated treatment. Panc-1 cells expressing PAUF (Panc-PAUF) showed relative resistance to parvovirus H-1 infection compared with Panc-1 cells expressing an empty vector (Panc-Vec). Of interest, expression of type I IFN-α receptor (IFNAR) was higher in Panc-PAUF cells than in Panc-Vec cells. Increased expression of IFNAR in turn increased the activation of Stat1 and Tyk2 in Panc-PAUF cells compared with that in Panc-Vec cells. Suppression of Tyk2 and Stat1, which are important downstream molecules for IFN-α signaling, sensitized pancreatic cancer cells to parvovirus H-1-mediated apoptosis. Further, constitutive suppression of PAUF sensitized Bxpc3 pancreatic cancer cells to parvovirus H-1 infection. Taken together, these results suggested that PAUF conferred resistance to pancreatic cancer cells against oncolytic parvovirus H-1 infection through IFNAR-mediated signaling. - Highlights: • PAUF confers resistance against oncolytic parvovirus H-1 infection. • PAUF enhances the expression of IFNAR in Panc-1 cells. • Increased activation of Tyk2 or Stat1 by PAUF provides resistance to parvovirus H-1-mediated apoptosis. • Constitutive inhibition of PAUF enhances parvovirus H-1-mediated oncolysis of Bxpc3 pancreatic cancer cells.

  7. A Lactose-Binding Lectin from the Marine Sponge Cinachyrella Apion (Cal Induces Cell Death in Human Cervical Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Adriana Uchoa

    2012-03-01

    Full Text Available Cancer represents a set of more than 100 diseases, including malignant tumors from different locations. Strategies inducing differentiation have had limited success in the treatment of established cancers. Marine sponges are a biological reservoir of bioactive molecules, especially lectins. Several animal and plant lectins were purified with antitumor activity, mitogenic, anti-inflammatory and antiviral, but there are few reports in the literature describing the mechanism of action of lectins purified from marine sponges to induce apoptosis in human tumor cells. In this work, a lectin purified from the marine sponge Cinachyrella apion (CaL was evaluated with respect to its hemolytic, cytotoxic and antiproliferative properties, besides the ability to induce cell death in tumor cells. The antiproliferative activity of CaL was tested against HeLa, PC3 and 3T3 cell lines, with highest growth inhibition for HeLa, reducing cell growth at a dose dependent manner (0.5–10 µg/mL. Hemolytic activity and toxicity against peripheral blood cells were tested using the concentration of IC50 (10 µg/mL for both trials and twice the IC50 for analysis in flow cytometry, indicating that CaL is not toxic to these cells. To assess the mechanism of cell death caused by CaL in HeLa cells, we performed flow cytometry and western blotting. Results showed that lectin probably induces cell death by apoptosis activation by pro-apoptotic protein Bax, promoting mitochondrial membrane permeabilization, cell cycle arrest in S phase and acting as both dependent and/or independent of caspases pathway. These results indicate the potential of CaL in studies of medicine for treating cancer.

  8. Synchronous malignant B-cell lymphoma and gastric tubular adenocarcinoma associated with paraneoplastic cutaneous vasculitis: hypereosinophilic syndrome with mixed cryoglobulinemia is an important sign of paraneoplastic syndrome

    Directory of Open Access Journals (Sweden)

    Kenji Takamori

    2009-12-01

    Full Text Available Gastric adenocarcinoma developing concomitantly with a lymphoma is rare. Furthermore, B-cell lymphoma, originating from lymph nodes, with eosinophilia is extremely rare. We report here a case with a synchronous diffuse large B-cell lymphoma (DLBCL and an early adenocarcinoma of the stomach. In addition, this case seemed to be associated with paraneoplastic cutaneous vasculitis caused by hypereosinophilic syndrome (HES with mixed cryoglobulinemia (MC. Many neoplastic diseases that affect internal organs display cutaneous manifestations, which may be the presenting signs and symptoms of the underlying malignancy. In particular, the association between cutaneous vasculitis and malignancy has been widely reviewed, and recently neoplasms have been suggested to produce antigens and the resultant immune complex formations, activating the serum complement, thus cause paraneoplastic vasculitis. In this case, severe eosinophilia and cryoglobulinemia with low complements were observed in a laboratory test. A biopsy specimen from a skin lesion revealed leukocytoclastic vasculitis with severe perivascular infiltration of eosinophils. The cutaneous vasuculitis was considered to be a manifestation of HES with MC, although there were no etiological factors of HES and MC. Therefore, the vasculitis seems to be a symptom of paraneoplastic syndrome in this case. Our finding suggests that the potential presence of malignancies should be kept in mind as a possible underlying disorder especially in the presence of HES with MC; this possibility is interesting also as regards at least part of the pathogenesis for paraneplastic syndrome.

  9. Molecular testing guidelines for lung adenocarcinoma: Utility of cell blocks and concordance between fine-needle aspiration cytology and histology samples

    Science.gov (United States)

    Heymann, Jonas J.; Bulman, William A.; Maxfield, Roger A.; Powell, Charles A.; Halmos, Balazs; Sonett, Joshua; Beaubier, Nike T.; Crapanzano, John P.; Mansukhani, Mahesh M.; Saqi, Anjali

    2014-01-01

    Background: Lung cancer is a leading cause of mortality, and patients often present at a late stage. More recently, advances in screening, diagnosing, and treating lung cancer have been made. For instance, greater numbers of minimally invasive procedures are being performed, and identification of lung adenocarcinoma driver mutations has led to the implementation of targeted therapies. Advances in molecular techniques enable use of scant tissue, including cytology specimens. In addition, per recently published consensus guidelines, cytology-derived cell blocks (CBs) are preferred over direct smears. Yet, limited comparison of molecular testing of fine-needle aspiration (FNA) CBs and corresponding histology specimens has been performed. This study aimed to establish concordance of epidermal growth factor receptor (EGFR) and Kirsten rat sarcoma (KRAS) virus homolog testing between FNA CBs and histology samples from the same patients. Materials and Methods: Patients for whom molecular testing for EGFR or KRAS was performed on both FNA CBs and histology samples containing lung adenocarcinoma were identified retrospectively. Following microdissection, when necessary, concordance of EGFR and KRAS molecular testing results between FNA CBs and histology samples was evaluated. Results: EGFR and/or KRAS testing was performed on samples obtained from 26 patients. Concordant results were obtained for all EGFR (22/22) and KRAS (17/17) mutation analyses performed. Conclusions: Identification of mutations in lung adenocarcinomas affects clinical decision-making, and it is important that results from small samples be accurate. This study demonstrates that molecular testing on cytology CBs is as sensitive and specific as that on histology. PMID:24987443

  10. Effects of varying degrees of surface strain anisotropies on endothelial cells

    NARCIS (Netherlands)

    Sinha, Ravi; le Gac, Severine; Verdonschot, Nicolaas Jacobus Joseph; van den Berg, Albert; Koopman, Hubertus F.J.M.; Rouwkema, Jeroen

    2016-01-01

    Introduction: Cyclic strain is well known to affect cell behavior. It is also known that isotropic and anisotropic strain can affect cells differently[1]. While in-vivo cells experience varying degrees of anisotropy (d.o.a.), in-vitro anisotropic strain studies have mostly focused on uniaxial

  11. The P2X7 receptor regulates cell survival, migration and invasion of pancreatic ductal adenocarcinoma cells

    DEFF Research Database (Denmark)

    Giannuzzo, Andrea; Pedersen, Stine Helene Falsig; Novak, Ivana

    2015-01-01

    of the ATP receptors, the P2X7 receptor (P2X7R) could be an important player in PDAC behaviour. METHODS: We determined the expression (real time PCR and Western blot) and localization (immunofluorescence) of P2X7R in human PDAC cell lines (AsPC-1, BxPC-3, Capan-1, MiaPaCa-2, Panc-1) and a "normal" human...... by necrosis. Moreover, the P2X7R-pore antagonist, A438079, prevented ATP-induced pore formation and cell death. Second, in basal conditions and with low concentrations of ATP/BzATP, the P2X7R allosteric inhibitor AZ10606120 reduced proliferation in all PDAC cell lines. P2X7R also affected other key...

  12. Flavonoids and Tannins from Smilax china L. Rhizome Induce Apoptosis Via Mitochondrial Pathway and MDM2-p53 Signaling in Human Lung Adenocarcinoma Cells.

    Science.gov (United States)

    Fu, San; Yang, Yanfang; Liu, Dan; Luo, Yan; Ye, Xiaochuan; Liu, Yanwen; Chen, Xin; Wang, Song; Wu, Hezhen; Wang, Yuhang; Hu, Qiwei; You, Pengtao

    2017-01-01

    In vitro evidence indicates that Smilax china L. rhizome (SCR) can inhibit cell proliferation. Therefore, in the present study, we analyzed the effects in vitro of SCR extracts on human lung adenocarcinoma A549 cells. Our results showed that A549 cell growth was inhibited in a dose- and time-dependent manner after treatment with SCR extracts. Total flavonoids and total tannins from SCR induced A549 apoptosis in a dose-dependent manner, as shown by our flow cytometry analysis, which was consistent with the alterations in nuclear morphology we observed. In addition, the total apoptotic rate induced by total tannins was higher than the rate induced by total flavonoids at the same dose. Cleaved-caspase-3 protein levels in A549 cells after treatment with total flavonoids or total tannins were increased in a dose-dependent manner, followed by the activation of caspase-8 and caspase-9, finally triggering to PARP cleavage. Furthermore, total flavonoids and total tannins increased the expression of Bax, decreased the expression of Bcl-2, and promoted cytochrome [Formula: see text] release. Moreover, MDM2 and p-MDM2 proteins were decreased, while p53 and p-p53 proteins were increased, both in a dose-dependent manner, after A549 treatment with total flavonoids and total tannins. Finally, cleaved-caspase-3 protein levels in the total flavonoids or total tannins-treated H1299 (p53 null) and p53-knockdown A549 cells were increased. Our results indicated that total flavonoids and total tannins from SCR exerted a remarkable effect in reducing A549 growth through their action on mitochondrial pathway and disruption of MDM2-p53 balance. Hence, our findings demonstrated a potential application of total flavonoids and total tannins from SCR in the treatment of human lung adenocarcinoma.

  13. Akt/mTOR mediated induction of bystander effect signaling in a nucleus independent manner in irradiated human lung adenocarcinoma epithelial cells.

    Science.gov (United States)

    Li, Lu; Wang, Lu; Prise, Kevin M; Yu, K N; Chen, Guodong; Chen, Lianyun; Mei, Yide; Han, Wei

    2017-03-14

    Cytoplasm is an important target for the radiation-induced bystander effect (RIBE). In the present work, the critical role of protein kinase B (Akt)/mammalian target of rapamycin (mTOR) pathway in the generation of RIBE signaling after X-ray irradiation and the rapid phosphorylation of Akt and mTOR was observed in the cytoplasm of irradiated human lung adenocarcinoma epithelial (A549) cells. Targeting A549 cytoplasts with individual protons from a microbeam showed that RIBE signal(s) mediated by the Akt/mTOR pathway were generated even in the absence of a cell nucleus. These results provide a new insight into the mechanisms driving the cytoplasmic response to irradiation and their impact on the production of RIBE signal(s).

  14. Pulmonary adenocarcinoma: A renewed entity in 2011

    Science.gov (United States)

    Kadara, Humam; Kabbout, Mohamed; Wistuba, Ignacio I.

    2014-01-01

    Lung cancer, of which non-small-cell lung cancer comprises the majority, is the leading cause of cancer-related deaths in the United States and worldwide. Lung adenocarcinomas are a major subtype of non-small-cell lung cancers, are increasing in incidence globally in both males and females and in smokers and non-smokers, and are the cause for almost 50% of deaths attributable to lung cancer. Lung adenocarcinoma is a tumour with complex biology that we have recently started to understand with the advent of various histological, transcriptomic, genomic and proteomic technologies. However, the histological and molecular pathogenesis of this malignancy is still largely unknown. This review will describe advances in the molecular pathology of lung adenocarcinoma with emphasis on genomics and DNA alterations of this disease. Moreover, the review will discuss recognized lung adenocarcinoma preneoplastic lesions and current concepts of the early pathogenesis and progression of the disease. We will also portray the field cancerization phenomenon and lineage-specific oncogene expression pattern in lung cancer and how both remerging concepts can be exploited to increase our understanding of lung adenocarcinoma pathogenesis for subsequent development of biomarkers for early detection of adenocarcinomas and possibly personalized prevention. PMID:22040022

  15. Association of visceral adiposity with oesophageal and junctional adenocarcinomas.

    LENUS (Irish Health Repository)

    Beddy, P

    2012-02-01

    BACKGROUND: Obesity is associated with an increased incidence of oesophageal and oesophagogastric junction adenocarcinoma, in particular Siewert types I and II. This study compared abdominal fat composition in patients with oesophageal\\/junctional adenocarcinoma with that in patients with oesophageal squamous cell carcinoma and gastric adenocarcinoma, and in controls. METHOD: In total, 194 patients (110 with oesophageal\\/junctional adenocarcinoma, 38 with gastric adenocarcinoma and 46 with oesophageal squamous cell carcinoma) and 90 matched control subjects were recruited. The abdominal fat area was assessed using computed tomography (CT), and the total fat area (TFA), visceral fat area (VFA) and subcutaneous fat area (SFA) were calculated. RESULTS: Patients with oesophageal\\/junctional adenocarcinoma had significantly higher TFA and VFA values compared with controls (both P < 0.001), patients with gastric adenocarcinoma (P = 0.013 and P = 0.006 respectively) and patients with oesophageal squamous cell carcinoma (both P < 0.001). For junctional tumours, the highest TFA and VFA values were seen in patients with Siewert type I tumours (respectively P = 0.041 and P = 0.033 versus type III; P = 0.332 and P = 0.152 versus type II). CONCLUSION: Patients with oesophageal\\/junctional adenocarcinoma, in particular oesophageal and Siewert type I junctional tumours, have greater CT-defined visceral adiposity than patients with gastric adenocarcinoma or oesophageal squamous cell carcinoma, or controls.

  16. Clinical Significance of T Lymphocyte Subset Changes After First Line Chemotherapy in Peripheral Blood from Patients with Advanced Stage Adenocarcinoma Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Xiang YAN

    2012-03-01

    Full Text Available Background and objective The immune function disorder relates closely to the occurrence, metastasis, and prognosis of cancer. T lymphocyte subsets take an important role in immune function. We identified the dynamic changes of the immune system by investigating the levels of T lymphocyte subsets in peripheral blood of lung cancer patients with advanced stage adenocarcinoma undergoing first line chemotherapy. The results aided the search for rational chemo-immunotherapy strategies in lung cancer treatment. Methods Samples from 49 patients with pathologically demonstrated advanced stage adenocarcinoma cell lung cancer were compared with those from 33 healthy donors. Subsequently, the patients were separately treated with Docetaxol-based or Pemetrexed-based therapy. Peripheral blood samples at different time points after therapy were analyzed by flowcytometry. The lymphocyte subsets of the total lymphocytes were compared. Independent sample t test was used for the quantitative data analysis. Results The percentage of CD3+, CD3+CD4+, CD4+CD25+ cells of the lung cancer patients significantly varied from those of the healthy donors, the P values are 0.012, 0.034 and 0.006 separately. The CD3+ and CD3+CD4+ levels increased significantly on the 4th and 7th-10th day post-chemotherapy, which return to normal levels on the 21th day. The CD3+ level increased significantly both in the treatment group on all time points, while the CD3+, CD3+CD4+, CD4+/CD8+ levels significantly increased and the CD3+CD8+, CD8+CD28- levels significantly decreased on the 4th day in Pemetrexed group. The CD3+CD4+ levels increased significantly on the 4th and 7th-10th day and the CD3+CD8+, CD8+CD28- levels decreased on the 4th day in partial response group. Conclusion The immune function of advanced stage adenocarcinoma cell lung cancer patients was evidently suppressed, and was restored at the 4th day, followed by a reduction at the 21st day after chemotherapy. On the 4th day

  17. Hepatoid Adenocarcinoma of the Urachus

    Directory of Open Access Journals (Sweden)

    Daniel Fernando Gallego

    2016-01-01

    Full Text Available Hepatoid adenocarcinoma of the urachus is a rare condition. We present the case of a 51-year-old female who developed abdominal pain and hematuria. Pelvic magnetic resonance imaging (MRI reported an urachal mass with invasion to the bladder that was resected by partial cystectomy. On light microscopy the tumor resembled liver architecture, with polygonal atypical cells in nest formation and trabecular structures. Immunochemistry was positive for alfa-fetoprotein (AFP and serum AFP was elevated. Hepatoid adenocarcinomas have been reported in multiple organs, being most commonly found in the stomach and the ovaries. Bladder compromise has been rarely described in the literature, and it has been associated with poor prognosis, low remission rates, and early metastasis.

  18. Artemisinin induces caspase-8/9-mediated and Bax/Bak-independent apoptosis in human lung adenocarcinoma (ASTC-a-1) cells.

    Science.gov (United States)

    Xiao, Feng-Lian; Gao, Wei-Jie; Liu, Cheng-Yi; Wang, Xiao-Ping; Chen, Tong-Sheng

    2011-01-01

    Artemisinin (ARTE), an antimalarial phytochemical component from the sweet wormwood plant, has been shown a potential anticancer activity by inducing cell apoptosis. The aim of this report is to explore the mechanism of ARTE-induced human lung adenocarcinoma (ASTC-a-1) cell apoptosis. Cell counting kit (CCK-8) assay showed that ARTE induced cytotoxcity in a dose- and time-dependent manner. Confocal microscopy fluorescence imaging of cells stained with Hoechst 33258 and flow cytometry (FCM) analysis of cells stained with Annexin V-FITC/propidium iodide (PI) showed that ARTE induced reactive oxygen species (ROS)-dependent apoptosis. Confocal fluorescence resonance energy transfer (FRET) imaging of single living cells expressing SCAT3, SCAT9 or CFP-Bid-YFP and fluorometic substrate assay showed that ARTE induced the activation of caspase-3, -8 and -9. Moreover, inhibition of caspase-8 or -9 completely blocked ARTE-induced apoptosis which was only partially attenuated by caspase-3 inhibitor. Interestingly, silencing Bax and Bak by RNA interference (RNAi) did not attenuate ARTE-induced apoptosis. Collectively, ARTE induces caspase-dependent but Bax/Bak-independent apoptosis in ASTC-a-1 cells.

  19. Allicin inhibits the invasion of lung adenocarcinoma cells by altering tissue inhibitor of metalloproteinase/matrix metalloproteinase balance via reducing the activity of phosphoinositide 3-kinase/AKT signaling.

    Science.gov (United States)

    Huang, Ling; Song, Yuanhong; Lian, Jianping; Wang, Zhiwei

    2017-07-01

    Allicin, the main active principle associated with Allium sativum chemistry, has various antitumor activities. However, to the best of our knowledge, there is no available information to address the anti-invasive effect and associated mechanism in lung adenocarcinoma. In the present study, cell viability assay, cell adhesion assay, western blot analysis, Transwell migration and invasion assays and reverse transcription-quantitative polymerase chain reaction were performed. Allicin was identified to inhibit the adhesion, invasion and migration of lung adenocarcinoma cells in a dose-dependent manner, accompanied by decreasing mRNA and protein levels of matrix metalloproteinase (MMP)-2 and MMP-9. Conversely, the mRNA and protein levels of tissue inhibitor of metalloproteinase (TIMP)-1 and TIMP-2 were increased in a dose-dependent manner. Furthermore, it was revealed that allicin treatment significantly suppressed the phosphorylation of AKT (Pallicin led to the synergistic reduction of MMP-2 and MMP-9 expression, followed by an increase in TIMP-1 and TIMP-2 expression. The invasive capabilities of lung adenocarcinoma cells were also suppressed. However, insulin-like growth factor-1 (an activator of PI3K/AKT signaling) reversed the effects of allicin on cell invasion and expression of MMP-2, MMP-9, TIMP-1 and TIMP-2. The present study concluded that allicin may inhibit invasion of lung adenocarcinoma cells by altering TIMP/MMP balance, via reducing the activity of the PI3K/AKT signaling pathway. This indicated that allicin may be recognized as an anti-invasive agent for lung adenocarcinoma treatment.

  20. VEGF/VEGFR-2 upregulates EZH2 expression in lung adenocarcinoma cells and EZH2 depletion enhances the response to platinum-based and VEGFR-2–targeted therapy

    Science.gov (United States)

    Riquelme, Erick; Suraokar, Milind; Behrens, Carmen; Lin, Heather Y.; Girard, Luc; Nilsson, Monique B.; Simon, George; Wang, Jing; Coombes, Kevin R.; Lee, J. Jack; Hong, Waun Ki; Heymach, John; Minna, John D.; Wistuba, Ignacio I.

    2014-01-01

    Purpose Investigate the mechanisms of regulation and role associated with EZH2 expression in lung cancer cells. Experimental Design We investigated the mechanisms of EZH2 expression associated with the vascular endothelial growth factor (VEGF)/VEGF receptor 2 (VEGFR-2) pathway. Furthermore, we sought to determine the role of EZH2 in response of lung adenocarcinoma to platinum-based chemotherapy, as well as the effect of EZH2 depletion on VEGFR-2–targeted therapy in lung adenocarcinoma cell lines. Additionally, we characterized EZH2 expression in lung adenocarcinoma specimens and correlated it with patients’ clinical characteristics. Results In this study, we demonstrate that VEGF/VEGFR-2 activation induces expression of EZH2 through the upregulation of E2F3 and HIF-1α, and downregulated expression of miR-101. EZH2 depletion by treatment with 3-deazaneplanocin A and knockdown by siRNA decreased the expression of EZH2 and H3K27me3, increased PARP-C level, reduced cell proliferation and migration, and increased sensitivity of the cells to treatment with cisplatin and carboplatin. Additionally, high EZH2 expression was associated with poor overall survival in patients who received platinum-based adjuvant therapy, but not in patients who did not receive this therapy. Furthermore, we demonstrated for the first time that the inhibition of EZH2 greatly increased the sensitivity of lung adenocarcinoma cells to the anti-VEGFR-2 drug AZD2171. Conclusion Our results suggest that VEGF/VEGFR-2 pathway plays a role in regulation of EZH2 expression via E2F3, HIF-1α and miR-101. EZH2 depletion decreases the malignant potential of lung adenocarcinoma and sensitivity of the cells to both platinum-based and VEGFR-2–targeted therapy. PMID:24850841

  1. Histological transformation of adenocarcinoma to small cell carcinoma lung as a rare mechanism of resistance to epidermal growth factor receptor-tyrosine kinase inhibitors: Report of a case with review of literature.

    Science.gov (United States)

    Hui, Monalisa; Uppin, Shantveer G; Stalin, Bala Joseph; Sadashivudu, G

    2018-01-01

    A subset of non-small cell lung carcinoma (NSCC) harbor active mutations of epidermal growth factor receptor (EGFR). In these, EGFR tyrosine kinase inhibitors (EGFR-TKIs) are recommended as the first-line treatment. Though drug resistance is inevitable, histological transformation to small cell lung carcinoma (SCLC) is a rare mechanism for acquired resistance. Here we report one such rare case of histological transformation of pulmonary adenocarcinoma to small cell lung carcinoma in 46 year old male treated with Gefitinib.

  2. Artificial Analogues of Circulating Box C/D RNAs Induce Strong Innate Immune Response and MicroRNA Activation in Human Adenocarcinoma Cells.

    Science.gov (United States)

    Stepanov, Grigory A; Filippova, Julia A; Nushtaeva, Anna A; Kuligina, Elena V; Koval, Olga A; Richter, Vladimir A; Semenov, Dmitriy V

    2016-01-01

    Fragments of small nucleolar RNAs (snoRNAs) were found among various non-coding RNAs (ncRNAs) circulating in human blood. Currently, the function of such cell-free sno-derived-RNAs is not clearly defined. This work is aimed at identifying regulatory pathways controlled by extracellular snoRNAs. In order to determine the molecular targets and pathways affected by artificial snoRNAs, we performed Illumina array analysis of MCF-7 human adenocarcinoma cells transfected with box C/D RNAs. The genes related to the innate immune response and apoptotic cascades were found to be activated in transfected cells compared with control cells. Intriguingly, the transfection of MCF-7 cells with artificial box C/D snoRNAs also increased the transcription of several microRNAs, such as mir-574, mir-599 and mir-21. Our data demonstrated that extracellular snoRNAs introduced into human cells may function as gene expression modulators, with activation of microRNA genes being one of the regulatory mechanisms.

  3. trans-11 18:1 Vaccenic Acid (TVA Has a Direct Anti-Carcinogenic Effect on MCF-7 Human Mammary Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Ji-Na Lim

    2014-02-01

    Full Text Available Trans vaccenic acid (TVA; trans-11 18:1 is a positional and geometric isomer of oleic acid and it is the predominant trans isomer found in ruminant fats. TVA can be converted into cis-9, trans-11 conjugated linoleic acid (c9, t11-CLA, a CLA isomer that has many beneficial effects, by stearoyl CoA desaturase 1 (SCD1 in the mammary gland. The health benefits associated with CLA are well documented, but it is unclear whether trans fatty acids (TFAs from ruminant products have healthy effects. Therefore, the effects of TVA on the proliferation of MCF-7 human breast adenocarcinoma cells and MCF-10A human breast epithelial cells were investigated in the present study. Results showed that TVA inhibited the proliferation of MCF-7 cells but not MCF-10A cells by down-regulating the expression of Bcl-2 as well as procaspase-9. In addition, the suppressive effect of TVA was confirmed in SCD1-depleted MCF-7 cells. Our results suggested that TVA exerts a direct anti-carcinogenic effect on MCF-7 cells. These findings provided a better understanding of the research on the anti-carcinogenic effects of TVA and this may facilitate the manufacture of TVA/c9, t11-CLA fortified ruminant products.

  4. Synchronous Quadruple Primary Neoplasms: Colon Adenocarcinoma, Collision Tumor of Neuroendocrine Tumor and Schwann Cell Hamartoma and Sessile Serrated Adenoma of the Appendix.

    Science.gov (United States)

    Meeks, Marshall W; Grace, Shane; Chen, Yongxin; Petterchak, James; Bolesta, Edward; Zhou, Yihua; Lai, Jin-Ping

    2016-08-01

    Quadruple synchronous primary neoplasms are very rare with only three cases reported in the English-speaking literature to date. Collision tumors are also rare entities, especially of the appendix. We herein report a case of synchronous quadruple primary neoplasm in a 95-year-old female. She was diagnosed with colon adenocarcinoma, sessile serrated adenoma of the appendix and a collision tumor composed of a well-differentiated neuroendocrine tumor and Schwann cell hamartoma. Histological examination and immunohistochemistry supported these four lesions as separate entities. This case is unique because we report the diagnosis of quadruple synchronous primary, an extremely rare occurrence, in addition to a collision tumor of the appendix. We also provide a review of the literature for synchronous neoplasms and collision tumors. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. Adenocarcinoma of urinary bladder: A report of two patients

    Directory of Open Access Journals (Sweden)

    Nitu Kumari

    2015-01-01

    Full Text Available Adenocarcinoma of the bladder is a rare tumor. Primary and metastatic adenocarcinomas of urinary bladder are morphologically similar, but histogenetically different. We present two cases, a signet ring cell adenocarcinoma with follow-up and another of glandular adenocarcinoma of urinary bladder. Pathological evaluation and immunohistochemical panel of eight markers (E-cadherin, CK20, CK7, CDX2, estrogen receptor (ER, gross cystic disease fluid protein 15 (GCDFP15, 34bE12, and prostate specific antigen (PSA provides a diagnostic confirmation of primary adenocarcinoma with the positive expression of E-cadherin and CK20 in case 1 and metastatic adenocarcinoma of prostate with profile of E-cadherin+, CK20-, GCDFP15+, 34bE12+, and PSA+ in case 2.

  6. TLR7 expression is decreased during tumour progression in transgenic adenocarcinoma of mouse prostate mice and its activation inhibits growth of prostate cancer cells.

    Science.gov (United States)

    Han, Ju-Hee; Park, Shin-Young; Kim, Jin-Bum; Cho, Sung-Dae; Kim, Bumseok; Kim, Bo-Yeon; Kang, Min-Jung; Kim, Dong-Jae; Park, Jae-Hak; Park, Jong-Hwan

    2013-10-01

    Although various Toll-like receptors (TLRs) have been associated with immune response and tumorigenesis in the prostate cells, little is known about the role of TLR7. Accordingly, we examined the expression of TLR7 during tumour progression of TRMAP (transgenic mouse model for prostate cancer) mice and its role on cell growth. Toll-like receptor7 expression was examined by RT-polymerase chain reaction (PCR), Western blot, and immunohistochemistry. Cell growth was examined by MTT assay. Colony formation was investigated by crystal violet staining. Strong expression of TLR7 was detected in the normal prostate epithelia of Wild-type (WT) mice, but not in TLR7-deficient mice. In contrast, TLR7 expression was weak in transgenic adenocarcinoma of mouse prostate (TRAMP)-C2 cells, as compared with murine bone marrow-derived macrophages (BMDMs). Moreover, TLR7 mRNA was markedly expressed in RWPE-1 cells (non-cancerous prostate epithelial cells), but not in PC3 and DU145 (prostate cancer cells). Immunohistochemically, TLR7 expression gradually decreased in TRAMP mice depending on the pathologic grade of the prostate cells. TLR7 agonists increased both the gene and protein expression of TLR7 and promoted production of proinflammatory cytokines/chemokines and IFN-β gene expression in prostate cancer cell lines. Moreover, loxoribine inhibited the growth and colony formation of TRAMP-C2 cells dependent of TLR7. These findings suggest that TLR7 may participate in tumour suppression in the prostate cells. © 2013 John Wiley & Sons Ltd.

  7. Cinnamomum cassia extracts reverses TGF-β1-induced epithelial-mesenchymal transition in human lung adenocarcinoma cells and suppresses tumor growth in vivo.

    Science.gov (United States)

    Lin, Chin-Yin; Hsieh, Yi-Hsien; Yang, Shun-Fa; Chu, Shu-Chen; Chen, Pei-Ni; Hsieh, Yih-Shou

    2017-07-01

    Metastasis is the most common cause of cancer-related mortality in patients, and epithelial-mesenchymal transition (EMT) is essential for cancer metastasis and antidrug resistance. Cinnamomum cassia has several antioxidative, anti-inflammatory, and anticancer biological effects. However, the anti-EMT effect of C. cassia in human lung carcinoma is rarely reported. In this study, we determined whether C. cassia extracts (CCE) reduces the EMT and tumor growth of human lung adenocarcinoma cells. CCE inhibited the transforming growth factor (TGF)-β1-induced cell motility and invasiveness of A549 and H1299 cells by repressing matrix metalloproteinase-2 and urokinase-type plasminogen activator as well as impaired cell adhesion to collagen. CCE also affected the TGF-β1-induced EMT by downregulating the expression of vimentin and fibronectin and upregulating E-cadherin. The nude mice xenograft model showed that CCE reduced A549 tumor growth. Thus, CCE possesses antimetastatic activity of A549 and H1299 cells by affecting EMT and suppressing A549 tumor growth in vivo. This result suggested that CCE could be used as an antimetastatic agent or as an adjuvant for anticancer therapy. © 2017 Wiley Periodicals, Inc.

  8. Cytopathogenesis of Naegleria fowleri Thai strains for cultured human neuroblastoma cells.

    Science.gov (United States)

    Tiewcharoen, Supathra; Malainual, Nat; Junnu, Virach; Chetanachan, Pruksawan; Rabablert, Jundee

    2008-04-01

    The aim of this study is to evaluate cellular interaction between free-living amoebae Naegleria fowleri strains and mammalian target cells in vitro. Two Thai strains of N. fowleri; Khon Kaen strain from the environment and Siriraj strain from the patient's cerebrospinal fluid and the Center of Disease Control VO 3081 strain from Atlanta (US) were studied. Human neuroblastoma (SK-N-MC) and African Green monkey Kidney (Vero) cells were used as target cells. Each cell line was inoculated with each strain of N. fowleri at a ratio of 1:1 and observed for 7 days. The uninoculated target cells and each strain of N. fowleri were used as control. The numbers of the challenged and unchallenged cells as well as the free-living amoebae were counted three times by trypan blue exclusion method. The inoculation began when the amoebae attached to the cell membrane and ingested the target cells. In this study, extensive cytopathogenesis with many floating inoculated cells and abundant number of amoebae were observed. The destruction pattern of both inoculated SK-N-MC and Vero target cells were similar. Interestingly, SK-N-MC was more susceptible to N. fowleri strains than the Vero cell. In addition, N. fowleri Siriraj strain showed the highest destruction pattern for each target cell. Our findings suggest that the SK-N-MC should be used as a base model for studying the neuropathogenesis in primary amoebic meningoencephalitis patients.

  9. The long noncoding RNA HOTAIR contributes to cisplatin resistance of human lung adenocarcinoma cells via downregualtion of p21(WAF1/CIP1 expression.

    Directory of Open Access Journals (Sweden)

    Zhili Liu

    Full Text Available HOTAIR, a long intervening non-coding RNA (lincRNA, associates with the Polycomb Repressive Complex 2 (PRC2 and is reported to reprogram chromatin organization and promote tumor progression. However, little is known about the roles of this gene in the development of chemoresistance phenotype of lung adenocarcinoma (LAD. Thus, we investigated the involvement of HOTAIR in the resistance of LAD cells to cisplatin. In this study, we show that HOTAIR expression was significantly upregulated in cisplatin-resistant A549/DDP cells compared with in parental A549 cells. Knockdown of HOTAIR by RNA interference could resensitize the responses of A549/DDP cells to cisplatin both in vitro and in vivo. In contrast, overexpression of HOTAIR could decrease the sensitivity of A549 and SPC-A1 cells to cisplatin. We also found that the siRNA/HOTAIR1-mediated chemosensivity enhancement was associated with inhibition of cell proliferation, induction of G0/G1 cell-cycle arrest and apoptosis enhancement through regulation of p21(WAF1/CIP1 (p21 expression. Also, pcDNA/p21or siRNA/p21 could mimic the effects of siRNA/HOTAIR1 or pcDNA/HOTAIR on the sensitivity of LAD cells to cisplatin. Importantly, siRNA/p21 or pcDNA/p21 could partially rescue the effects of siRNA/HOTAIR1 or pcDNA/HOTAIR on both p21 expression and cisplatin sensitivity in LAD cells. Further, HOTAIR was observed to be significantly downregulated in cisplatin-responding LAD tissues, and its expression was inversely correlated with p21 mRNA expression. Taken together, our findings suggest that upregulation of HOTAIR contributes to the cisplatin resistance of LAD cells, at least in part, through the regulation of p21 expression.

  10. Adenocarcinoma and wood.

    Science.gov (United States)

    Schraub, S; Belon-Leneutre, M; Mercier, M; Bourgeois, P

    1989-12-01

    The relation of adenocarcinoma of the facial sinuses and exposure to wood dust has been recognized for 20 years. As the tracheobronchial mucosa is similar to that lining the sinuses, a link between bronchial adenocarcinoma and wood dust exposure has been postulated. To test this hypothesis, a case-control study was conducted, based on all the histologically proven cases of adenocarcinoma of the lung reported to the tumor registry of the Doubs region of France from 1978 to 1985 and random population controls matched for age and residence. A questionnaire on occupational exposure and tobacco consumption was completed by 53 cases and 160 controls. Exposure to wood was similar for both groups, the crude relative risk (odds ratio) being 1.06; adjustment for tobacco consumption did not modify this value. Exposure to wood dust does not seem to be an occupational risk factor in the genesis of bronchial adenocarcinoma.

  11. Mucinous adenocarcinoma of colon

    National Research Council Canada - National Science Library

    Zamir, Naima; Ahmed, Soofia; Akhtar, Jamshed

    2010-01-01

    .... Underlying colorectal carcinoma is a rare cause and carries a poor prognosis. We report two cases of mucinous adenocarcinoma of colon, one in a 9 years old male and other in a female of 12 years...

  12. Actin and microtubule networks contribute differently to cell response for small and large strains

    Science.gov (United States)

    Kubitschke, H.; Schnauss, J.; Nnetu, K. D.; Warmt, E.; Stange, R.; Kaes, J.

    2017-09-01

    Cytoskeletal filaments provide cells with mechanical stability and organization. The main key players are actin filaments and microtubules governing a cell’s response to mechanical stimuli. We investigated the specific influences of these crucial components by deforming MCF-7 epithelial cells at small (≤5% deformation) and large strains (>5% deformation). To understand specific contributions of actin filaments and microtubules, we systematically studied cellular responses after treatment with cytoskeleton influencing drugs. Quantification with the microfluidic optical stretcher allowed capturing the relative deformation and relaxation of cells under different conditions. We separated distinctive deformational and relaxational contributions to cell mechanics for actin and microtubule networks for two orders of magnitude of drug dosages. Disrupting actin filaments via latrunculin A, for instance, revealed a strain-independent softening. Stabilizing these filaments by treatment with jasplakinolide yielded cell softening for small strains but showed no significant change at large strains. In contrast, cells treated with nocodazole to disrupt microtubules displayed a softening at large strains but remained unchanged at small strains. Stabilizing microtubules within the cells via paclitaxel revealed no significant changes for deformations at small strains, but concentration-dependent impact at large strains. This suggests that for suspended cells, the actin cortex is probed at small strains, while at larger strains; the whole cell is probed with a significant contribution from the microtubules.

  13. Benzyl Isothiocyanate Inhibits Prostate Cancer Development in the Transgenic Adenocarcinoma Mouse Prostate (TRAMP) Model, Which Is Associated with the Induction of Cell Cycle G1 Arrest.

    Science.gov (United States)

    Cho, Han Jin; Lim, Do Young; Kwon, Gyoo Taik; Kim, Ji Hee; Huang, Zunnan; Song, Hyerim; Oh, Yoon Sin; Kang, Young-Hee; Lee, Ki Won; Dong, Zigang; Park, Jung Han Yoon

    2016-02-22

    Benzyl isothiocyanate (BITC) is a hydrolysis product of glucotropaeolin, a compound found in cruciferous vegetables, and has been shown to have anti-tumor properties. In the present study, we investigated whether BITC inhibits the development of prostate cancer in the transgenic adenocarcinoma mouse prostate (TRAMP) mice. Five-week old, male TRAMP mice and their nontransgenic littermates were gavage-fed with 0, 5, or 10 mg/kg of BITC every day for 19 weeks. The weight of the genitourinary tract increased markedly in TRAMP mice and this increase was suppressed significantly by BITC feeding. H and E staining of the dorsolateral lobes of the prostate demonstrated that well-differentiated carcinoma (WDC) was a predominant feature in the TRAMP mice. The number of lobes with WDC was reduced by BITC feeding while that of lobes with prostatic intraepithelial neoplasia was increased. BITC feeding reduced the number of cells expressing Ki67 (a proliferation marker), cyclin A, cyclin D1, and cyclin-dependent kinase (CDK)2 in the prostatic tissue. In vitro cell culture results revealed that BITC decreased DNA synthesis, as well as CDK2 and CDK4 activity in TRAMP-C2 mouse prostate cancer cells. These results indicate that inhibition of cell cycle progression contributes to the inhibition of prostate cancer development in TRAMP mice treated with BITC.

  14. Grape waste extract obtained by supercritical fluid extraction contains bioactive antioxidant molecules and induces antiproliferative effects in human colon adenocarcinoma cells.

    Science.gov (United States)

    Lazzè, Maria Claudia; Pizzala, Roberto; Gutiérrez Pecharromán, Francisco Javier; Gatòn Garnica, Paloma; Antolín Rodríguez, Juan Manuel; Fabris, Nicola; Bianchi, Livia

    2009-06-01

    Grape waste management is one of the main problems of winery industries, but, conversely, grape waste contains a high amount of polyphenols that might protect against human diseases related to oxidative stress, such as colorectal cancer. Therefore, the aim of this work was to investigate the antioxidant and antiproliferative activities of a grape waste extract obtained by supercritical fluid extraction. Because the beneficial effect of grape is related to its content of polyphenolic molecules, the extract was chemically characterized by high-performance liquid chromatography in order to assess its major bioactive components. The antioxidant activity of the grape extract was determined. The results showed that the grape extract presents a strong antiradical activity in the in vitro 2,2-diphenyl-1-picrylhydrazyl radical assay and protects against reactive oxygen species production in human colon adenocarcinoma cells (Caco-2). In contrast, the extract did not protect in the citronellal thermooxidation system and showed a weak protective action against lipid peroxidation in Caco-2 cells. The clonogenic assay and the cell cycle distribution analysis showed that the grape extract has a significant antiproliferative effect in a tumor cell line. These data indicate that grape extract is a promising product to be used as an anti-free radical agent and could exert a chemopreventive action.

  15. Benzyl Isothiocyanate Inhibits Prostate Cancer Development in the Transgenic Adenocarcinoma Mouse Prostate (TRAMP Model, Which Is Associated with the Induction of Cell Cycle G1 Arrest

    Directory of Open Access Journals (Sweden)

    Han Jin Cho

    2016-02-01

    Full Text Available Benzyl isothiocyanate (BITC is a hydrolysis product of glucotropaeolin, a compound found in cruciferous vegetables, and has been shown to have anti-tumor properties. In the present study, we investigated whether BITC inhibits the development of prostate cancer in the transgenic adenocarcinoma mouse prostate (TRAMP mice. Five-week old, male TRAMP mice and their nontransgenic littermates were gavage-fed with 0, 5, or 10 mg/kg of BITC every day for 19 weeks. The weight of the genitourinary tract increased markedly in TRAMP mice and this increase was suppressed significantly by BITC feeding. H and E staining of the dorsolateral lobes of the prostate demonstrated that well-differentiated carcinoma (WDC was a predominant feature in the TRAMP mice. The number of lobes with WDC was reduced by BITC feeding while that of lobes with prostatic intraepithelial neoplasia was increased. BITC feeding reduced the number of cells expressing Ki67 (a proliferation marker, cyclin A, cyclin D1, and cyclin-dependent kinase (CDK2 in the prostatic tissue. In vitro cell culture results revealed that BITC decreased DNA synthesis, as well as CDK2 and CDK4 activity in TRAMP-C2 mouse prostate cancer cells. These results indicate that inhibition of cell cycle progression contributes to the inhibition of prostate cancer development in TRAMP mice treated with BITC.

  16. Elliptical posts allow for detailed control of non-equibiaxial straining of cell cultures

    DEFF Research Database (Denmark)

    Olesen, Christian Gammelgaard; Pennisi, Cristian Pablo; de Zee, Mark

    2013-01-01

    tissue cells in vivo are subjected to a range of mechanical deformations including shear strain caused by activities of daily living. Shear strains are suspected to play an important role in tissue necrosis. Method The Flexcell system was redesigned using a finite element model in order to obtain large......Background A modification of the Flexcell system that allows imposition of homogenous, controlled non-equibiaxial strains to cell cultures is developed and experimentally validated. The Flexcell system by default applies equibiaxial strain to cell cultures, meaning no shear strain, while soft...... areas of the membrane in a controlled, uniform non-equibiaxial strain state. Results The redesign was manufactured and the resulting strains were experimentally validated by means of image analysis methods. The results showed that the system could be used for experiments varying the shear strain...

  17. Short communication: Antiproliferative effect of 8 different Lactobacillus strains on K562 cells.

    Science.gov (United States)

    Tuo, Yanfeng; Jiang, Shujuan; Qian, Fang; Mu, Guangqing; Liu, Peng; Guo, Yuanji; Ma, Changlu

    2015-01-01

    Some strains of Lactobacillus genus have antiproliferative activities against cancer cells. However, until now, the exact effector molecules of Lactobacillus strains with anticancer activity have not been identified. The aim of the present study was to explore which fraction of the Lactobacillus cells exerts the highest antiproliferative effect. For this purpose, the heat-killed bacterial cells, bacterial cell wall extract, and genomic DNA of 8 Lactobacillus strains were prepared to assess their antiproliferative activities against human myeloid leukemia cell lines K562. The heat-killed bacterial cells of the 8 lactobacilli strains exerted antiproliferative effect on K562 cells, and the inhibition rates exerted by the heat-killed bacterial cells of the strains G15AL, M5AL, SB31AL, SB5AL, and T3AL were significantly higher than those exerted by the cell walls and genomic DNA of the strains. The bacterial DNA of G15AL exerted higher antiproliferative effect on K562 cells. The exact effector molecules and the effect mechanism of the strains should be further explored for the application of these strains as probiotic strains or bioactive probiotic molecules. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Strained hybrid perovskite thin films and their impact on the intrinsic stability of perovskite solar cells.

    Science.gov (United States)

    Zhao, Jingjing; Deng, Yehao; Wei, Haotong; Zheng, Xiaopeng; Yu, Zhenhua; Shao, Yuchuan; Shield, Jeffrey E; Huang, Jinsong

    2017-11-01

    Organic-inorganic hybrid perovskite (OIHP) solar cells have achieved comparable efficiencies to those of commercial solar cells, although their instability hinders their commercialization. Although encapsulation techniques have been developed to protect OIHP solar cells from external stimuli such as moisture, oxygen, and ultraviolet light, understanding of the origin of the intrinsic instability of perovskite films is needed to improve their stability. We show that the OIHP films fabricated by existing methods are strained and that strain is caused by mismatched thermal expansion of perovskite films and substrates during the thermal annealing process. The polycrystalline films have compressive strain in the out-of-plane direction and in-plane tensile strain. The strain accelerates degradation of perovskite films under illumination, which can be explained by increased ion migration in strained OIHP films. This study points out an avenue to enhance the intrinsic stability of perovskite films and solar cells by reducing residual strain in perovskite films.

  19. Strained hybrid perovskite thin films and their impact on the intrinsic stability of perovskite solar cells

    Science.gov (United States)

    Zhao, Jingjing; Deng, Yehao; Wei, Haotong; Zheng, Xiaopeng; Yu, Zhenhua; Shao, Yuchuan; Shield, Jeffrey E.; Huang, Jinsong

    2017-01-01

    Organic-inorganic hybrid perovskite (OIHP) solar cells have achieved comparable efficiencies to those of commercial solar cells, although their instability hinders their commercialization. Although encapsulation techniques have been developed to protect OIHP solar cells from external stimuli such as moisture, oxygen, and ultraviolet light, understanding of the origin of the intrinsic instability of perovskite films is needed to improve their stability. We show that the OIHP films fabricated by existing methods are strained and that strain is caused by mismatched thermal expansion of perovskite films and substrates during the thermal annealing process. The polycrystalline films have compressive strain in the out-of-plane direction and in-plane tensile strain. The strain accelerates degradation of perovskite films under illumination, which can be explained by increased ion migration in strained OIHP films. This study points out an avenue to enhance the intrinsic stability of perovskite films and solar cells by reducing residual strain in perovskite films. PMID:29159287

  20. Secretomic Analysis Identifies Alpha-1 Antitrypsin (A1AT) as a Required Protein in Cancer Cell Migration, Invasion, and Pericellular Fibronectin Assembly for Facilitating Lung Colonization of Lung Adenocarcinoma Cells*

    Science.gov (United States)

    Chang, Ying-Hua; Lee, Shu-Hui; Liao, I-Chuang; Huang, Shin-Huei; Cheng, Hung-Chi; Liao, Pao-Chi

    2012-01-01

    Metastasis is a major obstacle that must be overcome for the successful treatment of lung cancer. Proteins secreted by cancer cells may facilitate the progression of metastasis, particularly within the phases of migration and invasion. To discover metastasis-promoting secretory proteins within cancer cells, we used the label-free quantitative proteomics approach and compared the secretomes from the lung adenocarcinoma cell lines CL1-0 and CL1-5, which exhibit low and high metastatic properties, respectively. By employing quantitative analyses, we identified 660 proteins, 68 of which were considered to be expressed at different levels between the two cell lines. High levels of A1AT were secreted by CL1-5, and the roles of A1AT in the influence of lung adenocarcinoma metastasis were investigated. Molecular and pathological confirmation demonstrated that altered expression of A1AT correlates with the metastatic potential of lung adenocarcinoma. The migration and invasion properties of CL1-5 cells were significantly diminished by reducing the expression and secretion of their A1AT proteins. Conversely, the migration and invasion properties of CL1-0 cells were significantly increased through the overexpression and secretion of A1AT proteins. Furthermore, the assembly levels of the metastasis-promoting pericellular fibronectin (FN1), which facilitates colonization of lung capillary endothelia by adhering to the cell surface receptor dipeptidyl peptidase IV (DPP IV), were higher on the surfaces of suspended CL1-5 cells than on those of the CL1-0 cells. This discovery reflects previous findings in breast cancer. In line with this finding, FN1 assembly and the lung colonization of suspended CL1-5 cells were inhibited when endogenous A1AT protein was knocked down using siRNA. The major thrust of this study is to demonstrate the effects of coupling the label-free proteomics strategy with the secretomes of cancer cells that differentially exhibit invasive and metastatic

  1. Antimetastatic potential of amide-linked local anesthetics: inhibition of lung adenocarcinoma cell migration and inflammatory Src signaling independent of sodium channel blockade.

    Science.gov (United States)

    Piegeler, Tobias; Votta-Velis, E Gina; Liu, Guoquan; Place, Aaron T; Schwartz, David E; Beck-Schimmer, Beatrice; Minshall, Richard D; Borgeat, Alain

    2012-09-01

    Retrospective analysis of patients undergoing cancer surgery suggests the use of regional anesthesia may reduce cancer recurrence and improve survival. Amide-linked local anesthetics have antiinflammatory properties, although the mechanism of action in this regard is unclear. As inflammatory processes involving Src tyrosine protein kinase and intercellular adhesion molecule-1 are important in tumor growth and metastasis, we hypothesized that amide-linked local anesthetics may inhibit inflammatory Src-signaling involved in migration of adenocarcinoma cells. NCI-H838 lung cancer cells were incubated with tumor necrosis factor-α in absence/presence of ropivacaine, lidocaine, or chloroprocaine (1 nM-100 μM). Cell migration and total cell lysate Src-activation and intercellular adhesion molecule-1 phosphorylation were assessed. The role of voltage-gated sodium-channels in the mechanism of local anesthetic effects was also evaluated. Ropivacaine treatment (100 μM) of H838 cells for 20 min decreased basal Src activity by 62% (P=0.003), and both ropivacaine and lidocaine coadministered with tumor necrosis factor-α statistically significantly decreased Src-activation and intercellular adhesion molecule-1 phosphorylation, whereas chloroprocaine had no such effect. Migration of these cells at 4 h was inhibited by 26% (P=0.005) in presence of 1 μM ropivacaine and 21% by 1 μM lidocaine (P=0.004). These effects of ropivacaine and lidocaine were independent of voltage-gated sodium-channel inhibition. This study indicates that amide-, but not ester-linked, local anesthetics may provide beneficial antimetastatic effects. The observed inhibition of NCI-H838 cell migration by lidocaine and ropivacaine was associated with the inhibition of tumor necrosis factor-α-induced Src-activation and intercellular adhesion molecule-1 phosphorylation, providing the first evidence of a molecular mechanism that appears to be independent of their known role as sodium-channel blockers.

  2. Antitumor effects of the flavone chalcone: inhibition of invasion and migration through the FAK/JNK signaling pathway in human gastric adenocarcinoma AGS cells.

    Science.gov (United States)

    Lin, Su-Hsuan; Shih, Yuan-Wei

    2014-06-01

    Chalcones (benzylideneacetophenone) are cancer-preventive food components found in a human diet rich in fruits and vegetables. In this study, we first report the chemopreventive effect of chalcone in human gastric adenocarcinoma cell lines: AGS. The results showed that chalcone could inhibit the abilities of the adhesion, invasion, and migration by cell-matrix adhesion assay, Boyden chamber invasion/migration assay, and wound-healing assay. Molecular data showed that the effect of chalcone in AGS cells might be mediated via sustained inactivation of the phosphorylation of focal adhesion kinase (FAK) and c-Jun N-terminal kinase 1 and 2 (JNK1/2) signal involved in the downregulation of the expressions of matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9). Next, chalcone-treated AGS cells showed tremendous decrease in the phosphorylation and degradation of inhibitor of kappaBα (IκBα), the nuclear level of NF-κB, and the binding ability of NF-κB to NF-κB response element. Furthermore, treating FAK small interfering RNA (FAK siRNA) and specific inhibitor for JNK (SP600125) to AGS cells could reduce the phosphorylation of JNK1/2 and the activity of MMP-2 and MMP-9. Our results revealed that chalcone significantly inhibited the metastatic ability of AGS cells by reducing MMP-2 and MMP-9 expressions concomitantly with a marked reduction on cell invasion and migration through suppressing and JNK signaling pathways. We suggest that chalcone may offer the application in clinical medicine.

  3. Development of novel anti-Kv 11.1 antibody-conjugated PEG-TiO2 nanoparticles for targeting pancreatic ductal adenocarcinoma cells

    Science.gov (United States)

    Sette, Angelica; Spadavecchia, Jolanda; Landoulsi, Jessem; Casale, Sandra; Haye, Bernard; Crociani, Olivia; Arcangeli, Annarosa

    2013-12-01

    Titanium dioxide (TiO2) has been widely used in many nanotechnology areas including nanomedicine, where it could be proposed for the photodynamic and sonodynamic cancer therapies. However, TiO2 nanoformulations have been shown to be toxic for living cells. In this article, we report the development of a new delivery system, based on nontoxic TiO2 nanoparticles, further conjugated with a monoclonal antibody against a novel and easily accessible tumor marker, e.g., the Kv 11.1 potassium channel. We synthesized, by simple solvothermal method, dicarboxylic acid-terminated PEG TiO2 nanocrystals (PEG-TiO2 NPs). Anti-Kv 11.1 monoclonal antibodies (Kv 11.1-Mab) were further linked to the terminal carboxylic acid groups. Proper conjugation was confirmed by X-ray photoelectron spectroscopy analysis. Kv 11.1-Mab-PEG-TiO2 NPs efficiently recognized the specific Kv 11.1 antigen, both in vitro and in pancreatic ductal adenocarcinoma (PDAC) cells, which express the Kv 11.1 channel onto the plasma membrane. Both PEG TiO2 and Kv 11.1-Mab-PEG-TiO2 NPs were not cytotoxic, but only Kv 11.1-Mab-PEG-TiO2 NPs were efficiently internalized into PDAC cells. Data gathered from this study may have further applications for the chemical design of nanostructures to be applied for therapeutic purposes in pancreatic cancer.

  4. Neurological manifestation of colonic adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Uzair Chaudhary

    2012-04-01

    Full Text Available Paraneoplastic neurologic disorders are extremely rare in cancer patients and are most commonly associated with certain tumors, such as ovarian cancer, small cell lung cancer, and breast cancer. We report here a paraneoplastic neurological syndrome in a 53-year-old man with colonic adenocarcinoma with a solitary liver metastasis. His paraneoplastic syndrome was successfully treated by methylprednisolone and primary oncologic therapies including neoadjuvant chemotherapy and definitive surgery. This is also the first documented case of simultaneous manifestation of a sensory neuropathy and limbic encephalitis with colon cancer.

  5. Cyclic strain increases protease-activated receptor-1 expression in vascular smooth muscle cells

    Science.gov (United States)

    Nguyen, K. T.; Frye, S. R.; Eskin, S. G.; Patterson, C.; Runge, M. S.; McIntire, L. V.

    2001-01-01

    Cyclic strain regulates many vascular smooth muscle cell (VSMC) functions through changing gene expression. This study investigated the effects of cyclic strain on protease-activated receptor-1 (PAR-1) expression in VSMCs and the possible signaling pathways involved, on the basis of the hypothesis that cyclic strain would enhance PAR-1 expression, reflecting increased thrombin activity. Uniaxial cyclic strain (1 Hz, 20%) of cells cultured on elastic membranes induced a 2-fold increase in both PAR-1 mRNA and protein levels. Functional activity of PAR-1, as assessed by cell proliferation in response to thrombin, was also increased by cyclic strain. In addition, treatment of cells with antioxidants or an NADPH oxidase inhibitor blocked strain-induced PAR-1 expression. Preincubation of cells with protein kinase inhibitors (staurosporine or Ro 31-8220) enhanced strain-increased PAR-1 expression, whereas inhibitors of NO synthase, tyrosine kinase, and mitogen-activated protein kinases had no effect. Cyclic strain in the presence of basic fibroblast growth factor induced PAR-1 mRNA levels beyond the effect of cyclic strain alone, whereas no additive effect was observed between cyclic strain and platelet-derived growth factor-AB. Our findings that cyclic strain upregulates PAR-1 mRNA expression but that shear stress downregulates this gene in VSMCs provide an opportunity to elucidate signaling differences by which VSMCs respond to different mechanical forces.

  6. miR-107 and miR-25 simultaneously target LATS2 and regulate proliferation and invasion of gastric adenocarcinoma (GAC) cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Mingjun; Wang, Xiaolei [Cancer Center, The Second Affiliated Hospital of Anhui Medical University, Hefei 230601 (China); Li, Wanhu [MRI Room of Shandong Cancer Hospital & Institute, Jinan 250117 (China); Cui, Yongchun, E-mail: yongchuncui1@126.com [Drug Clinical Trial Institution of Shandong Cancer Hospital & Institute, #440, Jiyan Road, Jinan 250117 (China)

    2015-05-08

    Although a series of oncogenes and tumor suppressors were identified in the pathological development of gastric adenocarcinoma (GAC), the underlying molecule mechanism were still not fully understood. The current study explored the expression profile of miR-107 and miR-25 in GAC patients and their downstream regulative network. qRT-PCR analysis was performed to quantify the expression of these two miRNAs in serum samples from both patients and healthy controls. Dual luciferase assay was conducted to verify their putative bindings with LATS2. MTT assay, cell cycle assay and transwell assay were performed to explore how miR-107 and miR-25 regulate proliferation and invasion of gastric cancer cells. Findings of this study demonstrated that total miR-107 or miR-25 expression might be overexpressed in gastric cancer patients and they can simultaneously and synchronically regulate LATS2 expression, thereby affecting gastric cancer cell growth and invasion. Therefore, the miR-25/miR-107-LATS2 axis might play an important role in proliferation and invasion of the gastric cancer cells. - Highlights: • Total miR-107 and miR-25 expression is significantly increased in GAC patients. • Both miR-107 and miR-25 can promote proliferation and invasion of GAC cells. • Both miR-107 and miR-25 can target LATS2 and regulate its expression. • miR-107 and miR-25 regulate proliferation and invasion of GAC cells though LATS2.

  7. MiRNA-26a Contributes to the Acquisition of Malignant Behaviors of Doctaxel-Resistant Lung Adenocarcinoma Cells through Targeting EZH2

    Directory of Open Access Journals (Sweden)

    Jing Chen

    2017-02-01

    Full Text Available Background/Aims: Accumulating evidence revealed that microRNAs (miRNAs have been demonstrated as critical molecules in tumor development and progression. MiR-26a, located in a fragile chromosomal region associated with various human cancer, has been reported to be involved in regulating various cellular process, such as proliferation, apoptosis and invasion through targeting multiple oncogene. Docetaxel-mediated chemotherapy has been applied in improving the survival and prognosis of patients with advanced lung adenocarcinoma (LAD. However, chemoresistance remains a major impediment to clinical application of this agent. It has been presented that decreased miR-26a expression lead to cisplatin resistance and promoted growth and migration in human lung cancer. Enhancer of zeste homolog 2 (EZH2 is the target of miR-26a. The present study aimed to investigate the function of miR-26a/EZH2 in the acquisition of malignant behaviors of LAD. Methods: MiR-26a and EZH2 expression levels in the dcetaxel-insensitive groups (n = 19 and the docetaxel-sensitive groups (n = 18 were assessed by qRT-PCR. Colony formation assay, flow cytometric analysis, wound healing assay, cell transwell assays and western blotting were performed to assess the effects of miR-26a on proliferation, apoptosis and epithelial-to-mesenchymal (EMT phenotypes in docetaxel resistant LAD cells in vitro. Xenograft transplantation, immunohistochemistry, tunel assays and western blotting assays were employed to demonstrate the role of miR-26a in docetaxel resistant LAD cells in vivo. The expression level of EZH2 in docetaxel-resistant LAD cells and corresponding parental cells was detected by qRT-PCR and western blotting. The relationship between miR-26a and EZH2 was confirmed by luciferase reporter assay. And rescue assays were performed to further confirm that miRNA-26a contributes to the acquisition of malignant behaviors of docetaxel-resistant LAD cells through targeting EZH2. Results

  8. [Construction of a recombinant stable Ba/F3 cell strain containing Tpr-Met].

    Science.gov (United States)

    Shu, Ling-fei; Li, Wei; Zhan, Yi-qun; Xu, Wang-xiang; Yang, Xiao-ming; Li, Chang-yan

    2012-11-01

    To construct a stable cell strain encoding tumor-associated fused gene which expresses oncoprotein Tpr-Met. We transfected Tpr-Met vector into Ba/F3 cells and screened the cell strain stably expressing Tpr-Met. The interleukin 3 (IL-3) independent proliferation of the cells was measured using the MTS assay. The expression of Tpr-Met, the activity of downstream signal transduction pathway and SU11274-induced inhibition of the signal pathway were investigated by Western blotting. We obtained a Ba/F3 cell strain stably expressing Tpr-Met. The cells presented IL-3 independent proliferation, suggesting a malignant transformation of the cell line. In Tpr-Met transformed Ba/F3 cells, the phosphorylation of Met and ERK were enhanced; however, specific c-Met inhibitor SU11274 suppressed the cell proliferation and c-Met phosphorylation. Tpr-Met transformed Ba/F3 strain has been successfully constructed.

  9. Ca2+ entry is essential for cell strain-induced lamellar body fusion in isolated rat type II pneumocytes

    NARCIS (Netherlands)

    Frick, Manfred; Bertocchi, Cristina; Jennings, Paul; Haller, Thomas; Mair, Norbert; Singer, Wolfgang; Pfaller, Walter; Ritsch-Marte, Monika; Dietl, Paul

    Using a new equibiaxial strain device, we investigated strain-induced Ca2+ signals and their relation to lamellar body (LB) exocytosis in single rat alveolar type II (AT II) cells. The strain device allows observation of single cells while inducing strain to the entire substratum. AT II cells

  10. 5 alpha-reductase-catalyzed conversion of testosterone to dihydrotestosterone is increased in prostatic adenocarcinoma cells: suppression by 15-lipoxygenase metabolites of gamma-linolenic and eicosapentaenoic acids.

    Science.gov (United States)

    Pham, Hung; Ziboh, Vincent A

    2002-11-01

    Although the androgens, testosterone (T) and its highly active metabolite dihydrotestosterone (DHT) play a role in the development and progression of prostate cancer, the mechanism(s) are unclear. Furthermore, 5 alpha-reductase which catalyze the conversion of T to DHT, has been a target of manipulation in the treatment of prostatic cancer, hence synthetic 5 alpha-reductase activity inhibitors have shown therapeutic promise. To demonstrate that nutrients derived from dietary sources can exert similar therapeutic promise, this study was designed using benign hyperplastic cells (BHC) and malignant tumorigenic cells (MTC) derived from Lobund-Wistar (L-W) rat model of prostatic adenocarcinoma to test the effects of gamma-linolenic acid (GLA), eicosapentaenoic acid (EPA) and their 15-lipoxygenase metabolites on cellular 5 alpha-reductase activity. Our data revealed: (i) that incubation of MTC with [3H]-T resulted in marked conversion to [3H]-DHT when compared to similar incubation with BHC; (ii) that DHT-enhanced activity of 5 alpha-reductase was inhibited 80% by 15S-hydroxyeicosatrienoic acid, the 15-lipoxygenase metabolite of GLA, when compared to 55% by 15S-hydroxyeicosapentaenoic acid, the 15-lipoxygenase metabolite of EPA; and (iii) that their precursor fatty acids, respectively, exerted moderate inhibition. Taken together, the study underscores the biological importance of 15-lipoxygenase metabolites of polyunsaturated fatty acids (PUFAs) in androgen metabolism.

  11. Histone deacetylase 1/Sp1/microRNA-200b signaling accounts for maintenance of cancer stem-like cells in human lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Dong-Qin Chen

    Full Text Available The presence of cancer stem-like cells (CSCs is one of the mechanisms responsible for chemoresistance that has been a major hindrance towards lung adenocarcinoma (LAD treatment. Recently, we have identified microRNA (miR-200b as a key regulator of chemoresistance in human docetaxel-resistant LAD cells. However, whether miR-200b has effects on regulating CSCs remains largely unclear and needs to be further elucidated. Here, we showed that miR-200b was significantly downregulated in CD133+/CD326+ cells that exhibited properties of CSCs derived from docetaxel-resistant LAD cells. Also, restoration of miR-200b could inhibit maintenance and reverse chemoresistance of CSCs. Furthermore, suppressor of zeste-12 (Suz-12 was identified as a direct and functional target of miR-200b, and silencing of Suz-12 phenocopied the effects of miR-200b on CSCs. Additionally, overexpression of histone deacetylase (HDAC 1 was identified as a pivotal mechanism responsible for miR-200b repression in CSCs through a specificity protein (Sp 1-dependent mechanism, and restoration of miR-200b by HDAC1 repression significantly suppressed CSCs formation and reversed chemoresistance of CSCs by regulating Suz-12-E-cadherin signaling. Also, downregulation of HDAC1 or upregulation of miR-200b reduced the in vivo tumorigenicity of CSCs. Finally, Suz-12 was inversely correlated with miR-200b, positively correlated with HDAC1 and up-regulated in docetaxel-resistant LAD tissues compared with docetaxel-sensitive tissues. Taken together, the HDAC1/miR-200b/Suz-12-E-cadherin signaling might account for maintenance of CSCs and formation of chemoresistant phenotype in docetaxel-resistant LAD cells.

  12. STAT6 siRNA Matrix-Loaded Gelatin Nanocarriers: Formulation, Characterization, and Ex Vivo Proof of Concept Using Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Susanne R. Youngren

    2013-01-01

    Full Text Available The clinical utility of siRNA therapy has been hampered due to poor cell penetration, nonspecific effects, rapid degradation, and short half-life. We herewith proposed the formulation development of STAT6 siRNA (S6S nanotherapeutic agent by encapsulating them within gelatin nanocarriers (GNC. The prepared nanoformulation was characterized for size, charge, loading efficiency, release kinetics, stability, cytotoxicity, and gene silencing assay. The stability of S6S-GNC was also assessed under conditions of varying pH, serum level, and using electrophoretic assays. In vitro cytotoxicity performance was evaluated in human adenocarcinoma A549 cells following MTT assay. The developed formulation resulted in an average particle size, surface charge, and encapsulation efficiency as 70±6.5 nm, +10±1.5 mV, and 85±4.0%, respectively. S6S-GNC showed an insignificant (P<0.05 change in the size and charge in the presence of buffer solutions (pH 6.4 to 8.4 and FBS (10% v/v. A549 cells were treated with native S6S, S6S-lipofectamine, placebo-GNC, and S6S-GNC using untreated cells as a control. It was observed that cell viability was decreased significantly with S6S-GNC by 55±4.1% (P<0.001 compared to native S6S (2.0±0.55% and S6S-lipofectamine complex (40±3.1%. This investigation infers that gelatin polymer-based nanocarriers are a robust, stable, and biocompatible strategy for the delivery of siRNA.

  13. STAT6 siRNA matrix-loaded gelatin nanocarriers: formulation, characterization, and ex vivo proof of concept using adenocarcinoma cells.

    Science.gov (United States)

    Youngren, Susanne R; Tekade, Rakesh K; Gustilo, Brianne; Hoffmann, Peter R; Chougule, Mahavir B

    2013-01-01

    The clinical utility of siRNA therapy has been hampered due to poor cell penetration, nonspecific effects, rapid degradation, and short half-life. We herewith proposed the formulation development of STAT6 siRNA (S6S) nanotherapeutic agent by encapsulating them within gelatin nanocarriers (GNC). The prepared nanoformulation was characterized for size, charge, loading efficiency, release kinetics, stability, cytotoxicity, and gene silencing assay. The stability of S6S-GNC was also assessed under conditions of varying pH, serum level, and using electrophoretic assays. In vitro cytotoxicity performance was evaluated in human adenocarcinoma A549 cells following MTT assay. The developed formulation resulted in an average particle size, surface charge, and encapsulation efficiency as 70 ± 6.5 nm, +10 ± 1.5 mV, and 85 ± 4.0%, respectively. S6S-GNC showed an insignificant (P < 0.05) change in the size and charge in the presence of buffer solutions (pH 6.4 to 8.4) and FBS (10% v/v). A549 cells were treated with native S6S, S6S-lipofectamine, placebo-GNC, and S6S-GNC using untreated cells as a control. It was observed that cell viability was decreased significantly with S6S-GNC by 55 ± 4.1% (P < 0.001) compared to native S6S (2.0 ± 0.55%) and S6S-lipofectamine complex (40 ± 3.1%). This investigation infers that gelatin polymer-based nanocarriers are a robust, stable, and biocompatible strategy for the delivery of siRNA.

  14. MicroRNA-451 induces epithelial-mesenchymal transition in docetaxel-resistant lung adenocarcinoma cells by targeting proto-oncogene c-Myc.

    Science.gov (United States)

    Chen, Dongqin; Huang, Jiayuan; Zhang, Kai; Pan, Banzhou; Chen, Jing; De, Wei; Wang, Rui; Chen, Longbang

    2014-11-01

    Epithelial-mesenchymal transition (EMT) has been reported to play a significant role in tumour metastasis as well as chemoresistance. However, the molecular mechanisms involved in chemotherapy-induced EMT are still unclear. MicroRNA (miRNA) expression and functions have been reported to contribute to phenotypic features of tumour cells. To investigate the roles of miRNAs in chemotherapy-induced EMT, we established two docetaxel-resistant lung adenocarcinoma (LAD) cell models (SPC-A1/DTX and H1299/DTX), which display EMT-like properties and gain increased invasion or migration activity. MiR-451 was found to be significantly downregulated in docetaxel-resistant LAD cells, and re-expression of miR-451 could reverse EMT to mesenchymal-epithelial transition (MET) and inhibit invasion and metastasis of docetaxel-resistant LAD cells both in vitro and in vivo. The proto-oncogene c-Myc was identified as a direct and functional target of miR-451, and further researches confirmed that overexpression of c-Myc which induced extracellular-signal-regulated kinase (ERK)-dependent glycogen synthase kinase-3 beta (GSK-3β) inactivation and subsequent snail activation is essential for acquisition of EMT phenotype induced by loss of miR-451. Furthermore, c-Myc was significantly upregulated in docetaxel-non-responding LAD tissues in comparison with docetaxel-responding tissues, and its expression was inversely correlated with miR-451 expression. This study first reported the involvement of miR-451/c-Myc/ERK/GSK-3β signalling axis in the acquisition of EMT phenotype in docetaxel-resistant LAD cells, suggesting that re-expression of miR-451 or targeting c-Myc will be a potential strategy for the treatment of chemoresistant LAD patients. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. MV-NIS Infected Mesenchymal Stem Cells in Treating Patients With Recurrent Ovarian Cancer

    Science.gov (United States)

    2018-01-31

    Malignant Ovarian Brenner Tumor; Ovarian Clear Cell Adenocarcinoma; Ovarian Endometrioid Adenocarcinoma; Ovarian Mucinous Adenocarcinoma; Ovarian Seromucinous Carcinoma; Ovarian Serous Adenocarcinoma; Ovarian Transitional Cell Carcinoma; Recurrent Ovarian Carcinoma; Recurrent Primary Peritoneal Carcinoma; Undifferentiated Ovarian Carcinoma

  16. Mucinous Adenocarcinoma of Colon

    OpenAIRE

    Jamshed Akhtar; Soofia Ahmed; Naima Zamir

    2010-01-01

    Bleeding per rectum is a common complaint in pediatric age group and mostly relates to benign conditions. Underlying colorectal carcinoma is a rare cause and carries a poor prognosis. We report two cases of mucinous adenocarcinoma of colon, one in a 9 years old male and other in a female of 12 years. The boy presented with rectal bleeding and increasing constipation of more than three years duration. He had mucinous adenocarcinoma (T3N0MX) of rectosigmoid region and underwent local complete r...

  17. 1-(2,6-Dihydroxy-4-methoxyphenyl-2-(4-hydroxyphenyl Ethanone-Induced Cell Cycle Arrest in G1/G0 in HT-29 Cells Human Colon Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Ma Ma Lay

    2014-01-01

    Full Text Available 1-(2,6-Dihydroxy-4-methoxyphenyl-2-(4-hydroxyphenyl ethanone (DMHE was isolated from the ethyl acetate fraction of Phaleria macrocarpa (Scheff. Boerl fruits and the structure confirmed by GC-MS (gas chromatography-mass spectrometry and NMR (nuclear magnetic resonance analysis. This compound was tested on the HT-29 human colon adenocarcinoma cell line using MTT (method of transcriptional and translational cell proliferation assay. The results of MTT assay showed that DMHE exhibited good cytotoxic effect on HT-29 cells in a dose- and time-dependent manner but no cytotoxic effect on the MRC-5 cell line after 72 h incubation. Morphological features of apoptotic cells upon treatment by DMHE, e.g., cell shrinkage and membrane blebbing, were examined by an inverted and phase microscope. Other features, such as chromatin condension and nuclear fragmentation were studied using acridine orange and propidium iodide staining under the fluorescence microscope. Future evidence of apoptosis/necrosis was provided by result fromannexin V-FITC/PI (fluorescein-isothiocyanate/propidium iodide staining revealed the percentage of early apoptotic, late apoptotic, necrotic and live cells in a dose- and time-dependent manner using flow cytometry. Cell cycle analysis showed G0/G1 arrest in a time-dependent manner. A western blot analysis indicated that cell death might be associated with the up-regulation of the pro-apoptotic proteins Bax PUMA. However, the anit-apotptic proteins Bcl-2, Bcl-xL, and Mcl-1 were also found to increase in a time-dependent manner. The expression of the pro-apoptotic protein Bak was not observed.

  18. ADHESION OF 3 LACTOBACILLUS STRAINS TO HUMAN URINARY AND INTESTINAL EPITHELIAL-CELLS

    NARCIS (Netherlands)

    REID, G; SERVIN, AL; BRUCE, AW; BUSSCHER, HJ

    1993-01-01

    Three strains of urogenital lactobacilli were found to adhere in phosphate buffered saline to human uroepithelial cells in vitro according to thermodynamic principles, and to adhere in culture medium to intestinal cells with no such correlation. The most hydrophilic strain (water contact angle

  19. SIRT1 inhibits proliferation of pancreatic cancer cells expressing pancreatic adenocarcinoma up-regulated factor (PAUF), a novel oncogene, by suppression of {beta}-catenin

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Il-Rae [WCU, Department of Cogno-Mechatronics Engineering, Pusan National University, Busan 609-735 (Korea, Republic of); Koh, Sang Seok [Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 305-333 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology, Daejeon 305-333 (Korea, Republic of); Malilas, Waraporn; Srisuttee, Ratakorn; Moon, Jeong [WCU, Department of Cogno-Mechatronics Engineering, Pusan National University, Busan 609-735 (Korea, Republic of); Choi, Young-Whan [Department of Horticultural Bioscience, Pusan National University, Miryang 627-706 (Korea, Republic of); Horio, Yoshiyuki [Department of Pharmacology, Sapporo Medical University, Sapporo 060-8556 (Japan); Oh, Sangtaek [Department of Advanced Fermentation Fusion Science and Technology, Kookmin University, Seoul 136-702 (Korea, Republic of); Chung, Young-Hwa, E-mail: younghc@pusan.ac.kr [WCU, Department of Cogno-Mechatronics Engineering, Pusan National University, Busan 609-735 (Korea, Republic of)

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer SIRT1 inhibits protein levels of {beta}-catenin and its transcriptional activity. Black-Right-Pointing-Pointer Nuclear localization of SIRT1 is not required for the decrease of {beta}-catenin expression. Black-Right-Pointing-Pointer SIRT1-mediated degradation of {beta}-catenin is not required for GSK-3{beta} and Siah-1 but for proteosome. Black-Right-Pointing-Pointer SIRT1 activation inhibits proliferation of pancreatic cancer cells expressing PAUF. -- Abstract: Because we found in a recent study that pancreatic adenocarcinoma up-regulated factor (PAUF), a novel oncogene, induces a rapid proliferation of pancreatic cells by up-regulation of {beta}-catenin, we postulated that {beta}-catenin might be a target molecule for pancreatic cancer treatment. We thus speculated whether SIRT1, known to target {beta}-catenin in a colon cancer model, suppresses {beta}-catenin in those pancreatic cancer cells that express PAUF (Panc-PAUF). We further evaluated whether such suppression would lead to inhibition of the proliferation of these cells. The ectopic expression of either SIRT1 or resveratrol (an activator of SIRT1) suppressed levels of {beta}-catenin protein and its transcriptional activity in Panc-PAUF cells. Conversely, suppression of SIRT1 expression by siRNA enhanced {beta}-catenin expression and transcriptional activity. SIRT1 mutant analysis showed that nuclear localization of SIRT1 is not required for reduction of {beta}-catenin. Treatment with MG132, a proteasomal inhibitor, restored {beta}-catenin protein levels, suggesting that SIRT1-mediated degradation of {beta}-catenin requires proteasomal activity. It was reported that inhibition of GSK-3{beta} or Siah-1 stabilizes {beta}-catenin in colon cancer cells, but suppression of GSK-3{beta} or Siah-1 using siRNA in the presence of resveratrol instead diminished {beta}-catenin protein levels in Panc-PAUF cells. This suggests that GSK-3{beta} and Siah-1 are not involved in SIRT1

  20. Coordinate up-regulation of low-density lipoprotein receptor and cyclo-oxygenase-2 gene expression in human colorectal cells and in colorectal adenocarcinoma biopsies

    Science.gov (United States)

    Lum, D. F.; McQuaid, K. R.; Gilbertson, V. L.; Hughes-Fulford, M.

    1999-01-01

    Many colorectal cancers have high levels of cyclo-oxygenase 2 (COX-2), an enzyme that metabolizes the essential fatty acids into prostaglandins. Since the low-density lipoprotein receptor (LDLr) is involved in the uptake of essential fatty acids, we studied the effect of LDL on growth and gene regulation in colorectal cancer cells. DiFi cells grown in lipoprotein-deficient sera (LPDS) grew more slowly than cells with LDL. LDLr antibody caused significant inhibition of tumor cell growth but did not affect controls. In addition, LDL uptake did not change in the presence of excess LDL, suggesting that ldlr mRNA lacks normal feedback regulation in some colorectal cancers. Analysis of the ldlr mRNA showed that excess LDL in the medium did not cause down-regulation of the message even after 24 hr. The second portion of the study examined the mRNA expression of ldlr and its co-regulation with cox-2 in normal and tumor specimens from patients with colorectal adenocarcinomas. The ratio of tumor:paired normal mucosa of mRNA expression of ldlr and of cox-2 was measured in specimens taken during colonoscopy. ldlr and cox-2 transcripts were apparent in 11 of 11 carcinomas. There was significant coordinate up-regulation both of ldlr and of cox-2 in 6 of 11 (55%) tumors compared with normal colonic mucosa. There was no up-regulation of cox-2 without concomitant up-regulation of ldlr. These data suggest that the LDLr is abnormally regulated in some colorectal tumors and may play a role in the up-regulation of cox-2. Copyright 1999 Wiley-Liss, Inc.

  1. Adenocarcinoma of the urinary bladder, mesonephroid type: a rare case

    Directory of Open Access Journals (Sweden)

    Mahmoud Abbas

    2013-02-01

    Full Text Available Primary adenocarcinoma of the urinary bladder is a rare disease. It occurs in 0.5-2% of all bladder cancers and is discussed as the malignant counterpart of nephrogenic adenomas. We report a 46-year-old white female presented with gross hematuria for clinical examination. Histopathology revealed pT2, Pn1, L1, G2 adenocarcinoma of the bladder and carcinoma in situ according to the TNM classification. Computed tomography scan diagnostic was unremarkable. Patients with adenocarcinoma of the urinary bladder should be treated vigorously and without time delay. Only 7 cases of adenocarcinoma in the urinary bladder (mesonephroid have been described until now. We present a case of clear cell adenocarcinoma of the urinary bladder, mesonephroid type that early diagnosed and till now 3 months after the cystectomy without symptoms and without complications.

  2. SMAD4 loss enables EGF, TGFβ1 and S100A8/A9 induced activation of critical pathways to invasion in human pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Moz, Stefania; Basso, Daniela; Bozzato, Dania; Galozzi, Paola; Navaglia, Filippo; Negm, Ola H; Arrigoni, Giorgio; Zambon, Carlo-Federico; Padoan, Andrea; Tighe, Paddy; Todd, Ian; Franchin, Cinzia; Pedrazzoli, Sergio; Punzi, Leonardo; Plebani, Mario

    2016-10-25

    Epidermal Growth Factor (EGF) receptor overexpression, KRAS, TP53, CDKN2A and SMAD4 mutations characterize pancreatic ductal adenocarcinoma. This mutational landscape might influence cancer cells response to EGF, Transforming Growth Factor β1 (TGFβ1) and stromal inflammatory calcium binding proteins S100A8/A9. We investigated whether chronic exposure to EGF modifies in a SMAD4-dependent manner pancreatic cancer cell signalling, proliferation and invasion in response to EGF, TGFβ1 and S100A8/A9. BxPC3, homozigously deleted (HD) for SMAD4, and BxPC3-SMAD4+ cells were or not stimulated with EGF (100 ng/mL) for three days. EGF pre-treated and non pretreated cells were stimulated with a single dose of EGF (100 ng/mL), TGFβ1 (0,02 ng/mL), S100A8/A9 (10 nM). Signalling pathways (Reverse Phase Protein Array and western blot), cell migration (Matrigel) and cell proliferation (XTT) were evaluated. SMAD4 HD constitutively activated ERK and Wnt/β-catenin, while inhibiting PI3K/AKT pathways. These effects were antagonized by chronic EGF, which increased p-BAD (anti-apoptotic) in response to combined TGFβ1 and S100A8/A9 stimulation. SMAD4 HD underlied the inhibition of NF-κB and PI3K/AKT in response to TGFβ1 and S100A8/A9, which also induced cell migration. Chronic EGF exposure enhanced cell migration of both BxPC3 and BxPC3-SMAD4+, rendering the cells less sensitive to the other inflammatory stimuli. In conclusion, SMAD4 HD is associated with the constitutive activation of the ERK and Wnt/β-catenin signalling pathways, and favors the EGF-induced activation of multiple signalling pathways critical to cancer proliferation and invasion. TGFβ1 and S100A8/A9 mainly inhibit NF-κB and PI3K/AKT pathways and, when combined, sinergize with EGF in enhancing anti-apoptotic p-BAD in a SMAD4-dependent manner.

  3. Identification of Subtype-Specific Prognostic Genes for Early-Stage Lung Adenocarcinoma and Squamous Cell Carcinoma Patients Using an Embedded Feature Selection Algorithm.

    Directory of Open Access Journals (Sweden)

    Suyan Tian

    Full Text Available The existence of fundamental differences between lung adenocarcinoma (AC and squamous cell carcinoma (SCC in their underlying mechanisms motivated us to postulate that specific genes might exist relevant to prognosis of each histology subtype. To test on this research hypothesis, we previously proposed a simple Cox-regression model based feature selection algorithm and identified successfully some subtype-specific prognostic genes when applying this method to real-world data. In this article, we continue our effort on identification of subtype-specific prognostic genes for AC and SCC, and propose a novel embedded feature selection method by extending Threshold Gradient Descent Regularization (TGDR algorithm and minimizing on a corresponding negative partial likelihood function. Using real-world datasets and simulated ones, we show these two proposed methods have comparable performance whereas the new proposal is superior in terms of model parsimony. Our analysis provides some evidence on the existence of such subtype-specific prognostic genes, more investigation is warranted.

  4. A comparative study of clinicopathological significance, FGFBP1, and WISP-2 expression between squamous cell/adenosquamous carcinomas and adenocarcinoma of the gallbladder.

    Science.gov (United States)

    Yang, Zhulin; Yang, Zhi; Zou, Qiong; Yuan, Yuan; Li, Jinghe; Li, Daiqiang; Liang, Lufeng; Zeng, Guixiang; Chen, Senlin

    2014-04-01

    The differences in clinical, pathological, and biological characteristics between adenocarcinoma (AC) and squamous cell/adenosquamous carcinoma (SC/ASC) of gallbladder cancer have not been well documented. This study is to compare the clinicopathological characteristics and FGFBP1 and WISP-2 expression between AC and SC/ASC patients. We examined FGFBP1 and WISP-2 expression in 46 SC/ASC and 80 AC samples using immunohistochemistry and analyzed their correlations with clinicopathological characteristics. SC/ASCs occur more frequently in older patients and often correspond to larger tumor masses than ACs. Positive FGFBP1 and negative WISP-2 expression were significantly associated with lymph node metastasis and invasion of SC/ASCs and ACs. In addition, positive FGFBP1 and negative WISP-2 expression were significantly associated with differentiation and TMN stage in ACs. Univariate Kaplan-Meier analysis showed that either elevated FGFBP1 (p WISP-2 (p WISP-2 expression (p = 0.035 for SC/ASC and p = 0.009 for AC) is an independent predictor of poor prognosis in both SC/ASC and AC patients. We also revealed that differentiation, tumor size, TNM stage, lymph node metastasis, invasion, and surgical procedure were associated with survival of both SC/ASC and AC patients. Our study suggested that the overexpression of FGFBP1 or loss of WISP-2 expression is closely related to the metastasis, invasion and poor prognosis of gallbladder cancer.

  5. Modulation of DNA methylation levels sensitizes doxorubicin-resistant breast adenocarcinoma cells to radiation-induced apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Luzhna, Lidia [Department of Biological Sciences, University of Lethbridge, AB, Canada T1K 3M4 (Canada); Kovalchuk, Olga, E-mail: olga.kovalchuk@uleth.ca [Department of Biological Sciences, University of Lethbridge, AB, Canada T1K 3M4 (Canada)

    2010-02-05

    Chemoresistant tumors often fail to respond to other cytotoxic treatments such as radiation therapy. The mechanisms of chemo- and radiotherapy cross resistance are not fully understood and are believed to be epigenetic in nature. We hypothesize that MCF-7 cells and their doxorubicin-resistant variant MCF-7/DOX cells may exhibit different responses to ionizing radiation due to their dissimilar epigenetic status. Similar to previous studies, we found that MCF-7/DOX cells harbor much lower levels of global DNA methylation than MCF-7 cells. Furthermore, we found that MCF-7/DOX cells had lower background apoptosis levels and were less responsive to radiation than MCF-7 cells. Decreased radiation responsiveness correlated to significant global DNA hypomethylation in MCF-7/DOX cells. Here, for the first time, we show that the radiation resistance of MCF-7/DOX cells can be reversed by an epigenetic treatment - the application of methyl-donor SAM. SAM-mediated reversal of DNA methylation led to elevated radiation sensitivity in MCF-7/DOX cells. Contrarily, application of SAM on the radiation sensitive and higher methylated MCF-7 cells resulted in a decrease in their radiation responsiveness. This data suggests that a fine balance of DNA methylation is needed to insure proper radiation and drug responsiveness.

  6. Antiproliferative effects on colon adenocarcinoma cells induced by co-administration of vitamin K1 and Lactobacillus rhamnosus GG.

    Science.gov (United States)

    Orlando, Antonella; Linsalata, Michele; Russo, Francesco

    2016-06-01

    Vitamin K (VK), an essential nutrient associated with the clotting cascade, has also been demonstrated to have anticancer properties in various cancer cells including colon cancer cells. Also probiotics have gained interest as potential anticancer agents. Among them, Lactobacillus rhamnosus GG (L.GG) has been shown to inhibit cell proliferation and polyamine biosynthesis as well as to induce apoptosis in different human gastrointestinal cancer cells. Nevertheless, the exact mechanisms involved in these actions are not completely elucidated. Therefore, the aims of the present study were to evaluate in three differently graded human colon cancer cells (namely Caco-2, HT-29 and SW480) the effects of increasing VK1 concentrations, administered alone or in combination with viable L.GG, on the cell proliferation evaluated by MTT test, apoptosis investigated by Bax/Bcl-2 ratio and the percentage of the apoptotic cells, and the cell cycle evaluated by MUSE cell analyzer. Both VK1 and L.GG administered alone up to 72 h, caused inhibition of proliferation, induction of apoptosis and the cell cycle arrest in all the tested colon cancer cells. When VK1 and L.GG were co-administered, the addition of increasing VK1 concentrations potentiated the probiotic antiproliferative effect in a dose-dependent manner, being also related to the individual features of each cell line. The effect was more evident in Caco-2 and HT-29 cells compared to the less differentiated SW480. The enhanced antiproliferative efficacy due to co-administration of L.GG and VK1 could represent a suitable option in a functional food strategy for cancer growth inhibition and chemoprevention.

  7. Induction of apoptosis in human breast adenocarcinoma MCF-7 ...

    African Journals Online (AJOL)

    Induction of apoptosis in human breast adenocarcinoma MCF-7 cells by tannic acid and resveratrol. Ahu Soyocak, Didem Turgut Cosan, Ayse Basaran, Hasan Veysi Gunes, Irfan Degirmenci, Fezan Sahin Mutlu ...

  8. CK2 inhibitor CX-4945 blocks TGF-β1-induced epithelial-to-mesenchymal transition in A549 human lung adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Jiyeon Kim

    Full Text Available BACKGROUND: The epithelial-to-mesenchymal transition (EMT is a major phenotype of cancer metastasis and invasion. As a druggable cancer target, the inhibition of protein kinase CK2 (formally named to casein kinase 2 has been suggested as a promising therapeutic strategy to treat EMT-controlled cancer metastasis. This study aimed to evaluate the effect of the CK2 inhibitor CX-4945 on the processes of cancer migration and invasion during the EMT in A549 human lung adenocarcinoma cells. MATERIALS AND METHODS: The effect of CX-4945 on TGF-β1-induced EMT was evaluated in A549 cells treated with TGF-β1 (5 ng/ml and CX-4945. The effect of CX-4945 on TGF-β1-induced cadherin switch and activation of key signaling molecules involved in Smad, non-Smad, Wnt and focal adhesion signaling pathways were investigated by Western blot analysis, immunocytochemistry and reporter assay. Additionally, the effect of CX-4945 on TGF-β1-induced migration and invasion was investigated by wound healing assay, Boyden chamber assay, gelatin zymography, and the quantitative real-time PCR. RESULTS: CX-4945 inhibits the TGF-β1-induced cadherin switch and the activation of key signaling molecules involved in Smad (Smad2/3, Twist and Snail, non-Smad (Akt and Erk, Wnt (β-catenin and focal adhesion signaling pathways (FAK, Src and paxillin that cooperatively regulate the overall process of EMT. As a result, CX-4945 inhibits the migration and invasion of A549 cells accompanied with the downregulation of MMP-2 and 9. CONCLUSIONS: Clinical evaluation of CX-4945 in humans as a single agent in solid tumors and multiple myeloma has established its promising pharmacokinetic, pharmacodynamic, and safety profiles. Beyond regression of tumor mass, CX-4945 may be advanced as a new therapy for cancer metastasis and EMT-related disorders.

  9. Sensitivity to fuel diesel oil and cell wall structure of some Scenedesmus (Chlorococcales strains

    Directory of Open Access Journals (Sweden)

    Zbigniew Tukaj

    2014-01-01

    Full Text Available Sensitivity of three Scenedesmus strains exposed to aqueous fuel-oil extract (AFOE is strongly strain-dependent S. quadricauda is the most resistant, S. armatus moderately tolerant whereas the most sensitive appears to be S. microspina. The sensitivity of tested species increases parallel with decreasing of cell size and cell number in coenobium. The values of the cell surface/cell volumes ratios only partly explain the above relationships. Electron microscope investigations reveal that the sensitivity may depend on cell wall structure of the strains. Cell wall of all here investigated strains is built of two layers: the inner so-called cellulosic layer and the outer one showing a three-laminar structure (TLS. The latter contains an acetolysis-resistant biopolymer (ARB. These two layers are similar in thickness in the three strains tested, but the surface of Scenedesmus is covered with various epistructures that are characteristic of strains. Some of them as the tightly fitting warty layer of S. armatus and especially the loosely fitting reticulate layer of S. quadricauda may contribute to lower permeability of cell wall. The structure of the rosettes also appears to be correlated with the sensitivity of strains. Presence of invaginations of plasmalemma in areas under rosettes indicates their role in transport processes inside/outside the cells.

  10. Effects of equiaxial strain on the differentiation of dental pulp stem cells without using biochemical reagents.

    Science.gov (United States)

    Tabatabaei, F S; Jazayeri, M; Ghahari, P; Haghighipour, N

    2014-09-01

    During orthodontic treatments, applied mechanical forces create strain and result in tooth movement through the alveolar bone. This response to mechanical strain is a fundamental biological reaction. The present study evaluated the effect of equiaxial strain within the range of orthodontic forces on the osteogenic differentiation of human dental pulp stem cells (hDPSCs). Following isolation and culture of hDPSCs, 3rd passage cells were transferred on a silicone membrane covered with collagen. Cell adhesion to the membrane was evaluated under scanning electron microscope (SEM). Cells were divided into three groups: the first group was placed in a conventional culture medium, transferred to an equiaxial stretching device (3% strain for 2 weeks). The positive control was placed in an osteogenic medium with no mechanical strain. The negative control group was placed in the conventional culture medium with no mechanical strain either. Study groups were evaluated for expression ofosteogenic markers (Alkaline phosphatase and Osteopontin) with immunofluorescence and real time PCR. SEM images revealed optimal adhesion of cells to the silicone membrane. Immunofluorescence study demonstrated that osteocalcin expression occurred after 2 weeks in the two groups under mechanical and chemical signals. After application of equiaxial strain, level of expression of osteogenic markers was significantly higher than in the negative and positive control groups. Based on the study results, static equiaxial strain which mimics the types of orthodontic forces can result in differentiation of hDPSCs to osteoblasts. The results obtained may be used in cell therapy and tissue engineering.

  11. Invasive adenocarcinoma of the lung is associated with the upper lung regions.

    Science.gov (United States)

    Kinsey, C Matthew; Estepar, Raul San Jose; Zhao, Yang; Yu, Xiaojin; Diao, Nancy; Heist, Rebecca Suk; Wain, John C; Mark, Eugene J; Washko, George; Christiani, David C

    2014-05-01

    We postulated that ventilation-perfusion (V/Q) relationships within the lung might influence where lung cancer occurs. To address this hypothesis we evaluated the location of lung adenocarcinoma, by both tumor lobe and superior-inferior regional distribution, and associated variables such as emphysema. One hundred fifty-nine cases of invasive adenocarcinoma and adenocarcinoma with lepidic features were visually evaluated to identify lobar or regional tumor location. Regions were determined by automated division of the lungs into three equal volumes: (upper region, middle region, or lower region). Automated densitometry was used to measure radiographic emphysema. The majority of invasive adenocarcinomas occurred in the upper lobes (69%), with 94% of upper lobe adenocarcinomas occurring in the upper region of the lung. The distribution of adenocarcinoma, when classified as upper or lower lobe, was not different between invasive adenocarcinoma and adenocarcinoma with lepidic features (formerly bronchioloalveolar cell carcinoma, P = 0.08). Regional distribution of tumor was significantly different between invasive adenocarcinoma and adenocarcinoma with lepidic features (P = 0.001). Logistic regression analysis with the outcome of invasive adenocarcinoma histology was used to adjust for confounders. Tumor region continued to be a significant predictor (OR 8.5, P = 0.008, compared to lower region), whereas lobar location of tumor was not (P = 0.09). In stratified analysis, smoking was not associated with region of invasive adenocarcinoma occurrence (P = 0.089). There was no difference in total emphysema scores between invasive adenocarcinoma cases occurring in each of the three regions (P = 0.155). There was also no difference in the distribution of region of adenocarcinoma occurrence between quartiles of emphysema (P = 0.217). Invasive adenocarcinoma of the lung is highly associated with the upper lung regions. This association is not related to smoking, history of COPD

  12. “Stealth dissemination” of macrophage-tumor cell fusions cultured from blood of patients with pancreatic ductal adenocarcinoma

    Science.gov (United States)

    Circulating tumor cells (CTCs) appear to be involved in early dissemination of many cancers, although which characteristics are important in metastatic spread are not clear. Here we describe isolation and characterization of macrophage-tumor cell fusions (MTFs) from the blood of pancreatic ductal a...

  13. Clinically relevant concentrations of lidocaine and ropivacaine inhibit TNFα-induced invasion of lung adenocarcinoma cells in vitro by blocking the activation of Akt and focal adhesion kinase.

    Science.gov (United States)

    Piegeler, T; Schläpfer, M; Dull, R O; Schwartz, D E; Borgeat, A; Minshall, R D; Beck-Schimmer, B

    2015-11-01

    Matrix-metalloproteinases (MMP) and cancer cell invasion are crucial for solid tumour metastasis. Important signalling events triggered by inflammatory cytokines, such as tumour necrosis factor α (TNFα), include Src-kinase-dependent activation of Akt and focal adhesion kinase (FAK) and phosphorylation of caveolin-1. Based on previous studies where we demonstrated amide-type local anaesthetics block TNFα-induced Src activation in malignant cells, we hypothesized that local anaesthetics might also inhibit the activation and/or phosphorylation of Akt, FAK and caveolin-1, thus attenuating MMP release and invasion of malignant cells. NCI-H838 lung adenocarcinoma cells were incubated with ropivacaine or lidocaine (1 nM-100 µM) in absence/presence of TNFα (20 ng ml(-1)) for 20 min or 4 h, respectively. Activation/phosphorylation of Akt, FAK and caveolin-1 were evaluated by Western blot, and MMP-9 secretion was determined by enzyme-linked immunosorbent assay. Tumour cell migration (electrical wound-healing assay) and invasion were also assessed. Ropivacaine (1 nM-100 μM) and lidocaine (1-100 µM) significantly reduced TNFα-induced activation/phosphorylation of Akt, FAK and caveolin-1 in NCI-H838 cells. MMP-9 secretion triggered by TNFα was significantly attenuated by both lidocaine and ropivacaine (half-maximal inhibitory concentration [IC50]=3.29×10(-6) M for lidocaine; IC50=1.52×10(-10) M for ropivacaine). The TNFα-induced increase in invasion was completely blocked by both lidocaine (10 µM) and ropivacaine (1 µM). At clinically relevant concentrations both ropivacaine and lidocaine blocked tumour cell invasion and MMP-9 secretion by attenuating Src-dependent inflammatory signalling events. Although determined entirely in vitro, these findings provide significant insight into the potential mechanism by which local anaesthetics might diminish metastasis. © The Author 2015. Published by Oxford University Press on behalf of the British Journal of Anaesthesia

  14. Anti-metastatic Potential of Amide-linked Local Anesthetics: Inhibition of Lung Adenocarcinoma Cell Migration and Inflammatory Src Signaling Independent of Sodium Channel Blockade

    Science.gov (United States)

    Piegeler, Tobias; Votta-Velis, E. Gina; Liu, Guoquan; Place, Aaron T.; Schwartz, David E.; Beck-Schimmer, Beatrice; Minshall, Richard D.; Borgeat, Alain

    2012-01-01

    Background Retrospective analysis of patients undergoing cancer surgery suggests the use of regional anesthesia may reduce cancer recurrence and improve survival. Amide-linked local anesthetics have anti-inflammatory properties, although the mechanism of action in this regard is unclear. As inflammatory processes involving Src tyrosine protein kinase and intercellular adhesion molecule-1 are important in tumor growth and metastasis, we hypothesized that amide-linked local anesthetics may inhibit inflammatory Src-signaling involved in migration of adenocarcinoma cells. Methods NCI-H838 lung cancer cells were incubated with Tumor Necrosis Factor-α in absence/presence of ropivacaine, lidocaine, or chloroprocaine (1nM-100μM). Cell migration and total cell lysate Src-activation and Intercellular Adhesion Molecule-1 phosphorylation were assessed. The role of voltage-gated sodium-channels in the mechanism of local anesthetic effects was also evaluated. Results Ropivacaine treatment (100μM) of H838 cells for 20 minutes decreased basal Src activity by 62% (p=0.003), and both ropivacaine and lidocaine co-administered with Tumor Necrosis Factor-α statistically significantly decreased Src-activation and Intercellular Adhesion Molecule-1 phosphorylation, whereas chloroprocaine had no such effect. Migration of these cells at 4 hours was inhibited by 26% (p=0.005) in presence of 1μM ropivacaine and 21% by 1μM lidocaine (p=0.004). These effects of ropivacaine and lidocaine were independent of voltage-gated sodium-channel inhibition. Conclusions This study indicates that amide-, but not ester-linked local anesthetics may provide beneficial anti-metastatic effects. The observed inhibition of NCI-H838 cell migration by lidocaine and ropivacaine was associated with the inhibition of Tumor Necrosis Factor-α-induced Src-activation and Intercellular Adhesion Molecule-1 phosphorylation, providing the first evidence of a molecular mechanism which appears to be independent of their

  15. Engineered CAR T Cells Targeting the Cancer-Associated Tn-Glycoform of the Membrane Mucin MUC1 Control Adenocarcinoma

    DEFF Research Database (Denmark)

    Posey, Avery D; Schwab, Robert D; Boesteanu, Alina C

    2016-01-01

    Genetically modified T cells expressing chimeric antigen receptors (CARs) demonstrate robust responses against lineage restricted, non-essential targets in hematologic cancers. However, in solid tumors, the full potential of CAR T cell therapy is limited by the availability of cell surface antigens...... with sufficient cancer-specific expression. The majority of CAR targets have been normal self-antigens on dispensable hematopoietic tissues or overexpressed shared antigens. Here, we established that abnormal self-antigens can serve as targets for tumor rejection. We developed a CAR that recognized cancer......-associated Tn glycoform of MUC1, a neoantigen expressed in a variety of cancers. Anti-Tn-MUC1 CAR T cells demonstrated target-specific cytotoxicity and successfully controlled tumor growth in xenograft models of T cell leukemia and pancreatic cancer. These findings demonstrate the therapeutic efficacy of CAR T...

  16. Heat-killed and γ-irradiated Brucella strain RB51 stimulates enhanced dendritic cell activation, but not function compared with the virulent smooth strain 2308.

    Science.gov (United States)

    Surendran, Naveen; Hiltbold, Elizabeth M; Heid, Bettina; Sriranganathan, Nammalwar; Boyle, Stephen M; Zimmerman, Kurt L; Witonsky, Sharon G

    2010-11-01

    Brucella spp. are Gram-negative, facultative intracellular bacterial pathogens that cause abortion in livestock and undulant fever in humans worldwide. Brucella abortus strain 2308 is a pathogenic strain that affects cattle and humans. Currently, there are no efficacious human vaccines available. However, B. abortus strain RB51, which is approved by the USDA, is a live-attenuated rough vaccine against bovine brucellosis. Live strain RB51 induces protection via CD4(+) and CD8(+) T-cell-mediated immunity. To generate an optimal T-cell response, strong innate immune responses by dendritic cells (DCs) are crucial. Because of safety concerns, the use of live vaccine strain RB51 in humans is limited. Therefore, in this study, we analyzed the differential ability of the same doses of live, heat-killed (HK) and γ-irradiated (IR) strain RB51 in inducing DC activation and function. Smooth strain 2308, live strain RB51 and lipopolysaccharide were used as controls. Studies using mouse bone marrow-derived DCs revealed that, irrespective of viability, strain RB51 induced greater DC activation than smooth strain 2308. Live strain RB51 induced significantly (P≤0.05) higher DC maturation than HK and IR strains, and only live strain RB51-infected DCs (at multiplicity of infection 1:100) induced significant (P≤0.05) tumor necrosis factor-α and interleukin-12 secretion. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. [ABILITY OF STAPHYLOCOCCUS OF VARIOUS STRAINS TO CREATE BIOFILMS AND THEIR EFFECT ON HUMAN BODY CELLS].

    Science.gov (United States)

    Kornienko, M A; Kopyltsov, V N; Shevlyagina, N V; Didenko, L V; Lyubasovskaya, L A; Priputnevich, T V; Ilina, E N

    2016-01-01

    The urgency of the staphylococcus research is due to its ability to cause severe infections: softtissue infections, endocarditis, sepsis, toxic shock syndrome, and food poisoning. Coagulase-positive Staphylococcus aureus is the main infection agent of intrahospital infections. This agent has many factors of pathogenicity, which are well known. Among the coagulase-negative staphylococcus (CNS) strains, S. haemolyticus and S. epidermidis are clinically important, because they cause infections in patients with weak immune system. The mechanisms of the CNS pathogenicity are insufficiently understood. The goal of this work was to evaluate the potential pathogenicity of clinical strains of CNS from their capacity to create biofilms and the character of their interaction with human body cells by the example of the HT-29 cell culture. The research was carried out in laboratory strain S. aureus ATCC 29213 and clinical strains S. haemolyticus SH39, S. epidermidis SE36-1 isolated from the neonatal autopsy materials. The visual tests of biofilm formation by each strain and testing of the impact of the strains on the cell culture HT-29 was carried out in this work. The two species of CNS form biofilms at a higher rate than S. aureus. Upon incubation for 2 h of HT-29 cells with staphylococcus strains tested in this work, adhesion of bacteria on cell surface was observed. The adhesion was most pronounced in case of S. aureus ATCC 29213 and S. haemolyticus SH39. Upon 3 h of incubation with S. aureus ATCC 29213 and S. haemolyticus SH39, destruction of cell HT-29 monolayer was observed. The incubation for 24 h with the 3 strains tested in this work caused complete destruction of cell HT-29 monolayer. The maximal toxic effect on HT-29 cells was inherent in the strain S. haemolyticus SH39. The aggregate of the results obtained in this work indicates the presence of the pathogenicity factors in the strains S. haemolyticus SH39, which require additional research.

  18. Comparative characterization of stem cell marker expression, metabolic activity and resistance to doxorubicin in adherent and spheroid cells derived from the canine prostate adenocarcinoma cell line CT1258.

    Science.gov (United States)

    Liu, Wen; Moulay, Mohammed; Willenbrock, Saskia; Roolf, Catrin; Junghanss, Christian; Ngenazahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo

    2015-04-01

    Canine prostate cancer represents a spontaneous animal model for the human counterpart. Cells with stem cell-like character are considered to play a major role in therapeutic resistance and tumor relapse. Thus, the identification of markers allowing for recognition and characterization of these cells is essential. Expression of 12 stem cell marker genes in the canine prostate cancer cell line CT1258 and spheroid cells generated from these was analyzed by quantitative real-time PCR. In CT1258 and the generated spheroid cells, CD44 and CD133 expression was analyzed by flow cytometry, as well as proliferation and doxorubicin resistance. Integrin alpha-6 (ITGA6) expression and metabolic activity were significantly up-regulated in CT1258-derived spheroid cells, while doxorubicin resistance remained comparable. ITGA6 de-regulation and metabolic activity appear to be characteristic of the generated spheres, indicating potential intervention targets. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Dynamic evaluation of circulating tumour cells in patients with advanced gastric and oesogastric junction adenocarcinoma: Prognostic value and early assessment of therapeutic effects.

    Science.gov (United States)

    Pernot, Simon; Badoual, Cecile; Terme, Magali; Castan, Florence; Cazes, Aurelie; Bouche, Olivier; Bennouna, Jaafar; Francois, Eric; Ghiringhelli, Francois; De La Fouchardiere, Christelle; Samalin, Emmanuelle; Bachet, Jean Baptiste; Borg, Christophe; Ducreux, Michel; Marcheteau, Elie; Stanbury, Trevor; Gourgou, Sophie; Malka, David; Taieb, Julien

    2017-07-01

    The identification of dynamic biomarkers in advanced gastric and oesogastric junction adenocarcinoma (GOA) could help to tailor strategies for each patient. Enumeration of circulating tumour cells (CTCs) is approved by the US Food and Drug Administration in breast, colon and prostate cancer but is not in advanced GOA. Our study aims to establish the optimal threshold and the clinical significance of CTC count in advanced GOA before and during treatment. One hundred six patients with untreated advanced GOA were included in the ancillary study of the PRODIGE 17-ACCORD 20 trial. CTCs were detected in the peripheral blood using the CellSearch system on day 0 (D0) and day 28 (D28). The prognostic value of CTCs at D0 and D28 was analysed by testing several thresholds. At baseline, median CTC count was 1 (range, 0-415). While CTCs ≥1, 2 or 3 at D0 were all significantly associated with worse overall survival (OS) and progression-free survival (PFS), CTCs ≥2 were the optimal threshold, on D0 or D28. CTCs ≥2 at D28 were also predictive of disease control. Taking into account both D0 and D28 CTC count defined 3 groups (low/low, high/low and low-high/high) with significantly different PFS (p = 0.0002) and OS (p = 0.003). Quantification of CTCs at baseline and during treatment may be a useful prognostic tool in advanced GOA, as it is associated with worse PFS and OS. A threshold ≥2 CTCs seems to have the best discriminant value. Change in CTC count between baseline and D28 could help to tailor treatment to each individual patient. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Insights into the potential of picoplanktonic marine cyanobacteria strains for cancer therapies - Cytotoxic mechanisms against the RKO colon cancer cell line.

    Science.gov (United States)

    Freitas, Sara; Martins, Rosário; Campos, Alexandre; Azevedo, Joana; Osório, Hugo; Costa, Margarida; Barros, Piedade; Vasconcelos, Vitor; Urbatzka, Ralph

    2016-09-01

    In this work, we analysed the potential of picoplanktonic marine cyanobacteria strains as a source of anticancer compounds by elucidating the cytotoxic mechanisms of an ethyl acetate fraction of Cyanobium sp. (LEGE06113) and the Synechocystis salina (LEGE06155) on the RKO colon adenocarcinoma cell line. Cytotoxicity was analysed by MTT. Effects on cells were evaluated by mRNA expression of cell cycle and apoptotic genes, flow cytometry (cell cycle), qualitative and quantitative fluorescence microscopy (apoptosis), and quantitative proteomics. IC50 values were 27.01 and 8.03 μg/ml for Cyanobium sp., and 37.71 and 17.17 μg/ml for Synechocystis salina, after 24 h and 48 h, respectively. Exposure to the Cyanobium sp. fraction increased 2.5 fold BCL-2 mRNA expression (p KRT10). Exposure to the Synechocystis salina fraction decreased 2fold CCNB1 mRNA expression (p KRT10, KRT1). Since induction of cytotoxicity is a very broad parameter, the study demonstrates the potential of picocyanobacteria to produce bioactive compounds that target cancer cells via different molecular mechanisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Apoptosis of Epithelial Cells and Macrophages due to Nonpigmented Serratia marcescens Strains

    Science.gov (United States)

    Krzymińska, Sylwia; Ochocka, Katarzyna; Kaznowski, Adam

    2012-01-01

    Serratia marcescens strains are opportunistic pathogens that are increasingly recognized as a cause of severe nosocomial infections. In this study we observed interactions between nonpigmented strains with human epithelial and macrophage-like cells. The strains revealed hemolytic activity only after the contact of the cells with erythrocytes. The contact of the bacteria with the host cells was also essential to their cytotoxicity. Moreover, all strains revealed adherence ability and were invasive to epithelial cells. Analyses of cellular morphology and DNA fragmentation of the HEp-2 and J774 cells exhibited typical features of cells undergoing apoptosis. We observed morphological changes, including condensation of nuclear chromatin and formation of membrane-bound apoptotic bodies. The lowest apoptotic index in HEp-2 cells did not exceed 25%, whereas the highest reached 59% at 24 h and 72% at 48 h after infection. Most of the strains (60%) induced fragmentation of nuclear DNA. The process depended on the activation of caspases, and was completely blocked by the pan-caspase inhibitor z-VAD-fmk. This study provided new insights into the mechanisms of nonpigmented S. marcescens pathogenesis. The results revealed that the strains produce cell-contact toxins that facilitate bacterial invasion, induce hemolysis, cytotoxicity, and apoptosis of host cells. PMID:22649305

  2. Apoptosis of Epithelial Cells and Macrophages due to Nonpigmented Serratia marcescens Strains

    Directory of Open Access Journals (Sweden)

    Sylwia Krzymińska

    2012-01-01

    Full Text Available Serratia marcescens strains are opportunistic pathogens that are increasingly recognized as a cause of severe nosocomial infections. In this study we observed interactions between nonpigmented strains with human epithelial and macrophage-like cells. The strains revealed hemolytic activity only after the contact of the cells with erythrocytes. The contact of the bacteria with the host cells was also essential to their cytotoxicity. Moreover, all strains revealed adherence ability and were invasive to epithelial cells. Analyses of cellular morphology and DNA fragmentation of the HEp-2 and J774 cells exhibited typical features of cells undergoing apoptosis. We observed morphological changes, including condensation of nuclear chromatin and formation of membrane-bound apoptotic bodies. The lowest apoptotic index in HEp-2 cells did not exceed 25%, whereas the highest reached 59% at 24 h and 72% at 48 h after infection. Most of the strains (60% induced fragmentation of nuclear DNA. The process depended on the activation of caspases, and was completely blocked by the pan-caspase inhibitor z-VAD-fmk. This study provided new insights into the mechanisms of nonpigmented S. marcescens pathogenesis. The results revealed that the strains produce cell-contact toxins that facilitate bacterial invasion, induce hemolysis, cytotoxicity, and apoptosis of host cells.

  3. Nuclear Receptor 4A1 (NR4A1 as a Drug Target for Renal Cell Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Erik Hedrick

    Full Text Available The orphan nuclear receptor NR4A1 exhibits pro-oncogenic activity in cancer cell lines. NR4A1 activates mTOR signaling, regulates genes such as thioredoxin domain containing 5 and isocitrate dehydrogenase 1 that maintain low oxidative stress, and coactivates specificity protein 1 (Sp1-regulated pro-survival and growth promoting genes. Transfection of renal cell carcinoma (RCC ACHN and 786-O cells with oligonucleotides that target NR4A1 results in a 40-60% decrease in cell proliferation and induction of apoptosis. Moreover, knockdown of NR4A1 in RCC cells decreased bcl-2, survivin and epidermal growth factor receptor expression, inhibited of mTOR signaling, induced oxidative and endoplasmic reticulum stress, and decreased TXNDC5 and IDH1. We have recently demonstrated that selected 1,1-bis(3'-indolyl-1-(p-substituted phenylmethane (C-DIM compounds including the p-hydroxyphenyl (DIM-C-pPhOH and p-carboxymethyl (DIM-C-pPhCO2Me analogs bind NR4A1 and act as antagonists. Both DIM-C-pPhOH and DIM-C-pPhCO2Me inhibited growth and induced apoptosis in ACHN and 786-O cells, and the functional and genomic effects of the NR4A1 antagonists were comparable to those observed after NR4A1 knockdown. These results indicate that NR4A1 antagonists target multiple growth promoting and pro-survival pathways in RCC cells and in tumors (xenograft and represent a novel chemotherapy for treating RCC.

  4. Cell Surface-Associated Proteins in the Filamentous Cyanobacterium Anabaena sp. strain PCC 7120

    OpenAIRE

    Yoshimura, Hidehisa; Ikeuchi, Masahiko; Ohomori, Masayuki

    2012-01-01

    The cell surface senses environmental changes first and transfers signals into the cell. To understand the response to environmental changes, it is necessary to analyze cell surface components, particularly cell surface-associated proteins. We therefore investigated cell surface-associated proteins from the filamentous cyanobacterium Anabaena sp. strain PCC 7120. The cell surface-associated proteins extracted by an acidic buffer were resolved by SDS-PAGE. Eighteen proteins were identified fro...

  5. Strain-specific probiotic (Lactobacillus helveticus) inhibition of Campylobacter jejuni invasion of human intestinal epithelial cells.

    Science.gov (United States)

    Wine, Eytan; Gareau, Mélanie G; Johnson-Henry, Kathene; Sherman, Philip M

    2009-11-01

    Campylobacter jejuni is the most common bacterial cause of enterocolitis in humans, leading to diarrhoea and chronic extraintestinal diseases. Although probiotics are effective in preventing other enteric infections, beneficial microorganisms have not been extensively studied with C. jejuni. The aim of this study was to delineate the ability of selected probiotic Lactobacillus strains to reduce epithelial cell invasion by C. jejuni. Human colon T84 and embryonic intestine 407 epithelial cells were pretreated with Lactobacillus strains and then infected with two prototypic C. jejuni pathogens. Lactobacillus helveticus, strain R0052 reduced C. jejuni invasion into T84 cells by 35-41%, whereas Lactobacillus rhamnosus R0011 did not reduce pathogen invasion. Lactobacillus helveticus R0052 also decreased invasion of one C. jejuni isolate (strain 11168) into intestine 407 cells by 55%. Lactobacillus helveticus R0052 adhered to both epithelial cell types, which suggest that competitive exclusion could contribute to protection by probiotics. Taken together, these findings indicate that the ability of selected probiotics to prevent C. jejuni-mediated disease pathogenesis depends on the pathogen strain, probiotic strain and the epithelial cell type selected. The data support the concept of probiotic strain selectivity, which is dependent on the setting in which it is being evaluated and tested.

  6. Extremely low frequency electromagnetic field sensitizes cisplatin-resistant human ovarian adenocarcinoma cells via P53 activation

    OpenAIRE

    Baharara, Javad; Hosseini, Nasrin; Farzin, Tayebe Ramezani

    2015-01-01

    In the following study, extremely low frequency electromagnetic fields (EL-EMF) radiation was used to restore sensitivity in the cisplatin-resistant A2780 ovarian cancer cells. For this purpose A2780 cells were treated with different doses of cisplatin and EL-EMF (50 Hz, 200 gauss, and 2 h) alone. Cytotoxicity was the measurement using MTT assay. After calculating IC50 for cisplatin (90 µg/ml) a lower concentration from IC50 (30 and 60 µg/ml) was used to be combined with EL-EMF. We compare th...

  7. miR-297 acts as an oncogene by targeting GPC5 in lung adenocarcinoma.

    Science.gov (United States)

    Sun, Yunchuan; Zhao, Jianyong; Yin, Xiaoming; Yuan, Xiangkun; Guo, Jianfei; Bi, Jianqiang

    2016-10-01

    Emerging studies have demonstrated that microRNAs (miRNAs) play crucial roles in carcinogenesis of many developing human tumours. However, the functions and mechanisms of miR-297 in lung cancer have, up to now, been largely undefined. Here, miR-297 expression was measured in lung adenocarcinoma tissues and cell lines, using qRT-PCR. Lung adenocarcinoma cell line was treated with an miR-297 mimic. MTT and colony analysis were performed to detect cell proliferation and colony formation. The direct target gene of miR-297 was assessed by qRT-PCR, Western blotting and luciferase assays. We demonstrated that miR-297 expression was upregulated in lung adenocarcinomas compared to adjacent normal tissues. Expression of miR-297 was also upregulated in tested lung adenocarcinoma cell lines. Ectopic expression of miR-297 enhanced lung adenocarcinoma cell proliferation and colony formation. Furthermore, overexpression of miR-297 promoted cell migration and invasion. In addition, we identified Glypican-5 (GPC5) as a direct target gene of miR-297 in lung adenocarcinoma cells. Expression of GPC5 was downregulated in both lung adenocarcinoma tissues and cell lines. Moreover, expression of GPC5 was inversely associated with expression of miR-297 in lung adenocarcinoma tissues. These results suggest that miR-297 acted as an oncogenic miRNA, partly by targeting GPC5, adenocarcinoma of the lung. © 2016 John Wiley & Sons Ltd.

  8. Irofulven (6-hydroxymethylacylfulvene, MGI 114) induces caspase 8 and 9-mediated apoptosis in human pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Wang, W; Waters, S J; MacDonald, J R; Von Hoff, D D; Strodel, W E; Miller, A R

    2001-01-01

    Irofulven (MGI 114) is a novel, clinically active sesquiterpene whose mechanism of action is not fully understood. We sought to identify apoptotic effectors induced by this agent in human pancreatic cancer cells. MTT assay was used to assess IC50-Apoptosis was quantitated by flow cytometry and DAPI staining. Caspase activation was identified by western blot analysis. Irofulven was cytotoxic against all pancreatic cancer cell lines tested (IC50 1-18 microM), and induced 10-fold (4%+/- 2, vs. 41% +/- 5) induction of apoptosis. Irofulven-treated cells also demonstrated PARP3 cleavage and DAPI staining. Apoptosis was reduced to baseline levels by Z-VAD-FMK, a broad-spectrum caspase inhibitor. Western blot analysis revealed that caspases-3, -7, -8, and -9 were activated by irofulven. Time course evaluation demonstrated that caspases-8 and -9 were the initial species activated. Our data demonstrate that the cytotoxicity of irofulven in human pancreatic carcinoma cell lines is mediated by caspase-induced apoptosis.

  9. Differential Regulation of Gene Expression of Alveolar Epithelial Cell Markers in Human Lung Adenocarcinoma-Derived A549 Clones

    Directory of Open Access Journals (Sweden)

    Hiroshi Kondo

    2015-01-01

    Full Text Available Stem cell therapy appears to be promising for restoring damaged or irreparable lung tissue. However, establishing a simple and reproducible protocol for preparing lung progenitor populations is difficult because the molecular basis for alveolar epithelial cell differentiation is not fully understood. We investigated an in vitro system to analyze the regulatory mechanisms of alveolus-specific gene expression using a human alveolar epithelial type II (ATII cell line, A549. After cloning A549 subpopulations, each clone was classified into five groups according to cell morphology and marker gene expression. Two clones (B7 and H12 were further analyzed. Under serum-free culture conditions, surfactant protein C (SPC, an ATII marker, was upregulated in both H12 and B7. Aquaporin 5 (AQP5, an ATI marker, was upregulated in H12 and significantly induced in B7. When the RAS/MAPK pathway was inhibited, SPC and thyroid transcription factor-1 (TTF-1 expression levels were enhanced. After treatment with dexamethasone (DEX, 8-bromoadenosine 3′5′-cyclic monophosphate (8-Br-cAMP, 3-isobutyl-1-methylxanthine (IBMX, and keratinocyte growth factor (KGF, surfactant protein B and TTF-1 expression levels were enhanced. We found that A549-derived clones have plasticity in gene expression of alveolar epithelial differentiation markers and could be useful in studying ATII maintenance and differentiation.

  10. Evaluation of physicochemical properties and intestinal permeability of six dietary polyphenols in human intestinal colon adenocarcinoma Caco-2 cells.

    Science.gov (United States)

    Rastogi, Himanshu; Jana, Snehasis

    2016-02-01

    Phenolic compounds are common ingredients in many dietary supplements and functional foods. However, data concerning physicochemical properties and permeability of polyphenols on the intestinal epithelial cells are scarce. The aims of this study were to determine the experimental partition coefficient (Log P), and parallel artificial membrane permeability assay (PAMPA), to characterize the bi-directional transport of six phenolic compounds viz. caffeic acid, chrysin, gallic acid, quercetin, resveratrol and rutin in Caco-2 cells. The experimental Log P values of six polyphenols were correlated (R (2) = 0.92) well with the calculated Log P values. The apparent permeability (P app) range of all polyphenols in PAMPA for the apical (AP) to basolateral (BL) was 1.18 ± 0.05 × 10(-6) to 5.90 ± 0.16 × 10(-6) cm/s. The apparent Caco-2 permeability (P app) range for the AP-BL was 0.96 ± 0.03 × 10(-6) to 3.80 ± 0.45 × 10(-6) cm/s. The efflux ratio of P app (BL → AP) to P app (AP → BL) for all phenolics was Caco-2 cell monolayer permeation data. Dietary six polyphenols were poorly absorbed through PAMPA and Caco-2 cells, and their transepithelial transports were mainly by passive diffusion.

  11. Integrins are not essential for entry of coxsackievirus A9 into SW480 human colon adenocarcinoma cells

    NARCIS (Netherlands)

    Heikkilä, Outi; Merilahti, Pirjo; Hakanen, Marika; Karelehto, Eveliina; Alanko, Jonna; Sukki, Maria; Kiljunen, Saija; Susi, Petri

    2016-01-01

    Coxsackievirus A9 (CV-A9) is a pathogenic enterovirus type within the family Picornaviridae. CV-A9 infects A549 human epithelial lung carcinoma cells by attaching to the αVβ6 integrin receptor through a highly conserved Arg-Gly-Asp (RGD) motif, which is located at the exposed carboxy-terminus of the

  12. [Methodical approaches to isolation of teichoic acids from native cells of lactic acid bacteria probiotic strains].

    Science.gov (United States)

    Livins'ka, O P; Harmasheva, I L; Vasyl'iev, V M; Kovalenko, N K

    2012-01-01

    Teichoic acids of lactic acid bacteria probiotic strains have been obtained by extraction from native cells, followed by purification of extracts using ion exchange chromatography. Selected fractions contained high concentrations of phosphorus and did not contain nucleic acids. The content of teichoic acid depended on the species and strain specificity. Heterogeneity of the studied biomolecules was revealed.

  13. Differences in the red blood cell elution times of strains of Newcastle ...

    African Journals Online (AJOL)

    Elution times of velogenic, mesogenic and lentogenic strains of Newcastle disease virus were determined. Four samples each of velogenic (VGF2), mesogenic (Komarov) and lentogenic (Lasota) strains were used for haemaglutination test with 0.6% chicken red blood cells. The time it took for wells of the end ...

  14. Cyclooxygenase-2 expression in feline pancreatic adenocarcinomas.

    Science.gov (United States)

    Newman, Shelley Joy; Mrkonjich, Ladonna

    2006-11-01

    Cyclooxygenase-2 (COX-II) is an inducible enzyme that is responsible for the production of prostaglandin E2 (PGE2), which is often upregulated in neoplastic conditions. Expression of COX-II is documented in the majority of human pancreatic adenocarcinomas and in many epithelial neoplasms in humans and animals. The purpose of this study was to assess a series of feline pancreatic adenocarcinomas for the expression of COX-II. Eight feline pancreatic adenocarcinomas (5 poorly differentiated ductular variants and 3 well-differentiated acinar variants) were included. Immunohistochemical staining showed that COX-II was expressed in 2 (both poorly differentiated ductular variants) of the 8 neoplasms (25%). Approximately 10% of the epithelial cells from these 2 neoplasms expressed intense cytoplasmic staining. However, because feline pancreatic adenocarcinoma does not appear to consistently express COX-II, it is not a useful prognostic indicator for this group of feline neoplasms. In addition, COX-II inhibitors are not likely to be effective therapeutics for cats with this neoplasm.

  15. High cell density cultivation of six fungal strains efficient in azo dye bioremediation.

    Science.gov (United States)

    Abd El-Rahim, Wafaa M; Mostafa, Enas M; Moawad, Hassan

    2016-12-01

    This work aims at optimizing the high cell density fungal cultivation for producing large quantities of fungal biomass to be used in azo dye residues bioremediation. In our previous studies the efficacy of using certain fungal strains to decolorize a range of commercial textile dyes of different structures (azo, disazo) were investigated. Several promising fungal strains belonging to Aspergillus tubigenesis, Aspergillus niger, Aspergillus terreus, and Aspergillus fumigates demonstrated high capacity in decolorizing various azo dyes. This study focuses on the high cell density cultivation of the fungal strains identified as potential bioremediation agents. The study includes the optimization of all parameters involved in bioprocess development for high cell density cultivation of six promising fungal strains. The growth of the fungal strains was tested on the sucrose medium in 7 l-fermenter. The growth of these fungal strains having the capacity to accumulate large quantities of biomass was also tested in medium containing molasses as a cheap substrate. The residual molasses, biomass dry weight and protein content of the six fungal strains showed that the strains 20 and 2 were marked by the highest protein content. In this study a comparative analysis between the results of dry weight, residual molasses and protein content of geowth of the strains 20, 5 and 2 under uncontrolled and controlled pH of media in batch fermentation was studied to follow the accumulation of biomass and protein production in the growth media. The results indicate that the dry weight accumulated by strains No. 20, 5 and 2 grown on molasses was better than those of strains grown on sucrose. Fungal strain No. 5 had the highest biomass dry weight accumulation. The study shows that the molasses as cheaper sugar sources were better than sucrose for growing fungal biomass.

  16. High cell density cultivation of six fungal strains efficient in azo dye bioremediation

    Directory of Open Access Journals (Sweden)

    Wafaa M. Abd El-Rahim

    2016-12-01

    Full Text Available This work aims at optimizing the high cell density fungal cultivation for producing large quantities of fungal biomass to be used in azo dye residues bioremediation. In our previous studies the efficacy of using certain fungal strains to decolorize a range of commercial textile dyes of different structures (azo, disazo were investigated. Several promising fungal strains belonging to Aspergillus tubigenesis, Aspergillus niger, Aspergillus terreus, and Aspergillus fumigates demonstrated high capacity in decolorizing various azo dyes. This study focuses on the high cell density cultivation of the fungal strains identified as potential bioremediation agents. The study includes the optimization of all parameters involved in bioprocess development for high cell density cultivation of six promising fungal strains. The growth of the fungal strains was tested on the sucrose medium in 7 l-fermenter. The growth of these fungal strains having the capacity to accumulate large quantities of biomass was also tested in medium containing molasses as a cheap substrate. The residual molasses, biomass dry weight and protein content of the six fungal strains showed that the strains 20 and 2 were marked by the highest protein content. In this study a comparative analysis between the results of dry weight, residual molasses and protein content of geowth of the strains 20, 5 and 2 under uncontrolled and controlled pH of media in batch fermentation was studied to follow the accumulation of biomass and protein production in the growth media. The results indicate that the dry weight accumulated by strains No. 20, 5 and 2 grown on molasses was better than those of strains grown on sucrose. Fungal strain No. 5 had the highest biomass dry weight accumulation. The study shows that the molasses as cheaper sugar sources were better than sucrose for growing fungal biomass.

  17. A Comparative Pharmacokinetic Study of 2 Pemetrexed Formulations in Indian Adult Chemonaive Patients With Adenocarcinoma Stage III/IV Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Kavathiya, Krunal; Gurjar, Murari; Patil, Anand; Naik, Madhura; Noronha, Vanita; Joshi, Amit; Gota, Vikram; Prabhash, Kumar

    2017-05-01

    The study aimed to compare the pharmacokinetics of 2 pemetrexed formulations (Pemgem, Dr. Reddy's Laboratories w.r.t; Alimta, Eli Lilly) in adult chemonaive subjects with adenocarcinoma stage III/IV non-small cell lung cancer. All patients received 500 mg/m2 pemetrexed (Alimta or Pemgem) as a 10-minute infusion on day 1 of a 21-day cycle. Plasma pemetrexed concentrations were determined on day 1 of cycle 1. Area under the concentration-time curve (AUC0-inf ) and the maximum plasma concentration (Cmax ) were estimated using noncompartment analysis and compared between the 2 arms. Forty-eight patients were enrolled in the study, 24 in each arm. Patient demographics were comparable in both arms. Mean AUC0-inf for the generic and innovator formulations was 218.2 ± 19.18 and 223.6 ± 34.24 μg·h/mL, respectively, and mean Cmax was 119 ± 13.44 and 113 ± 7.26 μg/mL, respectively. Volume of distribution of pemetrexed was 17.5 and 27.6 L, clearance was 4.2 versus 4.72 L/h, and half-life was 4.3 and 4.83 h in the 2 arms respectively. Both formulations showed comparable response rates (objective response of 45% versus 50% in the Pemgem and Alimta arms, respectively) and similar safety profiles. To conclude, Pemgem showed pharmacokinetic and safety profiles similar to Alimta. Substitution of Alimta with Pemgem will be cost-effective and likely to yield comparable efficacy. © 2017, The American College of Clinical Pharmacology.

  18. BCG strain S4-Jena: An early BCG strain is capable to reduce the proliferation of bladder cancer cells by induction of apoptosis

    Directory of Open Access Journals (Sweden)

    Hermann Inge-Marie

    2010-06-01

    Full Text Available Abstract Background Intravesical immunotherapy with Mycobacterium bovis bacillus Calmette-Guérin has been established as the most effective adjuvant treatment for high risk non-muscle-invasive bladder cancer (NMIBC. We investigated the differences between the S4-Jena BCG strain and commercially available BCG strains. We tested the genotypic varieties between S4-Jena and other BCG strains and analysed the effect of the BCG strains TICE and S4-Jena on two bladder cancer cell lines. Results In contrast to commercially available BCG strains the S4-Jena strain shows genotypic differences. Spoligotyping verifies the S4-Jena strain as a BCG strain. Infection with viable S4-Jena or TICE decreased proliferation in the T24 cell line. Additionally, hallmarks of apoptosis were detectable. In contrast, Cal29 cells showed only a slightly decreased proliferation with TICE. Cal29 cells infected with S4-Jena, though, showed a significantly decreased proliferation in contrast to TICE. Concordantly with these results, infection with TICE had no effect on the morphology and hallmarks of apoptosis of Cal29 cells. However, S4-Jena strain led to clearly visible morphological changes and caspases 3/7 activation and PS flip. Conclusions S4-Jena strain has a direct influence on bladder cancer cell lines as shown by inhibition of cell proliferation and induction of apoptosis. The data implicate that the T24 cells are responder for S4-Jena and TICE BCG. However, the Cal29 cells are only responder for S4-Jena and they are non-responder for TICE BCG. S4-Jena strain may represent an effective therapeutic agent for NMIBC.

  19. Cutaneous metastasis in anorectal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Krishnendra Varma

    2015-01-01

    Full Text Available Cutaneous metastasis in anorectal adenocarcinoma is a rare entity. Here, we report the case of a 40-year-old female who presented with yellowish-brown, irregular, solid, elevated rashes over the pubis with a recent history off palliative colostomy for anorectal adenocarcinoma. Clinically, we suspected metastasis that was proved on biopsy. We report this case due to the rare presenting site (i.e., perineum of a metastatic adenocarcinoma.

  20. Involvement of ERK1/2, p38 MAPK, and PI3K/Akt signaling pathways in the regulation of cell cycle progression by PTHrP in colon adenocarcinoma cells.

    Science.gov (United States)

    Calvo, Natalia; Martín, María Julia; de Boland, Ana Russo; Gentili, Claudia

    2014-08-01

    Parathyroid hormone-related peptide (PTHrP) is distributed in most fetal and adult tissues, and its expression correlates with the severity of colon carcinoma. Recently we obtained evidence that in Caco-2 cells, a cell line from human colorectal adenocarcinoma, exogenous PTHrP increases the number of live cells, via ERK1/2, p38 MAPK, and PI3-kinase and induces the expression of cyclin D1, a cell cycle regulatory protein. In this study, we further investigated the role of PTHrP in the regulation of the cell cycle progression in these intestinal cells. Flow cytometry analysis revealed that PTHrP treatment diminishes the number of cells in the G0/G1 phase and increases the number in both S and G2/M phases. The hormone increases the expression of CDK6 and diminishes the amount of negative cell cycle regulators p27Kip1, p15INK4B, and p53. However, PTHrP does not modify the expression of cyclin D3, CDK4, and p16INK4A. In addition, inhibitors of ERK1/2 (PD98059), p38 MAPK (SB203580), and PI3Kinase (LY294002) reversed PTHrP response in Caco-2 cells. Taken together, our results suggest that PTHrP positively modulates cell cycle progression and changes the expression of proteins involved in cell cycle regulation via ERK1/2, p38 MAPK, and PI3K signaling pathways in Caco-2 cells.

  1. Replication of echo virus type 25 JV-4 reference strain and wild type strains in MRC5 cells compared with that of poliovirus type 1.

    Science.gov (United States)

    Bailly, J L; Chambon, M; Peigue-Lafeuille, H; Charbonné, F

    1994-01-01

    In echo virus type 25/JV-4 the shut off of host cell protein synthesis took significantly longer and the kinetics of the synthesis of viral proteins and viral RNA occurred much later than in the poliovirus. However, these characteristics impaired neither polyprotein processing nor virus production in the JV-4 strain. In contrast the two wild strains M.1262 and Th.222 had a lower virus yield than strain JV-4. The presence of a high Mr protein in the pattern of viral proteins of wild strains suggested that a defect in the polyprotein processing was responsible for the decreased virus yield. The infectious cycle of strain Th.222 differed from that of strains JV-4 and M.1262 in the rapid inhibition of host cell translation and the extent of viral protein synthesis. The sensitivity to actinomycin D was also investigated. Strain M.1262 was found to be insensitive. The virus yield of strains JV-4 and Th.222 was three- and fourfold lower respectively in the presence of actinomycin D. This sensitivity to the antibiotic was observed during viral RNA synthesis in strain JV-4 and during viral protein synthesis in strain Th.222. These results suggest that cellular factors are involved in the replication of echo virus type 25 strains in MRC5 cells.

  2. Cell-Specific Cre Strains For Genetic Manipulation in Salivary Glands.

    Directory of Open Access Journals (Sweden)

    Eri O Maruyama

    Full Text Available The secretory acinar cells of the salivary gland are essential for saliva secretion, but are also the cell type preferentially lost following radiation treatment for head and neck cancer. The source of replacement acinar cells is currently a matter of debate. There is evidence for the presence of adult stem cells located within specific ductal regions of the salivary glands, but our laboratory recently demonstrated that differentiated acinar cells are maintained without significant stem cell contribution. To enable further investigation of salivary gland cell lineages and their origins, we generated three cell-specific Cre driver mouse strains. For genetic manipulation in acinar cells, an inducible Cre recombinase (Cre-ER was targeted to the prolactin-induced protein (Pip gene locus. Targeting of the Dcpp1 gene, encoding demilune cell and parotid protein, labels intercalated duct cells, a putative site of salivary gland stem cells, and serous demilune cells of the sublingual gland. Duct cell-specific Cre expression was attempted by targeting the inducible Cre to the Tcfcp2l1 gene locus. Using the R26Tomato Red reporter mouse, we demonstrate that these strains direct inducible, cell-specific expression. Genetic tracing of acinar cells using PipGCE supports the recent finding that differentiated acinar cells clonally expand. Moreover, tracing of intercalated duct cells expressing DcppGCE confirms evidence of duct cell proliferation, but further analysis is required to establish that renewal of secretory acinar cells is dependent on stem cells within these ducts.

  3. Correlação da infiltração das células Natural Killer (NK CD 57+ no prognóstico do adenocarcinoma gástrico Gástrico correlation of Natural Killer cell with the prognosis of gastric adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Déborah Rosso

    2012-06-01

    Full Text Available OBJETIVO: Avaliar a concentração da célula Natural Killer (NK no adenocarcinoma gástrico operado, e sua correlação com fatores prognósticos e sobrevida MÉTODOS: Foram estudados 72 doentes portadores de adenocarcinoma gástrico e que foram submetidos à gastrectomia com linfadenectomia D2. A concentração de célula NK foi avaliada por técnica de imunoistoquímica pelo reagente CD57. Os doentes foram divididos em dois grupos: alta concentração de células (n=32 (>15 células /10 campos de grande aumento e baixa concentração (≤ 15 células/10 campos de grande aumento. Esses dois grupos foram comparados com seguintes fatores prognósticos: gênero, idade, localização do tumor, grau de diferenciação celular, classificação de Lauren, estádio, disseminação linfática, metástases e sobrevida. A curva de Kaplan-Meier foi empregada para avaliação de sobrevida e a análise multivariada para avaliação dos fatores prognósticos. RESULTADOS: Não houve relação das células NK com as diversas variáveis estudadas, a não ser com o estádio, onde houve significância (pAIM: To evaluate the concentration of Natural Killer cells (NK cells in adenocarcinoma of the stomach, and its correlation with prognostic factors and survival. METHODS: Seventy-two patients with gastric adenocarcinoma who underwent gastric resection surgery and D2 lymphadenectomy in the period 1997-2007 were analyzed. The concentration of NK cells was evaluated by immunohistochemistry technique with the reagent CD57. Patients were divided into two groups: high concentration (n = 32 (more than 15 cells per 10 high power field and low concentration (less or equal than 15 cells per 10 high power field. These two groups were compared with several prognostic factors such as: gender, age, tumor location, tumor differentiation, Lauren classification, stage, lymph nodes involvement, distant metastases and survival. The Kaplan-Meier curve was applied to evaluate survival

  4. Suppression of IL-8 Release by Sweet Olive Ethanolic Extract and Compounds in WiDr Colon Adenocarcinoma Cells.

    Science.gov (United States)

    Ye, Yi-Ling; Chang, Huei-Shin; Tseng, Yu-Fang; Shi, Li-Shian

    2017-08-01

    Oxidative stress can stimulate the secretion of pro-inflammatory cytokines. Interleukin-8 (IL-8) has been implicated in the pathogenesis of inflammatory bowel disease and the metastatic spread of colorectal cancer. The flowers of Osmanthus fragrans (sweet olive) are used to alleviate dysentery with blood in the bowel, as well as stomach ache and diarrhea. However, the evidence of their therapeutic effects on these symptoms remains unclear. In the present study, the protective effects of sweet olive flower ethanolic extract (OFE) against oxidative stress in WiDr cells was assessed by evaluating its 1,1-diphenyl-2-picrylhydrazyl (DPPH) free radical scavenging activity. In addition, cellular IL-8 secretion was evaluated. Notably, high-performance liquid chromatography showed verbascoside to be the primary constituent in OFE; it exhibited a DPPH scavenging activity with an IC50 of 8.23 μg/mL. Moreover, OFE (1 to 100 μg/mL) showed a potent, dose-dependent inhibitory effect on H2 O2 -induced IL-8 secretion in WiDr cells. Nine compounds were isolated from OFE based on a protective effect-guided purification process. Of these compounds, 5 phenolic compounds-verbascoside, phillygenin, tyrosol, methyl 4-hydroxycinnamate, and eutigoside A-reduced IL-8 secretion at 10 μg/mL treatment concentrations. Further analysis showed that the anti-inflammatory effects of OFE likely occurred via nuclear factor-κB pathway inhibition, which attenuates IL-8 secretion in cells. Collectively, these data suggest that OFE could be developed as an agent that suppresses IL-8 secretion to treat chronic inflammatory diseases. © 2017 Institute of Food Technologists®.

  5. Extremely low frequency electromagnetic field sensitizes cisplatin-resistant human ovarian adenocarcinoma cells via P53 activation.

    Science.gov (United States)

    Baharara, Javad; Hosseini, Nasrin; Farzin, Tayebe Ramezani

    2016-08-01

    In the following study, extremely low frequency electromagnetic fields (EL-EMF) radiation was used to restore sensitivity in the cisplatin-resistant A2780 ovarian cancer cells. For this purpose A2780 cells were treated with different doses of cisplatin and EL-EMF (50 Hz, 200 gauss, and 2 h) alone. Cytotoxicity was the measurement using MTT assay. After calculating IC50 for cisplatin (90 µg/ml) a lower concentration from IC50 (30 and 60 µg/ml) was used to be combined with EL-EMF. We compare the effects of each cisplatin, EL-EMF and combination groups using acridine orange-propidium iodide (AO/PI) and DAPI staining, caspase 3/9 activation assay and Annexin/PI assay. We also assessed changes in P53 and Matrix metalloproteinases 2 (MMPs) gene expression with semi-quantitative RT-PCR. Results indicated an EL-EMF-dependent proliferative decrease which was found EMF exposer, showed 47 and 71 % decrease in viability in rats. DAPI staining indicated that chromatin break down significantly increased in synergistic groups. Acridine orange staining also confirmed MTT assay results. Caspase activity significantly increased in the combined groups. Semi-quantitative RT-PCR showed that in synergistic groups of cisplatin and EL-EMF, expression of P53 was increased but the expression level of MPP-2 gene decreased. Results from this study showed that changes generated by the non-invasive EL-EMF can make resistant cells sensitive to cisplatin.

  6. MCF-7 human mammary adenocarcinoma cells exhibit augmented responses to human insulin on a collagen IV surface

    DEFF Research Database (Denmark)

    Listov-Saabye, Nicolai; Jensen, Marianne Blirup; Kiehr, Benedicte

    2009-01-01

    was significantly more mitogenic than native insulin, validating the ability of the assay to identify hypermitogenic human insulin analogs. With MCF-7 cells on a collagen IV surface, the ranking of mitogens was maintained, but fold mitogenic responses and dynamic range and steepness of dose-response curves were...... increased. Also, PI3K pathway activation by insulin was enhanced on a collagen IV surface. This study provided the first determination and ranking of the mitogenic potencies of standard reference compounds in an optimized MCF-7 assay. The optimized MCF-7 assay described here is of relevance for in vitro...... toxicological testing and carcinogenicity safety assessment of new insulin compounds....

  7. Nicotine-Mediated Regulation of Nicotinic Acetylcholine Receptors in Non-Small Cell Lung Adenocarcinoma by E2F1 and STAT1 Transcription Factors.

    Directory of Open Access Journals (Sweden)

    Courtney Schaal

    Full Text Available Cigarette smoking is the major risk factor for non-small cell lung cancer (NSCLC, which accounts for 80% of all lung cancers. Nicotine, the addictive component of tobacco smoke, can induce proliferation, migration, invasion, epithelial-mesenchymal transition (EMT, angiogenesis, and survival in NSCLC cell lines, as well as growth and metastasis of NSCLC in mice. This nicotine-mediated tumor progression is facilitated through activation of nicotinic acetylcholine receptors (nAChRs, specifically the α7 subunit; however, how the α7 nAChR gene is regulated in lung adenocarcinoma is not fully clear. Here we demonstrate that the α7 nAChR gene promoter is differentially regulated by E2F and STAT transcription factors through a competitive interplay; E2F1 induces the promoter, while STAT transcription factors repress it by binding to an overlapping site at a region -294 through -463bp upstream of the transcription start site. Treatment of cells with nicotine induced the mRNA and protein levels of α7 nAChR; this could be abrogated by treatment with inhibitors targeting Src, PI3K, MEK, α7 nAChR, CDK4/6 or a disruptor of the Rb-Raf-1 interaction. Further, nicotine-mediated induction of α7 nAChR was reduced when E2F1 was depleted and in contrast elevated when STAT1 was depleted by siRNAs. Interestingly, extracts from e-cigarettes, which have recently emerged as healthier alternatives to traditional cigarette smoking, can also induce α7 nAChR expression in a manner similar to nicotine. These results suggest an autoregulatory feed-forward loop that induces the levels of α7 nAChR upon exposure to nicotine, which enhances the strength of the signal. It can be imagined that such an induction of α7 nAChR contributes to the tumor-promoting functions of nicotine.

  8. Nicotine-Mediated Regulation of Nicotinic Acetylcholine Receptors in Non-Small Cell Lung Adenocarcinoma by E2F1 and STAT1 Transcription Factors.

    Science.gov (United States)

    Schaal, Courtney; Chellappan, Srikumar

    2016-01-01

    Cigarette smoking is the major risk factor for non-small cell lung cancer (NSCLC), which accounts for 80% of all lung cancers. Nicotine, the addictive component of tobacco smoke, can induce proliferation, migration, invasion, epithelial-mesenchymal transition (EMT), angiogenesis, and survival in NSCLC cell lines, as well as growth and metastasis of NSCLC in mice. This nicotine-mediated tumor progression is facilitated through activation of nicotinic acetylcholine receptors (nAChRs), specifically the α7 subunit; however, how the α7 nAChR gene is regulated in lung adenocarcinoma is not fully clear. Here we demonstrate that the α7 nAChR gene promoter is differentially regulated by E2F and STAT transcription factors through a competitive interplay; E2F1 induces the promoter, while STAT transcription factors repress it by binding to an overlapping site at a region -294 through -463bp upstream of the transcription start site. Treatment of cells with nicotine induced the mRNA and protein levels of α7 nAChR; this could be abrogated by treatment with inhibitors targeting Src, PI3K, MEK, α7 nAChR, CDK4/6 or a disruptor of the Rb-Raf-1 interaction. Further, nicotine-mediated induction of α7 nAChR was reduced when E2F1 was depleted and in contrast elevated when STAT1 was depleted by siRNAs. Interestingly, extracts from e-cigarettes, which have recently emerged as healthier alternatives to traditional cigarette smoking, can also induce α7 nAChR expression in a manner similar to nicotine. These results suggest an autoregulatory feed-forward loop that induces the levels of α7 nAChR upon exposure to nicotine, which enhances the strength of the signal. It can be imagined that such an induction of α7 nAChR contributes to the tumor-promoting functions of nicotine.

  9. Raspberry wine fermentation with suspended and immobilized yeast cells of two strains of Saccharomyces cerevisiae.

    Science.gov (United States)

    Djordjević, Radovan; Gibson, Brian; Sandell, Mari; de Billerbeck, Gustavo M; Bugarski, Branko; Leskošek-Čukalović, Ida; Vunduk, Jovana; Nikićević, Ninoslav; Nedović, Viktor

    2015-01-01

    The objectives of this study were to assess the differences in fermentative behaviour of two different strains of Saccharomyces cerevisiae (EC1118 and RC212) and to determine the differences in composition and sensory properties of raspberry wines fermented with immobilized and suspended yeast cells of both strains at 15 °C. Analyses of aroma compounds, glycerol, acetic acid and ethanol, as well as the kinetics of fermentation and a sensory evaluation of the wines, were performed. All fermentations with immobilized yeast cells had a shorter lag phase and faster utilization of sugars and ethanol production than those fermented with suspended cells. Slower fermentation kinetics were observed in all the samples that were fermented with strain RC212 (suspended and immobilized) than in samples fermented with strain EC1118. Significantly higher amounts of acetic acid were detected in all samples fermented with strain RC212 than in those fermented with strain EC1118 (0.282 and 0.602 g/l, respectively). Slightl