WorldWideScience

Sample records for adenocarcinoma cell lines

  1. A cystic fibrosis pancreatic adenocarcinoma cell line.

    Science.gov (United States)

    Schoumacher, R A; Ram, J; Iannuzzi, M C; Bradbury, N A; Wallace, R W; Hon, C T; Kelly, D R; Schmid, S M; Gelder, F B; Rado, T A

    1990-05-01

    We established a pancreatic adenocarcinoma cell line (CFPAC-1) from a patient with cystic fibrosis (CF) and assessed some of its properties. The cells show epithelial morphology and express cytokeratin and oncofetal antigens characteristic of pancreatic duct cells. Basal and stimulated levels of cAMP and cAMP-dependent protein kinase and the biophysical properties of single Cl- channels in CFPAC-1 are similar to those of airway and sweat gland primary cultures and Cl(-)-secreting epithelial cell lines. Anion transport and single Cl- channel activity was stimulated by Ca2+ ionophores but not by forskolin, cAMP analogs, or phosphodiesterase inhibitors. The cells express the CF gene and manifest the most common CF mutation, deletion of three nucleotides resulting in a phenylalanine-508 deletion. These properties have been stable through greater than 80 passages (24 months), suggesting that CFPAC-1 can serve as a continuous cell line that displays the CF defect.

  2. Characterization and properties of nine human ovarian adenocarcinoma cell lines.

    Science.gov (United States)

    Langdon, S P; Lawrie, S S; Hay, F G; Hawkes, M M; McDonald, A; Hayward, I P; Schol, D J; Hilgers, J; Leonard, R C; Smyth, J F

    1988-11-01

    Four series of cell lines have been derived from patients with ovarian adenocarcinoma. Nine cell lines have been established at one from a solid metastasis. Six lines were derived from the ascites or pleural effusion of patients with poorly differentiated adenocarcinoma: PEO1, PEO4, and PEO6 from one patient, PEA1 and PEA2 from a second, and PEO16 from a third. Three lines (PEO14 and PEO23 from ascites and TO14 from a solid metastasis) were derived from a patient with a well-differentiated serous adenocarcinoma. Each set of cell lines was morphologically distinct. The five cell lines PEO1, PEO4, PEO6, PEA1, and PEA2 had cloning efficiencies on plastic of 1-2% and only a few cells in these lines expressed alkaline phosphatase or vimentin. Only a low percentage of these cells reacted with the monoclonal antibodies 123C3 and 123A8 but most reacted with OC125. Conversely the cell lines PEO14, TO14, PEO23, and PEO16 were characterized by low cloning efficiency values (less than 0.05%), marked expression of alkaline phosphatase and vimentin, and good reaction with 123C3 and 123A8 but not OC125. These four cell lines also exhibited dome formation. Four of the cell lines, PEO1, PEO4, PEO6, and PEO16, have been xenografted into immune-deprived mice and found to be tumorigenic.

  3. Establishment and characterization of eight feline mammary adenocarcinoma cell lines.

    Science.gov (United States)

    Uyama, Rina; Hong, Sung-Hyeok; Nakagawa, Takayuki; Yazawa, Mitsuhiro; Kadosawa, Tsuyoshi; Mochizuki, Manabu; Tsujimoto, Hajime; Nishimura, Ryohei; Sasaki, Nobuo

    2005-12-01

    Eight new feline mammary adenocarcinoma cell lines derived from either primary or metastatic lesions were established. The morphology of all the cell lines was epithelioid and round to spindle in shape, with cell growth occurring in a monolayer fashion. On immunohistochemistry, these cells reacted with anti-keratin and anti-vimentin antisera. The doubling time of these cells was between 19 and 54 hr. Tumor masses were developed in nude mice by subcutaneous inoculation of the cells that were histologically identical to their original mammary tumor lesions. Telomerase activities measured using the telomeric repeat amplification protocol assay revealed high telemetric activity in all of the cells.

  4. Expression heterogeneity research of ITGB3 and BCL-2 in lung adenocarcinoma tissue and adenocarcinoma cell line.

    Science.gov (United States)

    Xia, Zong-Jiang; Hu, Wei; Wang, Yue-Bin; Zhou, Kun; Sun, Guo-Ju

    2014-06-01

    To analyze expression heterogeneity of Integrin beta 3 (ITGB3) and B-cell lymphoma 2 (BCL-2) in lung adenocarcinoma tissue and adenocarcinoma cell line and further provide theoretical direction for molecular biological research of lung adenocarcinoma. Tissue microarray was used to observe relation among expression, heterogeneitpy and clinical characteristics of ITGB3 and BCL-2 in lung cancer. ITGB3 and BCL-2 increased significantly in A549 cells in CAFs group withβ-actin as control; the expression level of BCL-2 also increased in ITGB3 transfected cells with GFP plasmid transfected A549 cells as control; immunohistochemistry staining showed that positive rates of ITGB3, ITGB1 and BCL-2 in normal lung tissues were 0, the positive rates in lung adenocarcinoma were 7.04%, 84.51% and 4.23%, respectively; in the results of immunohistochemistry staining, the expression of Girdin protein in lung adenocarcinoma was homogeneous, however protein expression of ITGB3, ITGB1 and BCL-2 showed different patterns in the same location with significant heterogeneity; majority of ITGB3, ITGB1 or BCL-2 positive tissue showed heterogeneity that expression in trailing edge was higher than that of trailing edge in lung adenocarcinoma tissue, the patients with BCL-2 heterogeneity showed higher lymph node metastasis ratio and lower clinical stage (P0.05). Expression of ITGB3 and BCL-2 in lung adenocarcinoma and adenocarcinoma cell line showed heterogeneity that expression in trailing edge was higher than that of trailing edge, which may play an important role in promoting tumor lymph node metastasis and vascular invasion, and provides a new research direction for exploration of lung adenocarcinoma metastasis mechanism. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  5. File list: DNS.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  6. File list: Unc.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  7. File list: ALL.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143598,SRX1143596,SRX1143599,SRX1143597 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  8. File list: His.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  9. File list: Unc.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  10. File list: Unc.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  11. File list: InP.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  12. File list: Pol.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  13. File list: ALL.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  14. File list: His.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143597,SRX1143599,SRX1143598,SRX1143596 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  15. File list: InP.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  16. File list: ALL.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  17. File list: His.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143596,SRX1143597,SRX1143598,SRX1143599 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  18. File list: ALL.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ALL.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 All antigens Lung Lung adenocarcinoma... cell lines SRX1143597,SRX1143599,SRX1143598,SRX1143596 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/ALL.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  19. File list: Pol.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  20. File list: NoD.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 No description Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  1. File list: Unc.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Unc.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 Unclassified Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Unc.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  2. File list: Oth.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  3. File list: Oth.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  4. File list: Pol.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  5. File list: Pol.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 RNA polymerase Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  6. File list: Oth.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  7. File list: NoD.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 No description Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  8. File list: DNS.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.50.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  9. File list: NoD.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available NoD.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 No description Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/NoD.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  10. File list: Oth.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 TFs and others Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Oth.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  11. File list: His.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 Histone Lung Lung adenocarcinoma... cell lines SRX1143598,SRX1143596,SRX1143599,SRX1143597 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  12. File list: InP.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  13. File list: DNS.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.05.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  14. File list: DNS.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available DNS.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines hg19 DNase-seq Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/DNS.Lng.20.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  15. File list: InP.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available InP.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines hg19 Input control Lung Lung adenocarcinoma... cell lines http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/InP.Lng.10.AllAg.Lung_adenocarcinoma_cell_lines.bed ...

  16. [Isolation and identification of side population cells in human lung adenocarcinoma cell line A549].

    Science.gov (United States)

    Xie, Tong; Li, Li; Li, Dan-rong; Mao, Nai-quan; Liu, De-seng; Zuo, Chuan-tian; Zhang, Wei; Huang, Ding-ming

    2011-02-01

    To isolate and characterize the side population cells (SP cells) in the lung adenocarcinomas cell line A549. The protein expression of ABCG2 in human lung adenocarcinoma cell line A549 was detected by immunohistochemistry. SP and NSP cells in the cell line A549 were isolated by FACS, and their differentiation was analysed. ABCG2 expression in the two cell subsets was detected by RT-PCR. The cell growth curves, cell division indexes, cell cycles, plate clone formation tests, migration and invasion assays, chemotherapeutic susceptibility tests, tests of the intracellular drug levels, and the tumor cell implantation experiments on nude mice were applied to study the biological properties of the two cell subsets. The expression of ABCG2 in the transplanted tumor in nude mice was detected by immunohistochemistry and RT-PCR. The positive rate of ABCG2 expression in the A549 cells by immunohistochemistry was 2.13%. SP and NSP cells were isolated by FACS. The SP cells could produce both SP and NSP cells, while NSP cells only produced NSP cells. SP cells expressed ABCG2, but NSP cells did not. The proliferation and migration abilities of the two cell subsets were similar, but the invasion and tumorigenic ability of SP cells was significantly higher than that of NSP cells. The susceptibilities to DDP and its intracellular levels of the two cell subsets were similar, but the susceptibilities to 5-FU, VP16, NVB and GEM and their intracellular levels of NSP cells were significantly higher than those of the SP cells. SP cells in the human lung adenocarcinomas cell line A549 is enriched with tumor stem cells. An effective way to get lung adenocarcinomas stem cells is to isolate SP cells by FACS.

  17. Growth Hormone differentially modulates chemoresistance in human endometrial adenocarcinoma cell lines.

    Science.gov (United States)

    Gentilin, Erica; Minoia, Mariella; Bondanelli, Marta; Tagliati, Federico; Degli Uberti, Ettore C; Zatelli, Maria Chiara

    2017-06-01

    Growth Hormone may influence neoplastic development of endometrial epithelium towards endometrial adenocarcinoma, which is one of the most occurring tumors in acromegalic patients. Since chemoresistance often develops in advanced endometrial adenocarcinoma, we investigated whether Growth Hormone might influence the development of chemoresistance to drugs routinely employed in endometrial adenocarcinoma treatment, such as Doxorubicin, Cisplatin, and Paclitaxel. Growth Hormone and Growth Hormone receptor expression was assessed by immunofluorescence in two endometrial adenocarcinoma cell lines, AN3 CA and HEC-1-A cells. Growth Hormone effects were assessed investigating cell viability, caspase3/7 activation, ERK1/2, and protein kinase C delta protein expression. AN3 CA and HEC-1-A cells display Growth Hormone and Growth Hormone receptor. Growth Hormone does not influence cell viability in both cells lines, but significantly reduces caspase 3/7 activation in AN3 CA cells, an effect blocked by a Growth Hormone receptor antagonist. Growth Hormone rescues AN3 CA cells from the inhibitory effects of Doxorubicin and Cisplatin on cell viability, while it has no effect on Paclitaxel. Growth Hormone does not influence the pro-apoptotic effects of Doxorubicin, but is capable of rescuing AN3 CA cells from the pro-apoptotic effects of Cisplatin. On the other hand, Growth Hormone did not influence the effects of Doxorubicin and Paclitaxel on HEC-1A cell viability. The protective action of Growth Hormone towards the effects of Doxorubicin may be mediated by ERK1/2 activation, while the pro-apoptotic effects of Cisplatin may be mediated by protein kinase C delta inhibition. All together our results indicate that Growth Hormone may differentially contribute to endometrial adenocarcinoma chemoresistance. This may provide new insights on novel therapies against endometrial adenocarcinoma chemoresistant aggressive tumors.

  18. Nuclear expression of claudin-3 in human colorectal adenocarcinoma cell lines and tissues.

    Science.gov (United States)

    Tokuhara, Yasunori; Morinishi, Tatsuya; Matsunaga, Toru; Sakai, Manabu; Sakai, Takayoshi; Ohsaki, Hiroyuki; Kadota, Kyuichi; Kushida, Yoshio; Haba, Reiji; Hirakawa, Eiichiro

    2018-01-01

    Claudins are members of a large family of transmembrane proteins, which are essential for the formation of tight junctions and have a significant effect on the biological behavior of tumor progression. Previous studies have demonstrated that several claudins show aberrant expression patterns in numerous types of cancer. The present study investigated the expression and localization of claudin-3 and claudin-7 in human colorectal adenocarcinoma cell lines and tissues. The protein expression levels of claudin-3 and claudin-7 were determined using immunocytochemical and immunohistochemical staining. Claudin-3, but not claudin-7, exhibited nuclear localization in the human colorectal adenocarcinoma Caco-2 and SW620 cell lines. Surgically resected colorectal adenocarcinoma tissue specimens were obtained, and the associations between the expression of claudin-3 or claudin-7 and various clinicopathological parameters were analyzed. The membranous expression rates of claudin-3 and claudin-7 were 58.0 and 50.0%, while their nuclear expression rates were 22.0 and 2.0%, respectively. The membranous expression of claudin-3 and claudin-7 was not associated with any clinicopathological factors, whereas the nuclear expression of claudin-3 was associated with histological type and was significantly increased in colorectal mucinous adenocarcinomas compared with that in well- to moderately-differentiated colorectal adenocarcinomas (P<0.01). However, no associations were observed between the nuclear expression of claudin-7 and any clinicopathological parameter. In conclusion, the nuclear expression of claudin-3 in colorectal mucinous adenocarcinoma may be involved in the biological transformation of tumors. The results from the present study indicated that claudin-3 is an important protein associated with histological type and has potential as a prognostic marker. Although the mechanisms underlying the nuclear localization of claudin-3 in tumorigenesis have not yet been elucidated in

  19. Self-renewing Pten-/- TP53-/- protospheres produce metastatic adenocarcinoma cell lines with multipotent progenitor activity.

    Directory of Open Access Journals (Sweden)

    Wassim Abou-Kheir

    Full Text Available Prostate cancers of luminal adenocarcinoma histology display a range of clinical behaviors. Although most prostate cancers are slow-growing and indolent, a proportion is aggressive, developing metastasis and resistance to androgen deprivation treatment. One hypothesis is that a portion of aggressive cancers initiate from stem-like, androgen-independent tumor-propagating cells. Here we demonstrate the in vitro creation of a mouse cell line, selected for growth as self-renewing stem/progenitor cells, which manifests many in vivo properties of aggressive prostate cancer. Normal mouse prostate epithelium containing floxed Pten and TP53 alleles was subjected to CRE-mediated deletion in vitro followed by serial propagation as protospheres. A polyclonal cell line was established from dissociated protospheres and subsequently a clonal daughter line was derived. Both lines demonstrate a mature luminal phenotype in vitro. The established lines contain a stable minor population of progenitor cells with protosphere-forming ability and multi-lineage differentiation capacity. Both lines formed orthotopic adenocarcinoma tumors with metastatic potential to lung. Intracardiac inoculation resulted in brain and lung metastasis, while intra-tibial injection induced osteoblastic bone formation, recapitulating the bone metastatic phenotype of human prostate cancer. The cells showed androgen receptor dependent growth in vitro. Importantly, in vivo, the deprivation of androgens from established orthotopic tumors resulted in tumor regression and eventually castration-resistant growth. These data suggest that transformed prostate progenitor cells preferentially differentiate toward luminal cells and recapitulate many characteristics of the human disease.

  20. Roles of histamine on the expression of aldehyde dehydrogenase 1 in endometrioid adenocarcinoma cell line

    Science.gov (United States)

    Wang, Yi; Jiang, Yang; Ikeda, Jun-ichiro; Tian, Tian; Sato, Atsushi; Ohtsu, Hiroshi; Morii, Eiichi

    2014-01-01

    Cancer-initiating cells (CICs) are a limited number of cells that are essential for maintenance, recurrence, and metastasis of tumors. Aldehyde dehydrogenase 1 (ALDH1) has been recognized as a marker of CICs. We previously reported that ALDH1-high cases of uterine endometrioid adenocarcinoma showed poor prognosis, and that ALDH1 high population was more tumorigenic, invasive, and resistant to apoptosis than ALDH1 low population. Histamine plays a critical role in cancer cell proliferation, migration, and invasion. Here, we examined the effect of histamine on ALDH1 expression in endometrioid adenocarcinoma cell line. The addition of histamine increased ALDH1 high population, which was consistent with the result that histamine enhanced the invasive ability and the resistance to anticancer drug. Among 4 types of histamine receptors, histamine H1 and H2 receptor (H1R and H2R) were expressed in endometrioid adenocarcinoma cell line. The addition of H1R agonist but not H2R agonist increased ALDH1. The antagonist H1R but not H2R inhibited the effect of histamine on ALDH1 expression. These results indicated that histamine increased the expression of ALDH1 via H1R but not H2R. These findings may provide the evidence for exploring a new strategy to suppress CICs by inhibiting ALDH1 expression with histamine. PMID:25045085

  1. Establishment and Characterization of a Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang2 in Immunodeficient Mice

    OpenAIRE

    Shunfang YANG; Su, Jianzhong; Meiping SHI; Lanxiang ZHAO; Zhang, Peiling; Cao, Jie; Lu, Jianying; Xie, Wenhui

    2009-01-01

    Background and objective The recurrence, metastasis and multidrug resistance (MDR) in lung cancer are the tough problems worldwide. This study was to establish a novel chinese lung adenocarcinoma cell line with high metastasis potential for exploring the mechanism of reccurrence, development and MDR in lung cancer. Methods The cell came from the abdominal dropsy of a fifty-six years old female patient with lung adenocarcinoma and the tumor markers CA125, CYFRA21-1, CEA, NSE were detected to b...

  2. Subcellular distribution and expression of cofilin and ezrin in human colon adenocarcinoma cell lines with different metastatic potential

    Directory of Open Access Journals (Sweden)

    D. Nowak

    2010-04-01

    Full Text Available The dynamic reorganization of the actin cytoskeleton is regulated by a number of actin binding proteins (ABPs. Four human colon adenocarcinoma cell lines – parental and three selected sublines, which differ in motility and metastatic potential, were used to investigate the expression level and subcellular localization of selected ABPs. Our interest was focused on cofilin and ezrin. These proteins are essential for cell migration and adhesion. The data received for the three more motile adenocarcinoma sublines (EB3, 3LNLN, 5W were compared with those obtained for the parental LS180 adenocarcinoma cells and fibroblastic NRK cells. Quantitative densitometric analysis and confocal fluorescence microscopy were used to examine the expression levels and subcellular distribution of the selected ABPs. Our data show distinct increase in the level of cofilin in adenocarcinoma cells accompanied by the reduction of inactive phosphorylated form of cofilin. In more motile cells, cofilin was accumulated at cellular periphery in co-localization with actin filaments. Furthemore, we indicated translocation of ezrin towards the cell periphery within more motile cells in comparison with NRK and parental adenocarcinoma cells. In summary, our data indicate the correlation between migration ability of selected human colon adenocarcinoma sublines and subcellular distribution as well as the level of cofilin and ezrin. Therefore these proteins might be essential for the higher migratory activity of invasive tumor cells.

  3. Sulforaphane-induced apoptosis in Xuanwei lung adenocarcinoma cell line XWLC-05.

    Science.gov (United States)

    Zhou, Lan; Yao, Qian; Li, Yan; Huang, Yun-Chao; Jiang, Hua; Wang, Chuan-Qiong; Fan, Lei

    2017-01-01

    Xuanwei district in Yunnan Province has the highest incidence of lung cancer in China, especially among non-smoking women. Cruciferous vegetables can reduce lung cancer risk by prompting a protective mechanism against respiratory tract inflammation caused by air pollution, and are rich in sulforaphane, which can induce changes in gene expression. We investigated the effect of sulforaphane-induced apoptosis in Xuanwei lung adenocarcinoma cell line (XWCL-05) to explore the value of sulforaphane in lung cancer prevention and treatment. Cell growth inhibition was determined by methyl thiazolyl tetrazolium assay; cell morphology and apoptosis were observed under transmission electron microscope; cell cycle and apoptosis rates were detected using flow cytometry; B-cell lymphoma 2 (Bcl-2) and Bcl-2-like protein 4 (Bax) messenger RNA expression were determined by quantitative PCR; and p53, p73, p53 upregulated modulator of apoptosis (PUMA), Bax, Bcl-2, and caspase-9 protein expression were detected by Western blotting. Sulforaphane inhibited XWLC-05 cell growth with inhibitory concentration (IC)50 of 4.04, 3.38, and 3.02 μg/mL at 24, 48, and 72 hours, respectively. Sulforaphane affected the XWLC-05 cell cycle as cells accumulated in the G2/M phase. The proportion of apoptotic cells observed was 27.6%. Compared with the control, the sulforaphane group showed decreased Bcl-2 and p53 expression, and significantly increased p73, PUMA, Bax, and caspase-9 protein expression (P Sulforaphane induces Xuanwei lung adenocarcinoma cell apoptosis. Its possible mechanism may involve the upregulation of p73 expression and its effector target genes PUMA and Bax in lung cancer cells, downregulation of the anti-apoptotic gene B cl -2, and activation of caspase-9. It may also involve downregulation of the mutant p53 protein. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  4. Human Adenocarcinoma Cell Line Sensitivity to Essential Oil Phytocomplexes from Pistacia Species: a Multivariate Approach.

    Science.gov (United States)

    Buriani, Alessandro; Fortinguerra, Stefano; Sorrenti, Vincenzo; Dall'Acqua, Stefano; Innocenti, Gabbriella; Montopoli, Monica; Gabbia, Daniela; Carrara, Maria

    2017-08-11

    Principal component analysis (PCA) multivariate analysis was applied to study the cytotoxic activity of essential oils from various species of the Pistacia genus on human tumor cell lines. In particular, the cytotoxic activity of essential oils obtained from P. lentiscus, P. lentiscus var. chia (mastic gum), P. terebinthus, P. vera, and P. integerrima, was screened on three human adenocarcinoma cell lines: MCF-7 (breast), 2008 (ovarian), and LoVo (colon). The results indicate that all the Pistacia phytocomplexes, with the exception of mastic gum oil, induce cytotoxic effects on one or more of the three cell lines. PCA highlighted the presence of different cooperating clusters of bioactive molecules. Cluster variability among species, and even within the same species, could explain some of the differences seen among samples suggesting the presence of both common and species-specific mechanisms. Single molecules from one of the most significant clusters were tested, but only bornyl-acetate presented cytotoxic activity, although at much higher concentrations (IC50 = 138.5 µg/mL) than those present in the essential oils, indicating that understanding of the full biological effect requires a holistic vision of the phytocomplexes with all its constituents.

  5. Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.

    Science.gov (United States)

    Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke

    2013-12-15

    The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.

  6. Gene expression changes associated with Barrett's esophagus and Barrett's-associated adenocarcinoma cell lines after acid or bile salt exposure

    Directory of Open Access Journals (Sweden)

    Sahbaie Peyman

    2007-06-01

    Full Text Available Abstract Background Esophageal reflux and Barrett's esophagus represent two major risk factors for the development of esophageal adenocarcinoma. Previous studies have shown that brief exposure of the Barrett's-associated adenocarcinoma cell line, SEG-1, or primary cultures of Barrett's esophageal tissues to acid or bile results in changes consistent with cell proliferation. In this study, we determined whether similar exposure to acid or bile salts results in gene expression changes that provide insights into malignant transformation. Methods Using previously published methods, Barrett's-associated esophageal adenocarcinoma cell lines and primary cultures of Barrett's esophageal tissue were exposed to short pulses of acid or bile salts followed by incubation in culture media at pH 7.4. A genome-wide assessment of gene expression was then determined for the samples using cDNA microarrays. Subsequent analysis evaluated for statistical differences in gene expression with and without treatment. Results The SEG-1 cell line showed changes in gene expression that was dependent on the length of exposure to pH 3.5. Further analysis using the Gene Ontology, however, showed that representation by genes associated with cell proliferation is not enhanced by acid exposure. The changes in gene expression also did not involve genes known to be differentially expressed in esophageal adenocarcinoma. Similar experiments using short-term primary cultures of Barrett's esophagus also did not result in detectable changes in gene expression with either acid or bile salt exposure. Conclusion Short-term exposure of esophageal adenocarcinoma SEG-1 cells or primary cultures of Barrett's esophagus does not result in gene expression changes that are consistent with enhanced cell proliferation. Thus other model systems are needed that may reflect the impact of acid and bile salt exposure on the esophagus in vivo.

  7. Enhancement of Radiation Effects by Ursolic Acid in BGC-823 Human Adenocarcinoma Gastric Cancer Cell Line.

    Directory of Open Access Journals (Sweden)

    Yang Yang

    Full Text Available Recent research has suggested that certain plant-derived polyphenols, i.e., ursolic acid (UA, which are reported to have antitumor activities, might be used to sensitize tumor cells to radiation therapy by inhibiting pathways leading to radiation therapy resistance. This experiment was designed to investigate the effects and possible mechanism of radiosensitization by UA in BGC-823 cell line from human adenocarcinoma gastric cancer in vitro. UA caused cytotoxicity in a dose-dependent manner, and we used a sub-cytotoxicity concentration of UA to test radioenhancement efficacy with UA in gastric cancer. Radiosensitivity was determined by clonogenic survival assay. Surviving fraction of the combined group with irradiation and sub-cytotoxicity UA significantly decreased compared with the irradiation group. The improved radiosensitization efficacy was associated with enhanced G2/M arrest, increased reactive oxygen species (ROS, down-regulated Ki-67 level and improved apoptosis. In conclusion, as UA demonstrated potent antiproliferation effect and synergistic effect, it could be used as a potential drug sensitizer for the application of radiotherapy.

  8. Rutamarin, an Active Constituent from Ruta angustifolia Pers., Induced Apoptotic Cell Death in the HT29 Colon Adenocarcinoma Cell Line.

    Science.gov (United States)

    Suhaimi, Shafinah Ahmad; Hong, Sok Lai; Abdul Malek, Sri Nurestri

    2017-07-01

    Ruta angustifolia Pers. is a perennial herb that is cultivated worldwide, including Southeast Asia, for the treatment of various diseases as traditional medicine. The purpose of the study was to identify an active principle of R. angustifolia and to investigate its effect on the HT29 cell death. The methanol and fractionated extracts (hexane, chloroform, ethyl acetate, and water) of R. angustifolia Pers. were initially investigated for their cytotoxic activity against two human carcinoma cell lines (MCF7 and HT29) and a normal human colon fibroblast cell line (CCD-18Co) using sulforhodamine B cytotoxicity assay. Eight compounds including rutamarin were isolated from the active chloroform extract and evaluated for their cytotoxic activity against HT29 human colon carcinoma cell line and CCD-18Co noncancer cells. Further studies on the induction of apoptosis such as morphological examinations, biochemical analyses, cell cycle analysis, and caspase activation assay were conducted in rutamarin-treated HT29 cells. Rutamarin exhibited remarkable cytotoxic activity against HT29 cells (IC50 value of 5.6 μM) but was not toxic to CCD-18Co cells. The morphological and biochemical hallmarks of apoptosis including activation of caspases 3, 8, and 9 were observed in rutamarin-treated HT29 cells. These may be associated with cell cycle arrest at the G0/G1 and G2/M checkpoints, which was also observed in HT29 cells. The present study describes rutamarin-induced apoptosis in the HT29 cell line for the first time and suggests that rutamarin has the potential to be developed as an anticancer agent. Rutamarin was cytotoxic to HT29 colon cancer cells but exerted no damage to normal colon cellsRutamarin induced morphological and biochemical hallmarks of apoptosis in HT29 cellsRutamarin induced cell cycle arrest at the G0/G1 and G2/M checkpoints in a dose-dependent manner in HT29 cellsRutamarin activated caspases 3, 8, and 9 in a dose-dependent manner in HT29 cells. Abbreviations used

  9. In Vitro Effects of Phthalate Mixtures on Colorectal Adenocarcinoma Cell Lines.

    Science.gov (United States)

    Yurdakok Dikmen, Begum; Alpay, Merve; Kismali, Gorkem; Filazi, Ayhan; Kuzukiran, Ozgur; Sireli, Ufuk Tansel

    2015-01-01

    Among endocrine-disrupting chemicals, phthalates are an important concern because of their wide-spread exposure in humans and environmental contamination. Even though the use of some phthalates has been restricted for toys, some plastics, and food contact materials, exposure to the mixture of these contaminants at very low concentrations in various matrices are still being reported. In the current research, the effects of the mixture of some phthalates were studied. Di-n-butyl phthalate (DBP), n-butyl benzyl phthalate (BBP), di-2-ethylhexyl phthalate (DEHP), diisononyl phthalate (DiNP), di-n-octyl phthalate (DNOP), and diisodecyl phthalate (DiDP) were tested on two colorectal adenocarcinoma cell lines; DLD-1 and HT29 were studied as described before. Cells were treated with increasing log concentrations (0.33 ppt to 33.33 ppb) of the phthalate mixture; cell viability/proliferation was measured by MTT and staining with neutral red and crystal violet; lactate dehydrogenase (LDH) activity was measured following 24-h exposure. Cell viability/proliferation increased from phthalate treatment at concentrations less than 33.33 ppt. The phthalate mixture induced increases in HT29 proliferation of 10.94% at 33.33 ppt and 60.87% at 3.33 ppt, whereas this proliferation relation at lower concentrations was not found for DLD1 cells. The present study demonstrates preliminary information regarding the low dose induction of proliferation of the cancer cells by phthalate mixtures. Because non-monotonic dose responses are still being debated, further studies are required to re-evaluate the reference doses defined by governments for phthalates.

  10. [Establishment and Characterization of a Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang2 in Immunodeficient Mice.].

    Science.gov (United States)

    Yang, Shunfang; Su, Jianzhong; Shi, Meiping; Zhao, Lanxiang; Zhang, Peiling; Cao, Jie; Lu, Jianying; Xie, Wenhui

    2009-10-20

    The recurrence, metastasis and multidrug resistance (MDR) in lung cancer are the tough problems worldwide. This study was to establish a novel chinese lung adenocarcinoma cell line with high metastasis potential for exploring the mechanism of reccurrence, development and MDR in lung cancer. The cell came from the abdominal dropsy of a fifty-six years old female patient with lung adenocarcinoma and the tumor markers CA125, CYFRA21-1, CEA, NSE were detected to be higher secretion by radioimmunoassay in the abdominal dropsy. Tumorigenicity of immunodeficient mice was confirmed in 8th passage. The cell growth curve was mapped. Analysis of chromosome karyotype was tested. The gene expression was measured by real-time quantitative PCR. The tumorigenesis rate started at 8th passage in 3/10 immunodeficient mice via subcutaneously and the fully tumorigenicity was at 11th passage as well as later passages. Under the microscope, the cell showed oval-shap and adherence. The chromosome karyotype analysis of the cells was sub-triploid. Approximately 1*10(6) and 1.5*10(6) cancerous cells were injected into left cardiac ventricle and tail vein of immunodeficient mice respectively. The results showed multiorgan metastasis in the mice after three-four weeks, including mandible, scapula, humerus, vertebral column, femur, rib and brain, liver, adrenal gland, pulmonary in the mice after inoculation. The bone metastasis rate was 100% in the tumor bearing mice by bone scintigraphy and pathology. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR genes were overexpressed. The novel cell was named CPA-Yang2 The characteristics of novel strain CPA-Yang2 is a highly metastasis cell line of Chinese lung adenocarcinoma. It has stable traits, highly metastasis ability and maybe is a MDR lung cancerous cell line. Of course, it's a good experimental model for lung cancer research.

  11. The study of optimal condition of SPIO labeling human lung adenocarcinoma cell line (SPC-A-1)

    Science.gov (United States)

    Yu, Ming-xi; Chen, Wen-li; Zhou, Quan; Xing, Da; Tang, Yong-hong

    2008-02-01

    Propose: To study the optimal concentration and time of incubation of human lung adenocarcinoma cell line (SPC-A-1) labeled with superparamagnetic iron oxide (SPIO) particles in vitro. Methods: Human lung adenocarcinoma cell line (SPC-A-1) was cultured with different concenration of SPIO and different time of incubation (labeled with media containing Fe-PLL: 25μg /mL, 100μg /mL, and 200 μg /mL, and for 30min, 90min, 180min. The phagocytosis of the cells was observed by laser scanning confocal microscopy (LSCM) to determine particle uptake and their distribution in cells. Results: Human lung adenocarcinoma cells(SPC-A-1) have taken up a large amount of SPIO particles within the first 3h. Conclusion: In this study, the concentration of iron with 25μg/ml SPIO and time of incubation for 30min is the optimal condition for labeling the SPC-A-1 with SPIO.

  12. Establishment and Characterization of a Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang2 in Immunodeficient Mice

    Directory of Open Access Journals (Sweden)

    Shunfang YANG

    2009-10-01

    Full Text Available Background and objective The recurrence, metastasis and multidrug resistance (MDR in lung cancer are the tough problems worldwide. This study was to establish a novel chinese lung adenocarcinoma cell line with high metastasis potential for exploring the mechanism of reccurrence, development and MDR in lung cancer. Methods The cell came from the abdominal dropsy of a fifty-six years old female patient with lung adenocarcinoma and the tumor markers CA125, CYFRA21-1, CEA, NSE were detected to be higher secretion by radioimmunoassay in the abdominal dropsy. Tumorigenicity of immunodeficient mice was confirmed in 8th passage. The cell growth curve was mapped. Analysis of chromosome karyotype was tested. The gene expression was measured by real-time quantitative PCR. Results The tumorigenesis rate started at 8th passage in 3/10 immunodeficient mice via subcutaneously and the fully tumorigenicity was at 11th passage as well as later passages. Under the microscope, the cell showed oval-shap and adherence. The chromosome karyotype analysis of the cells was sub-triploid. Approximately 1×106 and 1.5×106 cancerous cells were injected into left cardiac ventricle and tail vein of immunodeficient mice respectively. The results showed multiorgan metastasis in the mice after three-four weeks, including mandible, scapula, humerus, vertebral column, femur, rib and brain, liver, adrenal gland, pulmonary in the mice after inoculation. The bone metastasis rate was 100% in the tumor bearing mice by bone scintigraphy and pathology. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR genes were overexpressed. The novel cell was named CPA-Yang2. Conclusion The characteristics of novel strain CPA-Yang2 is a highly metastasis cell line of Chinese lung adenocarcinoma. It has stable traits, highly metastasis ability and maybe is a MDR lung cancerous cell line. Of course, it’s a good experimental

  13. In Vitro Incorporation of Radioiodinated Eugenol on Adenocarcinoma Cell Lines (Caco2, MCF7, and PC3).

    Science.gov (United States)

    Dervis, Emine; Yurt Kilcar, Ayfer; Medine, Emin Ilker; Tekin, Volkan; Cetkin, Buse; Uygur, Emre; Muftuler, Fazilet Zumrut Biber

    2017-04-01

    Recently, the synthesis of radiolabeled plant origin compounds has been increased due to their high uptake on some cancer cell lines. Eugenol (EUG), a phenolic natural compound in the essential oils of different spices such as Syzygium aromaticum (clove), Pimenta racemosa (bay leaves), and Cinnamomum verum (cinnamon leaf), has been exploited for various medicinal applications. EUG has antiviral, antioxidant, and anti-inflammatory functions and several anticancer properties. The objective of this article is to synthesize radioiodinated (131I) EUG and investigate its effect on Caco2, MCF7, and PC3 adenocarcinoma cell lines. It is observed that radioiodinated EUG would have potential on therapy and imaging due to its notable uptakes in studied cells.

  14. Inositol Hexakisphosphate Mediates Apoptosis in Human Breast Adenocarcinoma MCF-7 Cell Line via Intrinsic Pathway

    Science.gov (United States)

    Agarwal, Rakhee; Ali, Nawab

    2010-04-01

    Inositol polyphosphates (InsPs) are naturally occurring compounds ubiquitously present in plants and animals. Inositol hexakisphosphate (InsP6) is the most abundant among all InsPs and constitutes the major portion of dietary fiber in most cereals, legumes and nuts. Certain derivatives of InsPs also regulate cellular signaling mechanisms. InsPs have also been shown to reduce tumor formation and induce apoptosis in cancerous cells. Therefore, in this study, the effects of InsPs on apoptosis were studied in an attempt to investigate their potential anti-cancer therapeutic application and understand their mechanism of action. Acridine orange and ethidium bromide staining suggested that InsP6 dose dependently induced apoptosis in human breast adenocarcinoma MCF-7 cells. Among InsPs tested (InsP3, InsP4, InsP5, and InsP6), InsP6 was found to be the most effective in inducing apoptosis. Furthermore, effects of InsP6 were found most potent inducing apoptosis. Etoposide, the drug known to induce apoptosis in both in vivo and in vitro, was used as a positive control. Western blotting experiments using specific antibodies against known apoptotic markers suggested that InsP6 induced apoptotic changes were mediated via an intrinsic apoptotic pathway.

  15. The Anticancer Effects of Radachlorin-mediated Photodynamic Therapy in the Human Endometrial Adenocarcinoma Cell Line HEC-1-A.

    Science.gov (United States)

    Kim, Su-Mi; Rhee, Yun-Hee; Kim, Jong-Soo

    2017-11-01

    We investigated the effect of photodynamic therapy (PDT) using radachlorin on invasion, vascular formation and apoptosis by targeting epidermal growth factor receptor (EGFR)/vascular endothelial growth factor receptor 2 (VEGFR2) signaling pathways in the HEC-1-A endometrial adenocarcinoma cell line. To investigate the apoptotic pathway, we performed the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay, and western blot analysis. We also evaluated the effects of PDT on tubular capillary formation in and invasion by HEC-1-A cells with a tube formation assay, invasion assay, prostaglandin E2 (PGE2) assay, and western blot analysis. PDT had anticancer effects on HEC-1-A through activation of the intrinsic pathway of apoptosis via caspase-9 and poly-(ADP-ribose) polymerase (PARP). PDT also inhibited tubular capillary formation in and invasion by HEC-1-A under VEGF pretreatment, that resulted from down-regulation of VEGFR2, EGFR, Ras homolog gene family/ member A (RhoA) and PGE2. These results are indicative of the specificity of radachlorin-mediated PDT to VEGF. The major advantage of radachlorin-mediated PDT is its selectivity for cancer tissue while maintaining adjacent normal endometrial tissue. Therefore, radachlorin-mediated PDT might offer high anticancer efficacy for endometrial adenocarcinoma and an especially useful modality for preserving fertility. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  16. Curcumin Effect on the Expressional Profile of OCT4, Nanog and Nucleostemin Genes in AGS (Adenocarcinoma Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Fahmideh Bagrezaei

    2016-07-01

    Full Text Available Background Curcumin is the natural yellow pigment in turmeric isolated from the rhizome of the plant Curcuma longa. Curcumin inhibits formation and invasive cancer cells and destroys cancer cells resistant to chemotherapeutic drugs. Objectives The purpose of this study was the survey of effects of different concentrations of alcoholic curcumin on the octamer-binding transcription factor 4 (OCT4 Nanog and Nucleostemin genes in the AGS (human gastric adenocarcinoma cell line. Materials and Methods In this experimental study the AGS cell line was cultured in RPMI-1640, supplemented with penicillin/streptomycin (100 U/mL and 100 mg/mL, respectively and 10% fetal bovine serum, at 37°C in a humidified atmosphere of 5% CO2. In 60 - 70% cell confluence, the cells were treated with curcumin concentration (20, 40, 100 μL and incubated for 24, 48 and 72 hours. Finally, total RNA were extracted and cDNA were synthesized and the expression of mentioned genes was detected. The data were analyzed by excel software. Results Expression rate of OCT4A, OCT4B, Nanog and Nucleostemin (GLN3 at concentrations less than 20 μg/mL were reduced but OCT4B1 expression showed increased by hours respectively. Conclusions The results showed that curcumin inhibited cell division; also, this study could be the basis for more extensive studies on the anti-cancer effect of the combined plants.

  17. NONO and RALY proteins are required for YB-1 oxaliplatin induced resistance in colon adenocarcinoma cell lines

    Directory of Open Access Journals (Sweden)

    Tsofack Serges P

    2011-11-01

    Full Text Available Abstract Background YB-1 is a multifunctional protein that affects transcription, splicing, and translation. Overexpression of YB-1 in breast cancers causes cisplatin resistance. Recent data have shown that YB-1 is also overexpress in colorectal cancer. In this study, we tested the hypothesis that YB-1 also confers oxaliplatin resistance in colorectal adenocarcinomas. Results We show for the first time that transfection of YB-1 cDNA confers oxaliplatin resistance in two colorectal cancer cell lines (SW480 and HT29 cell lines. Furthermore, we identified by mass spectrometry analyses important YB-1 interactors required for such oxaliplatin resistance in these colorectal cancer cell lines. A tagged YB-1 construct was used to identify proteins interacting directly to YB-1 in such cells. We then focused on proteins that are potentially involved in colorectal cancer progression based on the Oncomine microarray database. Genes encoding for these YB-1 interactors were also examined in the public NCBI comparative genomic hybridization database to determine whether these genes are localized to regions of chromosomes rearranged in colorectal cancer tissues. From these analyses, we obtained a list of proteins interacting with YB-1 and potentially involved in oxaliplatin resistance. Oxaliplatin dose response curves of SW480 and HT29 colorectal cancer cell lines transfected with several siRNAs corresponding to each of these YB-1 interactors were obtained to identify proteins significantly affecting oxaliplatin sensitivity upon gene silencing. Only the depletion of either NONO or RALY sensitized both colorectal cancer cell lines to oxaliplatin. Furthermore, depletion of NONO or RALY sensitized otherwise oxaliplatin resistant overexpressing YB-1 SW480 or HT29 cells. Conclusion These results suggest knocking down NONO or RALY significant counteracts oxaliplatin resistance in colorectal cancers overexpressing the YB-1 protein.

  18. Evaluating the effect of four extracts of avocado fruit on esophageal squamous carcinoma and colon adenocarcinoma cell lines in comparison with peripheral blood mononuclear cells.

    Science.gov (United States)

    Vahedi Larijani, Laleh; Ghasemi, Maryam; AbedianKenari, Saeid; Naghshvar, Farshad

    2014-01-01

    Most patients with gastrointestinal cancers refer to the health centers at advanced stages of the disease and conventional treatments are not significantly effective for these patients. Therefore, using modern therapeutic approaches with lower toxicity bring higher chance for successful treatment and reduced adverse effects in such patients. The aim of this study is to evaluate the effect of avocado fruit extracts on inhibition of the growth of cancer cells in comparison with normal cells. In an experimental study, ethanol, chloroform, ethyl acetate, and petroleum extracts of avocado (Persea americana) fruit were prepared. Then, the effects if the extracts on the growth of esophageal squamous cell carcinoma and colon adenocarcinoma cell lines were evaluated in comparison with the control group using the MTT test in the cell culture medium. Effects of the four extracts of avocado fruit on three cells lines of peripheral blood mononuclear cells, esophageal squamous cell carcinoma, and colon adenocarcinoma were tested. The results showed that avocado fruit extract is effective in inhibition of cancer cell growth in comparison with normal cells (PAvocado fruit is rich in phytochemicals, which play an important role in inhibition of growth of cancer cells. The current study for the first time demonstrates the anti-cancer effect of avocado fruit extracts on two cancers common in Iran. Therefore, it is suggested that the fruit extracts can be considered as appropriate complementary treatments in treatment of esophageal and colon cancers.

  19. Nintedanib: A Review of Its Use as Second-Line Treatment in Adults with Advanced Non-Small Cell Lung Cancer of Adenocarcinoma Histology.

    Science.gov (United States)

    Dhillon, Sohita

    2015-06-01

    Nintedanib (Vargatef®) is a triple angiokinase inhibitor that potently blocks the proangiogenic pathways mediated by vascular endothelial growth factor receptors, platelet-derived growth factor receptors and fibroblast growth factor receptors. In the EU, nintedanib in combination with docetaxel is indicated for adults with locally advanced, metastatic or locally recurrent non-small cell lung cancer (NSCLC) of adenocarcinoma tumour histology after first-line chemotherapy. Nintedanib in combination with docetaxel relative to placebo plus docetaxel significantly prolonged progression-free survival (PFS), but did not increase overall survival (OS), in the overall population of patients with advanced NSCLC in the phase III LUME-Lung 1 study. Notably, the subgroup of patients with adenocarcinoma histology experienced a significant improvement in both PFS and OS with nintedanib plus docetaxel, with a greater benefit seen in patients with rapidly progressing disease. Nintedanib is the first antiangiogenic agent to have shown a survival benefit in the second-line treatment of these patients. Health-related quality of life (HR-QOL) was not adversely affected with the addition of nintedanib to docetaxel in the overall population or in the adenocarcinoma subgroup. Nintedanib combination therapy had a generally manageable tolerability profile. Adverse events typically associated with antiangiogenic agents (e.g. bleeding and hypertension) were not greatly increased with nintedanib plus docetaxel relative to placebo plus docetaxel. To conclude, nintedanib in combination with docetaxel is an effective treatment option for patients with advanced NSCLC of adenocarcinoma histology after first-line chemotherapy.

  20. Effects of proton beam irradiation on mitochondrial biogenesis in a human colorectal adenocarcinoma cell line.

    Science.gov (United States)

    Ha, Byung Geun; Jung, Sung Suk; Shon, Yun Hee

    2017-09-01

    Proton beam therapy has recently been used to improve local control of tumor growth and reduce side-effects by decreasing the global dose to normal tissue. However, the regulatory mechanisms underlying the physiological role of proton beam radiation are not well understood, and many studies are still being conducted regarding these mechanisms. To determine the effects of proton beams on mitochondrial biogenesis, we investigated: mitochondrial DNA (mtDNA) mass; the gene expression of mitochondrial transcription factors, functional regulators, and dynamic-related regulators; and the phosphorylation of the signaling molecules that participate in mitochondrial biogenesis. Both the mtDNA/nuclear DNA (nDNA) ratio and the mitochondria staining assays showed that proton beam irradiation increases mitochondrial biogenesis in 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced aggressive HT-29 cells. Simultaneously, proton beam irradiation increases the gene expression of the mitochondrial transcription factors PGC-1α, NRF1, ERRα, and mtTFA, the dynamic regulators DRP1, OPA1, TIMM44, and TOM40, and the functional regulators CytC, ATP5B and CPT1-α. Furthermore, proton beam irradiation increases the phosphorylation of AMPK, an important molecule involved in mitochondrial biogenesis that is an energy sensor and is regulated by the AMP/ATP ratio. Based on these findings, we suggest that proton beam irradiation inhibits metastatic potential by increasing mitochondrial biogenesis and function in TPA-induced aggressive HT-29 cells.

  1. Okadaic acid inhibits cell multiplication and induces apoptosis in a549 cells, a human lung adenocarcinoma cell line.

    Science.gov (United States)

    Wang, Renjun; Lv, Lili; Zhao, Yunfeng; Yang, Nana

    2014-01-01

    This essay aims to research the effect of okadaic acid (OA) on A549 cell multiplication, and cell apoptosis induced by OA was observed by cell morphology. MTT assay, trypan blue exclusion test (TBET), Giemsa staining method and acridine orange (AO) fluorescence staining assay were applied. The results of cell survival evaluated by TBET and colorimetric assay with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) showed: The number of A549 cells was decreased in a dose-dependent manner. Cytomorphology observation of okadaic acid-treated cells showed that cells became shrinkage and turned round, some cells floated in the nutrient medium with nucleus agglutination broken, resulting in apoptotic bodies. Above-mentioned results indicated that OA exerted significantly inhibitory effect on A549 cell multiplication due to the apoptosis induced by OA.

  2. Establishment of A Novel Chinese Human Lung Adenocarcinoma Cell Line CPA-Yang3 and Its Real Bone Metastasis Clone CPA-Yang3BM in Immunodeficient Mice

    Directory of Open Access Journals (Sweden)

    Shunfang YANG

    2011-02-01

    Full Text Available Background and objective The recurrence and metastasis of lung cancer is a tough problem worldwide. The aim of this study is to establish a novel Chinese lung adenocarcinoma cell line and its real bone-seeking clone sub-line for exploring the molecular mechanism of lung cancer metastasis. Methods The cells came from the pleural effusion of a sixtyfive years old female patient with lung adenocarcinoma and supraclavicular lymph node metastases. The gene expression was detected by real-time quantitative PCR. Intracardiac injection of the cells into nude mice was performed and in vivo imaging was obtained by bone scintigraphy and conventional radiography. Bone metastases were determined on bone scintigraphy and then the lesions were resected under deep anesthesia for bone metastasis cancer cell culture. The process was repeated for four cycles to obtain a real bone-seeking clone. Results The tumorigenesis rate started at 4th passage in immunodeficient mice via subcutaneously and as well as later passages. Approximately 1×106 cancer cells were injected into left cardiac ventricle of immunodeficient mice resulted bone metastasis sites were successfully revealed by bone scintigraphy and pathological diagnosis, the mandible (100%, scapula (33%, humerus (50%, vertebral column (50%, femur (66.7% and accompanied invasion with other organs, the adrenal gland (17%, pulmonary (33%, liver (50%, submaxillary gland (33% in the mice after inoculation two-three weeks. The chromosome karyotype analysis of the cells was subdiploid. Quantitative real-time PCR was used to examined and compared with SPC-A-1 lung adenocarcinoma, ESM1, VEGF-C, IL-6, IL-8, AR, SVIL, FN1 genes were overexpress. The novel cell was named CPA-Yang3. The femur metastasis cell was repeated in vivo-in vitro-in vivo with three cycles and harvested a real bone metastasis clone. It was named CPA-Yang3BM. Conclusion Tne characteristics of novel strain CPAYang3 is a highly metastasis cell line of

  3. MicroRNA alterations in Barrett′s esophagus, esophageal adenocarcinoma, and esophageal adenocarcinoma cell lines following cranberry extract treatment: Insights for chemoprevention

    Directory of Open Access Journals (Sweden)

    Laura A Kresty

    2011-01-01

    Full Text Available Background: Aberrant expression of small noncoding endogenous RNA molecules known as microRNAs (miRNAs is documented to occur in multiple cancer types including esophageal adencarcinoma (EAC and its only known precursor, Barrett′s esophagus (BE. Recent studies have linked dysregulation of specific miRNAs to histological grade, neoplastic progression and metastatic potential. Materials and Methods: Herein, we present a summary of previously reported dysregulated miRNAs in BE and EAC tissues as well as EAC cell lines and evaluate a cranberry proanthocyanidin rich extract′s (C-PAC ability to modulate miRNA expression patterns of three human EAC cell lines (JHEso-Ad-1, OE33 and OE19. Results: A review of 13 published studies revealed dysregulation of 87 miRNAs in BE and EAC tissues, whereas 52 miRNAs have been reported to be altered in BE or EAC cell lines, with 48% overlap with miRNA changes reported in tissues. We report for the first time C-PAC-induced modulation of five miRNAs in three EAC cell lines resulting in 26 validated gene targets and identification of key signaling pathways including p53, angiogenesis, T-cell activation and apoptosis. Additionally, mutiple cancer related networks were ideintified as modulated by C-PAC utilizing Kyoto Encyclopedia of Genes and Genomes (KEGG, Protein Analysis Through Evolutionary Relationships (PANTHER, and MetaCore analysis tools. Conclusions: Study results support the cancer inhibitory potential of C-PAC is in part attributable to C-PAC′s ability to modify miRNA profiles within EAC cells. A number of C-PAC-modulated miRNAs have been been identified as dysregulated in BE and EAC. Further insights into miRNA dysregulation and modulation by select cancer preventive agents will support improved targeted interventions in high-risk cohorts.

  4. Comparative proteome analysis of three mouse lung adenocarcinoma CMT cell lines with different metastatic potential by two-dimensional gel electrophoresis and mass spectrometry

    DEFF Research Database (Denmark)

    Zhang, Kelan; Wrzesinski, Krzysztof; Stephen, J Fey

    2008-01-01

    Metastasis is a lethal attribute of a cancer and presents a continuing therapeutic challenge. Metastasis is a highly complex process and more knowledge about the mechanisms behind metastasis is highly desirable. Isogenic CMT cell lines were selected from a spontaneous mouse lung adenocarcinoma...... to be significantly up- or down-regulated between cell lines with different metastatic potential at passages 5 and 15, respectively. These proteins were identified by MS and most of them have previously been reported to be related to cancer development and/or metastasis. Bioinformatics analysis indicated that several...... of the proteins were involved in proteasome, cell-cycle and cell-communication pathways. Among them, some keratins, 14-3-3 proteins and 26S proteasome proteins were identified and their aberrant expression may be directly or indirectly involved in cancer development and metastasis. In conclusion, our...

  5. Melatonin inhibits the migration of human lung adenocarcinoma A549 cell lines involving JNK/MAPK pathway.

    Directory of Open Access Journals (Sweden)

    Qiaoyun Zhou

    Full Text Available OBJECTIVE: Melatonin, an indolamine produced and secreted predominately by the pineal gland, exhibits a variety of physiological functions, possesses antioxidant and antitumor properties. But, the mechanisms for the anti-cancer effects are unknown. The present study explored the effects of melatonin on the migration of human lung adenocarcinoma A549 cells and its mechanism. METHODS: MTT assay was employed to measure the viability of A549 cells treated with different concentrations of melatonin. The effect of melatonin on the migration of A549 cells was analyzed by wound healing assay. Occludin location was observed by immunofluorescence. The expression of occludin, osteopontin (OPN, myosin light chain kinase (MLCK and phosphorylation of myosin light chain (MLC, JNK were detected by western blots. RESULTS: After A549 cells were treated with melatonin, the viability and migration of the cells were inhibited significantly. The relative migration rate of A549 cells treated with melatonin was only about 20% at 24 h. The expression level of OPN, MLCK and phosphorylation of MLC of A549 cells were reduced, while the expression of occludin was conversely elevated, and occludin located on the cell surface was obviously increased. The phosphorylation status of JNK in A549 cells was also reduced when cells were treated by melatonin. CONCLUSIONS: Melatonin significantly inhibits the migration of A549 cells, and this may be associated with the down-regulation of the expression of OPN, MLCK, phosphorylation of MLC, and up-regulation of the expression of occludin involving JNK/MAPK pathway.

  6. Synergistic antitumor activity of pro-apoptotic agent PAC-1 with cisplatinum by the activation of CASP3 in pulmonary adenocarcinoma cell line H1299.

    Science.gov (United States)

    Huang, Jian-qing; Liang, Hong-ling; Zhang, Xu-chao; Xie, Zhi; Jin, Tian-en

    2016-03-01

    Evasion of apoptosis is a hallmark of human cancer cells. We sought to explore the potential synergistic antitumor activity and underlying mechanisms of the pro-apoptotic agent PAC-1 plus cisplatinum (Cis) in non-small cell lung cancer (NSCLC) cell lines. The adenocarcinoma cell lines H1299, A549, PC9, H1650 and H1975 were used as in vitro models. Colorimetric MTT assays, Western blotting and flow cytometry were used to evaluate the anti-growth effects of PAC-1 and/or Cis and apoptosis status. The activated form of CASP3 (C-CASP3) was assessed by immunofluorescent staining. Single-agent Cis and PAC-1 were able to inhibit the cancer cell growth in certain dose ranges, with IC50 values of 1.9-11.7 and 5.6-14.8 μM, respectively. Sequential Cis→PAC-1 or concurrent Cis + PAC-1, but not PAC-1→Cis combinations showed synergistic effects on cell growth inhibition in H1299 cells (combination index, CI ≤ 0.6). In contrast, other combination modes mostly showed seemingly antagonistic effects (CI > 1.0). Flow cytometric analysis showed that Cis→PAC-1 sequential combination showed strong pro-apoptotic effects in H1299 cells. Western blots showed that in H1299, PC9 and H1975 cells, PAC-1 promoted the C-CASP3, but only in H1299 cells was there a synergistic effect with Cis on the CASP3 activation. PAC-1 showed anti-tumor activity in NSCLCs in vitro and a synergistic effect with cisplatin in EGFR(wt)KRAS(wt) H1299 cells. Our data suggest a potential treatment approach using cisplatin plus a pro-apoptotic agent acting via CASP3 activation for this subgroup of pulmonary adenocarcinomas. © 2015 The Authors. Asia-Pacific Journal of Clinical Oncology Published by Wiley Publishing Asia Pty Ltd.

  7. Establishment of an experimental human lung adenocarcinoma cell line SPC-A-1BM with high bone metastases potency by {sup 99m}Tc-MDP bone scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yang Shunfang [Department of Nuclear Medicine, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China)], E-mail: yzyg@sh163.net; Dong Qianggang [Laboratory of Mol-diagnosis, Shanghai Cancer Institute of Shanghai Jiaotong University, Shanghai 200032 (China); Yao Ming [Laboratory of Pathology, Shanghai Cancer Institute of Shanghai Jiaotong University, Shanghai 200032 (China); Shi Meiping [Department of Pathology, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Ye Jianding [Department of Radiology, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Zhao Langxiang [Department of Pathology, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Su Jianzhong; Gu Weiyong [Shanghai Thoracic Tumor Institute, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Xie Wenhui [Department of Nuclear Medicine, Shanghai Chest Hospital of Shanghai Jiaotong University, Shanghai 200030 (China); Wang Kankan; Du Yanzhi [State Key Laboratory of Medical Genomics, Ruijin Hospital of Shanghai Jiaotong University, Shanghai 200025 (China); Li Yao [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433 (China); Huang Yan [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Science, Fudan University, Shanghai 200433 (China)], E-mail: huangyan@fudan.edu.cn

    2009-04-15

    Background: Bone metastasis is one of the most common clinical phenomena of late stage lung cancer. A major impediment to understanding the pathogenesis of bone metastasis has been the lack of an appropriate animal and cell model. This study aims to establish human lung adenocarcinoma cell line with highly bone metastases potency with {sup 99m}Tc-MDP bone scintigraphy. Methods: The human lung adenocarcinoma cancer cells SPC-A-1 were injected into the left cardiac ventricle of NIH-Beige-Nude-XID (NIH-BNX) immunodeficient mice. The metastatic lesions of tumor-bearing mice were imaged with {sup 99m}Tc-MDP bone scintigraphy on a Siemens multi-single photon emission computed tomography. Pinhole images were acquired on a GZ-B conventional gamma camera with a self-designed pinhole collimator. The mice with bone metastasis were sacrificed under deep anesthesia, and the lesions were resected. Bone metastatic cancer cells in the resected lesions were subjected for culture and then reinoculated into the NIH-BNX mice through left cardiac ventricle. The process was repeated for eight cycles to obtain a novel cell subline SPC-A-1BM. Real-time polymerase chain reaction (PCR) was used to compare the gene expression differences in the parental and SPC-A-1BM cells. Results: The bone metastasis sites were successfully revealed by bone scintigraphy. The established bone metastasis cell line SPC-A-1BM had a high potential to metastasize in bone, including mandible, humerus, thoracic vertebra, lumbar, femur, patella, ilium and cartilage rib. The expression level of vascular endothelial growth factor gene family, Bcl-2 and cell adhesion-related genes ECM1, ESM1, AF1Q, SERPINE2 and FN1 were examined. Gene expression difference was found between parental and bone-seeking metastasis cell SPC-A-1BM, which indicates SPC-A-1BM has metastatic capacity vs. its parental cells. Conclusion: SPC-A-1BM is a bone-seeking metastasis human lung adenocarcinoma cell line. Bone scintigraphy may be used as

  8. Drug exposure in a metastatic human lung adenocarcinoma cell line gives rise to cells with differing adhesion, proliferation, and gene expression: Implications for cancer chemotherapy.

    Science.gov (United States)

    Li, Huiling; He, Jianxing; Zhong, Nanshan; Hoffman, Robert M

    2015-09-01

    The Am1010 cell line was previously established from a metastatic deposit in an arm muscle from a patient with lung adenocarcinoma who had undergone four cycles of chemotherapy with cisplatin and taxol. Am1010 cells were labeled with red fluorescent protein or green fluorescent protein. A total of eight sublines were isolated following in vitro exposure to cisplatin or taxol. The sublines differed with regard to their adhesion and proliferation properties, with certain sublines exhibiting an increased proliferation rate and/or decreased surface adhesion. Gene expression assays demonstrated that tenascin C; cyclin D1; collagen, type 1, α2; integrin α1; related RAS viral (r‑ras) oncogene homolog 2; platelet‑derived growth factor C; and Src homolog 2 domain containing in the focal adhesion pathway, and intercellular adhesion molecule 1, F11 receptor, claudin 7 and cadherin 1 in the cell adhesion pathway, varied in expression among the sublines. The results of the present study suggested that drug exposure may alter the aggressiveness and metastatic potential of cancer cells, which has important implications for cancer chemotherapy.

  9. Glucose-regulated protein 58 modulates β-catenin protein stability in a cervical adenocarcinoma cell line.

    Science.gov (United States)

    Liao, Chia-Jung; Wu, Tzu-I; Huang, Ya-Hui; Chang, Ting-Chang; Lai, Chyong-Huey; Jung, Shih-Ming; Hsueh, Chuen; Lin, Kwang-Huei

    2014-08-01

    Cervical cancer continues to threaten women's health worldwide, and the incidence of cervical adenocarcinoma (AD) is rising in the developed countries. Previously, we showed that glucose-regulated protein 58 (Grp58) served as an independent factor predictive of poor prognosis of patients with cervical AD. However, the molecular mechanism underlying the involvement of Grp58 in cervical carcinogenesis is currently unknown. DNA microarray and enrichment analysis were used to identify the pathways disrupted by knockdown of Grp58 expression. Among the pathway identified, the WNT signaling pathway was one of those that were significantly associated with knockdown of Grp58 expression in HeLa cells. Our experiments showed that β-catenin, a critical effector of WNT signaling, was stabilized thereby accumulated in stable Grp58 knockdown cells. Membrane localization of β-catenin was observed in Grp58 knockdown, but not control cells. Using a transwell assay, we found that accumulated β-catenin induced by Grp58 knockdown or lithium chloride treatment inhibited the migration ability of HeLa cells. Furthermore, an inverse expression pattern of Grp58 and β-catenin was observed in cervical tissues. Our results demonstrate that β-catenin stability is negatively regulated by Grp58 in HeLa cells. Overexpression of Grp58 may be responsible for the loss of or decrease in membranous β-catenin expression in cervical AD.

  10. Augmentation of the cytotoxic effects of zinc oxide nanoparticles by MTCP conjugation: Non-canonical apoptosis and autophagy induction in human adenocarcinoma breast cancer cell lines.

    Science.gov (United States)

    Mozdoori, Najmeh; Safarian, Shahrokh; Sheibani, Nader

    2017-09-01

    Zinc oxide nanoparticles are very toxic, but their agglomeration reduces their lethal cytotoxic effects. Here we tested the hypothesis that conjugation of ZnO nanoparticles via Meso-Tetra (4-Carboxyphenyl) Porphyrin (MTCP) could provide electrostatic or steric stabilization of ZnO nanoparticles and increase their cytotoxic effects. The cytotoxicity and cell death induction were assessed using two human breast adenocarcinoma cell lines (MCF-7 and MDA-MB-468). The MTT results indicated that the toxicity of ZnO nanoparticles was significantly increased upon MTCP conjugation. Annexin/PI and real time RT-PCR results demonstrated that the ZnO-MTCP nanoparticles induced cell death via different non-canonical pathways that are under ca2+ control. Calcium signaling could regulate lysosomal dependent apoptosis and death autophagy, and killing of the two selected types of breast cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Extracellular Signals of a Human Epithelial Colorectal Adenocarcinoma (Caco-2) Cell Line Facilitate the Penetration of Pseudomonas aeruginosa PAO1 Strain through the Mucin Layer.

    Science.gov (United States)

    Hayashi, Naoki; Yokotani, Atsushi; Yamamoto, Masami; Kososhi, Mariko; Morita, Mayu; Fukunishi, Chiaki; Nishizawa, Nagisa; Gotoh, Naomasa

    2017-01-01

    Pseudomonas aeruginosa can penetrate the layer of mucus formed by host intestinal epithelial cells, often resulting in sepsis in immunocompromised patients. We have previously demonstrated that P. aeruginosa can penetrate the mucin layer by flagellar motility and the degradation of the mucin layer. However, it remains unclear how P. aeruginosa initially recognizes epithelial cells. Using the human epithelial colorectal adenocarcinoma (Caco-2) cell line, we investigated extracellular signaling that could facilitate the penetration of P. aeruginosa through the mucin layer. The supernatant from Caco-2 cell cultures increased penetration of P. aeruginosa through an artificial mucin layer. The Caco-2 cell supernatant increased bacterial flagella-dependent swarming motility, but it did not influence P. aeruginosa growth or protease activity. Filtering of the Caco-2 cell supernatant indicated that proteins weighing Caco-2 cell supernatant attracted P. aeruginosa cells. Finally, we identified that growth-regulated oncogene-α (GRO-α) secreted by Caco-2 cells was a factor facilitating flagellar filament rotation and swarming motility, although it did not attract the bacteria. We conclude that penetration of the mucin layer by P. aeruginosa is facilitated by small proteins (Caco-2 cells, both by inducing acceleration of flagellar motility and increasing chemotaxis.

  12. Clinical Significance of T Lymphocyte Subset Changes After First Line Chemotherapy in Peripheral Blood from Patients with Advanced Stage Adenocarcinoma Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Xiang YAN

    2012-03-01

    Full Text Available Background and objective The immune function disorder relates closely to the occurrence, metastasis, and prognosis of cancer. T lymphocyte subsets take an important role in immune function. We identified the dynamic changes of the immune system by investigating the levels of T lymphocyte subsets in peripheral blood of lung cancer patients with advanced stage adenocarcinoma undergoing first line chemotherapy. The results aided the search for rational chemo-immunotherapy strategies in lung cancer treatment. Methods Samples from 49 patients with pathologically demonstrated advanced stage adenocarcinoma cell lung cancer were compared with those from 33 healthy donors. Subsequently, the patients were separately treated with Docetaxol-based or Pemetrexed-based therapy. Peripheral blood samples at different time points after therapy were analyzed by flowcytometry. The lymphocyte subsets of the total lymphocytes were compared. Independent sample t test was used for the quantitative data analysis. Results The percentage of CD3+, CD3+CD4+, CD4+CD25+ cells of the lung cancer patients significantly varied from those of the healthy donors, the P values are 0.012, 0.034 and 0.006 separately. The CD3+ and CD3+CD4+ levels increased significantly on the 4th and 7th-10th day post-chemotherapy, which return to normal levels on the 21th day. The CD3+ level increased significantly both in the treatment group on all time points, while the CD3+, CD3+CD4+, CD4+/CD8+ levels significantly increased and the CD3+CD8+, CD8+CD28- levels significantly decreased on the 4th day in Pemetrexed group. The CD3+CD4+ levels increased significantly on the 4th and 7th-10th day and the CD3+CD8+, CD8+CD28- levels decreased on the 4th day in partial response group. Conclusion The immune function of advanced stage adenocarcinoma cell lung cancer patients was evidently suppressed, and was restored at the 4th day, followed by a reduction at the 21st day after chemotherapy. On the 4th day

  13. Myxoma virus is oncolytic for human pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Woo, Yanghee; Kelly, Kaitlyn J; Stanford, Marianne M; Galanis, Charles; Chun, Yun Shin; Fong, Yuman; McFadden, Grant

    2008-08-01

    Viral oncolytic therapy, which seeks to exploit the use of live viruses to treat cancer, has shown promise in the treatment of cancers resistant to conventional anticancer therapies. Among the most difficult to treat cancers is advanced pancreatic adenocarcinoma. Our study investigates the ability of a novel oncolytic agent, myxoma virus, to infect, productively replicate in, and kill human pancreatic cancer cells in vitro. The myxoma virus vMyxgfp was tested against a panel of human pancreatic adenocarcinoma cell lines. Infectivity, viral proliferation, and tumor cell kill were assessed. Infection of tumor cells was assessed by expression of the marker gene enhanced green fluorescent protein (e-GFP). vMyxgfp had the ability to infect all pancreatic cancer cell lines tested. Killing of tumor cells varied among the 6 cell lines tested, ranging from >90% cell kill at 7 days for the most sensitive Panc-1 cells, to 39% in the most resistant cell line Capan-2. Sensitivity correlated to replication of virus, and was found to maximally exhibit a four-log increase in foci-forming units for the most sensitive Panc-1 cells within 72 h. Our study demonstrates for the first time the ability of the myxoma virus to productively infect, replicate in, and lyse human pancreatic adenocarcinoma cells in vitro. These data encourage further investigation of this virus, which is pathogenic only in rabbits, for treatment of this nearly uniformly fatal cancer.

  14. Comparative characterization of stem cell marker expression, metabolic activity and resistance to doxorubicin in adherent and spheroid cells derived from the canine prostate adenocarcinoma cell line CT1258.

    Science.gov (United States)

    Liu, Wen; Moulay, Mohammed; Willenbrock, Saskia; Roolf, Catrin; Junghanss, Christian; Ngenazahayo, Anaclet; Nolte, Ingo; Murua Escobar, Hugo

    2015-04-01

    Canine prostate cancer represents a spontaneous animal model for the human counterpart. Cells with stem cell-like character are considered to play a major role in therapeutic resistance and tumor relapse. Thus, the identification of markers allowing for recognition and characterization of these cells is essential. Expression of 12 stem cell marker genes in the canine prostate cancer cell line CT1258 and spheroid cells generated from these was analyzed by quantitative real-time PCR. In CT1258 and the generated spheroid cells, CD44 and CD133 expression was analyzed by flow cytometry, as well as proliferation and doxorubicin resistance. Integrin alpha-6 (ITGA6) expression and metabolic activity were significantly up-regulated in CT1258-derived spheroid cells, while doxorubicin resistance remained comparable. ITGA6 de-regulation and metabolic activity appear to be characteristic of the generated spheres, indicating potential intervention targets. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  15. Sirt3 is a tumor suppressor in lung adenocarcinoma cells.

    Science.gov (United States)

    Xiao, Kui; Jiang, Jiehan; Wang, Wei; Cao, Shan; Zhu, Liming; Zeng, Huihui; Ouyang, Ruoyun; Zhou, Rui; Chen, Ping

    2013-09-01

    Sirt3, a member of the mammalian sirtuin family protein that is localized to mitochondria, is a NAD+-dependent deacetylase and plays an important role in the control of metabolic activity. Recently, several studies have shown the potential role of Sirt3 in certain types of tumors such as breast cancer and hepatocellular carcinoma. However, the role of Sirt3 in lung adenocarcinoma has never been studied. In the present study, we found that Sirt3 protein expression was downregulated in human lung adenocarcinoma tissue when compared with that in adjacent normal tissue. Overexpression of Sirt3 using adenovirus significantly inhibited the growth of the A549 lung adenocarcinoma cell line. In this cell line, overexpression of Sirt3 induced apoptosis, which was evidenced by Annexin V + PI assay and cleaved caspase-3 immunoblotting. Furthermore, overexpression of Sirt3 increased the bax/bcl-2 and bad/bcl-x/L ratios, and promoted AIF translocation to the nucleus. Finally, Sirt3 overexpression upregulated p53 and p21 protein levels, and decreased intracellular ROS levels. Collectively, our data suggest that Sirt3 is a tumor suppressor in lung adenocarcinoma development and progression and may be a promising therapeutic target for lung adenocarcinoma.

  16. Molecular mechanisms of bortezomib resistant adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Erika Suzuki

    Full Text Available Bortezomib (Velcade™ is a reversible proteasome inhibitor that is approved for the treatment of multiple myeloma (MM. Despite its demonstrated clinical success, some patients are deprived of treatment due to primary refractoriness or development of resistance during therapy. To investigate the role of the duration of proteasome inhibition in the anti-tumor response of bortezomib, we established clonal isolates of HT-29 adenocarcinoma cells adapted to continuous exposure of bortezomib. These cells were ~30-fold resistant to bortezomib. Two novel and distinct mutations in the β5 subunit, Cys63Phe, located distal to the binding site in a helix critical for drug binding, and Arg24Cys, found in the propeptide region were found in all resistant clones. The latter mutation is a natural variant found to be elevated in frequency in patients with MM. Proteasome activity and levels of both the constitutive and immunoproteasome were increased in resistant cells, which correlated to an increase in subunit gene expression. These changes correlated with a more rapid recovery of proteasome activity following brief exposure to bortezomib. Increased recovery rate was not due to increased proteasome turnover as similar findings were seen in cells co-treated with cycloheximide. When we exposed resistant cells to the irreversible proteasome inhibitor carfilzomib we noted a slower rate of recovery of proteasome activity as compared to bortezomib in both parental and resistant cells. Importantly, carfilzomib maintained its cytotoxic potential in the bortezomib resistant cell lines. Therefore, resistance to bortezomib, can be overcome with irreversible inhibitors, suggesting prolonged proteasome inhibition induces a more potent anti-tumor response.

  17. Modulation of cell cycle and gene expression in pancreatic tumor cell lines by methionine deprivation (methionine stress): implications to the therapy of pancreatic adenocarcinoma.

    Science.gov (United States)

    Kokkinakis, Demetrius M; Liu, Xiaoyan; Neuner, Russell D

    2005-09-01

    The effect of methionine deprivation (methionine stress) on the proliferation, survival, resistance to chemotherapy, and regulation of gene and protein expression in pancreatic tumor lines is examined. Methionine stress prevents successful mitosis and promotes cell cycle arrest and accumulation of cells with multiple micronuclei with decondensed chromatin. Inhibition of mitosis correlates with CDK1 down-regulation and/or inhibition of its function by Tyr(15) phosphorylation or Thr(161) dephosphorylation. Inhibition of cell cycle progression correlates with loss of hyperphosphorylated Rb and up-regulation of p21 via p53 and/or transforming growth factor-beta (TGF-beta) activation depending on p53 status. Although methionine stress-induced toxicity is not solely dependent on p53, the gain in p21 and loss in CDK1 transcription are more enhanced in wild-type p53 tumors. Up-regulation of SMAD7, a TGF-beta signaling inhibitor, suggests that SMAD7 does not restrict the TGF-beta-mediated induction of p21, although it may prevent up-regulation of p27. cDNA oligoarray analysis indicated a pleiotropic response to methionine stress. Cell cycle and mitotic arrest is in agreement with up-regulation of NF2, ETS2, CLU, GADD45alpha, GADD45beta, and GADD45gamma and down-regulation of AURKB, TOP2A, CCNA, CCNB, PRC1, BUB1, NuSAP, IFI16, and BRCA1. Down-regulation of AREG, AGTR1, M-CSF, and EGF, IGF, and VEGF receptors and up-regulation of GNA11 and IGFBP4 signify loss of growth factor support. PIN1, FEN1, and cABL up-regulation and LMNB1, AREG, RhoB, CCNG, TYMS, F3, and MGMT down-regulation suggest that methionine stress sensitizes the tumor cells to DNA-alkylating drugs, 5-fluorouracil, and radiation. Increased sensitivity of pancreatic tumor cell lines to temozolomide is shown under methionine stress conditions and is attributed in part to diminished O(6)-methylguanine-DNA methyltransferase and possibly to inhibition of the cell cycle progression.

  18. Mertensene, a Halogenated Monoterpene, Induces G2/M Cell Cycle Arrest and Caspase Dependent Apoptosis of Human Colon Adenocarcinoma HT29 Cell Line through the Modulation of ERK-1/-2, AKT and NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Safa Tarhouni-Jabberi

    2017-07-01

    Full Text Available Conventional treatment of advanced colorectal cancer is associated with tumor resistance and toxicity towards normal tissues. Therefore, development of effective anticancer therapeutic alternatives is still urgently required. Nowadays, marine secondary metabolites have been extensively investigated due to the fact that they frequently exhibit anti-tumor properties. However, little attention has been given to terpenoids isolated from seaweeds. In this study, we isolated the halogenated monoterpene mertensene from the red alga Pterocladiella capillacea (S.G. Gmelin Santelices and Hommersand and we highlight its inhibitory effect on the viability of two human colorectal adenocarcinoma cell lines HT29 and LS174. Interestingly, exposure of HT29 cells to different concentrations of mertensene correlated with the activation of MAPK ERK-1/-2, Akt and NF-κB pathways. Moreover, mertensene-induced G2/M cell cycle arrest was associated with a decrease in the phosphorylated forms of the anti-tumor transcription factor p53, retinoblastoma protein (Rb, cdc2 and chkp2. Indeed, a reduction of the cellular level of cyclin-dependent kinases CDK2 and CDK4 was observed in mertensene-treated cells. We also demonstrated that mertensene triggers a caspase-dependent apoptosis in HT29 cancer cells characterized by the activation of caspase-3 and the cleavage of poly (ADP-ribose polymerase (PARP. Besides, the level of death receptor-associated protein TRADD increased significantly in a concentration-dependent manner. Taken together, these results demonstrate the potential of mertensene as a drug candidate for the treatment of colon cancer.

  19. Nintedanib plus docetaxel as second-line therapy in patients with non-small-cell lung cancer of adenocarcinoma histology: a network meta-analysis vs new therapeutic options.

    Science.gov (United States)

    Popat, Sanjay; Mellemgaard, Anders; Reck, Martin; Hastedt, Claudia; Griebsch, Ingolf

    2017-06-01

    We provide an update to a network meta-analysis evaluating the relative efficacy of nintedanib + docetaxel versus other second-line agents in adenocarcinoma histology non-small-cell lung cancer. Overall similarity of nintedanib + docetaxel versus ramucirumab + docetaxel, and versus nivolumab. Comparing nintedanib + docetaxel with nivolumab, hazards ratio (HR) of overall survival and progression-free survival (PFS) pointed in opposite directions (overall survival: HR: 1.20 [95% credible interval: 0.92-1.58]; PFS: HR: 0.91 [0.68-1.21]). Exploratory subgroup analysis indicated superiority of nivolumab in high PD-L1 expression level subgroups; results were more favorable for nintedanib in all subgroups with low (nintedanib + docetaxel compared with the new therapeutic options ramucirumab + docetaxel and nivolumab, with potential differences in subgroups according to PD-L1 expression level.

  20. Up regulation of K A I 1 gene expression and apoptosis effect of imatinib mesylate in gastric adenocarcinoma (AGS cell line

    Directory of Open Access Journals (Sweden)

    eyed Ataollah Sadat Shandiz

    2016-02-01

    Full Text Available Objective: To evaluate the effect of imatinib mesylate on KAI1 gene expression and apoptosis properties in human gastric carcinoma AGS cell line. Methods: Cell viability was assessed by MTT assay and quantitative real time PCR method was applied for investigation of Bax, Bcl-2, and KAI1 gene expression in AGS cells. The quantity of KAI1, Bax, and Bcl-2 compared to GAPDH gene expressions were examined using the formula 2-∆∆Ct. Furthermore, cell apoptosis/necrosis was carried out by annexin V/PI staining and quantified with flow cytometry after treatment with imatinib. Results: Imatinib mesylate was showed to have a dose-dependent toxicity effect against AGS cells. KAI1/GAPDH gene expression ratios were 1.07 ± 0.02 (P > 0.05, 1.68 ± 0.19 (P > 0.05, 3.60 ± 0.55 (P < 0.05, 6.54 ± 0.27 (P < 0.001 for 20, 50, 80 and 100 μmol/L of imatinib concentrations. The mRNA levels of Bax detected by real-time PCR after treatment with imatinib mesylate were significantly increased. Also, the number of apoptotic cells was increased from 3.72% (statistically significant; P < 0.05 in untreated AGS cells to 21.72%, 83.04% and 85.80%, respectively, following treatment with 20, 40, and 60 μmol/L imatinib mesylate. Conclusions: The results suggest that imatinib mesylate can induce apoptosis pathway in a dose-dependent mode and might modulate metastasis by up regulating KAI1 gene expression in human gastric carcinoma AGS cell line.

  1. Chylous ascites due to signet ring cell gastric adenocarcinoma | de ...

    African Journals Online (AJOL)

    “Chylous ascites is a rare presentation of peritoneal effusion. The signet ring cell gastric adenocarcinoma is also relatively rare presentation of gastric cancer. We present a quite rare case of chylous ascites associated with signet ring cell gastric adenocarcinoma. Case report: a 47-years-old Caucasian man presented to our ...

  2. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter.

    Science.gov (United States)

    Barbaro, Daniele; Di Bari, Lorenzo; Gandin, Valentina; Evangelisti, Claudio; Vitulli, Giovanni; Schiavi, Eleonora; Marzano, Cristina; Ferretti, Anna M; Salvadori, Piero

    2015-01-01

    Iron oxide nanoparticles (IONP) can have a variety of biomedical applications due to their visualization properties through Magnetic Resonance Imaging (MRI) and heating with radio frequency or alternating magnetic fields. In the oncological field, coating IONP with organic compounds to provide specific features and to achieve the ability of binding specific molecular targets appears to be very promising. To take advantage of the high avidity of tumor cells for glucose, we report the development of very small glucose-coated IONP (glc-IONP) by employing an innovative technique, Metal Vapor Synthesis (MVS). Moreover, we tested the internalization of our gl-IONP on a tumor line, BxPC3, over-expressing GLUT 1 transporter. Both glc-IONP and polyvinylpyrrolidone-IONP (PVP-IONP), as control, were prepared with MVS and were tested on BxPC3 at various concentrations. To evaluate the role of GLUT-1 transporter, we also investigated the effect of adding a polyclonal anti-GLUT1 antibody. After proper treatment, the iron value was assessed by atomic absorption spectrometer, reported in mcg/L and expressed in mg of protein. Our IONP prepared with MVS were very small and homogeneously distributed in a narrow range (1.75-3.75 nm) with an average size of 2.7 nm and were super-paramagnetic. Glc-IONP were internalized by BxPC3 cells in a larger amount than PVP-IONP. After 6h of treatment with 50 mcg/mL of IONPs, the content of Fe was 1.5 times higher in glc-IONP-treated cells compared with PVP-IONP-treated cells. After 1h pre-treatment with anti-GLUT1, a reduction of 41% cellular accumulation of glc-IONP was observed. Conversely, the uptake of PVP-IONPs was reduced only by 14% with antibody pretreatment. In conclusion, MVS allowed us to prepare small, homogeneous, super-paramagnetic glc-IONP, which are electively internalized by a tumor line over-expressing GLUT1. Our glc-IONP appear to have many requisites for in vivo use.

  3. Glucose-coated superparamagnetic iron oxide nanoparticles prepared by metal vapour synthesis are electively internalized in a pancreatic adenocarcinoma cell line expressing GLUT1 transporter.

    Directory of Open Access Journals (Sweden)

    Daniele Barbaro

    Full Text Available Iron oxide nanoparticles (IONP can have a variety of biomedical applications due to their visualization properties through Magnetic Resonance Imaging (MRI and heating with radio frequency or alternating magnetic fields. In the oncological field, coating IONP with organic compounds to provide specific features and to achieve the ability of binding specific molecular targets appears to be very promising. To take advantage of the high avidity of tumor cells for glucose, we report the development of very small glucose-coated IONP (glc-IONP by employing an innovative technique, Metal Vapor Synthesis (MVS. Moreover, we tested the internalization of our gl-IONP on a tumor line, BxPC3, over-expressing GLUT 1 transporter. Both glc-IONP and polyvinylpyrrolidone-IONP (PVP-IONP, as control, were prepared with MVS and were tested on BxPC3 at various concentrations. To evaluate the role of GLUT-1 transporter, we also investigated the effect of adding a polyclonal anti-GLUT1 antibody. After proper treatment, the iron value was assessed by atomic absorption spectrometer, reported in mcg/L and expressed in mg of protein. Our IONP prepared with MVS were very small and homogeneously distributed in a narrow range (1.75-3.75 nm with an average size of 2.7 nm and were super-paramagnetic. Glc-IONP were internalized by BxPC3 cells in a larger amount than PVP-IONP. After 6h of treatment with 50 mcg/mL of IONPs, the content of Fe was 1.5 times higher in glc-IONP-treated cells compared with PVP-IONP-treated cells. After 1h pre-treatment with anti-GLUT1, a reduction of 41% cellular accumulation of glc-IONP was observed. Conversely, the uptake of PVP-IONPs was reduced only by 14% with antibody pretreatment. In conclusion, MVS allowed us to prepare small, homogeneous, super-paramagnetic glc-IONP, which are electively internalized by a tumor line over-expressing GLUT1. Our glc-IONP appear to have many requisites for in vivo use.

  4. Pharmacogenomics of the polyamine analog 3,8,13,18-tetraaza-10,11-[(E)-1,2-cyclopropyl]eicosane tetrahydrochloride, CGC-11093, in the colon adenocarcinoma cell line HCT1161.

    Science.gov (United States)

    Ignatenko, Natalia A; Yerushalmi, Hagit F; Watts, George S; Futscher, Bernard W; Stringer, David E; Marton, Laurence J; Gerner, Eugene W

    2006-12-01

    Polyamine analogs are known to inhibit tumorigenesis at least in part by mimicking some of the regulatory roles of natural polyamines. To begin the identification of those signaling pathways that are involved in differential cellular responses to the synthetic conformationally restricted polyamine analog CGC-11093, we conducted gene expression profiling, proteomic, and genome-wide DNA methylation and histone acetylation analyses of the HCT116 colon adenocarcinoma cell line after treatment with this analog. Gene expression analysis was performed using Affymetrix GeneChip human genome U133 Plus 2.0 arrays. Changes in protein expression were evaluated using 2D polyacrylamide gels followed by LCMS/MS. DNA methylation was measured using 6,800 element CpG island microarrays. Treatment of cells with CGC-11093 at concentrations ranging from 0.1 to 10 microM caused inhibition of cell growth and metabolic activity, but only minimally affected cell viability. Gene expression analysis showed concentration-dependent effects of CGC-11093 on the DNA/RNA binding transcription factor, cell cycle, signaling, transport, cytoskeletal/structural, and serine protease genes. Functional gene analysis revealed distinct expression patterns related to inhibition of cell cycle control, TGF beta signaling, proteasome and RNA polymerase pathways, upregulation of the aminoacyl-tRNA synthesis pathway, and perturbations in the MAPK and Wnt signaling pathways. Microarray results were validated for selected genes with real time RT PCR. Proteomics analysis showed correlative changes in the expression of proteins involved in the regulation of proteasome function (proteasome subunit Y) and tRNA synthesis. CGC-11093 treatment did not produce any detectable changes in DNA methylation or histone acetylation in cells. This study validates specific target pathways for a specific conformationally restricted polyamine analog and suggests the utility of combined gene and DNA methylation microarrays along with

  5. Clear Cell Adenocarcinoma of the Renal Pelvis in a Male Patient

    Directory of Open Access Journals (Sweden)

    Sarawut Kongkarnka

    2013-01-01

    Full Text Available Carcinoma of the renal pelvis is an uncommon renal neoplasm. Clear cell adenocarcinoma in the urinary tract is rare and has a histomorphology resembling that of the female genital tract. We herein present a case of clear cell adenocarcinoma of the renal pelvis, which is the first example in a male patient to our knowledge. A 54-year-old man presented with right flank pain. The tumor was associated with renal stones and hydronephrosis and invaded into the peripelvic fat tissue with regional lymph node metastasis. The patient died of metastatic disease six months postoperatively. Histologically, the tumor showed complex papillary architecture lined with clear and hobnail cells. Clear cell adenocarcinoma of the renal pelvis may pose a diagnostic challenge on histological grounds, particularly in the distinction from renal cell carcinoma. The immunohistochemical stains could help confirm the diagnosis. Due to its rarity, an effective treatment regimen remains to be determined.

  6. Clonality analysis of neuroendocrine cells in gastric adenocarcinoma

    Science.gov (United States)

    Wang, Ling-Ling; Yao, Gen-You; Zhao, Zhong-Sheng; Wei, Xiao-Li; Xu, Ru-Jun

    2013-01-01

    AIM: To achieve a better understanding of the origination of neuroendocrine (NE) cells in gastric adenocarcinoma. METHODS: In this study, 120 cases of gastric adenocarcinoma were obtained. First, frozen section-immunohistochemistrical samples were selected from a large quantity of neuroendocrine cells. Second, laser capture microdissection was used to get target cells from gastric adenocarcinoma and whole genome amplification was applied to get a large quantity of DNA for further study. Third, genome-wide microsatellite abnormalities [microsatellite instability (MSI), loss of heterozygosity (LOH)] and p53 mutation were detected by polymerase chain reaction (PCR)-single-strand conformation polymer- phism-silver staining and PCR-sequencing in order to identify the clonality of NE cells. RESULTS: The total incidence rate of MSI was 27.4%, while LOH was 17.9%. Ten cases had a highest concordance for the two types of cells. The other samples had similar microsatellite changes, except for cases 7 and 10. Concordant p53 mutations exhibited in sample 4, 14, 21 and 27, and there were different mutations between two kinds of cells in case 7. In case 17, mutation took place only in adenocarcinoma cells. p53 mutation was closely related with degree of differentiation, tumor-node-metastasis stage, vessel invasion and lymph node metastasis. In brief, NE and adenocarcinoma cells showed the same MSI, LOH or p53 mutation in most cases (27/30). In the other three cases, different MSI, LOH or p53 mutation occurred. CONCLUSION: NE and the gastric adenocarcinoma cells may mainly derive from the same stem cells, but the remaining cases showing different origin needs further investigation. PMID:23983439

  7. Tyrosine kinase inhibitor induced growth factor receptor upregulation enhances the efficacy of near-infrared targeted photodynamic therapy in esophageal adenocarcinoma cell lines

    NARCIS (Netherlands)

    Hartmans, Elmire; Linssen, Matthijs D.; Sikkens, Claire; Levens, Afra; Witjes, Max J. H.; van Dam, Gooitzen M.; Nagengast, Wouter B.

    2017-01-01

    Esophageal carcinoma (EC) is a global health problem, with disappointing 5-year survival rates of only 15-25%. Near-infrared targeted photodynamic therapy (NIR-tPDT) is a novel strategy in which cancer-targeted phototoxicity is able to selectively treat malignant cells. In this in vitro report we

  8. MiRNA-145 suppresses lung adenocarcinoma cell invasion and migration by targeting N-cadherin.

    Science.gov (United States)

    Mo, Dongping; Yang, Daheng; Xiao, Xuelian; Sun, Ruihong; Huang, Lei; Xu, Jian

    2017-05-01

    To investigate the roles of miR-145 in lung adenocarcinoma (LAC) and to clarify the regulation of N-cadherin by miR-145. In 57 paired clinical LAC tissues, diminished miR-145 was significantly correlated with the lymph node metastasis and was negatively correlated with N-cadherin mRNA level expression. Wound healing and transwell assays revealed a reduced capability of tumor metastasis induced by miR-145 in LAC. miR-145 negatively regulated the invasion of cell lines through targeting N-cadherin by directly binding to its 3'-untranslated region. Silencing of N-cadherin inhibited invasion and migration of LAC cell lines similar to miR-145 overexpression. MiR-145 could inhibit invasion and migration of lung adenocarcinoma cell lines by directly targeting N-cadherin.

  9. NR4A2 is regulated by gastrin and influences cellular responses of gastric adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Kristine Misund

    Full Text Available The peptide hormone gastrin is known to play a role in differentiation, growth and apoptosis of cells in the gastric mucosa. In this study we demonstrate that gastrin induces Nuclear Receptor 4A2 (NR4A2 expression in the adenocarcinoma cell lines AR42J and AGS-GR, which both possess the gastrin/CCK2 receptor. In vivo, NR4A2 is strongly expressed in the gastrin responsive neuroendocrine ECL cells in normal mucosa, whereas gastric adenocarcinoma tissue reveals a more diffuse and variable expression in tumor cells. We show that NR4A2 is a primary early transient gastrin induced gene in adenocarcinoma cell lines, and that NR4A2 expression is negatively regulated by inducible cAMP early repressor (ICER and zinc finger protein 36, C3H1 type-like 1 (Zfp36l1, suggesting that these gastrin regulated proteins exert a negative feedback control of NR4A2 activated responses. FRAP analyses indicate that gastrin also modifies the nucleus-cytosol shuttling of NR4A2, with more NR4A2 localized to cytoplasm upon gastrin treatment. Knock-down experiments with siRNA targeting NR4A2 increase migration of gastrin treated adenocarcinoma AGS-GR cells, while ectopically expressed NR4A2 increases apoptosis and hampers gastrin induced invasion, indicating a tumor suppressor function of NR4A2. Collectively, our results uncover a role of NR4A2 in gastric adenocarcinoma cells, and suggest that both the level and the localization of NR4A2 protein are of importance regarding the cellular responses of these cells.

  10. NR4A2 is regulated by gastrin and influences cellular responses of gastric adenocarcinoma cells.

    Science.gov (United States)

    Misund, Kristine; Selvik, Linn-Karina Myrland; Rao, Shalini; Nørsett, Kristin; Bakke, Ingunn; Sandvik, Arne K; Lægreid, Astrid; Bruland, Torunn; Prestvik, Wenche S; Thommesen, Liv

    2013-01-01

    The peptide hormone gastrin is known to play a role in differentiation, growth and apoptosis of cells in the gastric mucosa. In this study we demonstrate that gastrin induces Nuclear Receptor 4A2 (NR4A2) expression in the adenocarcinoma cell lines AR42J and AGS-GR, which both possess the gastrin/CCK2 receptor. In vivo, NR4A2 is strongly expressed in the gastrin responsive neuroendocrine ECL cells in normal mucosa, whereas gastric adenocarcinoma tissue reveals a more diffuse and variable expression in tumor cells. We show that NR4A2 is a primary early transient gastrin induced gene in adenocarcinoma cell lines, and that NR4A2 expression is negatively regulated by inducible cAMP early repressor (ICER) and zinc finger protein 36, C3H1 type-like 1 (Zfp36l1), suggesting that these gastrin regulated proteins exert a negative feedback control of NR4A2 activated responses. FRAP analyses indicate that gastrin also modifies the nucleus-cytosol shuttling of NR4A2, with more NR4A2 localized to cytoplasm upon gastrin treatment. Knock-down experiments with siRNA targeting NR4A2 increase migration of gastrin treated adenocarcinoma AGS-GR cells, while ectopically expressed NR4A2 increases apoptosis and hampers gastrin induced invasion, indicating a tumor suppressor function of NR4A2. Collectively, our results uncover a role of NR4A2 in gastric adenocarcinoma cells, and suggest that both the level and the localization of NR4A2 protein are of importance regarding the cellular responses of these cells.

  11. Aryl hydrocarbon receptor protects lung adenocarcinoma cells against cigarette sidestream smoke particulates-induced oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Ya-Hsin [Graduate Institute of Basic Medical Science, School of Medicine, China Medical University, Taichung 40402, Taiwan, ROC (China); Huang, Su-Chin; Lin, Chun-Ju; Cheng, Li-Chuan [Division of Environmental Health and Occupational Medicine, National Health Research Institutes, Zhunan, Miaoli 35053, Taiwan, ROC (China); Li, Lih-Ann, E-mail: lihann@nhri.org.tw [Division of Environmental Health and Occupational Medicine, National Health Research Institutes, Zhunan, Miaoli 35053, Taiwan, ROC (China)

    2012-03-15

    Environmental cigarette smoke has been suggested to promote lung adenocarcinoma progression through aryl hydrocarbon receptor (AhR)-signaled metabolism. However, whether AhR facilitates metabolic activation or detoxification in exposed adenocarcinoma cells remains ambiguous. To address this question, we have modified the expression level of AhR in two human lung adenocarcinoma cell lines and examined their response to an extract of cigarette sidestream smoke particulates (CSSP). We found that overexpression of AhR in the CL1-5 cell line reduced CSSP-induced ROS production and oxidative DNA damage, whereas knockdown of AhR expression increased ROS level in CSSP-exposed H1355 cells. Oxidative stress sensor Nrf2 and its target gene NQO1 were insensitive to AhR expression level and CSSP treatment in human lung adenocarcinoma cells. In contrast, induction of AhR expression concurrently increased mRNA expression of xenobiotic-metabolizing genes CYP1B1, UGT1A8, and UGT1A10 in a ligand-independent manner. It appeared that AhR accelerated xenobiotic clearing and diminished associated oxidative stress by coordinate regulation of a set of phase I and II metabolizing genes. However, the AhR-signaled protection could not shield cells from constant oxidative stress. Prolonged exposure to high concentrations of CSSP induced G0/G1 cell cycle arrest via the p53–p21–Rb1 signaling pathway. Despite no effect on DNA repair rate, AhR facilitated the recovery of cells from growth arrest when CSSP exposure ended. AhR-overexpressing lung adenocarcinoma cells exhibited an increased anchorage-dependent and independent proliferation when recovery from exposure. In summary, our data demonstrated that AhR protected lung adenocarcinoma cells against CSSP-induced oxidative stress and promoted post-exposure clonogenicity. -- Highlights: ► AhR expression level influences cigarette sidestream smoke-induced ROS production. ► AhR reduces oxidative stress by coordinate regulation of

  12. MiR-373-3p Promotes Invasion and Metastasis of Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Aibing WU

    2015-07-01

    Full Text Available Background and objective Lung cancer is the leading cause of cancer-related deaths worldwide, and metastasis is the major cause of death in lung cancer patients. MiR-373 is closely associated with invasion and metastasis in other tumor cells. This study explored the expression of miR-373-3p in non-small cell lung cancer (NSCLC and its effect on the invasive and metastatic capabilities of lung adenocarcinoma cells, as well as their mechanisms of action. Methods The expression of miR-373-3p in NSCLC tissues and lung adenocarcinoma cell lines was detected by quantitative reverse transcription polymerase chain reaction. The roles of miR-373-3p in regulating lung adenocarcinoma cell invasion and metastatic properties were analyzed with miR-373-3p mimic/inhibitor-transfected cells via Transwell chamber assay. Matrix metalloproteinase MMP-9 and MMP-14 protein levels were detected by Western blot in lung cancer cells after transfection. Results MiR-373-3p was upregulated in 51 NSCLC tissues and 5 NSCLC cell lines. Gain-of-function and loss-of-function studies showed that overexpression of miR-373-3p promoted H1299 cell migration and invasion, which resulted in upregulation of MMP-9 and MMP-14. By contrast, miR-373-3p knockdown inhibited these processes in A549 cells and downregulated the expression of MMP-9 and MMP-14. Conclusion Our results demonstrated that miR-373-3p participated in the invasion and metastasis of lung adenocarcinoma cells, partly by upregulation of MMP-9 and MMP-14.

  13. Plant extracts as natural photosensitizers in photodynamic therapy: in vitro activity against human mammary adenocarcinoma MCF-7 cells

    Directory of Open Access Journals (Sweden)

    Rigo Baluyot Villacorta

    2017-04-01

    Conclusions: Two of the plant extracts used, L. racemosa and A. procera were toxic and induced apoptosis to mammary cell adenocarcinoma, MCF-7 when photoactivated. These extracts were also more toxic to human cancer than non-cancer cell lines.

  14. Different molecular organization of two carotenoids, lutein and zeaxanthin, in human colon epithelial cells and colon adenocarcinoma cells

    Science.gov (United States)

    Grudzinski, Wojciech; Piet, Mateusz; Luchowski, Rafal; Reszczynska, Emilia; Welc, Renata; Paduch, Roman; Gruszecki, Wieslaw I.

    2018-01-01

    Two cell lines, human normal colon epithelial cells (CCD 841 CoTr) and human colon adenocarcinoma cells (HT-29) were cultured in the presence of exogenous carotenoids, either zeaxanthin or lutein. Both carotenoids demonstrated cytotoxicity with respect to cancer cells but not to normal cells. Cells from both the cell lines were analyzed with application of fluorescence lifetime imaging microscopy and Raman scattering microscopy. Both imaging techniques show effective incorporation of carotenoid molecules into growing cells. Comparison of the Raman scattering and fluorescence lifetime characteristics reveals different molecular organization of carotenoids in the carcinoma and normal cells. The main difference consists in a carotenoid aggregation level which is substantially lower in the carcinoma cells as compared to the normal cells. Different molecular organization of carotenoids was interpreted in terms of a different metabolism of normal and carcinoma cells and has been concluded to provide a possibility of cancer diagnosis based on spectroscopic analyses.

  15. Comparison of erlotinib and pemetrexed as second-/third-line treatment for lung adenocarcinoma patients with asymptomatic brain metastases

    Directory of Open Access Journals (Sweden)

    He YY

    2016-04-01

    Full Text Available Yayi He,1,* Wenwen Sun,2,* Yan Wang,3,* Shengxiang Ren,1 Xuefei Li,3 Jiayu Li,3 Christopher J Rivard,4 Caicun Zhou,1 Fred R Hirsch4 1Department of Oncology, Shanghai Pulmonary Hospital, 2Clinic and Research Center of Tuberculosis, Shanghai Key Laboratory of Tuberculosis, Shanghai Pulmonary Hospital, 3Department of Lung Cancer and Immunology, Shanghai Pulmonary Hospital, Tongji University Medical School Cancer Institute, Tongji University School of Medicine, Shanghai, People’s Republic of China; 4Division of Medical Oncology, Department of Medicine, University of Colorado, Aurora, CO, USA *These authors contributed equally to this work Objective: Brain metastases occur in one-third of all non-small-cell lung cancer patients. Due to restrictive transport at the blood–brain barrier, many drugs provide poor control of metastases in the brain. The aim of this study was to compare erlotinib with pemetrexed as second-/third-line treatment in patients with lung adenocarcinoma with asymptomatic brain metastases.Methods: From January 2012 to June 2014, all lung adenocarcinoma patients with asymptomatic brain metastases who received treatment with erlotinib or pemetrexed as second-/third-line treatment were retrospectively reviewed. Chi-square and log-rank tests were used to perform statistical analysis.Results: The study enrolled 99 patients, of which 44 were positive for EGFR mutation. Median progression-free survival (PFS in months was not significantly different between the erlotinib- and pemetrexed-treated groups (4.2 vs 3.4 months; 95% confidence interval [CI]: 2.01–6.40 vs 2.80–5.00, respectively; P=0.635. Median PFS was found to be significantly longer in EGFR mutation–positive patients in the erlotinib-treated group (8.0 months; 95% CI 5.85–10.15 compared to the pemetrexed group (3.9 months; 95% CI: 1.25–6.55; P=0.032. The most common treatment-related side effect was mild-to-moderate rash and the most common drug-related side

  16. Gastrin activates autophagy and increases migration and survival of gastric adenocarcinoma cells.

    Science.gov (United States)

    Rao, Shalini V; Solum, Guri; Niederdorfer, Barbara; Nørsett, Kristin G; Bjørkøy, Geir; Thommesen, Liv

    2017-01-21

    The peptide hormone gastrin exerts a growth-promoting effect in both normal and malignant gastrointestinal tissue. Gastrin mediates its effect via the cholecystokinin 2 receptor (CCKBR/CCK2R). Although a substantial part of the gastric adenocarcinomas express gastrin and CCKBR, the role of gastrin in tumor development is not completely understood. Autophagy has been implicated in mechanisms governing cytoprotection, tumor growth, and contributes to chemoresistance. This study explores the role of autophagy in response to gastrin in gastric adenocarcinoma cell lines. Immunoblotting, survival assays and the xCELLigence system were used to study gastrin induced autophagy. Chemical inhibitors of autophagy were utilized to assess the role of this process in the regulation of cellular responses induced by gastrin. Further, knockdown studies using siRNA and immunoblotting were performed to explore the signaling pathways that activate autophagy in response to gastrin treatment. We demonstrate that gastrin increases the expression of the autophagy markers MAP1LC3B-II and SQSTM1 in gastric adenocarcinoma cells. Gastrin induces autophagy via activation of the STK11-PRKAA2-ULK1 and that this signaling pathway is involved in increased migration and cell survival. Furthermore, gastrin mediated increase in survival of cells treated with cisplatin is partially dependent on induced autophagy. This study reveals a novel role of gastrin in the regulation of autophagy. It also opens up new avenues in the treatment of gastric cancer by targeting CCKBR mediated signaling and/or autophagy in combination with conventional cytostatic drugs.

  17. [Establishment of the cell line that human lung adenocarcinoma can stably express luciferase which is absent of nm23-H1 expression and detecting its luminescence
in vitro and in vivo].

    Science.gov (United States)

    Wang, Hongming; Zhu, Daxing; Wu, Zhihao; Zhou, Qinghua

    2012-03-01

    On the condition that laboratory animals survive, we can detect the distribution of tumor cells by in vivo imaging that were labeled with firefly- luciferase (luc) gene. The purpose of this study is to establish a light-emitting cell line A549/nm23-H1-shRNA-luc which could express nm23-H1 shRNA and firefly-luciferase stably, and detect its bioluminescence in vitro and in vivo. It will provide the preparation for the next related experimental research in vivo. The optimal concentration of hygromycin B for screening A549/nm23-H1-shRNA cells was determined by concentration gradient method. We firstly transfected the plasmid (PGL4.50) with luc gene into A549/nm23-H1-shRNA cells and then screened the monoclonal cell line A549/nm23-H1-shRNA-luc with hyhromycin B. The positive monoclonal cell line was identified with an in vivo imaging system, thereafter the expression stability of luciferase was analyzed in the strongest light-emitting positive monoclonal cell line. The A549/nm23-H1-shRNA-luc cells were inoculated subcutaneously into right-hind groin of nude mice and then observed by the in vivo imaging system. The optimal concentration of hygromycin B used in screening A549/nm23-H1-shRNA cells was 300 μg/mL. After screening, the A549/nm23-H1-shRNA-luc cells established can express luciferase stably in vitro, a great linear correlation existed between the amount of cells (x) and bioluminescence values (y), with an equation of y=3,699.9x+992,237, and the square of the correlation coefficient (R2) was 0.975,1. To evaluate the stability of bioluminescence in vivo, 10 nude mice were randomly divided into two groups that the same number of cells were implanted into. The variation of bioluminescence values detected in vivo between the two groups of the same cells was not statistically significant (P>0.05). We have successfully established the cell line A549/nm23-H1-shRNA-luc which can express luciferase persistently and stably.

  18. A case with primary signet ring cell adenocarcinoma of the prostate and review of the literature

    Directory of Open Access Journals (Sweden)

    Orcun Celik

    2014-06-01

    Full Text Available Primary signet cell carcinoma of the prostate is a rare histological variant of prostate malignancies. It is commonly originated from the stomach, colon, pancreas, and less commonly in the bladder. Prognosis of the classical type is worse than the adenocarcinoma of the prostate. Primary signet cell adenocarcinoma is diagnosed by eliminating the adenocarcinomas of other organs such as gastrointestinal tract organs. In this case report, we present a case with primary signet cell adenocarcinoma of the prostate who received docetaxel chemotherapy because of short prostate specific antigen doubling time.

  19. A Study of Appendiceal Crypt Cell Adenocarcinoma (So-Called Goblet Cell Carcinoid and Its Related Adenocarcinoma).

    Science.gov (United States)

    Nonaka, Daisuke; Papaxoinis, George; Lamarca, Angela; Fulford, Paul; Valle, Juan; Chakrabarty, Bipasha

    2017-08-17

    Goblet cell carcinoids (GCCs) of the appendix are rare tumors, characterized by a carcinoid-like organoid growth pattern. Despite the term carcinoid, neuroendocrine features are inconspicuous, and its behavior is distinct from carcinoid. Its high grade counterpart is designated as adenocarcinoma ex GCC. We conducted a retrospective study of 105 tumors to find prognostic values of a variety of clinico-pathologic features. The tumors were subclassified as low grade, equivalent to classic type, and high grade, defined as loss of organoid pattern, and a proportion (%) of low and high grades were documented in each tumor. Correlations between survival and various clinico-pathologic parameters were investigated. One-third were pure low grade while the remainder contained variable high grade component ranging 5-95%. Neuroendocrine cell component ranged 0-90% (median 5) while mucus cell component ranged 5-100% (median 70). By univariate analysis, size, stage, high grade component, nuclear grade, surgery and chemotherapy correlated with cancer-related survival (CSS), and by multivariate analysis, stage (P=.001), high grade component (P=.008) and tumor size (P=.005) correlated with CSS. There was significant difference in CSS when the cases were grouped in high grade component <40%, 40-90 and ≤90% (P<.001). Our results indicate that staging and proportion of high grade histology may provide important prognostic information. Neuroendocrine component was insignificant in both low and high grade areas. In light of our findings, this tumor type is best regarded as a variant of adenocarcinoma, and the term crypt cell adenocarcinoma more appropriately reflects the nature and origin of this tumor group. Copyright © 2017. Published by Elsevier Inc.

  20. Immunohistochemical expression of MYB in salivary gland basal cell adenocarcinoma and basal cell adenoma.

    Science.gov (United States)

    Rooney, Sydney L; Robinson, Robert A

    2017-10-01

    Basal cell predominant salivary gland neoplasms can be difficult to separate histologically. One of the most aggressive of basaloid salivary gland neoplasms is adenoid cystic carcinoma. MYB expression by immunohistochemistry has been documented in adenoid cystic carcinoma. Some investigators have suggested that using this expression can help in establishing the diagnosis of adenoid cystic carcinoma. Utilizing tissue microarrays, we studied a group of basal cell adenocarcinomas and basal cell adenomas to determine: (i) whether either tumor expressed MYB and (ii) the frequency of any expression in either tumors. Seventeen salivary gland basal cell adenocarcinomas and 30 salivary gland basal cell adenomas were used to construct microarrays. These tissue microarrays were used to assess for immunohistochemical MYB expression. Fifty-three percent (nine of 17) of salivary gland basal cell adenocarcinomas and 57% (17 of 30) of salivary gland basal cell adenomas showed MYB overexpression. For comparison, we studied 11 adenoid cystic carcinomas for MYB expression and found that 64% (seven of 11) overexpressed MYB. We found no relation to clinical course for basal adenomas or basal cell adenocarcinomas that overexpressed MYB vs those that did not. MYB expression does not help separate basal cell adenocarcinomas from basal cell adenomas, and our data suggest it does not differentiate between either of these neoplasms and adenoid cystic carcinoma. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. An iPSC Line from Human Pancreatic Ductal Adenocarcinoma Undergoes Early to Invasive Stages of Pancreatic Cancer Progression

    Directory of Open Access Journals (Sweden)

    Jungsun Kim

    2013-06-01

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC carries a dismal prognosis and lacks a human cell model of early disease progression. When human PDAC cells are injected into immunodeficient mice, they generate advanced-stage cancer. We hypothesized that if human PDAC cells were converted to pluripotency and then allowed to differentiate back into pancreatic tissue, they might undergo early stages of cancer. Although most induced pluripotent stem cell (iPSC lines were not of the expected cancer genotype, one PDAC line, 10–22 cells, when injected into immunodeficient mice, generated pancreatic intraepithelial neoplasia (PanIN precursors to PDAC that progressed to the invasive stage. The PanIN-like cells secrete or release proteins from many genes that are known to be expressed in human pancreatic cancer progression and that predicted an HNF4α network in intermediate-stage lesions. Thus, rare events allow iPSC technology to provide a live human cell model of early pancreatic cancer and insights into disease progression.

  2. Low-Dose Cadmium Upregulates VEGF Expression in Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Fuhong Liu

    2015-08-01

    Full Text Available Cadmium (Cd is a heavy metal and environmental toxin. Exposure to Cd has been associated with a variety of human cancers. In this study, we performed in vitro assays to examine the effects of cadmium chloride (CdCl2 on A549 cells, a human lung adenocarcinoma cell line. Cd does not affect proliferation, migration, or apoptosis of A549 cells at concentrations of 0.1–10 μM. At 0.5 and 1 μM, Cd increases the expression of vascular endothelial growth factor (VEGF (p < 0.05, p < 0.01, respectively, but not basic fibroblast growth factor (b-FGF in A549 cells. The conditioned media were collected from the A549 cells treated with 1 μM Cd and were co-cultured with human umbilical vein endothelial cells (HUVECs. Upon treatment with the conditioned media, the proliferation and migration of HUVECs significantly increased (p < 0.01, p < 0.05, respectively, while apoptosis remained unchanged. In addition, 1 μM Cd increases the level of hypoxia inducible factor 1-α (HIF1-α, which is a positive regulator of VEGF expression. Although low-dose Cd does not directly affect the growth of lung adenocarcinoma cells, it might facilitate the development of tumors through its pro-angiogenic effects.

  3. Clear Cell Adenocarcinoma of the Urethra: Review of the Literature

    Directory of Open Access Journals (Sweden)

    Anthony Kodzo-Grey Venyo

    2015-01-01

    Full Text Available Background. Clear cell adenocarcinoma of the urethra (CCAU is extremely rare and a number of clinicians may be unfamiliar with its diagnosis and biological behaviour. Aims. To review the literature on CCAU. Methods. Various internet databases were used. Results/Literature Review. (i CCAU occurs in adults and in women in the great majority of cases. (ii It has a particular association with urethral diverticulum, which has been present in 56% of the patients; is indistinguishable from clear cell adenocarcinoma of the female genital tract but is not associated with endometriosis; and probably does not arise by malignant transformation of nephrogenic adenoma. (iii It is usually, readily distinguished from nephrogenic adenoma because of greater cytological a-typicality and mitotic activity and does not stain for prostate-specific antigen or prostatic acid phosphatase. (iv It has been treated by anterior exenteration in women and cystoprostatectomy in men and at times by radiotherapy; chemotherapy has rarely been given. (v CCAU is aggressive with low 5-year survival rates. (vi There is no consensus opinion of treatment options that would improve the prognosis. Conclusions. Few cases of CCAU have been reported. Urologists, gynaecologists, pathologists, and oncologists should report cases of CCAU they encounter and enter them into a multicentric trial to determine the best treatment options that would improve the prognosis.

  4. Telomere maintenance in laser capture microdissection-purified Barrett's adenocarcinoma cells and effect of telomerase inhibition in vivo

    Science.gov (United States)

    Shammas, Masood A; Qazi, Aamer; Batchu, Ramesh B; Bertheau, Robert C; Wong, Jason YY; Rao, Manjula Y; Prasad, Madhu; Chanda, Diptiman; Ponnazhagan, Selvarangan; Anderson, Kenneth C; Steffes, Christopher P; Munshi, Nikhil C; De Vivo, Immaculata; Beer, David G.; Gryaznov, Sergei; Weaver, Donald W; Goyal, Raj K

    2009-01-01

    Purpose: The aims of this study were to investigate telomere function in normal and Barrett's esophageal adenocarcinoma (BEAC) cells purified by laser capture microdissection (LCM) and to evaluate the impact of telomerase inhibition in cancer cells in vitro and in vivo. Experimental Design: Epithelial cells were purified from surgically resected esophagi. Telomerase activity was measured by modified “Telomeric Repeat Amplification Protocol” and telomere length determined by Real-Time PCR assay. To evaluate the impact of telomerase inhibition, adenocarcinoma cell lines were continuously treated with a specific telomerase inhibitor (GRN163L) and live cell number determined weekly. Apoptosis was evaluated by annexin labeling and senescence by beta-galactosidase staining. For in vivo studies, SCID-mice were subcutaneously inoculated with adenocarcinoma cells and following appearance of palpable tumors, injected intraperitoneally with saline or GRN163L. Results: Telomerase activity was significantly elevated whereas telomeres were shorter in BEAC cells relative to normal esophageal epithelial cells. The treatment of adenocarcinoma cells with telomerase inhibitor, GRN163L, led to loss of telomerase activity, reduction in telomere length, and growth arrest through induction of both the senescence and apoptosis. GRN163L induced cell death could also be expedited by addition of chemotherapeutic agents, doxorubicin and ritonavir. Finally, the treatment with GRN163L led to a significant reduction in tumor volume in a subcutaneous tumor model. Conclusions: We show that telomerase activity is significantly elevated whereas telomeres are shorter in BEAC and suppression of telomerase inhibits proliferation of adenocarcinoma cells both in vitro and in vivo. PMID:18676772

  5. ALDH1-high ovarian cancer stem-like cells can be isolated from serous and clear cell adenocarcinoma cells, and ALDH1 high expression is associated with poor prognosis.

    Directory of Open Access Journals (Sweden)

    Takafumi Kuroda

    Full Text Available Cancer stem-like cells (CSCs/cancer-initiating cells (CICs are defined as a small population of cancer cells that have high tumorigenicity. Furthermore, CSCs/CICs are resistant to several cancer therapies, and CSCs/CICs are therefore thought to be responsible for cancer recurrence after treatment and distant metastasis. In epithelial ovarian cancer (EOC cases, disease recurrence after chemotherapy is frequently observed, suggesting ovarian CSCs/CICs are involved. There are four major histological subtypes in EOC, and serous adenocarcinoma and clear cell adenocarcinoma are high-grade malignancies. We therefore analyzed ovarian CSCs/CICs from ovarian carcinoma cell lines (serous adenocarcinoma and clear cell adenocarcinoma and primary ovarian cancer cells in this study. We isolated ovarian CSCs/CICs as an aldehyde dehydrogenase 1 high (ALDH1(high population from 6 EOC cell lines (3 serous adenocarcinomas and 3 clear cell adenocarcinomas by the ALDEFLUOR assay. ALDH1(high cells showed greater sphere-forming ability, higher tumorigenicity and greater invasive capability, indicating that ovarian CSCs/CICs are enriched in ALDH1(high cells. ALDH1(high cells could also be isolated from 8 of 11 primary ovarian carcinoma samples. Immunohistochemical staining revealed that higher ALDH1 expression levels in ovary cancer cases are related to poorer prognosis in both serous adenocarcinoma cases and clear cell adenocarcinoma cases. Taken together, the results indicate that ALDH1 is a marker for ovarian CSCs/CICs and that the expression level of ALDH1 might be a novel biomarker for prediction of poor prognosis.

  6. Cytoplasmic Overexpression of CD95L in Esophageal Adenocarcinoma Cells Overcomes Resistance to CD95-Mediated Apoptosis

    Directory of Open Access Journals (Sweden)

    Gregory A. Watson

    2011-03-01

    Full Text Available Introduction: The CD95/CD95L pathway plays a critical role in tissue homeostasis and immune system regulation; however, the function of this pathway in malignancy remains poorly understood. We hypothesized that CD95L expression in esophageal adenocarcinoma confers advantages to the neoplasm other than immune privilege. Methods: CD95L expression was characterized in immortalized squamous esophagus (HET-1A and Barrett esophagus (BAR-T cells; adenocarcinoma cell lines FLO-1, SEG-1, and BIC-1, and MDA468 (- control; and KFL cells (+ control. Analyses included reverse transcription-polymerase chain reaction, immunoblots of whole cell and secretory vesicle lysates, FACScan analysis, laser scanning confocal microscopy of native proteins and fluorescent constructs, and assessment of apoptosis and ERK1/2 pathways. Results: Cleaved, soluble CD95L is expressed at both the RNA and protein levels in these cell lines derived from esophageal adenocarcinoma and other human tissues. CD95L was neither trafficked to the cell membrane nor secreted into the media or within vesicles, rather the protein seems to be sequestered in the cytoplasm. CD95 and CD95L colocalize by immunofluorescence, but an interaction was not proven by immunoprecipitation. Overexpression of CD95L in the adenocarcinoma cell lines induced robust apoptosis and, under conditions of pan-caspase inhibition, resulted in activation of ERK signaling. Conclusions: CD95L localization in EA cells is inconsistent with the conference of immune privilege and is more consistent with a function that promotes tumor growth through alternative CD95 signaling. Reduced cell surface expression of CD95 affects cell sensitivity to extracellular apoptotic signals more significantly than alterations in downstream modulators of apoptosis.

  7. Infrared light-absorbing gold/gold sulfide nanoparticles induce cell death in esophageal adenocarcinoma

    Science.gov (United States)

    Li, Yan; Gobin, Andre M; Dryden, Gerald W; Kang, Xinqin; Xiao, Deyi; Li, Su Ping; Zhang, Guandong; Martin, Robert CG

    2013-01-01

    Gold nanoparticles and near infrared-absorbing light are each innocuous to tissue but when combined can destroy malignant tissue while leaving healthy tissue unharmed. This study investigated the feasibility of photothermal ablation therapy for esophageal adenocarcinoma using chitosan-coated gold/gold sulfide (CS-GGS) nanoparticles. A rat esophagoduodenal anastomosis model was used for the in vivo ablation study, and three human esophageal cell lines were used to study the response of cancer cells and benign cells to near infrared light after treatment with CS-GGS. The results indicate that both cancerous tissue and cancer cells took up more gold nanoparticles and were completely ablated after exposure to near infrared light. The benign tissue and noncancerous cells showed less uptake of these nanoparticles, and remained viable after exposure to near infrared light. CS-GGS nanoparticles could provide an optimal endoluminal therapeutic option for near infrared light ablation of esophageal cancer. PMID:23818775

  8. Early human prostate adenocarcinomas harbor androgen-independent cancer cells.

    Directory of Open Access Journals (Sweden)

    Rita R Fiñones

    Full Text Available Although blockade of androgen receptor (AR signaling represents the main treatment for advanced prostate cancer (PrCa, many patients progress to a lethal phenotype of "Castration-Resistant" prostate cancer (CR-PrCa. With the hypothesis that early PrCa may harbor a population of androgen-unresponsive cancer cells as precursors to CR-recurrent disease, we undertook the propagation of androgen-independent cells from PrCa-prostatectomy samples of early, localized (Stage-I cases. A collection of 120 surgical specimens from prostatectomy cases was established, among which 54 were adenocarcinomas. Hormone-free cell culture conditions were developed allowing routine propagation of cells expressing prostate basal cell markers and stem/progenitor cell markers, and which proliferated as spheres/spheroids in suspension cultures. Colonies of androgen-independent epithelial cells grew out from 30/43 (70% of the adenocarcinoma cases studied in detail. Fluorescence microscopy and flow cytometry showed that CR-PrCa cells were positive for CD44, CD133, CK5/14, c-kit, integrin α2β1, SSEA4, E-Cadherin and Aldehyde Dehydrogenase (ALDH. All 30 CR-PrCa cell cultures were also TERT-positive, but negative for TMPRSS2-ERG. Additionally, a subset of 22 of these CR-PrCa cell cultures was examined by orthotopic xenografting in intact and castrated SCID mice, generating histologically typical locally-invasive human PrCa or undifferentiated cancers, respectively, in 6-8 weeks. Cultured PrCa cells and orthotopically-induced in vivo cancers lacked PSA expression. We report here the propagation of Cancer Initiating Cells (CIC directly from Stage I human PrCa tissue without selection or genetic manipulation. The propagation of stem/progenitor-like CR-PrCa cells derived from early human prostate carcinomas suggests the existence of a subpopulation of cells resistant to androgen-deprivation therapy and which may drive the subsequent emergence of disseminated CR-PrCa.

  9. Expression of RNA-binding motif 10 is associated with advanced tumor stage and malignant behaviors of lung adenocarcinoma cancer cells.

    Science.gov (United States)

    Guan, Guofang; Li, Ranwei; Tang, Wenfang; Liu, Tiecheng; Su, Zhenzhong; Wang, Yan; Tan, Jingjin; Jiang, Shan; Wang, Ke

    2017-03-01

    This study assessed RNA-binding motif 10 expression in lung adenocarcinoma tissues and examined the role and mechanism of RNA-binding motif 10 in the regulation of lung adenocarcinoma malignancy. Lung adenocarcinoma and corresponding adjacent non-tumor lung tissues from 41 patients were subjected to reverse transcription-polymerase chain reaction and Western blot assessment to detect RNA-binding motif 10 expression. Recombinant lentivirus carrying RNA-binding motif 10 complementary DNA was used to infect lung adenocarcinoma cell lines, A549 and H1299 cells. Complementary DNA microarray was used to profile RNA-binding motif 10-regulated genes. Levels of RNA-binding motif 10 messenger RNA and protein were significantly lower in lung adenocarcinoma tissues than those in paired non-tumor tissues (p lung adenocarcinoma cell lines and induced cell-cycle arrest at G0/G1 phase in A549 cells and at S phase in H1299 cells. Complementary DNA microarray analysis identified 304 upregulated and 386 downregulated genes induced by RNA-binding motif 10 overexpression, which may be involved in cancer, focal adhesion, peroxisome proliferator-activated receptor-regulated gene pathway, cytokine-cytokine receptor interaction, mitogen-activated protein kinase signaling, complement and coagulation cascades, platelet amyloid precursor protein pathway, extracellular matrix-receptor interaction, and small cell lung cancer-related genes. Expression of FGF2, EGFR, WNT5A, NF-κB, and RAP1A was downregulated, whereas expression of AKT2, BIRC3, and JUN was upregulated. RNA-binding motif 10 messenger RNA and protein were reduced in lung adenocarcinoma tissues, and RNA-binding motif 10 overexpression inhibited lung adenocarcinoma cancer cell malignant behavior in vitro. Molecularly, RNA-binding motif 10 regulates many gene pathways involving in the tumor development or progression.

  10. Salt-inducible kinase 1 (SIK1 is induced by gastrin and inhibits migration of gastric adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Linn-Karina M Selvik

    Full Text Available Salt-inducible kinase 1 (SIK1/Snf1lk belongs to the AMP-activated protein kinase (AMPK family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome in cancers, and that this involves an invasive cellular phenotype with increased metastatic potential. However, the molecular mechanism(s regulated by SIK1 in cancer cells is not well explored. The peptide hormone gastrin regulates cellular processes involved in oncogenesis, including proliferation, apoptosis, migration and invasion. The aim of this study was to examine the role of SIK1 in gastrin responsive adenocarcinoma cell lines AR42J, AGS-GR and MKN45. We show that gastrin, known to signal through the Gq/G11-coupled CCK2 receptor, induces SIK1 expression in adenocarcinoma cells, and that transcriptional activation of SIK1 is negatively regulated by the Inducible cAMP early repressor (ICER. We demonstrate that gastrin-mediated signalling induces phosphorylation of Liver Kinase 1B (LKB1 Ser-428 and SIK1 Thr-182. Ectopic expression of SIK1 increases gastrin-induced phosphorylation of histone deacetylase 4 (HDAC4 and enhances gastrin-induced transcription of c-fos and CRE-, SRE-, AP1- and NF-κB-driven luciferase reporter plasmids. We also show that gastrin induces phosphorylation and nuclear export of HDACs. Next we find that siRNA mediated knockdown of SIK1 increases migration of the gastric adenocarcinoma cell line AGS-GR. Evidence provided here demonstrates that SIK1 is regulated by gastrin and influences gastrin elicited signalling in gastric adenocarcinoma cells. The results from the present study are relevant for the understanding of molecular mechanisms involved in gastric adenocarcinomas.

  11. Salt-inducible kinase 1 (SIK1) is induced by gastrin and inhibits migration of gastric adenocarcinoma cells.

    Science.gov (United States)

    Selvik, Linn-Karina M; Rao, Shalini; Steigedal, Tonje S; Haltbakk, Ildri; Misund, Kristine; Bruland, Torunn; Prestvik, Wenche S; Lægreid, Astrid; Thommesen, Liv

    2014-01-01

    Salt-inducible kinase 1 (SIK1/Snf1lk) belongs to the AMP-activated protein kinase (AMPK) family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome in cancers, and that this involves an invasive cellular phenotype with increased metastatic potential. However, the molecular mechanism(s) regulated by SIK1 in cancer cells is not well explored. The peptide hormone gastrin regulates cellular processes involved in oncogenesis, including proliferation, apoptosis, migration and invasion. The aim of this study was to examine the role of SIK1 in gastrin responsive adenocarcinoma cell lines AR42J, AGS-GR and MKN45. We show that gastrin, known to signal through the Gq/G11-coupled CCK2 receptor, induces SIK1 expression in adenocarcinoma cells, and that transcriptional activation of SIK1 is negatively regulated by the Inducible cAMP early repressor (ICER). We demonstrate that gastrin-mediated signalling induces phosphorylation of Liver Kinase 1B (LKB1) Ser-428 and SIK1 Thr-182. Ectopic expression of SIK1 increases gastrin-induced phosphorylation of histone deacetylase 4 (HDAC4) and enhances gastrin-induced transcription of c-fos and CRE-, SRE-, AP1- and NF-κB-driven luciferase reporter plasmids. We also show that gastrin induces phosphorylation and nuclear export of HDACs. Next we find that siRNA mediated knockdown of SIK1 increases migration of the gastric adenocarcinoma cell line AGS-GR. Evidence provided here demonstrates that SIK1 is regulated by gastrin and influences gastrin elicited signalling in gastric adenocarcinoma cells. The results from the present study are relevant for the understanding of molecular mechanisms involved in gastric adenocarcinomas.

  12. Contributions of microRNA dysregulation to cisplatin resistance in adenocarcinoma cells.

    Science.gov (United States)

    Pouliot, Lynn M; Shen, Ding-Wu; Suzuki, Toshihiro; Hall, Matthew D; Gottesman, Michael M

    2013-02-15

    Cisplatin resistance in cancer cells is due to a pleiotropic phenotype transition that allows cells to resist cell death. miRNAs have been shown to be reliable markers of phenotype, critical in cell differentiation, and dysregulated in cancer and other pathologies. Here we investigate the influence of miRNA on cisplatin resistance in KB adenocarcinoma cells. Silencing both DICER and TRBP2 in the miRNA biosynthesis pathway in KB-3-1 (sensitive parental), KB-CP.5 (cisplatin-resistant), and KB-CP20 (highly cisplatin-resistant) cells resulted in the reversal of cisplatin resistance, with no effect on cell viability in the absence of cisplatin. We found miR-181 expression differences in the cell lines using RT-PCR, with several members of the miR-181 family overexpressed in two KB cisplatin-resistant lines and in two cisplatin-resistant lung cancer lines, compared to their respective parental cells. Functional assays showed minimal effects of miR-181 on cisplatin resistance. We conclude that the miRNA biosynthesis pathway is critical for maintaining the cisplatin-resistant phenotype, but that it is difficult to determine the precise miRNAs involved in cisplatin resistance simply using expression profiles of individual miRNA species. Functional assays are needed to determine the influence of a specific miRNA and different members of the same miRNA family may have opposite effects. Published by Elsevier Inc.

  13. Echinophora platyloba DC (Apiaceae crude extract induces apoptosis in human prostate adenocarcinoma cells (PC 3

    Directory of Open Access Journals (Sweden)

    Fatemeh Zare Shahneh

    2014-10-01

    Full Text Available Background: Prostate cancer is the second leading malignancy worldwide and the second prominent cause of cancer-related deaths among men. Therefore, there is a serious necessity for finding advanced alternative therapeutic measures against this lethal malignancy. In this article, we report the cytotoxicity and the mechanism of cell death of the methanolic extract prepared from Echinophora platyloba DC plant against human prostate adenocarcinoma PC 3 cell line and Human Umbilical Vein Endothelial Cells HUVEC cell line. Methods: Cytotoxicity and viability of the methanolic extract were assessed by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay and dye exclusion assay. Cell death enzyme-linked immunosorbent assay (ELISA was employed to quantify the nucleosome production resulting from nuclear DNA fragmentation during apoptosis and determine whether the mechanism involves induction of apoptosis or necrosis. The cell death was identified as apoptosis using terminal deoxynucleotidyl transferase (TdT-mediated dUTP nick end labeling (TUNEL assay and DNA fragmentation gel electrophoresis. Results: E. platyloba could decrease cell viability in malignant cells in a dose- and time-dependent manner. The IC50 values against PC 3 were determined as 236.136 ± 12.4, 143.400 ± 7.2, and 69.383 ± 1.29 μg/ml after 24, 36, and 48 h, respectively, but there was no significant activity in HUVEC normal cell (IC50 > 800 μg/ml. Morphological characterizations and DNA laddering assay showed that the methanolic extract treated cells displayed marked apoptotic characteristics such as nuclear fragmentation, appearance of apoptotic bodies, and DNA laddering fragment. Increase in an early apoptotic population was observed in a dose-dependent manner. PC 3 cell death elicited by the extract was found to be apoptotic in nature based a clear indication of TUNEL assay and gel electrophoresis DNA fragmentation, which is a hallmark of apoptosis

  14. NFAT5 promotes proliferation and migration of lung adenocarcinoma cells in part through regulating AQP5 expression

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Kai, E-mail: gk161@163.com [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China); Department of Respiration, 161th Hospital, PLA, Wuhan 430015 (China); Jin, Faguang, E-mail: jinfag@fmmu.edu.cn [Department of Respiration, Tangdu Hospital, Fourth Military Medical University, Xi' an 710038 (China)

    2015-09-25

    The osmoregulated transcription factor nuclear factor of activated T-cells 5(NFAT5), has been found to play important roles in the development of many kinds of human cancers, including breast cancer, colon carcinoma, renal cell carcinoma and melanoma. The aim of the present study was to determine whether NFAT5 is involved in the proliferation and migration of lung adenocarcinoma cells. We found that NFAT5 was upregulated in lung adenocarcinoma cells and knockdown of NFAT5 decreased proliferation and migration of the cells, accompanied by a significant reduction in the expression of AQP5. AQP5 was upregulated in lung adenocarcinoma cells and knockdown of AQP5 also inhibited proliferation and migration of the cells as knockdown of NFAT5 did. Moreover, overexpression of NFAT5 promoted proliferation and migration of lung adenocarcinoma cells, accompanied by a significant increase in the expression of AQP5. These results indicate that NFAT5 plays important roles in proliferation and migration of human lung adenocarcinoma cells through regulating AQP5 expression, providing a new therapeutic option for lung adenocarcinoma therapy. - Highlights: • NFAT5 expression is higher in lung adenocarcinoma cells compared with normal cells. • NFAT5 knockdown decreases proliferation and migration of lung adenocarcinoma cells. • Knockdown of NFAT5 reduces AQP5 expression in human lung adenocarcinoma cells. • Overexpression of NFAT5 promotes proliferation and migration of lung adenocarcinoma cells. • Overexpression of NFAT5 increases AQP5 expression in human lung adenocarcinoma cells.

  15. Clear Cell Adenocarcinoma Arising from Abdominal Wall Endometriosis

    Directory of Open Access Journals (Sweden)

    Thouraya Achach

    2008-01-01

    Full Text Available Endometriosis is a frequent benign disorder. Malignancy arising in extraovarian endometriosis is a rare event. A 49-year-old woman is presented with a large painful abdominal wall mass. She underwent a myomectomy, 20 years before, for uterus leiomyoma. Computed tomography suggested that this was a desmoid tumor and she underwent surgery. Histological examination showed a clear cell adenocarcinoma associated with endometriosis foci. Pelvic ultrasound, computed tomography, and endometrial curettage did not show any malignancy or endometriosis in the uterus and ovaries. Adjuvant chemotherapy was recommended, but the patient was lost to follow up. Six months later, she returned with a recurrence of the abdominal wall mass. She was given chemotherapy and then she was reoperated.

  16. MicroRNA-449a enhances radiosensitivity in CL1-0 lung adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Yi-Jyun Liu

    Full Text Available Lung cancer is the leading cause of cancer-related mortality worldwide. Radiotherapy is often applied for treating lung cancer, but it often fails because of the relative non-susceptibility of lung cancer cells to radiation. MicroRNAs (miRNAs have been reported to modulate the radiosensitivity of lung cancer cells and have the potential to improve the efficacy of radiotherapy. The purpose of this study was to identify a miRNA that can adjust radiosensitivity in lung adenocarcinoma cells. Two lung adenocarcinoma cell lines (CL1-0 and CL1-5 with different metastatic ability and radiosensitivity were used. In order to understand the regulatory mechanisms of differential radiosensitivity in these isogenic tumor cells, both CL1-0 and CL1-5 were treated with 10 Gy radiation, and were harvested respectively at 0, 1, 4, and 24 h after radiation exposure. The changes in expression of miRNA upon irradiation were examined using Illumina Human microRNA BeadChips. Twenty-six miRNAs were identified as having differential expression post-irradiation in CL1-0 or CL1-5 cells. Among these miRNAs, miR-449a, which was down-regulated in CL1-0 cells at 24 h after irradiation, was chosen for further investigation. Overexpression of miR-449a in CL1-0 cells effectively increased irradiation-induced DNA damage and apoptosis, altered the cell cycle distribution and eventually led to sensitization of CL1-0 to irradiation.

  17. Effects of adrenaline in human colon adenocarcinoma HT-29 cells.

    Science.gov (United States)

    Wong, Helen P S; Ho, Judy W C; Koo, Marcel W L; Yu, Le; Wu, William K K; Lam, Emily K Y; Tai, Emily K K; Ko, Joshua K S; Shin, Vivian Y; Chu, Kent Man; Cho, Chi Hin

    2011-06-20

    Stress has been implicated in the development of cancers. Adrenaline levels are increased in response to stress. The effects of adrenaline on colon cancer are largely unknown. The aims of the study are to determine the effects of adrenaline in human colon adenocarcinoma HT-29 cells and the possible underlying mechanisms involved. The effect of adrenaline on HT-29 cell proliferation was determined by [(3)H] thymidine incorporation assay. Expression of cyclooxygenase-2 (COX-2) and vascular endothelial growth factor (VEGF) were detected by Western blot. Matrix metalloproteinase-9 (MMP-9) activity and prostaglandin E(2) (PGE(2)) release were determined by zymography and enzyme immunoassay, respectively. Adrenaline stimulated HT-29 cell proliferation. This was accompanied by the enhanced expression of COX-2 and VEGF in HT-29 cells. Adrenaline also upregulated MMP-9 activity and PGE(2) release. Adrenaline stimulated HT-29 cell proliferation which was reversed by COX-2 inhibitor sc-236. COX-2 inhibitor also reverted the action of adrenaline on VEGF expression and MMP-9 activity. Further study was performed to determine the involvement of β-adrenoceptors. The stimulatory action of adrenaline on colon cancer growth was blocked by atenolol and ICI 118,551, a β(1)- and β(2)-selective antagonist, respectively. This signified the role of β-adrenoceptors in this process. In addition, both antagonists also abrogated the stimulating actions of adrenaline on COX-2, VEGF expression, MMP-9 activity and PGE(2) release in HT-29 cells. These results suggest that adrenaline stimulates cell proliferation of HT-29 cells via both β(1)- and β(2)-adrenoceptors by a COX-2 dependent pathway. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. The HSP90 Inhibitor Ganetespib Radiosensitizes Human Lung Adenocarcinoma Cells

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Casal, Roberto; Bhattacharya, Chitralekha [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Medicine, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Epperly, Michael W. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Radiation Oncology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Basse, Per H. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Immunology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Wang, Hong [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Biostatistics, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Wang, Xinhui [Harvard Medical School, Harvard University, 25 Shattuck Street, Boston, MA 02115 (United States); Proia, David A. [Synta Pharmaceuticals Corp., 45 Hartwell Avenue, Lexington, MA 02421 (United States); Greenberger, Joel S. [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Radiation Oncology, The University of Pittsburgh, Pittsburgh, PA 15213 (United States); Socinski, Mark A.; Levina, Vera, E-mail: levinav@upmc.edu [The University of Pittsburgh Cancer Institute, Pittsburgh, PA 15213 (United States); Department of Medicine, The University of Pittsburgh, Pittsburgh, PA 15213 (United States)

    2015-05-22

    The molecular chaperone HSP90 is involved in stabilization and function of multiple client proteins, many of which represent important oncogenic drivers in NSCLC. Utilization of HSP90 inhibitors as radiosensitizing agents is a promising approach. The antitumor activity of ganetespib, HSP90 inhibitor, was evaluated in human lung adenocarcinoma (AC) cells for its ability to potentiate the effects of IR treatment in both in vitro and in vivo. The cytotoxic effects of ganetespib included; G2/M cell cycle arrest, inhibition of DNA repair, apoptosis induction, and promotion of senescence. All of these antitumor effects were both concentration- and time-dependent. Both pretreatment and post-radiation treatment with ganetespib at low nanomolar concentrations induced radiosensitization in lung AC cells in vitro. Ganetespib may impart radiosensitization through multiple mechanisms: such as down regulation of the PI3K/Akt pathway; diminished DNA repair capacity and promotion of cellular senescence. In vivo, ganetespib reduced growth of T2821 tumor xenografts in mice and sensitized tumors to IR. Tumor irradiation led to dramatic upregulation of β-catenin expression in tumor tissues, an effect that was mitigated in T2821 xenografts when ganetespib was combined with IR treatments. These data highlight the promise of combining ganetespib with IR therapies in the treatment of AC lung tumors.

  19. In vitro cytotoxicity screening of wild plant extracts from Saudi Arabia on human breast adenocarcinoma cells.

    Science.gov (United States)

    Ali, M A; Abul Farah, M; Al-Hemaid, F M; Abou-Tarboush, F M

    2014-05-23

    This study investigated the in vitro anticancer activities of a total of 14 wild angiosperms collected in Saudi Arabia. The cytotoxic activity of each extract was assessed against human breast adenocarcinoma (MCF-7) cell lines by using the MTT assay. Among the plants screened, the potential cytotoxic activity exhibited by the extract of Lavandula dentata (Lamiaceae) was identified, and we analyzed its anticancer potential by testing antiproliferative and apoptotic activity. Our results clearly show that ethanolic extract of L. dentata exhibits promising cytotoxic activity with an IC50 value of 39 μg/mL. Analysis of cell morphological changes, DNA fragmentation and apoptosis (using an Annexin V assay) also confirmed the apoptotic effect of L. dentata extract, and thus, our data call for further investigations to determine the active chemical constituent(s) and their mechanisms of inducing apoptosis.

  20. Comparison of gefitinib as first- and second-line therapy for advanced lung adenocarcinoma patients with positive exon 21 or 19 del epidermal growth factor receptor mutation

    Directory of Open Access Journals (Sweden)

    Patel N

    2017-06-01

    Full Text Available Nishant Patel,1 Pingping Wu,2 Haijun Zhang1 1Department of Oncology, Zhongda Hospital, Medical School, Southeast University, 2Department of Medical Oncology, Jiangsu Cancer Hospital, Nanjing, People’s Republic of China Objectives: Gefitinib, a tyrosine kinase inhibitor (TKI targeting epidermal growth factor receptor (EGFR, shows excellent clinical benefit in treating advanced non-small-cell lung cancer (NSCLC. The aim of this study was to compare the efficacy and toxicity of gefitinib as first-line therapy and second-line therapy for advanced lung adenocarcinoma patients with positive exon 21 (L858R or exon 19 deletion of EGFR mutation. Methods: We retrospectively analyzed the clinical data of 60 EGFR-mutated advanced lung adenocarcinoma patients from July 2011 to November 2015 who have received oral gefitinib 250 mg once daily. Gefitinib was taken until disease progression, intolerable toxicity or death. Results: After a median follow-up of 792 days, one death had occurred. Among the 59 patients who survived, 17 patients progressed. Overall, the median progression-free survival (mPFS was 10 months (95% confidence interval [CI]: 7.53–12.46 months, p<0.05. The response rate (RR and disease control rate (DCR were 33.33% and 71.66%, respectively. However, there was longer mPFS in the first line-therapy than that in the second-line therapy: in the first-line gefitinib therapy, mPFS was 12 months among 41 patients (95% CI: 9.58–14.41 months, p<0.05, and in the second-line therapy, mPFS was 7 months among 19 patients (95% CI: 1.31–12.68 months, p<0.05. Furthermore, in subgroup analyses examining different EGFR mutation types, we noted that mPFS was significantly longer for patients with exon 19 deletion than for those with positive exon 21in both the first-line therapy and second-line therapy. Conclusion: Patients with advance lung adenocarcinoma who were selected by positive exon 21 or 19 deletion mutations had significantly longer m

  1. Influence of mast cells on two murine mammary adenocarcinomas.

    Science.gov (United States)

    de Cidre, L L; Eijan, A M; Bertolesi, G; Isturiz, M; Sacerdote de Lustig, E

    1996-01-01

    A high content of mast cells (MC) is considered characteristic of neoplasias. Some researchers postulate MC as enhancers of tumor development, others as inhibitors. The purpose of this study was to evaluate the ability of peritoneal cavity MC to modulate the in vivo and in vitro growth of two murine mammary adenocarcinomas with low (M3) and high (MM3) metastatic capacity. MC from the peritoneal cavity of normal (NMC) or tumor-bearing mice (TMC) were used. TMC, which by histochemical methods appeared degranulated, were not able to modify the tumorigenicity of both tumors. NMC, in contrast, decreased M3 tumor incidence and cell proliferation in vitro and increased the latency period of only MM3 tumors. No changes in the number of spontaneous lung metastases could be seen in experiments carried out either with NMC or TMC. We conclude that NMC, which are rich in chemical mediators, can modulate some of the first steps of tumor development. Once tumor-mediated degranulation occurs, MC become unable to regulate it.

  2. Effects of the Spider Venom on proliferation of Human Lung Adenocarcinoma Cell A549

    Directory of Open Access Journals (Sweden)

    Zengxiang HU

    2010-10-01

    Full Text Available Background and objective The spider venom may inspire new drugs to treat cancer. The aim of this study is to investigate the effects and mechanisms of spider venom on lung adenocarcinoma cell A549. Methods The proliferation of lung adenocarcinoma A549 cells was detected by MTT. The apoptosis rate was observed with MTT assay and flow cytometer. The activity of catalase was detected by colorimetry. The malondialdehyde (MDA content was determined by improved thiobarbituric acid fluorometric method. The expression of P38MAPK protein was analyzed with Western blot. Results Spider venom can remarkably inhibite the proliferation of lung adenocarcinoma A549 cells, increased activity of catalase and MDA content, down-regulated expression of P38MAPK compared with the control group. Conclusion The reduced proliferation of lung adenocarcinoma A549 cells by spider venom is may be associated with the increased of activity of catalase and MDA content and decreased expression of P38MAPK.

  3. The Progression of Nephrogenic Metaplasia of the Urinary Bladder to Clear Cell Adenocarcinoma: A Case Report

    OpenAIRE

    Dhaliwal, Catharine A.; Fineron, Paul W.

    2012-01-01

    Nephrogenic metaplasia (or nephrogenic adenoma) and clear cell adenocarcinoma of the bladder are uncommon lesions that cause diagnostic dilemmas for pathologists due to their similar morphologic features. Nephrogenic metaplasia describes a lesion in the lower urinary tract that is composed of small tubules resembling renal medullary tubules. It has been suggested that nephrogenic metaplasia may progress to clear cell adenocarcinoma but this possibility is not widely accepted. We present a cas...

  4. Effects of the Spider Venom on proliferation of Human Lung Adenocarcinoma Cell A549

    OpenAIRE

    Zengxiang HU; Du, Yulei; Quanxi LIU; Wang, Yuan

    2010-01-01

    Background and objective The spider venom may inspire new drugs to treat cancer. The aim of this study is to investigate the effects and mechanisms of spider venom on lung adenocarcinoma cell A549. Methods The proliferation of lung adenocarcinoma A549 cells was detected by MTT. The apoptosis rate was observed with MTT assay and flow cytometer. The activity of catalase was detected by colorimetry. The malondialdehyde (MDA) content was determined by improved thiobarbituric acid fluorometric met...

  5. Cytomorphological features of ALK-positive lung adenocarcinomas: psammoma bodies and signet ring cells.

    Science.gov (United States)

    Pareja, Fresia; Crapanzano, John P; Mansukhani, Mahesh M; Bulman, William A; Saqi, Anjali

    2015-03-01

    Correlation between histology and genotype has been described in lung adenocarcinomas. For example, studies have demonstrated that adenocarcinomas with an anaplastic lymphoma kinase (ALK) gene rearrangement may have mucinous features. The objective of the current study was to determine whether a similar association can be identified in cytological specimens. A retrospective search for ALK-rearranged cytopathology (CP) and surgical pathology (SP) lung carcinomas was conducted. Additional ALK-negative (-) lung adenocarcinomas served as controls. For CP and SP cases, the clinical data (i.e., age, sex, and smoking history), architecture, nuclear features, presence of mucin-containing cells (including signet ring cells), and any additional salient characteristics were evaluated. The search yielded 20 ALK-positive (+) adenocarcinomas. Compared with patients with ALK(-) lung adenocarcinomas (33 patients; 12 with epidermal growth factor receptor [EGFR]-mutation, 11 with Kristen rat sarcoma [KRAS]-mutation, and 10 wild-type adenocarcinomas), patients with ALK(+) adenocarcinoma presented at a younger age; and there was no correlation noted with sex or smoking status. The most common histological pattern in SP was papillary/micropapillary. Mucinous features were associated with ALK rearrangement in SP specimens. Signet ring cells and psammoma bodies were evident in and significantly associated with ALK(+) SP and CP specimens. However, psammoma bodies were observed in rare adenocarcinomas with an EGFR mutation. Both the ALK(+) and ALK(-) groups had mostly high nuclear grade. Salient features, including signet ring cells and psammoma bodies, were found to be significantly associated with ALK(+) lung adenocarcinomas and are identifiable on CP specimens. Recognizing these may be especially helpful in the molecular triage of scant CP samples. © 2014 American Cancer Society.

  6. Net expression inhibits the growth of pancreatic ductal adenocarcinoma cell PL45 in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Baiwen Li

    Full Text Available Pancreatic ductal adenocarcinoma has a poor prognosis due to late diagnosis and a lack of effective therapeutic options. Thus, it is important to better understand its molecular mechanisms and to develop more effective treatments for the disease. The ternary complex factor Net, which exerts its strong inhibitory function on transcription of proto-oncogene gene c-fos by forming ternary complexes with a second transcription factor, has been suspected of being involved in pancreatic cancer and other tumors biology. In this study, we found that the majority of pancreatic ductal adenocarcinoma tissues and cell lines had weak or no expression of Net, whereas significantly high level of Net expression occurred in paired adjacent normal tissues we studied. Furthermore, using in vitro and in vivo model systems, we found that overexpression of Net inhibited cell growth and survival and induced cell apoptosis in human pancreatic ductal adenocarcinoma cell PL45; the mechanisms by which Net inhibited the cell cycle progression were mainly through P21-Cyclin D1/CDK4 Pathway. Our data thus suggested that Net might play an important role in pancreatic carcinogenesis, possibly by acting as a tumor suppressor gene.

  7. Circulating Tumor Cells in the Adenocarcinoma of the Esophagus

    Directory of Open Access Journals (Sweden)

    Giulia Gallerani

    2016-08-01

    Full Text Available Circulating tumor cells (CTCs are elements of indisputable significance as they seem to be responsible for the onset of metastasis. Despite this, research into CTCs and their clinical application have been hindered by their rarity and heterogeneity at the molecular and cellular level, and also by a lack of technical standardization. Esophageal adenocarcinoma (EAC is a highly aggressive cancer that is often diagnosed at an advanced stage. Its incidence has increased so much in recent years that new diagnostic, prognostic and predictive biomarkers are urgently needed. Preliminary findings suggest that CTCs could represent an effective, non-invasive, real-time assessable biomarker in all stages of EAC. This review provides an overview of EAC and CTC characteristics and reports the main research results obtained on CTCs in this setting. The need to carry out further basic and translational research in this area to confirm the clinical usefulness of CTCs and to provide oncologists with a tool to improve therapeutic strategies for EAC patients was herein highlighted.

  8. miR-145 Inhibits Lung Adenocarcinoma Stem Cells Proliferation by Targeting OCT4 Gene

    Directory of Open Access Journals (Sweden)

    Shuai ZHANG

    2011-04-01

    Full Text Available Background and objective MiR-145 functions as a protective miRNA identified in tumor tissues of lung adenocarcinoma patients. The aim of this study is to investigate the relationship between miR-145 and proliferation of lung cancer stem cells and involved molecular mechanisms in human lung adenocarcinaoma A549 cell line. Methods MicroRNA microarray technology was conducted to compare miRNA signature between tumor and adjacent normal tissue of lung adenocarcinaoma. The potential target gene of miR-145 was predicted by online bioinformatic softwares. Pre-miR-145 mimics and anti-miR-145 inhibitor were transfected into A549 cell line by lipofectamine 2000. miR-145 expression in each group was detected by real time PCR. The OCT4 protein level was analyzed by Western blot. The predicted miR-145 binding site in OCT4 3’-untranslated region (UTR was validated by dual-luciferase reporter gene assay. CCK-8 assay was employed to observe the proliferation activity of A549 cells. The ratio of CD133 positive cells in each group was analyzed by flow cytometry. Results miR-145 expression was significantly down-regulated in lung adenocarcinoma compared with ajacent normal tissue. OCT4 is a potential target gene of miR-145 predicted by miRanda. Compared with control group, miR-145 was significantly up-regulated and down-regulated in the pre-miR-145 mimics and anti-miR-145 inhibitor groups respectively. Overexpression of miR-145 inhibited the proliferation of A549 cells. Both the OCT4 protein level and CD133 positive ratio were remarkably decreased in the pre-miR-145 mimics group, whereas significantly increased in the anti-miR-145 inhibitor group. Dual-luciferase reporter gene assay validated the predicted miR-145 binding site of OCT4 3’UTR. Conclusion MiR-145 can inhibit the proliferation of lung cancer stem cells in A549 cell line via down-regulating OCT4 expression. MiR-145 is a potential protective miRNA of lung cancer.

  9. Enterococcus faecalis Infection and Reactive Oxygen Species Down-Regulates the miR-17-92 Cluster in Gastric Adenocarcinoma Cell Culture

    DEFF Research Database (Denmark)

    Strickertsson, Jesper A B; Rasmussen, Lene Juel; Friis-Hansen, Lennart

    2014-01-01

    of many human diseases including gastric cancer. Here we studied the impact of infection by the gram-positive bacteria Enterococcus faecalis (E. faecalis) on global miRNA expression as well as the effect of ROS on selected miRNAs. Human gastric adenocarcinoma cell line MKN74 was infected with living E...

  10. Cytotoxic and apoptotic effects of chalcone derivatives of 2-acetyl thiophene on human colon adenocarcinoma cells.

    Science.gov (United States)

    de Vasconcelos, Alana; Campos, Vinicius Farias; Nedel, Fernanda; Seixas, Fabiana Kömmling; Dellagostin, Odir A; Smith, Kevin R; de Pereira, Cláudio Martin Pereira; Stefanello, Francieli Moro; Collares, Tiago; Barschak, Alethéa Gatto

    2013-06-01

    Recent studies report that chalcones exhibit cytotoxicity to human cancer cell lines. Typically, the form of cell death induced by these compounds is apoptosis. In the context of the discovery of new anticancer agents and in light of the antitumour potential of several chalcone derivatives, in the present study, we synthesized and tested the cytotoxicity of six chalcone derivatives on human colon adenocarcinoma cells. Six derivatives of 3-phenyl-1-(thiophen-2-yl) prop-2-en-1-one were prepared and characterized on the basis of their (1) H and (13) C NMR spectra. HT-29 cells were treated with synthesized chalcones on two concentrations by three different incubation times. Cells were evaluated by cell morphology, Tetrazolium dye (MTT) colorimetric assay, live/dead, flow cytometry (annexin V) and gene expression analyses to determine the cytotoxic way. Chalcones 3-(4-bromophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C06) and 3-(2-nitrophenyl)-1-(thiophen-2-yl)prop-2-en-1-one (C09) demonstrated higher cytotoxicity than other chalcones as shown by cell morphology, live/dead and MTT assays. In addition, C06 induced apoptosis on flow cytometry annexin V assay. These data were confirmed by a decreased expression of anti-apoptotic genes and increased pro-apoptotic genes. Our findings indicate in summary that the cytotoxic activity of chalcone C06 on colorectal carcinoma cells occurs by apoptosis. Copyright © 2012 John Wiley & Sons, Ltd.

  11. Clear cell adenocarcinoma of the ulterine cervix in a 15 year old girl: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seung Joon; Kim, Jee Eun; KIm, Hyung Sik; Choi, Hye Young [Dept. of Radiology, Gachon University Gil Hospital, Incheon (Korea, Republic of)

    2013-10-15

    Cervical cancer is rare in the pediatric population. In cases of cervical cancer, adenocarcinoma is predominantly reported. Clear cell adenocarcinoma (CCAC) of the uterine cervix is a very rare tumor and accounts for only 4% of all adenocarcinomas of the uterine cervix. Risk factors and pathogenesis of this disease are not exactly revealed. The intrauterine exposure to diethylstilbestrol (DES) and associated non-steroidal estrogen during pregnancy before 18 weeks is the only known risk factor. This study reports the imaging finding of primary uterine cervical tumor in a 15-year-old girl, who was finally diagnosed with CCAC, with no maternal history of DES exposure in utero.

  12. Radiation induced esophageal adenocarcinoma in a woman previously treated for breast cancer and renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Raissouni Soundouss

    2012-08-01

    Full Text Available Abstract Background Secondary radiation-induced cancers are rare but well-documented as long-term side effects of radiation in large populations of breast cancer survivors. Multiple neoplasms are rare. We report a case of esophageal adenocarcinoma in a patient treated previously for breast cancer and clear cell carcinoma of the kidney. Case presentation A 56 year-old non smoking woman, with no alcohol intake and no familial history of cancer; followed in the National Institute of Oncology of Rabat Morocco since 1999 for breast carcinoma, presented on consultation on January 2011 with dysphagia. Breast cancer was treated with modified radical mastectomy, 6 courses of chemotherapy based on CMF regimen and radiotherapy to breast, inner mammary chain and to pelvis as castration. Less than a year later, a renal right mass was discovered incidentally. Enlarged nephrectomy realized and showed renal cell carcinoma. A local and metastatic breast cancer recurrence occurred in 2007. Patient had 2 lines of chemotherapy and 2 lines of hormonotherapy with Letrozole and Tamoxifen assuring a stable disease. On January 2011, the patient presented dysphagia. Oesogastric endoscopy showed middle esophagus stenosing mass. Biopsy revealed adenocarcinoma. No evidence of metastasis was noticed on computed tomography and breast disease was controlled. Palliative brachytherapy to esophagus was delivered. Patient presented dysphagia due to progressive disease 4 months later. Jejunostomy was proposed but the patient refused any treatment. She died on July 2011. Conclusion We present here a multiple neoplasm in a patient with no known family history of cancers. Esophageal carcinoma is most likely induced by radiation. However the presence of a third malignancy suggests the presence of genetic disorders.

  13. Primary mucinous adenocarcinoma of the bladder with signet-ring cells: case report

    Directory of Open Access Journals (Sweden)

    Marcelo Lorenzi Marques

    Full Text Available CONTEXT: Primary adenocarcinomas of the bladder are uncommon and usually occur by contiguity with or hematogenic dissemination of other adenocarcinomas such as colorectal, prostate and gynecological tract carcinomas. Mucinous and signet-ring cell histological patterns are even rarer and it is often difficult to morphologically distinguish them from metastatic colorectal adenocarcinoma. CASE REPORT: We present and discuss a rare case of primary mucinous adenocarcinoma of the bladder with signet-ring cells in a 57-year-old male patient. Other primary sites for the tumor had been excluded and, in the absence of digestive tract tumor and for confirmation that it was a primary bladder tumor, an immunohistochemistry study was performed.

  14. Combined choriocarcinoma, neuroendocrine cell carcinoma and tubular adenocarcinoma in the stomach

    Science.gov (United States)

    Hirano, Yasumitsu; Hara, Takuo; Nozawa, Hiroshi; Oyama, Kaeko; Ohta, Naohiro; Omura, Kenji; Watanabe, Go; Niwa, Hideki

    2008-01-01

    We described a patient with adenocarcinoma of the stomach combined with choriocarcinoma and neuroendocrine cell carcinoma. An 85-year-old man visited our hospital because of appetite loss. Gastric fiberscopy revealed a large tumor occupying the cardial region and anterior wall of the gastric body. The patient underwent total gastrectomy with lymphnode dissection and partial resection of the liver. Choriocarcinoma, small cell carcinoma and tubular adenocarcinoma existed in the gastric tumor. The choriocarcinomatous foci contained cells positive for beta-subunit of human chorionic gonadotropin (B-hCG) and human placental lactogen mainly in syncytiotrophoblastic cells. The small cell carcinomatous foci contained cells positive for synaptophysin, neuron-specific enolase (NSE), and chromogranin A. The prognosis for gastric adenocarcinoma with choriocarcinoma and neuroendocrine cell carcinoma is exceedingly poor. This patient died about 2 mo after the first complaint from hepatic failure. This is the first reported case of gastric cancer with these three pathological features. PMID:18506939

  15. Effects of ozone exposure on human epithelial adenocarcinoma and normal fibroblasts cells.

    Science.gov (United States)

    Poma, Anna; Colafarina, Sabrina; Aruffo, Eleonora; Zarivi, Osvaldo; Bonfigli, Antonella; Di Bucchianico, Sebastiano; Di Carlo, Piero

    2017-01-01

    Previous studies show variable ozone cytotoxicity and genotoxicity in cell cultures, laboratory animals and humans directly exposed to tropospheric ozone. The aim of this study was therefore to investigate and compare the cyto and genotoxic effects of ozone using adenocarcinoma human alveolar basal epithelial cells A549 and normal human fibroblasts Hs27. A cell culture chamber with controlled atmosphere (a simulation reactor) was built to inject a flow of 120 ppb of ozone, which is two times the threshold value for the protection of human health, fixed by the EU legislation. Cell proliferation was evaluated by a luminescent cell viability assay while we assessed the genotoxic potential of ozone by the induction of micronuclei as well as evaluating DNA strand breaks by the induction of micronuclei evaluated by means of the cytokinesis-block micronucleus (CBMN) assay as well as evaluating DNA strand breaks by Alkaline Comet Assay (CA) or Comet Assay. A549 cells viability decreases significantly at 24 hours treatment with 120 ppb of O3 while at 48 hours and 72 hours O3 treated cells viability doesn't differ in respect to the control. However a significative decrease of A549 viability is shown at 72 hours vs. 48 hours in both treated and not-treated cells. The viability trend in the Hs27 cells did not show any significant changes in treated samples compared to the control in all conditions. The two genotoxicity biomarkers, the micronucleus and the comet tests, showed in both the cell types exposed to ozone, a significant increase in the number of micronuclei and in the tail DNA % in respect to the control even if at different times/cell type. Moreover, we found that O3 provokes genotoxic effects more evident in A549 cancer cells than in normal fibroblasts Hs27 ones. We applied a cell growth simulation model referred to ozone treated or not cell lines to confirm that the ozone exposure causes a slackening in the cells replication.

  16. Effect of New Water-Soluble Dendritic Phthalocyanines on Human Colorectal and Liver Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Ebru YABAŞ

    2017-08-01

    Full Text Available Human hepatocellular carcinoma (HepG2 cells and colorectal adenocarcinoma (DLD-1 cells were treated with the synthesized water soluble phthalocyanine derivatives to understand the effect of the compounds both on colorectal and liver cancer cells. The compounds inhibited cell proliferation and displayed cytotoxic effect on these cancer cell lines however; the effect of the compounds on healthy control fibroblast cell line was comparatively lower. The compounds can be employed for cancer treatment as anticancer agents.

  17. Silencing of Receptor Tyrosine Kinase ROR1 Inhibits Tumor-Cell Proliferation via PI3K/AKT/mTOR Signaling Pathway in Lung Adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Yanchun Liu

    Full Text Available Receptor tyrosine kinase ROR1, an embryonic protein involved in organogenesis, is expressed in certain hematological malignancies and solid tumors, but is generally absent in adult tissues. This makes the protein an ideal drug target for cancer therapy. In order to assess the suitability of ROR1 as a cell surface antigen for targeted therapy of lung adenocarcinoma, we carried out a comprehensive analysis of ROR1 protein expression in human lung adenocarcinoma tissues and cell lines. Our data show that ROR1 protein is selectively expressed on lung adenocarcinoma cells, but do not support the hypothesis that expression levels of ROR1 are associated with aggressive disease. However silencing of ROR1 via siRNA treatment significantly down-regulates the activity of the PI3K/AKT/mTOR signaling pathway. This is associated with significant apoptosis and anti-proliferation of tumor cells. We found ROR1 protein expressed in lung adenocarcinoma but almost absent in tumor-adjacent tissues of the patients. The finding of ROR1-mediated proliferation signals in both tyrosine kinase inhibitor (TKI-sensitive and -resistant tumor cells provides encouragement to develop ROR1-directed targeted therapy in lung adenocarcinoma, especially those with TKI resistance.

  18. Targeting of [[sup 111]In]biocytin to cultured ovarian adenocarcinoma cells using covalent monoclonal antibody -streptavidin conjugates

    Energy Technology Data Exchange (ETDEWEB)

    Sheldon, K.; Marks, A. (Toronto Univ., ON (Canada). Banting and Best Dept. of Medical Research); Baumal, R. (Hospital for Sick Children, Toronto, ON (Canada). Dept. of Pathology)

    1992-11-01

    Three monoclonal antibodies (mAb) directed against the human ovarian adenocarcinoma cell line HEY, were substituted with maleimide and covalently bonded to thiolated streptavidin. The conjugates were separated from unreacted reagents by successive affinity chromatography on protein A-Sepharose and iminobiotin columns. Purified conjugates consisted of an immunoglobulin (Ig) monomer bound to a streptavidin tetramer through a covalent bond between the Ig molecule and one of the streptavidin subunits. The conjugates were able to specifically target [[sup 111]In]biocytin to HEY cells in vitro in the presence of human serum and ascitic fluid from ovarian cancer patients. (Author).

  19. Gene Methylation Profiling in Sinonasal Adenocarcinoma and Squamous Cell Carcinoma.

    Science.gov (United States)

    Costales, Maria; López-Hernández, Alejandro; García-Inclán, Cristina; Vivanco, Blanca; López, Fernando; Llorente, José Luis; Hermsen, Mario A

    2016-11-01

    To identify epigenetic events in intestinal-type sinonasal adenocarcinoma (ITAC) and sinonasal squamous cell carcinoma (SNSCC) and to evaluate their relation to clinicopathologic features and follow-up data. Retrospective study. Academic research hospital. The methylation status of 23 genes in 50 ITACs and 32 SNSCCs was analyzed by methylation-specific multiplex ligation-dependent probe amplification and its relation to clinicopathologic features and follow-up data. Gene methylation was observed in 50% of all tumors. Recurrent methylated genes in SNSCC were RASSF1 and CDH13 (for both, 6 of 32 cases), CHFR (4 of 32 cases), and TIMP3 (2 of 32 cases). None of these genes showed significant correlation to clinicopathologic features or overall survival. In ITAC, recurrent methylated genes were CDH13 (18 of 50 cases), ESR1 (13 of 50 cases), APC (7 of 50 cases), TIMP3 (5 of 50 cases), CASP8 (3 of 50 cases), and HIC1 and RASSF1 (for both, 2 of 50 cases). Papillary and colonic ITAC subtypes carried a mean of 1.26 gene methylations per tumor versus 0.63 in solid and mucinous subtypes. Methylation of TIMP3 was associated with a significantly worse survival in ITAC patients. ITAC carries a higher number and a different profile of gene methylations as compared with SNSCC. Gene methylation plays a greater role in papillary and colonic ITAC subtypes, which may indicate a different tumorigenic pathway for these ITAC subtypes. These findings could be used as prognosticators and may have implications for future individualized therapies based on epigenetic changes. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2016.

  20. Dynamics of regulatory networks in gastrin-treated adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Naresh Doni Jayavelu

    Full Text Available Understanding gene transcription regulatory networks is critical to deciphering the molecular mechanisms of different cellular states. Most studies focus on static transcriptional networks. In the current study, we used the gastrin-regulated system as a model to understand the dynamics of transcriptional networks composed of transcription factors (TFs and target genes (TGs. The hormone gastrin activates and stimulates signaling pathways leading to various cellular states through transcriptional programs. Dysregulation of gastrin can result in cancerous tumors, for example. However, the regulatory networks involving gastrin are highly complex, and the roles of most of the components of these networks are unknown. We used time series microarray data of AR42J adenocarcinoma cells treated with gastrin combined with static TF-TG relationships integrated from different sources, and we reconstructed the dynamic activities of TFs using network component analysis (NCA. Based on the peak expression of TGs and activity of TFs, we created active sub-networks at four time ranges after gastrin treatment, namely immediate-early (IE, mid-early (ME, mid-late (ML and very late (VL. Network analysis revealed that the active sub-networks were topologically different at the early and late time ranges. Gene ontology analysis unveiled that each active sub-network was highly enriched in a particular biological process. Interestingly, network motif patterns were also distinct between the sub-networks. This analysis can be applied to other time series microarray datasets, focusing on smaller sub-networks that are activated in a cascade, allowing better overview of the mechanisms involved at each time range.

  1. Dynamics of regulatory networks in gastrin-treated adenocarcinoma cells.

    Science.gov (United States)

    Doni Jayavelu, Naresh; Bar, Nadav

    2014-01-01

    Understanding gene transcription regulatory networks is critical to deciphering the molecular mechanisms of different cellular states. Most studies focus on static transcriptional networks. In the current study, we used the gastrin-regulated system as a model to understand the dynamics of transcriptional networks composed of transcription factors (TFs) and target genes (TGs). The hormone gastrin activates and stimulates signaling pathways leading to various cellular states through transcriptional programs. Dysregulation of gastrin can result in cancerous tumors, for example. However, the regulatory networks involving gastrin are highly complex, and the roles of most of the components of these networks are unknown. We used time series microarray data of AR42J adenocarcinoma cells treated with gastrin combined with static TF-TG relationships integrated from different sources, and we reconstructed the dynamic activities of TFs using network component analysis (NCA). Based on the peak expression of TGs and activity of TFs, we created active sub-networks at four time ranges after gastrin treatment, namely immediate-early (IE), mid-early (ME), mid-late (ML) and very late (VL). Network analysis revealed that the active sub-networks were topologically different at the early and late time ranges. Gene ontology analysis unveiled that each active sub-network was highly enriched in a particular biological process. Interestingly, network motif patterns were also distinct between the sub-networks. This analysis can be applied to other time series microarray datasets, focusing on smaller sub-networks that are activated in a cascade, allowing better overview of the mechanisms involved at each time range.

  2. Inhibitory Effects of the Survivin siRNA Transfection on Human Lung Adenocarcinoma Cells SPCA1 and SH77

    Directory of Open Access Journals (Sweden)

    Quanxi LIU

    2011-01-01

    Full Text Available Background and objective Survivin, a member of the inhibitor of apoptosis (IAP protein family, has been demonstrated as a potential new target for apoptosis-based therapy in cancer and lymphoma. The aim of this study is to investigate effects and mechanisms of survivin siRNA transfection on lung adenocarcinoma cell lines SPCA1 and SH77. Methods A siRNA plasmid expression vector and pSi scrambled against survivin were constructed and transfected into SPCA1 and SH77 cells with Lipofectamine 2000. The proliferations of lung adenocarcinoma SPCA1 and SH77 cells were detected by MTT. The apoptotic rate and cell cycle were detected by flow cytometer. The activity of survivin mRNA and protein expression were analyzed with RT-PCR and Western blot. Results Survivin siRNA reduced the proliferation of SPCA1 and SH77 cells. Cell cycle was inhibited in G0/G1. Expressions of survivin siRNA mRNA and protein were reduced in transfected cells compared with the control cells. Conclusion siRNA targeted against survivin can effectively suppress SPCA1 and SH77 cells proliferation and significantly induce SPCA1 and SH77 cells apoptosis.

  3. TROP2 overexpression promotes proliferation and invasion of lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zanhua [Medical School of Nanchang University (China); The Chest Hospital of Jiangxi Province Department of Respiration (China); Jiang, Xunsheng [Department of Respiration, Medical School of Nanchang University (China); Zhang, Wei, E-mail: weizhangncu@gmail.com [Department of Respiration, The First Affiliated Hospital of Nanchang University (China)

    2016-01-29

    Recent studies suggest that the human trophoblast cell-surface antigen TROP2 is highly expressed in a number of tumours and is correlated with poor prognosis. However, its role in non-small cell lung carcinoma (NSCLC) remains largely unknown. Here we examined TROP2 expression by immunohistochemistry in a series of 68 patients with adenocarcinoma (ADC). We found significantly elevated TROP2 expression in ADC tissues compared with normal lung tissues (P < 0.05), and TROP2 overexpression was significantly associated with TNM (tumour, node, metastasis) stage (P = 0.012), lymph node metastasis (P = 0.038), and histologic grade (P = 0.013). Kaplan–Meier survival analysis revealed that high TROP2 expression correlated with poor prognosis (P = 0.046). Multivariate analysis revealed that TROP2 expression was an independent prognostic marker for overall survival of ADC patients. Moreover, TROP2 overexpression enhanced cell proliferation, migration, and invasion in the NSCLC cell line A549, whereas knockdown of TROP2 induced apoptosis and impaired proliferation, migration, and invasion in the PC-9 cells. Altogether, our data suggest that TROP2 plays an important role in promoting ADC and may represent a novel prognostic biomarker and therapeutic target for the disease.

  4. Dihydroartemisinin (DHA induces caspase-3-dependent apoptosis in human lung adenocarcinoma ASTC-a-1 cells

    Directory of Open Access Journals (Sweden)

    Sun Lei

    2009-02-01

    Full Text Available Abstract Background Dihydroartemisinin (DHA, a semi-synthetic derivative of artemisinin, isolated from the traditional Chinese herb Artemisia annua, is recommended as the first-line anti-malarial drug with low toxicity. DHA has been shown to possess promising anticancer activities and induce cancer cell death through apoptotic pathways, although the molecular mechanisms are not well understood. Methods In this study, cell counting kit (CCK-8 assay was employed to evaluate the survival of DHA-treated ASTC-a-1 cells. The induction of apoptosis was detected by Hoechst 33258 and PI staining as well as flow cytometry analysis. Collapse of mitochondrial transmembrane potential (ΔΨm was measured by dynamic detection under a laser scanning confocal microscope and flow cytometry analysis using Rhodamine123. Caspase-3 activities measured with or without Z-VAD-fmk (a broad spectrum caspase inhibitor pretreatment by FRET techniques, caspase-3 activity measurement, and western blotting analysis. Results Our results indicated that DHA induced apoptotic cell death in a dose- and time-dependent manner, which was accompanied by mitochondrial morphology changes, the loss of ΔΨm and the activation of caspase-3. Conclusion These results show for the first time that DHA can inhibit proliferation and induce apoptosis via caspase-3-dependent mitochondrial death pathway in ASTC-a-1 cells. Our work may provide evidence for further studies of DHA as a possible anticancer drug in the clinical treatment of lung adenocarcinoma.

  5. Impact of laparoscopy on the biological behavior and gene expression of endometrial adenocarcinoma cells.

    Science.gov (United States)

    Huang, Shouguo; Qin, Jie; Chen, Jin; Cheng, Hong; Meng, Qiu; Zhang, Jing; Wang, Haiyan

    2017-11-01

    The current study investigated the effect of laparoscopy on the biological behavior and gene expression of endometrial adenocarcinoma cells. Totally, 40 patients with stage I endometrial adenocarcinoma and 20 patients with benign uterine diseases were enrolled in this study. For patients with endometrial adenocarcinoma, laparoscopy was performed in 20 cases and laparotomy was carried out in the other 20 cases. Total laparoscopic hysterectomy was performed in patients with benign diseases. Cell apoptotic rate and the gene expression of N-myc, Fas, metastasis-associated protein 1 (MTA1), and nm23-H1 were determined in the normal and cancerous endometrial tissues both preoperatively and postoperatively. For endometrial adenocarcinoma cells, laparoscopy, instead of laparotomy, promoted the apoptosis of endometrial adenocarcinoma cells, down-regulated the expression of apoptosis suppressor gene N-myc and metastasis-promoting gene MTA1, up-regulated the expression of apoptosis-promoting gene Fas and metastasis suppressor gene nm23-H1. However, laparoscopy did not affect the apoptotic rate and gene expression in normal endometrial cells. Laparoscopy may be used as a safe and effective intervention for endometrial cancer.

  6. Germ Cell Tumor Targeting Chemotherapy in Gastric Adenocarcinoma with an Endodermal Sinus Tumor Component: A Case Report.

    Science.gov (United States)

    Choi, Jung Eun; Choe, A Reum; Yoon, Sang Eun; Nam, Eun Mi; Park, Heejung; Lee, Kyoung Eun

    2017-01-01

    The most common sites for extragonadal germ cell tumors are the midline mediastinum, retroperitoneum and, much less frequently, the stomach. The stomach-originated primary germ cell tumor carries a poor prognosis, especially when metastasis occurs to the liver, with a mean survival time of 1 month. We describe the case of a 77-year-old male who presented with usual symptoms of gastric malignancy. Gastrectomy was performed. Histopathology of surgically resected tissue revealed a mixture of adenocarcinoma and endodermal sinus tumor components with α-fetoprotein production. After liver metastasis was identified, oxaliplatin and capecitabine were administered as palliative chemotherapy. The response was poor. For the second-line therapy, bleomycin, etoposide, and cisplatin (BEP) therapy was initiated. The overall response to these drugs was a partial response and the residual liver lesion was considered to be resectable. The patient died of pneumonia 11 months following the BEP session, representing an overall survival time of 22 months. Gastric adenocarcinoma with a germ cell tumor component is uncommon and an effective combination of chemotherapeutic agents is not yet clear. In this case, the patient received germ cell tumor-targeting chemotherapy and showed a durable response. Hence, germ cell-targeting cytotoxic agents have potential as the 'front-line regimen'. © 2016 S. Karger AG, Basel.

  7. p, p'-Dichlorodiphenyldichloroethylene induces colorectal adenocarcinoma cell proliferation through oxidative stress.

    Directory of Open Access Journals (Sweden)

    Li Song

    Full Text Available p, p'-Dichlorodiphenyldichloroethylene (DDE, the major metabolite of Dichlorodiphenyltrichloroethane (DDT, is an organochlorine pollutant and associated with cancer progression. The present study investigated the possible effects of p,p'-DDE on colorectal cancer and the involved molecular mechanism. The results indicated that exposure to low concentrations of p,p'-DDE from 10(-10 to 10(-7 M for 96 h markedly enhanced proliferations of human colorectal adenocarcinoma cell lines. Moreover, p,p'-DDE exposure could activate Wnt/β-catenin and Hedgehog/Gli1 signaling cascades, and the expression level of c-Myc and cyclin D1 was significantly increased. Consistently, p,p'-DDE-induced cell proliferation along with upregulated c-Myc and cyclin D1 were impeded by β-catenin siRNA or Gli1 siRNA. In addition, p,p'-DDE was able to activate NADPH oxidase, generate reactive oxygen species (ROS and reduce GSH content, superoxide dismutase (SOD and calatase (CAT activities. Treatment with antioxidants prevented p,p'-DDE-induced cell proliferation and signaling pathways of Wnt/β-catenin and Hedgehog/Gli1. These results indicated that p,p'-DDE promoted colorectal cancer cell proliferation through Wnt/β-catenin and Hedgehog/Gli1 signalings mediated by oxidative stress. The finding suggests an association between p,p'-DDE exposure and the risk of colorectal cancer progression.

  8. p, p'-Dichlorodiphenyldichloroethylene induces colorectal adenocarcinoma cell proliferation through oxidative stress.

    Science.gov (United States)

    Song, Li; Liu, Jianxin; Jin, Xiaoting; Li, Zhuoyu; Zhao, Meirong; Liu, Weiping

    2014-01-01

    p, p'-Dichlorodiphenyldichloroethylene (DDE), the major metabolite of Dichlorodiphenyltrichloroethane (DDT), is an organochlorine pollutant and associated with cancer progression. The present study investigated the possible effects of p,p'-DDE on colorectal cancer and the involved molecular mechanism. The results indicated that exposure to low concentrations of p,p'-DDE from 10(-10) to 10(-7) M for 96 h markedly enhanced proliferations of human colorectal adenocarcinoma cell lines. Moreover, p,p'-DDE exposure could activate Wnt/β-catenin and Hedgehog/Gli1 signaling cascades, and the expression level of c-Myc and cyclin D1 was significantly increased. Consistently, p,p'-DDE-induced cell proliferation along with upregulated c-Myc and cyclin D1 were impeded by β-catenin siRNA or Gli1 siRNA. In addition, p,p'-DDE was able to activate NADPH oxidase, generate reactive oxygen species (ROS) and reduce GSH content, superoxide dismutase (SOD) and calatase (CAT) activities. Treatment with antioxidants prevented p,p'-DDE-induced cell proliferation and signaling pathways of Wnt/β-catenin and Hedgehog/Gli1. These results indicated that p,p'-DDE promoted colorectal cancer cell proliferation through Wnt/β-catenin and Hedgehog/Gli1 signalings mediated by oxidative stress. The finding suggests an association between p,p'-DDE exposure and the risk of colorectal cancer progression.

  9. The significance of programmed cell death ligand 1 expression in resected lung adenocarcinoma.

    Science.gov (United States)

    Wu, Shafei; Shi, Xiaohua; Sun, Jian; Liu, Yuanyuan; Luo, Yufeng; Liang, Zhiyong; Wang, Jinghui; Zeng, Xuan

    2017-03-07

    Lung adenocarcinoma (AD) is a common variant of non-small cell lung cancer (NSCLC). Programmed cell death protein 1/programmed cell death ligand 1 (PD1/PD-L1) are promising immunotherapy targets and its expression may be an important biomarker of predicting clinical response. In this study, we evaluated PD-L1 expression in conjunction with clinicopathological characteristics and outcomes in resected lung adenocarcinoma. This study included 133 cases of lung adenocarcinoma. PD-L1 expression rate in lung adenocarcinoma was 16.5% at the mRNA level and 13.5% at the protein level, and the kappa coefficient of the two examination methods was 0.824 (P = 0.219, highly correlated). PD-L1 was highly expressed in male patients and smokers with lung adenocarcinoma (P = 0.019 and 0.002, respectively), while no associations were identified between PD-L1 expression and age, tumor size, clinical stage, positive pleural invasion, lymph node metastasis, or therapy methods. Overexpression of PD-L1 was a significant indicator of shorter recurrence free survival time and overall survival (P = 0.000 and 0.000, respectively). Multivariate analysis revealed that PD-L1 expression was an independent risk factor for poor recurrence free survival and overall survival (P = 0.009 and 0.016, respectively). Expression of PD-L1 was examined with immunohistochemistry, using the VENTANA PD-L1 (SP263) rabbit monoclonal antibody. mRNA levels of PD-L1 were evaluated using in situ hybridization. PD-L1 overexpression is more frequently observed in male patients and smokers in lung adenocarcinoma. PD-L1 expression is an indicator of worse prognosis in surgically resected lung adenocarcinoma patients.

  10. Clear Cell Adenocarcinoma of the Renal Pelvis in a Male Patient

    OpenAIRE

    Sarawut Kongkarnka; Pruit Kitirattakarn; Hironori Katayama; Surapan Khunamornpong

    2013-01-01

    Carcinoma of the renal pelvis is an uncommon renal neoplasm. Clear cell adenocarcinoma in the urinary tract is rare and has a histomorphology resembling that of the female genital tract. We herein present a case of clear cell adenocarcinoma of the renal pelvis, which is the first example in a male patient to our knowledge. A 54-year-old man presented with right flank pain. The tumor was associated with renal stones and hydronephrosis and invaded into the peripelvic fat tissue with regional ly...

  11. Prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma.

    Science.gov (United States)

    Che, Keying; Zhao, Yang; Qu, Xiao; Pang, Zhaofei; Ni, Yang; Zhang, Tiehong; Du, Jiajun; Shen, Hongchang

    2017-01-01

    Gastric carcinoma (GC) is a highly aggressive cancer and one of the leading causes of cancer-related deaths worldwide. Histopathological evaluation pertaining to invasiveness is likely to provide additional information in relation to patient outcome. In this study, we aimed to evaluate the prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma. Hematoxylin and eosin-stained slides generated from 296 gastric adenocarcinoma patients with full clinical and pathological and follow-up information were systematically reviewed. The patients were grouped on the basis of tumor budding, single cell invasion, large cell invasion, mitotic count, and fibrosis. The association between histopathological parameters, different classification systems, and overall survival (OS) was statistically analyzed. Among the 296 cases that were analyzed, high-grade tumor budding was observed in 49.0% (145) of them. Single cell invasion and large cell invasion were observed in 62.8% (186) and 16.9% (50) of the cases, respectively. Following univariate analysis, patients with high-grade tumor budding had shorter OS than those with low-grade tumor budding (hazard ratio [HR]: 2.260, Ptumor budding and single cell invasion were observed to be independent risk factors for gastric adenocarcinoma (PTumor budding and single cell invasion in gastric adenocarcinoma are associated with an unfavorable prognosis.

  12. Antiproliferative action of metformin in human lung cancer cell lines.

    Science.gov (United States)

    Ashinuma, Hironori; Takiguchi, Yuichi; Kitazono, Satoru; Kitazono-Saitoh, Miyako; Kitamura, Atsushi; Chiba, Tetsuhiro; Tada, Yuji; Kurosu, Katsushi; Sakaida, Emiko; Sekine, Ikuo; Tanabe, Nobuhiro; Iwama, Atsushi; Yokosuka, Osamu; Tatsumi, Koichiro

    2012-07-01

    The oral antidiabetic agent metformin has anticancer properties, probably via adenosine monophosphate-activated protein kinase activation. In the present study, growth inhibition was assessed by a clonogenic and by a cell survival assay, apoptosis induction was assessed by Hoechst staining and caspase activities and cell cycle alteration after exposure to metformin, and the interaction of metformin with cisplatin in vitro were elucidated in four human lung cancer cell lines representing squamous, adeno-, large cell and small cell carcinoma. Clonogenicity and cell proliferation were inhibited by metformin in all the cell lines examined. This inhibitory effect was not specific to cancer cells because it was also observed in a non-transformed human mesothelial cell line and in mouse fibroblast cell lines. Inhibition of clonogenicity was observed only when the cells were exposed to metformin for a long period, (10 days) and the surviving fraction, obtained after inhibiting proliferation by increasing the dose, reached a plateau at approximately 0.1-0.3, indicating the cytostatic characteristics of metformin. Metformin induced significant apoptosis only in the small cell carcinoma cell line. A tendency of cell cycle accumulation at the G0/G1 phase was observed in all four cell lines. Cisplatin, in a dose-dependent manner, severely antagonized the growth inhibitory effect of metformin, and even reversed the effect in three cell lines but not in the adenocarcinoma cell line. The present data obtained using various histological types of human lung cancer cell lines in vitro illustrate the cytostatic nature of metformin and its cytoprotective properties against cisplatin.

  13. Innate Immune Landscape in Early Lung Adenocarcinoma by Paired Single-Cell Analyses.

    Science.gov (United States)

    Lavin, Yonit; Kobayashi, Soma; Leader, Andrew; Amir, El-Ad David; Elefant, Naama; Bigenwald, Camille; Remark, Romain; Sweeney, Robert; Becker, Christian D; Levine, Jacob H; Meinhof, Klaus; Chow, Andrew; Kim-Shulze, Seunghee; Wolf, Andrea; Medaglia, Chiara; Li, Hanjie; Rytlewski, Julie A; Emerson, Ryan O; Solovyov, Alexander; Greenbaum, Benjamin D; Sanders, Catherine; Vignali, Marissa; Beasley, Mary Beth; Flores, Raja; Gnjatic, Sacha; Pe'er, Dana; Rahman, Adeeb; Amit, Ido; Merad, Miriam

    2017-05-04

    To guide the design of immunotherapy strategies for patients with early stage lung tumors, we developed a multiscale immune profiling strategy to map the immune landscape of early lung adenocarcinoma lesions to search for tumor-driven immune changes. Utilizing a barcoding method that allows a simultaneous single-cell analysis of the tumor, non-involved lung, and blood cells, we provide a detailed immune cell atlas of early lung tumors. We show that stage I lung adenocarcinoma lesions already harbor significantly altered T cell and NK cell compartments. Moreover, we identified changes in tumor-infiltrating myeloid cell (TIM) subsets that likely compromise anti-tumor T cell immunity. Paired single-cell analyses thus offer valuable knowledge of tumor-driven immune changes, providing a powerful tool for the rational design of immune therapies. VIDEO ABSTRACT. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Eriocalyxin B induces apoptosis and cell cycle arrest in pancreatic adenocarcinoma cells through caspase- and p53-dependent pathways

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lin [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Yue, Grace G.L. [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Lau, Clara B.S. [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); Sun, Handong [State Key Laboratory of Phytochemistry and Plant Resources in West China, Kunming Institute of Botany, CAS, Yunnan (China); Fung, Kwok Pui [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China); Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Leung, Ping Chung [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); Han, Quanbin, E-mail: simonhan@hkbu.edu.hk [Institute of Chinese Medicine, The Chinese University of Hong Kong, Hong Kong (China); State Key Laboratory of Phytochemistry and Plant Resources in West China, The Chinese University of Hong Kong, Hong Kong (China); School of Chinese Medicine, The Hong Kong Baptist University, Hong Kong (China); Leung, Po Sing, E-mail: psleung@cuhk.edu.hk [School of Biomedical Sciences, The Chinese University of Hong Kong, Hong Kong (China)

    2012-07-01

    Pancreatic cancer is difficult to detect early and responds poorly to chemotherapy. A breakthrough in the development of new therapeutic agents is urgently needed. Eriocalyxin B (EriB), isolated from the Isodon eriocalyx plant, is an ent-kaurane diterpenoid with promise as a broad-spectrum anti-cancer agent. The anti-leukemic activity of EriB, including the underlying mechanisms involved, has been particularly well documented. In this study, we demonstrated for the first time EriB's potent cytotoxicity against four pancreatic adenocarcinoma cell lines, namely PANC-1, SW1990, CAPAN-1, and CAPAN-2. The effects were comparable to that of the chemotherapeutic camptothecin (CAM), but with much lower toxicity against normal human liver WRL68 cells. EriB's cytoxicity against CAPAN-2 cells was found to involve caspase-dependent apoptosis and cell cycle arrest at the G2/M phase. Moreover, the p53 pathway was found to be activated by EriB in these cells. Furthermore, in vivo studies showed that EriB inhibited the growth of human pancreatic tumor xenografts in BALB/c nude mice without significant secondary adverse effects. These results suggest that EriB should be considered a candidate for pancreatic cancer treatment. -- Highlights: ► We study Eriocalyxin B (EriB)'s cytotoxic effects on pancreatic cancer cell lines. ► EriB inhibits cell proliferation via mediation of apoptosis and cell cycle arrest. ► The effects are involved in caspase-dependent apoptosis and p53 pathway. ► In vivo study also shows EriB inhibits the growth of human pancreatic tumor. ► EriB can be a good candidate for chemotherapy in pancreatic cancer.

  15. Selective gene delivery toward gastric and esophageal adenocarcinoma cells via EpCAM-targeted adenoviral vectors

    NARCIS (Netherlands)

    Heideman, DAM; Snijders, PJF; Craanen, ME; Bloemena, E; Meijer, CJLM; Meuwissen, SGM; van Beusechem, VW; Pinedo, HM; Curiel, DT; Haisma, HJ; Gerritsen, WR

    Application of recombinant adenoviral vectors for cancer gene therapy is currently limited due to lack of specificity for tumor cells. For gastric and esophageal adenocarcinoma, we present here that the relative abundant expression of the primary adenovirus receptor, coxsackie/adenovirus receptor

  16. Interfacing polymeric scaffolds with primary pancreatic ductal adenocarcinoma cells to develop 3D cancer models

    NARCIS (Netherlands)

    Ricci, C.; Mota, C.M.; Moscato, S.; D' Alessandro, D.; Ugel, S.; Sartoris, S.; Bronte, V.; Boggi, U.; Campani, D.; Funel, N.; Moroni, Lorenzo; Danti, S.

    2014-01-01

    We analyzed the interactions between human primary cells from pancreatic ductal adenocarcinoma (PDAC) and polymeric scaffolds to develop 3D cancer models useful for mimicking the biology of this tumor. Three scaffold types based on two biocompatible polymeric formulations, such as poly(vinyl

  17. Iron overload of human colon adenocarcinoma cells studied by synchrotron-based X-ray techniques

    NARCIS (Netherlands)

    Mihucz, Victor G.; Meirer, Florian; Polgári, Zsófia; Réti, Andrea; Pepponi, Giancarlo; Ingerle, Dieter; Szoboszlai, Norbert; Streli, Christina

    2016-01-01

    Fast- and slow-proliferating human adenocarcinoma colorectal cells, HT-29 and HCA-7, respectively, overloaded with transferrin (Tf), Fe(III) citrate, Fe(III) chloride and Fe(II) sulfate were studied by synchrotron radiation total-reflection X-ray spectrometry (TXRF), TXRF-X-ray absorption near edge

  18. A rare tumoral combination, synchronous lung adenocarcinoma and mantle cell lymphoma of the pleura

    Directory of Open Access Journals (Sweden)

    Foroulis Christophoros N

    2008-12-01

    Full Text Available Abstract Background Coexistence of adenocarcinoma and mantle cell lymphoma in the same or different anatomical sites is extremely rare. We present a case of incidental discovery of primary lung adenocarcinoma and mantle cell lymphoma involving the pleura, during an axillary thoracotomy performed for a benign condition. Case presentation A 73-year old male underwent bullectomy and apical pleurectomy for persistent pneumothorax. A bulla of the lung apex was resected en bloc with a scar-like lesion of the lung, which was located in proximity with the bulla origin, by a wide wedge resection. Histologic examination of the stripped-off parietal pleura and of the bullectomy specimen revealed the synchronous occurrence of two distinct neoplasms, a lymphoma infiltrating the pleura and a primary, early lung adenocarcinoma. Immunohistochemical and fluorescence in situ hybridization assays were performed. The morphologic, immunophenotypic and genetic findings supported the diagnosis of primary lung adenocarcinoma (papillary subtype coexisting with a non-Hodgkin, B-cell lineage, mantle cell lymphoma involving both, visceral and parietal pleura and without mediastinal lymph node involvement. The neoplastic lymphoid cells showed the characteristic immunophenotype of mantle cell lymphoma and the translocation t(11;14. The patient received 6 cycles of chemotherapy, while pulmonary function tests precluded further pulmonary parenchyma resection (lobectomy for his adenocarcinoma. The patient is alive and without clinical and radiological findings of local recurrence or distant relapse from both tumors 14 months later. Conclusion This is the first reported case of a rare tumoral combination involving simultaneously lung and pleura, emphasizing at the incidental discovery of the two coexisting neoplasms during a procedure performed for a benign condition. Any tissue specimen resected during operations performed for non-tumoral conditions should be routinely sent for

  19. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-06-01

    Full Text Available Weiyi Huang,* Haihua Huang,* Lei Wang, Jiong Hu, Weifeng Song Department of Oncology, The First People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Cytoskeleton is critical for carcinoma cell proliferation, migration, and invasion. Sad-1 and UNC-84 domain containing 1 (SUN1 is one of the core linkers of nucleoskeleton and cytoskeleton. However, the functions of SUN1 in lung adenocarcinoma are largely unknown.Methods: In this study, we first transduced the lentivirus delivering the short hairpin RNA (shRNA against SUN1 to lung adenocarcinoma cells (A549 and 95D cells with high efficiency. After lentivirus infection, quantitative real-time polymerase chain reaction and Western blotting were used to detect the expressions of SUN1 mRNA and protein. The cell proliferation and colony formation were detected by MTT assay and colony formation assay, respectively. The cell distribution in the cell cycle was analyzed by flow cytometry.Results: Both mRNA and protein levels of SUN1 were significantly decreased in A549 and 95D cells after lentivirus infection, as indicated by quantitative real-time polymerase chain reaction and Western blot. Next, we found that cell proliferation and colony formation were markedly reduced in SUN1 silenced cells. Moreover, suppression of SUN1 led to cell cycle arrest at G0/G1 phase. Furthermore, Cyclin D1, CDK6, and CDK2 expressions were obviously reduced in A549 cells after SUN1 silencing.Conclusion: These results suggest that SUN1 plays an essential role in proliferation of lung adenocarcinoma cells in vitro and may be used as a potential therapeutic target for the treatment of lung adenocarcinoma in the future. Keywords: SUN1, lung cancer, proliferation

  20. Promoter Methylation status of HIN-1 associated with outcomes of ovarian clear cell adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Ho Chih-Ming

    2012-08-01

    Full Text Available Abstract Background This study is to analyze promoter methylation of various tumor suppressor genes in different types of ovarian carcinoma and to identify potential therapeutic targets of ovarian clear cell adenocarcinoma (OCCA. Materials and methods The promoter methylation statuses of 40 genes in primary ovarian carcinomas including 47 clear- and 63 non-clear-cell type tissues, 6 OCCA cell lines, 29 benign ovarian endometriotic cysts, and 31 normal controls were analyzed by methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA. The MS-MLPA results were correlated with clinicopathological features and outcomes of 47 OCCA patients. Functions of the target genes were further explored by Western Blot Analysis, apoptosis assay, and caspase-3/7 activity analysis. Results Frequencies of methylated RASSF1A, CDH13, CACNA1A, HIN-1, and sFRP5 genes in OCCA tissues were significantly higher than those in non-OCCA cancerous tissues and benign endometriotic cysts. The expected OS for patients with methylated promoters of HIN-1 was significantly worse than those for patients without methylated HIN-1 (30% vs. 62%, p = 0.002. The HIN-1 gene was over-expressed in ES2 cells, a significant reduction in cell growth and induction of apoptosis, and increasing paclitaxel sensitivity by reducing phosphorylation of Akt were observed. Conclusions Methylation of HIN-1 promoter is a novel epigenetic biomarker associated with poor outcomes in OCCA patients. Ectopic expression of the HIN-1 gene increased paclitaxel sensitivity which is partly through Akt pathway.

  1. MicroRNA-29a suppresses the growth, migration, and invasion of lung adenocarcinoma cells by targeting carcinoembryonic antigen-related cell adhesion molecule 6.

    Science.gov (United States)

    Han, Hye Sook; Son, Seung-Myoung; Yun, Jieun; Jo, Yeong Nang; Lee, Ok-Jun

    2014-10-16

    Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) is an important regulator of cell adhesion, invasion, and metastasis. The aim of this study was to evaluate the functional roles of CEACAM6 in lung adenocarcinoma and to identify miRNAs that inhibit the growth, migration, and invasion of lung adenocarcinoma cells by targeting CEACAM6. CEACAM6 expression is associated with poor prognosis of patients with lung adenocarcinoma, and CEACAM6 has important functional roles in controlling the growth, migration, and invasion of lung adenocarcinoma cells in vitro and in vivo. Furthermore, miR-29a can suppress the growth, migration, and invasion of lung adenocarcinoma cells by targeting CEACAM6. Therefore, miR-29a/CEACAM6 axis represents a potential therapeutic target for treatment of lung adenocarcinoma. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  2. Prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Che K

    2017-02-01

    Full Text Available Keying Che,1,* Yang Zhao,2,3,* Xiao Qu,1 Zhaofei Pang,1 Yang Ni,4 Tiehong Zhang,4 Jiajun Du,1,5 Hongchang Shen4 1Institute of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, 2Department of Breast Surgery, Key Laboratory of Breast Cancer in Shanghai, Collaborative Innovation Center of Cancer Medicine, Fudan University Shanghai Cancer Center, 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 4Department of Oncology, Shandong Provincial Hospital Affiliated to Shandong University, 5Department of Thoracic Surgery, Shandong Provincial Hospital Affiliated to Shandong University, Jinan, People’s Republic of China *These authors contributed equally to this work Purpose: Gastric carcinoma (GC is a highly aggressive cancer and one of the leading causes of cancer-related deaths worldwide. Histopathological evaluation pertaining to invasiveness is likely to provide additional information in relation to patient outcome. In this study, we aimed to evaluate the prognostic significance of tumor budding and single cell invasion in gastric adenocarcinoma.Materials and methods: Hematoxylin and eosin-stained slides generated from 296 gastric adenocarcinoma patients with full clinical and pathological and follow-up information were systematically reviewed. The patients were grouped on the basis of tumor budding, single cell invasion, large cell invasion, mitotic count, and fibrosis. The association between histopathological parameters, different classification systems, and overall survival (OS was statistically analyzed.Results: Among the 296 cases that were analyzed, high-grade tumor budding was observed in 49.0% (145 of them. Single cell invasion and large cell invasion were observed in 62.8% (186 and 16.9% (50 of the cases, respectively. Following univariate analysis, patients with high-grade tumor budding had shorter OS than those with low-grade tumor budding (hazard ratio [HR]: 2.260, P<0

  3. In vitro and in vivo antitumour effects of phenylboronic acid against mouse mammary adenocarcinoma 4T1 and squamous carcinoma SCCVII cells.

    Science.gov (United States)

    Marasovic, Maja; Ivankovic, Sinisa; Stojkovic, Ranko; Djermic, Damir; Galic, Borivoj; Milos, Mladen

    2017-12-01

    The cytotoxic activity of phenylboroxine acid was evaluated in vitro on mouse mammary adenocarcinoma 4T1, mouse squamous cell carcinoma SCCVII, hamster lung fibroblast V79 and mouse dermal fibroblasts L929 cell lines. The cytotoxic effects were dose dependent for all tested tumour and non-tumour cell lines. Under in vivo conditions, three application routes of phenylboronic acid were studied: intra-peritoneal (i.p.), intra-tumour (i.t.) and per-oral. After tumour transplantation in syngeneic mice, phenylboronic acid was shown to slow the growth of both tumour cell lines (4T1 and SCCVII) compared with the control. The inhibitory effects were pronounced during the application of phenylboronic acid. For both tested tumour cell lines, the most prominent antitumour effect was obtained by intraperitoneal administration, followed significantly by oral administration.

  4. Deregulation of the CEACAM expression pattern causes undifferentiated cell growth in human lung adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Bernhard B Singer

    Full Text Available CEACAM1, CEA/CEACAM5, and CEACAM6 are cell adhesion molecules (CAMs of the carcinoembryonic antigen (CEA family that have been shown to be deregulated in lung cancer and in up to 50% of all human cancers. However, little is known about the functional impact of these molecules on undifferentiated cell growth and tumor progression. Here we demonstrate that cell surface expression of CEACAM1 on confluent A549 human lung adenocarcinoma cells plays a critical role in differentiated, contact-inhibited cell growth. Interestingly, CEACAM1-L, but not CEACAM1-S, negatively regulates proliferation via its ITIM domain, while in proliferating cells no CEACAM expression is detectable. Furthermore, we show for the first time that CEACAM6 acts as an inducer of cellular proliferation in A549 cells, likely by interfering with the contact-inhibiting signal triggered by CEACAM1-4L, leading to undifferentiated anchorage-independent cell growth. We also found that A549 cells expressed significant amounts of non-membrane anchored variants of CEACAM5 and CEACAM6, representing a putative source for the increased CEACAM5/6 serum levels frequently found in lung cancer patients. Taken together, our data suggest that post-confluent contact inhibition is established and maintained by CEACAM1-4L, but disturbances of CEACAM1 signalling by CEACAM1-4S and other CEACAMs lead to undifferentiated cell growth and malignant transformation.

  5. Cell cycle arrest by the isoprenoids perillyl alcohol, geraniol, and farnesol is mediated by p21(Cip1) and p27(Kip1) in human pancreatic adenocarcinoma cells.

    Science.gov (United States)

    Wiseman, Dean A; Werner, Sean R; Crowell, Pamela L

    2007-03-01

    Pancreatic cancer, the fourth leading cause of cancer-associated mortality in the United States, usually presents in an advanced stage and is generally refractory to chemotherapy. As such, there is a great need for novel therapies for this disease. The naturally derived isoprenoids perillyl alcohol, farnesol, and geraniol have chemotherapeutic potential in pancreatic and other tumor types. However, their mechanisms of action in these systems are not completely defined. In this study, we investigated isoprenoid effects on the cell cycle and observed a similar antiproliferative mechanism of action among the three compounds. First, when given in combination, the isoprenoids exhibited an additive antiproliferative effect against MIA PaCa-2 human pancreatic cancer cells. Furthermore, all three compounds induced a G(0)/G(1) cell cycle arrest that coincided with an increase in the expression of the cyclin kinase inhibitor proteins p21(Cip1) and p27(Kip1) and a reduction in cyclin A, cyclin B1, and cyclin-dependent kinase (Cdk) 2 protein levels. Immunoprecipitation studies demonstrated increased association of both p21(Cip1) and p27(Kip1) with Cdk2 as well as diminished Cdk2 kinase activity after isoprenoid exposure, indicating a cell cycle-inhibitory role for p21(Cip1) and p27(Kip1) in pancreatic adenocarcinoma cells. When siRNA was used to inhibit expression of p21(Cip1) and p27(Kip1) proteins in MIA PaCa-2 cells, conditional resistance to all three isoprenoid compounds was evident. Given similar findings in this cell line and in BxPC-3 human pancreatic adenocarcinoma cells, we conclude that the chemotherapeutic isoprenoid compounds perillyl alcohol, farnesol, and geraniol invoke a p21(Cip1)- and p27(Kip1)-dependent antiproliferative mechanism in human pancreatic adenocarcinoma cells.

  6. Mechanism study of low-energy laser irradiation-induced lung adenocarcinoma cell proliferation by FRET in living cell

    Science.gov (United States)

    Wang, Fang; Chen, Xiao-Chuan; Xing, Da

    2004-07-01

    Low-energy laser irradiation (LELI) has been shown to promote cell proliferation in various cell types, yet the mechanism of which has not been fully clarified. The Ras/Raf/MEK (mitogen-activated protein kinase)ERK kinase)/ERK (extracellular-signal-regulated kinase) signaling pathway is a network that govern proliferation, differentiation and cell survival. Recent studies suggested that Ras/Raf/MEK/ERK pathway is involved in the LELI-induced cell proliferation. Here, we utilized fluorescence resonance energy transfer (FRET) technique to investigate the effect of LELI on Ras/Raf signaling pathway in living cells. Raichu-Ras reporter plasmid was utilized which consisted of fusions of H-ras, the Ras-binding domain of Raf(RafRBD), a cyan fluorescent protein (CFP) and a yellow fluorescent protein (YFP), so that intramolecular binding of GTP-Ras to RafRBD brings CFP close to YFP and increases FRET between CFP and YFP. Human lung adenocarcinoma cell line (ASTC-a-1) were transfected with the plasmid (pRaichu-Ras) and then were treated by LELI. The living cell imaging showed the increase of FRET at different time points after LELI at the dose of 1.8 J/cm2, which corresponds to the Ras/Raf activation assayed by Western Blotting. Furthermore, this dose of LELI enhanced the proliferation of ASTC-a-1 cells. Taken together, these in vivo imaging data provide direct evidences with temporal or spatial resolution that Ras/Raf/MEK/ pathway plays an important role in LELI-promoted cell proliferation.

  7. Cryptolepine, isolated from Sida acuta, sensitizes human gastric adenocarcinoma cells to TRAIL-induced apoptosis.

    Science.gov (United States)

    Ahmed, Firoj; Toume, Kazufumi; Ohtsuki, Takashi; Rahman, Mahmudur; Sadhu, Samir Kumar; Ishibashi, Masami

    2011-01-01

    Bioassay guided separation of Sida acuta whole plants led to the isolation of an alkaloid, cryptolepine (1), along with two kaempferol glycosides (2-3). Compound 1 showed strong activity in overcoming TRAIL-resistance in human gastric adenocarcinoma (AGS) cells at 1.25, 2.5 and 5 μm. Combined treatment of 1 and TRAIL sensitized AGS cells to TRAIL-induced apoptosis at the aforementioned concentrations. Copyright © 2010 John Wiley & Sons, Ltd.

  8. Cuminaldehyde from Cinnamomum verum Induces Cell Death through Targeting Topoisomerase 1 and 2 in Human Colorectal Adenocarcinoma COLO 205 Cells

    Directory of Open Access Journals (Sweden)

    Kuen-daw Tsai

    2016-05-01

    Full Text Available Cinnamomum verum, also called true cinnamon tree, is employed to make the seasoning cinnamon. Furthermore, the plant has been used as a traditional Chinese herbal medication. We explored the anticancer effect of cuminaldehyde, an ingredient of the cortex of the plant, as well as the molecular biomarkers associated with carcinogenesis in human colorectal adenocarcinoma COLO 205 cells. The results show that cuminaldehyde suppressed growth and induced apoptosis, as proved by depletion of the mitochondrial membrane potential, activation of both caspase-3 and -9, and morphological features of apoptosis. Moreover, cuminaldehyde also led to lysosomal vacuolation with an upregulated volume of acidic compartment and cytotoxicity, together with inhibitions of both topoisomerase I and II activities. Additional study shows that the anticancer activity of cuminaldehyde was observed in the model of nude mice. Our results suggest that the anticancer activity of cuminaldehyde in vitro involved the suppression of cell proliferative markers, topoisomerase I as well as II, together with increase of pro-apoptotic molecules, associated with upregulated lysosomal vacuolation. On the other hand, in vivo, cuminaldehyde diminished the tumor burden that would have a significant clinical impact. Furthermore, similar effects were observed in other tested cell lines. In short, our data suggest that cuminaldehyde could be a drug for chemopreventive or anticancer therapy.

  9. Immunotherapy “Shock” with vitiligo due to nivolumab administration as third line therapy in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Paul Zarogoulidis

    2017-01-01

    Full Text Available Non-small cell lung cancer is still diagnosed at late stage due to the lack of early symptoms and methods of diagnostic prevention. In the past ten years several targeted therapies have been introduced or explored. Tyrosine kinase inhibitors and immunotherapy are currently considered the most effective and safe therapies in comparison to the non-specific cytotoxic agents. Regarding tyrosine kinase inhibitors the adverse effects have been fully explored, however; on the other hand for immunotherapy there are still several issues to be clarified. We report a rare case of a patient with lung cancer adenocarcinoma who developed vitiligo throughout his body after nivolumab administration.

  10. The tumor suppressor gene RBM5 inhibits lung adenocarcinoma cell growth and induces apoptosis

    Directory of Open Access Journals (Sweden)

    Shao Chen

    2012-08-01

    Full Text Available Abstract Background The loss of tumor suppressor gene (TSG function is a critical step in the pathogenesis of human lung cancer. RBM5 (RNA-binding motif protein 5, also named H37/LUCA-15 gene from chromosome 3p21.3 demonstrated tumor suppressor activity. However, the role of RBM5 played in the occurrence and development of lung cancer is still not well understood. Method Paired non-tumor and tumor tissues were obtained from 30 adenocarcinomas. The expression of RBM5 mRNA and protein was examined by RT-PCR and Western blot. A549 cell line was used to determine the apoptotic function of RBM5 in vitro. A549 cells were transiently transfected with pcDNA3.1-RBM5. AnnexinV analysis was performed by flow cytometry. Expression of Bcl-2, cleaved caspase-3, caspase-9 and PAPP proteins in A549 lung cancer cells and the A549 xenograft BALB/c nude mice model was determined by Western blot. Tumor suppressor activity of RBM5 was also examined in the A549 xenograft model treated with pcDNA3.1-RBM5 plasmid carried by attenuated Salmonella typhi Ty21a. Result The expression of RBM5 mRNA and protein was decreased significantly in adenocarcinoma tissues compared to that in the non-tumor tissues. In addition, as compared to the vector control, a significant growth inhibition of A549 lung cancer cells was observed when transfected with pcDNA3.1-RBM5 as determined by cell proliferation assay. We also found that overexpression of RBM5 induced both early and late apoptosis in A549 cells using AnnexinV/PI staining as determined by flow cytometry. Furthermore, the expression of Bcl-2 protein was decreased, whereas the expression of cleaved caspase-3, caspase-9 and PARP proteins was significantly increased in the RBM5 transfected cells; similarly, expression of decreased Bcl-2 and increased cleaved caspase-3 proteins was also examined in the A549 xenograft model. More importantly, we showed that accumulative and stable overexpression of RBM5 in the A549 xenograft BALB

  11. miR-297 acts as an oncogene by targeting GPC5 in lung adenocarcinoma.

    Science.gov (United States)

    Sun, Yunchuan; Zhao, Jianyong; Yin, Xiaoming; Yuan, Xiangkun; Guo, Jianfei; Bi, Jianqiang

    2016-10-01

    Emerging studies have demonstrated that microRNAs (miRNAs) play crucial roles in carcinogenesis of many developing human tumours. However, the functions and mechanisms of miR-297 in lung cancer have, up to now, been largely undefined. Here, miR-297 expression was measured in lung adenocarcinoma tissues and cell lines, using qRT-PCR. Lung adenocarcinoma cell line was treated with an miR-297 mimic. MTT and colony analysis were performed to detect cell proliferation and colony formation. The direct target gene of miR-297 was assessed by qRT-PCR, Western blotting and luciferase assays. We demonstrated that miR-297 expression was upregulated in lung adenocarcinomas compared to adjacent normal tissues. Expression of miR-297 was also upregulated in tested lung adenocarcinoma cell lines. Ectopic expression of miR-297 enhanced lung adenocarcinoma cell proliferation and colony formation. Furthermore, overexpression of miR-297 promoted cell migration and invasion. In addition, we identified Glypican-5 (GPC5) as a direct target gene of miR-297 in lung adenocarcinoma cells. Expression of GPC5 was downregulated in both lung adenocarcinoma tissues and cell lines. Moreover, expression of GPC5 was inversely associated with expression of miR-297 in lung adenocarcinoma tissues. These results suggest that miR-297 acted as an oncogenic miRNA, partly by targeting GPC5, adenocarcinoma of the lung. © 2016 John Wiley & Sons Ltd.

  12. Clear Cell Adenocarcinoma of the Colon: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Christian Daniel Barrera-Maldonado

    2014-01-01

    Full Text Available Clear cell adenocarcinoma of the colon has been described scarcely in the literature. It affects elderly men more commonly than women and usually appears in the left side of the colon. A Hispanic 41-year-old female came to the emergency room with abdominal pain, vomiting, and distension. Physical exam revealed generalized tenderness without peritoneal signs. Laboratory data was unremarkable. A CT scan showed an apple-core lesion in the distal colon. A flexible sigmoidoscopy revealed an obstructive mass that made further evaluation impossible. Exploratory surgery revealed a hard mass obstructing the descending colon, which was resected. Histopathology analysis with immunohistochemistry staining was positive for cytokeratin 20, cytokeratin 10, CDX2, and villin, while it was negative for cytokeratin 7, RCC, vimentin, and CD31. These results confirmed the clear cell variant of the adenocarcinoma. Clear cell adenocarcinomas usually arise from the kidneys and Müllerian organs. Immunohistochemistry is crucial for establishing the origin of these neoplastic cells. A cytokeratin 20+/7− with positive CDX2 is highly specific and sensitive for intestinal neoplastic origin. The main treatment has been surgery alone with moderately good results. More research and information about this malignancy is needed, especially in regard to prognosis and in order to provide the best treatment option.

  13. Multisystem Langerhans cell histiocytosis coexisting with metastasizing adenocarcinoma of the lung: A case report

    Directory of Open Access Journals (Sweden)

    Lovrenski Aleksandra

    2013-01-01

    Full Text Available Introduction. Langerhans cell histiocytosis (LCH is an uncommon disease of unknown etiology characterized by uncontrolled proliferation and infiltration of various organs by Langerhans cells. Case report. We presented a 54-year-old man, heavy smoker, with dyspnea, cough, hemoptysis, headache and ataxia, who died shortly after admission to our hospital. On the autopsy, tumor was found in the posterior segment of the right upper pulmonary lobe as well as a right-sided occipitoparietal lesion which penetrated into the right ventricle resulting in internal and external hematocephalus. Histologically and immunohistohemically, the diagnosis of primary lung adenocarcinoma with brain metastasis was made (tumor cells showed positivity for CK7 and TTF-1 which confirmed the diagnosis. In the lung parenchyma around the tumor, as well as in brain tissue around the metastatic adenocarcinoma histiocytic lesions were found. Light microscopic examination of the other organs also showed histiocytic lesions involving the pituitary gland, hypothalamus, spleen and mediastinal lymph nodes. Immunohistochemical studies revealed CD68, S-100 and CD1a immunoreactivity within the histiocytes upon which the diagnosis of Langerhans' cells histiocytosis was made. Conclusion. The multisystem form of LCH with extensive organ involvement was an incidental finding, while metastatic lung adenocarcinoma to the brain that led to hematocephalus was the cause of death.

  14. Primary Clear Cell Adenocarcinoma of a Urethral Diverticulum Treated with Multidisciplinary Robotic Anterior Pelvic Exenteration

    Directory of Open Access Journals (Sweden)

    Dane Scantling

    2013-01-01

    Full Text Available Primary urethral carcinoma is extremely rare and is marked by a variety of clinical symptoms. Primary carcinoma of a urethral diverticulum is still rarer and clear cell adenocarcinoma of the urethra is particularly uncommon (Swartz et al., 2006. Such infrequency has led to inadequate management guidance in the literature for a disease that is often late in presentation and carries substantial morbidity and mortality. This treatable but grave disease deserves definitive curative treatment. We present the first published instance in which it was treated with robotic anterior exenteration. In our case, a 47-year-old female was referred to the urology service for investigation of recurring urinary tract infections. During the workup, the patient was found to have an advanced clear cell urethral adenocarcinoma originating in a urethral diverticulum. We discuss the natural history of this condition, its consequences, and the first instance of its treatment using robotic anterior pelvic exenteration.

  15. Demographic, Clinical, and Prognostic Factors of Ovarian Clear Cell Adenocarcinomas According to Endometriosis Status

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard

    2017-01-01

    to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher......OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...

  16. A clear cell adenocarcinoma of the gallbladder with hepatoid differentiation: case report and review of literature

    Directory of Open Access Journals (Sweden)

    Zhang C

    2016-09-01

    Full Text Available Chengsheng Zhang,1,2 Wei Zhang,1,2 Dianbin Mu,1 Xuetao Shi,1 Lei Zhao1,2 1Department of Hepatobiliary Surgery, Shandong Cancer Hospital affiliated to Shandong University, Shandong Academy of Medical Science, 2School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong Province, People’s Republic of China Abstract: An 80-year-old male was referred to our department for a gallbladder mass. He denied any history of alcohol consumption or cholecystitis and smoking. Hepatitis B surface antigen test and antihepatitis C antibody test were found to be negative. Serum carbohydrate antigen 19-9 (CA19-9 and carcinoembryonic antigen were elevated (CA19-9 was 59.92 U/mL and carcinoembryonic antigen was 12.64 ng/mL, whereas alpha-fetoprotein was below the normal limit (2.46 ng/mL. Computed tomography scan revealed a solid mass with measurements of 4.6×5.6×7.1 cm, which nearly filled the whole gallbladder space. Radical cholecystectomy, including segments IV B and V of the liver and lymphadenectomy, was performed. The neoplasm in gallbladder was completely resected, and the patient obtained a negative margin. Histological and immunohistochemical profile suggested a clear cell adenocarcinoma of the gallbladder with hepatoid differentiation. After reviewing the literature, we reported that this case is the first identified case of cell adenocarcinoma of the gallbladder with extensive hepatoid differentiation. However, clinical features of clear cell adenocarcinoma with hepatoid differentiation remain unclear due to the extremely rare incidence. There was no indication of adjuvant chemotherapy and no literature has been reported on the application of chemotherapy. This case showed a promising clinical outcome after curative resection, which indicated that surgical treatment could be potentially considered for suitable patients. Keywords: gallbladder, clear cell adenocarcinoma, hepatoid differentiation 

  17. Anal metastasis of rectal cancer-adenocarcinoma of squamous cells: a case report and literature review.

    Science.gov (United States)

    Sasaki, Shun; Sugiyama, Masahiko; Nakaji, Yu; Nakanishi, Ryota; Nakashima, Yuichiro; Saeki, Hiroshi; Oki, Eiji; Oda, Yoshinao; Maehara, Yoshihiko

    2017-12-01

    Anal metastasis of colorectal cancer is very rare and is usually associated with a history of anal disease, including anal fistula, fissure, hemorrhoidectomy, and anastomotic injury. We report a case of rectal cancer with a synchronous anal metastasis consisting of adenocarcinoma of squamous cells without a history of anal disease. A 60-year-old woman had a chief complaint of melena. She had a 1.5-cm anal tumor on the perianal skin, and a Bollman type 2 rectal tumor on the Ra portion was found on colonoscopy. Biopsy of both tumors revealed a similar histology of well- to moderately differentiated adenocarcinoma. There was no sign of metastases in lymph nodes or other organs. For the purpose of diagnosis and treatment, transperineal local resection of the anal tumor was performed, and it was histologically identified as adenocarcinoma of squamous cells with no invasion to muscles, lymph ducts, or microvessels. The pathological margin was free. Then, to achieve radical cure, laparoscopic low anterior resection (LAR) with D3 lymphadenectomy was performed. The histological diagnosis of the anal tumor was adenocarcinoma of squamous cells without invasion to muscles, lymph ducts, or vessels. The surgical margin was completely free. Immunohistochemical analysis of both tumors revealed similar staining patterns, and the final diagnosis was rectal cancer with metastasis to the anal skin. The patient received no postoperative therapy, and no recurrences have been observed 12 months after surgery. We expect that our sphincter-preserving surgical strategy provided a good prognosis for the synchronous rectal cancer and anal metastasis. This is a rare report of a case with an anal metastasis of colorectal cancer on perianal squamous cells without a history of anal disease that was resected while preserving anal function.

  18. Undifferentiated pulmonary adenocarcinoma of clear cells associated to hypertrophic osteopathy in a dog

    OpenAIRE

    Rossetto, Victor José Vieira [UNESP; Rahal, Sheila Canevese [UNESP; Pardini, Luciana Moura Campos [UNESP; Fabris, Viciany Erique [UNESP; Mamprim, Maria Jaqueline [UNESP; Ribeiro, Sergio Marrone [UNESP

    2015-01-01

    Background: Most of the primary pulmonary tumors in dogs are malignant and from epithelial origin, being bronchioalveolar tumors more prevalent. Adenocarcinoma of clear cells, however, is a very rare pulmonary tumor and its origin is still unknown. It is related to several clinical abnormalities, including hypertrophic osteopathy, an unusual paraneoplastic syndrome characterized by a periosteal reaction along the shaft of long bones. Because of the unusual presentation of the pulmonary adenoc...

  19. Molecular Analysis of Motility in Metastatic Mammary Adenocarcinoma Cells

    Science.gov (United States)

    1996-09-01

    elements of epidermoid carcinoma (A43 1) cells. J. Cell. Biol. 103: 87-94 Winkler, M. (1988). Translational regulation in sea urchin eggs: a complex...response range of changes in cell motility and morphology after stimulation with EGF using time-lapse video microscopy. This determines the appropriate...importance in mediating changes in cell motility or morphology after stimulation, and identify or acquire clones for the rat gene for the most important proten

  20. Use of gemcitabine as a second-line treatment following chemotherapy with folfirinox for metastatic pancreatic adenocarcinoma.

    Science.gov (United States)

    Sarabi, Matthieu; Mais, Laetitia; Oussaid, Nadia; Desseigne, Françoise; Guibert, Pierre; De La Fouchardiere, Christelle

    2017-06-01

    There is a lack of prospective data about second-line treatments for metastatic pancreatic ductal adenocarcinoma patients. This is partially due to recent changes in first-line chemotherapy treatments. Despite this dearth of information, 50.0% of the patients who experience failure with first-line folinic acid, 5-fluorouracil, irinotecan and oxaliplatin (folfirinox) treatment are eligible for additional chemotherapy. In this setting, gemcitabine is widely used without any standard recommendations available. The present study evaluated 42 patients who received gemcitabine subsequent to a first-line treatment of folfirinox between January 2008 and December 2012 at the Centre Léon Bérard (Lyon, France). Clinical data, biological data and tumor characteristics were retrospectively analyzed to identify prognostic factors for successful treatment with gemcitabine. In total, 11 patients (26.2%) experienced control of their cancer with gemcitabine treatment. However, there was no predictive marker for their response to the drug. The median overall survival was 3.6 months from gemcitabine initiation [95% confidence interval (CI), 2.1-5.1]. The median length of gemcitabine treatment was 1.5 months (95% CI, 0.3-13.3). Among the 11 patients who were successfully treated with gemcitabine, 6 were resistant to first-line folfirinox treatment. Patients who were non responsive to folfirinox had a higher probability of success with gemcitabine compared with patients that responded to folfirinox (54.5 vs. 21.4%, respectively; P=0.061). The present study did not identify any clinical or biological marker with a predictive value for successful gemcitabine treatment. Furthermore, successful gemcitabine treatment was not correlated with patients' response to first-line folfirinox treatment. This suggests an absence of cross-resistance in the chemotherapy protocols and provides evidence for effective cancer treatment with the second-line gemcitabine therapy.

  1. Characterization of a human ovarian carcinoma cell line: UCI 101.

    Science.gov (United States)

    Fuchtner, C; Emma, D A; Manetta, A; Gamboa, G; Bernstein, R; Liao, S Y

    1993-02-01

    A new epithelial ovarian carcinoma cell line (UCI 101) has been established from the ascitic fluids and solid tumor of a patient with progressive papillary adenocarcinoma of the ovary shown previously to be refractory to combination chemotherapy consisting of cyclophosphamide, Adriamycin, and cisplatin as well as single-agent chemotherapy of taxol and high-dose cisplatin. The UCI 101 cell line grows well with an in vitro doubling time of 24 hr. The cell line expresses the B 72.3 (Tag 72), CA125, MH99 (ESA), and E29 (EMA) cell surface antigens and AE1/AE3 cytokeratins. This cell line overexpresses (as determined by immunocytochemistry) both p-glycoprotein and the epidermal growth factor receptor. The in vitro drug response to single agents including Adriamycin, cisplatin, dequalinium chloride, etoposide, 5-fluorouracil, taxol, and tumor necrosis factor was examined. Intraperitoneal transplantation of the cells into athymic mice resulted in foci of tumor on all peritoneal surfaces including the viscera and diaphragm ultimately leading to solid bulky disease with massive production of ascites. High levels of CA125 (> 500 units/ml) were detected in the serum of tumor-bearing mice. Cytogenetic analysis of cultured cells shows several marker chromosomes containing deletions, duplications, and translocations. Cytologic and histologic evaluation of the xenograft revealed morphological characteristics identical to those of the original tumor.

  2. Antitumor activity of a Trans-thiosemicarbazone schiff base palladium (II) complex on human gastric adenocarcinoma cells.

    Science.gov (United States)

    Zhang, Bingchang; Luo, Haiqing; Xu, Qinjuan; Lin, Lirong; Zhang, Bing

    2017-02-21

    The development of transition-metal-based antitumor drug candidates increases the metallopharmaceuticals study dramatically. Two trans-thiosemicarbazone-based, Schiff base palladium (Pd) (II) complexes, DMABTSPd (TSPd) and DMABPTSPd (PTSPd), were prepared and characterized as described in our previous study. Here, we investigated whether the two complexes have antitumor effect on human gastric adenocarcinoma cell lines, BGC-823 and SGC-7901, compared with normal human gastric mucosal epithelial cell line, Ges-1. The results show that the Pd complex with the bare amino group (DMABTSPd(TSPd)) can inhibit cell viabilities and induce apoptosis in human gastric carcinoma cells, rather than the Pd complex without the bare amino group (DMABPTSPd (PTSPd)). This occurs via a mitochondrial-related pathway by down-regulating the level of Bcl-2 expression and up-regulating the level of Bid expression. Meanwhile, DMABTSPd (TSPd) suppressed tumor growth via a mitochondrial-related pathway in a nude mouse tumor xenograft model derived from BGC-823 cells. These findings demonstrate that DMABTSPd (TSPd) is worthy of further structural optimization and representing a promising Pd complex for the development of a new antitumor therapeutic agent.

  3. Intratumoral Immune Cell Densities Are Associated with Lung Adenocarcinoma Gene Alterations.

    Science.gov (United States)

    Mansuet-Lupo, Audrey; Alifano, Marco; Pécuchet, Nicolas; Biton, Jérôme; Becht, Etienne; Goc, Jeremy; Germain, Claire; Ouakrim, Hanane; Régnard, Jean-François; Cremer, Isabelle; Laurent-Puig, Pierre; Dieu-Nosjean, Marie-Caroline; Blons, Hélène; Damotte, Diane

    2016-12-01

    Tumor-infiltrating immune cells affect lung cancer outcome. However, the factors that influence the composition and function of the tumor immune environment remain poorly defined and need investigation, particularly in the era of immunotherapy. To determine whether the tumoral immune environment is related to lung adenocarcinoma mutations. This retrospective cohort included 316 consecutive patients with lung adenocarcinoma (225 men; 258 smokers) studied from 2001 to 2005 in a single center. We investigated the association of densities of intratumoral mature dendritic cells (mDCs), CD8(+) T cells, neutrophils, and macrophages with clinical and pathological variables and tumor cell mutation profiles obtained by next-generation sequencing. In 282 tumors, we found 460 mutations, mainly in TP53 (59%), KRAS (40%), STK11 (24%), and EGFR (14%). Intratumoral CD8(+) T-cell density was high in smokers (P = 0.02) and TP53-mutated tumors (P = 0.02) and low in BRAF-mutated tumors (P = 0.005). Intratumoral mDC density was high with low pathological tumor stage (P = 0.01) and low with STK11 mutation (P = 0.004). Intratumoral neutrophil density was high and low with BRAF mutation (P = 0.04) and EGFR mutation (P = 0.02), respectively. Intratumoral macrophage density was low with EGFR mutation (P = 0.01). Intratumoral CD8(+) T-cell and mDC densities remained strong independent markers of overall survival (P = 0.001 and P = 0.02, respectively). Intratumoral immune cell densities (mDCs, CD8(+) T cells, neutrophils, macrophages) were significantly associated with molecular alterations in adenocarcinoma underlying the interactions between cancer cells and their microenvironment.

  4. Topotecan-induced alterations in the amount and stability of human DNA topoisomerase I in solid tumor cell lines.

    Science.gov (United States)

    Devy, Jérome; Wargnier, Richard; Pluot, Michel; Nabiev, Igor; Sukhanova, Alyona

    2004-01-01

    Human DNA topoisomerase I (topo 1) is an essential nuclear enzyme involved in vital cellular processes and the sole target of antitumor drugs of the camptothecin (CPT) family. The CPT derivative topotecan (Tpt, Hycamtin) is currently used in clinic, its effectiveness varying considerably for different types of cancer. The purpose of this study was to compare time- and dose-dependent cellular responses to Tpt in terms of alterations in the amount and stability of topo 1 in lung adenocarcinoma (A-549), ovarian adenocarcinoma (CaOv-3), colorectal adenocarcinoma (HT-29) and breast adenocarcinoma (MCF-7) cell lines. Western blot analysis of the time-dependent redistribution of a full-size topo 1 and its proteolytical fragments was performed after Tpt treatment for 1 h at concentrations 10-fold or 100-fold higher than the Tpt IC50 for the respective cell lines. Tpt treatment of the CaOv-3 cell line produced a substantial time-dependent decrease in the amount of topo 1 immunoprotein. Conversely, the MCF7 cell line did not exhibit a topo 1-associated response to the Tpt treatment. Strong but different time- and dose-dependent topo 1 down-regulation effects were observed in the HT-29 and A-549 cell lines. The data obtained indicate that Tpt-induced time- and dose-dependent effects on the amount and stability of topo 1 are involved in the mechanisms of Tpt activity against different solid tumor cell lines.

  5. Phosphonium Salt Displays Cytotoxic Effects Against Human Cancer Cell Lines.

    Science.gov (United States)

    Dhanya, Dhanyalayam; Palma, Giuseppe; Cappello, AnnaRita; Mariconda, Annaluisa; Sinicropi, Maria Stefania; Giordano, Francesca; Vecchio, Vitale Del; Ramunno, Anna; Arra, Claudio; Longo, Pasquale; Saturnino, Carmela

    2017-07-19

    Aims/ Objective: Phosphonium salts are compounds whose structural characteristics enable them to cross the plasma and mitochondrial membrane with ease. Cancer cells have higher plasma membrane potentials than normal cells, phosphonium salts selectively accumulate in the mitochondria of neoplastic cells and inhibit mitochondrial function. In the presente work, we investigate the cytotoxic activity of lipophilic phosphonium salt (11-methoxy11-oxo-undecyl) triphenylphosphonium bromide (MUTP) as well as of two new phosphine oxide salts, 3,3'-(methylphosphoryl) dibenzenaminium chloride (SBAMPO) and 3,3' (phenylphosphoryl) dibenzenaminium chloride (SBAPPO) on the proliferation of breast cancer cell line (MCF-7) and human uterin cervix adenocarcinoma cells (HeLa). We show that only MUTP exhibits antiproliferative effects on both cell lines, without affecting normal breast epithelial cell proliferation. More specifically, we demonstrate that MUTP treatment of breast cancer cells is associated with impaired cell-cycle progression and metabolically induces mitochondrial damage and triggers apoptotic cell death in MCF-7 and HeLa cells. Taken together, these findings suggest that MUTP may be capable of selectively targeting neoplastic cell growth and therefore has potential applications as anticancer agent. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Cyclopedic protein expression analysis of cultured canine mammary gland adenocarcinoma cells from six tumours.

    Science.gov (United States)

    Nakagawa, T; Watanabe, M; Ohashi, E; Uyama, R; Takauji, S; Mochizuki, M; Nishimura, R; Ogawa, H; Sugano, S; Sasaki, N

    2006-06-01

    We characterised cultured canine mammary gland adenocarcinoma cells by exhaustive step protein expression analysis to identify factors associated with tumour progression or metastasis of canine mammary gland tumour. Cultured adenocarcinoma cells derived from a total of 3 primary and 3 metastatic lesions from 3 dogs (CHMp/m, CIPp/m and CNMp/m, where CHM, CIP, and CNM indicate the 3 animals) were used in this study. The expression of 24 proteins reported to be related to tumourigenesis or malignancy of human breast cancers were examined by Western blot analysis using 24 antibodies. The expression of sialyl Lewis X [sLe(x)] was only observed in CHMm cells, which were derived from pleural effusion. This expression was further confirmed by immunohistochemistry. The levels of some factors, such as 14-3-3sigma, cyclinD1 and Rb, differed among cells or between the primary and metastatic cells in the pair. Though the difference in their expression was not consistent within the cells from primary and metastatic origin, this characterisation should provide useful information for further molecular analysis of these cultured cells. Since some of the factors, such as sLe(x), 14-3-3sigma, cyclinD1 and Rb, showed different levels of expression in the pair, these cultured cells might be meaningful tools for clarification of distant metastasis in canine mammary gland tumours.

  7. Aptamer based electrochemical sensor for detection of human lung adenocarcinoma A549 cells

    Science.gov (United States)

    Sharma, Rachna; Varun Agrawal, Ved; Sharma, Pradeep; Varshney, R.; Sinha, R. K.; Malhotra, B. D.

    2012-04-01

    We report results of the studies relating to development of an aptamer-based electrochemical biosensor for detection of human lung adenocarcinoma A549 cells. The aminated 85-mer DNA aptamer probe specific for the A549 cells has been covalently immobilized onto silane self assembled monolayer (SAM) onto ITO surface using glutaraldehyde as the crosslinker. The results of cyclic voltammetry and differential pulse voltammetry studies reveal that the aptamer functionalized bioelectrode can specifically detect lung cancer cells in the concentration range of 103 to 107 cells/ml with detection limit of 103 cells/ml within 60 s. The specificity studies of the bioelectrode have been carried out with control KB cells. No significant change in response is observed for control KB cells as compared to that of the A549 target cells.

  8. Antioxidant potential of buffalo and cow milk Cheddar cheeses to tackle human colon adenocarcinoma (Caco-2 cells

    Directory of Open Access Journals (Sweden)

    Nuzhat Huma

    2018-02-01

    Full Text Available Objective The aim of present study was to assess the anti-oxidant potential of water-soluble peptides (WSPs extract derived from buffalo and cow milk Cheddar cheeses at different stages of ripening. Methods The antioxidant potential of WSPs extract was assessed through 2,2’-azinobis-3-ethylbenzothiazoline-6sulfonic acid (ABTS-radical scavenging activity. In addition, impact of WSPs extract on cell viability and production of reactive oxygen species (ROS in human colon adenocarcinoma Caco-2 (tert-butylhydroperoxide-induced cell lines was also evaluated. Results The ABTS-radical scavenging activity increased progressively with ripening period and dose-dependently in both cheeses. However, peptide extract from buffalo milk Cheddar cheese demonstrated relatively higher activity due to higher contents of water-soluble nitrogen. Intracellular ROS production in Caco-2 cells decreased significantly (p<0.05 till 150th day of cheese ripening and remained constant thereafter. Additionally, dose-dependent response of WSPs extract on antioxidant activity was noticed in the Caco-2 cell line. Conclusion On the basis of current in vitro study, the Cheddar cheese WSPs extract can protect intestinal epithelium against oxidative stress due to their antioxidant activity.

  9. Uptake and cytotoxicity of poly(D,L-lactide-co-glycolide) nanoparticles in human colon adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Katsikari, A. [Laboratory of General Microbiology, Department of Genetics, Development and Molecular Biology, School of Biology, Faculty of Sciences and Mathematics, Aristotle University of Thessaloniki, Thessaloniki 54124 (Greece); Patronidou, Chr.; Kiparissides, C. [Section of Analysis, Design and Control of Chemical Processes and Plants, Department of Chemical Engineering, Aristotle University of Thessaloniki, Thessaloniki 54124 (Greece); Arsenakis, M., E-mail: arsenaki@bio.auth.g [Laboratory of General Microbiology, Department of Genetics, Development and Molecular Biology, School of Biology, Faculty of Sciences and Mathematics, Aristotle University of Thessaloniki, Thessaloniki 54124 (Greece)

    2009-12-15

    The main objectives of the present study were to evaluate the cytotoxicity and the mechanisms of uptake of biodegradable lactic acid-glycolic acid copolymer (PLGA) nanoparticle carrier systems in vitro using the human colon adenocarcinoma cell line Caco2. Nanoparticles (NPs) (PLGA 75:25) with an average diameter of 299.5 nm containing bovine serum albumin labeled with fluorescein isothiocyanate (BSA-FITC) as a fluorescent model protein marker were formulated by the double emulsion technique. Various parameters influencing the internalization process by Caco2 cells including concentration of NPs, duration of contact time and cell culture conditions were studied. After overnight exposure of NPs to cells at 37 deg. C, the cell uptake capacity varied in accord with NP concentration, over the 25-800 mug/ml concentration range tested. Maximal uptake of nanoparticles at 37 deg. C occurred at 4 h and was inhibited significantly at 4 deg. C. The extent of NPs internalization was evaluated by confocal laser scanning microscopy. Potential NP toxicity evaluated by modified MTS and lactate dehydrogenase (LDH) colorimetric cytotoxicity tests, measuring mitochondrial activity and membrane integrity respectively, showed that cell viability is significantly reduced at PLGA nanoparticle concentrations greater than 700 mug/ml after 24 and 48 h respectively. The results obtained in vitro for BSA-FITC loaded PLGA nanoparticles underline their potential as carriers for peptide delivery and their utility for the study of NP cell transport and trafficking mechanisms.

  10. Mixed Large Cell Neuroendocrine Carcinoma and Adenocarcinoma with Spindle Cell and Clear Cell Features in the Extrahepatic Bile Duct

    Directory of Open Access Journals (Sweden)

    John Wysocki

    2014-01-01

    Full Text Available Mixed adenoneuroendocrine carcinomas, spindle cell carcinomas, and clear cell carcinomas are all rare tumors in the biliary tract. We present the first case, to our knowledge, of an extrahepatic bile duct carcinoma composed of all three types. A 65-year-old man with prior cholecystectomy presented with painless jaundice, vomiting, and weight loss. CA19-9 and alpha-fetoprotein (AFP were elevated. Cholangioscopy revealed a friable mass extending from the middle of the common bile duct to the common hepatic duct. A bile duct excision was performed. Gross examination revealed a 3.6 cm intraluminal polypoid tumor. Microscopically, the tumor had foci of conventional adenocarcinoma (CK7-positive and CA19-9-postive surrounded by malignant-appearing spindle cells that were positive for cytokeratins and vimentin. Additionally, there were separate areas of large cell neuroendocrine carcinoma (LCNEC. Foci of clear cell carcinoma merged into both the LCNEC and the adenocarcinoma. Tumor invaded through the bile duct wall with extensive perineural and vascular invasion. Circumferential margins were positive. The patient’s poor performance status precluded adjuvant therapy and he died with recurrent and metastatic disease 5 months after surgery. This is consistent with the reported poor survival rates of biliary mixed adenoneuroendocrine carcinomas.

  11. Correlation between Serum Tumor Markers and Efficacy of First-line EGFR-TKIs in Patients with Advanced Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Hanxiao CHEN

    2017-09-01

    Full Text Available Background and objective Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs significantly improve the survival of advanced lung adenocarcinoma patients harboring EGFR mutation. Limited to the standards of tumor tissue samples and detection methods, still some people can’t receive target therapy following genetic guidance. This study was to explore the relevance between serum tumor markers and treatment of EGFR-TKIs. Methods We retrospectively collected the clinical information of advanced lung adenocarcinoma patients harboring EGFR mutation, who received EGFR-TKIs as first-line therapy from June 2009 to June 2014 in Peking University Cancer Hospital, analyzed the relationship between serum tumor markers and efficacy of EGFR-TKIs. Results The objective response rate (ORR was 52.8% and the disease control rate (DCR was 89.3%. The results showed that, patients with high CEA level before treatment responded better to TKIs (ORR 61.3% vs 35.9%, DCR 95.2% vs 74.4%, P<0.001. Similar phenomena was found in patients with CEA decreased 1 month later (61.5% vs 25%, P=0.002. Progression-free survival (PFS significantly prolonged in patients with elevated baseline CEA (mPFS 9.8 mo vs 5.9 mo, P=0.027. To the opposite, PFS was significantly shorter in patients with elevated baseline CYFRA21-1 and CA125 (mPFS 9.0 mo vs 11.4 mo, P=0.029; 9.0 mo vs 11.5 mo, P=0.023, respectively. Multivariate analysis showed that Eastern Cooperative Oncology Group (ECOG score of 0-1, normal baseline CYFRA21-1 and CEA decline predicted longer PFS. The overall survival (OS was highly associated with elevated CYFRA21-1 and CA125 (median OS 25.1 mo vs 52.5 mo, P=0.003; 22.7 mo vs 55.0 mo, P<0.001, respectively, while independent of CEA. Conclusion High level of baseline CEA and decline 1 month after treatment could predict the efficacy of EGFR-TKIs in patients with advanced lung adenocarcinoma. While high levels of baseline CYFRA21-1 and CA125 indicated shortened

  12. Antiproliferative Evaluation of Isofuranodiene on Breast and Prostate Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Michela Buccioni

    2014-01-01

    Full Text Available The anticancer activity of isofuranodiene, extracted from Smyrnium olusatrum, was evaluated in human breast adenocarcinomas MDA-MB 231 and BT 474, and Caucasian prostate adenocarcinoma PC 3 cell lines by MTS assay. MTS assay showed a dose-dependent growth inhibition in the tumor cell lines after isofuranodiene treatment. The best antiproliferative activity of the isofuranodiene was found on PC 3 cells with an IC50 value of 29 μM, which was slightly less than the inhibition against the two breast adenocarcinoma cell lines with IC50 values of 59 and 55 μM on MDA-MB 231 and BT 474, respectively. Hoechst 33258 assay was performed in order to study the growth inhibition mechanism in prostate cancer cell line; the results indicate that isofuranodiene induces apoptosis. Overall, the understudy compound has a good anticancer activity especially towards the PC 3. On the contrary, it is less active on Chinese hamster ovary cells (CHO and human embryonic kidney (HEK 293 appearing as a good candidate as a potential natural anticancer drug with low side effects.

  13. Discovery of HeLa Cell Contamination in HES Cells: Call for Cell Line Authentication in Reproductive Biology Research.

    Science.gov (United States)

    Kniss, Douglas A; Summerfield, Taryn L

    2014-08-01

    Continuous cell lines are used frequently in reproductive biology research to study problems in early pregnancy events and parturition. It has been recognized for 50 years that many mammalian cell lines contain inter- or intraspecies contaminations with other cells. However, most investigators do not routinely test their culture systems for cross-contamination. The most frequent contributor to cross-contamination of cell lines is the HeLa cell isolated from an aggressive cervical adenocarcinoma. We report on the discovery of HeLa cell contamination of the human endometrial epithelial cell line HES isolated in our laboratory. Short tandem repeat analysis of 9 unique genetic loci demonstrated molecular identity between HES and HeLa cells. In addition, we verified that WISH cells, isolated originally from human amnion epithelium, were also contaminated with HeLa cells. Inasmuch as our laboratory did not culture HeLa cells at the time of HES cell derivations, the source of contamination was the WISH cell line. These data highlight the need for continued diligence in authenticating cell lines used in reproductive biology research. © The Author(s) 2014.

  14. Hypoxia Upregulates the Expression of Annexin A1 in Lung Adenocarcinoma A549 Cells

    Directory of Open Access Journals (Sweden)

    Zhenhong HU

    2012-05-01

    Full Text Available Background and objective The growth of tumor often faced up with lackness of blood and oxygen, and it has been reported that Annexin A1 may be involved in tumor. The aim of this investigation is to explore the characteristics of expression of Annexin A1 in lung adenocarcinoma A549 cells after hypoxia. Methods A549 cells were exposured to either normoxia (21%O2 or hypoxia (1%O2 condition for 4 h, 12 h, 24 h. The expressions of Annexin A1 mRNA levels were measured by RT-PCR. The expressions of Annexin 1 protein were investigaged by Western blot. The relative content of reactive oxygen species (ROS were assayed by special kit. The expressions of nuclear translocation of NF-κB was assayed by Western blot; After been treated with ROS scavenger NAC and PDTC, the levels of Annexin 1 protein of A549 cells were measured by Western blot. Results Compared with normoxia group, the Annexin A1 mRNA in hypoxia group increased after 4 h, and then decreased gradually; Moreover, Annexin 1 protein levels of A549 cells were also increased when treated with hypoxia. An increaing of ROS production in cells exprosed to hypoxia was detected. NAC and PDTC inhibited hypoxia-induced Annexin A1 increase. Conclusion Hypoxia upregulates the expression of Annexin A1 in lung adenocarcinoma A549 cells, in which process ROS-NF-κB may paticipate in.

  15. Establishment and characterization of a new cell line derived from feline mammary tumor.

    Science.gov (United States)

    Muleya, J S; Nakaichi, M; Sugahara, J; Taura, Y; Murata, T; Nakama, S

    1998-08-01

    A new cell line designated FRM was established from pleural effusion of a 13-year-old female cat with mammary adenocarcinoma. The cell line exhibited irregular round and polygonal shaped epithelial cells and demonstrated cell growth in a monolayer fashion with a doubling time of 22.4 hr. It possessed a modal chromosome number of 79. The immortality of this cell line was demonstrated using the TRAP assay which revealed a high telomeric activity of these cells. Scatchard analysis revealed quite low levels of estrogen receptors in both tumor mass produced in nude mice and FRM cells. Subcutaneous transplantation of the cells produced localized palpable masses in athymic nude mice within two weeks. This cell line may provide a good model for in vivo and in vitro studies on feline mammary tumors.

  16. Bad is not involved in DHA-induced apoptosis in human lung adenocarcinoma ASTC-a-1 cells

    Science.gov (United States)

    Yu, Huai-na; Lu, Ying-ying; Chen, Tong-sheng

    2011-03-01

    Dihydroartemisinin (DHA), a first-line anti-malarial drug with low toxicity, has been shown to possess promising anticancer activities and induce cancer cell death through apoptotic pathway, but the molecular mechanisms are not well understood. In this paper, we focus on whether Bad, a BH3-only pro-apoptotic protein, is involved in apoptotic cell death in DHA-treated human lung adenocarcinoma (ASTC-a-1) cells. Confocal fluorescence microscope imaging was used to monitor the temporal and spatial distribution of Bad in single living cells. Our results indicate that Bad is still located in cytoplasm and does not translocate to mitochondria after treatment with DHA for 24 h, while only a small proportion of Bad located in cytoplasm in the STS-treated cells for 6 h. These results show for the first time that Bad is not involved in DHA-induced apoptosis in ASTC-a-1 cells, which could give more evidence for the molecular mechanisms of apoptosis induced by DHA.

  17. In vivo gene transfer targeting in pancreatic adenocarcinoma with cell surface antigens

    Directory of Open Access Journals (Sweden)

    Lafitte Marie

    2012-10-01

    Full Text Available Abstract Background Pancreatic ductal adenocarcinoma is a deadly malignancy resistant to current therapies. It is critical to test new strategies, including tumor-targeted delivery of therapeutic agents. This study tested the possibility to target the transfer of a suicide gene in tumor cells using an oncotropic lentiviral vector. Results Three cell surface markers were evaluated to target the transduction of cells by lentiviruses pseudotyped with a modified glycoprotein from Sindbis virus. Only Mucin-4 and the Claudin-18 proteins were found efficient for targeted lentivirus transductions in vitro. In subcutaneous xenografts of human pancreatic cancer cells models, Claudin-18 failed to achieve efficient gene transfer but Mucin-4 was found very potent. Human pancreatic tumor cells were modified to express a fluorescent protein detectable in live animals by bioimaging, to perform a direct non invasive and costless follow up of the tumor growth. Targeted gene transfer of a bicistronic transgene bearing a luciferase gene and the herpes simplex virus thymidine kinase gene into orthotopic grafts was carried out with Mucin-4 oncotropic lentiviruses. By contrast to the broad tropism VSV-G carrying lentivirus, this oncotropic lentivirus was found to transduce specifically tumor cells, sparing normal pancreatic cells in vivo. Transduced cells disappeared after ganciclovir treatment while the orthotopic tumor growth was slowed down. Conclusion This work considered for the first time three aspect of pancreatic adenocarcinoma targeted therapy. First, lentiviral transduction of human pancreatic tumor cells was possible when cells were grafted orthotopically. Second, we used a system targeting the tumor cells with cell surface antigens and sparing the normal cells. Finally, the TK/GCV anticancer system showed promising results in vivo. Importantly, the approach presented here appeared to be a safer, much more specific and an as efficient way to perform gene

  18. Bax is not involved in the resveratrol-induced apoptosis in human lung adenocarcinoma cells

    Science.gov (United States)

    Zhang, Wei-wei; Wang, Zhi-ping; Chen, Tong-sheng

    2010-02-01

    Resveratrol (RV) is a natural plant polyphenol widely present in foods such as grapes, wine, and peanuts. Previous studies indicate that RV has an ability to inhibit various stages of carcinogenesis and eliminate preneoplastic cells in vitro and in vivo. However, little is known about the molecular mechanism of RV-induced apoptosis in human lung adenocarcinoma (ASTC-a-1) cell. In this report, we analyzed whether Bax translocation from cytoplasm to mitochondria during RV-induced apoptosis in single living cell using onfocal microscopey. Cells were transfected with GFP-Bax plasmid. Cell counting kit (CCK-8) assay was used to assess the inhibition of RV on the cells viability. Apoptotic activity of RV was detected by Hoechst 33258 and propidium iodide (PI) staining. Our results showed that RV induced a dose-dependent apoptosis in which Bax did not translocate to mitochondrias.

  19. Histological transformation of adenocarcinoma to small cell carcinoma lung as a rare mechanism of resistance to epidermal growth factor receptor-tyrosine kinase inhibitors: Report of a case with review of literature.

    Science.gov (United States)

    Hui, Monalisa; Uppin, Shantveer G; Stalin, Bala Joseph; Sadashivudu, G

    2018-01-01

    A subset of non-small cell lung carcinoma (NSCC) harbor active mutations of epidermal growth factor receptor (EGFR). In these, EGFR tyrosine kinase inhibitors (EGFR-TKIs) are recommended as the first-line treatment. Though drug resistance is inevitable, histological transformation to small cell lung carcinoma (SCLC) is a rare mechanism for acquired resistance. Here we report one such rare case of histological transformation of pulmonary adenocarcinoma to small cell lung carcinoma in 46 year old male treated with Gefitinib.

  20. Expression of C4.4A in precursor lesions of pulmonary adenocarcinoma and squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Santoni-Rugiu, Eric; Illemann, Martin

    2012-01-01

    The protein C4.4A, a structural homologue of the urokinase-type plasminogen activator receptor, is a potential new biomarker in non-small cell lung cancer, with high levels of expression recently shown to correlate to poor survival of adenocarcinoma patients. In this study, C4.4A immunoreactivity...... in precursor lesions of lung squamous cell carcinoma and adenocarcinoma was investigated by stainings with a specific anti-C4.4A antibody. In the transformation from normal bronchial epithelium to squamous cell carcinoma, C4.4A was weakly expressed in basal cell hyperplasia but dramatically increased...... finding that C4.4A expression levels do not provide prognostic information on the survival of squamous cell carcinoma patients. In the progression from normal alveolar epithelium to peripheral adenocarcinoma, we observed an unexpected, distinct cytoplasmic staining for C4.4A in a fraction of atypical...

  1. Inhibitory effect of piperine on Helicobacter pylori growth and adhesion to gastric adenocarcinoma cells.

    Science.gov (United States)

    Tharmalingam, Nagendran; Kim, Sa-Hyun; Park, Min; Woo, Hyun Jun; Kim, Hyun Woo; Yang, Ji Yeong; Rhee, Ki-Jong; Kim, Jong Bae

    2014-01-01

    Piperine is a compound comprising 5-9% of black pepper (Piper nigrum), which has a variety of biological roles related to anticancer activities. Helicobacter pylori has been classified as a gastric carcinogen, because it causes gastritis and gastric cancer by injecting the virulent toxin CagA and translocating VacA. The present study investigated the inhibitory action of piperine on H. pylori growth and adhesion. Inhibition of H. pylori growth was determined by the broth macrodilution method, and adhesion to gastric adenocarcinoma cells validated by urease assay. Motility test was performed by motility agar and the expression of adhesion gene and flagellar gene in response to the piperine treatment was assessed by RT-PCR and immunoblotting. Administrated piperine suppressed the level of H. pylori adhesion to gastric adenocarcinoma cells in a dose dependent manner and the inhibition was statistically significant as determined by Student's t-test. In addition, piperine treatment effects on the flagellar hook gene flgE and integral membrane component of the export apparatus gene flhA expression to be suppressed and piperine diminished the H. pylori motility. flhA, encodes an integral membrane component of the export apparatus, which is also one of the regulatory protein in the class 2 genes expression and flgE is one of them that encodes hook part of the flagella. Suppression of both genes, leads to less motility results in the organism attracted less towards to the gastric epithelial cells might be the possible reason in the adhesion inhibition. To our knowledge, this is the first report published on the inhibitory effects of piperine against the adhesion of H. pylori to gastric adenocarcinoma cells.

  2. DAG/PKCδ and IP3/Ca2+/CaMK IIβ Operate in Parallel to Each Other in PLCγ1-Driven Cell Proliferation and Migration of Human Gastric Adenocarcinoma Cells, through Akt/mTOR/S6 Pathway

    Science.gov (United States)

    Dai, Lianzhi; Zhuang, Luhua; Zhang, Bingchang; Wang, Fen; Chen, Xiaolei; Xia, Chun; Zhang, Bing

    2015-01-01

    Phosphoinositide specific phospholipase Cγ (PLCγ) activates diacylglycerol (DAG)/protein kinase C (PKC) and inositol 1,4,5-trisphosphate (IP3)/Ca2+/calmodulin-dependent protein kinase II (CaMK II) axes to regulate import events in some cancer cells, including gastric adenocarcinoma cells. However, whether DAG/PKCδ and IP3/Ca2+/CaMK IIβ axes are simultaneously involved in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells and the underlying mechanism are not elucidated. Here, we investigated the role of DAG/PKCδ or CaMK IIβ in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells, using the BGC-823 cell line. The results indicated that the inhibition of PKCδ and CaMK IIβ could block cell proliferation and migration of BGC-823 cells as well as the effect of inhibiting PLCγ1, including the decrease of cell viability, the increase of apoptotic index, the down-regulation of matrix metalloproteinase (MMP) 9 expression level, and the decrease of cell migration rate. Both DAG/PKCδ and CaMK IIβ triggered protein kinase B (Akt)/mammalian target of rapamycin (mTOR)/S6 pathway to regulate protein synthesis. The data indicate that DAG/PKCδ and IP3/Ca2+/CaMK IIβ operate in parallel to each other in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells through Akt/mTOR/S6 pathway, with important implication for validating PLCγ1 as a molecular biomarker in early gastric cancer diagnosis and disease surveillance. PMID:26633375

  3. DAG/PKCδ and IP3/Ca2+/CaMK IIβ Operate in Parallel to Each Other in PLCγ1-Driven Cell Proliferation and Migration of Human Gastric Adenocarcinoma Cells, through Akt/mTOR/S6 Pathway

    Directory of Open Access Journals (Sweden)

    Lianzhi Dai

    2015-12-01

    Full Text Available Phosphoinositide specific phospholipase Cγ (PLCγ activates diacylglycerol (DAG/protein kinase C (PKC and inositol 1,4,5-trisphosphate (IP3/Ca2+/calmodulin-dependent protein kinase II (CaMK II axes to regulate import events in some cancer cells, including gastric adenocarcinoma cells. However, whether DAG/PKCδ and IP3/Ca2+/CaMK IIβ axes are simultaneously involved in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells and the underlying mechanism are not elucidated. Here, we investigated the role of DAG/PKCδ or CaMK IIβ in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells, using the BGC-823 cell line. The results indicated that the inhibition of PKCδ and CaMK IIβ could block cell proliferation and migration of BGC-823 cells as well as the effect of inhibiting PLCγ1, including the decrease of cell viability, the increase of apoptotic index, the down-regulation of matrix metalloproteinase (MMP 9 expression level, and the decrease of cell migration rate. Both DAG/PKCδ and CaMK IIβ triggered protein kinase B (Akt/mammalian target of rapamycin (mTOR/S6 pathway to regulate protein synthesis. The data indicate that DAG/PKCδ and IP3/Ca2+/CaMK IIβ operate in parallel to each other in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells through Akt/mTOR/S6 pathway, with important implication for validating PLCγ1 as a molecular biomarker in early gastric cancer diagnosis and disease surveillance.

  4. In vitro antiproliferative effect of six Salvia species on human tumor cell lines.

    Science.gov (United States)

    Fiore, Giovina; Nencini, Cristina; Cavallo, Federica; Capasso, Anna; Bader, Ammar; Giorgi, Giorgio; Micheli, Lucia

    2006-08-01

    This study was designed to examine the in vitro antiproliferative activity of the methanol crude extracts of six Salvia species: Salvia dominica L. leaves, Salvia lanigera Desf. aerial parts, Salvia menthaefolia Ten. roots, Salvia palaestina Benth. aerial parts, Salvia sclarea L. roots and Salvia spinosa L. aerial parts. Extracts were screened for their possible antitumoral activity by MTT test on nine human cancer cell lines: glioblastoma (DBTRG-05MG, T98G, U-87MG), colorectal adenocarcinoma (WiDr and HT-29), prostate adenocarcinoma (MDA Pca2b), choriocarcinoma (JEG-3), endometrium adenocarcinoma (HEC-1A) and B lymphoblast (CIR). IC(50) values were determined for only five extracts and ranged from 90 to 400 microg/mL approximately. Salvia menthaefolia extract exhibited marked antiproliferative activity against all tumor cell lines showing lower IC(50) values, while S. spinosa, S. sclarea and S. dominica extracts showed a degree cytotoxic activity dependent on the cell line type. Finally S. palaestina extract revealed a moderate antiproliferative effect only against three cell lines. Salvia lanigera extract displayed toxic activity at all concentrations tested. The results strengthen the evidence that the genus Salvia could be considered a natural resource of potential antitumor agents.

  5. A case of clear cell adenocarcinoma arising from the urethral diverticulum: Utility of urinary cytology and immunohistochemistry

    Directory of Open Access Journals (Sweden)

    Shin-ichi Nakatsuka

    2012-01-01

    Full Text Available Carcinomas rarely arise from the urethral diverticulum. In this report, we present a case of clear cell adenocarcinoma arising from the urethral diverticulum. A 42-year-old woman complained of bloody discharge and lower back pain. Imaging studies showed a tumor involving the region surrounding the urethra and cystourethroscopy showed papillary and villous tumors in the urethral diverticula. Cytology of the urine sediment showed papillary or spherical clusters of atypical cells, some of which had clear abundant cytoplasm and formed mirror ball-like clusters, suggesting adenocarcinoma. Although histological diagnosis was indeterminate by biopsy and transurethral resection (TUR because of absence of stromal invasion, surgically resected specimen via cysturethrectomy revealed that the tumor was clear cell carcinoma. Urinary cytological findings and immunohistochemical analysis for CD15, Ki-67, and p53 might be useful for accurate diagnosis of clear cell adenocarcinoma that arises from the urethral diverticulum when sufficient materials are not available by biopsy and TUR.

  6. [Effect of RNA interference targeting HIF-1α gene on biological behavior of human esophageal squamous cell carcinoma and gastric adenocarcinoma cells in vitro].

    Science.gov (United States)

    Zeng, Kai-feng; Jin, Hai-lin; Zhang, Wei-feng; Xiao, Bin; Zhu, Hong; Hao, Bo; Shi, Rui-hua

    2011-04-01

    To investigate the effect of hypoxia inducible factor-1α (HIF-1α) on the proliferation, migration and vasculogenic mimicry(VM) in human esophageal squamous cell carcinoma cell line Eca-109 and gastric adenocarcinoma cell line SGC-7901 in vitro. The recombinant plasmid pGCsi-shHIF-1α was transfected into Eca-109 and SGC-7901 cells by Lipofectamine(TM) 2000. The inhibitory effect of HIF-1α was measured at protein level by Western blot under normoxia and hypoxia. The cell proliferation was detected by colony formation and MTT assays. The migration of transfected cells was assayed using Transwell chambers. Whether Eca-109 and SGC-7901 cells could form the capillary tube-like structures (TLSs) was observed by 3-dimensional culture, and the tube formation of transfected cells was detected by tube-like structure formation assay. The expression of HIF-1α protein in each group of transfected cells was significantly suppressed under normoxia and hypoxia (Eca-109: 0.00, 0.74 ± 0.05; 0.00, 1.11 ± 0.06; SGC-7901: 0.00, 0.60 ± 0.05; 0.00, 0.96 ± 0.07, P groups (104.7 ± 9.6, 151.7 ± 4.5; 88.3 ± 5.1, 128.3 ± 6.7, P Eca-109 and SGC-7901 cells could form TLSs when cultured on matrigel, and the number of tubules was significantly increased under hypoxia (30.8 ± 3.9, 34.3 ± 3.4; 26.2 ± 3.4, 30.1 ± 4.1, P groups was significantly inhibited under normoxia and hypoxia (Eca-109: 3.7 ± 2.8, 30.8 ± 3.9; 3.9 ± 2.7, 34.3 ± 3.4; SGC-7901: 4.9 ± 3.5, 26.2 ± 3.4; 5.3 ± 3.6, 30.1 ± 4.1, P Eca-109 and gastric adenocarcinoma cell line SGC-7901 are capable of forming vasculogenic mimicry structures in vitro. The recombinant plasmid pGCsi-shHIF-1α can efficiently suppress their proliferation, migration and vasculogenic mimicry formation.

  7. Targeting the mRNA-binding protein HuR impairs malignant characteristics of pancreatic ductal adenocarcinoma cells

    Science.gov (United States)

    Jimbo, Masaya; Blanco, Fernando F.; Screnci, Brad A.; Cosma, Gabriela L.; Alexeev, Vitali; Gonye, Gregory E.; Yeo, Charles J.; Sawicki, Janet A.; Winter, Jordan M.; Brody, Jonathan R.

    2015-01-01

    Post-transcriptional regulation is a powerful mediator of gene expression, and can rapidly alter the expression of numerous transcripts involved in tumorigenesis. We have previously shown that the mRNA-binding protein HuR (ELAVL1) is elevated in human pancreatic ductal adenocarcinoma (PDA) specimens compared to normal pancreatic tissues, and its cytoplasmic localization is associated with increased tumor stage. To gain a better insight into HuR’s role in PDA biology and to assess it as a candidate therapeutic target, we altered HuR expression in PDA cell lines and characterized the resulting phenotype in preclinical models. HuR silencing by short hairpin and small interfering RNAs significantly decreased cell proliferation and anchorage-independent growth, as well as impaired migration and invasion. In comparison, HuR overexpression increased migration and invasion, but had no significant effects on cell proliferation and anchorage-independent growth. Importantly, two distinct targeted approaches to HuR silencing showed marked impairment in tumor growth in mouse xenografts. NanoString nCounter® analyses demonstrated that HuR regulates core biological processes, highlighting that HuR inhibition likely thwarts PDA viability through post-transcriptional regulation of diverse signaling pathways (e.g. cell cycle, apoptosis, DNA repair). Taken together, our study suggests that targeted inhibition of HuR may be a novel, promising approach to the treatment of PDA. PMID:26314962

  8. An embryonic stem cell-like signature identifies poorly differentiated lung adenocarcinoma but not squamous cell carcinoma.

    Science.gov (United States)

    Hassan, Khaled A; Chen, Guoan; Kalemkerian, Gregory P; Wicha, Max S; Beer, David G

    2009-10-15

    An embryonic stem cell (ESC) profile correlates with poorly differentiated breast, bladder, and glioma cancers. In this article, we assess the correlation between the ESC profile and clinical variables in lung cancer. Microarray gene expression analysis was done using Affymetrix Human Genome U133A on 443 samples of human lung adenocarcinoma and 130 samples of squamous cell carcinoma (SCC). To identify gene set enrichment patterns, we used the Genomica software. Our analysis showed that an increased expression of the ESC gene set and a decreased expression of the Polycomb target gene set identified poorly differentiated lung adenocarcinoma. In addition, this gene expression signature was associated with markers of poor prognosis and worse overall survival in lung adenocarcinoma. However, there was no correlation between this ESC gene signature and any histologic or clinical variable assessed in lung SCC. This work suggests that not all poorly differentiated non-small cell lung cancers exhibit a gene expression profile similar to that of ESC, and that other characteristics may play a more important role in the determination of differentiation and survival in SCC of the lung.

  9. Role of coagulation in the recruitment of colon adenocarcinoma cells to thrombus under shear.

    Science.gov (United States)

    Baker-Groberg, Sandra M; Itakura, Asako; Gruber, András; McCarty, Owen J T

    2013-11-01

    Colorectal cancer metastases can appear on the peritoneum and in lymph nodes, liver, and lungs, suggesting both hematogenous and lymphatic spreading of the primary tumor. While antithrombotic agents have been shown to reduce both long-term incidence and metastasis, the role of coagulation in facilitating metastasis is ill defined. We investigated the kinetics and molecular mechanisms of metastatic colon adenocarcinoma cell recruitment to thrombi under shear flow, ex vivo. Platelet aggregates were formed by perfusing citrated anticoagulated whole blood over immobilized fibrinogen or fibrillar collagen. Thrombi were formed by perfusing recalcified whole blood over fibrinogen or fibrillar collagen in the presence of coagulation. Cultured colon adenocarcinoma cells (SW620) were perfused either during or following platelet aggregate or thrombus formation. The degree of transient tumor cell interactions (recruitment, rolling, and release) and the number of firmly adhered tumor cells were quantified using fluorescence microscopy. Platelet aggregates and thrombi formed on either fibrinogen- or fibrillar-collagen supported SW620 cell interactions and adhesion under shear. Thrombi or fibrin supported a greater degree of SW620 cell interactions and adhesion compared with platelet aggregates or fibrinogen, respectively, demonstrating that coagulation promoted SW620 cell recruitment under shear. Interestingly, in the absence of anticoagulation, we observed SW620 preferentially binding to thrombus-bound polymorphonuclear leukocytes (PMNs). The addition of purified PMNs to thrombi resulted in a doubling of the number of interacting and bound SW620 cells. Since thrombi often accumulate and activate leukocytes, our findings suggest that leukocytes may play a role in localizing metastases to sites of thrombogenesis.

  10. Inverse Relationship Between Leydig Cell Density and Metastatic Potential of Prostatic Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    W. John Wang

    1999-01-01

    Full Text Available Purpose: Evaluate the relationship between metastatic potential of prostatic adenocarcinoma (PC and testicular Leydig cell density. Materials and methods: Tissue samples from 111 men, age 52–85, with PC and bilateral orchiectomy were evaluated for Leydig cell density. The patients were divided into two groups: Group A were patients with metastasis (n=36 and Group B were patients without metastasis (n=75. Leydig cell density was determined by direct manual microscopic cell count on the tissue sections. The means of cell counts by four pathologists, expressed as cell/0.78 mm2 were used for analysis. The normally distributed data were analyzed by two‐tail Student’s t‐test. Thirty‐eight age‐compatible autopsy cases who died of unrelated causes served as normal controls. Results: The mean of Leydig cell count in group A patients was 14.43 (14.43 ± 1.19 SE. Mean of Group B was 47.05 (47.05 ± 4.05 SE whereas normal controls displayed a mean of 48.66 (48.66 ± 2.94 SE. Group A was significantly different from control (p0.75. Conclusions: Patients with metastatic adenocarcinoma of prostate, as a group, have a significantly lower Leydig cell density than patients without metastasis or patients without PC in compatible age groups. The hormonal relationship between this observation is however unknown. One possible explanation is that PC subpopulation with metastatic potential may require different level of endogenous androgen or are androgen‐independent.

  11. [Long-term survival of metastatic clear cell adenocarcinoma of the female urethra by multidisciplinary treatment: a case report].

    Science.gov (United States)

    Suzuki, Takahisa; Furuse, Hiroshi; Kurita, Yutaka; Imanishi, Takeshi; Tamura, Keita; Otsuka, Atsushi; Mugiya, Soichi; Ozono, Seiichiro

    2013-05-01

    We report a case of clear cell adenocarcinoma of the female urethra. A 57-year-old woman presented with complaint of gross hematuria. Abdominal ultrasonography, cystourethroscopy, computed tomography (CT) and magnetic resonance imaging (MRI) revealed the urethral tumor was invasive to bladder neck. Clinical stage was determined as cT3N1M0, then anterior pelvic exenteration and ileal conduit formation were performed. The pathological diagnosis was clear cell adenocarcinoma of urethra and the stage was pT3N1. The patient received TS-1 and cisplatin for postoperative recurrence, but she died from multiple lung metastasis 54 months after the operation. Clear cell adenocarcinoma of the female urethra is rare case in the Japanese literatures. Pathogenesis and management of this rare condition are discussed.

  12. Cell-free DNA promoter hypermethylation in plasma as a diagnostic marker for pancreatic adenocarcinoma.

    Science.gov (United States)

    Henriksen, Stine Dam; Madsen, Poul Henning; Larsen, Anders Christian; Johansen, Martin Berg; Drewes, Asbjørn Mohr; Pedersen, Inge Søkilde; Krarup, Henrik; Thorlacius-Ussing, Ole

    2016-01-01

    Pancreatic cancer has a 5-year survival rate of only 5-7%. Difficulties in detecting pancreatic cancer at early stages results in the high mortality and substantiates the need for additional diagnostic tools. Surgery is the only curative treatment and unfortunately only possible in localized tumours. A diagnostic biomarker for pancreatic cancer will have a major impact on patient survival by facilitating early detection and the possibility for curative treatment. DNA promoter hypermethylation is a mechanism of early carcinogenesis, which can cause inactivation of tumour suppressor genes. The aim of this study was to examine promoter hypermethylation in a panel of selected genes from cell-free DNA, as a diagnostic marker for pancreatic adenocarcinoma. Patients with suspected or biopsy-verified pancreatic cancer were included prospectively and consecutively. Patients with chronic/acute pancreatitis were included as additional benign control groups. Based on an optimized accelerated bisulfite treatment protocol, methylation-specific PCR of a 28 gene panel was performed on plasma samples. A diagnostic prediction model was developed by multivariable logistic regression analysis using backward stepwise elimination. Patients with pancreatic adenocarcinoma ( n  = 95), chronic pancreatitis ( n  = 97) and acute pancreatitis ( n  = 59) and patients screened, but negative for pancreatic adenocarcinoma ( n  = 27), were included. The difference in mean number of methylated genes in the cancer group (8.41 (95% CI 7.62-9.20)) vs the total control group (4.74 (95% CI 4.40-5.08)) was highly significant ( p  diagnostic prediction model (age >65, BMP3 , RASSF1A , BNC1 , MESTv2 , TFPI2 , APC , SFRP1 and SFRP2 ) had an area under the curve of 0.86 (sensitivity 76%, specificity 83%). The model performance was independent of cancer stage. Cell-free DNA promoter hypermethylation has the potential to be a diagnostic marker for pancreatic adenocarcinoma and differentiate

  13. Synchronous double primary squamous cell carcinoma and adenocarcinoma of the extrahepatic bile duct: a case report.

    Science.gov (United States)

    Yoo, Youngsun; Mun, Seongpyo

    2015-05-19

    Synchronous double cancers of the bile duct are exceptionally rare. We here report a case of synchronous squamous cell carcinoma and adenocarcinoma of the extrahepatic bile duct. A 67-year-old Asian man visited our clinic complaining of jaundice and dark urine. Direct hyperbilirubinemia and an elevated cancer antigen 19-9 level were detected. Preoperative abdominal computed tomography and positron emission tomography showed two masses at the bifurcation of the common hepatic duct and at the distal common bile duct. After biliary drainage, we performed radical pylorus-preserving pancreaticoduodenectomy, without resection margin involvement. Pathological findings revealed that the proximal lesion was a squamous cell carcinoma and that the distal lesion was an adenocarcinoma. Both cholangiocarcinomas were confined to the fibromuscular layer, and there was no communication between the two tumors. Multiple conglomerated metastatic tumors were detected in his liver 3 months after surgery. He died 8 months after diagnosis. The disease displayed very aggressive behavior and a very poor prognosis. The only chance for long-term survival is treatment with radical resection. Preoperative positron emission tomography-computed tomography is useful in detecting occult cancer.

  14. High fluence laser irradiation induces reactive oxygen species generation in human lung adenocarcinoma cells

    Science.gov (United States)

    Wang, Fang; Xing, Da; Chen, Tong-Sheng

    2006-09-01

    Low-power laser irradiation (LPLI) has been used for therapies such as curing spinal cord injury, healing wound et al. Yet, the mechanism of LPLI remains unclear. Our previous study showed that low fluences laser irradiation induces human lung adenocarcinoma cells (ASTC-a-1) proliferation, but high fluences induced apoptosis and caspase-3 activation. In order to study the mechanism of apoptosis induced by high fluences LPLI further, we have measured the dynamics of generation of reactive oxygen species (ROS) using H IIDCFDA fluorescence probes during this process. ASTC-a-1 cells apoptosis was induced by He-Ne laser irradiation at high fluence of 120J/cm2. A confocal laser scanning microscope was used to perform fluorescence imaging. The results demonstrated that high fluence LPLI induced the increase of mitochondria ROS. Our studies contribute to clarify the biological mechanism of high fluence LPLI-induced cell apoptosis.

  15. Detection of Merkel cell polyomavirus in cervical squamous cell carcinomas and adenocarcinomas from Japanese patients

    Directory of Open Access Journals (Sweden)

    Imajoh Masayuki

    2012-08-01

    Full Text Available Abstract Background Merkel cell polyomavirus (MCPyV was identified originally in Merkel cell carcinoma (MCC, a rare form of human skin neuroendocrine carcinoma. Evidence of MCPyV existence in other forms of malignancy such as cutaneous squamous cell carcinomas (SCCs is growing. Cervical cancers became the focus of our interest in searching for potentially MCPyV-related tumors because: (i the major histological type of cervical cancer is the SCC; (ii the uterine cervix is a common site of neuroendocrine carcinomas histologically similar to MCCs; and (iii MCPyV might be transmitted during sexual interaction as demonstrated for human papillomavirus (HPV. In this study, we aimed to clarify the possible presence of MCPyV in cervical SCCs from Japanese patients. Cervical adenocarcinomas (ACs were also studied. Results Formalin-fixed paraffin-embedded tissue samples from 48 cervical SCCs and 16 cervical ACs were examined for the presence of the MCPyV genome by polymerase chain reaction (PCR and sequencing analyses. PCR analysis revealed that 9/48 cervical SCCs (19% and 4/16 cervical ACs (25% were positive for MCPyV DNA. MCPyV-specific PCR products were sequenced to compare them with reference sequences. The nucleotide sequences in the MCPyV large T (LT-sequenced region were the same among MCPyV-positive cervical SCCs and AC. Conversely, in the MCPyV viral protein 1 (VP1-sequenced region, two cervical SCCs and three cervical ACs showed several nucleotide substitutions, of which three caused amino acid substitutions. These sequencing results suggested that three MCPyV variants of the VP1 were identified in our cases. Immunohistochemistry showed that the LT antigen was expressed in tumor cells in MCPyV-positive samples. Genotyping of human HPV in the MCPyV-positive samples revealed that infected HPVs were HPV types 16, 31 and 58 for SCCs and HPV types 16 and 18 for ACs. Conclusions This study provides the first observation that MCPyV coexists in a subset

  16. Detection of Merkel cell polyomavirus in cervical squamous cell carcinomas and adenocarcinomas from Japanese patients.

    Science.gov (United States)

    Imajoh, Masayuki; Hashida, Yumiko; Nemoto, Yuiko; Oguri, Hiroyoshi; Maeda, Nagamasa; Furihata, Mutsuo; Fukaya, Takao; Daibata, Masanori

    2012-08-09

    Merkel cell polyomavirus (MCPyV) was identified originally in Merkel cell carcinoma (MCC), a rare form of human skin neuroendocrine carcinoma. Evidence of MCPyV existence in other forms of malignancy such as cutaneous squamous cell carcinomas (SCCs) is growing. Cervical cancers became the focus of our interest in searching for potentially MCPyV-related tumors because: (i) the major histological type of cervical cancer is the SCC; (ii) the uterine cervix is a common site of neuroendocrine carcinomas histologically similar to MCCs; and (iii) MCPyV might be transmitted during sexual interaction as demonstrated for human papillomavirus (HPV). In this study, we aimed to clarify the possible presence of MCPyV in cervical SCCs from Japanese patients. Cervical adenocarcinomas (ACs) were also studied. Formalin-fixed paraffin-embedded tissue samples from 48 cervical SCCs and 16 cervical ACs were examined for the presence of the MCPyV genome by polymerase chain reaction (PCR) and sequencing analyses. PCR analysis revealed that 9/48 cervical SCCs (19%) and 4/16 cervical ACs (25%) were positive for MCPyV DNA. MCPyV-specific PCR products were sequenced to compare them with reference sequences. The nucleotide sequences in the MCPyV large T (LT)-sequenced region were the same among MCPyV-positive cervical SCCs and AC. Conversely, in the MCPyV viral protein 1 (VP1)-sequenced region, two cervical SCCs and three cervical ACs showed several nucleotide substitutions, of which three caused amino acid substitutions. These sequencing results suggested that three MCPyV variants of the VP1 were identified in our cases. Immunohistochemistry showed that the LT antigen was expressed in tumor cells in MCPyV-positive samples. Genotyping of human HPV in the MCPyV-positive samples revealed that infected HPVs were HPV types 16, 31 and 58 for SCCs and HPV types 16 and 18 for ACs. This study provides the first observation that MCPyV coexists in a subset of HPV-associated cervical cancers from

  17. Anticancer Activity of Certain Herbs and Spices on the Cervical Epithelial Carcinoma (HeLa) Cell Line

    OpenAIRE

    Danielle Berrington; Namrita Lall

    2012-01-01

    Acetone extracts of selected plant species were evaluated for their in vitro cytotoxicity against a noncancerous African green monkey kidney (Vero) cell line and an adenocarcinoma cervical cancer (HeLa) cell line. The plants studied were Origanum vulgare L. (Oregano), Rosmarinus officinalis L. (Upright and ground cove rosemary), Lavandula spica L. (Lavender), Laurus nobilis L. (Bay leaf), Thymus vulgaris L. (Thyme), Lavandula x intermedia L. (Margaret Roberts Lavender), Petroselinum crispum M...

  18. Upregulation of Yes-associated protein and transcriptional co-activator with PDZ-binding motif influences the behavior of LOVO human colon adenocarcinoma cells.

    Science.gov (United States)

    Li, Yu; Li, Lan; Zhu, Min; Ye, Limin; Yang, Qian

    2017-10-01

    The present study aimed to investigate the role of Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) in the LOVO human colon adenocarcinoma cell line and explore the underlying mechanisms. First, the expression levels of YAP and TAZ were detected in LOVO cells using reverse-transcription quantitative PCR, and the results suggested that YAP and TAZ were faintly expressed in LOVO cells. To investigate the exact role of YAP and TAZ in LOVO cells, stable YAP- and/or TAZ-overexpressing LOVO cell lines were established using YAP and/or TAZ expression plasmids. An MTT assay and flow cytometry were used to assess cell proliferation and apoptosis, respectively. The results indicated that compared with the control, YAP or TAZ overexpression significantly increased the proliferation ability of LOVO cells, while apoptosis was significantly decreased. Furthermore, the expression of the tumor-associated proteins connective tissue growth factor and cysteine-rich angiogenic inducer 61, which have critical roles in facilitating cancer cell proliferation, migration and invasion, were found to be upregulated following upregulation of YAP and TAZ. In addition, the expression of cell apoptosis-associated protein B-cell lymphoma 2 (Bcl-2) was significantly increased, while Bcl-2-associated X protein and caspase-3 were inhibited by YAP or TAZ overexpression. All of these effects were amplified when YAP and TAZ were co-overexpressed. In conclusion, YAP and TAZ function as tumor promoters in human colon carcinoma, and upregulation of YAP and TAZ influences the behavior of LOVO colon adenocarcinoma cells via regulating tumor-associated gene expression.

  19. ATRA and Genistein synergistically inhibit the metastatic potential of human lung adenocarcinoma cells.

    Science.gov (United States)

    Cheng, Ji; Qi, Jun; Li, Xue-Tao; Zhou, Kun; Xu, Jing-Han; Zhou, Yong; Zhang, Guo-Qiang; Xu, Jian-Ping; Zhou, Ren-Jie

    2015-01-01

    This study was to investigate the effects of all-trans retinoic acid (ATRA) in combination with Genistein on the proliferation, expression of apoptosis related proteins and adhesion molecules (MUC1 and ICAM-1) and invasiveness of A549 cells, aiming to investigate whether combined therapy of ATRA and Genistein is superior to monotherapy in suppressing metastasis of lung cancer cells. ATRA, Genistein and both were used to treat human lung adenocarcinoma cells (A549 cells). Immunohistochemistry was done for MUC1 expression, flow cytometry for ICAM-1 expression, fluorescence quantitative PCR for MUC1 expression and Western blot assay for the expressions of cell cycle related proteins (CDK4, Rb and p-ERK1/2) and apoptosis related proteins (Bax and Bcl-2). Cells were seeded into Matrigel pre-coated Transwell chambers, and the migrating cells were counted. Combined treatment with ATRA and Genistein was able to reduce the expressions of Bcl-2, MUC1 and ICAM-1 and exerted synergistic effects to inhibit the invasion of A549 cells. ATRA and Genistein may synergistically inhibit MUC1 and ICAM-1 expressions and affect the expressions of cell cycle related proteins (CDK4, Rb and p-ERK1/2) and apoptosis related proteins (Bax and Bcl-2), inhibit the metastatic potential of lung cancer A549 cells.

  20. Isolation and characterization of stromal progenitor cells from ascites of patients with epithelial ovarian adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Ho Chih-Ming

    2012-02-01

    Full Text Available Abstract Background At least one-third of epithelial ovarian cancers are associated with the development of ascites containing heterogeneous cell populations, including tumor cells, inflammatory cells, and stromal elements. The components of ascites and their effects on the tumor cell microenvironment remain poorly understood. This study aimed to isolate and characterize stromal progenitor cells from the ascites of patients with epithelial ovarian adenocarcinoma (EOA. Methods Seventeen ascitic fluid samples and 7 fresh tissue samples were collected from 16 patients with EOA. The ascites samples were then cultured in vitro in varying conditions. Flow cytometry and immunocytochemistry were used to isolate and characterize 2 cell populations with different morphologies (epithelial type and mesenchymal type deriving from the ascites samples. The in vitro cell culture model was established using conditional culture medium. Results The doubling times of the epithelial type and mesenchymal type cells were 36 h and 48 h, respectively, indicating faster growth of the epithelial type cells compared to the mesenchymal type cells. Cultured in vitro, these ascitic cells displayed the potential for self-renewal and long-term proliferation, and expressed the typical cancer stem/progenitor cell markers CD44high, CD24low, and AC133+. These cells also demonstrated high BMP-2, BMP4, TGF-β, Rex-1, and AC133 early gene expression, and expressed EGFR, integrin α2β1, CD146, and Flt-4, which are highly associated with tumorigenesis and metastasis. The epithelial type cells demonstrated higher cytokeratin 18 and E-cadherin expression than the mesenchymal type cells. The mesenchymal type cells, in contrast, demonstrated higher AC133, CD73, CD105, CD117, EGFR, integrin α2β1, and CD146 surface marker expression than the epithelial type cells. Conclusion The established culture system provides an in vitro model for the selection of drugs that target cancer

  1. Isolation and characterization of stromal progenitor cells from ascites of patients with epithelial ovarian adenocarcinoma.

    Science.gov (United States)

    Ho, Chih-Ming; Chang, Shwu-Fen; Hsiao, Chih-Chiang; Chien, Tsai-Yen; Shih, Daniel Tzu-Bi

    2012-02-14

    At least one-third of epithelial ovarian cancers are associated with the development of ascites containing heterogeneous cell populations, including tumor cells, inflammatory cells, and stromal elements. The components of ascites and their effects on the tumor cell microenvironment remain poorly understood. This study aimed to isolate and characterize stromal progenitor cells from the ascites of patients with epithelial ovarian adenocarcinoma (EOA). Seventeen ascitic fluid samples and 7 fresh tissue samples were collected from 16 patients with EOA. The ascites samples were then cultured in vitro in varying conditions. Flow cytometry and immunocytochemistry were used to isolate and characterize 2 cell populations with different morphologies (epithelial type and mesenchymal type) deriving from the ascites samples. The in vitro cell culture model was established using conditional culture medium. The doubling times of the epithelial type and mesenchymal type cells were 36 h and 48 h, respectively, indicating faster growth of the epithelial type cells compared to the mesenchymal type cells. Cultured in vitro, these ascitic cells displayed the potential for self-renewal and long-term proliferation, and expressed the typical cancer stem/progenitor cell markers CD44(high), CD24(low), and AC133(+). These cells also demonstrated high BMP-2, BMP4, TGF-β, Rex-1, and AC133 early gene expression, and expressed EGFR, integrin α2β1, CD146, and Flt-4, which are highly associated with tumorigenesis and metastasis. The epithelial type cells demonstrated higher cytokeratin 18 and E-cadherin expression than the mesenchymal type cells. The mesenchymal type cells, in contrast, demonstrated higher AC133, CD73, CD105, CD117, EGFR, integrin α2β1, and CD146 surface marker expression than the epithelial type cells. The established culture system provides an in vitro model for the selection of drugs that target cancer-associated stromal progenitor cells, and for the development of ovarian

  2. Growth and Maintenance of Vero Cell Lines

    OpenAIRE

    Ammerman, Nicole C.; Beier-Sexton, Magda; Azad, Abdu F.

    2008-01-01

    Vero cells are derived from the kidney of an African green monkey, and are one of the more commonly used mammalian continuous cell lines in microbiology, and molecular and cell biology research. This unit includes protocols for the growth and maintenance of Vero cell lines in a research laboratory setting.

  3. LINE-1 Cultured Cell Retrotransposition Assay

    Science.gov (United States)

    Kopera, Huira C.; Larson, Peter A.; Moldovan, John B.; Richardson, Sandra R.; Liu, Ying; Moran, John V.

    2016-01-01

    Summary The Long INterspersed Element-1 (LINE-1 or L1) retrotransposition assay has facilitated the discovery and characterization of active (i.e., retrotransposition-competent) LINE-1 sequences from mammalian genomes. In this assay, an engineered LINE-1 containing a retrotransposition reporter cassette is transiently transfected into a cultured cell line. Expression of the reporter cassette, which occurs only after a successful round of retrotransposition, allows the detection and quantification of the LINE-1 retrotransposition efficiency. This assay has yielded insight into the mechanism of LINE-1 retrotransposition. It also has provided a greater understanding of how the cell regulates LINE-1 retrotransposition and how LINE-1 retrotransposition impacts the structure of mammalian genomes. Below, we provide a brief introduction to LINE-1 biology and then detail how the LINE-1 retrotransposition assay is performed in cultured mammalian cells. PMID:26895052

  4. Effects of non-thermal mobile phone radiation on breast adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Zen Fourie

    2011-09-01

    Full Text Available Mobile phone usage currently exceeds landline communication in Africa. The extent of this usage has raised concerns about the long-term health effects of the ongoing use of mobile phones. To assess the physiological effects of radiation from mobile phones in vitro, MCF-7 breast adenocarcinoma cells were exposed to 2W/kg non-thermal 900-MHz mobile phone radiation. The effects investigated were those on metabolic activity, cell morphology, cell cycle progression, phosphatidylserine (PS externalisation and the generation of reactive oxygen species and nitrogen species. Statistically insignificant increases in mitochondrial dehydrogenase activity were observed in irradiated cells when compared to controls. Fluorescent detection of F-actin demonstrated an increase in F-actin stress fibre formation in irradiated MCF-7 cells. Cell cycle progression revealed no statistically significant variation. A small increase in early and late apoptotic events in irradiated MCF-7 cells was observed. No statistically significant changes were observed in reactive oxygen and reactive nitrogen species generation. In addition, quantitative and qualitative analyses of cell cycle activity and nuclear and cytosolic changes, respectively, revealed no significant changes. In conclusion, exposure to 1 h of 900-MHz irradiation induced an increase in PS externalisation and an increase in the formation of F-actin stress fibres in MCF-7 cells. Data obtained from this study, and their correlation with other studies, provides intriguing links between radio frequency radiation and cellular events and warrant further investigation.

  5. Clotrimazole decreases glycolysis and the viability of lung carcinoma and colon adenocarcinoma cells.

    Science.gov (United States)

    Penso, Julia; Beitner, Rivka

    2002-09-20

    Glycolysis is known to be the primary energy source in most cancer cells. We investigated here the effect of clotrimazole (1-(alpha-2-chlorotrityl)imidazole), the antifungal azole derivative, which was recently recognized as calmodulin antagonist, on the levels of glucose 1,6-bisphosphate and fructose 1,6-bisphosphate, the two stimulatory signal molecules of glycolysis, and on ATP content and cell viability in LL/2 Lewis lung carcinoma cells and CT-26 colon adenocarcinoma cells. We found that clotrimazole induced a significant, dose- and time-dependent reduction in the levels of glucose 1,6-bisphosphate, fructose 1,6-bisphosphate, ATP, and cell viability. These findings suggest that clotrimazole causes a reduction in glycolysis and ATP levels, which eventually leads to cell destruction after 3 h of treatment. Since cell proliferation was also reported to be inhibited by calmodulin antagonists, this substance is most promising agent in treatment of cancer by inhibiting both cell proliferation and the glycolytic supply of ATP required for cancer cell growth. Copyright 2002 Elsevier Science B.V.

  6. Nintedanib plus docetaxel as second-line therapy in patients with non-small-cell lung cancer

    DEFF Research Database (Denmark)

    Popat, Sanjay; Mellemgaard, Anders; Fahrbach, Kyle

    2015-01-01

    BACKGROUND: Nintedanib plus docetaxel has proven an overall survival benefit over docetaxel monotherapy in second-line treatment of non-small-cell lung cancer of adenocarcinoma histology in the LUME-Lung 1 pivotal trial. No published trials have previously compared nintedanib plus docetaxel...... with agents – other than docetaxel – that are approved second-line treatments for non-small-cell lung cancer. METHODS: The relative efficacy of nintedanib plus docetaxel versus second-line agents was evaluated by conducting a network meta-analysis of progression-free survival and overall survival. RESULTS...... with advanced non-small-cell lung cancer of adenocarcinoma histology, results suggest that nintedanib plus docetaxel offers clinical benefit compared with docetaxel alone, when used as second-line treatment, and suggests that this combination may also add clinical benefit compared with erlotinib in this patient...

  7. Bilateral Basal Cell Adenocarcinoma of the Parotid Gland: In a Recipient of Kidney Transplant

    Directory of Open Access Journals (Sweden)

    Mari Markkanen-Leppänen

    2010-01-01

    Full Text Available We report a rare case of bilateral basal cell adenocarcinoma (BcAC of the parotid gland in a male patient 30 years after kidney transplantation and continuous administration of immunosuppressive therapy. BcAC is a salivary gland malignancy first recognized as a distinct neoplastic entity in WHO classification of salivary gland tumours in 1991. Over 90% of BcACs are detected in the parotid gland. The most important differential diagnosis is basal cell adenoma. Infiltrative growth is the distinguishing feature of BcAC. Administration of immunosuppressive medication to this patient for three decades may have contributed to development of this rare neoplasia. To our knowledge, similar cases of BcAC have not been reported previously.

  8. [Two Cases of Urethral Clear Cell Adenocarcinoma with Suspected Recurrence of Uterine Cancer].

    Science.gov (United States)

    Okuno, Masato; Kusuda, Yuji; Taguchi, Isao; Kawabata, Gaku

    2017-08-01

    Herein, we report two cases of urethral clear cell carcinoma in two patients who had previously undergone radical hysterectomyfor utetine cancer. Case 1 presented with bloodyvaginal discharge and case 2 presented with acute urinaryretention. Magnetic resonance imaging revealed a periurethral tumor in both cases. Both cases were suspected to be recurrence at first. However, pathological findings of the transurethral resection-biopsyshowed clear cell adenocarcinoma in both cases. Subsequentlyradical cystourethrectomy and pelvic lymphadenectomy were performed in both cases. Surgical findings showed tumor invasion of the vaginal muscularis in case 1 and invasion of the anterior wall of the vagina and bladder neck in case 2. Although adjuvant postoperative therapywas not performed, there has been no evidence of recurrence to date.

  9. Apoptotic-like tumor cells and apoptotic neutrophils in mitochondrion-rich gastric adenocarcinomas: a comparative study with light and electronmicroscopy between these two forms of cell death

    Directory of Open Access Journals (Sweden)

    Antonio Venuti

    2013-04-01

    Full Text Available Mitochondrion-rich adenocarcinomas represent a rare variant of gastric adenocarcinomas composed predominantly of columnar adenocarcinoma cells with eosinophilic cytoplasm, a strong supranuclear immunoreactivity for antimitochondrial antibody, and a marked neutrophil infiltration associated to tumor cell death. The purpose of this work is to investigate, using correlated light and electron microscopy, mitochondrion-rich gastric adenocarcinomas focusing on the nature of the death in neoplastic cells and in infiltrating neutrophils. Adenocarcinoma cells, single or in small clusters, showed convoluted nuclei, irregularly condensed chromatin, loss of microvilli, and nuclear envelope dilatation. No nuclear fragmentation was observed in these dying cells and the plasma membrane did not show signs of disruption. These ultrastructural findings represent intermediate aspects between apoptosis and necrosis and are compatible with apoptosis-like programmed cell death. By contrast, some infiltrating neutrophils showed ultrastructural signs of classic apoptosis such as chromatin condensation into compact geometric (globular, crescent-shaped figures, tightly packed cytoplasmic granules and intact cell membrane. Our study provides ultrastructural evidence of apoptosis-like tumour cell death in mitochondrion-rich gastric carcinomas and confirms that stereotyped outcome either as apoptosis or necrosis of tumor cells cannot always be expected in human neoplasms.

  10. Inflammatory cells contribute to the generation of an angiogenic phenotype in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Esposito, I; Menicagli, M; Funel, N; Bergmann, F; Boggi, U; Mosca, F; Bevilacqua, G; Campani, D

    2004-06-01

    Inflammatory cells contribute to the growth and spread of human malignancies by producing molecules that enhance tumour invasiveness. To characterise the inflammatory infiltrate in pancreatic ductal adenocarcinoma and to analyse its contribution to angiogenesis and its prognostic relevance. Immunohistochemistry was used to identify inflammatory cells and evaluate the expression of proangiogenic and prolymphangiogenic molecules (vascular endothelial growth factor A (VEGF-A), VEGF-C, and basic fibroblast growth factor (bFGF)) by inflammatory and cancer cells in 137 pancreatic cancers. Intratumorous microvessel density (IMD) was assessed using CD34 as an endothelial cell marker. There were significantly more mast cells and macrophages in pancreatic cancers than in normal pancreas and the number of mast cells directly correlated with the presence of lymph node metastases. However, there was no relation between numbers of infiltrating inflammatory cells and the presence of chronic pancreatitis (CP)-like changes in the parenchyma surrounding the tumour. Double immunostaining revealed that both pancreatic mast cells and macrophages express VEGF-A, VEGF-C, and bFGF. These factors were also expressed in the tumour cells in many cases. The numbers of VEGF-A expressing tumour cells and bFGF expressing tumour and inflammatory cells significantly correlated with IMD. Moreover, tumours with higher IMD had higher numbers of infiltrating mast cells and macrophages. Mononuclear inflammatory cells of the non-specific immune response are recruited to pancreatic cancer tissues independent of the presence of CP-like changes, may influence the metastatic capacity of the cancer cells, and may contribute to the development of tumours with high angiogenic activity.

  11. Biosynthesis and transport of lysosomal alpha-glucosidase in the human colon carcinoma cell-line Caco-2: secretion from the apical surface

    NARCIS (Netherlands)

    Klumperman, J.; Fransen, J.A.; Boekestijn, J.C.; Oude Elferink, R.P.; Matter, K.; Hauri, H.P.; Tager, J.M.; Ginsel, L.A.

    1991-01-01

    The human adenocarcinoma cell line Caco-2 was used for studies on the biosynthesis and transport of lysosomal acid alpha-glucosidase in polarized epithelial cells. Metabolic labelling revealed that in Caco-2 cells alpha-glucosidase is synthesized as a precursor form of 110 x 10(3) Mr. This form is

  12. Biosynthesis and transport of lysosomal alpha-glucosidase in the human colon carcinoma cell line Caco-2: secretion from the apical surface

    NARCIS (Netherlands)

    Klumperman, J.; Fransen, J. A.; Boekestijn, T. C.; Oude Elferink, R. P.; Matter, K.; Hauri, H. P.; Tager, J. M.; Ginsel, L. A.

    1991-01-01

    The human adenocarcinoma cell line Caco-2 was used for studies on the biosynthesis and transport of lysosomal acid alpha-glucosidase in polarized epithelial cells. Metabolic labelling revealed that in Caco-2 cells alpha-glucosidase is synthesized as a precursor form of 110 x 10(3) Mr. This form is

  13. Sulforaphane down-regulates SKP2 to stabilize p27(KIP1) for inducing antiproliferation in human colon adenocarcinoma cells.

    Science.gov (United States)

    Chung, Yuan-Kai; Chi-Hung Or, Richard; Lu, Chien-Hsing; Ouyang, Wei-Ting; Yang, Shu-Yi; Chang, Chia-Che

    2015-01-01

    Sulforaphane is a cruciferous vegetable-derived isothiocyanate with promising chemopreventive and therapeutic activities. Induction of proliferation arrest and apoptosis principally contribute to sulforaphane's anticancer activity, but the precise molecular mechanisms remain elusive. The oncoprotein SKP2 is a key component of the SKP1-CULLIN1-F-box (SCF) E3 ligase complex and is responsible for directing SCF-mediated degradation of cyclin-dependent kinase inhibitor p27(KIP1) to promote cell proliferation. We herein provide the first evidence supporting the critical involvement of the SKP2-p27(KIP1) axis in sulforaphane-induced antiproliferation in various human colon adenocarcinoma cell lines. Specifically, sulforaphane markedly suppressed the levels of bromodeoxyuridine (BrdU) incorporation and clonogenicity in all tested cell lines, illustrating the antiproliferative effect of sulforaphane. Of note, sulforaphane-induced antiproliferation was accompanied with down-regulation of SKP2, leading to the stabilization and thus up-regulation of p27(KIP1). Additionally, sulforaphane was found to down-regulate SKP2 mainly through transcriptional repression, as sulforaphane lowered SKP2 mRNA expression and the SKP2 promoter activity. Furthermore, sulforaphane treatment led to the activation of both AKT and ERK, thus ruling out the possibility that sulforaphane down-regulates SKP2 by inhibiting AKT or ERK. Notably, sulforaphane-elicited suppression of BrdU incorporation and clonogenicity were significantly rescued in the context of SKP2 overexpression or p27(KIP1) depletion, therefore highlighting the important role of SKP2 down-regulation and the ensuing stabilization of p27(KIP1) in sulforaphane-induced antiproliferation. Collectively, these data expand our molecular understanding about how sulforaphane elicits proliferation arrest, but also implicate the application of sulforaphane in therapeutic modalities targeting SKP2. Copyright © 2014 The Society for Biotechnology

  14. Integrins are not essential for entry of coxsackievirus A9 into SW480 human colon adenocarcinoma cells.

    Science.gov (United States)

    Heikkilä, Outi; Merilahti, Pirjo; Hakanen, Marika; Karelehto, Eveliina; Alanko, Jonna; Sukki, Maria; Kiljunen, Saija; Susi, Petri

    2016-10-18

    Coxsackievirus A9 (CV-A9) is a pathogenic enterovirus type within the family Picornaviridae. CV-A9 infects A549 human epithelial lung carcinoma cells by attaching to the αVβ6 integrin receptor through a highly conserved Arg-Gly-Asp (RGD) motif, which is located at the exposed carboxy-terminus of the capsid protein VP1 detected in all studied clinical isolates. However, genetically-modified CV-A9 that lacks the RGD motif (CV-A9-RGDdel) has been shown to be infectious in some cell lines but not in A549, suggesting that RGD-mediated integrin binding is not always essential for efficient entry of CV-A9. Two cell lines, A549 and SW480, were used in the study. SW480 was the study object for the integrin-independent entry and A549 was used as the control for integrin-dependent entry. Receptor levels were quantitated by cell sorting and quantitative PCR. Antibody blocking assay and siRNA silencing of receptor-encoding genes were used to block virus infection. Peptide phage display library was used to identify peptide binders to CV-A9. Immunofluorescence and confocal microscopy were used to visualize the virus infection in the cells. We investigated the receptor use and early stages of CV-A9 internalization to SW480 human epithelial colon adenocarcinoma cells. Contrary to A549 infection, we showed that both CV-A9 and CV-A9-RGDdel internalized into SW480 cells and that function-blocking anti-αV integrin antibodies had no effect on the binding and entry of CV-A9. Whereas siRNA silencing of β6 integrin subunit had no influence on virus infection in SW480, silencing of β2-microglobulin (β2M) inhibited the virus infection in both cell lines. By using a peptide phage display screening, the virus-binding peptide identical to the N-terminal sequence of HSPA5 protein was identified and shown to block the virus infection in both A549 and SW480 cell lines. HSPA5 was also found to co-localize with CV-A9 at the SW480 cell periphery during the early stages of infection by confocal

  15. A comparative analysis by SAGE of gene expression profiles of esophageal adenocarcinoma and esophageal squamous cell carcinoma

    NARCIS (Netherlands)

    van Baal, Jantine W. P. M.; Milana, Francesco; Rygiel, Agnieszka M.; Sondermeijer, Carine M. T.; Spek, C. Arnold; Bergman, Jacques J. G. H. M.; Peppelenbosch, Maikel P.; Krishnadath, Kausilia K.

    2008-01-01

    Esophageal adenocarcinoma (EA) and esophageal squamous cell carcinoma (ESCC) are the two main types of esophageal cancer. Despite extensive research the exact molecular basis of these cancers is unclear. Therefore we evaluated the transcriptome of EA in comparison to non-dysplastic Barrett's

  16. Demographic Clinical and Prognostic Factors of Primary Ovarian Adenocarcinomas of Serous and Clear Cell Histology—A Comparative Study

    DEFF Research Database (Denmark)

    Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte

    2016-01-01

    OBJECTIVE: To compare clinical demographic and prognostic factors as well as overall survival in a nationwide cohort of patients diagnosed with ovarian clear cell carcinoma (oCCC) and high grade ovarian serous adenocarcinoma (oSAC) during 2005 to 2013. MATERIALS AND METHODS: Population-based pros...

  17. Expression of G-protein inwardly rectifying potassium channels (GIRKs in lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Schuller Hildegard M

    2005-08-01

    Full Text Available Abstract Background Previous data from our laboratory has indicated that there is a functional link between the β-adrenergic receptor signaling pathway and the G-protein inwardly rectifying potassium channel (GIRK1 in human breast cancer cell lines. We wanted to determine if GIRK channels were expressed in lung cancers and if a similar link exists in lung cancer. Methods GIRK1-4 expression and levels were determined by reverse transcription polymerase chain reaction (RT-PCR and real-time PCR. GIRK protein levels were determined by western blots and cell proliferation was determined by a 5-bromo-2'-deoxyuridine (BrdU assay. Results GIRK1 mRNA was expressed in three of six small cell lung cancer (SCLC cell lines, and either GIRK2, 3 or 4 mRNA expression was detected in all six SCLC cell lines. Treatment of NCI-H69 with β2-adrenergic antagonist ICI 118,551 (100 μM daily for seven days led to slight decreases of GIRK1 mRNA expression levels. Treatment of NCI-H69 with the β-adrenergic agonist isoproterenol (10 μM decreased growth rates in these cells. The GIRK inhibitor U50488H (2 μM also inhibited proliferation, and this decrease was potentiated by isoproterenol. In the SCLC cell lines that demonstrated GIRK1 mRNA expression, we also saw GIRK1 protein expression. We feel these may be important regulatory pathways since no expression of mRNA of the GIRK channels (1 & 2 was found in hamster pulmonary neuroendocrine cells, a suggested cell of origin for SCLC, nor was GIRK1 or 2 expression found in human small airway epithelial cells. GIRK (1,2,3,4 mRNA expression was also seen in A549 adenocarcinoma and NCI-H727 carcinoid cell lines. GIRK1 mRNA expression was not found in tissue samples from adenocarcinoma or squamous cancer patients, nor was it found in NCI-H322 or NCI-H441 adenocarcinoma cell lines. GIRK (1,3,4 mRNA expression was seen in three squamous cell lines, GIRK2 was only expressed in one squamous cell line. However, GIRK1 protein

  18. An increased expression of long non-coding RNA PANDAR promotes cell proliferation and inhibits cell apoptosis in pancreatic ductal adenocarcinoma.

    Science.gov (United States)

    Jiang, Yuehong; Feng, Enhang; Sun, Lifang; Jin, Wei; You, Yuhong; Yao, Yue; Xu, Yi

    2017-11-01

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive malignancies worldwide. Emerging evidence indicates that aberrantly expressed long non-coding RNAs (lncRNAs) act as imperative roles in tumorigenesis and progression. PANDAR (promoter of CDKN1A antisense DNA damage activated RNA) is a novel lncRNA that contributes to the development of various cancers. However, its clinical significance and potential effects on PDAC remains unknown. In the present study, qRT-PCR was performed to explore the expression levels of PANDAR in PDAC tissues and corresponding non-tumor tissues, the correlation between PANDAR expression and clinicopathological characteristics was also analyzed. The functional roles of lncRNA PANDAR in PDAC cells were evaluated both in vitro and in vivo. The results indicated that PANDAR was aberrantly overexpressed in PDAC tissues and cell lines, and this overexpression was closely associated with tumor stage and vascular invasion in PDAC patients. Besides, silencing of PANDAR exerted tumor suppressive effect via reducing cell proliferation, colony-forming ability, inducing cell cycle G0/G1 arrest and apoptosis in PANC1 and Capan-2 cells. Further in vivo study confirmed the oncogenesis role of PANDAR in PDAC cells. Overall, our findings may help to develop a potential therapeutic target for the patients with PDAC. Copyright © 2017. Published by Elsevier Masson SAS.

  19. Antiproliferative effects and mechanisms of liver X receptor ligands in pancreatic ductal adenocarcinoma cells.

    Science.gov (United States)

    Candelaria, Nicholes R; Addanki, Sridevi; Zheng, Jine; Nguyen-Vu, Trang; Karaboga, Husna; Dey, Prasenjit; Gabbi, Chiara; Vedin, Lise-Lotte; Liu, Ka; Wu, Wanfu; Jonsson, Philip K; Lin, Jean Z; Su, Fei; Bollu, Lakshmi Reddy; Hodges, Sally E; McElhany, Amy L; Issazadeh, Mehdi A; Fisher, William E; Ittmann, Michael M; Steffensen, Knut R; Gustafsson, Jan-Åke; Lin, Chin-Yo

    2014-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is difficult to detect early and is often resistant to standard chemotherapeutic options, contributing to extremely poor disease outcomes. Members of the nuclear receptor superfamily carry out essential biological functions such as hormone signaling and are successfully targeted in the treatment of endocrine-related malignancies. Liver X receptors (LXRs) are nuclear receptors that regulate cholesterol homeostasis, lipid metabolism, and inflammation, and LXR agonists have been developed to regulate LXR function in these processes. Intriguingly, these compounds also exhibit antiproliferative activity in diverse types of cancer cells. In this study, LXR agonist treatments disrupted proliferation, cell-cycle progression, and colony-formation of PDAC cells. At the molecular level, treatments downregulated expression of proteins involved in cell cycle progression and growth factor signaling. Microarray experiments further revealed changes in expression profiles of multiple gene networks involved in biological processes and pathways essential for cell growth and proliferation following LXR activation. These results establish the antiproliferative effects of LXR agonists and potential mechanisms of action in PDAC cells and provide evidence for their potential application in the prevention and treatment of PDAC.

  20. Antiproliferative effects and mechanisms of liver X receptor ligands in pancreatic ductal adenocarcinoma cells.

    Directory of Open Access Journals (Sweden)

    Nicholes R Candelaria

    Full Text Available Pancreatic ductal adenocarcinoma (PDAC is difficult to detect early and is often resistant to standard chemotherapeutic options, contributing to extremely poor disease outcomes. Members of the nuclear receptor superfamily carry out essential biological functions such as hormone signaling and are successfully targeted in the treatment of endocrine-related malignancies. Liver X receptors (LXRs are nuclear receptors that regulate cholesterol homeostasis, lipid metabolism, and inflammation, and LXR agonists have been developed to regulate LXR function in these processes. Intriguingly, these compounds also exhibit antiproliferative activity in diverse types of cancer cells. In this study, LXR agonist treatments disrupted proliferation, cell-cycle progression, and colony-formation of PDAC cells. At the molecular level, treatments downregulated expression of proteins involved in cell cycle progression and growth factor signaling. Microarray experiments further revealed changes in expression profiles of multiple gene networks involved in biological processes and pathways essential for cell growth and proliferation following LXR activation. These results establish the antiproliferative effects of LXR agonists and potential mechanisms of action in PDAC cells and provide evidence for their potential application in the prevention and treatment of PDAC.

  1. Apoptosis signal-regulating kinase 1 mediates denbinobin-induced apoptosis in human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Pan Shiow-Lin

    2009-05-01

    Full Text Available Abstract In the present study, we explore the role of apoptosis signal-regulating kinase 1 (ASK1 in denbinobin-induced apoptosis in human lung adenocarcinoma (A549 cells. Denbinobin-induced cell apoptosis was attenuated by an ASK1 dominant-negative mutant (ASK1DN, two antioxidants (N-acetyl-L-cysteine (NAC and glutathione (GSH, a c-Jun N-terminal kinase (JNK inhibitor (SP600125, and an activator protein-1 (AP-1 inhibitor (curcumin. Treatment of A549 cells with denbinobin caused increases in ASK1 activity and reactive oxygen species (ROS production, and these effects were inhibited by NAC and GSH. Stimulation of A549 cells with denbinobin caused JNK activation; this effect was markedly inhibited by NAC, GSH, and ASK1DN. Denbinobin induced c-Jun phosphorylation, the formation of an AP-1-specific DNA-protein complex, and Bim expression. Bim knockdown using a bim short interfering RNA strategy also reduced denbinobin-induced A549 cell apoptosis. The denbinobin-mediated increases in c-Jun phosphorylation and Bim expression were inhibited by NAC, GSH, SP600125, ASK1DN, JNK1DN, and JNK2DN. These results suggest that denbinobin might activate ASK1 through ROS production to cause JNK/AP-1 activation, which in turn induces Bim expression, and ultimately results in A549 cell apoptosis.

  2. Second cancers after squamous cell carcinoma and adenocarcinoma of the cervix

    DEFF Research Database (Denmark)

    Chaturvedi, Anil K; Kleinerman, Ruth A; Hildesheim, Allan

    2008-01-01

    PURPOSE: Although cervical squamous cell carcinoma (SCC) and adenocarcinoma (AC) are both caused by human papillomavirus (HPV) infection, they differ in cofactors such as cigarette smoking. We assessed whether these cofactor differences translate into differences in second cancer risk. PATIENTS...... AND METHODS: We assessed second cancer risk among 85,109 cervical SCC and 10,280 AC survivors reported to population-based cancer registries in Denmark, Finland, Norway, Sweden, and the United States. Risks compared to the general population were assessed using standardized incidence ratios (SIR). RESULTS......: Overall cancer risk was significantly increased among both cervical SCC survivors (n = 10,559 second cancers; SIR, 1.31; 95% CI, 1.29 to 1.34) and AC survivors (n = 920 second cancers; SIR, 1.29; 95% CI, 1.22 to 1.38). Risks of HPV-related and radiation-related cancers were increased to a similar extent...

  3. Clinicopathologic and Molecular Features of Colorectal Adenocarcinoma with Signet-Ring Cell Component.

    Directory of Open Access Journals (Sweden)

    Qing Wei

    Full Text Available We performed a retrospective study to assess the clinicopathological characters, molecular alterations and multigene mutation profiles in colorectal cancer patients with signet-ring cell component.Between November 2008 and January 2015, 61 consecutive primary colorectal carcinomas with signet-ring cell component were available for pathological confirmation. RAS/BRAF status was performed by direct sequencing. 14 genes associated with hereditary cancer syndromes were analyzed by targeted gene sequencing.A slight male predominance was detected in these patients (59.0%. Colorectal carcinomas with signet-ring cell component were well distributed along the large intestine. A frequently higher TNM stage at the time of diagnosis was observed, compared with the conventional adenocarcinoma. Family history of malignant tumor was remarkable with 49.2% in 61 cases. The median OS time of stage IV patients in our study was 14 months. RAS mutations were detected in 22.2% (12/54 cases with KRAS mutations in 16.7% (9/54 cases and Nras mutations in 5.4%(3/54 cases. BRAF V600E mutation was detected in 3.7% (2/54 cases. As an exploration, we analyzed 14 genes by targeted gene sequencing. These genes were selected based on their biological role in association with hereditary cancer syndromes. 79.6% cases carried at least one pathogenic mutation. Finally, the patients were classified by the percentage of signet-ring cell. 39 (63.9% cases were composed of ≥50% signet-ring cells; 22 (36.1% cases were composed of <50% signet-ring cells. We compared clinical parameters, molecular and genetic alterations between the two groups and found no significant differences.Colorectal adenocarcinoma with signet-ring cell component is characterized by advanced stage at diagnosis with remarkable family history of malignant tumor. It is likely a negative prognostic factor and tends to affect male patients with low rates of RAS /BRAF mutation. Colorectal patients with any component of

  4. Effects of NVP-BEZ235 on the proliferation, migration, apoptosis and autophagy in HT-29 human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Yu, Yang; Yu, Xiaofeng; Ma, Jianxia; Tong, Yili; Yao, Jianfeng

    2016-07-01

    The phosphoinositide 3 kinase (PI3K)/Akt/mammalian target of the rapamycin (mTOR) pathway plays a significant role in colorectal adenocarcinoma. NVP-BEZ235 (dactolisib) is a novel dual inhibitor of PI3K/mTOR. The effects of NVP-BEZ235 in human colorectal adenocarcinoma are still unclear. In the present study, we aimed to explore the proliferation, migration, apoptosis and autophagy in HT-29 human colorectal adenocarcinoma cells. HT-29 human colorectal adenocarcinoma cells were treated with NVP-BEZ235 (0, 0.001, 0.01, 0.1, 1 and 3 µM) for 24 and 48 h, respectively. Cells were also treated with NVP-BEZ235 (0.1 µM), DDP (100, 300 and 1,000 µM), and NVP-BEZ235 (0.1 µM) combined with DDP (100, 300 and 1,000 µM) respectively, and cultured for 24 h after treatment. MTT assay was utilized to evaluate the effects of NVP-BEZ235 alone or NVP-BEZ235 combined with cis-diamminedichloroplatinum (DDP) on proliferation of HT-29 cells. Cell wound-scratch assay was used detect cell migration. In addition, expression of microtubule-associated proteins 1A/1B light chain 3B (MAP1LC3B and LC3B) in HT-29 cells was detected by immunofluorescence at 48 h after NVP-BEZ235 (1 µM) treatment. Expression of proteins involved in cell cycle and proliferation (p-Akt, p-mTOR and cyclin D1), apoptosis (cleaved caspase-3), and autophagy (cleaved LC3B and Beclin-1) were detected by western blot analysis. NVP-BEZ235 inhibited the proliferation and migration of HT-29 human colorectal adenocarcinoma cells. NVP-BEZ235 decreased protein expression of p-Akt, p-mTOR and cyclin D1, and increased protein expression of cleaved caspase-3, cleaved LC3B and Beclin-1 as the concentrations and the incubation time of NVP-BEZ235 increased. In addition, NVP-BEZ235 and DDP had synergic effects in inhibiting cell proliferation and migration. The expression of protein involved in apoptosis (cleaved caspase-3) was higher in drug combination group compared to the NVP-BEZ235 single treatment group. NVP-BEZ235

  5. Adenocarcinoma ex-goblet cell carcinoid (appendiceal-type crypt cell adenocarcinoma) is a morphologically distinct entity with highly aggressive behavior and frequent association with peritoneal/intra-abdominal dissemination: an analysis of 77 cases

    OpenAIRE

    Reid, Michelle D.; Basturk, Olca; Shaib, Walid L; Xue, Yue; Balci, Serdar; Choi, Hye-Jeong; Akkas, Gizem; Memis, Bahar; Brian S Robinson; Bassel F. El-Rayes; Staley, Charles A.; Staley, Christopher A; Winer, Joshua H.; Russell, Maria C; Knight, Jessica H

    2016-01-01

    High-grade versions of appendiceal goblet cell carcinoids (?adenocarcinoma ex-goblet cell carcinoids?) are poorly characterized. We herein document 77 examples. Tumors occurred predominantly in females (74%), mean age 55 years (29?84), most with disseminated abdominal (77% peritoneal, 58% gynecologic tract involvement) and stage IV (65%) disease. Many presented to gynecologic oncologists, and nine had a working diagnosis of ovarian carcinoma. Metastases to liver (n =3) and lung (n =1) were un...

  6. VEGF/VEGFR-2 upregulates EZH2 expression in lung adenocarcinoma cells and EZH2 depletion enhances the response to platinum-based and VEGFR-2–targeted therapy

    Science.gov (United States)

    Riquelme, Erick; Suraokar, Milind; Behrens, Carmen; Lin, Heather Y.; Girard, Luc; Nilsson, Monique B.; Simon, George; Wang, Jing; Coombes, Kevin R.; Lee, J. Jack; Hong, Waun Ki; Heymach, John; Minna, John D.; Wistuba, Ignacio I.

    2014-01-01

    Purpose Investigate the mechanisms of regulation and role associated with EZH2 expression in lung cancer cells. Experimental Design We investigated the mechanisms of EZH2 expression associated with the vascular endothelial growth factor (VEGF)/VEGF receptor 2 (VEGFR-2) pathway. Furthermore, we sought to determine the role of EZH2 in response of lung adenocarcinoma to platinum-based chemotherapy, as well as the effect of EZH2 depletion on VEGFR-2–targeted therapy in lung adenocarcinoma cell lines. Additionally, we characterized EZH2 expression in lung adenocarcinoma specimens and correlated it with patients’ clinical characteristics. Results In this study, we demonstrate that VEGF/VEGFR-2 activation induces expression of EZH2 through the upregulation of E2F3 and HIF-1α, and downregulated expression of miR-101. EZH2 depletion by treatment with 3-deazaneplanocin A and knockdown by siRNA decreased the expression of EZH2 and H3K27me3, increased PARP-C level, reduced cell proliferation and migration, and increased sensitivity of the cells to treatment with cisplatin and carboplatin. Additionally, high EZH2 expression was associated with poor overall survival in patients who received platinum-based adjuvant therapy, but not in patients who did not receive this therapy. Furthermore, we demonstrated for the first time that the inhibition of EZH2 greatly increased the sensitivity of lung adenocarcinoma cells to the anti-VEGFR-2 drug AZD2171. Conclusion Our results suggest that VEGF/VEGFR-2 pathway plays a role in regulation of EZH2 expression via E2F3, HIF-1α and miR-101. EZH2 depletion decreases the malignant potential of lung adenocarcinoma and sensitivity of the cells to both platinum-based and VEGFR-2–targeted therapy. PMID:24850841

  7. Fra-1 induces morphological transformation and increases in vitro invasiveness and motility of epithelioid adenocarcinoma cells

    DEFF Research Database (Denmark)

    Kustikova, O.; Kramerov, D.; Grigorian, M.

    1998-01-01

    Two cell lines originating from a common ancestral tumor, CSML0 and CSML100, were used as a model to study AP-1 transcription factors at different steps of tumor progression. CSML0 cells have an epithelial morphology; they express epithelial but not mesenchymal markers and are invasive neither...... component, namely, JunD, detected in both cell lines. We found that the enhanced level of AP-1 in CSML100 cells was due to high expression of Fra-1 and Fra-2 proteins, which were undetectable in CSML0 nuclear extracts. Analysis of the transcription of different AP-1 members in various cell lines derived...... from tumors of epithelial origin revealed a correlation of fra-1 expression with mesenchymal characteristics of carcinoma cells. Moreover, we show here for the first time that the expression of exogenous Fra-1 in epithelioid cells results in morphological changes that resemble fibroblastoid conversion...

  8. Cytotoxic effects of Euterpe oleracea Mart. in malignant cell lines.

    Science.gov (United States)

    Silva, Dulcelena Ferreira; Vidal, Flávia Castello Branco; Santos, Debora; Costa, Maria Célia Pires; Morgado-Díaz, José Andrés; do Desterro Soares Brandão Nascimento, Maria; de Moura, Roberto Soares

    2014-05-29

    Euterpe oleracea Mart., a plant from the Amazon region, is commonly known as açaí or juçara; it has high nutritional value and elevated levels of lipids, proteins, and minerals. Açaí is an abundant and much consumed fruit by the Amazon local population, and studies have demonstrated that it is rich in phytochemicals with antioxidant, anti-inflammatory, and anticancer activities. Therefore, the aim of this study was to test this plant for anticancer activity in different human malignant cell lines. Cell lines derived from breast and colorectal adenocarcinomas were treated with 10, 20, and 40 μg/mL of bark, seed, and total açaí fruit hydroalcoholic extracts for 24 and 48 h. After treatment, cell viability was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays, and cell morphological features were observed by light and transmission electron microscopy. The type of cell death was also evaluated. The data were analyzed statistically by one-way analysis of variance (ANOVA), followed by Dunnett's or Tukey's post hoc tests, as appropriate. We observed that of all the cell lines tested, MCF-7 was the only line that responded to açaí treatment. The extracts caused significant reduction (p<0.01) in cell viability and altered cell morphological features by inducing the appearance of autophagic vacuoles, as observed by transmission electron microscopy. Furthermore, increased expression of LC3BII, a protein marker of autophagosome formation, was observed by western blotting. Caspase Glo™ assays and morphologic observations by DAPI nuclear staining and transmission electron microscopy did not indicate any apoptotic events. The present study demonstrated that açaí possesses antitumorigenic potential in the MCF-7 cell line. Further studies are needed to identify the compound (s) responsible for this cytotoxic activity and the molecular target in the cell. This discovery of the anticancer potential of açaí may help in the

  9. Seminal plasma enhances cervical adenocarcinoma cell proliferation and tumour growth in vivo.

    Directory of Open Access Journals (Sweden)

    Jason R Sutherland

    Full Text Available Cervical cancer is one of the leading causes of cancer-related death in women in sub-Saharan Africa. Extensive evidence has shown that cervical cancer and its precursor lesions are caused by Human papillomavirus (HPV infection. Although the vast majority of HPV infections are naturally resolved, failure to eradicate infected cells has been shown to promote viral persistence and tumorigenesis. Furthermore, following neoplastic transformation, exposure of cervical epithelial cells to inflammatory mediators either directly or via the systemic circulation may enhance progression of the disease. It is well recognised that seminal plasma contains an abundance of inflammatory mediators, which are identified as regulators of tumour growth. Here we investigated the role of seminal plasma in regulating neoplastic cervical epithelial cell growth and tumorigenesis. Using HeLa cervical adenocarcinoma cells, we found that seminal plasma (SP induced the expression of the inflammatory enzymes, prostaglandin endoperoxide synthase (PTGS1 and PTGS2, cytokines interleukin (IL -6, and -11 and vascular endothelial growth factor-A (VEGF-A. To investigate the role of SP on tumour cell growth in vivo, we xenografted HeLa cells subcutaneously into the dorsal flank of nude mice. Intra-peritoneal administration of SP rapidly and significantly enhanced the tumour growth rate and size of HeLa cell xenografts in nude mice. As observed in vitro, we found that SP induced expression of inflammatory PTGS enzymes, cytokines and VEGF-A in vivo. Furthermore we found that SP enhances blood vessel size in HeLa cell xenografts. Finally we show that SP-induced cytokine production, VEGF-A expression and cell proliferation are mediated via the induction of the inflammatory PTGS pathway.

  10. A Potential Daidzein Derivative Enhances Cytotoxicity of Epirubicin on Human Colon Adenocarcinoma Caco-2 Cells

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    2012-12-01

    Full Text Available In this study, we evaluated the effects of 8-hydroxydaidzein (8HD, an isoflavone isolated from fermented soy germ koji, and epirubicin (Epi, an antineoplastic agent, on the production of reactive oxygen species (ROS. We subsequently correlated the ROS levels to the anticancer mechanisms of Epi and 8HD in human colon adenocarcinoma Caco-2 cells. 8HD enhanced cytotoxicity of Epi and generated a synergistic effect. Epi and/or 8HD treatments increased the hydrogen peroxide and superoxide levels. Combined treatment markedly decreased mRNA expression levels of multidrug resistance protein 1 (MDR1, MDR-associated protein (MRP 1, and MRP2. 8HD significantly intensified Epi intracellular accumulation in Caco-2 cells. 8HD and/or Epi-induced apoptosis, as indicated by the reduced mitochondrial membrane potential and increased sub-G1 phase in cell cycle. Moreover, 8HD and Epi significantly enhanced the mRNA expressions of Bax, p53, caspases-3, -8, and -9. To our best knowledge, this study verifies for the first time that 8HD effectively circumvents MDR in Caco-2 cells through the ROS-dependent inhibition of efflux transporters and p53-mediated activation of both death receptor and mitochondrial pathways of apoptosis. Our findings of 8HD shed light on the future search for potential biotransformed isoflavones to intensify the cytotoxicity of anticancer drugs through simultaneous reversal of pump and nonpump resistance.

  11. Composition and antiproliferative effect of essential oil of Origanum vulgare against tumor cell lines.

    Science.gov (United States)

    Begnini, Karine Rech; Nedel, Fernanda; Lund, Rafael Guerra; Carvalho, Pedro Henrique de Azambuja; Rodrigues, Maria Regina Alves; Beira, Fátima Tereza Alves; Del-Pino, Francisco Augusto Burkert

    2014-10-01

    Cancer is a leading cause of death and is responsible for one in eight deaths worldwide. The use of herbs as complementary medicine for cancer, especially advanced cancer, has recently increased. The aim of this study was to evaluate in vitro, the antiproliferative effect of Origanum vulgare against human breast adenocarcinoma (MCF-7), and human colon adenocarcinoma (HT-29). The essential oil (EO) was extracted from a bought amount of O. vulgare dried leaves and analyzed in a gas chromatograph interfaced with a mass selective detector. The cytotoxicity test was performed by sulforhodamine B assay. The results show that the EO is composed mostly of 4-terpineol and induces a high cytotoxicity effect in HT-29. In the MCF-7 cell line the EO was less effective. In conclusion, this study showed that O. vulgare main component is 4-terpineol and was effective in inducing cancer cell growth inhibition.

  12. Assessing CMT cell line stability by two dimensional polyacrylamide gel electrophoresis and mass spectrometry based proteome analysis

    DEFF Research Database (Denmark)

    Zhang, Kelan; Wrzesinski, Krzysztof; Fey, Stephen J

    2008-01-01

    Two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) followed by mass spectrometric identification of the proteins in the protein spots has become a central tool in proteomics. CMT167(H), CMT64(M) and CMT170(L) cell lines, selected from a spontaneous mouse lung adenocarcinoma, with high-...... to be a useful tool for assessing differences in cell line stability. This approach provided a tool to select the best cell line and optimal subculture period for studies of cancer related phenomena and for testing the effect of potential anticancer drugs....

  13. Cost-Effectiveness of an Individualized First-Line Treatment Strategy Offering Erlotinib Based on EGFR Mutation Testing in Advanced Lung Adenocarcinoma Patients in Germany.

    Science.gov (United States)

    Schremser, Katharina; Rogowski, Wolf H; Adler-Reichel, Sigrid; Tufman, Amanda L H; Huber, Rudolf M; Stollenwerk, Björn

    2015-11-01

    Lung cancer is among the top causes of cancer-related deaths. Epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors can increase progression-free survival compared with standard chemotherapy in patients with EGFR mutation-positive advanced non-small cell lung cancer (NSCLC). The aim of the study was to evaluate the cost-effectiveness of EGFR mutation analysis and first-line therapy with erlotinib for mutation-positive patients compared with non-individualized standard chemotherapy from the perspective of German statutory health insurance. A state transition model was developed for a time horizon of 10 years (reference year 2014). Data sources were published data from the European Tarceva versus Chemotherapy (EURTAC) randomized trial for drug efficacy and safety and German cost data. We additionally performed deterministic, probabilistic and structural sensitivity analyses. The individualized strategy incurred 0.013 additional quality-adjusted life-years (QALYs) and additional costs of € 200, yielding an incremental cost-effectiveness ratio (ICER) of € 15,577/QALY. Results were most sensitive to uncertainty in survival curves and changes in utility values. Cross-validating health utility estimates with recent German data increased the ICER to about € 58,000/QALY. The probabilistic sensitivity analysis indicated that the individualized strategy is cost-effective, with a probability exceeding 50 % for a range of possible willingness-to-pay thresholds. The uncertainty of the predicted survival curves is substantial, particularly for overall survival, which was not a primary endpoint in the EURTAC study. Also, there is limited data on quality of life in metastatic lung cancer patients. Individualized therapy based on EGFR mutation status has the potential to provide a cost-effective alternative to non-individualized care for patients with advanced adenocarcinoma. Further clinical research is needed to confirm these results.

  14. Lung Adenocarcinoma and Squamous Cell Carcinoma Gene Expression Subtypes Demonstrate Significant Differences in Tumor Immune Landscape.

    Science.gov (United States)

    Faruki, Hawazin; Mayhew, Gregory M; Serody, Jonathan S; Hayes, D Neil; Perou, Charles M; Lai-Goldman, Myla

    2017-06-01

    Molecular subtyping of lung adenocarcinoma (AD) and lung squamous cell carcinoma (SCC) reveal biologically diverse tumors that vary in their genomic and clinical attributes. Published immune cell signatures and several lung AD and SCC gene expression data sets, including The Cancer Genome Atlas, were used to examine immune response in relation to AD and SCC expression subtypes. Expression of immune cell populations and other immune related genes, including CD274 molecule gene (CD274) (programmed death ligand 1), was investigated in the tumor microenvironment relative to the expression subtypes of the AD (terminal respiratory unit, proximal proliferative, and proximal inflammatory) and SCC (primitive, classical, secretory, and basal) subtypes. Lung AD and SCC expression subtypes demonstrated significant differences in tumor immune landscape. The proximal proliferative subtype of AD demonstrated low immune cell expression among ADs whereas the secretory subtype showed elevated immune cell expression among SCCs. Tumor expression subtype was a better predictor of immune cell expression than CD274 (programmed death ligand 1) in SCC tumors but was a comparable predictor in AD tumors. Nonsilent mutation burden was not correlated with immune cell expression across subtypes; however, major histocompatibility complex class II gene expression was highly correlated with immune cell expression. Increased immune and major histocompatibility complex II gene expression was associated with improved survival in the terminal respiratory unit and proximal inflammatory subtypes of AD and in the primitive subtype of SCC. Molecular expression subtypes of lung AD and SCC demonstrate key and reproducible differences in immune host response. Evaluation of tumor expression subtypes as potential biomarkers for immunotherapy should be investigated. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  15. Spatial distribution of B cells predicts prognosis in human pancreatic adenocarcinoma.

    Science.gov (United States)

    Castino, Giovanni Francesco; Cortese, Nina; Capretti, Giovanni; Serio, Simone; Di Caro, Giuseppe; Mineri, Rossana; Magrini, Elena; Grizzi, Fabio; Cappello, Paola; Novelli, Francesco; Spaggiari, Paola; Roncalli, Massimo; Ridolfi, Cristina; Gavazzi, Francesca; Zerbi, Alessandro; Allavena, Paola; Marchesi, Federica

    2016-04-01

    B-cell responses are emerging as critical regulators of cancer progression. In this study, we investigated the role of B lymphocytes in the microenvironment of human pancreatic ductal adenocarcinoma (PDAC), in a retrospective consecutive series of 104 PDAC patients and in PDAC preclinical models. Immunohistochemical analysis revealed that B cells occupy two histologically distinct compartments in human PDAC, either scatteringly infiltrating (CD20-TILs), or organized in tertiary lymphoid tissue (CD20-TLT). Only when retained within TLT, high density of B cells predicted longer survival (median survival 16.9 mo CD20-TLThi vs. 10.7 mo CD20-TLTlo; p = 0.0085). Presence of B cells within TLT associated to a germinal center (GC) immune signature, correlated with CD8-TIL infiltration, and empowered their favorable prognostic value. Immunotherapeutic vaccination of spontaneously developing PDAC (KrasG12D-Pdx1-Cre) mice with α-enolase (ENO1) induced formation of TLT with active GCs and correlated with increased recruitment of T lymphocytes, suggesting induction of TLT as a strategy to favor mobilization of immune cells in PDAC. In contrast, in an implanted tumor model devoid of TLT, depletion of B cells with an anti-CD20 antibody reinstated an antitumor immune response. Our results highlight B cells as an essential element of the microenvironment of PDAC and identify their spatial organization as a key regulator of their antitumor function. A mindfully evaluation of B cells in human PDAC could represent a powerful prognostic tool to identify patients with distinct clinical behaviors and responses to immunotherapeutic strategies.

  16. Adenocarcinoma and wood.

    Science.gov (United States)

    Schraub, S; Belon-Leneutre, M; Mercier, M; Bourgeois, P

    1989-12-01

    The relation of adenocarcinoma of the facial sinuses and exposure to wood dust has been recognized for 20 years. As the tracheobronchial mucosa is similar to that lining the sinuses, a link between bronchial adenocarcinoma and wood dust exposure has been postulated. To test this hypothesis, a case-control study was conducted, based on all the histologically proven cases of adenocarcinoma of the lung reported to the tumor registry of the Doubs region of France from 1978 to 1985 and random population controls matched for age and residence. A questionnaire on occupational exposure and tobacco consumption was completed by 53 cases and 160 controls. Exposure to wood was similar for both groups, the crude relative risk (odds ratio) being 1.06; adjustment for tobacco consumption did not modify this value. Exposure to wood dust does not seem to be an occupational risk factor in the genesis of bronchial adenocarcinoma.

  17. Identification of crucial microRNAs and genes in hypoxia-induced human lung adenocarcinoma cells

    Directory of Open Access Journals (Sweden)

    Geng Y

    2016-07-01

    Full Text Available Ying Geng,1,* Lili Deng,2,* Dongju Su,1 Jinling Xiao,1 Dongjie Ge,3 Yongxia Bao,1 Hui Jing4 1Department of Respiratory, 2Department of Oncology, The Second Affiliated Hospital of Harbin Medical University, 3Department of Respiratory, The First Hospital of Harbin, 4Department of Emergency, The Second Affiliated Hospital of Harbin Medical University Harbin, Heilongjiang, People’s Republic of China *These authors contributed equally to this work Background: Variations of microRNA (miRNA expression profile in hypoxic lung cancer cells have not been studied so far. Therefore, using miRNA microarray technology, this study aimed to study the miRNA expression profile and investigate the potential crucial miRNAs and their target genes in hypoxia-induced human lung adenocarcinoma cells.Materials and methods: Based on miRNA microarray, miRNA expression profiling of hypoxia-induced lung adenocarcinoma A549 cells was obtained. After identification of differentially expressed miRNAs (DE-miRNAs in hypoxic cells, target genes of DE-miRNAs were predicted, and functional enrichment analysis of targets was conducted. Furthermore, the expression levels of DE-miRNAs and their target genes were validated by real-time quantitative polymerase chain reaction. In addition, using miRNA mimics, the effect of overexpressed DE-miRNAs on A549 cell behaviors (cell proliferation, cell cycle, and apoptosis was evaluated.Results: In total, 14 DE-miRNAs (nine upregulated miRNAs and five downregulated miRNAs were identified in hypoxic cells, compared with normoxic cells. Target genes of both upregulated and downregulated miRNAs were enriched in the functions such as chromatin modification, and pathways such as Wnt signaling pathway and transforming growth factor (TGF-β signaling pathway. The expression levels of several miRNAs and their target genes were confirmed, including hsa-miR-301b/FOXF2, hsa-miR-148b-3p/WNT10B, hsa-miR-769-5p/(SMAD2, ARID1A, and hsa-miR-622. Among them

  18. Molecular Characterization of an Endometrial Endometrioid Adenocarcinoma Metastatic to a Thyroid Hürthle Cell Adenoma Showing Cancerization of Follicles.

    Science.gov (United States)

    Afrogheh, Amir H; Meserve, Emily; Sadow, Peter M; Stephen, Antonia E; Nosé, Vânia; Berlin, Suzanne; Faquin, William C

    2016-09-01

    Tumor-to-tumor metastasis is rare. Herein, we present a unique case of endometrial endometrioid adenocarcinoma metastatic to a thyroid Hürthle cell adenoma 9 years after initial diagnosis. On histologic examination of the thyroid, the malignant endometrioid glands and single cells (donor tumor) were dispersed within the Hürthle cell adenoma (recipient tumor). In several sections of the adenoma with still preserved microfollicular architecture, malignant endometrial adenocarcinoma cells were admixed within oncocytic adenomatous epithelium (so-called "cancerization of the follicles"). This unusual phenomenon, to our knowledge, is a novel finding in the thyroid gland. Immunohistochemistry, subsequently elicited clinical history, and morphologic comparison of the tumor in the thyroid to the primary endometrial tumor confirmed the origin of the donor tumor cells. Molecular analysis of both the metastatic and primary endometrial tumors demonstrated PIK3CA and PTEN mutations in both tumors, as is characteristic of well-differentiated endometrioid tumors of the endometrium. Amplification of chromosome 1q was detected in both sites; however, only the metastatic tumor showed loss of chromosomes 2, 9, and 22. The morphologic differential diagnosis of metastatic endometrioid adenocarcinoma in the thyroid includes columnar cell variant of papillary thyroid carcinoma (CCVPTC) arising in a preexisting adenoma, endocrine glandular atypia within an adenoma, and metastasis from other anatomic sites. Histomorphologic differences among these entities may be subtle; therefore, knowledge of and morphologic comparison with prior malignancies and immunohistochemistry can be helpful in rendering the correct diagnosis.

  19. Needle tract implantation after fine needle aspiration biopsy (FNAB) of transitional cell carcinoma of the urinary bladder and adenocarcinoma of the lung.

    Science.gov (United States)

    Vignoli, M; Rossi, F; Chierici, C; Terragni, R; De Lorenzi, D; Stanga, M; Olivero, D

    2007-07-01

    This paper reports three clinical cases of needle tract implantation of neoplastic cells on the abdominal and thoracic wall after ultrasound (US) fine needle aspiration biopsy (FNAB). Primary tumors were two transitional cell carcinomas of the urinary bladder (2 dogs) and one pulmonary adenocarcinoma (1 cat). All three masses grew up along the needle tract. To our knowledge, the seeding of pulmonary adenocarcinoma cells after FNAB on the thoracic wall has never been reported in veterinary medicine.

  20. Establishment and characterization of a human prostatic carcinoma cell line (PC-3).

    Science.gov (United States)

    Kaighn, M E; Narayan, K S; Ohnuki, Y; Lechner, J F; Jones, L W

    1979-07-01

    The establishment, characterization, and tumorigenicity of a new epithelial cell line (PC-3) from a human prostatic adenocarcinoma metastatic to bone is reported. The cultured cells show anchorage-independent growth in both monolayers and in soft agar suspension and produce subcutaneous tumors in nude mice. Culture of the transplanted tumor yielded a human cell line with characteristics identical to those used initially to produce the tumor. PC-3 has a greatly reduced dependence upon serum for growth when compared to normal prostatic epithelial cells and does not respond to androgens, glucocorticoids, or epidermal or fibroblast gowth factors. Karyotypic analysis by quinacrine banding revealed the cells to be completely aneuploid with a modal chromosome number in the hypotriploid range. At least 10 distinctive marker chromosomes were identified. The overall karyotype as well as the marker chromosomes are distinct from those of the HeLa cell. Electron microscopic studies revealed many features common to neoplastic cells of epithelial origin including numerous microvilli, junctional complexes, abnormal nuclei and nucleoli, abnormal mitochondria, annulate lamellae, and lipoidal bodies. Overall, the functional and morphologic characteristics of PC-3 are those of a poorly-differentiated adenocarcinoma. These cells should be useful in investigating the biochemical changes in advanced prostatic cancer cells and in assessing their response to chemotherapeutic agents.

  1. Characterization of Cancer Stem Cells in Colon Adenocarcinoma Metastasis to the Liver.

    Science.gov (United States)

    Humphries, Hugo N; Wickremesekera, Susrutha K; Marsh, Reginald W; Brasch, Helen D; Mehrotra, Shreeja; Tan, Swee T; Itinteang, Tinte

    2017-01-01

    Fifty percent of colorectal cancer (CRC) patients develop liver metastasis. This study identified and characterized cancer stem cells (CSCs) within colon adenocarcinoma metastasis to the liver (CAML). 3,3-Diaminobenzidine immunohistochemical (IHC) staining was performed on nine CAML samples for embryonic stem cell (ESC) markers OCT4, SOX2, NANOG, c-Myc, and KLF4. Immunofluorescence (IF) IHC staining was performed to investigate coexpression of two markers. NanoString mRNA expression analysis and colorimetric in situ hybridization (CISH) were performed on four snap-frozen CAML tissue samples for transcript expression of these ESC markers. Cells stained positively and negatively for each marker by IHC and CISH staining were counted and analyzed. 3,3-Diaminobenzidine IHC staining, and NanoString and CISH mRNA analyses demonstrated the expression of OCT4, SOX2, NANOG, c-Myc, and KLF4 within in all nine CAML samples, except for SOX2 which was below detectable levels on NanoString mRNA analysis. IF IHC staining showed the presence of a SOX2 + /NANOG + /KLF4 + /c-Myc + /OCT - CSC subpopulation within the tumor nests, and a SOX2 + /NANOG + /KLF4 + /c-Myc + /OCT4 - CSC subpopulation and a SOX2 + /NANOG + /KLF4 + /c-Myc + /OCT4 + CSC subpopulation within the peritumoral stroma. The novel finding of three CSC subpopulations within CAML provides insights into the biology of CRC.

  2. Comparative Proteomic Analysis of Human Lung Adenocarcinoma Cisplatin-resistant Cell Strain A549/CDDP

    Directory of Open Access Journals (Sweden)

    Sien SHI

    2009-11-01

    Full Text Available Background and objective Chemotherapy plays an important role in the comprehensive therapy of lung cancer. However, the drug-resistance often causes the failure of the chemotherapy. The aim of this study is to identify differently expressed protein before and after cisplatin resistance of human lung adenocarcinoma cell A549 by proteomic analysis. Methods Cisplatin-resistant cell strain A549/CDDP was established by combining gradually increasing concentration of cisplatin with large dosage impact. Comparative proteomic analysis of A549 and A549/CDDP were carried out by means of two-dimensional gel electrophoresis. The differentially expressed proteins were detected and identified by MALDI-TOF mass spectrometry. Results Eighty-two differentially expressed proteins were screened by analysis the electrophoretic maps of A549 and A549/CDDP. Six differential proteins were analyzed by peptide mass fingerprinting. Glucose regulating protein 75, ribosomal protein S4, mitochondrial ATP synthase F1 complex beta subunit and immunoglobulin heavy chain variable region were identified. All four differentially expressed proteins were over-expressed in A549/CDDP, whereas low-expressed or no-expressed in A549. Conclusion These differentially expressed proteins give some clues to elucidate the mechanism of lung cancer cell resistant of cisplatin, providing the basis of searching for potential target of chemotherapy of lung cancer.

  3. Mastic Oil Inhibits the Metastatic Phenotype of Mouse Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Heleni Loutrari

    2011-02-01

    Full Text Available Mastic oil from Pistacia lentiscus variation chia, a natural combination of bioactive terpenes, has been shown to exert anti-tumor growth effects against a broad spectrum of cancers including mouse Lewis lung adenocarcinomas (LLC. However, no studies have addressed its anti-metastatic actions. In this study, we showed that treatment of LLC cells with mastic oil within a range of non-toxic concentrations (0.01–0.04% v/v: (a abrogated their Matrigel invasion and migration capabilities in transwell assays; (b reduced the levels of secreted MMP-2; (c restricted phorbol ester-induced actin remodeling and (d limited the length of neo-vessel networks in tumor microenvironment in the model of chick embryo chorioallantoic membrane. Moreover, exposure of LLC and endothelial cells to mastic oil impaired their adhesive interactions in a co-culture assay and reduced the expression of key adhesion molecules by endothelial cells upon their stimulation with tumor necrosis factor-alpha. Overall, this study provides novel evidence supporting a multipotent role for mastic oil in prevention of crucial processes related to cancer metastasis.

  4. Mastic Oil Inhibits the Metastatic Phenotype of Mouse Lung Adenocarcinoma Cells

    Energy Technology Data Exchange (ETDEWEB)

    Loutrari, Heleni, E-mail: elloutrar@med.uoa.gr; Magkouta, Sophia [“G.P. Livanos and M. Simou Laboratories”, Evangelismos Hospital, Department of Critical Care and Pulmonary Services, School of Medicine, University of Athens, 3 Ploutarchou Street, 10675 Athens (Greece); Papapetropoulos, Andreas [Laboratory of Molecular Pharmacology, Department of Pharmacy, University of Patras, 26504 Patras (Greece); Roussos, Charis [“G.P. Livanos and M. Simou Laboratories”, Evangelismos Hospital, Department of Critical Care and Pulmonary Services, School of Medicine, University of Athens, 3 Ploutarchou Street, 10675 Athens (Greece)

    2011-02-23

    Mastic oil from Pistacia lentiscus variation chia, a natural combination of bioactive terpenes, has been shown to exert anti-tumor growth effects against a broad spectrum of cancers including mouse Lewis lung adenocarcinomas (LLC). However, no studies have addressed its anti-metastatic actions. In this study, we showed that treatment of LLC cells with mastic oil within a range of non-toxic concentrations (0.01–0.04% v/v): (a) abrogated their Matrigel invasion and migration capabilities in transwell assays; (b) reduced the levels of secreted MMP-2; (c) restricted phorbol ester-induced actin remodeling and (d) limited the length of neo-vessel networks in tumor microenvironment in the model of chick embryo chorioallantoic membrane. Moreover, exposure of LLC and endothelial cells to mastic oil impaired their adhesive interactions in a co-culture assay and reduced the expression of key adhesion molecules by endothelial cells upon their stimulation with tumor necrosis factor-alpha. Overall, this study provides novel evidence supporting a multipotent role for mastic oil in prevention of crucial processes related to cancer metastasis.

  5. Conventional cytogenetic characterization of a new cell line, ACP01, established from a primary human gastric tumor

    Directory of Open Access Journals (Sweden)

    E.M. Lima

    2004-12-01

    Full Text Available Gastric cancer is the second most frequent type of neoplasia and also the second most important cause of death in the world. Virtually all the established cell lines of gastric neoplasia were developed in Asian countries, and western countries have contributed very little to this area. In the present study we describe the establishment of the cell line ACP01 and characterize it cytogenetically by means of in vitro immortalization. Cells were transformed from an intestinal-type gastric adenocarcinoma (T4N2M0 originating from a 48-year-old male patient. This is the first gastric adenocarcinoma cell line established in Brazil. The most powerful application of the cell line ACP01 is in the assessment of cytotoxicity. Solid tumor cell lines from different origins have been treated with several conventional and investigational anticancer drugs. The ACP01 cell line is triploid, grows as a single, non-organized layer, similar to fibroblasts, with focus formation, heterogeneous division, and a cell cycle of approximately 40 h. Chromosome 8 trisomy, present in 60% of the cells, was the most frequent cytogenetic alteration. These data lead us to propose a multifactorial triggering of gastric cancer which evolves over multiple stages involving progressive genetic changes and clonal expansion.

  6. Biophysical Profiling of Tumor Cell Lines

    Directory of Open Access Journals (Sweden)

    Frederick Coffman

    2011-01-01

    Full Text Available Despite significant differences in genetic profiles, cancer cells share common phenotypic properties, including membrane-associated changes that facilitate invasion and metastasis. The Corning Epic® optical biosensor was used to monitor dynamic mass rearrangements within and proximal to the cell membrane in tumor cell lines derived from cancers of the colon, bone, cervix, lung and breast. Data was collected in real time and required no exogenously added signaling moiety (signal-free technology. Cell lines displayed unique profiles over the time-courses: the time-courses all displayed initial signal increases to maximal values, but the rate of increase to those maxima and the value of those maxima were distinct for each cell line. The rate of decline following the maxima also differed among cell lines. There were correlations between the signal maxima and the observed metastatic behavior of the cells in xenograft experiments; for most cell types the cells that were more highly metastatic in mice had lower time-course maxima values, however the reverse was seen in breast cancer cells. The unique profiles of these cell lines and the correlation of at least one profile characteristic with metastatic behavior demonstrate the potential utility of biophysical tumor cell profiling in the study of cancer biology.

  7. miR-590 accelerates lung adenocarcinoma migration and invasion through directly suppressing functional target OLFM4.

    Science.gov (United States)

    Liu, Yanhong; Wang, Feng; Xu, Peng

    2017-02-01

    MicroRNA-590 (miR-590) shows oncogenic functions in various tumor types, but little is known about biological functions of miR-590 in lung adenocarcinoma. In this study, we observe that miR-590 is not only overexpressed in lung adenocarcinoma tissues and metastatic lymph nodes, but also significantly increased in lung adenocarcinoma cell lines. Moreover, gain-of-function and loss-of-function studies show miR-590 serve as a tumor suppressor regulating lung adenocarcinoma cells migration and invasion. Furthermore, OLFM4 is proved to as a functional target for miR-590 to regulate lung adenocarcinoma cells migration and invasion. In conclusion, miR-590 regulates lung adenocarcinoma metastasis through directly modulating functional target OLFM4. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  8. Effects of fatty acids on benzo[a]pyrene uptake and metabolism in human lung adenocarcinoma A549 cells.

    Directory of Open Access Journals (Sweden)

    Rola Barhoumi

    Full Text Available Dietary supplementation with natural chemoprotective agents is receiving considerable attention because of health benefits and lack of toxicity. In recent in vivo and in vitro experimental studies, diets rich in n-3 polyunsaturated fatty acids have been shown to provide significant anti-tumor action. In this investigation, the effects of control fatty acids (oleic acid (OA, linoleic acid (LA and n-3 PUFA, e.g., docosahexaenoic acid (DHA on the uptake and metabolism of the carcinogenic polycyclic aromatic hydrocarbon, benzo[a]pyrene (BaP was investigated in A549 cells, a human adenocarcinoma alveolar basal epithelial cell line. A549 cells activate BaP through the cytochrome P450 enzyme system to form reactive metabolites, a few of which covalently bind to DNA and proteins. Therefore, multiphoton microscopy spectral analysis combined with linear unmixing was used to identify the parent compound and BaP metabolites formed in cells, in the presence and absence of fatty acids. The relative abundance of select metabolites was associated with altered P450 activity as determined using ethoxyresorufin-O-deethylase activity in cells cultured in the presence of BSA-conjugated fatty acids. In addition, the parent compound within cellular membranes increases significantly in the presence of each of the fatty acids, with the greatest accumulation observed following DHA treatment. DHA treated cells exhibit significantly lower pyrene-like metabolites indicative of lower adducts including DNA adducts compared to control BSA, OA or LA treated cells. Further, DHA reduced the abundance of the proximate carcinogen BaP 7,8-dihydrodiol and the 3-hydroxybenzo[a]pyrene metabolites compared to other treatments. The significant changes in BaP metabolites in DHA treated cells may be mediated by the effects on the physicochemical properties of the membrane known to affect enzyme activity related to phase I and phase II metabolism. In summary, DHA is a highly bioactive chemo

  9. Synthesis of 2,3-diyne-1,4-naphthoquinone derivatives and evaluation of cytotoxic activity against tumor cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Mauro G.; Camara, Celso A.; Silva, Tania M.S., E-mail: ccelso@dcm.ufrpe.br [Universidade Federal Rural de Pernambuco (LSCB/UFRPE), Recife, PE (Brazil). Dept. de Ciencias Moleculares. Lab. de Sintese de Compostos Bioativos; Feitosa, Anderson C.S.; Meira, Assuero S.; Pessoa, Claudia [Universidade Federal do Ceara (LOE/UFC), Fortaleza, CE (Brazil). Dept. de Fisiologia e Farmacologia. Lab. de Oncologia Experimental

    2013-09-15

    A series of 2,3-diyne-1,4-naphthoquinone derivatives was synthesized from 2,3-dibromo- 1,4-naphthoquinone and various functionalized terminal alkynes using palladium-catalyzed Sonogashira cross-coupling reaction. The diynes were evaluated as potential cytotoxic agents against three tumor cell lines: human ovarian adenocarcinoma (OVCAR-8), human metastatic prostate cancer (PC-3M) and human bronchoalveolar lung carcinoma (NCI-H358M), presenting, in general, satisfactory results for inhibition of cell growth. (author)

  10. Osthole inhibits the invasive ability of human lung adenocarcinoma cells via suppression of NF-κB-mediated matrix metalloproteinase-9 expression

    Energy Technology Data Exchange (ETDEWEB)

    Kao, Shang-Jyh [Department of Chest Medicine, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Su, Jen-Liang [Graduate Institute of Cancer Biology, College of Medicine, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung, Taiwan (China); Department of Biotechnology, Asia University, Taichung, Taiwan (China); Chen, Chi-Kuan [Graduate Institute of Toxicology, College of Medicine, National Taiwan University, Taipei, Taiwan (China); Yu, Ming-Chih; Bai, Kuan-Jen; Chang, Jer-Hua [Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Bien, Mauo-Ying [School of Respiratory Therapy, Taipei Medical University, Taipei Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Taipei Medical University-Wan Fang Hospital, Taipei, Taiwan (China); Yang, Shun-Fa [Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Research, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Chien, Ming-Hsien, E-mail: mhchien1976@gmail.com [Graduate Institute of Clinical Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2012-05-15

    The induction of matrix metalloproteinase (MMP)-9 is particularly important for the invasiveness of various cancer cells. Osthole, a natural coumarin derivative extracted from traditional Chinese medicines, is known to inhibit the proliferation of a variety of tumor cells, but the effect of osthole on the invasiveness of tumor cells is largely unknown. This study determines whether and by what mechanism osthole inhibits invasion in CL1-5 human lung adenocarcinoma cells. Herein, we found that osthole effectively inhibited the migratory and invasive abilities of CL1-5 cells. A zymographic assay showed that osthole inhibited the proteolytic activity of MMP-9 in CL1-5 cells. Inhibition of migration, invasion, and MMP2 and/or MMP-9 proteolytic activities was also observed in other lung adenocarcinoma cell lines (H1299 and A549). We further found that osthole inhibited MMP-9 expression at the messenger RNA and protein levels. Moreover, a chromatin immunoprecipitation assay showed that osthole inhibited the transcriptional activity of MMP-9 by suppressing the DNA binding activity of nuclear factor (NF)-κB in the MMP-9 promoter. Using reporter assays with point-mutated promoter constructs further confirmed that the inhibitory effect of osthole requires an NF-κB binding site on the MMP-9 promoter. Western blot and immunofluorescence assays demonstrated that osthole inhibited NF-κB activity by inhibiting IκB-α degradation and NF-κB p65 nuclear translocation. In conclusion, we demonstrated that osthole inhibits NF-κB-mediated MMP-9 expression, resulting in suppression of lung cancer cell invasion and migration, and osthole might be a potential agent for preventing the invasion and metastasis of lung cancer. -- Highlights: ► Osthole treatment inhibits lung adenocarcinoma cells migration and invasion. ► Osthole reduces the expression and proteolytic activity of MMP-9. ► Osthole inhibits MMP-9 transcription via suppression of NF-κB binding activity. ► Osthole

  11. Claudin-1 correlates with poor prognosis in lung adenocarcinoma.

    Science.gov (United States)

    Sun, Bing-Sheng; Yao, Yi-Qun; Pei, Bao-Xiang; Zhang, Zhen-Fa; Wang, Chang-Li

    2016-09-01

    This study was conducted to investigate the clinical significance of claudin-1 (CLDN1) expression in patients with lung adenocarcinoma. We examined CLDN1 protein expression by immunohistochemistry in a tissue microarray from 258 patients with lung adenocarcinoma. We investigated messenger ribonucleic acid (mRNA) expression in H358 (formerly bronchioloalveolar carcinoma) and lung adenocarcinoma cell lines (A549) by real-time reverse transcriptase-polymerase chain reaction. Multivariate analysis showed that prognostic factors for lung adenocarcinoma were histologic type, CLDN1, T stage and N stage. Patients with positive CLDN1 expression had a poorer prognosis than patients with negative CLDN1 expression. CLDN1 expression was correlated with Ras and epidermal growth factor receptor (EGFR) expression. Patients with positive expressions of both CLDN1 and Ras/EGFR had a poorer prognosis than patients with CLDN1 (+) Ras/EGFR(-) or CLDN1 (-) Ras/EGFR(+) and patients with negative expressions of both CLDN1 and Ras/EGFR. CLDN1 mRNA expression was lower in the H358 compared with the lung adenocarcinoma cell line (A549). The combination of CLDN1 and Ras/EGFR is a valuable independent prognostic predictor for lung adenocarcinoma. © 2016 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

  12. Human pancreatic stellate cells modulate 3D collagen alignment to promote the migration of pancreatic ductal adenocarcinoma cells.

    Science.gov (United States)

    Drifka, Cole R; Loeffler, Agnes G; Esquibel, Corinne R; Weber, Sharon M; Eliceiri, Kevin W; Kao, W John

    2016-12-01

    A hallmark of pancreatic ductal adenocarcinoma (PDAC) is the ability for cancer cells to aggressively infiltrate and navigate through a dense stroma during the metastatic process. Key features of the PDAC stroma include an abundant population of activated pancreatic stellate cells (PSCs) and highly aligned collagen fibers; however, important questions remain regarding how collagen becomes aligned and what the biological manifestations are. To better understand how PSCs, aligned collagen, and PDAC cells might cooperate during the transition to invasion, we utilized a microchannel-based in vitro tumor model and advanced imaging technologies to recreate and examine in vivo-like heterotypic interactions. We found that PSCs participate in a collaborative process with cancer cells by orchestrating the alignment of collagen fibers that, in turn, are permissive to enhanced cell migration. Additionally, direct contact between PSCs, collagen, and PDAC cells is critical to invasion and co-migration of both cell types. This suggests PSCs may accompany and assist in navigating PDAC cells through the stromal terrain. Together, our data provides a new role for PSCs in stimulating the metastatic process and underscores the importance of collagen alignment in cancer progression.

  13. Early-Onset Signet-Ring Cell Adenocarcinoma of the Colon: A Case Report and Review of the Literature

    Directory of Open Access Journals (Sweden)

    Maliha Khan

    2017-01-01

    Full Text Available Colorectal cancer (CRC remains the second leading cause of cancer-related deaths in the United States. While a decline has been observed in the older population, the occurrence of CRC in the adolescent and young adult (AYA population has increased over the past two decades. The histopathologic characteristics and clinical behavior of CRC in AYA patients have been shown to be distinct from those of CRC in older adults. The rarer subtypes of CRC such as mucinous adenocarcinoma and signet-ring cell carcinoma are associated with a poorer prognosis compared to the more common subtypes. Here we report a case of a 20-year-old man who was diagnosed with stage IVB (T4 N2 M1, with peritoneal carcinomatosis signet-ring cell adenocarcinoma of the colon. The scarcity of information on these rarer subtypes merits further study and investigation.

  14. Spontaneously Arising Concurrent Ileocaecal Adenocarcinoma and Renal Pelvis Transitional Cell Carcinoma in a Rhesus Macaque (Macaca mulatta)

    Science.gov (United States)

    Gumber, S.; Wood, J. S.; Jones, A. C.; Strobert, E.

    2015-01-01

    Summary A 25-year-old, female rhesus macaque presented with a history of weight loss despite a normal appetite and supportive care. The animal was humanely destroyed due to poor prognosis. Post-mortem examination revealed a focally extensive, firm, white annular constriction at the ileocaecal junction and an incidental finding of a pale white nodule approximately 0.8 cm in diameter in the left renal pelvis. Based on the microscopical findings, ileocaecal adenocarcinoma and renal pelvis transitional cell carcinoma (TCC) was diagnosed. The use of cytokeratin (CK)-7 and-20 and uroplakin III as potential renal TCC markers was evaluated. The neoplastic cells were labelled intensely with antibodies to uroplakin III, but not to CK-7 or -20. Spontaneous intestinal adenocarcinoma has been documented in the rhesus macaque, but concurrent renal pelvis TCC is highly unusual. PMID:24016782

  15. Efficacy of chemotherapy in epidermal growth factor receptor (EGFR) mutated metastatic pulmonary adenocarcinoma patients who had acquired resistance to first-line EGFR tyrosine kinase inhibitor (TKI).

    Science.gov (United States)

    Tseng, Yen-Han; Hung, Hsiu-Ying; Sung, Yi-Chen; Tseng, Yen-Chiang; Lee, Yu-Chin; Whang-Peng, Jacqueline; Chen, Yuh-Min

    2016-01-01

    Salvage chemotherapy is frequently used when tumour epidermal growth factor receptor (EGFR) mutated patients experience disease progression with first-line EGFR-tyrosine kinase inhibitor (TKI) treatment. However, the efficacy of salvage chemotherapy is still unknown. We retrospectively reviewed the chart records of our pulmonary adenocarcinoma patients between 2010 and 2013. Five hundred and six of the 1240 stage IV adenocarcinoma patients had an EGFR mutation and 338 received first-line EGFR-TKI treatment. In all, 169 patients in this group received salvage chemotherapy after failure of EGFR-TKI, and 102 patients were eligible for this study. The chemotherapy response rate of these 102 patients was 24.5%, with a median progression-free survival (PFS) of 4.5?months, and median survival time was 14.6?months. Patients who received pemetrexed-based chemotherapy had longer PFS and overall survival (OS), although the extent was statistically insignificant. Progression-free survival and OS were longer for patients who received combination chemotherapy than single-agent chemotherapy. Pemetrexed-based combination chemotherapy is preferred before a more efficient treatment strategy is found.

  16. Long Noncoding RNA RGMB-AS1 Indicates a Poor Prognosis and Modulates Cell Proliferation, Migration and Invasion in Lung Adenocarcinoma

    Science.gov (United States)

    Li, Ping; Zhang, Guojun; Li, Juan; Yang, Rui; Chen, Shanshan; Wu, Shujun; Zhang, Furui; Bai, Yong; Zhao, Huasi; Wang, Yuanyuan; Dun, Shaozhi; Chen, Xiaonan; Sun, Qianqian; Zhao, Guoqiang

    2016-01-01

    Lung cancer is the most common cause of cancer-related mortality worldwide. It is a complex disease involving multiple genetic and epigenetic alterations. The development of transcriptomics revealed the important role of long non-coding RNAs (lncRNAs) in lung cancer occurrence and development. Here, microarray analysis of lung adenocarcinoma tissues showed the abnormal expression of lncRNA RGMB-AS1. However, the role of lncRNA RGMB-AS1 in lung adenocarcinoma remains largely unknown. We showed that upregulation of lncRNA RGMB-AS1 was significantly correlated with differentiation, TNM stage, and lymph node metastasis. In lung adenocarcinoma cells, downregulation of lncRNA RGMB-AS1 inhibited cell proliferation, migration, invasion, and caused cell cycle arrest at the G1/G0 phase. In vivo experiments showed that lncRNA RGMB-AS1 downregulation significantly suppressed the growth of lung adenocarcinoma. The expression of lncRNA RGMB-AS1 was inversely correlated with that of repulsive guidance molecule b (RGMB) in lung adenocarcinoma tissues, and UCSC analysis and fluorescence detection assay indicated that lncRNA RGMB-AS1 may be involved in the development of human lung adenocarcinoma by regulating RGMB expression though exon2 of RGMB. In summary, our findings indicate that lncRNA RGMB-AS1 may play an important role in lung adenocarcinoma and may serve as a potential therapeutic target. PMID:26950071

  17. Cytotoxicity screening of essential oils in cancer cell lines

    Directory of Open Access Journals (Sweden)

    Pollyanna Francielli de Oliveira

    Full Text Available Abstract This study evaluated the cytotoxicity activity of the essential oils of Tagetes erecta L., Asteraceae (TE-OE, Tetradenia riparia (Hochst. Codd, Lamiaceae (TR-OE, Bidens sulphurea (Cav. Sch. Bip., Asteraceae (BS-OE, and Foeniculum vulgare Mill., Apiaceae (FV-OE, traditionally used in folk medicine, against the tumor cell lines murine melanoma (B16F10, human colon carcinoma (HT29, human breast adenocarcinoma (MCF-7, human cervical adenocarcinoma (HeLa, human hepatocellular liver carcinoma (HepG2, and human glioblastoma (MO59J, U343, and U251. Normal hamster lung fibroblasts (V79 cells were included as control. The cells were treated with essential oil concentrations ranging from 3.12 to 400 µg/ml for 24 h. The cytotoxic activity was evaluated using the XTT assay; results were expressed as IC50, and the selectivity index was calculated. The results were compared with those achieved for classic chemotherapeutic agents. TE-OE was the most promising among the evaluated oils: it afforded the lowest IC50 values for B16F10 cells (7.47 ± 1.08 µg/ml and HT29 cells (6.93 ± 0.77 µg/ml, as well as selectivity indices of 2.61 and 2.81, respectively. The major BS-EO, FV-EO and TE-EO chemical constituents were identified by gas chromatography mass spectrometry as being (E-caryophyllene (10.5%, germacrene D (35.0% and 2,6-di-tert-butyl-4-methylphenol (43.0% (BS-EO; limonene (21.3% and (E-anethole (70.2% (FV-EO; limonene (10.4%, dihydrotagetone (11.8%, α-terpinolene (18.1% and (E-ocimenone (13.0% (TE-EO; and fenchone (6.1%, dronabinol (11.0%, aromadendrene oxide (14.7% and (E,E–farnesol (15.0% (TR-EO. 2,6-di-tert-butyl-4-methylphenol (43.0%, (E-anethole (70.2% and α-terpinolene (18.1%, respectively. These results suggest that TE-OE may be used to treat cancer without affecting normal cells.

  18. Xenon decreases cell migration and secretion of a pro-angiogenesis factor in breast adenocarcinoma cells: comparison with sevoflurane.

    Science.gov (United States)

    Ash, S A; Valchev, G I; Looney, M; Ni Mhathuna, A; Crowley, P D; Gallagher, H C; Buggy, D J

    2014-07-01

    While volatile agents have been implicated in metastasis-enhancing effects on cancer cells, the effects of xenon are unknown. We investigated xenon- and sevoflurane-mediated effects on migration and expression of angiogenesis biomarkers in human breast adenocarcinoma cells. MDA-MB-231 and MCF-7 cells were exposed to xenon 70% with O2 25%, CO2 5%; control gas containing O2 25%, CO2 5%, N2 70%; or sevoflurane 2.5 vol% administered in O2 60%, N2 37%, or control gas. Cell viability was determined by the MTT assay. Migration at 24 h was determined using the Oris™ Cell Migration Assay. Secretion of angiogenesis factors was measured using a membrane-based immunoassay array. Xenon reduced MDA-MB-231 migration to 59 (13%) after 1-h exposure (P=0.02), 64 (10%) after 3 h (P=0.01), and 71 (9%) after 5 h (P=0.04) compared with control gas, without affecting viability. Similarly, MCF-7 migration was significantly reduced at all timepoints [to 58 (12%) at 1 h, 65 (12%) at 3 h, and 65% (12%) at 5 h]. Sevoflurane did not affect migration when delivered in control gas. Glycine, an N-methyl-d-aspartate receptor co-agonist, antagonized the effects of xenon on migration. Expression of the pro-angiogenesis factor regulated on activation, normal T cell expressed and secreted (RANTES) was reduced in conditioned medium from xenon-exposed MDA-MB-231 cells compared with cells exposed to either control gas or sevoflurane [mean dot density 2.0 (0.2) compared with 3.0 (0.1) and 3.1 (0.3), respectively (P=0.02)]. Xenon, but not sevoflurane, inhibited migration in both oestrogen receptor positive and negative breast adenocarcinoma cells. Furthermore, xenon decreased release of the pro-angiogenic factor RANTES from MDA-MB-231 cells. © The Author [2014]. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Secretomic Analysis Identifies Alpha-1 Antitrypsin (A1AT) as a Required Protein in Cancer Cell Migration, Invasion, and Pericellular Fibronectin Assembly for Facilitating Lung Colonization of Lung Adenocarcinoma Cells*

    Science.gov (United States)

    Chang, Ying-Hua; Lee, Shu-Hui; Liao, I-Chuang; Huang, Shin-Huei; Cheng, Hung-Chi; Liao, Pao-Chi

    2012-01-01

    Metastasis is a major obstacle that must be overcome for the successful treatment of lung cancer. Proteins secreted by cancer cells may facilitate the progression of metastasis, particularly within the phases of migration and invasion. To discover metastasis-promoting secretory proteins within cancer cells, we used the label-free quantitative proteomics approach and compared the secretomes from the lung adenocarcinoma cell lines CL1-0 and CL1-5, which exhibit low and high metastatic properties, respectively. By employing quantitative analyses, we identified 660 proteins, 68 of which were considered to be expressed at different levels between the two cell lines. High levels of A1AT were secreted by CL1-5, and the roles of A1AT in the influence of lung adenocarcinoma metastasis were investigated. Molecular and pathological confirmation demonstrated that altered expression of A1AT correlates with the metastatic potential of lung adenocarcinoma. The migration and invasion properties of CL1-5 cells were significantly diminished by reducing the expression and secretion of their A1AT proteins. Conversely, the migration and invasion properties of CL1-0 cells were significantly increased through the overexpression and secretion of A1AT proteins. Furthermore, the assembly levels of the metastasis-promoting pericellular fibronectin (FN1), which facilitates colonization of lung capillary endothelia by adhering to the cell surface receptor dipeptidyl peptidase IV (DPP IV), were higher on the surfaces of suspended CL1-5 cells than on those of the CL1-0 cells. This discovery reflects previous findings in breast cancer. In line with this finding, FN1 assembly and the lung colonization of suspended CL1-5 cells were inhibited when endogenous A1AT protein was knocked down using siRNA. The major thrust of this study is to demonstrate the effects of coupling the label-free proteomics strategy with the secretomes of cancer cells that differentially exhibit invasive and metastatic

  20. Susceptibility of cell lines to avian viruses

    Directory of Open Access Journals (Sweden)

    Simoni Isabela Cristina

    1999-01-01

    Full Text Available The susceptibility of the five cell lines - IB-RS-2, RK-13, Vero, BHK-21, CER - to reovirus S1133 and infectious bursal disease virus (IBDV vaccine GBV-8 strain was studied to better define satisfactory and sensitive cell culture systems. Cultures were compared for presence of CPE, virus titers and detection of viral RNA. CPE and viral RNA were detected in CER and BHK-21 cells after reovirus inoculation and in RK-13 cell line after IBDV inoculation and with high virus titers. Virus replication by production of low virus titers occurred in IB-RS-2 and Vero cells with reovirus and in BHK-21 cell line with IBDV.

  1. ATM Deficiency Generating Genomic Instability Sensitizes Pancreatic Ductal Adenocarcinoma Cells to Therapy-Induced DNA Damage.

    Science.gov (United States)

    Perkhofer, Lukas; Schmitt, Anna; Romero Carrasco, Maria Carolina; Ihle, Michaela; Hampp, Stephanie; Ruess, Dietrich Alexander; Hessmann, Elisabeth; Russell, Ronan; Lechel, André; Azoitei, Ninel; Lin, Qiong; Liebau, Stefan; Hohwieler, Meike; Bohnenberger, Hanibal; Lesina, Marina; Algül, Hana; Gieldon, Laura; Schröck, Evelin; Gaedcke, Jochen; Wagner, Martin; Wiesmüller, Lisa; Sipos, Bence; Seufferlein, Thomas; Reinhardt, Hans Christian; Frappart, Pierre-Olivier; Kleger, Alexander

    2017-10-15

    Pancreatic ductal adenocarcinomas (PDAC) harbor recurrent functional mutations of the master DNA damage response kinase ATM, which has been shown to accelerate tumorigenesis and epithelial-mesenchymal transition. To study how ATM deficiency affects genome integrity in this setting, we evaluated the molecular and functional effects of conditional Atm deletion in a mouse model of PDAC. ATM deficiency was associated with increased mitotic defects, recurrent genomic rearrangements, and deregulated DNA integrity checkpoints, reminiscent of human PDAC. We hypothesized that altered genome integrity might allow synthetic lethality-based options for targeted therapeutic intervention. Supporting this possibility, we found that the PARP inhibitor olaparib or ATR inhibitors reduced the viability of PDAC cells in vitro and in vivo associated with a genotype-selective increase in apoptosis. Overall, our results offered a preclinical mechanistic rationale for the use of PARP and ATR inhibitors to improve treatment of ATM-mutant PDAC. Cancer Res; 77(20); 5576-90. ©2017 AACR. ©2017 American Association for Cancer Research.

  2. A Petiveria alliacea standardized fraction induces breast adenocarcinoma cell death by modulating glycolytic metabolism.

    Science.gov (United States)

    Hernández, John Fredy; Urueña, Claudia Patricia; Cifuentes, Maria Claudia; Sandoval, Tito Alejandro; Pombo, Luis Miguel; Castañeda, Diana; Asea, Alexzander; Fiorentino, Susana

    2014-05-14

    Folk medicine uses aqueous and alcoholic extracts from Petiveria alliacea (Phytolaccaceae) in leukemia and breast cancer treatment in the Caribbean, Central and South America. Herein, we validated the biological activity of a Petiveria alliacea fraction using a metastatic breast adenocarcinoma model (4T1). Petiveria alliacea fraction biological activity was determined estimating cell proliferation, cell colony growth capacity and apoptosis (caspase-3 activity, DNA fragmentation and mitochondrial membrane potential) in 4T1 cells. Petiveria alliacea was used at IC₅₀ concentration (29 µg/mL) and 2 dilutions below, doxorubicin at 0.27 µg/mL (positive control) and dibenzyl disulfide at 2.93 µg/mL (IC50 fraction marker compound). Proteomic estimations were analyzed by LC-MS-MS. Protein level expression was confirmed by RT-PCR. Glucose and lactate levels were measured by enzymatic assays. LD50 was established in BALB/c mice and antitumoral activity evaluated in mice transplanted with GFP-tagged 4T1 cells. Mice were treated with Petiveria alliacea fraction via I.P (182 mg/kg corresponding to 1/8 of LD₅₀ and 2 dilutions below). Petiveria alliacea fraction in vitro induces 4T1 cells apoptosis, caspase-3 activation, DNA fragmentation without mitochondria membrane depolarization, and decreases cell colony growth capacity. Also, changes in glycolytic enzymes expression cause a decrease in glucose uptake and lactate production. Fraction also promotes breast primary tumor regression in BALB/c mice transplanted with GFP-tagged 4T1 cells. A fraction of Petiveria alliacea leaves and stems induces in vitro cell death and in vivo tumor regression in a murine breast cancer model. Our results validate in partly, the traditional use of Petiveria alliacea in breast cancer treatment, revealing a new way of envisioning Petiveria alliacea biological activity. The fraction effect on the glycolytic pathway enzymes contributes to explain the antiproliferative and antitumor activities

  3. Characterization of Cancer Stem Cells in Colon Adenocarcinoma Metastasis to the Liver

    Directory of Open Access Journals (Sweden)

    Hugo N. Humphries

    2018-01-01

    Full Text Available BackgroundFifty percent of colorectal cancer (CRC patients develop liver metastasis. This study identified and characterized cancer stem cells (CSCs within colon adenocarcinoma metastasis to the liver (CAML.Methods3,3-Diaminobenzidine immunohistochemical (IHC staining was performed on nine CAML samples for embryonic stem cell (ESC markers OCT4, SOX2, NANOG, c-Myc, and KLF4. Immunofluorescence (IF IHC staining was performed to investigate coexpression of two markers. NanoString mRNA expression analysis and colorimetric in situ hybridization (CISH were performed on four snap-frozen CAML tissue samples for transcript expression of these ESC markers. Cells stained positively and negatively for each marker by IHC and CISH staining were counted and analyzed.Results3,3-Diaminobenzidine IHC staining, and NanoString and CISH mRNA analyses demonstrated the expression of OCT4, SOX2, NANOG, c-Myc, and KLF4 within in all nine CAML samples, except for SOX2 which was below detectable levels on NanoString mRNA analysis. IF IHC staining showed the presence of a SOX2+/NANOG+/KLF4+/c-Myc+/OCT− CSC subpopulation within the tumor nests, and a SOX2+/NANOG+/KLF4+/c-Myc+/OCT4− CSC subpopulation and a SOX2+/NANOG+/KLF4+/c-Myc+/OCT4+ CSC subpopulation within the peritumoral stroma.ConclusionThe novel finding of three CSC subpopulations within CAML provides insights into the biology of CRC.

  4. Durable complete remission of poor performance status metastatic lung adenocarcinoma patient treated with second-line erlotinib: a case report.

    Science.gov (United States)

    Jovanovic, Dragana; Stevic, Ruza; Velinovic, Marta; Kontic, Milica; Maric, Dragana; Spasic, Jelena; Radosavljevic, Davorin

    2017-01-01

    This paper presents a rare case of an elderly patient treated with erlotinib for disseminated lung adenocarcinoma with poor performance status (Eastern Cooperative Oncology Group performance status [PS]3). This treatment led to a long duration of complete remission according to Response Evaluation Criteria in Solid Tumors 1.1 - almost 7 years (81 months) of progression-free survival (PFS) and overall survival (OS) of 10 years by March 2017. The treatment with erlotinib started in September 2008 and it was well tolerated with no adverse effects. Mutation analyses (real-time polymerase chain reaction method) revealed deletion of EGFR (epidermal growth factor receptor) gene and wild-type Kirsten-ras protein gene in exon 19. In May 2015, the patient relapsed with jaundice and enlarged lymph nodes of the liver hilum, with no other metastasis, PS 2. Biopsy confirmed metastasis of lung adenocarcinoma. EGFR molecular testing did not reveal T790M mutation. Treatment was continued with gemcitabine-cisplatin chemotherapy. A total of six cycles were administered with nearly complete response and Eastern Cooperative Oncology Group performance status 0. Further on, gemcitabine monotherapy has been administered with nearly complete response maintained and OS of 10 years by March 2017. This report describes an extremely rare case of a poor performance patient with advanced metastatic adenocarcinoma harboring EGFR mutation - deletion in exon 19 - who was receiving salvage erlotinib and had a complete response with 81 months of PFS followed by a relapse and subsequent chemotherapy which led to nearly complete response, with an OS of 10 years by March 2017. Such a complete response to tyrosine kinase inhibitor therapy in a poor PS patient, with long PFS and OS achieved, justifies tyrosine kinase inhibitor treatment approach in poor PS patients with EGFR-sensitizing tumors, and furthermore points to the feasibility of administering chemotherapy at the time of relapse.

  5. Difference in membrane repair capacity between cancer cell lines and a normal cell line

    DEFF Research Database (Denmark)

    Frandsen, Stine Krog; McNeil, Anna K.; Novak, Ivana

    2016-01-01

    Electroporation-based treatments and other therapies that permeabilize the plasma membrane have been shown to be more devastating to malignant cells than to normal cells. In this study, we asked if a difference in repair capacity could explain this observed difference in sensitivity. Membrane...... repair was investigated by disrupting the plasma membrane using laser followed by monitoring fluorescent dye entry over time in seven cancer cell lines, an immortalized cell line, and a normal primary cell line. The kinetics of repair in living cells can be directly recorded using this technique......, providing a sensitive index of repair capacity. The normal primary cell line of all tested cell lines exhibited the slowest rate of dye entry after laser disruption and lowest level of dye uptake. Significantly, more rapid dye uptake and a higher total level of dye uptake occurred in six of the seven tested...

  6. Investigations of the Toxic Effect of Silver Nanoparticles on Mammalian Cell Lines

    Directory of Open Access Journals (Sweden)

    F. Sambale

    2015-01-01

    Full Text Available Silver nanoparticles are widely used for many applications. In this study silver nanoparticles have been tested for their toxic effect on fibroblasts (NIH-3T3, on a human lung adenocarcinoma epithelial cell line (A-549, on PC-12-cells, a rat adrenal pheochromocytoma cell line, and on HEP-G2-cells, a human hepatocellular carcinoma cell line. The viability of the cells cultivated with different concentrations of silver was determined by the MTT assay, a photometric method to determine cell metabolism. Dose-response curves were extrapolated and IC50, total lethal concentration (TLC, and no observable adverse effect concentration (NOAEC values were calculated for each cell line. As another approach, ECIS (electric-cell-substrate-impedance-sensing an automated method to monitor cellular behavior in real-time was applied to observe cells cultivated with silver nanoparticles. To identify the type of cell death the membrane integrity was analyzed by measurements of the lactate dehydrogenase releases and by determination of the caspase 3/7 activity. To ensure that the cytotoxic effect of silver nanoparticles is not traced back to the presence of Ag+ ions in the suspension, an Ag+ salt (AgNO3 has been examined at the same concentration of Ag+ present in the silver nanoparticle suspension that is assuming that the Ag particles are completely available as Ag+ ions.

  7. Adenocarcinoma of the Lung Acquiring Resistance to Afatinib by Transformation to Small Cell Carcinoma: A Case Report

    Directory of Open Access Journals (Sweden)

    Jun Nishimura

    2017-07-01

    Full Text Available A 65-year-old woman visited our hospital due to right chest pain and dyspnea on exertion. Chest radiography revealed decreased permeability of the right lung. Computed tomography demonstrated a huge mass in the right upper lobe and right pleural effusion. Right pleural effusion cytology yielded a diagnosis of adenocarcinoma and was positive for mutation of epidermal growth factor receptor (EGFR; exon 21 L858R. Afatinib was selected for the initial treatment. Multiple tumors regressed remarkably, but then rapidly progressed 3 months later. We performed re-biopsy to detect the mechanism of resistance to afatinib. Histopathology revealed a mixture of small cell carcinoma (SCC and adenocarcinoma harboring same EGFR mutation. To the best of our knowledge, this is the first report of transformation to SCC after treatment with afatinib.

  8. Galectin-1 is overexpressed in CD133+ human lung adenocarcinoma cells and promotes their growth and invasiveness

    Science.gov (United States)

    Zhou, Xuefeng; Li, Dan; Wang, Xianguo; Zhang, Bo; Zhu, Hua; Zhao, Jinping

    2015-01-01

    Previous studies demonstrated that a subpopulation of cancer cells, which are CD133 positive (CD133+) feature higher invasive and metastatic abilities, are called cancer stem cells (CSCs). By using tumor cells derived from patients with lung adenocarcinoma, we found that galectin-1 is highly overexpressed in the CD133+ cancer cells as compared to the normal cancer cells (CD133−) from the same patients. We overexpressed galectin-1 in CD133− cancer cells and downregulated it in CSCs. We found that overexpression of galectin-1 promoted invasiveness of CD133− cells, while knockdown of galectin-1 suppressed proliferation, colony formation and invasiveness of CSCs. Furthermore, tumor growth was significantly inhibited in CSCs xenografts with knockdown of galectin-1 as compared to CSCs treated with scramble siRNAs. Biochemical studies revealed that galectin-1 knockdown led to the suppression of COX-2/PGE2 and AKT/mTOR pathways, indicating galectin-1 might control the phenotypes of CSCs by regulating these signaling pathways. Finally, a retrospective study revealed that galectin-1 levels in blood circulation negatively correlates with overall survival and positively correlates with lymph node metastasis of the patients. Taken together, these findings suggested that galectin-1 plays a major role on the tumorigenesis and invasiveness of CD133+ cancer cells and might serve as a potential therapeutic target for treatment of human patients with lung adenocarcinoma. PMID:25605013

  9. ATM protein is deficient in over 40% of lung adenocarcinomas.

    Science.gov (United States)

    Villaruz, Liza C; Jones, Helen; Dacic, Sanja; Abberbock, Shira; Kurland, Brenda F; Stabile, Laura P; Siegfried, Jill M; Conrads, Thomas P; Smith, Neil R; O'Connor, Mark J; Pierce, Andrew J; Bakkenist, Christopher J

    2016-09-06

    Lung cancer is the leading cause of cancer-related mortality in the USA and worldwide, and of the estimated 1.2 million new cases of lung cancer diagnosed every year, over 30% are lung adenocarcinomas. The backbone of 1st-line systemic therapy in the metastatic setting, in the absence of an actionable oncogenic driver, is platinum-based chemotherapy. ATM and ATR are DNA damage signaling kinases activated at DNA double-strand breaks (DSBs) and stalled and collapsed replication forks, respectively. ATM protein is lost in a number of cancer cell lines and ATR kinase inhibitors synergize with cisplatin to resolve xenograft models of ATM-deficient lung cancer. We therefore sought to determine the frequency of ATM loss in a tissue microarray (TMA) of lung adenocarcinoma. Here we report the validation of a commercial antibody (ab32420) for the identification of ATM by immunohistochemistry and estimate that 61 of 147 (41%, 95% CI 34%-50%) cases of lung adenocarcinoma are negative for ATM protein expression. As a positive control for ATM staining, nuclear ATM protein was identified in stroma and immune infiltrate in all evaluable cases. ATM loss in lung adenocarcinoma was not associated with overall survival. However, our preclinical findings in ATM-deficient cell lines suggest that ATM could be a predictive biomarker for synergy of an ATR kinase inhibitor with standard-of-care cisplatin. This could improve clinical outcome in 100,000's of patients with ATM-deficient lung adenocarcinoma every year.

  10. Adenocarcinoma of the rectum in patients under age 40 is increasing: impact of signet-ring cell histology.

    Science.gov (United States)

    Tawadros, Patrick S; Paquette, Ian M; Hanly, Ann M; Mellgren, Anders F; Rothenberger, David A; Madoff, Robert D

    2015-05-01

    Overall, the incidence of colorectal cancer appears to be stable or diminishing. However, based on our practice pattern, we observed that the incidence of rectal cancer in patients under 40 is increasing and may be associated with a prominence of signet-ring cell histology. The aim of this study was to verify the rising trend in rectal cancer in patients under 40 and describe the histology prominent in that cohort. This is a retrospective cohort study. We performed a retrospective cohort study of all patients diagnosed with rectal adenocarcinoma from 1980 to 2010 using the Surveillance, Epidemiology, and End Results cancer registry. Rectal cancer incidence, histology, and associated staging characteristics were the primary outcomes measured. Although the incidence of rectal cancer for all ages remained stable from 1980 to 2010, we observed an annual percent change of +3.6% in the incidence of rectal cancer in patients under 40. The prevalence of signet cell histology in patients under 40 was significantly greater than in patients over 40 (3% vs 0.87%, p < 0.01). A multivariate regression analysis revealed an adjusted odds ratio of 3.6 (95% CI, 2.6-5.1) for signet cell histology in rectal adenocarcinoma under age 40. Signet cell histology was also significantly associated with a more advanced stage at presentation, poorly differentiated tumor grade, and worse prognosis compared with mucinous and nonmucinous rectal adenocarcinoma. The study was limited by its retrospective nature and the information available in the Surveillance, Epidemiology, and End Results database. Despite a stable incidence of rectal cancer for all ages, the incidence in patients under 40 has quadrupled since 1980, and cancers in this group are 3.6 times more likely to have signet cell histology. Given the worse outcomes associated with signet cell histology, these data highlight a need for thorough evaluation of young patients with rectal symptoms.

  11. Estrogen and cigarette sidestream smoke particulate matter exhibit ERα-dependent tumor-promoting effects in lung adenocarcinoma cells.

    Science.gov (United States)

    Kuo, Lun-Cheng; Cheng, Li-Chuan; Lee, Chia-Huei; Lin, Chun-Ju; Chen, Pei-Yu; Li, Lih-Ann

    2017-09-01

    Estrogen and secondhand smoke are key risk factors for nonsmoking female lung cancer patients who frequently have lung adenocarcinoma and show tumor estrogen receptor α (ERα) expression. We speculated that estrogen and secondhand smoke might cause harmful effects via ERα signaling. Our results showed that 17β-estradiol (E2), the primary form of endogenous estrogen, exacerbated proliferation, migration, and granzyme B resistance of lung adenocarcinoma cells in an ERα-dependent manner. Cigarette sidestream smoke particulate matter (CSSP), the major component of secondhand smoke, could activate ERα activity dose dependently in human lung adenocarcinoma cells. The estrogenic activity of CSSP was abolished by an ERα-selective antagonist. CSSP regulated the nuclear entry, phosphorylation, and turnover of ERα similarly to E2. Furthermore, CSSP enhanced E2-stimulated ERα activity and Ser118 phosphorylation even when ERα became saturated with E2. Activation of ERα by CSSP required GSK3β activity, but not involving polycyclic aromatic hydrocarbons, reactive oxygen species, calcium, epidermal growth factor receptor, and PI3K/Akt. Although CSSP possessed cytotoxicity, ERα-expressing cells grew and migrated faster than nonexpressing cells on recovery from CSSP exposure as observed in E2-pretreated cells. Knockdown of ERα by siRNA diminished E2- and CSSP-stimulated cell migration. Twenty-one genes, including SERPINB9, were identified to be upregulated by both E2 and CSSP via ERα. Increased SERPINB9 expression was accompanied with increased resistance to granzyme B-mediated apoptosis. This study demonstrates that estrogen has ERα-dependent tumor-promoting activity. CSSP acts like estrogen and shows a potential to enhance estrogen-induced ERα action. Copyright © 2017 the American Physiological Society.

  12. LAP TGF-Beta Subset of CD4+CD25+CD127− Treg Cells is Increased and Overexpresses LAP TGF-Beta in Lung Adenocarcinoma Patients

    Directory of Open Access Journals (Sweden)

    Lorenzo Islas-Vazquez

    2015-01-01

    Full Text Available Lung cancer is the leading cause of cancer death worldwide. Adenocarcinoma, the most commonly diagnosed histologic type of lung cancer, is associated with smoking. Cigarette smoke promotes inflammation on the airways, which might be mediated by Th17 cells. This inflammatory environment may contribute to tumor development. In contrast, some reports indicate that tumors may induce immunosuppressive Treg cells to dampen immune reactivity, supporting tumor growth and progression. Thus, we aimed to analyze whether chronic inflammation or immunosuppression predominates at the systemic level in lung adenocarcinoma patients, and several cytokines and Th17 and Treg cells were studied. Higher proportions of IL-17-producing CD4+ T-cells were found in smoking control subjects and in lung adenocarcinoma patients compared to nonsmoking control subjects. In addition, lung adenocarcinoma patients increased both plasma concentrations of IL-2, IL-4, IL-6, and IL-10, and proportions of Latency Associated Peptide (LAP TGF-β subset of CD4+CD25+CD127− Treg cells, which overexpressed LAP TGF-β. This knowledge may lead to the development of immunotherapies that could inhibit the suppressor activity mediated by the LAP TGF-β subset of CD4+CD25+CD127− Treg cells to promote reactivity of immune cells against lung adenocarcinoma cells.

  13. The Synergistic Effects of Low Dose Fluorouracil and TRAIL on TRAIL-Resistant Human Gastric Adenocarcinoma AGS Cells

    Directory of Open Access Journals (Sweden)

    Hong Zhu

    2013-01-01

    Full Text Available The TNF-related apoptosis-inducing ligand (TRAIL is a TNF family member which has been under intense focus because of its remarkable ability to induce apoptosis in malignant human cells while leaving normal cells unscathed. However, many cancer cells remain resistant to TRAIL. In this study, we had investigated the synergistic effects of low dose fluorouracil (5-Fu and TRAIL on TRAIL-resistant human gastric adenocarcinoma AGS cells and explored the potential mechanisms. Cell viability was analyzed by sulforhodamine B (SRB assay and the synergistic effects were evaluated by Jin’s formula and confirmed by both morphological changes under inverted microscope and flow cytometry. The expression of TRAIL-R1 (death receptor 4, DR4, TRAIL-R2 (DR5, TRAIL-R3 (decoy receptor, DcR1, TRAIL-R4 (DcR2, procaspase-3, procaspase-8, and procaspase-9 was detected by western blotting. Our results showed that there were significant synergistic effects of low dose 5-Fu and TRAIL on TRAIL-resistant AGS cells, and this effect was supposed to be mediated by decreasing DcR2 expression and increasing DR5 expression. The extrinsic and intrinsic apoptosis pathways were both activated. The data suggest that combined treatment of low dose 5-Fu and TRAIL can be an effective therapeutic approach for gastric adenocarcinoma.

  14. NMR metabolomics of human lung tumours reveals distinct metabolic signatures for adenocarcinoma and squamous cell carcinoma.

    Science.gov (United States)

    Rocha, Cláudia M; Barros, António S; Goodfellow, Brian J; Carreira, Isabel M; Gomes, Ana; Sousa, Vitor; Bernardo, João; Carvalho, Lina; Gil, Ana M; Duarte, Iola F

    2015-01-01

    Lung tumour subtyping, particularly the distinction between adenocarcinoma (AdC) and squamous cell carcinoma (SqCC), is a critical diagnostic requirement. In this work, the metabolic signatures of lung carcinomas were investigated through (1)H NMR metabolomics, with a view to provide additional criteria for improved diagnosis and treatment planning. High Resolution Magic Angle Spinning Nuclear Magnetic Resonance (NMR) spectroscopy was used to analyse matched tumour and adjacent control tissues from 56 patients undergoing surgical excision of primary lung carcinomas. Multivariate modeling allowed tumour and control tissues to be discriminated with high accuracy (97% classification rate), mainly due to significant differences in the levels of 13 metabolites. Notably, the magnitude of those differences were clearly distinct for AdC and SqCC: major alterations in AdC were related to phospholipid metabolism (increased phosphocholine, glycerophosphocholine and phosphoethanolamine, together with decreased acetate) and protein catabolism (increased peptide moieties), whereas SqCC had stronger glycolytic and glutaminolytic profiles (negatively correlated variations in glucose and lactate and positively correlated increases in glutamate and alanine). Other tumour metabolic features were increased creatine, glutathione, taurine and uridine nucleotides, the first two being especially prominent in SqCC and the latter in AdC. Furthermore, multivariate analysis of AdC and SqCC profiles allowed their discrimination with a 94% classification rate, thus showing great potential for aiding lung tumours subtyping. Overall, this study has provided new, clear evidence of distinct metabolic signatures for lung AdC and SqCC, which can potentially impact on diagnosis and provide important leads for future research on novel therapeutic targets or imaging tracers. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Cartilage oligomeric matrix protein (COMP)-mediated cell differentiation to proteolysis mechanism networks from human normal adjacent tissues to lung adenocarcinoma.

    Science.gov (United States)

    Wang, Lin; Huang, Juxiang; Jiang, Minghu; Diao, Haizhen; Zhou, Huilei; Li, Xiaohe; Chen, Qingchun; Jiang, Zhenfu; Feng, Haitao; Wolfl, Stefan

    2013-01-01

    To understand cartilage oligomeric matrix protein (COMP) mechanism network from human normal adjacent tissues to lung adenocarcinoma. COMP complete different activated (all no positive correlation, Pearson CC lung adenocarcinoma compared with lower human normal adjacent tissues from the corresponding COMP-stimulated (≥0.25) or inhibited (Pearson CC ≤ -0.25) overlapping molecules of Pearson correlation coefficient (CC) and GRNInfer, respectively. COMP complete different activated and inhibited (all no positive correlation, Pearson CC lung adenocarcinoma and lower human normal adjacent tissues were constructed by integration of Pearson CC, GRNInfer and GO. As visualized by integration of GO, KEGG, GenMAPP, BioCarta and Disease, we deduced COMP complete different activated and inhibited network in higher lung adenocarcinoma and lower human normal adjacent tissues. As visualized by GO, KEGG, GenMAPP, BioCarta and disease database integration, we proposed mainly that the mechanism and function of COMP complete different activated network in higher lung adenocarcinoma was involved in COMP activation with matrix-localized insulin-like factor coupling carboxypeptidase to metallopeptidase-induced proteolysis, whereas the corresponding inhibited network in lower human normal adjacent tissues participated in COMP inhibition with nucleus-localized vasculogenesis, B and T cell differentiation and neural endocrine factors coupling pyrophosphatase-mediated proteolysis. However, COMP complete different inhibited network in higher lung adenocarcinoma included COMP inhibition with nucleus-localized chromatin maintenance, licensing and assembly factors coupling phosphatase-inhibitor to cytokinesis regulators-mediated cell differentiation, whereas the corresponding activated network in lower human normal adjacent tissues contained COMP activation with cytolplasm-localized translation elongation factor coupling fucosyltransferase to ubiquitin-protein ligase-induced cell

  16. Comprehensive pharmacological profiling of neurofibromatosis cell lines.

    Science.gov (United States)

    Guo, Jianman; Grovola, Michael R; Xie, Hong; Coggins, Grace E; Duggan, Patrick; Hasan, Rukhsana; Huang, Jiale; Lin, Danny W; Song, Claire; Witek, Gabriela M; Berritt, Simon; Schultz, David C; Field, Jeffrey

    2017-01-01

    Patients with Neurofibromatosis type 1 (NF1) and Neurofibromatosis type 2 (NF2) are predisposed to tumors of the nervous system. NF1 patients predominantly develop neurofibromas, and Malignant Peripheral Nerve Sheath Tumors (MPNST) while NF2 patients develop schwannomas and meningiomas. Here we quantified the drug sensitivities of NF1 and NF2 tumor cell lines in a high throughput platform. The platform contained a comprehensive collection of inhibitors of MEK, RAF, RAS, farnesyl transferase, PAK and ERK, representative drugs against many other cancer pathways including Wnt, Hedgehog, p53, EGF, HDAC, as well as classical cytotoxic agents recommended for treating MPNST, such as doxorubicin and etoposide. We profiled seven NF1-associated MPNST cell lines (ST88-14, ST88-3, 90-8, sNF02.2, T265, S462TY, SNF96.2), one sporadic MPNST cell line (STS26), one schwannoma from a NF2 patient (HEI193), one NF2-deficient malignant meningioma (KT21-MG-Luc5D), one mouse NF2 schwannoma (SC4) and one sporadic rat schwannoma (RT4-67 or RT4). NF1 cells were primarily distinguished from NF2 cells and the sporadic MPNST cell line by their sensitivity to MEK and ERK inhibitors, and to a smaller extent their sensitivity to BH3 mimetics and farnesyl transferase inhibitors. The platform was highly successful in predicting the effects of clinical trials for Neurofibromas.

  17. Bax translocation into mitochondria during dihydroartemisinin(DHA)-induced apoptosis in human lung adenocarcinoma cells

    Science.gov (United States)

    Lu, Ying-ying; Chen, Tong-sheng; Qu, Jun-Le

    2009-02-01

    Dihydroartemisinin (DHA), a semi-synthetic derivative of artemisinin, isolated from the traditional Chinese herb Artemisia annua, has been shown to possess promising anticancer activities and induce cancer cell death through apoptotic pathways. However, the molecular mechanisms are not well understood. This study was investigated in human lung adenocarconoma ASTC-a-1 cell line and aimed to determine whether the apoptotic process was mediated by Bax activation and translocation during DHA-induced apoptosis. In this study, DHA induced a time-dependent apoptotic cell death, which was assayed by Cell Counting Kit (CCK-8) and Hoechst 33258 staining. Detection of Bax aggregation and translocation to mitochondria was observed in living cells which were co-transfected with GFP-Bax and Dsred-mito plasmid using confocal fluorescence microscope technique. Overall, these results demonstrated that Bax activation and translocation to mitochondria occurred during DHA-induced apoptosis.

  18. Cell Line Data Base: structure and recent improvements towards molecular authentication of human cell lines

    Science.gov (United States)

    Romano, Paolo; Manniello, Assunta; Aresu, Ottavia; Armento, Massimiliano; Cesaro, Michela; Parodi, Barbara

    2009-01-01

    The Cell Line Data Base (CLDB) is a well-known reference information source on human and animal cell lines including information on more than 6000 cell lines. Main biological features are coded according to controlled vocabularies derived from international lists and taxonomies. HyperCLDB (http://bioinformatics.istge.it/hypercldb/) is a hypertext version of CLDB that improves data accessibility by also allowing information retrieval through web spiders. Access to HyperCLDB is provided through indexes of biological characteristics and navigation in the hypertext is granted by many internal links. HyperCLDB also includes links to external resources. Recently, an interest was raised for a reference nomenclature for cell lines and CLDB was seen as an authoritative system. Furthermore, to overcome the cell line misidentification problem, molecular authentication methods, such as fingerprinting, single-locus short tandem repeat (STR) profile and single nucleotide polymorphisms validation, were proposed. Since this data is distributed, a reference portal on authentication of human cell lines is needed. We present here the architecture and contents of CLDB, its recent enhancements and perspectives. We also present a new related database, the Cell Line Integrated Molecular Authentication (CLIMA) database (http://bioinformatics.istge.it/clima/), that allows to link authentication data to actual cell lines. PMID:18927105

  19. Enhancement of effects of irradiation by gemcitabine in a glioblastoma cell line and cell line spheroids

    NARCIS (Netherlands)

    Genç, Mine; Castro Kreder, Natasja; Barten-van Rijbroek, Angelique; Stalpers, Lukas J. A.; Haveman, Jaap

    2004-01-01

    Background and purpose. To determine the cytotoxicity of, and radioenhancement by, gemcitabine on a glioma cell line grown as a monolayer and as spheroid cultures. Material and methods. We used a human glioma cell line, Gli-6, which originated from a biopsy specimen of a patient with a glioblastoma

  20. Cell Line Data Base: structure and recent improvements towards molecular authentication of human cell lines.

    Science.gov (United States)

    Romano, Paolo; Manniello, Assunta; Aresu, Ottavia; Armento, Massimiliano; Cesaro, Michela; Parodi, Barbara

    2009-01-01

    The Cell Line Data Base (CLDB) is a well-known reference information source on human and animal cell lines including information on more than 6000 cell lines. Main biological features are coded according to controlled vocabularies derived from international lists and taxonomies. HyperCLDB (http://bioinformatics.istge.it/hypercldb/) is a hypertext version of CLDB that improves data accessibility by also allowing information retrieval through web spiders. Access to HyperCLDB is provided through indexes of biological characteristics and navigation in the hypertext is granted by many internal links. HyperCLDB also includes links to external resources. Recently, an interest was raised for a reference nomenclature for cell lines and CLDB was seen as an authoritative system. Furthermore, to overcome the cell line misidentification problem, molecular authentication methods, such as fingerprinting, single-locus short tandem repeat (STR) profile and single nucleotide polymorphisms validation, were proposed. Since this data is distributed, a reference portal on authentication of human cell lines is needed. We present here the architecture and contents of CLDB, its recent enhancements and perspectives. We also present a new related database, the Cell Line Integrated Molecular Authentication (CLIMA) database (http://bioinformatics.istge.it/clima/), that allows to link authentication data to actual cell lines.

  1. Tramadol regulates proliferation, migration and invasion via PTEN/PI3K/AKT signaling in lung adenocarcinoma cells.

    Science.gov (United States)

    Xia, M; Tong, J-H; Ji, N-N; Duan, M-L; Tan, Y-H; Xu, J-G

    2016-06-01

    Tramadol is used mainly for the treatment of moderate to severe chronic cancer pain. However, the effect of tramadol on lung cancer remains unclear. Therefore, it is important to explore the mechanism accounting for the function of tramadol on lung cancer. We investigated the effects of tramadol on the proliferation, migration and invasion in human lung adenocarcinoma cells in vitro by CCK-8 assay, wound healing assay and Transwell assay, respectively. We also explored the potential mechanism of tramadol on lung cancer cells by Western blotting. A549 and PC-9 cells were incubated with 2 µM tramadol for different time (0, 7, 14 and 28 d). The in vitro experiments showed that tramadol treatment significantly inhibited cell proliferation, migration and invasion in a time-dependent manner. Moreover, administration of tramadol suppressed tumor growth in vivo. The data also revealed that tramadol could up-regulate the protein expression level of PTEN and consistently inhibit the phosphorylation level of PI3K and Akt, whereas the total level of PI3K and Akt remain unchanged. These findings indicated that tramadol inhibited proliferation, migration and invasion of human lung adenocarcinoma cells through elevation of PTEN and inactivation of PI3K/Akt signaling.

  2. Cytotoxic Activity of Selected Iranian Traditional Medicinal Plants on Colon, Colorectal and Breast Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Leila Mohammad Taghizadeh Kashani

    2014-11-01

    Full Text Available Background: Many natural products from plants have been recognized to exert anticancer activity. In this study, ethanolic extracts of selected medicinal herbs from Iranian flora including Alyssum homolocarpum Fisch. (from seeds, Urtica dioica L. (from aerial parts, Cichorium intybus L. (from roots and Solanum nigrum L. (from fruits, were evaluated for their cytotoxic effect on different cell lines.Methods: Cytotoxic effect of these extracts was studied on three different cancer cell lines; colon carcinoma (HT-29, colorectal adenocarcinoma (Caco-2 and breast ductal carcinoma (T47D. In addition, Swiss mouse embryo fibroblasts (NIH 3T3 were used as normal nonmalignant cells. MTT assay (3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide was utilized for calculating the cytotoxicity of extracts on cell lines.Results: Results showed the potent cytotoxic activity of U. dioica ethanolic extract against T47D cell line with IC50 value of 46.14±4.55 µg/ml. Other extracts showed poor activity with IC50>100 µg/ml.Conclusions: Cytotoxic activity recorded in the present study revealed high potential antiproliferative activity of U. dioica ethanolic extract against T47D cell line. The real IC50 values of this extract may be considerably lower than the IC50 measured in our study if its pharmacological active compounds become pure. The results emphasize the importance of studies on U. dioica ethanolic extract to characterize potential components as cytotoxic natural medicines.

  3. Telomerase inhibition by siRNA causes senescence and apoptosis in Barrett's adenocarcinoma cells: mechanism and therapeutic potential

    Directory of Open Access Journals (Sweden)

    Batchu Ramesh B

    2005-07-01

    Full Text Available Abstract Background In cancer cells, telomerase induction helps maintain telomere length and thereby bypasses senescence and provides enhanced replicative potential. Chemical inhibitors of telomerase have been shown to reactivate telomere shortening and cause replicative senescence and apoptotic cell death of tumor cells while having little or no effect on normal diploid cells. Results We designed siRNAs against two different regions of telomerase gene and evaluated their effect on telomere length, proliferative potential, and gene expression in Barrett's adenocarcinoma SEG-1 cells. The mixture of siRNAs in nanomolar concentrations caused a loss of telomerase activity that appeared as early as day 1 and was essentially complete at day 3. Inhibition of telomerase activity was associated with marked reduction in median telomere length and complete loss of detectable telomeres in more than 50% of the treated cells. Telomere loss caused senescence in 40% and apoptosis in 86% of the treated cells. These responses appeared to be associated with activation of DNA sensor HR23B and subsequent activation of p53 homolog p73 and p63 and E2F1. Changes in these gene regulators were probably the source of observed up-regulation of cell cycle inhibitors, p16 and GADD45. Elevated transcript levels of FasL, Fas and caspase 8 that activate death receptors and CARD 9 that interacts with Bcl10 and NFKB to enhance mitochondrial translocation and activation of caspase 9 were also observed. Conclusion These studies show that telomerase siRNAs can cause effective suppression of telomerase and telomere shortening leading to both cell cycle arrest and apoptosis via mechanisms that include up-regulation of several genes involved in cell cycle arrest and apoptosis. Telomerase siRNAs may therefore be strong candidates for highly selective therapy for chemoprevention and treatment of Barrett's adenocarcinoma.

  4. TLR7 expression is decreased during tumour progression in transgenic adenocarcinoma of mouse prostate mice and its activation inhibits growth of prostate cancer cells.

    Science.gov (United States)

    Han, Ju-Hee; Park, Shin-Young; Kim, Jin-Bum; Cho, Sung-Dae; Kim, Bumseok; Kim, Bo-Yeon; Kang, Min-Jung; Kim, Dong-Jae; Park, Jae-Hak; Park, Jong-Hwan

    2013-10-01

    Although various Toll-like receptors (TLRs) have been associated with immune response and tumorigenesis in the prostate cells, little is known about the role of TLR7. Accordingly, we examined the expression of TLR7 during tumour progression of TRMAP (transgenic mouse model for prostate cancer) mice and its role on cell growth. Toll-like receptor7 expression was examined by RT-polymerase chain reaction (PCR), Western blot, and immunohistochemistry. Cell growth was examined by MTT assay. Colony formation was investigated by crystal violet staining. Strong expression of TLR7 was detected in the normal prostate epithelia of Wild-type (WT) mice, but not in TLR7-deficient mice. In contrast, TLR7 expression was weak in transgenic adenocarcinoma of mouse prostate (TRAMP)-C2 cells, as compared with murine bone marrow-derived macrophages (BMDMs). Moreover, TLR7 mRNA was markedly expressed in RWPE-1 cells (non-cancerous prostate epithelial cells), but not in PC3 and DU145 (prostate cancer cells). Immunohistochemically, TLR7 expression gradually decreased in TRAMP mice depending on the pathologic grade of the prostate cells. TLR7 agonists increased both the gene and protein expression of TLR7 and promoted production of proinflammatory cytokines/chemokines and IFN-β gene expression in prostate cancer cell lines. Moreover, loxoribine inhibited the growth and colony formation of TRAMP-C2 cells dependent of TLR7. These findings suggest that TLR7 may participate in tumour suppression in the prostate cells. © 2013 John Wiley & Sons Ltd.

  5. Effects of teicoplanin on cell number of cultured cell lines

    Directory of Open Access Journals (Sweden)

    Kashkolinejad-Koohi Tahere

    2015-03-01

    Full Text Available Teicoplanin is a glycopeptide antibiotic with a wide variation in human serum half-life. It is also a valuable alternative of vancomycin. There is however no study on its effect on cultured cells. The aim of the present study was to test the effect of teicoplanin on cultured cell lines CHO, Jurkat E6.1 and MCF-7. The cultured cells were exposed to teicoplanin at final concentrations of 0–11000 μg/ml for 24 hours. To determine cell viability, the 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT test was performed. At low concentrations of teicoplanin the numbers of cultured cells (due to cell proliferation were increased in the three cell lines examined. The maximum cell proliferation rates were observed at concentrations of 1000, 400, and 200 μg/ml of teicoplanin for CHO, MCF-7 and Jurkat cell lines, respectively. Cell toxicity was observed at final concentrations over 2000, 6000, and 400 μg/ml of teicoplanin for CHO, MCF-7 and Jurkat cell lines, respectively. A dose-dependent manner of cell toxicity was observed. Our present findings indicated that teicoplanin at clinically used concentrations induced cell proliferation. It should therefore be used cautiously, particularly in children, pregnant women and patients with cancer.

  6. Fraction against Human Cancer Cell Lines

    African Journals Online (AJOL)

    Purpose: To investigate the anti-proliferative and apoptotic activity of crude and dichloromethane fraction of A. sieberi against seven cancer cell lines (Colo20, HCT116, DLD, MCF7, Jurkat, HepG2 and. L929). Methods: A. sieberi was extracted with methanol and further purification was carried out using liquid-.

  7. Transitional cell cancer: establishment and characterization of cell lines.

    Science.gov (United States)

    Elliott, A Y; Bronson, D L; Fraley, E E

    1978-12-01

    Eleven long-term (in culture more than 1 yr) cell lines were established from surgical specimens of human TCC. Characterization studies performed on the individual cell lines showed that each 1) demonstrated an abnormal human karyotype, 2) grew in soft agar, 3) exhibited rapid growth and multilayering 4) was free from microbial and HeLa cell contamination, 5) produced tumors in cheek pouches of immunosuppressed Syrian golden hamsters, 6) contained ultrastructural features consistently found in epithelial cells in culture, and 7) could be grown to high cell densities in roller-bottle cultures.

  8. DAG/PKCδ and IP3/Ca²⁺/CaMK IIβ Operate in Parallel to Each Other in PLCγ1-Driven Cell Proliferation and Migration of Human Gastric Adenocarcinoma Cells, through Akt/mTOR/S6 Pathway.

    Science.gov (United States)

    Dai, Lianzhi; Zhuang, Luhua; Zhang, Bingchang; Wang, Fen; Chen, Xiaolei; Xia, Chun; Zhang, Bing

    2015-12-01

    Phosphoinositide specific phospholipase Cγ (PLCγ) activates diacylglycerol (DAG)/protein kinase C (PKC) and inositol 1,4,5-trisphosphate (IP3)/Ca(2+)/calmodulin-dependent protein kinase II (CaMK II) axes to regulate import events in some cancer cells, including gastric adenocarcinoma cells. However, whether DAG/PKCδ and IP3/Ca(2+)/CaMK IIβ axes are simultaneously involved in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells and the underlying mechanism are not elucidated. Here, we investigated the role of DAG/PKCδ or CaMK IIβ in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells, using the BGC-823 cell line. The results indicated that the inhibition of PKCδ and CaMK IIβ could block cell proliferation and migration of BGC-823 cells as well as the effect of inhibiting PLCγ1, including the decrease of cell viability, the increase of apoptotic index, the down-regulation of matrix metalloproteinase (MMP) 9 expression level, and the decrease of cell migration rate. Both DAG/PKCδ and CaMK IIβ triggered protein kinase B (Akt)/mammalian target of rapamycin (mTOR)/S6 pathway to regulate protein synthesis. The data indicate that DAG/PKCδ and IP3/Ca(2+)/CaMK IIβ operate in parallel to each other in PLCγ1-driven cell proliferation and migration of human gastric adenocarcinoma cells through Akt/mTOR/S6 pathway, with important implication for validating PLCγ1 as a molecular biomarker in early gastric cancer diagnosis and disease surveillance.

  9. Grape waste extract obtained by supercritical fluid extraction contains bioactive antioxidant molecules and induces antiproliferative effects in human colon adenocarcinoma cells.

    Science.gov (United States)

    Lazzè, Maria Claudia; Pizzala, Roberto; Gutiérrez Pecharromán, Francisco Javier; Gatòn Garnica, Paloma; Antolín Rodríguez, Juan Manuel; Fabris, Nicola; Bianchi, Livia

    2009-06-01

    Grape waste management is one of the main problems of winery industries, but, conversely, grape waste contains a high amount of polyphenols that might protect against human diseases related to oxidative stress, such as colorectal cancer. Therefore, the aim of this work was to investigate the antioxidant and antiproliferative activities of a grape waste extract obtained by supercritical fluid extraction. Because the beneficial effect of grape is related to its content of polyphenolic molecules, the extract was chemically characterized by high-performance liquid chromatography in order to assess its major bioactive components. The antioxidant activity of the grape extract was determined. The results showed that the grape extract presents a strong antiradical activity in the in vitro 2,2-diphenyl-1-picrylhydrazyl radical assay and protects against reactive oxygen species production in human colon adenocarcinoma cells (Caco-2). In contrast, the extract did not protect in the citronellal thermooxidation system and showed a weak protective action against lipid peroxidation in Caco-2 cells. The clonogenic assay and the cell cycle distribution analysis showed that the grape extract has a significant antiproliferative effect in a tumor cell line. These data indicate that grape extract is a promising product to be used as an anti-free radical agent and could exert a chemopreventive action.

  10. Antiproliferative efficacy of Tabernaemontana divaricata against HEP2 cell line and Vero cell line.

    Science.gov (United States)

    Kumar, Arvind; Selvakumar, S

    2015-05-01

    Laryngeal cancer may also be called cancer of the larynx or laryngeal carcinoma. Conventional plants are a precious source of novel anticancer agents and are still in performance better role in health concern. The study was intended to estimation of the anticancer activity of the chloroformic extract of Tabernaemontana divaricata on the human epidermoid larynx carcinoma cell line (Hep 2). The aerial parts (leaves, stem, and flowers) of T. divaricata were tested for its inhibitory effect in 96 microplate formats against Hep 2 cell line. The anticancer activity of samples on Hep 2 and Vero was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and various enzymatic parameters like catalase, reduced glutathione (GSH), GSH peroxidase, and superoxide anion scavenging activity. Viable cells were determined by the absorbance at 540 nm. Measurements were performed, and the concentration required for a 50% inhibition of viability (IC50) was determined graphically. The effect of the samples on the proliferation of Hep 2 and Vero cells was expressed as the % cell viability. The extract on Hep 2 cell line up to 7.8 μg/ml and that IC50 value on Hep 2 cell line was 112 μg whereas 94 μg for Vero cell line. Hence, T. divaricata has lesser significant action on Vero cell line. Medicinal plant drug discovery continues to provide new and important leads against various pharmacological targets including cancer. Our results clearly indicate the anticancer property of the medicinal plant T. divaricata against the human laryngeal carcinoma cell lines (Hep 2 cell line).

  11. Crosstalk between EGFR and integrin affects invasion and proliferation of gastric cancer cell line, SGC7901

    Directory of Open Access Journals (Sweden)

    Dan L

    2012-10-01

    Full Text Available Li Dan,1,* Ding Jian,2,* Lin Na,1 Wang Xiaozhong,1 1Digestive Department, the Union Hospital of Fujian Medical University, Fujian, People’s Republic of China; 2Digestive Department, the First Affiliated Hospital of Fujian Medical University, Fuzhou, Fujian, People’s Republic of China*These authors contributed equally to this workBackground/objective: To investigate the crosstalk between epidermal growth factor receptor (EGFR and integrin-mediated signal transduction pathways in human gastric adenocarcinoma cells.Methods: EGF was used as a ligand of EGFR to stimulate the gastric adenocarcinoma cell, SGC7901. Signal molecules downstream of the integrin, FAK(Y397 and p130cas(Y410 phosphorylation, were measured by immunoprecipitation and western blot. Fibronectin (Fn was used as a ligand of integrin to stimulate the same cell line. Signal molecules downstream of EGFR and extracellular signal-regulated kinase (ERK general phosphorylation were also measured. Focal adhesion kinase (FAK small-interfering RNA was designed and transfected into SGC7901 cells to decrease the expression of FAK. Modified Boyden chambers and MTT assay were used to examine the effect of FAK inhibition on the invasiveness and proliferation of SGC7901.Results: EGF activated FAK(Y397 and p130cas(Y410 phosphorylation, while Fn activated ERK general phosphorylation. Inhibition of FAK expression decreased p130cas(Y410 phosphorylation activated by EGF and ERK general phosphorylation activated by Fn, also decreased the invasiveness and proliferation of SGC7901 cells activated by EGF or Fn.Conclusion: There is crosstalk between EGFR and integrin signal transduction. FAK may be a key cross point of the two signal pathways and acts as a potential target for human gastric cancer therapy.Keywords: gastric adenocarcinoma, epidermal growth factor receptor, integrin, focal adhesion kinase, crosstalk

  12. In vitro evaluation of the cellular effect of indium tin oxide nanoparticles using the human lung adenocarcinoma A549 cells.

    Science.gov (United States)

    Tabei, Yosuke; Sonoda, Akinari; Nakajima, Yoshihiro; Biju, Vasudevanpillai; Makita, Yoji; Yoshida, Yasukazu; Horie, Masanori

    2015-05-01

    Indium tin oxide (ITO) is widely used in liquid crystal displays (LCDs) or plasma and mobile phone displays. Elevated production and usage of ITO in such displays have led to increased concerns over the safety of industrial workers exposed to particulate aerosols produced during cutting, grinding and polishing of these materials. However, the cellular effects of ITO nanoparticles (NPs) are still unclear, although it has been reported that micro-scale ITO particles induce cytotoxicity. The aim of this study was to examine the potential of ITO NPs to induce cytotoxicity, oxidative stress, and DNA damage using human lung adenocarcinoma A549 cells. Here, stable dispersions of a medium containing ITO NPs were obtained using pre-adsorption and centrifugal fractionation methods, and the A549 cells were incubated in this medium. The ITO NPs showed low cytotoxic effects as shown by the WST-1 and LDH assays. Transmission electron microscopy observations showed the cellular uptake of ITO NPs. The ITO NPs increased the intracellular level of reactive oxygen species and the expression of the heme oxygenase 1 gene. Further, the results of alkaline comet assays showed that ITO NPs induced DNA damage. Thus, these results suggest that ITO NPs possess a genotoxic potential on human lung adenocarcinoma A549 cells.

  13. Monocarboxylate transporters MCT1 and MCT4 regulate migration and invasion of pancreatic ductal adenocarcinoma cells

    DEFF Research Database (Denmark)

    Kong, Su Chii; Nøhr-Nielsen, Asbjørn; Zeeberg, Katrine

    2016-01-01

    and MCT4 (messenger RNA, protein) were robustly expressed in all PDAC lines, localizing to the plasma membrane. Lactate influx capacity was highest in AsPC-1 cells and lowest in HPDE cells and was inhibited by the MCT inhibitor α-cyano-4-hydroxycinnamate (4-CIN), MCT1/MCT2 inhibitor AR-C155858......, or knockdown of MCT1 or MCT4. PDAC cell migration was largely unaffected by MCT1/MCT2 inhibition or MCT1 knockdown but was reduced by 4-CIN and by MCT4 knockdown (BxPC-3). Invasion measured in Boyden chamber (BxPC-3, Panc-1) and spheroid outgrowth (BxPC-3) assays was attenuated by 4-CIN and AR-C155858...

  14. 1-(2,6-Dihydroxy-4-methoxyphenyl-2-(4-hydroxyphenyl Ethanone-Induced Cell Cycle Arrest in G1/G0 in HT-29 Cells Human Colon Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Ma Ma Lay

    2014-01-01

    Full Text Available 1-(2,6-Dihydroxy-4-methoxyphenyl-2-(4-hydroxyphenyl ethanone (DMHE was isolated from the ethyl acetate fraction of Phaleria macrocarpa (Scheff. Boerl fruits and the structure confirmed by GC-MS (gas chromatography-mass spectrometry and NMR (nuclear magnetic resonance analysis. This compound was tested on the HT-29 human colon adenocarcinoma cell line using MTT (method of transcriptional and translational cell proliferation assay. The results of MTT assay showed that DMHE exhibited good cytotoxic effect on HT-29 cells in a dose- and time-dependent manner but no cytotoxic effect on the MRC-5 cell line after 72 h incubation. Morphological features of apoptotic cells upon treatment by DMHE, e.g., cell shrinkage and membrane blebbing, were examined by an inverted and phase microscope. Other features, such as chromatin condension and nuclear fragmentation were studied using acridine orange and propidium iodide staining under the fluorescence microscope. Future evidence of apoptosis/necrosis was provided by result fromannexin V-FITC/PI (fluorescein-isothiocyanate/propidium iodide staining revealed the percentage of early apoptotic, late apoptotic, necrotic and live cells in a dose- and time-dependent manner using flow cytometry. Cell cycle analysis showed G0/G1 arrest in a time-dependent manner. A western blot analysis indicated that cell death might be associated with the up-regulation of the pro-apoptotic proteins Bax PUMA. However, the anit-apotptic proteins Bcl-2, Bcl-xL, and Mcl-1 were also found to increase in a time-dependent manner. The expression of the pro-apoptotic protein Bak was not observed.

  15. Amplification and expression of a cellular oncogene (c-myc) in human gastric adenocarcinoma cells.

    Science.gov (United States)

    Shibuya, M; Yokota, J; Ueyama, Y

    1985-01-01

    Three of 16 human gastric adenocarcinoma samples, maintained as solid tumors in nude mice, were found to carry amplified c-myc genes. In two samples with a high degree of c-myc DNA amplification (15- to 30-fold), double minute chromosomes were observed in karyotype analysis. The level of c-myc RNA was markedly elevated in a rapidly growing and poorly differentiated tumor, whereas it was only slightly elevated in a slowly growing and more differentiated tumor. Images PMID:2579323

  16. Cancer stem cell-like cells from a single cell of oral squamous carcinoma cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Felthaus, O. [Department of Operative Dentistry and Periodontology, University of Regensburg (Germany); Department of Oral and Maxillofacial Surgery, University of Regensburg (Germany); Ettl, T.; Gosau, M.; Driemel, O. [Department of Oral and Maxillofacial Surgery, University of Regensburg (Germany); Brockhoff, G. [Department of Gynecology and Obstetrics, University of Regensburg (Germany); Reck, A. [Department of Oral and Maxillofacial Surgery, University of Regensburg (Germany); Zeitler, K. [Institute of Pathology, University of Regensburg (Germany); Hautmann, M. [Department of Radiotherapy, University of Regensburg (Germany); Reichert, T.E. [Department of Oral and Maxillofacial Surgery, University of Regensburg (Germany); Schmalz, G. [Department of Operative Dentistry and Periodontology, University of Regensburg (Germany); Morsczeck, C., E-mail: christian.morsczeck@klinik.uni-regensburg.de [Department of Operative Dentistry and Periodontology, University of Regensburg (Germany)

    2011-04-01

    Research highlights: {yields} Four oral squamous cancer cell lines (OSCCL) were analyzed for cancer stem cells (CSCs). {yields} Single cell derived colonies of OSCCL express CSC-marker CD133 differentially. {yields} Monoclonal cell lines showed reduced sensitivity for Paclitaxel. {yields} In situ CD133{sup +} cells are slow cycling (Ki67-) indicating a reduced drug sensitivity. {yields} CD133{sup +} and CSC-like cells can be obtained from single colony forming cells of OSCCL. -- Abstract: Resistance of oral squamous cell carcinomas (OSCC) to conventional chemotherapy or radiation therapy might be due to cancer stem cells (CSCs). The development of novel anticancer drugs requires a simple method for the enrichment of CSCs. CSCs can be enriched from OSCC cell lines, for example, after cultivation in serum-free cell culture medium (SFM). In our study, we analyzed four OSCC cell lines for the presence of CSCs. CSC-like cells could not be enriched with SFM. However, cell lines obtained from holoclone colonies showed CSC-like properties such as a reduced rate of cell proliferation and a reduced sensitivity to Paclitaxel in comparison to cells from the parental lineage. Moreover, these cell lines differentially expressed the CSC-marker CD133, which is also upregulated in OSCC tissues. Interestingly, CD133{sup +} cells in OSCC tissues expressed little to no Ki67, the cell proliferation marker that also indicates reduced drug sensitivity. Our study shows a method for the isolation of CSC-like cell lines from OSCC cell lines. These CSC-like cell lines could be new targets for the development of anticancer drugs under in vitro conditions.

  17. A universal mammalian vaccine cell line substrate.

    Directory of Open Access Journals (Sweden)

    Jackelyn Murray

    Full Text Available Using genome-wide small interfering RNA (siRNA screens for poliovirus, influenza A virus and rotavirus, we validated the top 6 gene hits PV, RV or IAV to search for host genes that when knocked-down (KD enhanced virus permissiveness and replication over wild type Vero cells or HEp-2 cells. The enhanced virus replication was tested for 12 viruses and ranged from 2-fold to >1000-fold. There were variations in virus-specific replication (strain differences across the cell lines examined. Some host genes (CNTD2, COQ9, GCGR, NDUFA9, NEU2, PYCR1, SEC16G, SVOPL, ZFYVE9, and ZNF205 showed that KD resulted in enhanced virus replication. These findings advance platform-enabling vaccine technology, the creation of diagnostic cells substrates, and are informative about the host mechanisms that affect virus replication in mammalian cells.

  18. Selenoesters and selenoanhydrides as novel multidrug resistance reversing agents: A confirmation study in a colon cancer MDR cell line.

    Science.gov (United States)

    Gajdács, Márió; Spengler, Gabriella; Sanmartín, Carmen; Marć, Małgorzata Anna; Handzlik, Jadwiga; Domínguez-Álvarez, Enrique

    2017-02-15

    Taking into account that multidrug resistance (MDR) is the main cause for chemotherapeutic failure in cancer treatment and as a continuation of our efforts to overcome this problem we report the evaluation of one cyclic selenoanhydride (1) and ten selenoesters (2-11) in MDR human colon adenocarcinoma Colo 320 cell line. The most potent derivatives (1, 9-11) inhibited the ABCB1 efflux pump much stronger than the reference compound verapamil. Particularly, the best one (9) was 4-fold more potent than verapamil at a 10-fold lower concentration. Furthermore, the evaluated derivatives exerted a potent and selective cytotoxic activity. In addition, they were strong apoptosis inducers as the four derivatives triggered apoptotic events in a 64-72% of the examined MDR Colo 320 human adenocarcinoma cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Paradoxical antiproliferative effect by a murine mammary tumor-derived epithelial cell line

    Directory of Open Access Journals (Sweden)

    Scharovsky O Graciela

    2007-10-01

    Full Text Available Abstract Background Despite significant advancement in breast cancer therapy, there is a great need for a better understanding of the mechanisms involved in breast carcinogenesis and progression, as well as of the role of epigenetic contributions from stromal cells in mammary tumorigenesis. In this study, we isolated and characterized murine mammary tumor-derived epithelial and myofibroblast cell lines, and investigated the in vitro and in vivo effect of cellular soluble factors produced by the epithelial cell line on tumor cells. Methods Morphology, immunophenotype, cytogenetics, invasiveness, and tumorigenicity of epithelial (LM-234ep and myofibroblast (LM-234mf cell lines isolated from two murine mammary adenocarcinomas with common ancestor were studied. The in vitro effects of LM-234ep conditioned medium on proliferation, cell cycle distribution, and expression of cell cycle proteins, were investigated in LM-234mf cells, mouse melanoma cells (B16-F10, and human cervical adenocarcinoma cells (HeLa. The in vivo anti-tumor activity of LM-234ep conditioned media was evaluated in subcutaneous tumors formed in nude mice by B16-F10 and HeLa cells. Results LM-234ep cells were found to be cytokeratin positive and hipertriploid, whereas LM-234mf cells were α-smooth muscle actin positive and hypohexaploid. Chromosome aberrations were found in both cases. Only LM-234mf revealed to be invasive in vitro and to secrete active MMP-2, though neither of the cell types were able to produce progressing tumors. LM-234ep-derived factors were able to inhibit the in vitro growth of LM-234mf, B16-F10, and HeLa cells, inducing cell cycle arrest in G0/G1 phase. The administration of LM-234ep conditioned medium inhibited the growth of B16-F10 and HeLa tumors in nude mice. Conclusion Our data suggest the existence of epithelial cell variants with tumor suppressive properties within mammary tumors. To our knowledge, this is the first report showing antiproliferative and

  20. The cornerstone K-RAS mutation in pancreatic adenocarcinoma: From cell signaling network, target genes, biological processes to therapeutic targeting.

    Science.gov (United States)

    Jonckheere, Nicolas; Vasseur, Romain; Van Seuningen, Isabelle

    2017-03-01

    RAS belongs to the super family of small G proteins and plays crucial roles in signal transduction from membrane receptors in the cell. Mutations of K-RAS oncogene lead to an accumulation of GTP-bound proteins that maintains an active conformation. In the pancreatic ductal adenocarcinoma (PDAC), one of the most deadly cancers in occidental countries, mutations of the K-RAS oncogene are nearly systematic (>90%). Moreover, K-RAS mutation is the earliest genetic alteration occurring during pancreatic carcinogenetic sequence. In this review, we discuss the central role of K-RAS mutations and their tremendous diversity of biological properties by the interconnected regulation of signaling pathways (MAPKs, NF-κB, PI3K, Ral…). In pancreatic ductal adenocarcinoma, transcriptome analysis and preclinical animal models showed that K-RAS mutation alters biological behavior of PDAC cells (promoting proliferation, migration and invasion, evading growth suppressors, regulating mucin pattern, and miRNA expression). K-RAS also impacts tumor microenvironment and PDAC metabolism reprogramming. Finally we discuss therapeutic targeting strategies of K-RAS that have been developed without significant clinical success so far. As K-RAS is considered as the undruggable target, targeting its multiple effectors and target genes should be considered as potential alternatives. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Small cell lung cancer transformation from EGFR-mutated lung adenocarcinoma: A case report and literatures review.

    Science.gov (United States)

    Liu, Yangyang

    2018-02-20

    Epithelial growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) have markedly improved the response of non-small cell lung cancer (NSCLC) with EGFR-mutant patients. However, these patients inevitably come cross acquired resistance to EGFR-TKIs. The transformation of lung adenocarcinoma to small cell lung cancer (SCLC) following treatment with EGFR-TKIs is rare, which leads to resistance to EGFR-TKIs. The present case concerns a case of a 38-year-old man presenting with cough and dyspnea. Radical resection was performed and confirmed an EGFR exon 21 L858R lung adenocarcinoma. However, the patient suffered pleural metastasis after successful treatment with surgery and adjuvant treatment. So, erlotinib was administered with 18 months. Because of enlarged pleural nodule, repeat biopsy identified an SCLC and chemotherapy was started. However, despite the brief success of chemotherapy, our patient suffered brain metastasis. Our case emaphsizes both the profile of transformation from NSCLC to SCLC and the importance of repeat biopsy dealing with drug resistance. We also summarize the clinical characteristics, mechanisms, predictors of SCLC transformation, treatment after transformation and other types of transformation to SCLC.

  2. Urachal Adenocarcinoma

    African Journals Online (AJOL)

    Cancer. 1991; 67:2165-72. 6. Thali-Schwab CM, Woodward PJ, Wagner BJ. Computed tomographic appearance of urachal adenocarcinomas: review of 25 cases. Eur Radiol. 2005; 15:79-84. 7. Wong-You-Cheong JJ, Woodward PJ, Manning. MA, et al. Neoplasms of the urinary bladder: radiologic-pathologic correlation.

  3. Curcumin inhibits growth potential by G1 cell cycle arrest and induces apoptosis in p53-mutated COLO 320DM human colon adenocarcinoma cells.

    Science.gov (United States)

    Dasiram, Jade Dhananjay; Ganesan, Ramamoorthi; Kannan, Janani; Kotteeswaran, Venkatesan; Sivalingam, Nageswaran

    2017-02-01

    Curcumin, a natural polyphenolic compound and it is isolated from the rhizome of Curcuma longa, have been reported to possess anticancer effect against stage I and II colon cancer. However, the effect of curcumin on colon cancer at Dukes' type C metastatic stage III remains still unclear. In the present study, we have investigated the anticancer effects of curcumin on p53 mutated COLO 320DM human colon adenocarcinoma cells derived from Dukes' type C metastatic stage. The cellular viability and proliferation were assessed by trypan blue exclusion assay and MTT assay, respectively. The cytotoxicity effect was examined by lactate dehydrogenase (LDH) cytotoxicity assay. Apoptosis was analyzed by DNA fragmentation analysis, Hoechst and propidium iodide double fluorescent staining and confocal microscopy analysis. Cell cycle distribution was performed by flow cytometry analysis. Here we have observed that curcumin treatment significantly inhibited the cellular viability and proliferation potential of p53 mutated COLO 320DM cells in a dose- and time-dependent manner. In addition, curcumin treatment showed no cytotoxic effects to the COLO 320DM cells. DNA fragmentation analysis, Hoechst and propidium iodide double fluorescent staining and confocal microscopy analysis revealed that curcumin treatment induced apoptosis in COLO 320DM cells. Furthermore, curcumin caused cell cycle arrest at the G1 phase, decreased the cell population in the S phase and induced apoptosis in COLO 320DM colon adenocarcinoma cells. Together, these data suggest that curcumin exerts anticancer effects and induces apoptosis in p53 mutated COLO 320DM human colon adenocarcinoma cells derived from Dukes' type C metastatic stage. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. Cost-effectiveness of precision medicine in the fourth-line treatment of metastatic lung adenocarcinoma: An early decision analytic model of multiplex targeted sequencing.

    Science.gov (United States)

    Doble, Brett; John, Thomas; Thomas, David; Fellowes, Andrew; Fox, Stephen; Lorgelly, Paula

    2017-05-01

    To identify parameters that drive the cost-effectiveness of precision medicine by comparing the use of multiplex targeted sequencing (MTS) to select targeted therapy based on tumour genomic profiles to either no further testing with chemotherapy or no further testing with best supportive care in the fourth-line treatment of metastatic lung adenocarcinoma. A combined decision tree and Markov model to compare costs, life-years, and quality-adjusted life-years over a ten-year time horizon from an Australian healthcare payer perspective. Data sources included the published literature and a population-based molecular cohort study (Cancer 2015). Uncertainty was assessed using deterministic sensitivity analyses and quantified by estimating expected value of perfect/partial perfect information. Uncertainty due to technological/scientific advancement was assessed through a number of plausible future scenario analyses. Point estimate incremental cost-effective ratios indicate that MTS is not cost-effective for selecting fourth-line treatment of metastatic lung adenocarcinoma. Lower mortality rates during testing and for true positive patients, lower health state utility values for progressive disease, and targeted therapy resulting in reductions in inpatient visits, however, all resulted in more favourable cost-effectiveness estimates for MTS. The expected value to decision makers of removing all current decision uncertainty was estimated to be between AUD 5,962,843 and AUD 13,196,451, indicating that additional research to reduce uncertainty may be a worthwhile investment. Plausible future scenarios analyses revealed limited improvements in cost-effectiveness under scenarios of improved test performance, decreased costs of testing/interpretation, and no biopsy costs/adverse events. Reductions in off-label targeted therapy costs, when considered together with the other scenarios did, however, indicate more favourable cost-effectiveness of MTS. As more clinical evidence is

  5. Impact of epidermal growth factor receptor gene expression level on clinical outcomes in epidermal growth factor receptor mutant lung adenocarcinoma patients taking first-line epidermal growth factor receptor-tyrosine kinase inhibitors.

    Science.gov (United States)

    Chang, Huang-Chih; Chen, Yu-Mu; Tseng, Chia-Cheng; Huang, Kuo-Tung; Wang, Chin-Chou; Chen, Yung-Che; Lai, Chien-Hao; Fang, Wen-Feng; Kao, Hsu-Ching; Lin, Meng-Chih

    2017-03-01

    Epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors (TKIs) are first-choice treatments for advanced non-small-cell lung cancer patients harboring EGFR mutations. Although EGFR mutations are strongly predictive of patients' outcomes and their response to treatment with EGFR-TKIs, early failure of first-line therapy with EGFR-TKIs in patients with EGFR mutations is not rare. Besides several clinical factors influencing EGFR-TKI efficacies studied earlier such as the Eastern Cooperative Oncology Group performance status or uncommon mutation, we would like to see whether semi-quantify EGFR mutation gene expression calculated by 2(-ΔΔct) was a prognostic factor in EGFR-mutant non-small cell lung cancer patients receiving first-line EGFR-TKIs. This retrospective study reviews 926 lung cancer patients diagnosed from January 2011 to October 2013 at the Kaohsiung Chang Gung Memorial Hospital in Taiwan. Of 224 EGFR-mutant adenocarcinoma patients, 148 patients who had 2(-ΔΔct) data were included. The best cutoff values of 2(-ΔΔct) for in-frame deletions in exon 19 (19 deletion) and a position 858 substituted from leucine (L) to an arginine (R) in exon 21 (L858R) were determined using receiver operating characteristic curves. Patients were divided into high and low 2(-ΔΔct) expression based on the above cutoff level. The best cutoff point of 2(-ΔΔct) value of 19 deletion and L858R was 31.1 and 104.7, respectively. In all, 92 (62.1%) patients showed high 2(-ΔΔct) expression and 56 patients (37.9%) low 2(-ΔΔct) expression. The mean age was 65.6 years. Progression-free survival of 19 deletion mutant patients with low versus high expression level was 17.07 versus 12.04 months (P = 0.004), respectively. Progression-free survival of L858 mutant patients was 13.75 and 7.96 months (P = 0.008), respectively. EGFR-mutant lung adenocarcinoma patients with lower EGFR gene expression had longer progression-free survival duration without

  6. Characterization of a human carcinosarcoma cell line of the ovary established after in vivo change of histologic differentiation.

    Science.gov (United States)

    Möbus, V J; Gerharz, C D; Weikel, W; Merk, O; Dreher, L; Kreienberg, R; Moll, R

    2001-12-01

    Cell lines are valuable in vitro models for clinical and basic research. Most ovarian cancer cell lines described are serous cystadenocarcinomas or poorly differentiated adenocarcinomas. The establishment of ovarian cancer cell lines with rare histologic differentiation is especially of interest. We describe the establishment of a carcinosarcoma cell line of the ovary after in vivo selection. The cell line OV-MZ-22 was established from a solid tumor mass in the upper abdomen. At the time of establishment, the patient underwent secondary debulking and was pretreated with six cycles of cis-platinum/epirubicin/cyclophosphamide. Features of the cell line studied included morphology, ultrastructure, heterotransplantation, chromosome analysis, and analysis of intermediate filament proteins and actins by immunocytochemistry. The first histologic report of the patient described a papillary cystadenocarcinoma, which changed to a carcinosarcoma with predominantly sarcomatous differentiation at secondary debulking. This cell line is aneuploid and shows no expression of the tumor-associated antigens CA-125 and CEA, but an overexpression of MDR-1, lung resistance protein, p53, and topoisomerase I and II, but not of multidrug-resistance-associated protein. The cell line did not give rise to transplant tumors in nude mice. The histologic and immunocytochemical comparison of the primary and the relapsed tumor proved evidence of an in vivo change of differentiation from predominantly papillary cystadenocarcinoma to carcinosarcoma. Morphological characteristics and intermediate filament pattern underlined the sarcomatous differentiation and origin of this cell line. The differentiation phenotype of OV-MZ-22 cells is that of smooth-muscle cells. The change of histologic differentiation was apparently due to a selection process caused by platinum-containing chemotherapy. The origin of the cell line and its rarity make this new line an appropriate tool for further investigation.

  7. Cellular radiosensitivity of small-cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Krarup, M; Poulsen, H S; Spang-Thomsen, M

    1997-01-01

    PURPOSE: The objective of this study was to determine the radiobiological characteristics of a panel of small-cell lung cancer (SCLC) cell lines by use of a clonogenic assay. In addition, we tested whether comparable results could be obtained by employing a growth extrapolation method based...

  8. Diatom-derived polyunsaturated aldehydes activate cell death in human cancer cell lines but not normal cells.

    Directory of Open Access Journals (Sweden)

    Clementina Sansone

    Full Text Available Diatoms are an important class of unicellular algae that produce bioactive polyunsaturated aldehydes (PUAs that induce abortions or malformations in the offspring of invertebrates exposed to them during gestation. Here we compare the effects of the PUAs 2-trans,4-trans-decadienal (DD, 2-trans,4-trans-octadienal (OD and 2-trans,4-trans-heptadienal (HD on the adenocarcinoma cell lines lung A549 and colon COLO 205, and the normal lung/brunch epithelial BEAS-2B cell line. Using the viability MTT/Trypan blue assays, we show that PUAs have a toxic effect on both A549 and COLO 205 tumor cells but not BEAS-2B normal cells. DD was the strongest of the three PUAs tested, at all time-intervals considered, but HD was as strong as DD after 48 h. OD was the least active of the three PUAs. The effect of the three PUAs was somewhat stronger for A549 cells. We therefore studied the death signaling pathway activated in A549 showing that cells treated with DD activated Tumor Necrosis Factor Receptor 1 (TNFR1 and Fas Associated Death Domain (FADD leading to necroptosis via caspase-3 without activating the survival pathway Receptor-Interacting Protein (RIP. The TNFR1/FADD/caspase pathway was also observed with OD, but only after 48 h. This was the only PUA that activated RIP, consistent with the finding that OD causes less damage to the cell compared to DD and HD. In contrast, cells treated with HD activated the Fas/FADD/caspase pathway. This is the first report that PUAs activate an extrinsic apoptotic machinery in contrast to other anticancer drugs that promote an intrinsic death pathway, without affecting the viability of normal cells from the same tissue type. These findings have interesting implications also from the ecological viewpoint considering that HD is one of the most common PUAs produced by diatoms.

  9. Antitumor effects of the flavone chalcone: inhibition of invasion and migration through the FAK/JNK signaling pathway in human gastric adenocarcinoma AGS cells.

    Science.gov (United States)

    Lin, Su-Hsuan; Shih, Yuan-Wei

    2014-06-01

    Chalcones (benzylideneacetophenone) are cancer-preventive food components found in a human diet rich in fruits and vegetables. In this study, we first report the chemopreventive effect of chalcone in human gastric adenocarcinoma cell lines: AGS. The results showed that chalcone could inhibit the abilities of the adhesion, invasion, and migration by cell-matrix adhesion assay, Boyden chamber invasion/migration assay, and wound-healing assay. Molecular data showed that the effect of chalcone in AGS cells might be mediated via sustained inactivation of the phosphorylation of focal adhesion kinase (FAK) and c-Jun N-terminal kinase 1 and 2 (JNK1/2) signal involved in the downregulation of the expressions of matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9). Next, chalcone-treated AGS cells showed tremendous decrease in the phosphorylation and degradation of inhibitor of kappaBα (IκBα), the nuclear level of NF-κB, and the binding ability of NF-κB to NF-κB response element. Furthermore, treating FAK small interfering RNA (FAK siRNA) and specific inhibitor for JNK (SP600125) to AGS cells could reduce the phosphorylation of JNK1/2 and the activity of MMP-2 and MMP-9. Our results revealed that chalcone significantly inhibited the metastatic ability of AGS cells by reducing MMP-2 and MMP-9 expressions concomitantly with a marked reduction on cell invasion and migration through suppressing and JNK signaling pathways. We suggest that chalcone may offer the application in clinical medicine.

  10. MicroRNA-1254 inhibits the migration of colon adenocarcinoma cells by targeting PSMD10.

    Science.gov (United States)

    Chu, Yi Min; Peng, Hai Xia; Xu, Ying; Yang, Da Ming; Zhou, Feng Li; Li, Ji; Kuai, Rong; Lin, Yong

    2017-03-01

    MicroRNA-1254 (miR-1254) has not been studied in colorectal cancer (CRC) to date. This study aimed to investigate the inhibitory mechanism of miR-1254 in CRC tumorigenesis. MiR-1254 expression was examined using real-time polymerase chain reaction in CRC and adjacent non-tumorous tissues. The correlation between miR-1254 expressions and proliferation and migration of cancer cells was determined using the CCK-8 and transwell assays. RNA sequencing was used to identify differentially expressed genes downstream from miR-1254. A luciferase reporter assay was used to confirm the direct interaction between miR-1254 and its predicted target gene, PSMD10. Moreover, PSMD10 was either overexpressed or silenced in colon carcinoma cells overexpressing miR-1254 to determine whether their interaction contributed to CRC migration and epithelial-mesenchymal transition (EMT). Significantly lower miR-1254 expressions were observed in CRC tissues than in adjacent non-tumorous tissues. Exogenous miR-1254 expression suppressed the migration of colon carcinoma cell lines SW1116 and HCT116. RNA sequencing and luciferase assays revealed that miR-1254 directly binded to the 3'-untranslated region of PSMD10, an important regulator of EMT and cell migration. PSMD10 knockdown inhibited EMT and colon cancer cell migration, whereas PSMD10 overexpression reversed the inhibition of EMT and cell migration caused by miR-1254. MiR-1254 may act as a tumor suppressor in CRC and may inhibit CRC migration by directly targeting PSMD10 to suppress the EMT process. © 2017 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

  11. Novel near-diploid ovarian cancer cell line derived from a highly aneuploid metastatic ovarian tumor.

    Directory of Open Access Journals (Sweden)

    Ester Rozenblum

    Full Text Available A new ovarian near-diploid cell line, OVDM1, was derived from a highly aneuploid serous ovarian metastatic adenocarcinoma. A metastatic tumor was obtained from a 47-year-old Ashkenazi Jewish patient three years after the first surgery removed the primary tumor, both ovaries, and the remaining reproductive organs. OVDM1 was characterized by cell morphology, genotyping, tumorigenic assay, mycoplasma testing, spectral karyotyping (SKY, and molecular profiling of the whole genome by aCGH and gene expression microarray. Targeted sequencing of a panel of cancer-related genes was also performed. Hierarchical clustering of gene expression data clearly confirmed the ovarian origin of the cell line. OVDM1 has a near-diploid karyotype with a low-level aneuploidy, but samples of the original metastatic tumor were grossly aneuploid. A number of single nucleotide variations (SNVs/mutations were detected in OVDM1 and the metastatic tumor samples. Some of them were cancer-related according to COSMIC and HGMD databases (no founder mutations in BRCA1 and BRCA2 have been found. A large number of focal copy number alterations (FCNAs were detected, including homozygous deletions (HDs targeting WWOX and GATA4. Progression of OVDM1 from early to late passages was accompanied by preservation of the near-diploid status, acquisition of only few additional large chromosomal rearrangements and more than 100 new small FCNAs. Most of newly acquired FCNAs seem to be related to localized but massive DNA fragmentation (chromothripsis-like rearrangements. Newly developed near-diploid OVDM1 cell line offers an opportunity to evaluate tumorigenesis pathways/events in a minor clone of metastatic ovarian adenocarcinoma as well as mechanisms of chromothripsis.

  12. The P2X7 receptor regulates cell survival, migration and invasion of pancreatic ductal adenocarcinoma cells

    DEFF Research Database (Denmark)

    Giannuzzo, Andrea; Pedersen, Stine Helene Falsig; Novak, Ivana

    2015-01-01

    of the ATP receptors, the P2X7 receptor (P2X7R) could be an important player in PDAC behaviour. METHODS: We determined the expression (real time PCR and Western blot) and localization (immunofluorescence) of P2X7R in human PDAC cell lines (AsPC-1, BxPC-3, Capan-1, MiaPaCa-2, Panc-1) and a "normal" human...... by necrosis. Moreover, the P2X7R-pore antagonist, A438079, prevented ATP-induced pore formation and cell death. Second, in basal conditions and with low concentrations of ATP/BzATP, the P2X7R allosteric inhibitor AZ10606120 reduced proliferation in all PDAC cell lines. P2X7R also affected other key...

  13. N-Hydroxycinnamide derivatives of osthole presenting genotoxicity and cytotoxicity against human colon adenocarcinoma cells in vitro and in vivo.

    Science.gov (United States)

    Liu, Ling-Yu; Huang, Wei-Jan; Lin, Ren-Jye; Lin, Shyr-Yi; Liang, Yu-Chih

    2013-11-18

    Osthole is extracted from the Chinese herbs Cnidium monnieri and Angelica pubescens, and it was found to have antitumor activity in vitro and in vivo. A series of osthole derivatives have been synthesized, and the N-hydroxycinnamide derivatives of osthole, WJ1376-1 and WJ1398-1 were found to have the greatest potential against human colon adenocarcinoma cells. In contrast to the parental osthole, both WJ1376-1 and WJ1398-1 were found to induce multinucleation and polyploidy by microscopic observation and flow cytometry. WJ1376-1 and WJ1398-1 significantly activated ataxia telangiectasia and rad3 related (ATR) kinase, which triggered activation of the checkpoint kinase 2 (Chk2) signaling pathway and then down regulated Cdc25 phosphatase and Cdc2/cyclin B kinase activities. WJ1376-1 and WJ1398-1 also inhibited the phosphorylation of Aurora A kinase, which is associated with important processes during mitosis. The presence of a "comet" DNA fragment and phosphorylation of p53 at Ser 15 clearly indicated that DNA damage occurred with WJ1376-1 and WJ1398-1 treatment. WJ1376-1 and WJ1398-1 ultimately induced apoptosis as evidenced by the upregulation of Bad and activation of caspases-3, -7, and -9. Furthermore, WJ1376-1 and WJ1398-1 also showed a great effect in attenuating tumor growth without affecting the body weight of xenograft nude mice. Taken together, these results suggest that the toxic activities of WJ1376-1 and WJ1398-1 were dissimilar to that of the parental osthole, which can induce cell polyploidy and G2/M cell cycle arrest in colon adenocarcinoma cells and may provide a potential therapeutic target for colon cancer treatment in the future.

  14. Establishment and characterization of a human primary prostate carcinoma cell line, HH870.

    Science.gov (United States)

    Selvan, Senthamil R; Cornforth, Andrew N; Rao, Nagesh P; Reid, Yvonne A; Schiltz, Patric M; Liao, Ray P; Price, David T; Heinemann, F Scott; Dillman, Robert O

    2005-04-01

    Development of new therapeutic modalities for human prostate carcinoma has been impeded by a lack of adequate in vitro and in vivo models. Most in vitro studies have been carried out using a limited number of human prostate cancer cell lines that are mostly derived from metastatic tumors sites or are immortalized. Characterization of the prostate cancer cell line, HH870, included description of morphology, determination of doubling time, response to androgens, immunocytochemistry, and immunoblotting of proteins known to be associated with prostate carcinoma, karyotyping, fluorescence in situ hybridization (FISH), DNA profiling, and growth as xenograft in athymic rodents. HH870 expresses various epithelial marker antigens that correlate with known basic immunostaining profiles of prostate adenocarcinoma, although the cell line does not express PSA, PSMA, or PAP. HH870 exhibits complex chromosomal abnormalities and harbors no immortalizing HPV, BKV, JCV, and SV40 DNA. We report the successful establishment and characterization of a new long-term primary human prostate tumor cell line HH870. Copyright (c) 2004 Wiley-Liss, Inc.

  15. Expression profiles of cancer stem cell markers: CD133, CD44, Musashi-1 and EpCAM in the cardiac mucosa-Barrett's esophagus-early esophageal adenocarcinoma-advanced esophageal adenocarcinoma sequence.

    Science.gov (United States)

    Mokrowiecka, Anna; Veits, Lothar; Falkeis, Christina; Musial, Jacek; Kordek, Radzislaw; Lochowski, Mariusz; Kozak, Jozef; Wierzchniewska-Lawska, Agnieszka; Vieth, Michael; Malecka-Panas, Ewa

    2017-03-01

    Barrett's esophagus (BE), which develops as a result of gastroesophageal reflux disease, is a preneoplastic condition for esophageal adenocarcinoma (EAC). A new hypothesis suggests that cancer is a disease of stem cells, however, their expression and pathways in BE - EAC sequence are not fully elucidated yet. We used a panel of putative cancer stem cells markers to identify stem cells in consecutive steps of BE-related cancer progression. Immunohistochemistry was performed on formalin-fixed, paraffin-embedded blocks from 58 patients with normal cardiac mucosa (n=5), BE (n=14), early EAC (pT1) from mucosal resection (n=17) and advanced EAC (pT1-T4) from postoperative specimens (n=22). Expression of the CD133, CD44, Musashi-1 and EpCAM was analyzed using respective monoclonal antibodies. All markers showed a heterogeneous expression pattern, mainly at the base of the crypts of Barrett's epithelium and EAC, with positive stromal cells in metaplastic and dysplastic lesions. Immuno-expression of EpCAM, CD44 and CD133 in cardiac mucosa was significantly lower (mean immunoreactivity score (IRS)=1.2; 0.0; 0.4; respectively) compared to their expression in Barrett's metaplasia (mean IRS=4.3; 0.14; 0.7; respectively), in early adenocarcinoma (mean IRS=4.4; 0.29; 1.3; respectively) and in advanced adenocarcinoma (mean IRS=6.6; 0.7; 2.7; respectively) (p<0.05). On the contrary, Musashi-1 expression was higher in BE and early ADC compared to GM and advanced ADC (NS). Our results suggest that the stem cells could be present in premalignant lesions. EpCAM, CD44 and CD133 expression could be candidate markers for BE progression, whereas Musashi-1 may be a marker of the small intestinal features of Barrett's mucosa. Copyright © 2016 Elsevier GmbH. All rights reserved.

  16. Susceptibility testing of fish cell lines for virus isolation

    DEFF Research Database (Denmark)

    Ariel, Ellen; Skall, Helle Frank; Olesen, Niels Jørgen

    2009-01-01

    compare susceptibility between cell lines and between lineages within a laboratory and between laboratories (Inter-laboratory Proficiency Test). The objective being that the most sensitive cell line and lineages are routinely selected for diagnostic purposes.In comparing cell lines, we simulated "non......-cell-culture-adapted" virus by propagating the virus in heterologous cell lines to the one tested. A stock of test virus was produced and stored at - 80 °C and tests were conducted biannually. This procedure becomes complicated when several cell lines are in use and does not account for variation among lineages. In comparing...... cell lineages, we increased the number of isolates of each virus, propagated stocks in a given cell line and tested all lineages of that line in use in the laboratory. Testing of relative cell line susceptibility between laboratories is carried out annually via the Inter-laboratory Proficiency Test...

  17. Induced pluripotent stem cell lines derived from human somatic cells.

    Science.gov (United States)

    Yu, Junying; Vodyanik, Maxim A; Smuga-Otto, Kim; Antosiewicz-Bourget, Jessica; Frane, Jennifer L; Tian, Shulan; Nie, Jeff; Jonsdottir, Gudrun A; Ruotti, Victor; Stewart, Ron; Slukvin, Igor I; Thomson, James A

    2007-12-21

    Somatic cell nuclear transfer allows trans-acting factors present in the mammalian oocyte to reprogram somatic cell nuclei to an undifferentiated state. We show that four factors (OCT4, SOX2, NANOG, and LIN28) are sufficient to reprogram human somatic cells to pluripotent stem cells that exhibit the essential characteristics of embryonic stem (ES) cells. These induced pluripotent human stem cells have normal karyotypes, express telomerase activity, express cell surface markers and genes that characterize human ES cells, and maintain the developmental potential to differentiate into advanced derivatives of all three primary germ layers. Such induced pluripotent human cell lines should be useful in the production of new disease models and in drug development, as well as for applications in transplantation medicine, once technical limitations (for example, mutation through viral integration) are eliminated.

  18. Pancreatic adenocarcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Schima, Wolfgang; Ba-Ssalamah, Ahmed; Koelblinger, Claus; Kulinna-Cosentini, Christiane [Medical University of Vienna, Department of Radiology, Vienna (Austria); Puespoek, Andreas [Medical University of Vienna, Department of Internal Medicine 4, Division of Gastroenterology and Hepatology, Vienna (Austria); Goetzinger, Peter [Medical University of Vienna, Austria, Department of Surgery, Vienna (Austria)

    2007-03-15

    Adenocarcinoma is the most common malignant pancreatic tumor, affecting the head of the pancreas in 60-70% of cases. By the time of diagnosis, at least 80% of tumors are unresectable. Helical computed tomography (CT) is very effective in detecting and staging adenocarcinoma, with a sensitivity of up to 90% for detection and an accuracy of 80-90% for staging, but it has limitations in detecting small cancers. Moreover, it is not very accurate for determining nonresectability because small liver metastases, peritoneal carcinomatosis, and subtle signs of vascular infiltration may be missed. Multidetector-row CT (MDCT) has brought substantial improvements with its inherent ability to visualize vascular involvement in three dimensions. MDCT has been found to be at least equivalent to contrast-enhanced magnetic resonance imaging (MRI) for detecting adenocarcinoma. MRI can be used as a problem-solving tool in equivocal CT: MRI may help rule out pitfalls, such as inflammatory pseudotumor, focal lipomatosis, abscess, or cystic tumors. Mangafodipir-enhanced MRI reveals a very high tumor-pancreas contrast, which helps in diagnosing small cancers. Endosonography is, if available, also a very accurate tool for detecting small cancers, with a sensitivity of up to 98%. It is the technique of choice for image-guided biopsy if a histologic diagnosis is required for further therapy. (orig.)

  19. Methanolic Extracts from Brown Seaweeds Dictyota cilliolata and Dictyota menstrualis Induce Apoptosis in Human Cervical Adenocarcinoma HeLa Cells

    Directory of Open Access Journals (Sweden)

    Dayanne Lopes Gomes

    2015-04-01

    Full Text Available Carcinoma of the uterine cervix is the second most common female tumor worldwide, surpassed only by breast cancer. Natural products from seaweeds evidencing apoptotic activity have attracted a great deal of attention as new leads for alternative and complementary preventive or therapeutic anticancer agents. Here, methanol extracts from 13 species of tropical seaweeds (Rhodophytas, Phaeophyta and Chlorophyta collected from the Northeast of Brazil were assessed as apoptosis-inducing agents on human cervical adenocarcinoma (HeLa. All extracts showed different levels of cytotoxicity against HeLa cells; the most potent were obtained from the brown alga Dictyota cilliolata (MEDC and Dictyota menstrualis (MEDM. In addition, MEDC and MEDM also inhibits SiHa (cervix carcinoma cell proliferation. Studies with these two extracts using flow cytometry and fluorescence microscopy showed that HeLa cells exposed to MEDM and MEDC exhibit morphological and biochemical changes that characterize apoptosis as shown by loss of cell viability, chromatin condensation, phosphatidylserine externalization, and sub-G1 cell cycle phase accumulation, also MEDC induces cell cycle arrest in cell cycle phase S. Moreover, the activation of caspases 3 and 9 by these extracts suggests a mitochondria-dependent apoptosis route. However, other routes cannot be ruled out. Together, these results point out the methanol extracts of the brown algae D. mentrualis and D. cilliolata as potential sources of molecules with antitumor activity.

  20. The role of the obestatin/GPR39 system in human gastric adenocarcinomas.

    Science.gov (United States)

    Alén, Begoña O; Leal-López, Saúl; Alén, María Otero; Viaño, Patricia; García-Castro, Victoria; Mosteiro, Carlos S; Beiras, Andrés; Casanueva, Felipe F; Gallego, Rosalía; García-Caballero, Tomás; Camiña, Jesús P; Pazos, Yolanda

    2016-02-02

    Obestatin, a 23-amino acid peptide encoded by the ghrelin gene, and the GPR39 receptor were reported to be involved in the control of mitogenesis of gastric cancer cell lines; however, the relationship between the obestatin/GPR39 system and gastric cancer progression remains unknown. In the present study, we determined the expression levels of the obestatin/GPR39 system in human gastric adenocarcinomas and explored their potential functional roles. Twenty-eight patients with gastric adenocarcinomas were retrospectively studied, and clinical data were obtained. The role of obestatin/GPR39 in gastric cancer progression was studied in vitro using the human gastric adenocarcinoma AGS cell line. Obestatin exogenous administration in these GPR39-bearing cells deregulated the expression of several hallmarks of the epithelial-mesenchymal transition (EMT) and angiogenesis. Moreover, obestatin signaling promoted phenotypic changes via GPR39, increasingly impacting on the cell morphology, proliferation, migration and invasion of these cells. In healthy human stomachs, obestatin expression was observed in the neuroendocrine cells and GPR39 expression was localized mainly in the chief cells of the oxyntic glands. In human gastric adenocarcinomas, no obestatin expression was found; however, an aberrant pattern of GPR39 expression was discovered, correlating to the dedifferentiation of the tumor. Altogether, our data strongly suggest the involvement of the obestatin/GPR39 system in the pathogenesis and/or clinical outcome of human gastric adenocarcinomas and highlight the potential usefulness of GPR39 as a prognostic marker in gastric cancer.

  1. Novel seleno- and thio-urea derivatives with potent in vitro activities against several cancer cell lines.

    Science.gov (United States)

    Alcolea, Verónica; Plano, Daniel; Karelia, Deepkamal N; Palop, Juan Antonio; Amin, Shantu; Sanmartín, Carmen; Sharma, Arun K

    2016-05-04

    A series of novel selenourea derivatives and corresponding thiourea analogs were synthesized and tested against a panel of six human cancer cell lines: melanoma (1205Lu), lung carcinoma (A549), prostatic carcinoma (DU145), colorectal carcinoma (HCT116), pancreatic epithelioid carcinoma (PANC-1) and pancreatic adenocarcinoma (BxPC3). In general, we found that the selenium-containing derivatives were more potent than their isosteric sulfur analogs. Four selenourea derivatives (1e, 1f, 1g and 1i) showed IC50 values below 10 μM in all of tested cell lines at 72 h. On the basis of its potent activity, compound 1g was selected for further biological evaluation in different colon cancer cell lines. Our results indicated that compound 1g induced apoptosis by caspase activation, along with inhibition of anti-apoptotic proteins. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Short-Chain Fatty Acids Stimulate Angiopoietin-Like 4 Synthesis in Human Colon Adenocarcinoma Cells by Activating Peroxisome Proliferator-Activated Receptor γ

    DEFF Research Database (Denmark)

    Alex, Sheril; Lange, Katja; Amolo, Tom

    2013-01-01

    with the notion that fermentation leads to PPAR activation in vivo, feeding mice a diet rich in inulin induced PPAR target genes and pathways in the colon. We conclude that (i) SCFA potently stimulate ANGPTL4 synthesis in human colon adenocarcinoma cells and (ii) SCFA transactivate and bind to PPARγ. Our data...

  3. Regulatory networks define phenotypic classes of human stem cell lines

    OpenAIRE

    Müller, Franz-Josef; Laurent, Louise C.; Kostka, Dennis; Ulitsky, Igor; Williams, Roy; Lu, Christina; Park, In-Hyun; Rao, Mahendra?S.; Shamir, Ron; Schwartz, Philip H.; Schmidt, Nils O.; Loring, Jeanne F.

    2008-01-01

    Stem cells are defined as self-renewing cell populations that can differentiate into multiple distinct cell types. However, hundreds of different human cell lines from embryonic, fetal, and adult sources have been called stem cells, even though they range from pluripotent cells, typified by embryonic stem cells, which are capable of virtually unlimited proliferation and differentiation, to adult stem cell lines, which can generate a far more limited repertory of differentiated cell types. The...

  4. ESOPHAGEAL CARCINOMA: IS SQUAMOUS CELL CARCINOMA DIFFERENT DISEASE COMPARED TO ADENOCARCINOMA? A transversal study in a quaternary high volume hospital in Brazil

    Directory of Open Access Journals (Sweden)

    Francisco TUSTUMI

    Full Text Available ABSTRACT Background Esophageal cancer is one of the leading causes of mortality among the neoplasms that affect the gastrointestinal tract. There are several factors that contribute for development of an epidemiological esophageal cancer profile in a population. Objective This study aims to describe both clinically and epidemiologically the population of patients with diagnosis of esophageal cancer treated in a quaternary attention institute for cancer from January, 2009 to December, 2011, in Sao Paulo, Brazil. Methods The charts of all patients diagnosed with esophageal cancer from January, 2009, to December, 2011, in a Sao Paulo (Brazil quaternary oncology institute were retrospectively reviewed. Results Squamous cell cancer made up to 80% of the cases of esophageal cancer. Average age at diagnosis was 60.66 years old for esophageal adenocarcinoma and 62 for squamous cell cancer, average time from the beginning of symptoms to the diagnosis was 3.52 months for esophageal adenocarcinoma and 4.2 months for squamous cell cancer. Average time for initiating treatment when esophageal cancer is diagnosed was 4 months for esophageal adenocarcinoma and 4.42 months for squamous cell cancer. There was a clear association between squamous cell cancer and head and neck cancers, as well as certain habits, such as smoking and alcoholism, while adenocarcinoma cancer showed more association with gastric cancer and gastroesophageal reflux disease. Tumoral bleeding and pneumonia were the main causes of death. No difference in survival rate was noted between the two groups. Conclusion Adenocarcinoma and squamous cell carcinoma are different diseases, but both are diagnosed in advanced stages in Brazil, compromising the patients' possibilities of cure.

  5. Emission spectral analysis of caspase-3 activation during artesunate (ART)-induced apoptosis of human lung adenocarcinoma cell

    Science.gov (United States)

    Pan, Wen-liang; Chen, Tong-sheng; Qu, Junle

    2009-02-01

    Artesunate (ART), a semi-synthetic derivative of the sesquiterpene artemisinin extracted from the Chinese herb Artemisia annua, exerts a broad spectrum of clinical activity against human cancers. Artemisinin-derivative combination chemotherapy is recommended by WHO since it acts rapidly and is well tolerated and particularly effective. In present investigation, we used CKK-8 assay to assess the inhibitory effects of ART on human lung adenocarcinoma (ASTC-a-1) cells. Apoptotic activity of ART in ASTC-a-1 cells was detected by means of nuclear staining with Hoechst33258. In order to monitor the activity of caspase-3 during ART-induced ASTC-a-1 cells apoptosis, the dynamical emission spectra of SCAT3, a FRET plasmid based on GFPs, were performed inside living cell expressed stably with SCAT3 after ART treatment. The results showed that (1) ART could inhibit ASTC-a-1 cells proliferation in a dose-dependent manner; (2) chromatin condensation was observed after ART treatment for 48 h; (3) the SCAT3 inside living cells were cleaved after ART treatment for 48 h, implying that caspase-3 was involved in the ART-induced apoptosis.

  6. Anticancer function of α-solanine in lung adenocarcinoma cells by inducing microRNA-138 expression.

    Science.gov (United States)

    Zhang, Furui; Yang, Rui; Zhang, Guojun; Cheng, Ruirui; Bai, Yong; Zhao, Huasi; Lu, Xinhua; Li, Hui; Chen, Shanshan; Li, Juan; Wu, Shujun; Li, Ping; Chen, Xiaonan; Sun, Qianqian; Zhao, Guoqiang

    2016-05-01

    Currently, lung cancer is still a main cause of malignancy-associated death worldwide. Even though various methods for prevention and treatment of lung cancer have been improved in recent decades, the 5-year survival rate has remained very low. Insights into the anticancer function of small-molecule anticancer compounds have opened our visual field about cancer therapy. α-Solanine has been well studied for its antitumor properties, but its effect in lung cancer and associated molecular mechanisms have not yet been evaluated. To explore the anticancer function of α-solanine, we performed an MTT assay, Transwell arrays, colony-forming survival assay, quantitative reverse transcription PCR (qRT-PCR), Western blotting, and dual luciferase reporter assays in A549 and H1299 cells. We found that α-solanine not only inhibited cell migration and invasion ability but also enhanced the chemosensitivity and radiosensitivity of A549 and H1299 cells. Moreover, we discovered that α-solanine could affect the expression of miR-138 and focal adhesion kinase (FAK), both of which were also found to affect the chemosensitivity and radiosensitivity of A549 and H1299 cells. In conclusion, α-solanine could affect miR-138 and FAK expression to restrict cell migration and invasion and enhance the chemosensitivity and radiosensitivity of A549 and H1299 cells. The α-solanine/miR-138/FAK cascade can probably be a potential therapy target against lung adenocarcinoma.

  7. Radiosensitivity of Human Melanoma Cell Lines

    Energy Technology Data Exchange (ETDEWEB)

    Bergoc, R. M.; Medina, V.; Cricco, G.; Mohamed, N.; Martin, G.; Nunez, M.; Croci, M.; Crescenti, E. J.; Rivera, E. S.

    2004-07-01

    Cutaneous melanoma is a skin cancer resulting from the malign transformation of skin-pigment cells, the melanocytes. The radiotherapy, alone or in combination with other treatment, is an important therapy for this disease. the objective of this paper was to determine in vitro the radiosensitivity of two human melanoma cell lines with different metastatic capability: WM35 and MI/15, and to study the effect of drugs on radiobiological parameters. The Survival Curves were adjusted to the mathematical Linear-quadratic model using GrapsPad Prism software. Cells were seeded in RPMI medium (3000-3500 cells/flask), in triplicate and irradiated 24 h later. The irradiation was performed using an IBL 437C H Type equipment (189 TBq, 7.7 Gy/min) calibrated with a TLD 700 dosimeter. The range of Doses covered from 0 to 10 Gy and the colonies formed were counted at day 7th post-irradiation. Results obtained were: for WM35, {alpha}=0.37{+-}0.07 Gy''-1 and {beta}=0.06{+-}0.02 Gy''-2, for M1/15m {alpha}=0.47{+-}0.03 Gy''-1 and {beta}=0.06{+-}0.01 Gy''-2. The {alpha}/{beta} values WM35: {alpha}/{beta} values WM35: {alpha}/{beta}=6.07 Gy and M1/15: {alpha}/{beta}{sub 7}.33 Gy were similar, independently of their metastatic capabillity and indicate that both lines exhibit high radioresistance. Microscopic observation of irradiated cells showed multinuclear cells with few morphologic changes non-compatible with apoptosis. By means of specific fluorescent dyes and flow cytometry analysis we determined the intracellular levels of the radicals superoxide and hydrogen peroxide and their modulation in response to ionizing radiation. The results showed a marked decreased in H{sub 2}O{sub 2} intracellular levels with a simultaneous increase in superoxide that will be part of a mechanism responsible for induction of cell radioresistance. This response triggered by irradiated cells could not be abrogated by different treatments like histamine or the

  8. Cytotoxicity of Sambucus ebulus on cancer cell lines and protective ...

    African Journals Online (AJOL)

    Cytotoxicity of Sambucus ebulus on cancer cell lines and protective effects of vitamins C and E against its cytotoxicity on normal cell lines. ... Cytotoxicity of SEE on cancer (HepG2 and CT26) and normal (CHO and rat fibroblast) cell lines was evaluated by MTT assay. IC50 of SEE on ... African Journal of Biotechnology Vol.

  9. Cytotoxicity of Sambucus ebulus on cancer cell lines and protective ...

    African Journals Online (AJOL)

    DR. TONUKARI NYEROVWO

    2013-05-22

    May 22, 2013 ... Also, protective effects of vitamins C and E against SEE-induced cytotoxicity on normal cell lines were studied. Cytotoxicity of SEE on cancer (HepG2 and CT26) and normal (CHO and rat fibroblast) cell lines was evaluated by MTT assay. IC50 of SEE on the cell lines was assessed. Furthermore, IC50 of ...

  10. The pseudogene-derived long noncoding RNA SFTA1P is down-regulated and suppresses cell migration and invasion in lung adenocarcinoma.

    Science.gov (United States)

    Zhang, Hua; Xiong, Yaqiong; Xia, Rui; Wei, Chenchen; Shi, Xuefei; Nie, Fengqi

    2017-02-01

    Pseudogenes were once considered to be genomic fossils without biological function. Interestingly, recent evidence showed that a lot of pseudogenes are transcribed in human cancers, and their alterations contribute to multiple cancer development and progression. It is apparent that many pseudogenes transcribe noncoding RNAs and contribute to the role noncoding genome plays in human cancers. On this basis, some pseudogene transcripts are currently ranked among the classes of long noncoding RNAs. In this study, we identified a new pseudogene-derived long noncoding RNA termed SFTA1P by analyzing the microarray data of non-small cell lung cancer from Gene Expression Omnibus datasets. We found that SFTA1P expression was significantly decreased in non-small cell lung cancer tissues compared with normal tissues in non-small cell lung cancer microarray data. Moreover, decreased SFTA1P expression is only correlated with lung adenocarcinoma patients' poor survival time but not with lung squamous cell carcinoma patients' survival. In addition, gain-of-function studies including growth curves, migration, invasion assays, and in vivo studies were performed to verify the tumor suppressor role of SFTA1P in non-small cell lung cancer. Finally, the potential underlying pathways involved in SFTA1P were investigated by analyzing the SFTA1P-correlated genes in The Cancer Genome Atlas lung adenocarcinoma and normal tissues RNA sequencing data. Taken together, these findings demonstrate that pseudogene-derived long noncoding RNA SFTA1P exerts the tumor suppressor functions in human lung adenocarcinoma. Our investigation reveals the novel roles of pseudogene in lung adenocarcinoma, which may serve as a new target for lung adenocarcinoma diagnosis and therapy.

  11. Normalizing genes for quantitative RT-PCR in differentiating human intestinal epithelial cells and adenocarcinomas of the colon.

    Science.gov (United States)

    Dydensborg, Anders Bondo; Herring, Elizabeth; Auclair, Joëlle; Tremblay, Eric; Beaulieu, Jean-Francois

    2006-05-01

    As for other mRNA measurement methods, quantitative RT-PCR results need to be normalized relative to stably expressed genes. Widely used normalizing genes include beta-actin and glyceraldehyde-3-phosphate dehydrogenase. It has, however, become clear that these and other normalizing genes can display modulated patterns of expression across tissue types and during complex cellular processes such as cell differentiation and cancer progression. Our objective was to set the basis for identifying normalizing genes that displayed stable expression during enterocytic differentiation and between healthy tissue and adenocarcinomas of the human colon. We thus identified novel potential normalizing genes using previously generated cDNA microarray data and examined the alterations of expression of two of these genes as well as seven commonly used normalizing genes during the enterocytic differentiation process and between matched pairs of resection margins and primary carcinomas of the human colon using real-time RT-PCR. We found that ribosomal phosphoprotein P0 was particularly stable in all intestinal epithelial cell extracts, thereby representing a particularly robust housekeeping reference gene for the assessment of gene expression during the human enterocytic differentiation process. On the other hand, beta-2-microglobulin generated the best score as a normalizing gene for comparing human colon primary carcinomas with their corresponding normal mucosa of the resection margin, although others were found to represent acceptable alternatives. In conclusion, we identified and characterized specific normalizing genes that should significantly improve quantitative mRNA studies related to both the differentiation process of the human intestinal epithelium and adenocarcinomas of the human colon. This approach should also be useful to validate normalizing genes in other intestinal contexts.

  12. Anticancer Effects of Extracts from the Fruit of Morinda Citrifolia (Noni) in Breast Cancer Cell Lines.

    Science.gov (United States)

    Sharma, K; Pachauri, S D; Khandelwal, K; Ahmad, H; Arya, A; Biala, P; Agrawal, S; Pandey, R R; Srivastava, A; Srivastav, A; Saxena, J K; Dwivedi, A K

    2016-03-01

    Morinda citrifolia L. (NONI) fruits have been used for thousands of years for the treatment of many health problems including cancer, cold, diabetes, flu, hypertension, and pain. Plant extracts have reported several therapeutic benefits, but extraction of individual compound from the extract often exhibits limited clinical utility as the synergistic effect of various natural ingredients gets lost. They generally constitute polyphenols and flavonoids. Studies have suggested that these phytochemicals, especially polyphenols, display high antioxidant properties, which help to reduce the risk of degenerative diseases, such as cancer and cardiovascular diseases. Several in-vitro and in-vivo studies have shown that Noni fruits have antioxidant, anti-inflammatory, anti-dementia, liver-protective, anticancer, analgesic, and immunomodulatory effects. Till date about 7 in vitro cancer studies have been done, but a detailed in vitro study including cell cycle and caspase activation assay on breast cancer cell line has not been done. In the present study different Noni fruit fractions have tested on cancer cell lines MCF-7, MDA-MB-231 (breast adenocarcinoma) and one non-cancer cell line HEK-293 (Human embryonic kidney). Out of which ethylacetate extract showed a higher order of in vitro anticancer activity profile. The ethylacetate extract strongly inhibited the proliferation of MCF-7, MDA-MB-231 and HEK-293 cell lines with IC50 values of 25, 35, 60 µg/ml respectively. The extract showed increase in apoptotic cells in MCF-7 and MDA-MB-231 cells and arrested the cell cycle in the G1/S phase in MCF-7 and G0/G1 phase in MDA-MB-231 cells. Noni extract also decreases the intracellular ROS generation and mitochondrial membrane potential. © Georg Thieme Verlag KG Stuttgart · New York.

  13. Cytotoxicity of Portuguese Propolis: The Proximity of the In Vitro Doses for Tumor and Normal Cell Lines

    Directory of Open Access Journals (Sweden)

    Ricardo C. Calhelha

    2014-01-01

    Full Text Available With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7—breast adenocarcinoma, NCI-H460—non-small cell lung carcinoma, HCT15—colon carcinoma, HeLa—cervical carcinoma, and HepG2—hepatocellular carcinoma, and non-tumor primary cells (PLP2. The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2. Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.

  14. A Lactose-Binding Lectin from the Marine Sponge Cinachyrella Apion (Cal Induces Cell Death in Human Cervical Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Adriana Uchoa

    2012-03-01

    Full Text Available Cancer represents a set of more than 100 diseases, including malignant tumors from different locations. Strategies inducing differentiation have had limited success in the treatment of established cancers. Marine sponges are a biological reservoir of bioactive molecules, especially lectins. Several animal and plant lectins were purified with antitumor activity, mitogenic, anti-inflammatory and antiviral, but there are few reports in the literature describing the mechanism of action of lectins purified from marine sponges to induce apoptosis in human tumor cells. In this work, a lectin purified from the marine sponge Cinachyrella apion (CaL was evaluated with respect to its hemolytic, cytotoxic and antiproliferative properties, besides the ability to induce cell death in tumor cells. The antiproliferative activity of CaL was tested against HeLa, PC3 and 3T3 cell lines, with highest growth inhibition for HeLa, reducing cell growth at a dose dependent manner (0.5–10 µg/mL. Hemolytic activity and toxicity against peripheral blood cells were tested using the concentration of IC50 (10 µg/mL for both trials and twice the IC50 for analysis in flow cytometry, indicating that CaL is not toxic to these cells. To assess the mechanism of cell death caused by CaL in HeLa cells, we performed flow cytometry and western blotting. Results showed that lectin probably induces cell death by apoptosis activation by pro-apoptotic protein Bax, promoting mitochondrial membrane permeabilization, cell cycle arrest in S phase and acting as both dependent and/or independent of caspases pathway. These results indicate the potential of CaL in studies of medicine for treating cancer.

  15. Mitochondrial thiol modification by a targeted electrophile inhibits metabolism in breast adenocarcinoma cells by inhibiting enzyme activity and protein levels

    Directory of Open Access Journals (Sweden)

    M. Ryan Smith

    2016-08-01

    Full Text Available Many cancer cells follow an aberrant metabolic program to maintain energy for rapid cell proliferation. Metabolic reprogramming often involves the upregulation of glutaminolysis to generate reducing equivalents for the electron transport chain and amino acids for protein synthesis. Critical enzymes involved in metabolism possess a reactive thiolate group, which can be modified by certain oxidants. In the current study, we show that modification of mitochondrial protein thiols by a model compound, iodobutyl triphenylphosphonium (IBTP, decreased mitochondrial metabolism and ATP in MDA-MB 231 (MB231 breast adenocarcinoma cells up to 6 days after an initial 24 h treatment. Mitochondrial thiol modification also depressed oxygen consumption rates (OCR in a dose-dependent manner to a greater extent than a non-thiol modifying analog, suggesting that thiol reactivity is an important factor in the inhibition of cancer cell metabolism. In non-tumorigenic MCF-10A cells, IBTP also decreased OCR; however the extracellular acidification rate was significantly increased at all but the highest concentration (10 µM of IBTP indicating that thiol modification can have significantly different effects on bioenergetics in tumorigenic versus non-tumorigenic cells. ATP and other adenonucleotide levels were also decreased by thiol modification up to 6 days post-treatment, indicating a decreased overall energetic state in MB231 cells. Cellular proliferation of MB231 cells was also inhibited up to 6 days post-treatment with little change to cell viability. Targeted metabolomic analyses revealed that thiol modification caused depletion of both Krebs cycle and glutaminolysis intermediates. Further experiments revealed that the activity of the Krebs cycle enzyme, aconitase, was attenuated in response to thiol modification. Additionally, the inhibition of glutaminolysis corresponded to decreased glutaminase C (GAC protein levels, although other protein levels were

  16. Expression, localization and polymorphisms of the nuclear receptor PXR in Barrett's esophagus and esophageal adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Kusters Johannes G

    2011-10-01

    Full Text Available Abstract Background The continuous exposure of esophageal epithelium to refluxate may induce ectopic expression of bile-responsive genes and contribute to the development of Barrett's esophagus (BE and esophageal adenocarcinoma. In normal physiology of the gut and liver, the nuclear receptor Pregnane × Receptor (PXR is an important factor in the detoxification of xenobiotics and bile acid homeostasis. This study aimed to investigate the expression and genetic variation of PXR in reflux esophagitis (RE, Barrett's esophagus (BE and esophageal adenocarcinoma. Methods PXR mRNA levels and protein expression were determined in biopsies from patients with adenocarcinoma, BE, or RE, and healthy controls. Esophageal cell lines were stimulated with lithocholic acid and rifampicin. PXR polymorphisms 25385C/T, 7635A/G, and 8055C/T were genotyped in 249 BE patients, 233 RE patients, and 201 controls matched for age and gender. Results PXR mRNA levels were significantly higher in adenocarcinoma tissue and columnar Barrett's epithelium, compared to squamous epithelium of these BE patients (P P = 0.003. Immunohistochemical staining of PXR showed predominantly cytoplasmic expression in BE tissue, whereas nuclear expression was found in adenocarcinoma tissue. In cell lines, stimulation with lithocholic acid did not increase PXR mRNA levels, but did induce nuclear translocation of PXR protein. Genotyping of the PXR 7635A/G polymorphism revealed that the G allele was significantly more prevalent in BE than in RE or controls (P = 0.037. Conclusions PXR expresses in BE and adenocarcinoma tissue, and showed nuclear localization in adenocarcinoma tissue. Upon stimulation with lithocholic acid, PXR translocates to the nuclei of OE19 adenocarcinoma cells. Together with the observed association of a PXR polymorphism and BE, this data implies that PXR may have a function in prediction and treatment of esophageal disease.

  17. [Effects of LAK cells activated by IL-2 on MCF-7 human breast cancer cell line maintained in organotypic culture].

    Science.gov (United States)

    Gharib, M; Mainguené, C; Tamboise, E; Tamboise, A; Lièvre, N; Amouroux, J; Beaupain, R

    1993-08-01

    Lymphokine Activated Killer (LAK) cells, stimulated by interleukin 2 (IL-2) have a pronounced antitumor effect in the therapy of melanoma and renal cancers. LAK cells were cultivated in presence of the nodules of the human breast adenocarcinoma cell line MCF-7 maintained in organotypic culture to study the interactions between lymphocytes and breast tumor cells. After two days of co-culture, the proliferation of MCF-7 nodules and that of LAK cells was diminished about five folds. The cytotoxic effect of the latter, appreciated by Chrome 51 release was unchanged after the coculture. In histological sections, the penetration of the LAK cells into the MCF-7 nodules was accompanied by an increase of tumor necrosis but also by a glandular differentiation of cancerous tissue. Polarized epithelial cell formations bording neoplasic lumens with intracytoplasmic vacuoles filled with mucus, appeared in the nodules. The immunohistochemistry underlines the presence of T lymphocytes marked by UCHL1 and CD3 antibodies and of Natural Killer (NK) cells marked by IOT10, located between the MCF-7 cancer cells. In electron microscopy, the membrane contacts were tight and were accompanied by the appearance of secondary lysosomes and nuclear alterations. The relatively low infiltration level of the nodules may lead to the supposition that an indirect mechanism will intervene in this dual action of a LAK cells: increase of necrosis, although partially, and development of glandular and functional differentiation.

  18. Antiproliferative activity of New Zealand propolis and phenolic compounds vs human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Catchpole, Owen; Mitchell, Kevin; Bloor, Stephen; Davis, Paul; Suddes, Amanda

    2015-10-01

    New Zealand propolis is a "European" type propolis obtained by honey bees mainly from exudates of poplar. European type propolis is known to have anti-inflammatory and anti-cancer properties and this activity has been attributed to some of the main constituents such as chrysin and CAPE (caffeic acid phenethyl ester). As part of our studies on how New Zealand propolis might benefit gastro-intestinal health, we carried out in vitro bioactivity-guided fractionation of "Bio30™" propolis using both anti-inflammatory (TNF-α, COX-1, COX-2) and anti-colon cancer (DLD-1 colon cancer cell viability) assays; and determined the phenolic compounds responsible for the activity. The New Zealand wax-free Bio30™ propolis tincture solids had very high levels of the dihydroflavonoids pinocembrin and pinobanksin-3-O-acetate, and high levels of the dimethylallyl, benzyl and 3-methyl-3-butenyl caffeates relative to CAPE. The DLD-1 assays identified strong anti-proliferative activity associated with these components as well as chrysin, galangin and CAPE and a number of lesser known or lower concentration compounds including benzyl ferulate, benzyl isoferulate, pinostrobin, 5-phenylpenta-2,4-dienoic acid and tectochrysin. The phenolic compounds pinocembrin, pinobanksin-3-O-acetate, tectochrysin, dimethylallyl caffeate, 3-methyl-3-butenyl caffeate, benzyl ferulate and benzyl isoferulate also showed good broad spectrum activity in anti-proliferative assays against three other gastro-intestinal cancer cell lines; HCT-116 colon carcinoma, KYSE-30 oesophageal squamous cancer, and NCI-N87 gastric carcinoma. Activity is also observed in anti-inflammatory assays although it appears to be limited to one of the first cytokines in the inflammatory cascade, TNF-α. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Close relation of large cell carcinoma to adenocarcinoma by hierarchical cluster analysis: implications for histologic typing of lung cancer on biopsies.

    Science.gov (United States)

    Hammer, Stephan H; Prall, Friedrich

    2015-09-01

    Determining histologic types of lung cancer on biopsies can be difficult. This study addresses the role of immunohistochemistry in histologic typing, using a tissue microarray (TMA) as "model biopsies," and presents a classification generated by an unsupervised hierarchical cluster analysis. A TMA was made from resection specimens of a consecutive series of 165 lung tumors. In a "tissue-spot review" with hematoxylin and eosin sections all the large cell carcinomas (N=22) were assigned to the noncommittal class of non-small cell lung cancer (NSCLC), as were an additional 37 tumors of defined histologic types. Adenocarcinomas and squamous cell carcinomas included with these NSCLC could be diagnosed by immunohistochemistry with antibodies against TTF-1, Napsin A, cytokeratin (CK)7, p40, p63, and CK5/6 with moderate to good sensitivities and specificities. Unsupervised hierarchical clustering was done with these data and additional high-molecular-weight cytokeratins, CD56, synaptophysin, and chromogranin immunohistochemistry. This delineated separate clusters for adenocarcinomas, large cell carcinomas, neuroendocrine tumors, and squamous cell carcinomas. Notably, adenocarcinoma and large cell carcinoma clusters were closely related and clearly set off from the squamous cell carcinoma cluster. As would be expected for a clinically well-staged series CDX2, GATA3, estrogen, and progesterone receptor immunohistochemistry remained negative in the vast majority of the tumors and, if positive, were restricted to very few cells. These results, the clustering data in particular, underpin the pragmatic recommendation canvassed with the IASLC/ATS/ERS classification of lung cancers that adenocarcinoma-type molecular studies should include NSCLC with a nonsquamous cell carcinoma immunophenotype.

  20. A Distinct Slow-Cycling Cancer Stem-like Subpopulation of Pancreatic Adenocarcinoma Cells is maintained in Vivo

    Energy Technology Data Exchange (ETDEWEB)

    Dembinski, Jennifer L., E-mail: jennifer.dembinski@rr-research.no; Krauss, Stefan [Cellular and Genetic Therapy, Department of Microbiology, Cancer Stem Cell Innovation Center (CAST), Oslo University Hospital, Rikshospitalet, Oslo (Norway)

    2010-11-29

    Pancreatic adenocarcinoma has the worst prognosis of any major malignancy, with <5% of patients surviving five years. This can be contributed to the often late diagnosis, lack of sufficient treatment and metastatic spread. Heterogeneity within tumors is increasingly becoming a focus in cancer research, as novel therapies are required to target the most aggressive subpopulations of cells that are frequently termed cancer stem cells (CSCs). In the current study, we describe the identification of a slow-cycling cancer stem-like population of cells in vivo in BxPC-3 and Panc03.27 xenografts. A distinct slow-cycling label-retaining population of cells (DiI+/SCC) was found both at the edge of tumors, and in small circumscribed areas within the tumors. DiI+/SCC in these areas display an epithelial-to-mesenchymal transition (EMT) fingerprint, including an upregulation of the mesenchymal markers vimentin and N-cadherin and a loss of the epithelial marker E-cadherin. DiI+/SCC also displayed a critical re-localization of beta-catenin from the membrane to the nucleus. Additionally, the DiI+/SCC population was found to express the developmental signaling molecule sonic hedgehog. This study represents a novel step in defining the biological activities of a tumorigenic subpopulation within the heterogeneous tumor microenvironment in vivo. Understanding the interactions and functions of a CSC population within the context of the tumor microenvironment is critical to design targeted therapeutics.

  1. Generating Rho-0 Cells Using Mesenchymal Stem Cell Lines.

    Directory of Open Access Journals (Sweden)

    Mercedes Fernández-Moreno

    Full Text Available The generation of Rho-0 cells requires the use of an immortalization process, or tumor cell selection, followed by culture in the presence of ethidium bromide (EtBr, incurring the drawbacks its use entails. The purpose of this work was to generate Rho-0 cells using human mesenchymal stem cells (hMSCs with reagents having the ability to remove mitochondrial DNA (mtDNA more safely than by using EtBr.Two immortalized hMSC lines (3a6 and KP were used; 143B.TK-Rho-0 cells were used as reference control. For generation of Rho-0 hMSCs, cells were cultured in medium supplemented with each tested reagent. Total DNA was isolated and mtDNA content was measured by real-time polymerase chain reaction (PCR. Phenotypic characterization and gene expression assays were performed to determine whether 3a6 Rho-0 hMSCs maintain the same stem properties as untreated 3a6 hMSCs. To evaluate whether 3a6 Rho-0 hMSCs had a phenotype similar to that of 143B.TK-Rho-0 cells, in terms of reactive oxygen species (ROS production, apoptotic levels and mitochondrial membrane potential (Δψm were measured by flow cytometry and mitochondrial respiration was evaluated using a SeaHorse XFp Extracellular Flux Analyzer. The differentiation capacity of 3a6 and 3a6 Rho-0 hMSCs was evaluated using real-time PCR, comparing the relative expression of genes involved in osteogenesis, adipogenesis and chondrogenesis.The results showed the capacity of the 3a6 cell line to deplete its mtDNA and to survive in culture with uridine. Of all tested drugs, Stavudine (dt4 was the most effective in producing 3a6-Rho cells. The data indicate that hMSC Rho-0 cells continue to express the characteristic MSC cell surface receptor pattern. Phenotypic characterization showed that 3a6 Rho-0 cells resembled 143B.TK-Rho-0 cells, indicating that hMSC Rho-0 cells are Rho-0 cells. While the adipogenic capability was higher in 3a6 Rho-0 cells than in 3a6 cells, the osteogenic and chondrogenic capacities were lower

  2. Generating Rho-0 Cells Using Mesenchymal Stem Cell Lines.

    Science.gov (United States)

    Fernández-Moreno, Mercedes; Hermida-Gómez, Tamara; Gallardo, M Esther; Dalmao-Fernández, Andrea; Rego-Pérez, Ignacio; Garesse, Rafael; Blanco, Francisco J

    2016-01-01

    The generation of Rho-0 cells requires the use of an immortalization process, or tumor cell selection, followed by culture in the presence of ethidium bromide (EtBr), incurring the drawbacks its use entails. The purpose of this work was to generate Rho-0 cells using human mesenchymal stem cells (hMSCs) with reagents having the ability to remove mitochondrial DNA (mtDNA) more safely than by using EtBr. Two immortalized hMSC lines (3a6 and KP) were used; 143B.TK-Rho-0 cells were used as reference control. For generation of Rho-0 hMSCs, cells were cultured in medium supplemented with each tested reagent. Total DNA was isolated and mtDNA content was measured by real-time polymerase chain reaction (PCR). Phenotypic characterization and gene expression assays were performed to determine whether 3a6 Rho-0 hMSCs maintain the same stem properties as untreated 3a6 hMSCs. To evaluate whether 3a6 Rho-0 hMSCs had a phenotype similar to that of 143B.TK-Rho-0 cells, in terms of reactive oxygen species (ROS) production, apoptotic levels and mitochondrial membrane potential (Δψm) were measured by flow cytometry and mitochondrial respiration was evaluated using a SeaHorse XFp Extracellular Flux Analyzer. The differentiation capacity of 3a6 and 3a6 Rho-0 hMSCs was evaluated using real-time PCR, comparing the relative expression of genes involved in osteogenesis, adipogenesis and chondrogenesis. The results showed the capacity of the 3a6 cell line to deplete its mtDNA and to survive in culture with uridine. Of all tested drugs, Stavudine (dt4) was the most effective in producing 3a6-Rho cells. The data indicate that hMSC Rho-0 cells continue to express the characteristic MSC cell surface receptor pattern. Phenotypic characterization showed that 3a6 Rho-0 cells resembled 143B.TK-Rho-0 cells, indicating that hMSC Rho-0 cells are Rho-0 cells. While the adipogenic capability was higher in 3a6 Rho-0 cells than in 3a6 cells, the osteogenic and chondrogenic capacities were lower. Among the

  3. Down-regulation of HSP40 gene family following OCT4B1 suppression in human tumor cell lines

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Mirzaei

    2016-02-01

    Full Text Available Objective(s: The OCT4B1, as one of OCT4 variants, is expressed in cancer cell lines and tissues more than other variants and plays an important role in apoptosis and stress (heat shock protein pathways. The present study was designed to determine the effects of OCT4B1 silencing on expressional profile of HSP40 gene family expression in three different human tumor cell lines. Materials and Methods: The OCT4B1 expression was suppressed by specific siRNA transfection in AGS (gastric adenocarcinoma, 5637 (bladder tumor and U-87MG (brain tumor cell lines employing Lipofectamine reagent. Real-time PCR array technique was employed for RNA qualification. The fold changes were calculated using RT2 Profiler PCR array data analysis software version 3.5. Results: Our results indicated that fifteen genes (from 36 studied genes were down-regulated and two genes (DNAJC11 and DNAJC5B were up-regulated in all three studied tumor cell lines by approximately more than two folds. The result of other studied genes (19 genes showed different expressional pattern (up or down-expression based on tumor cell lines. Conclusion: According to the findings of the present study, we may suggest that there is a direct correlation between OCT4B1 expression in tumor cell lines (and tissues and HSP40 family gene expressions to escape from apoptosis and cancer expansion.

  4. The response effect of pheochromocytoma (PC12) cell lines to ...

    African Journals Online (AJOL)

    The toxicity of oxidized multi-walled carbon nanotubes (o-MWCNTs) are of utmost concern and in most in-vitro studies conducted so far are on dendritic cell (DC) lines with limited data on PC12 cell lines. Objectives: We focused on the effect of o-MWCNTs in PC12 cells in vitro: a common model cell for neurotoxicity.

  5. Involvement of ERK1/2, p38 MAPK, and PI3K/Akt signaling pathways in the regulation of cell cycle progression by PTHrP in colon adenocarcinoma cells.

    Science.gov (United States)

    Calvo, Natalia; Martín, María Julia; de Boland, Ana Russo; Gentili, Claudia

    2014-08-01

    Parathyroid hormone-related peptide (PTHrP) is distributed in most fetal and adult tissues, and its expression correlates with the severity of colon carcinoma. Recently we obtained evidence that in Caco-2 cells, a cell line from human colorectal adenocarcinoma, exogenous PTHrP increases the number of live cells, via ERK1/2, p38 MAPK, and PI3-kinase and induces the expression of cyclin D1, a cell cycle regulatory protein. In this study, we further investigated the role of PTHrP in the regulation of the cell cycle progression in these intestinal cells. Flow cytometry analysis revealed that PTHrP treatment diminishes the number of cells in the G0/G1 phase and increases the number in both S and G2/M phases. The hormone increases the expression of CDK6 and diminishes the amount of negative cell cycle regulators p27Kip1, p15INK4B, and p53. However, PTHrP does not modify the expression of cyclin D3, CDK4, and p16INK4A. In addition, inhibitors of ERK1/2 (PD98059), p38 MAPK (SB203580), and PI3Kinase (LY294002) reversed PTHrP response in Caco-2 cells. Taken together, our results suggest that PTHrP positively modulates cell cycle progression and changes the expression of proteins involved in cell cycle regulation via ERK1/2, p38 MAPK, and PI3K signaling pathways in Caco-2 cells.

  6. In vitro cytotoxicity of silver nanoparticles and zinc oxide nanoparticles to human epithelial colorectal adenocarcinoma (Caco-2) cells

    Energy Technology Data Exchange (ETDEWEB)

    Song, Yijuan [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Guan, Rongfa, E-mail: rongfaguan@163.com [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Lyu, Fei [Department of Food Science and Technology, Zhejiang University of Technology, Hangzhou 310014 (China); Kang, Tianshu; Wu, Yihang [Zhejiang Provincial Key Laboratory of Biometrology and Inspection and Quarantine, China Jiliang University, Hangzhou 310018 (China); Chen, Xiaoqiang [Hubei University of Technology, Wuhan 430068 (China)

    2014-11-15

    Highlights: • The characterization of Ag NPs and ZnO NPs. • The various morphologies of Caco-2 cells stained with AO/EB. • The viability of Caco-2 cells after Ag NPs and ZnO NPs exposure. • The cytotoxicity of Ag NPs and ZnO NPs on Caco-2 cells by oxidative stress assays. - Abstract: With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200 μg/mL of Ag NPs and ZnO NPs (90 nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0–200 μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD{sub 50} of ZnO NPs in Caco-2 cells is 0.431 mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells’ antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50 μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials

  7. Long noncoding RNA ROR regulates chemoresistance in docetaxel-resistant lung adenocarcinoma cells via epithelial mesenchymal transition pathway.

    Science.gov (United States)

    Pan, Yan; Chen, Jing; Tao, Leilei; Zhang, Kai; Wang, Rui; Chu, Xiaoyuan; Chen, Longbang

    2017-05-16

    Emerging evidence indicates that the dysregulation of long non-coding RNAs (lncRNAs) contributes to the development and progression of lung adenocarcinoma (LAD), however the underlying mechanism of action of lncRNAs remains unclear. It is well known that the effective treatment of cancers has been hindered by drug resistance in the clinical setting. Epithelial-mesenchymal transition (EMT) has been recognized to be involved in acquiring drug resistance, cell migration and invasion properties in several types of cancer. Docetaxel-resistant LAD cells established previously in our lab present chemoresistant and mesenchymal features. Long intergenic non-protein coding RNA, regulator of reprogramming (linc-ROR), was first discovered in induced pluripotent stem cells (iPSCs) and was upregulated in docetaxel-resistant LAD cells. In this study, we tried to make clarification of lincRNA-related mechanisms underlying EMT followed by acquired resistance to chemotherapy in LAD. In order to hit the mark, we made use of multiple methods including microarray analysis, qRT-PCR, western blotting analysis, loss/gain-of-function analysis, luciferase assays, drug sensitivity assays, wound-healing assay and invasion assay. We found that decreased expression of linc-ROR effectively reversed EMT in docetaxel-resistant LAD cells and sensitized them to chemotherapy. The function of linc-ROR exerted in LAD cells depended on the sponging of miR-145, therefore, releasing the miR-145 target FSCN1, and thus contributing to the acquisition of chemoresistance and EMT phenotypes of docetaxel-resistant LAD cells. Our findings revealed that linc-ROR might act as potential therapeutic target to overcome chemotherapy resistance in LAD.

  8. Deleterious effects on MDAMB-231 breast adenocarcinoma cell lineage submitted to Ho-166 radioactive seeds at very low activity

    Energy Technology Data Exchange (ETDEWEB)

    Falcao, Patricia L.; Campos, Tarcisio P.R., E-mail: campos@nuclear.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Engenharia Nuclear; Sarmento, Eduardo V. [Centro de Desenvolvimento de Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Cuperschmid, Ethel M. [Universidade Federal de Minas Gerais (CEMEMOR/UFMG), Belo Horizonte, BR (Brazil). Fac. de Medicina. Centro de Memoria da Medicina

    2011-07-01

    Herein, the deleterious effect of ionizing radiation provided by Ho-166 radioactive seeds at low activity were addressed, based on experimental in vitro assays at the MDA MB231 cell lineage, a breast adenocarcinoma, compared to PBMC - peripheral blood cells. The methodology involves of the MDBMB-231 and PBMC expansion in culture in suitable environment in 30mm well plates and T-25 flasks. Seeds were synthesized with Ho-165 incorporated and characterized previously. Activation was processed at IPR1 reactor at the peripheral table, at 8h exposition. Three groups of seeds were tested: 0,34 mCi, 0,12 mCi activity, and control group. Such seeds were placed on culture and held to a period of 05 half-lives of the radionuclide. The biological responses at these exposure were documented by inverse microscopic photographic in time. Also, MTT essay were performed. A fast response in producing deleterious effects at cancer cell was observed even if for the low activity seeds. Also, a biological response dependent to a radial distance of the seed was observed. At conclusion, viability clonogenic control of MDAMB231 is identified at the exposition to Ho-166 ceramic seeds, even if at low activity of 0,1 to 0,3mCi. (author)

  9. Cyto- and genotoxicity assessment of Gold nanoparticles obtained by laser ablation in A549 lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Bucchianico, Sebastiano Di [Karolinska Institutet, Institute of Environmental Medicine (Sweden); Migliore, Lucia [University of Pisa, Department of Translational Research and New Technologies in Medicine and Surgery, Division of Medical Genetics (Italy); Marsili, Paolo [Institute of Complex Systems (ISC-CNR) (Italy); Vergari, Chiara [Plasma Diagnostics and Technologies s.r.l. (Italy); Giammanco, Francesco [University of Pisa, Department of Physics “E. Fermi” (Italy); Giorgetti, Emilia, E-mail: emilia.giorgetti@fi.isc.cnr.it [Institute of Complex Systems (ISC-CNR) (Italy)

    2015-05-15

    Gold nanoparticles have attracted enormous interest in biomedical applications, based on their unique optical properties. However, their toxicity on human tissues is still an open issue. Beyond the potential intrinsic toxicity of nanostructured gold, a non-negligible contribution of stabilizers or reaction by-products related to current wet chemical synthesis procedures can be expected. Aimed at isolating gold contribution from that of any other contaminant, we produced colloidal suspensions of Gold nanoparticles having average size <10 nm in deionized water or acetone by pulsed laser ablation, that permits preparation of uncoated and highly stable Gold nanoparticles in pure solvents. Subsequently, we investigated the role of surface chemistry, size, and dispersivity of synthesized Gold nanoparticles in exerting toxicity in a cell model system of deep respiratory tract, representing the main route of exposure to NPs, namely adenocarcinoma epithelial A549 cells. Gold nanoparticles prepared in water showed no particular signs of cytotoxicity, cytostasis, and/or genotoxicity as assessed by MTT colorimetric viability test and Cytokinesis-block micronucleus cytome assay up to concentrations of the order of 5 μg/mL. In contrast, Gold nanoparticles produced in pure acetone and then transferred into deionized water showed impaired cell viability, apoptosis responses, micronuclei, and dicentric chromosomes induction as well as nuclear budding, as a function of the amount of surface contaminants like amorphous carbon and enolate ions.

  10. IL-8-Positive Tumor-Infiltrating Inflammatory Cells Are a Novel Prognostic Marker in Pancreatic Ductal Adenocarcinoma Patients.

    Science.gov (United States)

    Fang, Yuan; Saiyin, Hexige; Zhao, Xinping; Wu, Yanhua; Han, Xu; Lou, Wenhui

    2016-01-01

    Tumor-infiltrating inflammatory cells (TIICs) in pancreatic ductal adenocarcinoma (PDAC) are reported to initiate and exacerbate invasion and metastasis. Interleukin-8 (IL-8), a proinflammatory cytokine, is expressed in both neoplastic cells and TIICs in PDAC tissues and increased in patient serum. The aim of this study is to evaluate the values of IL-8 expression profiles in tumor tissues and predict the source of serum IL-8 in PDAC patients. We used 2 independent groups of PDAC patient samples that included 240 cases. Tissue expression profiles of cytokines were evaluated with immunohistochemistry and serum levels with human IL-8 assay. The prognostic values of the variables were assessed by Kaplan-Meier or Cox regression analysis. Higher levels of IL-8-positive TIICs but not tumor cells in PDAC patients correlated with worse prognosis (P = 0.009) and higher blood serum IL-8 levels (P = 0.002). Controlling other independent factors, the relative hazard ratio for PDAC with higher IL-8-positive TIIC levels compared with those with lower TIIC levels was 1.588 (95% confidence interval, 1.04-2.42). Higher IL-8-positive TIIC levels in PDAC tumors indicate poorer prognosis and positively correlate with serum IL-8 concentrations and vice versa. These data suggested that IL-8 might have a potential target for PDAC therapies.

  11. In vitro radiosensitivity of human leukemia cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Weichselbaum, R.R.; Greenberger, J.S.; Schmidt, A.; Karpas, A.; Moloney, W.C.; Little, J.B.

    1981-05-01

    The in vitro radiobiologic survival values (anti n, D/sub 0/) of four tumor lines derived from human hematopoietic tumors were studied. These cell lines were HL60 promyelocytic leukemia; K562 erythroleukemia; 45 acute lymphocytic leukemia; and 176 acute monomyelogenous leukemia. More cell lines must be examined before the exact relationship between in vitro radiosensitivity and clinical radiocurability is firmly established.

  12. MUCOUS CELLS IN THE EPITHELIAL LINING OF DENTIGEROUS CYST

    OpenAIRE

    Pratiksha; Sangeeta; Sumanta; Prashanti; Sathyajitraje; Rajkumar

    2014-01-01

    The epithelial lining of both the developmental and inflammatory cysts of odontogenic origin are primarily composed of squamous epithelium. Various forms of metaplasia and degenerations are observed in these epithelial linings e.g. mucous cells, ciliated cells, para and/or orthokeratinization and formation of hyaline bodies. The present study was designed to investigate the incidences of mucous cells in the epithelial lining of dentigerous cyst. Mucous cells were observed ...

  13. Analysis of renal cancer cell lines from two major resources enables genomics-guided cell line selection

    Science.gov (United States)

    Sinha, Rileen; Winer, Andrew G.; Chevinsky, Michael; Jakubowski, Christopher; Chen, Ying-Bei; Dong, Yiyu; Tickoo, Satish K.; Reuter, Victor E.; Russo, Paul; Coleman, Jonathan A.; Sander, Chris; Hsieh, James J.; Hakimi, A. Ari

    2017-05-01

    The utility of cancer cell lines is affected by the similarity to endogenous tumour cells. Here we compare genomic data from 65 kidney-derived cell lines from the Cancer Cell Line Encyclopedia and the COSMIC Cell Lines Project to three renal cancer subtypes from The Cancer Genome Atlas: clear cell renal cell carcinoma (ccRCC, also known as kidney renal clear cell carcinoma), papillary (pRCC, also known as kidney papillary) and chromophobe (chRCC, also known as kidney chromophobe) renal cell carcinoma. Clustering copy number alterations shows that most cell lines resemble ccRCC, a few (including some often used as models of ccRCC) resemble pRCC, and none resemble chRCC. Human ccRCC tumours clustering with cell lines display clinical and genomic features of more aggressive disease, suggesting that cell lines best represent aggressive tumours. We stratify mutations and copy number alterations for important kidney cancer genes by the consistency between databases, and classify cell lines into established gene expression-based indolent and aggressive subtypes. Our results could aid investigators in analysing appropriate renal cancer cell lines.

  14. Cytokine stimulation of MUC4 expression in human female reproductive tissue carcinoma cell lines and endometrial cancer.

    Science.gov (United States)

    Chapela, Patricia J; Broaddus, Russell R; Hawkins, Shannon M; Lessey, Bruce A; Carson, Daniel D

    2015-11-01

    MUC4, a transmembrane glycoprotein, interferes with cell adhesion, and promotes EGFR signaling in cancer. Studies in rat models have demonstrated steroid hormonal regulation of endometrial MUC4 expression. In this study, qRT-PCR screening of mouse tissues determined that Muc4 mRNA also was robustly expressed in mouse uteri. Previous studies from our labs have demonstrated MUC4 mRNA was expressed at levels human endometrium and endometriotic tissue. Multiple human endometrial adenocarcinoma cell lines were assayed for MUC4 mRNA expression revealing extremely low basal expression in the Ishikawa, RL-95-2, AN3CA, and KLE lines. Moderate to high expression was observed in HEC50 and HEC-1A cells. MUC4 mRNA expression was not affected by progesterone and/or estrogen treatment, but was greatly stimulated at both mRNA and protein levels by proinflammatory cytokines (IFN-γ and TNF-α), particularly when used in combination. In endometrial tissue, MUC4 mRNA levels did not change significantly between normal or cancerous samples; although, a subset of patients with grade 1 and 2 tumors displayed substantially higher expression. Likewise, immunostaining of human endometrial adenocarcinoma tissues revealed little to no staining in many patients (low MUC4), but strong staining in some patients (high MUC4) independent of cancer grade. In cases where staining was observed, it was heterogeneous with some cells displaying robust MUC4 expression and others displaying little or no staining. Collectively, these observations demonstrate that while MUC4 is highly expressed in the mouse uterus, it is not a major mucin in normal human endometrium. Rather, MUC4 is a potential marker of endometrial adenocarcinoma in a subset of patients. © 2015 Wiley Periodicals, Inc.

  15. Differences between gastric signet-ring cell carcinoma and poorly differentiated adenocarcinoma: A comparison of histopathologic features determined by mucin core protein and trefoil factor family peptide immunohistochemistry.

    Science.gov (United States)

    Fujimoto, Ai; Ishikawa, Yukio; Ishii, Toshiharu; Yamada, Akihiro; Igarashi, Yoshinori; Ohmoto, Yasukazu; Kaise, Mitsuru

    2017-08-01

    We investigated differences between the pathological features of gastric signet-ring cell carcinoma (sig) and poorly differentiated adenocarcinoma (por) by examining the expressions of the trefoil factor family peptides (TFFs) and mucin core proteins (MUCs). Ninety-seven tissues of 97 gastric cancer patients were selected for this study. After gastrectomy, the major histopathologic types were determined to be sig, solid-type poorly differentiated adenocarcinoma (por1), non-solid type poorly differentiated adenocarcinoma (por2), and well-differentiated tubular adenocarcinoma (tub1). We evaluated the prevalence of positive staining for MUCs (MUC5AC and MUC2) and TFFs (TFF1 and TFF3) and assessed the correlation between MUCs and TFFs in each histopathological type. The rate of MUC2 expression significantly differed between sig and por2 (50.0% vs 11.7%, P = 0.011). TFF3 expression in sig significantly differed from TFF3 expression in both por2 (100% vs 17.6%, P sig (r = 0.593, P = 0.040). The expression and correlation patterns of the TFFs and MUCs suggest that the histopathologic features of gastric sig differ from those of por. © 2017 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  16. Serous papillary adenocarcinoma possibly related to the presence of primitive oocyte-like cells in the adult ovarian surface epithelium: a case report

    Directory of Open Access Journals (Sweden)

    Virant-Klun Irma

    2011-08-01

    Full Text Available Abstract Introduction The presence of oocytes in the ovarian surface epithelium has already been confirmed in the fetal ovaries. We report the presence of SSEA-4, SOX-2, VASA and ZP2-positive primitive oocyte-like cells in the adult ovarian surface epithelium of a patient with serous papillary adenocarcinoma. Case presentation Ovarian tissue was surgically retrieved from a 67-year old patient. Histological analysis revealed serous papillary adenocarcinoma. A proportion of ovarian cortex sections was deparaffinized and immunohistochemically stained for the expression of markers of pluripotency SSEA-4 and SOX-2 and oocyte-specific markers VASA and ZP2. The analysis confirmed the presence of round, SSEA-4, SOX-2, VASA and ZP2-positive primitive oocyte-like cells in the ovarian surface epithelium. These cells were possibly related to the necrotic malignant tissue. Conclusion Primitive oocyte-like cells present in the adult ovarian surface epithelium persisting probably from the fetal period of life or developed from putative stem cells are a pathological condition which is not observed in healthy adult ovaries, and might be related to serous papillary adenocarcinoma manifestation in the adult ovarian surface epithelium. This observation needs attention to be further investigated.

  17. LFG-500, a novel synthetic flavonoid, suppresses epithelial-mesenchymal transition in human lung adenocarcinoma cells by inhibiting NLRP3 in inflammatory microenvironment.

    Science.gov (United States)

    Yang, Dan; Cao, Xin; Wang, Fan; Jiang, Haijing; Feng, Dingding; Guo, Hao; Du, Lei; Jin, Yingliang; Chen, Yansu; Yin, Xiaoxing; Li, Chenglin

    2017-08-01

    Increasing evidence indicates that inflammatory microenvironment facilitates tumor metastasis. Here, we found that LFG-500, a novel synthetic flavonoid, significantly inhibited epithelial-mesenchymal transition (EMT) in human lung adenocarcinoma A549 and H1299 cells co-cultured with LPS-challenged THP-1 cells or cultured in THP-1 cell-derived conditioned medium. Moreover, we found that TNF-α is a direct and decisive factor for promoting EMT and LFG-500 suppressed TNF-α-induced EMT and cell motility. NLRP3 knockdown inactivated NLRP3 inflammasome, which subsequently inhibited EMT and blocked cell migration, indicating that TNF-α-induced EMT requires the NLRP3 inflammasome. LFG-500 inhibited the activation of the NLRP3 inflammasome, thus inhibiting EMT. Moreover, LFG-500 treatment significantly inhibited metastasis in vivo by downregulating NLRP3 expression. Importantly, we found that NLRP3 was highly expressed in high-grade lung adenocarcinoma and that its expression was correlated with lymph node metastasis. NLRP3 and vimentin levels were significantly increased in matched metastatic lymph nodes. Moreover, a significant positive correlation was observed between their levels. Together, these results suggest that LFG-500 markedly suppresses EMT by inhibiting the NLRP3 inflammasome in the inflammatory microenvironment and that NLRP3 is a potential biomarker of lung adenocarcinoma metastasis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Lycopene Inhibits Metastasis of Human Liver Adenocarcinoma SK-Hep-1 Cells by Downregulation of NADPH Oxidase 4 Protein Expression.

    Science.gov (United States)

    Jhou, Bo-Yi; Song, Tuzz-Ying; Lee, Inn; Hu, Miao-Lin; Yang, Nae-Cherng

    2017-08-16

    NADPH oxidase 4 (NOX4), with the sole function to produce reactive oxygen species (ROS), can be a molecular target for disrupting cancer metastasis. Several studies have indicated that lycopene exhibited anti-metastatic actions in vitro and in vivo. However, the role of NOX4 in the anti-metastatic action of lycopene remains unknown. Herein, we first confirmed the anti-metastatic effect of lycopene (0.1-5 μM) on human liver adenocarcinoma SK-Hep-1 cells. We showed that lycopene significantly inhibited NOX4 protein expression, with the strongest inhibition of 64.3 ± 10.2% (P lycopene. Lycopene also significantly inhibited NOX4 mRNA expression, NOX activity, and intracellular ROS levels in SK-Hep-1 cells. We then determined the effects of lycopene on transforming growth factor β (TGF-β)-induced metastasis. We found that TGF-β (5 ng/mL) significantly increased migration, invasion, and adhesion activity, the intracellular ROS level, matrix metalloproteinase 9 (MMP-9) and MMP-2 activities, the level of NOX4 protein expression, and NOX activity. All these TGF-β-induced effects were antagonized by the incubation of SK-Hep-1 cells with lycopene (2.5 μM). Using transient transfection of siRNA against NOX4, we found that the downregulation of NOX4 could mimic lycopene by inhibiting cell migration and the activities of MMP-9 and MMP-2 during the incubation with or without TGF-β on SK-Hep-1 cells. The results demonstrate that the downregulation of NOX4 plays a crucial role in the anti-metastatic action of lycopene in SK-Hep-1 cells.

  19. Gastrin upregulates the prosurvival factor secretory clusterin in adenocarcinoma cells and in oxyntic mucosa of hypergastrinemic rats.

    Science.gov (United States)

    Fjeldbo, Christina Sæten; Bakke, Ingunn; Erlandsen, Sten Even; Holmseth, Jannicke; Lægreid, Astrid; Sandvik, Arne K; Thommesen, Liv; Bruland, Torunn

    2012-01-01

    We show that the gastric hormone gastrin induces the expression of the prosurvival secretory clusterin (sCLU) in rat adenocarcinoma cells. Clusterin mRNA was still upregulated in the presence of the protein synthesis inhibitor cycloheximide, although at a lower level. This indicates that gastrin induces clusterin transcription independently of de novo protein synthesis but requires de novo protein synthesis of signal transduction pathway components to achieve maximal expression level. Luciferase reporter assay indicates that the AP-1 transcription factor complex is involved in gastrin-mediated activation of the clusterin promoter. Gastrin-induced clusterin expression and subsequent secretion is dependent on sustained treatment, because removal of gastrin after 1-2 h abolished the response. Neutralization of secreted clusterin by a specific antibody abolished the antiapoptotic effect of gastrin on serum starvation-induced apoptosis, suggesting that extracellular clusterin is involved in gastrin-mediated inhibition of apoptosis. The clusterin response to gastrin was validated in vivo in hypergastrinemic rats, showing increased clusterin expression in the oxyntic mucosa, as well as higher levels of clusterin in plasma. In normal rat oxyntic mucosa, clusterin protein was strongly expressed in chromogranin A-immunoreactive neuroendocrine cells, of which the main cell type was the histidine decarboxylase-immunoreactive enterochromaffin-like (ECL) cell. The association of clusterin with neuroendocrine differentiation was further confirmed in human gastric ECL carcinoids. Interestingly, in hypergastrinemic rats, clusterin-immunoreactive cells formed distinct groups of diverse cells at the base of many glands. Our results suggest that clusterin may contribute to gastrin's growth-promoting effect on the oxyntic mucosa.

  20. Claudin-1 promotes TNF-α-induced epithelial-mesenchymal transition and migration in colorectal adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhat, Ajaz A. [Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ahmad, Rizwan; Uppada, SrijayaPrakash B. [Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Singh, Amar B. [From the Department of Veterans Affairs, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Dhawan, Punita, E-mail: punita.dhawan@unmc.edu [From the Department of Veterans Affairs, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Departments of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE 68022 (United States); Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE 68022 (United States)

    2016-11-15

    Epithelial-mesenchymal transition (EMT) is an important mechanism in cancer progression and malignancy including colorectal cancer (CRC). Importantly, inflammatory mediators are critical constituents of the local tumor environment and an intimate link between CRC progression and inflammation is now validated. We and others have reported key role of the deregulated claudin-1 expression in colon carcinogenesis including colitis-associated colon cancer (CAC). However, the causal association between claudin-1 expression and inflammation-induced colon cancer progression remains unclear. Here we demonstrate, TNF-α, a pro-inflammatory cytokine, regulates claudin-1 to modulate epithelial to mesenchymal transition (EMT) and migration in colon adenocarcinoma cells. Importantly, colon cancer cells cultured in the presence of TNF-α (10 ng/ml), demonstrated a sharp decrease in E-cadherin expression and an increase in vimentin expression (versus control cells). Interestingly, TNF-α treatment also upregulated (and delocalized) claudin-1 expression in a time-dependent manner accompanied by increase in proliferation and wound healing. Furthermore, similar to our previous observation that claudin-1 overexpression in CRC cells induces ERK1/2 and Src- activation, signaling associated with colon cancer cell survival and transformation, TNF-α-treatment induced upregulation of phospho-ERK1/2 and -Src expression. The shRNA-mediated inhibition of claudin-1 expression largely abrogated the TNF-α-induced changes in EMT, proliferation, migration, p-Erk and p-Src expression. Taken together, our data demonstrate TNF-α mediated regulation of claudin-1 and tumorigenic abilities of colon cancer cells and highlights a key role of deregulated claudin-1 expression in inflammation-induced colorectal cancer growth and progression, through the regulation of the ERK and Src-signaling.

  1. Epithelial-to-mesenchymal transition in pancreatic ductal adenocarcinoma: Characterization in a 3D-cell culture model.

    Science.gov (United States)

    Gagliano, Nicoletta; Celesti, Giuseppe; Tacchini, Lorenza; Pluchino, Stefano; Sforza, Chiarella; Rasile, Marco; Valerio, Vincenza; Laghi, Luigi; Conte, Vincenzo; Procacci, Patrizia

    2016-05-14

    To analyze the effect of three-dimensional (3D)-arrangement on the expression of epithelial-to-mesenchymal transition markers in pancreatic adenocarcinoma (PDAC) cells. HPAF-II, HPAC, and PL45 PDAC cells were cultured in either 2D-monolayers or 3D-spheroids. Ultrastructure was analyzed by transmission electron microscopy. The expression of E-cadherin, β-catenin, N-cadherin, collagen type I (COL-I), vimentin, α-smooth muscle actin (αSMA), and podoplanin was assayed by confocal microscopy in cells cultured on 12-mm diameter round coverslips and in 3D-spheroids. Gene expression for E-cadherin, Snail, Slug, Twist, Zeb1, and Zeb2 was quantified by real-time PCR. E-cadherin protein level and its electrophoretic pattern were studied by Western blot in cell lysates obtained from cells grown in 2D-monolayers and 3D-spheroids. The E-cadherin/β-catenin complex was expressed in a similar way in plasma membrane cell boundaries in both 2D-monolayers and 3D-spheroids. E-cadherin increased in lysates obtained from 3D-spheroids, while cleavage fragments were more evident in 2D-monolayers. N-cadherin expression was observed in very few PDAC cells grown in 2D-monolayers, but was more evident in 3D-spheroids. Some cells expressing COL-I were observed in 3D-spheroids. Podoplanin, expressed in collectively migrating cells, and αSMA were similarly expressed in both experimental conditions. The concomitant maintenance of the E-cadherin/β-catenin complex at cell boundaries supports the hypothesis of a collective migration for these cells, which is consistent with podoplanin expression. We show that a 3D-cell culture model could provide deeper insight into understanding the biology of PDAC and allow for the detection of marked differences in the phenotype of PDAC cells grown in 3D-spheroids.

  2. The in vitro photodynamic effect of laser activated gallium, indium and iron phthalocyanine chlorides on human lung adenocarcinoma cells.

    Science.gov (United States)

    Maduray, K; Odhav, B

    2013-11-05

    Metal-based phthalocyanines currently are utilized as a colorant for industrial applications but their unique properties also make them prospective photosensitizers. Photosensitizers are non-toxic drugs, which are commonly used in photodynamic therapy (PDT), for the treatment of various cancers. PDT is based on the principle that, exposure to light shortly after photosensitizer administration predominately leads to the production of reactive oxygen species for the eradication of cancerous cells and tissue. This in vitro study investigated the photodynamic effect of gallium (GaPcCl), indium (InPcCl) and iron (FePcCl) phthalocyanine chlorides on human lung adenocarcinoma cells (A549). Experimentally, 2 × 10(4)cells/ml were seeded in 24-well tissue culture plates and allowed to attach overnight, after which cells were treated with different concentrations of GaPcCl, InPcCl and FePcCl ranging from 2 μg/ml to 100 μg/ml. After 2h, cells were irradiated with constant light doses of 2.5 J/cm(2), 4.5 J/cm(2) and 8.5 J/cm(2) delivered from a diode laser (λ = 661 nm). Post-irradiated cells were incubated for 24h before cell viability was measured using the MTT Assay. At 24h after PDT, irradiation with a light dose of 2.5 J/cm(2) for each photosensitizing concentration of GaPcCl, InPcCl and FePcCl produced a significant decrease in cell viability, but when the treatment light dose was further increased to 4.5 J/cm(2) and 8.5 J/cm(2) the cell survival was less than 40%. Results also showed that photoactivated FePcCl decreased cell survival of A549 cells to 0% with photosensitizing concentrations of 40 μg/ml and treatment light dose of 2.5 J/cm(2). A 20 μg/ml photosensitizing concentration of FePcCl in combination with an increased treatment light dose of either 4.5 J/cm(2) or 8.5 J/cm(2) also resulted in 0% cell survival. This PDT study concludes that low concentrations on GaPcCl, InPcCl and FePcCl activated with low level light doses can be used for the effective in

  3. In vitro cytotoxicity of silver nanoparticles and zinc oxide nanoparticles to human epithelial colorectal adenocarcinoma (Caco-2) cells.

    Science.gov (United States)

    Song, Yijuan; Guan, Rongfa; Lyu, Fei; Kang, Tianshu; Wu, Yihang; Chen, Xiaoqiang

    2014-11-01

    With the increasing applications of silver nanoparticles (Ag NPs) and zinc oxide nanoparticles (ZnO NPs) in foods and cosmetics, the concerns about the potential toxicities to human have been raised. The aims of this study are to observe the cytotoxicity of Ag NPs and ZnO NPs to human epithelial colorectal adenocarcinoma (Caco-2) cells in vitro, and to discover the toxicity mechanism of nanoparticles on Caco-2 cells. Caco-2 cells were exposed to 10, 25, 50, 100, 200μg/mL of Ag NPs and ZnO NPs (90nm). AO/EB double staining was used to characterize the morphology of the treated cells. The cell counting kit-8 (CCK-8) assay was used to detect the proliferation of the cells. Reactive oxygen species (ROS), superoxide dismutase (SOD) and glutathione (GSH) assay were used to explore the oxidative damage of Caco-2 cells. The results showed that Ag NPs and ZnO NPs (0-200μg/mL) had highly significant effect on the Caco-2 cells activity. ZnO NPs exerted higher cytotoxicity than Ag NPs in the same concentration range. ZnO NPs have dose-depended toxicity. The LD50 of ZnO NPs in Caco-2 cells is 0.431mg/L. Significant depletion of SOD level, variation in GSH level and release of ROS in cells treated by ZnO NPs were observed, which suggests that cytotoxicity of ZnO NPs in intestine cells might be mediated through cellular oxidative stress. While Caco-2 cells treated with Ag NPs at all experimental concentrations showed no cellular oxidative damage. Moreover, the cells' antioxidant capacity increased, and reached the highest level when the concentration of Ag NPs was 50μg/mL. Therefore, it can be concluded that Ag NPs are safer antibacterial material in food packaging materials than ZnO NPs. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Role of ATM in bystander signaling between human monocytes and lung adenocarcinoma cells.

    Science.gov (United States)

    Ghosh, Somnath; Ghosh, Anu; Krishna, Malini

    2015-12-01

    The response of a cell or tissue to ionizing radiation is mediated by direct damage to cellular components and indirect damage mediated by radiolysis of water. Radiation affects both irradiated cells and the surrounding cells and tissues. The radiation-induced bystander effect is defined by the presence of biological effects in cells that were not themselves in the field of irradiation. To establish the contribution of the bystander effect in the survival of the neighboring cells, lung carcinoma A549 cells were exposed to gamma-irradiation, 2Gy. The medium from the irradiated cells was transferred to non-irradiated A549 cells. Irradiated A549 cells as well as non-irradiated A549 cells cultured in the presence of medium from irradiated cells showed decrease in survival and increase in γ-H2AX and p-ATM foci, indicating a bystander effect. Bystander signaling was also observed between different cell types. Phorbol-12-myristate-13-acetate (PMA)-stimulated and gamma-irradiated U937 (human monocyte) cells induced a bystander response in non-irradiated A549 (lung carcinoma) cells as shown by decreased survival and increased γ-H2AX and p-ATM foci. Non-stimulated and/or irradiated U937 cells did not induce such effects in non-irradiated A549 cells. Since ATM protein was activated in irradiated cells as well as bystander cells, it was of interest to understand its role in bystander effect. Suppression of ATM with siRNA in A549 cells completely inhibited bystander effect in bystander A549 cells. On the other hand suppression of ATM with siRNA in PMA stimulated U937 cells caused only a partial inhibition of bystander effect in bystander A549 cells. These results indicate that apart from ATM, some additional factor may be involved in bystander effect between different cell types. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Polyunsaturated fatty acid metabolism in enterocyte models: T84 cell line vs. Caco-2 cell line.

    Science.gov (United States)

    Beguin, Pauline; Schneider, Anne-Catherine; Mignolet, Eric; Schneider, Yves-Jacques; Larondelle, Yvan

    2014-02-01

    Human colon carcinoma cell lines such as Caco-2 cells, model of mature enterocytes and T84 cells, model of crypt cells are useful to study interactions between nutrient processing and metabolic functions at intestinal level. Our study aimed at comparing the ability of Caco-2 and T84 cells (1) to incorporate dietary polyunsaturated fatty acids (PUFA), (2) to process them and (3) to sort them into neutral lipids (NL), free fatty acids (FFA) and phospholipids (PL). Caco-2 and T84 cells were exposed to a 7-day long supplementation with PUFA. The amounts of fatty acids accumulated and incorporated into the NL, FFA or PL fractions were higher in Caco-2 than in T84 cells. Caco-2 cells were able to significantly elongate C18 PUFA and C20 PUFA of both n-3 and n-6 families. In contrast, T84 cells were unable to elongate the n-6 fatty acids whereas elongation of n-3 fatty acids was detectable but marginal. Similarly, a Δ6 desaturase activity was observed in Caco-2 but not in T84 cells. In T84 cells, each exogenous fatty acid was predominantly accumulated in the PL fraction. In Caco-2 cells, C20 fatty acids and C18:2n-6 was preferentially accumulated in the PL fraction, while C22 PUFA and C18:3n-3 was preferentially accumulated in the NL fraction. Overall, this study has shown that Caco-2 and T84 cells, as models of intestinal mucosal cells, present large differences in PUFA accumulation capacity, specific elongase and desaturase activities and distribution pattern of exogenous PUFA and of their metabolites in the lipid classes.

  6. Scaffold-Free Coculture Spheroids of Human Colonic Adenocarcinoma Cells and Normal Colonic Fibroblasts Promote Tumorigenicity in Nude Mice

    Directory of Open Access Journals (Sweden)

    Jong-il Park

    2016-02-01

    Full Text Available The aim of this study was to form a scaffold-free coculture spheroid model of colonic adenocarcinoma cells (CACs and normal colonic fibroblasts (NCFs and to use the spheroids to investigate the role of NCFs in the tumorigenicity of CACs in nude mice. We analysed three-dimensional (3D scaffold-free coculture spheroids of CACs and NCFs. CAC Matrigel invasion assays and tumorigenicity assays in nude mice were performed to examine the effect of NCFs on CAC invasive behaviour and tumorigenicity in 3D spheroids. We investigated the expression pattern of fibroblast activation protein-α (FAP-α by immunohistochemical staining. CAC monocultures did not form densely-packed 3D spheroids, whereas cocultured CACs and NCFs formed 3D spheroids. The 3D coculture spheroids seeded on a Matrigel extracellular matrix showed higher CAC invasiveness compared to CACs alone or CACs and NCFs in suspension. 3D spheroids injected into nude mice generated more and faster-growing tumors compared to CACs alone or mixed suspensions consisting of CACs and NCFs. FAP-α was expressed in NCFs-CACs cocultures and xenograft tumors, whereas monocultures of NCFs or CACs were negative for FAP-α expression. Our findings provide evidence that the interaction between CACs and NCFs is essential for the tumorigenicity of cancer cells as well as for tumor propagation.

  7. Santamarine Inhibits NF-κB Activation and Induces Mitochondrial Apoptosis in A549 Lung Adenocarcinoma Cells via Oxidative Stress

    Directory of Open Access Journals (Sweden)

    Xuefeng Wu

    2017-01-01

    Full Text Available Santamarine (STM, a sesquiterpene lactone component of Magnolia grandiflora and Ambrosia confertiflora, has been shown to possess antimicrobial, antifungal, antibacterial, anti-inflammatory, and anticancer activities. However, no study has yet been conducted to investigate the molecular mechanism of STM-mediated anticancer activity. In the present study, we found that STM inhibits growth and induces apoptosis in A549 lung adenocarcinoma cells through induction of oxidative stress. STM induces oxidative stress by promoting reactive oxygen species (ROS generation, depleting intracellular glutathione (GSH, and inhibiting thioredoxin reductase (TrxR activity in a dose-dependent manner. Further mechanistic study demonstrated that STM induces apoptosis by modulation of Bax/Bcl-2 expressions, disruption of mitochondrial membrane potential, activation of caspase-3, and cleavage of PARP in a dose-dependent manner. Moreover, STM inhibited the constitutive and inducible translocation of NF-κBp65 into the nucleus. IKK-16 (I-κB kinase inhibitor augmented the STM-induced apoptosis, indicating that STM induces apoptosis in A549 cells at least in part through NF-κB inhibition. Finally, STM-induced apoptosis and expressions of apoptosis regulators were effectively inhibited by thiol antioxidant N-acetyl-L-cysteine (NAC, indicating that STM exerts its anticancer effects mainly through oxidative stress. To the best of our knowledge, this is the first report providing evidence of anticancer activity and molecular mechanism of STM.

  8. Cyto- and genotoxicity assessment of Gold nanoparticles obtained by laser ablation in A549 lung adenocarcinoma cells

    Science.gov (United States)

    Di Bucchianico, Sebastiano; Migliore, Lucia; Marsili, Paolo; Vergari, Chiara; Giammanco, Francesco; Giorgetti, Emilia

    2015-05-01

    Gold nanoparticles have attracted enormous interest in biomedical applications, based on their unique optical properties. However, their toxicity on human tissues is still an open issue. Beyond the potential intrinsic toxicity of nanostructured gold, a non-negligible contribution of stabilizers or reaction by-products related to current wet chemical synthesis procedures can be expected. Aimed at isolating gold contribution from that of any other contaminant, we produced colloidal suspensions of Gold nanoparticles having average size adenocarcinoma epithelial A549 cells. Gold nanoparticles prepared in water showed no particular signs of cytotoxicity, cytostasis, and/or genotoxicity as assessed by MTT colorimetric viability test and Cytokinesis-block micronucleus cytome assay up to concentrations of the order of 5 μg/mL. In contrast, Gold nanoparticles produced in pure acetone and then transferred into deionized water showed impaired cell viability, apoptosis responses, micronuclei, and dicentric chromosomes induction as well as nuclear budding, as a function of the amount of surface contaminants like amorphous carbon and enolate ions.

  9. Adenocarcinomas of the gastro-oesophageal junction : from gene to clinic

    NARCIS (Netherlands)

    B.P.L. Wijnhoven (Bas)

    2001-01-01

    textabstractAdenocarcinomas of the gastro-oesophageal junction are thought to arise from premalignant Barretr's epithelium. Barrett's epithelium is columnar epithelium that has replaced the normal squamous cell lining of the oesopha",ous. This metaplastic change is driven by

  10. Comparative proteomic analysis of fibrosarcoma and skin fibroblast cell lines.

    Science.gov (United States)

    Meral, Ogunc; Uysal, Hamdi

    2015-02-01

    Comparative proteomic analysis of normal and cancer cell lines provides for a better understanding of the molecular mechanism of cancer development and is essential for developing more effective strategies for new biomarker or drug target discovery. The purpose of this study is to compare protein expression levels between fibrosarcoma and fibroblast cell lines. In our study, two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) and liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) techniques were carried out to compare the protein profile between fibrosarcoma and fibroblast cell lines. We prepared cell lysate samples to analyze intracellular proteins and secretome samples to analyze extracellular proteins in both cell lines. Our results revealed 13 upregulated proteins and 1 downregulated protein of which all of them identified in fibrosarcoma cell line after the comparison with fibroblast cell line cell lysates. When comparing secretome profiles of both cell lines, we found and identified 13 proteins only expressed in fibrosarcoma cell line. These identified proteins have common functions such as cell proliferation, cell differentiation, invasion, metastasis, and apoptosis in cancer. The data obtained from this study indicates that these proteins have importance on understanding the molecular mechanism of fibrosarcoma. These proteins may serve as candidate biomarkers and drug targets for future clinical studies.

  11. Effects of Urtica dioica dichloromethane extract on cell apoptosis and related gene expression in human breast cancer cell line (MDA-MB-468).

    Science.gov (United States)

    Mohammadi, A; Mansoori, B; Goldar, S; Shanehbandi, D; Khaze, V; Mohammadnejad, L; Baghbani, E; Baradaran, B

    2016-02-29

    Breast cancer is the most common cancer among women in worldwide, especially in developing countries. Therefore, a large number of anticancer agents with herbal origins have been reported against this deadly disease. This study is the first to examine the cytotoxic and apoptotic effects of Urtica dioica in MDA-MB-468, human breast adenocarcinoma cells. The 3-(4,5-dimethylethiazol-2 yl)-2,5- diphenyltetrazolium (MTT) reduction and trypan-blue exclusion assay were performed in MDA-MB-468 cells as well as control cell line L929 to analyze the cytotoxic activity of the dichloromethane extract. In addition, Apoptosis induction of Urtica dioica on the MDA-MB-468 cells was assessed using TUNEL (terminal deoxy transferase (TdT)-mediated dUTP nick- end labeling) assay and DNA fragmentation analysis and real-time polymerase chain reaction (PCR). The results showed that the extract significantly inhibited cell growth and viability without inducing damage to normal control cells. Nuclei Staining in TUNEL and DNA fragments in DNA fragmentation assay and increase in the mRNA expression levels of caspase-3, caspase-9, decrease in the bcl2 and no significant change in the caspase-8 mRNA expression level, showed that the induction of apoptosis was the main mechanism of cell death that induce by Urtica dioica extract. Our results suggest that urtica dioica dichloromethane extract may contain potential bioactive compound(s) for the treatment of breast adenocarcinoma.

  12. Prostatic adenocarcinoma (PCa metastasizing to renal cell carcinoma (RCC with periureteral tumor deposit: A case of tumor-to-tumor metastasis (TTM

    Directory of Open Access Journals (Sweden)

    Jenissa Amor Dionisio Arceño, MD

    2017-06-01

    Full Text Available Renal cell carcinoma (RCC and prostatic adenocarcinoma (PCa, occurring as a double primary is uncommon, but well documented. However, metastatic PCa in a RCC is quite rare. We report a case of an 81-year old male chemical engineer with history of hematuria and prostatomegaly suspicious for carcinoma, who underwent left radical nephrectomy for a renal mass. Histopathology revealed RCC that harbored an undiagnosed PCa. Periureteral tumor deposit likewise showed combined metastasis of RCC and PCa.

  13. Successful Salvage Chemotherapy with FOLFIRINOX for Recurrent Mixed Acinar Cell Carcinoma and Ductal Adenocarcinoma of the Pancreas in an Adolescent Patient

    Directory of Open Access Journals (Sweden)

    Sarah Pfrommer

    2013-09-01

    Full Text Available Pancreatic tumors are rare in children and adolescents. Here, we report the case of a 15-year-old boy who presented with a mixed acinar cell carcinoma/ductal adenocarcinoma with blastomatous components. He received multimodal treatment including various chemotherapy regimens and multistep surgery including liver transplantation. Introduction of FOLFIRINOX after relapse repeatedly achieved a durable metabolic and clinical response with good quality of life.

  14. Evaluating the Number of Stages in Development of Squamous Cell and Adenocarcinomas across Cancer Sites Using Human Population-Based Cancer Modeling

    OpenAIRE

    Julia Kravchenko; Igor Akushevich; Abernethy, Amy P; Kim Lyerly, H.

    2012-01-01

    BACKGROUND: Adenocarcinomas (ACs) and squamous cell carcinomas (SCCs) differ by clinical and molecular characteristics. We evaluated the characteristics of carcinogenesis by modeling the age patterns of incidence rates of ACs and SCCs of various organs to test whether these characteristics differed between cancer subtypes. METHODOLOGY/PRINCIPAL FINDINGS: Histotype-specific incidence rates of 14 ACs and 12 SCCs from the SEER Registry (1973-2003) were analyzed by fitting several biologically mo...

  15. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells.

    Directory of Open Access Journals (Sweden)

    Jie Hong

    Full Text Available Mechanisms of the progression from Barrett's esophagus (BE to esophageal adenocarcinoma (EA are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA.

  16. Phospho-ERK1/2 levels in cancer cell nuclei predict responsiveness to radiochemotherapy of rectal adenocarcinoma

    DEFF Research Database (Denmark)

    Holck, Susanne; phw435, phw435; Pedersen, Niels

    2015-01-01

    Locally advanced rectal adenocarcinoma is treated with radiochemotherapy (RCT) before surgery. The response to RCT is heterogeneous and consensus regarding reliable predictors is lacking. Since the ERK pathway is implicated in radioprotection, we examined pretreatment biopsies from 52 patients...

  17. Metastatic appendiceal goblet cell carcinoid masquerading as mucinous adenocarcinoma in effusion cytology: A diagnostic pitfall

    Directory of Open Access Journals (Sweden)

    Anuja Gupta

    2013-01-01

    Full Text Available Goblet cell carcinoids are rare tumors of appendix having a mixed phenotype, with partial neuroendocrine differentiation and intestinal type goblet cell morphology. The reported incidence of this tumor is still limited. Till now, only two cases of metastatic goblet cell appendiceal carcinoid on effusion cytology have been reported in literature. We describe the clinico-pathological details and lay stress on fluid cytology of metastatic goblet cell carcinoid to ascitic fluid.

  18. Isolation of a Wheat Cell Line with Altered Membrane Properties

    Science.gov (United States)

    Erdei, László; Vigh, László; Dudits, Dénes

    1982-01-01

    A spontaneous dimethylsulfoxide (DMSO)-tolerant cell line was isolated from a cell culture of wheat (Triticum monococcum L.). The tolerant cells were able to grow in the presence of 4% DMSO. Cells formed from protoplasts of the tolerant line required DMSO for division in culture medium of high osmotic value. Fatty acid composition and the molar ratio of phospholipids/sterols suggest a more ordered membrane structure in the tolerant line. Accordingly, a lower K+ influx rate was detected in the tolerant cells in comparison with the original line. These characteristics were maintained after 6 months' cultivation of the cells in DMSO-free growth medium. This suggested that genetic changes could be responsible for differences between the two cell lines. PMID:16662251

  19. Apoptotic Effect of the Urtica Dioica Plant Extracts on Breast Cancer Cell Line (MDA- MB- 468

    Directory of Open Access Journals (Sweden)

    A Mohammadi

    2015-09-01

    Full Text Available Background & objectives: Cancer is one of the most causes of mortality in worldwide. Components derived from natural plants that induce apoptosis are used for cancer treatment. Therefore investigation of different herbal components for new anti-cancer drug is one of the main research activities throughout the world. According to low cost, oral consumption and easy access to the public extracts of Urtica dioica, in this study we aimed to investigate the effectiveness of this herb on MDA-MB-468 breast cancer cells.   Methods: Cytotoxic effect of Urtica dioica extract was measured using MTT assays. To show induction of apoptosis by this plant TUNEL and DNA Fragmentation test were performed.   Results: In the present study dichloromethane extracts noticeably killed cancer cells. IC50 values related to human breast adenocarcinoma cell line MDA-MB-468 were 29.46±1.05 µg/ml in 24 hours and 15.54±1.04 µg/ml in 48 hours. TUNEL test and DNA Fragmentation assay showed apoptotic characteristic in the extract treated cells.   Conclusion: The results showed that MDA-MB-468 cells after treatment with dichloromethane extract of Urtica dioica, induces apoptosis in MDA-MB-468 cancer cells which may be useful in the treatment of cancer.

  20. Investigation of the selenium metabolism in cancer cell lines

    DEFF Research Database (Denmark)

    Lunøe, Kristoffer; Gabel-Jensen, Charlotte; Stürup, Stefan

    2011-01-01

    The aim of this work was to compare different selenium species for their ability to induce cell death in different cancer cell lines, while investigating the underlying chemistry by speciation analysis. A prostate cancer cell line (PC-3), a colon cancer cell line (HT-29) and a leukaemia cell line...... (Jurkat E6-1) were incubated with five selenium compounds representing inorganic as well as organic Se compounds in different oxidation states. Selenomethionine (SeMet), Se-methylselenocysteine (MeSeCys), methylseleninic acid (MeSeA), selenite and selenate in the concentration range 5-100 mu M were...... incubated with cells for 24 h and the induction of cell death was measured using flow cytometry. The amounts of total selenium in cell medium, cell lysate and the insoluble fractions was determined by ICP-MS. Speciation analysis of cellular fractions was performed by reversed phase, anion exchange and size...

  1. Derivation and characterization of a pig embryonic stem cell-derived exocrine pancreatic cell line

    Science.gov (United States)

    The establishment and initial characterization of a pig embryonic stem cell-derived pancreatic cell line, PICM-31, and a colony-cloned derivative cell line, PICM-31A, is described. The cell lines were propagated for several months at split ratios of 1:3 or 1:5 at each passage on STO feeder cells af...

  2. Cytological Study of Grade 3 Endometrioid Adenocarcinoma of Endometrial Origin: Cytoarchitecture and Features of Cell Clusters Assessed With Endometrial Brushing Cytology--Focusing on a comparison with endometrioid adenocarcinoma Grade 1, 2.

    Science.gov (United States)

    Matsui, Naruaki; Kajiwara, Hiroshi; Morishita, Akihiro; Tsukada, Hitomi; Nakazawa, Kazumi; Miyazawa, Masaki; Mikami, Mikio; Nakamura, Naoya; Sato, Shinkichi

    2015-06-20

    Aim of study was to clarify the cytological characteristics of grade 3 endometrioid adenocarcinoma of endometrial origin (G3 EA) by endometrial brushing cytology. The subjects were 11 patients in whom G3 EA was diagnosed by review of preoperative cytological specimens obtained at our hospital and related institutions between 2000 and 2010. These patients were investigated with respect to the preoperative cytological diagnosis, background changes, cell cluster patterns, and individual cellular findings. Background changes were classified as inflammatory or tumorous, while cell clusters were classified as overlapping cell cluster, sheet-like cell cluster, clump of high dense gland, papillary, or other cell cluster. Cellular findings were investigated by comparing the incidence of squamous and clear cell metaplasia, the nuclear rounding rate, and the nuclear area with the findings in a control group (35 patients with G1-2 EA). Background changes were classified as inflammatory in 63.6% and necrotic in 36.4%. The cell clusters were classified as overlapping cell cluster in 44.8%, cell cluster in 21.7%, clump of high dense gland in 10.0%, papillary in 4.0%, and other cell cluster in 19.5%. The incidence of squamous and clear cell metaplasia was 27.2% and 18.1%, respectively. The mean nuclear rounding rate was 0.97, and the mean nuclear area was 55.98 µm2. Investigation of the cytoarchitecture of G3 EA with endometrial brushing cytology revealed overlapping cell cluster and tumor cells of a relatively uniform size. These findings suggest that it is necessary to recognize that there are differences between the cytological findings of G3 EA and the usual features of G1-2 EA.

  3. CLCA2 as a Novel Immunohistochemical Marker for Differential Diagnosis of Squamous Cell Carcinoma from Adenocarcinoma of the Lung

    Directory of Open Access Journals (Sweden)

    Kazuya Shinmura

    2014-01-01

    Full Text Available Recent progress in targeted therapy for lung cancer has revealed that accurate differential diagnosis between squamous cell carcinoma (SCC and adenocarcinoma (ADC of the lung is essential. To identify a novel immunohistochemical marker useful for differential diagnosis between the two subtypes of lung cancer, we first selected 24 SCC-specific genes and 6 ADC-specific genes using data (case number, 980 from the Cancer Genome Atlas (TCGA database. Among the genes, we chose the CLCA2 gene, which is involved in chloride conductance and whose protein expression in lung cancer is yet to be characterized, and evaluated its protein expression status in 396 cases of primary lung cancer at Hamamatsu University Hospital. Immunohistochemical analysis revealed a significantly higher CLCA2 expression level in the SCCs than in the ADCs (P<0.0001 and also a significantly higher frequency of CLCA2 protein expression in the SCCs (104/161, 64.6% as compared with that in the ADCs (2/235, 0.9% (P<0.0001; sensitivity 64.6%, specificity 99.1%. The CLCA2 protein expression status was associated with the histological tumor grade in the SCCs. These results suggest that CLCA2 might be a novel excellent immunohistochemical marker for differentiating between primary SCC and primary ADC of the lung.

  4. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  5. The extracellular matrix and focal adhesion kinase signaling regulate cancer stem cell function in pancreatic ductal adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Asma Begum

    Full Text Available Cancer stem cells (CSCs play an important role in the clonogenic growth and metastasis of pancreatic ductal adenocarcinoma (PDAC. A hallmark of PDAC is the desmoplastic reaction, but the impact of the tumor microenvironment (TME on CSCs is unknown. In order to better understand the mechanisms, we examined the impact of extracellular matrix (ECM proteins on PDAC CSCs. We quantified the effect of ECM proteins, β1-integrin, and focal adhesion kinase (FAK on clonogenic PDAC growth and migration in vitro and tumor initiation, growth, and metastasis in vivo in nude mice using shRNA and overexpression constructs as well as small molecule FAK inhibitors. Type I collagen increased PDAC tumor initiating potential, self-renewal, and the frequency of CSCs through the activation of FAK. FAK overexpression increased tumor initiation, whereas a dominant negative FAK mutant or FAK kinase inhibitors reduced clonogenic PDAC growth in vitro and in vivo. Moreover, the FAK inhibitor VS-4718 extended the anti-tumor response to gemcitabine and nab-paclitaxel in patient-derived PDAC xenografts, and the loss of FAK expression limited metastatic dissemination of orthotopic xenografts. Type I collagen enhances PDAC CSCs, and both kinase-dependent and independent activities of FAK impact PDAC tumor initiation, self-renewal, and metastasis. The anti-tumor impact of FAK inhibitors in combination with standard chemotherapy support the clinical testing of this combination.

  6. A comparative Analysis by SAGE of Gene Expression Profiles of Esophageal Adenocarcinoma and Esophageal Squamous Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Jantine W. P. M. van Baal

    2008-01-01

    Full Text Available Esophageal adenocarcinoma (EA and esophageal squamous cell carcinoma (ESCC are the two main types of esophageal cancer. Despite extensive research the exact molecular basis of these cancers is unclear. Therefore we evaluated the transcriptome of EA in comparison to non-dysplastic Barrett’s esophagus (BE, the metaplastic epithelium that predisposes for EA, and compared the transcriptome of ESCC to normal esophageal squamous epithelium. For obtaining the transcriptomes tissue biopsies were used and serial analysis of gene expression (SAGE was applied. Validation of results by RT-PCR and immunoblotting was performed using tissues of an additional 23 EA and ESCC patients. Over 58,000 tags were sequenced. Between EA and BE 1013, and between ESCC and normal squamous epithelium 1235 tags were significantly differentially expressed (p < 0.05. The most up-regulated genes in EA compared to BE were SRY-box 4 and Lipocalin2, whereas the most down-regulated genes in EA were Trefoil factors and Annexin A10. The most up-regulated genes in ESCC compared to normal squamous epithelium were BMP4, E-Cadherin and TFF3. The results could suggest that the BE expression profile is closer related to normal squamous esophagus then to EA. In addition, several uniquely expressed genes are identified.

  7. Differential role of gene hypermethylation in adenocarcinomas, squamous cell carcinomas and cervical intraepithelial lesions of the uterine cervix.

    Science.gov (United States)

    Blanco-Luquin, Idoia; Guarch, Rosa; Ojer, Amaya; Pérez-Janices, Noemí; Martín-Sánchez, Esperanza; Maria-Ruiz, Sergio; Monreal-Santesteban, Iñaki; Blanco-Fernandez, Laura; Pernaut-Leza, Eduardo; Escors, David; Guerrero-Setas, David

    2015-09-01

    Cervical cancer is the third most common cancer in women worldwide. The hypermethylation of P16, TSLC-1 and TSP-1 genes was analyzed in squamous cell carcinomas (SCC), cervical intraepithelial lesions (CIN) and adenocarcinomas (ADC) of the uterine cervix (total 181 lesions). Additionally human papillomavirus (HPV) type, EPB41L3, RASSF1 and RASSF2 hypermethylation were tested in ADC and the results were compared with those obtained previously by our group in SCC. P16, TSLC-1 and TSP-1 hypermethylation was more frequent in SCCs than in CINs. These percentages and the corresponding ones for EPB41L3, RASSF1 and RASSF2 genes were also higher in SCCs than in ADCs, except for P16. The presence of HPV in ADCs was lower than reported previously in SCC and CIN. Patients with RASSF1A hypermethylation showed significantly longer disease-free survival (P = 0.015) and overall survival periods (P = 0.009) in ADC patients. To our knowledge, this is the first description of the EPB41L3 and RASSF2 hypermethylation in ADCs. These results suggest that the involvement of DNA hypermethylation in cervical cancer varies depending on the histological type, which might contribute to explaining the different prognosis of patients with these types of tumors. © 2015 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

  8. Identification of Epigenetic Biomarkers of Lung Adenocarcinoma through Multi-Omics Data Analysis.

    Science.gov (United States)

    Kikutake, Chie; Yahara, Koji

    2016-01-01

    Epigenetic mechanisms such as DNA methylation or histone modifications are essential for the regulation of gene expression and development of tissues. Alteration of epigenetic modifications can be used as an epigenetic biomarker for diagnosis and as promising targets for epigenetic therapy. A recent study explored cancer-cell specific epigenetic biomarkers by examining different types of epigenetic modifications simultaneously. However, it was based on microarrays and reported biomarkers that were also present in normal cells at a low frequency. Here, we first analyzed multi-omics data (including ChIP-Seq data of six types of histone modifications: H3K27ac, H3K4me1, H3K9me3, H3K36me3, H3K27me3, and H3K4me3) obtained from 26 lung adenocarcinoma cell lines and a normal cell line. We identified six genes with both H3K27ac and H3K4me3 histone modifications in their promoter regions, which were not present in the normal cell line, but present in ≥85% (22 out of 26) and ≤96% (25 out of 26) of the lung adenocarcinoma cell lines. Of these genes, NUP210 (encoding a main component of the nuclear pore complex) was the only gene in which the two modifications were not detected in another normal cell line. RNA-Seq analysis revealed that NUP210 was aberrantly overexpressed among the 26 lung adenocarcinoma cell lines, although the frequency of NUP210 overexpression was lower (19.3%) in 57 lung adenocarcinoma tissue samples studied and stored in another database. This study provides a basis to discover epigenetic biomarkers highly specific to a certain cancer, based on multi-omics data at the cell population level.

  9. Overexpression of miR-519d in lung adenocarcinoma inhibits cell proliferation and invasion via the association of eIF4H.

    Science.gov (United States)

    Bai, Yong; Lu, Chunya; Zhang, Guojun; Hou, Yu; Guo, Yanjie; Zhou, Heqi; Ma, Xiaojingnan; Zhao, Guoqiang

    2017-03-01

    Lung cancer is one of the deadliest types of cancer worldwide due to its high mortality rate. Adenocarcinoma constitutes 20%-30% of all lung cancers. In recent years, studies on the mechanisms of lung tumorigenesis and development have in part focused on the microRNAs for their crucial role in the progress of different cancers. As for our study, we demonstrated that miR-519d was differently downregulated and eIF4H was significantly overexpressed in lung adenocarcinoma via the detection of quantitative real-time polymerase chain reaction compared with the adjacent normal tissues. Furthermore, Cell Counting Kit-8 assay, colony formation assay, xenograft tumor experiment, Ki67 immunohistochemistry assay and transwell assay were performed to explain that the upregulated miR-519d could inhibit the proliferation and invasion of A549 and H1299 cells. To further advance our understanding of the mechanisms of miR-519d, we performed the bioinformatics analysis and the luciferase report assay. The results from these procedures revealed eIF4H to be one of the targets of miR-519d. Downregulated eIF4H was analogous to the overexpressed miR-519d obtained from miR-519d agomir and si-eIF4H transfection. In summary, it can be concluded that miR-519d targets eIF4H in lung adenocarcinoma to inhibit cell proliferation and invasion. This mechanism may offer new insights into the tumorigenesis and development of lung adenocarcinoma.

  10. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells

    OpenAIRE

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-01-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF o...

  11. Human rhabdomyosarcoma cell lines for rhabdomyosarcoma research: Utility and pitfalls

    Directory of Open Access Journals (Sweden)

    Ashley R.P. Hinson

    2013-07-01

    Full Text Available Rhabdomyosarcoma (RMS is the most common soft tissue sarcoma of childhood and adolescence. Despite intergroup clinical trials conducted in Europe and North America, outcomes for high risk patients with this disease have not significantly improved in the last several decades, and survival of metastatic or relapsed disease remains extremely poor. Accrual into new clinical trials is slow and difficult, so in vitro cell line research and in vivo xenograft models present an attractive alternative for preclinical research for this cancer type. Currently, 30 commonly used human RMS cell lines exist, with differing origins, karyotypes, histologies, and methods of validation. Selecting an appropriate cell line for RMS research has important implications for outcomes. There are also potential pitfalls in using certain cell lines including contamination with murine stromal cells, cross-contamination between cell lines, discordance between the cell line and its associated original tumor, imposter cell lines, and nomenclature errors that result in the circulation of two or more presumed unique cell lines that are actually from the same origin. These pitfalls can be avoided by testing for species-specific isoenzymes, microarray analysis, assays for subtype-specific fusion products, and short tandem repeat analysis.

  12. Genetic and Epigenetic Determinants of Lung Cancer Subtype: Adenocarcinoma to Small Cell Conversion

    Science.gov (United States)

    2016-10-01

    these objectives in mind , the specific aims of this grant are to comprehensively define the genomic sequence alterations (Aim 1) and epigenomic DNA...the Institutional Animal Care and Use Committee at Massachusetts General Hospital. Cell viability assays. Cell viability assays were carried out in a

  13. Extracts of Opuntia humifusa Fruits Inhibit the Growth of AGS Human Gastric Adenocarcinoma Cells.

    Science.gov (United States)

    Hahm, Sahng-Wook; Park, Jieun; Park, Kun-Young; Son, Yong-Suk; Han, Hyungchul

    2016-03-01

    Opuntia humifusa (OHF) has been used as a nutraceutical source for the prevention of chronic diseases. In the present study, the inhibitory effects of ethyl acetate extracts of OHF on the proliferation of AGS human gastric cancer cells and the mode of action were investigated. To elucidate the antiproliferative mechanisms of OHF in cancer cells, the expression of genes related to apoptosis and cell cycle arrest were determined with real-time PCR and western blot. The cytotoxic effect of OHF on AGS cells was observed in a dose-dependent manner. Exposure to OHF (100 μg/mL) significantly induced (Pgenes associated with cell cycle progression (Cdk4, Cdk2, and cyclin E) was significantly downregulated (P<0.05) by the OHF treatment. Moreover, the expression of Bax and caspase-3 in OHF treated cells was higher (P<0.05) than in the control. These findings suggest that OHF induces the G1 phase cell cycle arrest and activation of mitochondria-mediated apoptosis pathway in AGS human gastric cancer cells.

  14. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seon Young; Jang, Soo Hwa [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of); Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su [Soongsil University, Department of Chemistry (Korea, Republic of); Lee, Kangtaek [Yonsei University, Department of Chemical and Biomolecular Engineering (Korea, Republic of); Yang, Sung Ik [Kyung Hee University, College of Environment and Applied Chemistry (Korea, Republic of); Joo, Sang-Woo, E-mail: sjoo@ssu.ac.kr [Soongsil University, Department of Chemistry (Korea, Republic of); Ryu, Pan Dong; Lee, So Yeong, E-mail: leeso@snu.ac.kr [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of)

    2012-12-15

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  15. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    Science.gov (United States)

    Choi, Seon Young; Jang, Soo Hwa; Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su; Lee, Kangtaek; Yang, Sung Ik; Joo, Sang-Woo; Ryu, Pan Dong; Lee, So Yeong

    2012-12-01

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  16. Regulation of voltage-gated potassium channels attenuates resistance of side-population cells to gefitinib in the human lung cancer cell line NCI-H460.

    Science.gov (United States)

    Choi, Seon Young; Kim, Hang-Rae; Ryu, Pan Dong; Lee, So Yeong

    2017-02-21

    Side-population (SP) cells that exclude anti-cancer drugs have been found in various tumor cell lines. Moreover, SP cells have a higher proliferative potential and drug resistance than main population cells (Non-SP cells). Also, several ion channels are responsible for the drug resistance and proliferation of SP cells in cancer. To confirm the expression and function of voltage-gated potassium (Kv) channels of SP cells, these cells, as well as highly expressed ATP-binding cassette (ABC) transporters and stemness genes, were isolated from a gefitinib-resistant human lung adenocarcinoma cell line (NCI-H460), using Hoechst 33342 efflux. In the present study, we found that mRNA expression of Kv channels in SP cells was different compared to Non-SP cells, and the resistance of SP cells to gefitinib was weakened with a combination treatment of gefitinib and Kv channel blockers or a Kv7 opener, compared to single-treatment gefitinib, through inhibition of the Ras-Raf signaling pathway. The findings indicate that Kv channels in SP cells could be new targets for reducing the resistance to gefitinib.

  17. Molecular characterization of immortalized normal and dysplastic oral cell lines.

    Science.gov (United States)

    Dickman, Christopher T D; Towle, Rebecca; Saini, Rajan; Garnis, Cathie

    2015-05-01

    Cell lines have been developed for modeling cancer and cancer progression. The molecular background of these cell lines is often unknown to those using them to model disease behaviors. As molecular alterations are the ultimate drivers of cell phenotypes, having an understanding of the molecular make-up of these systems is critical for understanding the disease biology modeled. Six immortalized normal, one immortalized dysplasia, one self-immortalized dysplasia, and two primary normal cell lines derived from oral tissues were analyzed for DNA copy number changes and changes in both mRNA and miRNA expression using SMRT-v.2 genome-wide tiling comparative genomic hybridization arrays, Agilent Whole Genome 4x44k expression arrays, and Exiqon V2.M-RT-PCR microRNA Human panels. DNA copy number alterations were detected in both normal and dysplastic immortalized cell lines-as well as in the single non-immortalized dysplastic cell line. These lines were found to have changes in expression of genes related to cell cycle control as well as alterations in miRNAs that are deregulated in clinical oral squamous cell carcinoma tissues. Immortal lines-whether normal or dysplastic-had increased disruption in expression relative to primary lines. All data are available as a public resource. Molecular profiling experiments have identified DNA, mRNA, and miRNA alterations for a panel of normal and dysplastic oral tissue cell lines. These data are a valuable resource to those modeling diseases of the oral mucosa, and give insight into the selection of model cell lines and the interpretation of data from those lines. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Murine pancreatic adenocarcinoma reduces Ikaros expression and disrupts T cell homeostasis.

    Directory of Open Access Journals (Sweden)

    Nadine Nelson

    Full Text Available Maintenance of T cell immune homeostasis is critical for adequate anti-tumor immunity. The transcription factor Ikaros is essential for lymphocyte development including T cells. Alterations in Ikaros expression occur in blood malignancies in humans and mice. In this study, we investigated the role of Ikaros in regulating T cell immune balance in pancreatic cancer mouse models.Using our Panc02 tumor-bearing (TB mouse model, western blot analysis revealed a reduction in Ikaros proteins while qRT-PCR showed no differences in Ikaros mRNA levels in TB splenocytes compared to control. Treatment of naïve splenocytes with the proteasomal inhibitor, MG132, stabilized Ikaros expression and prevented Ikaros downregulation by Panc02 cells, in vitro. Western blot analyses showed a reduction in protein phosphatase 1 (PP1 and protein kinase CK2 expression in TB splenocytes while CK2 activity was increased. Immunofluorescence microscopy revealed altered punctate staining of Ikaros in TB splenocytes. Flow cytometry revealed a significant decrease in effector CD4+ and CD8+ T cell percentages but increased CD4+CD25+ regulatory T cells in TB splenocytes. Similar alterations in T cell percentages, as well as reduced Ikaros and CK2 but not PP1 expression, were observed in a transgenic, triple mutant (TrM pancreatic cancer model. Ikaros expression was also reduced in enriched TB CD3+ T cells. MG132 treatment of naïve CD3+ T cells stabilized Ikaros expression in the presence of Panc02 cells. Western blots showed reduced PP1 and CK2 expression in TB CD3+ T cells.The results of this study suggest that the pancreatic tumor microenvironment may cause proteasomal degradation of Ikaros, possibly via dysregulation of PP1 and CK2 expression and activity, respectively. This loss of Ikaros expression may contribute to an imbalance in T cell percentages. Ikaros may potentially be a therapeutic target to restore T cell homeostasis in pancreatic cancer hosts, which may be

  19. [Successful treatment of a patient with recurrent ovarian clear cell adenocarcinoma under combination chemotherapy of 5-FU (civ) and low-dose CDDP (i.v.)].

    Science.gov (United States)

    Sakaihara, M; Sakai, K; Hara, Y; Kataoka, S; Tabata, M; Hanatani, K; Hareyama, H

    2000-01-01

    Resistance to conventional chemotherapy including CDDP is the most important therapeutic problem in ovarian cancer. The combination chemotherapy of 5-FU (civ) and low-dose CDDP (i.v.) was applied to a patient with recurrent ovarian clear cell adenocarcinoma (stage IIa), which is often more resistant to systemic chemotherapy than other ovarian adenocarcinomas and is a poor prognostic factor. The patient underwent cytoreductive surgery. Then, 5-FU 375 mg/m2/day civ (days 1-5, 8-12, 15-19, 22-26) and CDDP 3.75 mg/m2/day i.v. (days 1-5, 8-12, 15-19, 22-26) were administered. After four courses of this treatment, there is no sign of recurrence. This result indicates that the combination of 5-FU and CDDP is useful in the treatment of recurrent ovarian cancers.

  20. Anticancer Effects of Sinulariolide-Conjugated Hyaluronan Nanoparticles on Lung Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Kuan Yin Hsiao

    2016-03-01

    Full Text Available Lung cancer is one of the most clinically challenging malignant diseases worldwide. Sinulariolide (SNL, extracted from the farmed coral species Sinularia flexibilis, has been used for suppressing malignant cells. For developing anticancer therapeutic agents, we aimed to find an alternative for non-small cell lung cancer treatment by using SNL as the target drug. We investigated the SNL bioactivity on A549 lung cancer cells by conjugating SNL with hyaluronan nanoparticles to form HA/SNL aggregates by using a high-voltage electrostatic field system. SNL was toxic on A549 cells with an IC50 of 75 µg/mL. The anticancer effects of HA/SNL aggregates were assessed through cell viability assay, apoptosis assays, cell cycle analyses, and western blotting. The size of HA/SNL aggregates was approximately 33–77 nm in diameter with a thin continuous layer after aggregating numerous HA nanoparticles. Flow cytometric analysis revealed that the HA/SNL aggregate-induced apoptosis was more effective at a lower SNL dose of 25 µg/mL than pure SNL. Western blotting indicated that caspases-3, -8, and -9 and Bcl-xL and Bax played crucial roles in the apoptotic signal transduction pathway. In summary, HA/SNL aggregates exerted stronger anticancer effects on A549 cells than did pure SNL via mitochondria-related pathways.

  1. Pemetrexed in second line treatment of non-small cell lung cancer - The portuguese experience.

    Science.gov (United States)

    Araújo, A; Barata, F; Parente, B; Rego, S; Teixeira, E; Melo, M; Queiroga, H; Cunha, J; Duarte, J; Coelho, A

    2008-07-01

    Until 2004, docetaxel in monotherapy was the standard for second-line treatment of non-small cell lung cancer (NSCLC). Pemetrexed (P) has shown similar activity in this setting with a better adverse event profile. In Portugal, it was introduced in October of 2004. We have carried out a retrospective analysis of patients (pts) who received P for second-line NSCLC in Portugal from October 2004 to December 2006. Data were collected from the records of pts with locally advanced or metastatic NSCLC and failed first-line chemotherapy enrolled in centers participating in the Portuguese Lung Cancer Study Group (GECP). Objective response (OR; complete [CR] or partial [PR] response) was evaluated using RECIST and safety was assessed using serious or non-serious adverse events (SAEs/AEs). By December 2006, 19 GECP centers had enrolled 244 pts who had received P for ≥1cycle, and were considered evaluable for both objective response and safety. Demography: male/female, 175/69; median age, 57.0years (range 20-81); smoking status, y/ex/n, 116/57/71; adenocarcinoma / squamous-cell carcinoma/other histology, 141/72/31; mean time to progression (TTP) 8.07months. Disease control in 209 evaluable pts was observed in 116 (55.5%): 2 CR, 45 PR and 69 SD; mean TTP 4.70months. The majority of AEs were grade 3 anemia (15 pts) and neutropenia (18 pts). The mean overall survival was 17.27months. Our retrospective analysis has observed a similar disease control rate with P in 2nd line (55.5%), and TTP (4.7months) in our current unselected population to that published in the literature. P is an option for second-line NSCLC with a good tolerability. Rev Port Pneumol 2008; XIV (Sup.2): S9-S20. © 2008 Sociedade Portuguesa de Pneumologia/SPP.

  2. CytoregR inhibits growth and proliferation of human adenocarcinoma cells via induction of apoptosis

    Directory of Open Access Journals (Sweden)

    Hassanhi M

    2006-01-01

    Full Text Available Abstract Background Cancer is one of the devastating neovascular diseases that incapacitate so many people the world over. Recent reports from the National Cancer Institute indicate some significant gain therapy and cancer management as seen in the increase in the 5-year survival rate over the past two decades. Although near-perfect cure rate have been reported in the early-stage disease, these data reveal high recurrence rate and serious side effects including second malignancies and fatalities. Most of the currently used anticancer agents are only effective against proliferating cancer cells. Thus attention has been focused on potential anti-cancer agents capable of killing cancer cells independent of the cell cycle state, to ensure effective elimination of most cancer cells. The objective of this study was to test the chemosensitivity and potential mechanism of action of a novel cancer drug, CytoregR, in a panel of human cancer cells. Methods the study was performed using a series of bioassays including Trypan blue exclusion, MTS Growth inhibition, LDH-cytotoxicity, TUNEL-Terminal DNA fragmentation Apoptosis Assay, and the Caspase protease CPP32 activity assays. Results CytoregR induced significant dose- and time-dependent inhibition of growth in all the cells; with significant differences in chemosensitivity (P < 0.05 between the target cells becoming more apparent at 48 hr exposure. CytoregR showed no significant effect on normal cells relative to the tumor cells. Growth inhibition in all the cells was due to induction of apoptosis at lower concentrations of cytoregR (> 1:300. CytoregR-induced caspase protease-3 (CPP32 activation significantly and positively correlated with apoptosis induction and growth inhibition; thus implicating CPP32 as the principal death pathway in cytoregR-induced apoptosis. Conclusion CytoregR exerted a dose-and time-dependent growth inhibitory effect in all the target cells through induction of apoptosis via the

  3. Licochalcone A exerts antitumor activity in bladder cancer cell lines ...

    African Journals Online (AJOL)

    State and Federal laws, standards of the US. Department of Health and Human Services, and guidelines established by Tulane University. Animal Care and Use Committee, accredited by. Association for the Assessment and. Accreditation of Laboratory Animal Care [16]. Tumor cell line. The bladder cancer cell lines, ...

  4. Trichloroethylene toxicity in a human hepatoma cell line

    Energy Technology Data Exchange (ETDEWEB)

    Thevenin, E.; McMillian, J. [Medical Univ. of Charleston South Carolina, SC (United States)

    1994-12-31

    The experiments conducted in this study were designed to determine the usefullness of hepatocyte cultures and a human hepatoma cell line as model systems for assessing human susceptibility to hepatocellular carcinoma due to exposure to trichloroethylene. The results from these studies will then be analyzed to determine if human cell lines can be used to conduct future experiments of this nature.

  5. Cancer and inflammation studies using zebrafish cell lines

    NARCIS (Netherlands)

    He, Shuning

    2010-01-01

    As the zebrafish, Danio rerio, has been increasingly used as an animal model for biomedical research, we aimed to establish zebrafish cell line models for inflammation and cancer studies in this thesis. Several zebrafish cell lines were characterized and their genetic and physiological properties

  6. Beryllium-stimulated apoptosis in macrophage cell lines.

    Science.gov (United States)

    Sawyer, R T; Fadok, V A; Kittle, L A; Maier, L A; Newman, L S

    2000-08-21

    In vitro stimulation of bronchoalveolar lavage cells from patients with chronic beryllium disease (CBD) induces the production of TNF-alpha. We tested the hypothesis that beryllium (Be)-stimulated TNF-alpha might induce apoptosis in mouse and human macrophage cell lines. These cell lines were selected because they produce a range of Be-stimulated TNF-alpha. The mouse macrophage cell line H36.12j produces high levels of Be-stimulated TNF-alpha. The mouse macrophage cell line P388D.1 produces low, constitutive, levels of TNF-alpha and does not up-regulate Be-stimulated TNF-alpha production. The DEOHS-1 human CBD macrophage cell line does not produce constitutive or Be-stimulated TNF-alpha. Apoptosis was determined by microscopic observation of propidium iodide stained fragmented nuclei in unstimulated and BeSO(4)-stimulated macrophage cell lines. BeSO(4) induced apoptosis in all macrophage cell lines tested. Beryllium-stimulated apoptosis was dose-responsive and maximal after 24 h of exposure to 100 microM BeSO(4). In contrast, unstimulated and Al(2)(SO(4))(3)-stimulated macrophage cell lines did not undergo apoptosis. The general caspase inhibitor BD-fmk inhibited Be-stimulated macrophage cell line apoptosis at concentrations above 50 microM. Our data show that Be-stimulated macrophage cell line apoptosis was caspase-dependent and not solely dependent on Be-stimulated TNF-alpha levels. We speculate that the release of Be-antigen from apoptotic macrophages may serve to re-introduce Be material back into the lung microenvironment, make it available for uptake by new macrophages, and thereby amplify Be-stimulated cytokine production, promoting ongoing inflammation and granuloma maintenance in CBD.

  7. Patterns of PD-L1 expression and CD8 T cell infiltration in gastric adenocarcinomas and associated immune stroma.

    Science.gov (United States)

    Thompson, Elizabeth D; Zahurak, Marianna; Murphy, Adrian; Cornish, Toby; Cuka, Nathan; Abdelfatah, Eihab; Yang, Stephen; Duncan, Mark; Ahuja, Nita; Taube, Janis M; Anders, Robert A; Kelly, Ronan J

    2017-05-01

    Recent data supports a significant role for immune checkpoint inhibitors in the treatment of solid tumours. Here, we evaluate gastric and gastro-oesophageal junction (G/GEJ) adenocarcinomas for their expression of programmed death-ligand 1 (PD-L1), infiltration by CD8+ T cells and the relationship of both factors to patient survival. Thirty-four resections of primary invasive G/GEJ were stained by immunohistochemistry for PD-L1 and CD8 and by DNA in situ hybridisation for Epstein-Barr virus (EBV). CD8+ T cell densities both within tumours and at the tumour-stromal interface were analysed using whole slide digital imaging. Patient survival was evaluated according to PD-L1 status and CD8 density. 12% of resections showed tumour cell membranous PD-L1 expression and 44% showed expression within the immune stroma. Two cases (6%) were EBV positive, with one showing membranous PD-L1 positivity. Increasing CD8+ densities both within tumours and immune stroma was associated with increasing percentage of tumour (p=0.027) and stromal (p=0.005) PD-L1 expression. Both tumour and immune stromal PD-L1 expression and high intratumoral or stromal CD8+ T cell density (>500/mm(2)) were associated with worse progression-free survival (PFS) and overall survival (OS). PD-L1 is expressed on both tumour cells and in the immune stroma across all stages and histologies of G/GEJ. Surprisingly, we demonstrate that increasing CD8 infiltration is correlated with impaired PFS and OS. Patients with higher CD8+ T cell densities also have higher PD-L1 expression, indicating an adaptive immune resistance mechanism may be occurring. Further characterisation of the G/GEJ immune microenvironment may highlight targets for immune-based therapy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  8. Increased numbers of Foxp3-positive regulatory T cells in gastritis, peptic ulcer and gastric adenocarcinoma.

    Science.gov (United States)

    Cheng, Hsin-Hung; Tseng, Guan-Ying; Yang, Hsiao-Bai; Wang, Hung-Jung; Lin, Hwai-Jeng; Wang, Wen-Ching

    2012-01-07

    To determine the number of regulatory T cells (Tregs) in gastric mucosa of patients with gastritis, peptic ulcers and gastric cancer. This study was a retrospective analysis of gastric antrum biopsy specimens from healthy controls (n = 22) and patients with gastritis (n = 30), peptic ulcer (n = 83), or gastric cancer (n = 32). Expression of CD4, CD25 and Foxp3 was determined by immunohistochemistry in three consecutive sections per sample. Compared with healthy controls, there was an increased number of CD25(+) and Foxp3(+) cells in patients with gastritis (P = 0.004 and P = 0.008), peptic ulcer (P acute inflammation, chronic inflammation, lymphoid follicle number, and Helicobacter pylori infection. The number of CD4(+), CD25(+) and Foxp3(+) cells, and the ratio of CD25(+)/CD4(+) and Foxp3(+)/CD4(+) cells, were negatively associated with intestinal metaplasia among gastritis (P gastritis and peptic ulcer groups.

  9. Proteomic inventory of "anchorless" proteins on the colon adenocarcinoma cell surface.

    NARCIS (Netherlands)

    Tjalsma, H.; Pluk, W.J.G.; Heuvel, L.P.W.J. van den; Peters, W.H.M.; Roelofs, R.H.W.M.; Swinkels, D.W.

    2006-01-01

    Surface proteins play important pathophysiological roles in health and disease, and accumulating proteomics-based studies suggest that several "non-membrane" proteins are sorted to the cell surface by unconventional mechanisms. Importantly, these proteins may comprise attractive therapeutic targets

  10. Urokinase plasminogen activator receptor on invasive cancer cells: A prognostic factor in distal gastric adenocarcinoma

    DEFF Research Database (Denmark)

    Alpizar, Warner Enrique Alpizar; Christensen, Ib Jarle; Santoni-Rugiu, Eric

    2012-01-01

    Gastric cancer is the second cancer causing death worldwide. The five-year survival for this malignancy is below 25% and few parameters have shown an impact on the prognosis of the disease. The receptor for urokinase plasminogen activator (uPAR) is involved in extracellular matrix degradation...... by mediating cell surface associated plasminogen activation, and its presence on gastric cancer cells is linked to micrometastasis and poor prognosis. Using immunohistochemistry, the prognostic significance of uPAR was evaluated in tissue samples from a retrospective series of 95 gastric cancer patients. u...... association between the expression of uPAR on tumor cells in the peripheral invasion zone and overall survival of gastric cancer patients (HR = 2.16; 95% CI: 1.13-4.14; p = 0.02). Multivariate analysis showed that uPAR immunoreactivity in cancer cells at the invasive front is an independent prognostic factor...

  11. A comparison study of pancreatic acinar cell carcinoma with ductal adenocarcinoma using computed tomography in Chinese patients

    Directory of Open Access Journals (Sweden)

    Wang Q

    2016-09-01

    Full Text Available Qingbing Wang,1,2 Xiaolin Wang,1,2 Rongfang Guo,2,3 Guoping Li1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Department of Radiology, Zhongshan Hospital, Fudan University, Shanghai, People’s Republic of China Abstract: Pancreatic acinar cell carcinoma (ACC is a rare tumor that is difficult to diagnose preoperatively. The aim of this study was to evaluate and describe the computed tomography (CT features of ACC and compare the results with pancreatic ductal adenocarcinoma (DAC for improving preoperative diagnosis. The control group consisted of 34 patients with DAC collected from the pathology electronic database. The CT imaging from nine patients with pathologically confirmed ACC was retrospectively reviewed. Two radiologists independently assessed the tumor location, size, texture, and enhancement patterns. We found that 64.3% (9/14 of ACC tumors were homogeneous and 35.7% (5/14 had necrosis. The percentage of common bile duct and pancreatic ductal dilation was 14.3% (2/14 and 7.1% (1/14, respectively. The mean size of ACC was 50.1±24.2 mm. The mean attenuation of ACC was 35.4±3.9 Hounsfield unit (HU before enhancement, 73.1±42.9 HU in arterial phase, and 71.8±15.6 HU in port venous phase. It is difficult to distinguish ACC from DAC preoperatively only based on CT findings. However, compared with DAC, we found that ACC tumors are likely to be larger and contain more heterogeneous intratumoral necrotic hypovascular regions, and less pancreatic ductal and common biliary dilation. Keywords: acinar cell carcinoma, computed tomography, pancreatic ductal carcinoma, pancreas

  12. [Effects of AS1411 on the apoptosis of taxol-resistant lung adenocarcinoma A549 cell].

    Science.gov (United States)

    Zhou, Wei; Zhao, Zitong; Liu, Lingyan; Zhan, Qimin; Song, Yongmei

    2014-05-13

    To explore the effects of AS1411 on the apoptosis of taxol-resistant lung adenocarinoma A549 cell (A549/T cell). A549/T cells were treated with AS1411 at a concentration gradient of 0-20.0 µmol/L. The assays of methyl tolyl sulfide (MTS) and colony formation were used to detect the cellular vitality (absorbance value (A490 nm)) and proliferation. The apoptotic effects were detected by flow cytometer and the relevant apoptotic signaling proteins detected by Western blot. A549/T cells exhibited some characteristics of epithelial mesenchymal transition (EMT) and a negative expression of epidermal growth factor receptor (EGFR). After a treatment of 5.0 µmol/L AS1411, compared to the control sequence, cell vitality was inhibited (A490 nm: 0.185 ± 0.009 vs 0.272 ± 0.006, P AS1411 concentration, A549/T cells vitality decreased in a dose-dependent manner. After a 48-hour treatment of 20.0 µmol/L AS1411, the ratio of apoptosis ((19.9 ± 2.6)%) had significant difference (P = 0.002) with the control sequence group ((8.8 ± 1.3)%). Compared to the control sequence group, the expressions of protein kinase B (AKT), extracellular regulated protein kinases 1/2 (ERK1/2) and B-cell lymphoma 2 (Bcl-2) protein declined (0.353 ± 0.003, 0.432 ± 0.015, 0.294 ± 0.015 vs 0.688 ± 0.003, 0.911 ± 0.019, 0.422 ± 0.018, all P AS1411 may induce the apoptosis of A549/T cells through inhibiting the AKT-ERK pathways.

  13. Primary clear cell ductal adenocarcinoma of the pancreas: A case report and clinicopathologic literature review

    Directory of Open Access Journals (Sweden)

    Yashpal Modi

    2014-01-01

    Full Text Available We present a very rare, interesting case of a carcinoma of the pancreas with predominantly abundant clear cell morphology. According to the WHO classification, primary clear cell carcinoma of the pancreas is classified as a rare "miscellaneous" carcinoma. The tumor was observed in the distal body and tail of the pancreas of a 74-year-old woman. The histopathology of tumor cells showed well-defined cell membranes, clear cytoplasm, and prominent cell boundaries. Immunohistochemical (IHC staining showed positive reactions to antibodies against vimentin, cytokeratin 7 (CK-7, mucicarmine (MUC-1, periodic acid-Schiff (PAS, periodic acid-Schiff with diastase (PASD, carcinoembryonic antigen (CEA, and Carbohydrate Antigen 19-9 (CA 19-9. On the other hand, IHC staining was negative for alpha-fetoprotein (AFP, cytokeratin 20 (CK-20, HMB45, chromogranin, and synaptophysin. The patient was subsequently diagnosed with a primary solid-type pancreatic clear cell carcinoma with hepatic metastasis. Herein, we report this rare case and include a review of the current literature of this tumor.

  14. Effect of lycopene on cell viability and cell cycle progression in human cancer cell lines

    Directory of Open Access Journals (Sweden)

    Teodoro Anderson

    2012-08-01

    Full Text Available Abstract Background Lycopene, a major carotenoid component of tomato, has a potential anticancer activity in many types of cancer. Epidemiological and clinical trials rarely provide evidence for mechanisms of the compound’s action, and studies on its effect on cancer of different cell origins are now being done. The aim of the present study was to determine the effect of lycopene on cell cycle and cell viability in eight human cancer cell lines. Methods Human cell lines were treated with lycopene (1–5 μM for 48 and 96 h. Cell viability was monitored using the method of MTT. The cell cycle was analyzed by flow cytometry, and apoptotic cells were identified by terminal deoxynucleotidyl transferase-mediated dUTP nick labeling (TUNEL and by DAPI. Results Our data showed a significant decrease in the number of viable cells in three cancer cells lines (HT-29, T84 and MCF-7 after 48 h treatment with lycopene, and changes in the fraction of cells retained in different cell cycle phases. Lycopene promoted also cell cycle arrest followed by decreased cell viability in majority of cell lines after 96 h, as compared to controls. Furthermore, an increase in apoptosis was observed in four cell lines (T-84, HT-29, MCF-7 and DU145 when cells were treated with lycopene. Conclusions Our findings show the capacity of lycopene to inhibit cell proliferation, arrest cell cycle in different phases and increase apoptosis, mainly in breast, colon and prostate lines after 96 h. These observations suggest that lycopene may alter cell cycle regulatory proteins depending on the type of cancer and the dose of lycopene administration. Taken together, these data indicated that the antiproliferative effect of lycopene was cellular type, time and dose-dependent.

  15. Comparison of steroid receptors from the androgen responsive DDT1 cell line and the nonresponsive HVP cell line.

    Science.gov (United States)

    Norris, J S; Kohler, P O

    1978-01-01

    Two hamster cell lines have been isolated from androgen target tissue. The DDT1 cells derived from ductus deferens tissue exhibit a growth response to androgens, while the HVP cells derived from ventral prostate are androgen unresponsive. Both cell lines contain androgen receptors, that are similar when compared by kinetic methods, sedimentation velocity, chromatographic procedures or nuclear translocation ability. The forms of the high salt extracted nuclear receptors are indistinguishable chromatographically. Therefore, we postulate that the lesion preventing androgen induced growth in the HVP cell line is subseqent to nuclear translocation of the steroid receptor complex.

  16. Curcuminoids and ω-3 fatty acids with anti-oxidants potentiate cytotoxicity of natural killer cells against pancreatic ductal adenocarcinoma cells and inhibit interferon γ production

    Directory of Open Access Journals (Sweden)

    Milan eFiala

    2015-05-01

    Full Text Available Pancreatic cancer has a poor prognosis attributed in part to immune suppression and deactivation of natural killer (NK cells. Curcuminoids have a potential for improving the therapy of pancreatic cancer given promising results in cancer models and a clinical trial, but their oral absorption is limited. Our objective in this study is to show curcuminoid anti-oncogenic effects alone and together with human NK cells. We tested curcuminoids in an emulsion of ω-3 fatty acids and anti-oxidants (Smartfish regarding their direct cytocidal effect and enhancement of the cytocidal activity of NK cells in pancreatic ductal adenocarcinoma (PDAC cells (Mia Paca 2 and L3.6. Curcuminoids (at > 10 microM with ω-3 fatty acids and anti-oxidants or with the lipidic mediator resolvin D1 (RvD1 (26 nM induced high caspase-3 activity in PDAC cells. Importantly, curcuminoids with ω-3 fatty acids and anti-oxidants or with RvD1 significantly potentiated NK cell cytocidal function and protected them against degradation. In a co-culture of cancer cells with NK cells, interferon-γ ( IFN-γ production by NK cells was not altered by ω-3 fatty acids with anti-oxidants or by RvD1 but was inhibited by curcuminoids. The inhibition was not eliminated by ω-3 fatty acids or RvD1 but was relieved by removing curcuminoids after adding NK cells. In conclusion, curcuminoids with ω-3 fatty acids and anti-oxidants or with RvD1 have increased cytotoxic activity on PDAC cells alone and with NK cells. The effects of curcuminoids with ω-3 fatty acids and anti-oxidants on pancreatic cancer will be investigated in a mouse model with humanized immune system.

  17. Epithelial cell adhesion molecule aptamer functionalized PLGA-lecithin-curcumin-PEG nanoparticles for targeted drug delivery to human colorectal adenocarcinoma cells.

    Science.gov (United States)

    Li, Lei; Xiang, Dongxi; Shigdar, Sarah; Yang, Wenrong; Li, Qiong; Lin, Jia; Liu, Kexin; Duan, Wei

    2014-01-01

    To improve the efficacy of drug delivery, active targeted nanotechnology-based drug delivery systems are gaining considerable attention as they have the potential to reduce side effects, minimize toxicity, and improve efficacy of anticancer treatment. In this work CUR-NPs (curcumin-loaded lipid-polymer-lecithin hybrid nanoparticles) were synthesized and functionalized with ribonucleic acid (RNA) Aptamers (Apts) against epithelial cell adhesion molecule (EpCAM) for targeted delivery to colorectal adenocarcinoma cells. These CUR-encapsulated bioconjugates (Apt-CUR-NPs) were characterized for particle size, zeta potential, drug encapsulation, stability, and release. The in vitro specific cell binding, cellular uptake, and cytotoxicity of Apt-CUR-NPs were also studied. The Apt-CUR-NP bioconjugates exhibited increased binding to HT29 colon cancer cells and enhancement in cellular uptake when compared to CUR-NPs functionalized with a control Apt (Pcells with Apt-CUR-NP bioconjugates. The encapsulation of CUR in Apt-CUR-NPs resulted in the increased bioavailability of delivered CUR over a period of 24 hours compared to that of free CUR in vivo. These results show that the EpCAM Apt-functionalized CUR-NPs enhance the targeting and drug delivery of CUR to colorectal cancer cells. Further development of CUR-encapsulated, nanosized carriers will lead to improved targeted delivery of novel chemotherapeutic agents to colorectal cancer cells.

  18. [To evaluate the clinicopathologic characteristics and outcome of tumor cells spreading through air spaces in patients with adenocarcinoma of lung].

    Science.gov (United States)

    Sun, P L; Liu, J N; Cao, L Q; Yao, M; Gao, H W

    2017-05-08

    Objective: To investigate the clinicopathologic features, molecular characteristics and prognosis of spread through air space (STAS) in patients with adenocarcinoma of the lung. Methods: Two hundred and eighty-eight lung adenocarcinoma patients with complete clinicopathologic and follow-up data were included. The patients were divided into STAS positive (178 cases) and negative (110 cases) groups.EGFR and KRAS gene mutations were detected by amplification refractory mutation system (ARMS), and ALK and ROS1 gene fusion were detected by fluorescence in situ hybridization method. The relationship between STAS and clinicopathologic, molecular features, and patient outcome was analyzed. Results: STAS was present in 61.8%(178/288) of lung adenocarcinomas. The positive rate of STAS in tumors >3 cm was significantly higher than that in tumors ≤3 cm (P=0.009), and was significantly higher in tumors with pleural invasion (Padenocarcinomas, respectively. In addition, the positive rates of STAS in tumor with micropapillary (>5%) and without micropapillary pattern were 80.9%(55/68) and 55.9%(123/220), respectively (Plung adenocarcinoma patients (HR: 2.749, 95%CI: 1.550-4.876, P=0.001). Conclusions: The presence of STAS in lung adenocarcinoma suggests high risk of recurrence and invasion and is thus an important prognostic factor. In addition, STAS is associated with EGFR mutation, ALK and ROS1 gene rearrangement.

  19. Binase Immobilized on Halloysite Nanotubes Exerts Enhanced Cytotoxicity toward Human Colon Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Vera Khodzhaeva

    2017-09-01

    Full Text Available Many ribonucleases (RNases are considered as promising tools for antitumor therapy because of their selective cytotoxicity toward cancer cells. Binase, the RNase from Bacillus pumilus, triggers apoptotic response in cancer cells expressing RAS oncogene which is mutated in a large percentage of prevalent and deadly malignancies including colorectal cancer. The specific antitumor effect of binase toward RAS-transformed cells is due to its direct binding of RAS protein and inhibition of downstream signaling. However, the delivery of proteins to the intestine is complicated by their degradation in the digestive tract and subsequent loss of therapeutic activity. Therefore, the search of new systems for effective delivery of therapeutic proteins is an actual task. This study is aimed to the investigation of antitumor effect of binase immobilized on natural halloysite nanotubes (HNTs. Here, we have developed the method of binase immobilization on HNTs and optimized the conditions for the enzyme loading and release (i; we have found the non-toxic concentration of pure HNTs which allows to distinguish HNTs- and binase-induced cytotoxic effects (ii; using dark-field and fluorescent microscopy we have proved the absorption of binase-loaded HNTs on the cell surface (iii and demonstrated that binase-halloysite nanoformulations possessed twice enhanced cytotoxicity toward tumor colon cells as compared to the cytotoxicity of binase itself (iv. The enhanced antitumor activity of biocompatible binase-HNTs complex confirms the advisability of its future development for clinical practice.

  20. Therapeutic potential of antiviral drugs targeting chemorefractory colorectal adenocarcinoma cells overexpressing endogenous retroviral elements.

    Science.gov (United States)

    Díaz-Carballo, David; Acikelli, Ali Haydar; Klein, Jacqueline; Jastrow, Holger; Dammann, Philipp; Wyganowski, Thomas; Guemues, Cihan; Gustmann, Sebastian; Bardenheuer, Walter; Malak, Sascha; Tefett, Nora Sophia; Khosrawipour, Veria; Giger-Pabst, Urs; Tannapfel, Andrea; Strumberg, Dirk

    2015-08-12

    Endoretroviruses account for circa 8 % of all transposable elements found in the genome of humans and other animals. They represent a genetic footprint of ancestral germ-cell infections of exoviruses that is transmittable to the progeny by Mendelian segregation. Traces of human endogenous retroviruses are physiologically expressed in ovarial, testicular and placental tissues as well as in stem cells. In addition, a number of these fossil viral elements have also been related to carcinogenesis. However, a relation between endoretroviruses expression and chemoresistance has not been reported yet. Twenty colorectal carcinoma patient samples were scrutinized for HERV-WE1 and HERV-FRD1 endoretroviruses using immunohistochemical approaches. In order to search for differential expression of these elements in chemotherapy refractory cells, a resistant HCT8 colon carcinoma subline was developed by serial etoposide exposure. Endoretroviral elements were detected by immunocytochemical staining, qPCR and ELISA. IC50-values of antiviral and cytostatic drugs in HCT8 cells were determined by MTT proliferation assay. The antivirals-cytostatics interaction was evaluated by the isobologram method. In this work, we show for the first time that HERV-WE1, HERV-FRD1, HERV-31, and HERV-V1 are a) simultaneously expressed in treatment-naïve colon carcinoma cells and b) upregulated after cytostatic exposure, suggesting that these retroviral elements are intimately related to chemotherapy resistance. We found a number of antiviral drugs to have cytotoxic activity and the ability to force the downregulation of HERV proteins in vitro. We also demonstrate that the use of different antiviral compounds alone or in combination with anticancer agents results in a synergistic antiproliferative effect and downregulation of different endoretroviral elements in highly chemotherapy-resistant colorectal tumor cells. Enhanced HERV-expression is associated with chemoresistance in colon carcinomas which

  1. Cytotoxic and Anti-Inflammatory Activities of Garcinia xanthochymus Extracts on Cell Lines

    Directory of Open Access Journals (Sweden)

    Hanisuhana Hamidon

    2016-01-01

    Full Text Available Objective: Garcinia xanthochymus extract has been reported to have several pharmacological properties. This study was conducted to evaluate cytotoxic and anti-inflammatory activities of G. xanthochymus extracts on cell lines. Methods: The roots and stem barks of plant were extracted using maceration method with n-hexane, dichloromethane and methanol, successively. Cytotoxic activity of the extracts was tested against MCF-7 breast adenocarcinoma using MTT assay. Anti-inflammatory study was evaluated using RAW 264.7 mouse macrophage cells. The nitric oxide production in LPS-stimulated cells was measured using Griess reagent. Results: The results of cytotoxic and anti-inflammatory study showed that dichloromethane and n-hexane extracts of root and stem bark exhibited cytotoxic activity in dose-dependent manner. Meanwhile, for anti-inflammatory study, all root extracts together with stem bark dichloromethane and n-hexane extracts reduce NO production in LPS-stimulated cells in dose dependent manner. Conclusions: This finding indicated that G. xanthochymus extracts might become interesting candidate for treatment of cancer and inflammation.

  2. Functional calcium imaging in zebrafish lateral-line hair cells.

    Science.gov (United States)

    Zhang, Q X; He, X J; Wong, H C; Kindt, K S

    2016-01-01

    Sensory hair-cell development, function, and regeneration are fundamental processes that are challenging to study in mammalian systems. Zebrafish are an excellent alternative model to study hair cells because they have an external auxiliary organ called the lateral line. The hair cells of the lateral line are easily accessible, which makes them suitable for live, function-based fluorescence imaging. In this chapter, we describe methods to perform functional calcium imaging in zebrafish lateral-line hair cells. We compare genetically encoded calcium indicators that have been used previously to measure calcium in lateral-line hair cells. We also outline equipment required for calcium imaging and compare different imaging systems. Lastly, we discuss how to set up optimal imaging parameters and how to process and visualize calcium signals. Overall, using these methods, in vivo calcium imaging is a powerful tool to examine sensory hair-cell function in an intact organism. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Radiobiological effects of multiple vs. single low-dose pre-irradiation on the HT29 cell line.

    Science.gov (United States)

    Djan, Igor; Solajic, Slavica; Djan, Mihajla; Vucinic, Natasa; Popovic, Dunja; Ilic, Miroslav; Lučić, Silvija; Bogdanovic, Gordana

    2014-01-01

    Aim of the study was to compare radiobiological effects of multiple vs. single low-dose pre-irradiation on the HT29 cell line. This regime is designed to be as similar as possible to fractionated tumour radiotherapy treatment, and to provide data on radiobiological effects on human tumour cells. The cell line used in the study was HT29 (human colorectal adenocarcinoma, American Type Culture Collection HTB-38™). Also, for comparison, the MRC5 cell line (human foetal lung fibroblasts, American Type Culture Collection CCL 171) was used. Four-day treatment in a 4 × 2 Gy regime was performed. Cell viability was evaluated by tetrazolium colorimetric MTT assay. Multiple low-dose pre-irradiation induced a stronger radioadaptive response compared to single low-dose application in the HT29 cell line