WorldWideScience

Sample records for adenine-modified functionalized dna

  1. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    for a long period of time before its information is accessed by the cell. Although DNA plays a critical role as an informational storage molecule, it is by no means as unexciting as a computer tape or disk drive. The structure of the DNA described by Watson and Crick in 1953 is a right handed helix of two......This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...... individual antiparallel DNA strands. Hydrogen bonds provide specificity that allows pairing between the complementary bases (A.T and G.C) in opposite strands. Base stacking occurs near the center of the DNA helix and provides a great deal of stability to the helix (in addition to hydrogen bonding). The sugar...

  2. Functionalizing Designer DNA Crystals

    Science.gov (United States)

    Chandrasekaran, Arun Richard

    Three-dimensional crystals have been self-assembled from a DNA tensegrity triangle via sticky end interaction. The tensegrity triangle is a rigid DNA motif containing three double helical edges connected pair-wise by three four-arm junctions. The symmetric triangle contains 3 unique strands combined in a 3:3:1 ratio: 3 crossover, 3 helical and 1 central. The length of the sticky end reported previously was two nucleotides (nt) (GA:TC) and the motif with 2-helical turns of DNA per edge diffracted to 4.9 A at beam line NSLS-X25 and to 4 A at beam line ID19 at APS. The purpose of these self-assembled DNA crystals is that they can be used as a framework for hosting external guests for use in crystallographic structure solving or the periodic positioning of molecules for nanoelectronics. This thesis describes strategies to improve the resolution and to incorporate guests into the 3D lattice. The first chapter describes the effect of varying sticky end lengths and the influence of 5'-phosphate addition on crystal formation and resolution. X-ray diffraction data from beam line NSLS-X25 revealed that the crystal resolution for 1-nt (G:C) sticky end was 3.4 A. Motifs with every possible combination of 1-nt and 2-nt sticky-ended phosphorylated strands were crystallized and X-ray data were collected. The position of the 5'-phosphate on either the crossover (strand 1), helical (strand 2), or central strand (3) had an impact on the resolution of the self-assembled crystals with the 1-nt 1P-2-3 system diffracting to 2.62 A at APS and 3.1 A at NSLS-X25. The second chapter describes the sequence-specific recognition of DNA motifs with triplex-forming oligonucleotides (TFOs). This study examined the feasibility of using TFOs to bind to specific locations within a 3-turn DNA tensegrity triangle motif. The TFO 5'-TTCTTTCTTCTCT was used to target the tensegrity motif containing an appropriately embedded oligopurine.oligopyrimidine binding site. As triplex formation involving cytidine

  3. DNA functionalization by dynamic chemistry

    Directory of Open Access Journals (Sweden)

    Zeynep Kanlidere

    2016-10-01

    Full Text Available Dynamic combinatorial chemistry (DCC is an attractive method to efficiently generate libraries of molecules from simpler building blocks by reversible reactions under thermodynamic control. Here we focus on the chemical modification of DNA oligonucleotides with acyclic diol linkers and demonstrate their potential for the deoxyribonucleic acid functionalization and generation of libraries of reversibly interconverting building blocks. The syntheses of phosphoramidite building blocks derived from D-threoninol are presented in two variants with protected amino or thiol groups. The threoninol building blocks were successfully incorporated via automated solid-phase synthesis into 13mer oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was obtained, whereas, the highest selectivity (over 80% was found for the guanine aldehyde templated by the complementary cytosine containing DNA. The elevated occurrence of mismatches can be explained by increased backbone plasticity derived from the linear threoninol building block as a cyclic deoxyribose analogue.

  4. Controlling Function and Structure with DNA

    DEFF Research Database (Denmark)

    Tørring, Thomas

    2011-01-01

    In this thesis, the research on three different topics will be described. The overall area of the research is DNA nanotechnology, and the first chapter is therefore an introduction to DNA, and its advantages as a building material. The first research topic is the development of a new method...... investigated on a two dimensional DNA origami platform. This was done by incorporating functional groups on the surface of the origami, and reacting these with biotin analogues carrying the complementary functional groups. Successful reactions could then be observed using atomic force microscopy after addition...... of the protein streptavidin. While the implementation of chemical functionalities on origami can be achieved during automated DNA synthesis, this is laborious and costly. In a separate research project we aimed at improving the accessibility by applying an enzymatic labelling method. We demonstrated that the DNA...

  5. Purification of functionalized DNA origami nanostructures.

    Science.gov (United States)

    Shaw, Alan; Benson, Erik; Högberg, Björn

    2015-05-26

    The high programmability of DNA origami has provided tools for precise manipulation of matter at the nanoscale. This manipulation of matter opens up the possibility to arrange functional elements for a diverse range of applications that utilize the nanometer precision provided by these structures. However, the realization of functionalized DNA origami still suffers from imperfect production methods, in particular in the purification step, where excess material is separated from the desired functionalized DNA origami. In this article we demonstrate and optimize two purification methods that have not previously been applied to DNA origami. In addition, we provide a systematic study comparing the purification efficacy of these and five other commonly used purification methods. Three types of functionalized DNA origami were used as model systems in this study. DNA origami was patterned with either small molecules, antibodies, or larger proteins. With the results of our work we aim to provide a guideline in quality fabrication of various types of functionalized DNA origami and to provide a route for scalable production of these promising tools.

  6. Functional DNA nanostructures for theranostic applications.

    Science.gov (United States)

    Pei, Hao; Zuo, Xiaolei; Zhu, Dan; Huang, Qing; Fan, Chunhai

    2014-02-18

    There has been tremendous interest in constructing nanostructures by exploiting the unparalleled ability of DNA molecules in self-assembly. We have seen the appearance of many fantastic, "art-like" DNA nanostructures in one, two, or three dimensions during the last two decades. More recently, much attention has been directed to the use of these elegant nanoobjects for applications in a wide range of areas. Among them, diagnosis and therapy (i.e., theranostics) are of particular interest given the biological nature of DNA. One of the major barricades for the biosensor design lies in the restricted target accessibility at the solid-water interface. DNA nanotechnology provides a convenient approach to well control the biomolecule-confined surface to increase the ability of molecular recognition at the biosensing interface. For example, tetrahedral DNA nanostructures with thiol modifications can be self-assembled at the gold surface with high reproducibility. Since DNA tetrahedra are highly rigid and well-defined structures with atomic precision and versatile functionality, they provide scaffolds for anchoring of a variety of biomolecular probes (DNA, aptamers, peptides, and proteins) for biosensing. Significantly, this DNA nanostructure-based biosensing platform greatly increases target accessibility and improves the sensitivity for various types of molecular targets (DNA, RNA, proteins, and small molecules) by several orders of magnitude. In an alternative approach, DNA nanostructures provide a framework for the development of dynamic nanosensors that can function inside the cell. DNA tetrahedra are found to be facilely cell permeable and can sense and image specific molecules in cells. More importantly, these DNA nanostructures can be efficient drug delivery nanocarriers. Since they are DNA molecules by themselves, they have shown excellent cellular biocompatibility with minimal cytotoxicity. As an example, DNA tetrahedra tailored with CpG oligonucleotide drugs have

  7. Mitochondrial DNA Alterations and Reduced Mitochondrial Function in Aging

    OpenAIRE

    Hebert, Sadie L.; Lanza, Ian R.; Nair, K. Sreekumaran

    2010-01-01

    Oxidative damage to mitochondrial DNA increases with aging. This damage has the potential to affect mitochondrial DNA replication and transcription which could alter the abundance or functionality of mitochondrial proteins. This review describes mitochondrial DNA alterations and changes in mitochondrial function that occur with aging. Age-related alterations in mitochondrial DNA as a possible contributor to the reduction in mitochondrial function are discussed.

  8. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  9. Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping.

    Science.gov (United States)

    Ishibashi, Yu; Oura, Shusuke; Umemura, Kazuo

    2017-09-01

    We examined the adsorption of DNA binding proteins on functionalized, single-walled carbon nanotubes (SWNTs). When SWNTs were functionalized with polyethylene glycol (PEG-SWNT), moderate adsorption of protein molecules was observed. In contrast, nanotubes functionalized with CONH2 groups (CONH2-SWNT) exhibited very strong interactions between the CONH2-SWNT and DNA binding proteins. Instead, when these SWNT surfaces were wrapped with DNA molecules (thymine 30-mers), protein binding was a little decreased. Our results revealed that DNA wrapped PEG-SWNT was one of the most promising candidates to realize DNA nanodevices involving protein reactions on DNA-SWNT surfaces. In addition, the DNA binding protein RecA was more adhesive than single-stranded DNA binding proteins to the functionalized SWNT surfaces.

  10. Regulation and function of DNA methylation in plants and animals

    KAUST Repository

    He, Xinjian

    2011-02-15

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

  11. Functions and applications of polypyridyl complexes in DNA

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The syntheses and desymmetration of a series of novel polypyridyl ligands as well as their complexes, and their DNA-binding properties are reported in this review.The stresses are focused on the functions and potential applications of such complexes as DNA structural probe, DNA molecular light switches, anti-cancer drugs, and photoactivated cleavage agents.

  12. Plasma polymerized epoxide functional surfaces for DNA probe immobilization.

    Science.gov (United States)

    Chu, Li-Qiang; Knoll, Wolfgang; Förch, Renate

    2008-09-15

    The development of functional surfaces for the immobilization of DNA probe is crucial for a successful design of a DNA sensor. In this report, epoxide functional thin films were achieved simply by pulsed plasma polymerization (PP) of glycidyl methacrylate (GMA) at low duty cycle. The presence of epoxide groups in the resulting ppGMA films was confirmed by Fourier transform infrared spectroscopy. The ppGMA coatings were found to be resistant to the non-specific adsorption of DNA strands, while the epoxide groups obtained could react with amine-modified DNA probes in a mild basic environment without any activation steps. A DNA sensor was made, and was successfully employed to distinguish different DNA sequences with one base pair mismatch as seen by surface plasmon enhanced fluorescence spectroscopy (SPFS). The regeneration of the present DNA sensor was also discussed. This result suggests that surface modification with ppGMA films is very promising for the fabrication of various DNA sensors.

  13. Streching of (DNA/functional molecules) complex between electrodes towards DNA molecular wire

    Science.gov (United States)

    Kobayashi, Norihisa; Nishizawa, Makoto; Inoue, Shintarou; Nakamura, Kazuki

    2009-08-01

    DNA/functional molecules such as (Ru(bpy)32+ complex, conducting polymer etc.) complex was prepared to study molecular structure and I-V characteristics towards DNA molecular wire. For example, Ru(bpy)32+ was associated with duplex of DNA by not only electrostatic interaction but also intercalation in the aqueous solution. Singlemolecular structure of DNA/Ru(bpy)32+ complex was analyzed with AFM. We found a network structure of DNA/Ru(bpy)32+ complex on the mica substrate, which is similar to native DNA. The height of DNA/Ru(bpy)32+ complex on the mica substrate was ranging from 0.8 to 1.6 nm, which was higher than the naked DNA (0.5-1.0 nm). This indicates that single-molecular DNA/Ru(bpy)32+ complex also connects to each other to form network structure on a mica substrate. In order to stretch DNA complex between electrodes, we employed high frequency and high electric field stretching method proposed by Washizu et al. We stretched and immobilized DNA single molecules between a pair of electrodes and its structures were analyzed with AFM technique. The I-V characteristics of DNA single molecules between electrodes were improved by the association of functional molecules with DNA. The molecular structure and I-V characteristics of DNA complex were discussed.

  14. Tetrahedron-structured DNA and functional oligonucleotide for construction of an electrochemical DNA-based biosensor.

    Science.gov (United States)

    Bu, Nan-Nan; Tang, Chun-Xia; He, Xi-Wen; Yin, Xue-Bo

    2011-07-21

    Tetrahedron-structured DNA (ts-DNA) in combination with a functionalized oligonucleotide was used to develop a "turn-on" biosensor for Hg(2+) ions. The ts-DNA provided an improved sensitivity and was used to block the active sites.

  15. Functional redundancy between DNA ligases I and III in DNA replication in vertebrate cells

    Science.gov (United States)

    Arakawa, Hiroshi; Bednar, Theresa; Wang, Minli; Paul, Katja; Mladenov, Emil; Bencsik-Theilen, Alena A.; Iliakis, George

    2012-01-01

    In eukaryotes, the three families of ATP-dependent DNA ligases are associated with specific functions in DNA metabolism. DNA ligase I (LigI) catalyzes Okazaki-fragment ligation at the replication fork and nucleotide excision repair (NER). DNA ligase IV (LigIV) mediates repair of DNA double strand breaks (DSB) via the canonical non-homologous end-joining (NHEJ) pathway. The evolutionary younger DNA ligase III (LigIII) is restricted to higher eukaryotes and has been associated with base excision (BER) and single strand break repair (SSBR). Here, using conditional knockout strategies for LIG3 and concomitant inactivation of the LIG1 and LIG4 genes, we show that in DT40 cells LigIII efficiently supports semi-conservative DNA replication. Our observations demonstrate a high functional versatility for the evolutionary new LigIII in DNA replication and mitochondrial metabolism, and suggest the presence of an alternative pathway for Okazaki fragment ligation. PMID:22127868

  16. Combing genomic DNA for structural and functional studies.

    Science.gov (United States)

    Schurra, Catherine; Bensimon, Aaron

    2009-01-01

    Molecular combing is a process whereby single DNA molecules bind by their extremities to a silanised surface and are then uniformly stretched and aligned by a receding air/water interface (1). This method, with a high resolution ranging from a few kilobases to megabases, has many applications in the field of molecular cytogenetics, allowing structural and functional analysis at the genome level. Here we describe protocols for preparing DNA for combing and for the use of fluorescent hybridisation (FH) applied to combed DNA to conduct physical mapping or genomic structural analysis. We also present the methodology for visualising and studying DNA replication using combed DNA.

  17. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  18. Functional aspects of baculovirus DNA photolyases

    NARCIS (Netherlands)

    Xu, F.

    2010-01-01

    Keywords: baculovirus, ChchNPV, CPD photolyase, phylogeny, UV resistance, DNA binding, localization, proteomics Baculoviruses are insect viruses that are applied as biological control agents due to adequate virulence, host specificity and safety for the environment. Solar light negatively affects

  19. Functional aspects of baculovirus DNA photolyases

    NARCIS (Netherlands)

    Xu, F.

    2010-01-01

    Keywords: baculovirus, ChchNPV, CPD photolyase, phylogeny, UV resistance, DNA binding, localization, proteomics Baculoviruses are insect viruses that are applied as biological control agents due to adequate virulence, host specificity and safety for the environment. Solar light negatively affects

  20. Mechanisms and functions of DNA mismatch repair

    Institute of Scientific and Technical Information of China (English)

    Guo MinLi

    2008-01-01

    DNA mismatch repair (MMR) is a highly conserved biological pathway that plays a key role in maintaining genomic stability. The specificity of MMR is primarily for base-base mismatches and insertion/deletion mispairs generated dur-ing DNA replication and recombination. MMR also suppresses homeologous recombination and was recently shown to play a role in DNA damage signaling in eukaryotic cells. Escherichia coli MutS and MutL and their eukaryotic homo-logs, MutSα and MutLα, respectively, are key players in MMR-associated genome maintenance. Many other protein components that participate in various DNA metabolic pathways, such as PCNA and RPA, are also essential for MMR. Defects in MMR are associated with genome-wide instability, predisposition to certain types of cancer including he-reditary non-polyposis colorectal cancer, resistance to certain chemotherapeutic agents, and abnormalities in meiosis and sterility in mammalian systems.

  1. NLO properties of functionalized DNA thin films

    Energy Technology Data Exchange (ETDEWEB)

    Krupka, Oksana [University d' Angers, Laboratoire POMA CNRS UMR 6136, France, 2 Bd. Lavoisier, 49045 (France)], E-mail: okrupka@mail.ru; El-ghayoury, Abdelkrim [University d' Angers, UFR Sciences, Laboratoire CIMMA UMR CNRS 6200, 2 Bd. Lavoisier, 49045 (France); Rau, Ileana; Sahraoui, Bouchta [University d' Angers, Laboratoire POMA CNRS UMR 6136, France, 2 Bd. Lavoisier, 49045 (France); Grote, James G. [Air Force Research Laboratory Materials and Manufacturing Directorate, Wright-Patterson Air Force Base, 3005 Hobson Way, Dayton, OH 45433-7707 (United States); Kajzar, Francois [University d' Angers, Laboratoire POMA CNRS UMR 6136, France, 2 Bd. Lavoisier, 49045 (France)

    2008-10-31

    In this paper we investigate the third-order nonlinear optical properties of spin deposited thin films of DNA-based complexes using the optical third harmonic generation (THG) technique at a fundamental wavelength of 1064 nm. We found that the third-order susceptibility, {chi}{sup (3)}(- 3{omega};{omega},{omega},{omega}), of DNA-based films was about one order of magnitude larger than that of our reference, a pure silica slab. In thin films doped with 5% of the chromophore disperse red 1 (DR1), a two order of magnitude larger value of {chi}{sup (3)}(- 3{omega};{omega},{omega},{omega}) was observed.

  2. Self-assembly of DNA-functionalized colloids

    Directory of Open Access Journals (Sweden)

    P.E. Theodorakis

    2015-06-01

    Full Text Available Colloidal particles grafted with single-stranded DNA (ssDNA chains can self-assemble into a number of different crystalline structures, where hybridization of the ssDNA chains creates links between colloids stabilizing their structure. Depending on the geometry and the size of the particles, the grafting density of the ssDNA chains, and the length and choice of DNA sequences, a number of different crystalline structures can be fabricated. However, understanding how these factors contribute synergistically to the self-assembly process of DNA-functionalized nano- or micro-sized particles remains an intensive field of research. Moreover, the fabrication of long-range structures due to kinetic bottlenecks in the self-assembly are additional challenges. Here, we discuss the most recent advances from theory and experiment with particular focus put on recent simulation studies.

  3. Microarray of DNA probes on carboxylate functional beads surface

    Institute of Scientific and Technical Information of China (English)

    黄承志; 李原芳; 黄新华; 范美坤

    2000-01-01

    The microarray of DNA probes with 5’ -NH2 and 5’ -Tex/3’ -NH2 modified terminus on 10 um carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) is characterized in the preseni paper. it was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentra-tion of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.

  4. Microarray of DNA probes on carboxylate functional beads surface

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The microarray of DNA probes with 5′-NH2 and 5′-Tex/3′-NH2 modified terminus on 10 m m carboxylate functional beads surface in the presence of 1-ethyl-3-(3-dimethylaminopropyl)- carbodiimide (EDC) is characterized in the present paper. It was found that the microarray capacity of DNA probes on the beads surface depends on the pH of the aqueous solution, the concentration of DNA probe and the total surface area of the beads. On optimal conditions, the minimum distance of 20 mer single-stranded DNA probe microarrayed on beads surface is about 14 nm, while that of 20 mer double-stranded DNA probes is about 27 nm. If the probe length increases from 20 mer to 35 mer, its microarray density decreases correspondingly. Mechanism study shows that the binding mode of DNA probes on the beads surface is nearly parallel to the beads surface.

  5. Functional self-assembled DNA nanostructures for molecular recognition

    Science.gov (United States)

    Zhang, Xiaojuan; Yadavalli, Vamsi K.

    2012-03-01

    Nucleic acids present a wonderful toolkit of structural motifs for nanoconstruction. Functional DNA nanostructures can enable protein recognition by the use of aptamers attached to a basic core shape formed by DNA self-assembly. Here, we present a facile, programmable strategy for the assembly of discrete aptamer-tagged DNA shapes and nanostructures that can function for molecular recognition and binding in an aqueous environment. These nanostructures, presented here to bind two different protein targets, are easily synthesized in large numbers, and are portable and stable over long periods of time. This construction modality can facilitate on-demand production of libraries of diverse shapes to recognize and bind proteins or catalyze reactions via functional nucleic acid tags.Nucleic acids present a wonderful toolkit of structural motifs for nanoconstruction. Functional DNA nanostructures can enable protein recognition by the use of aptamers attached to a basic core shape formed by DNA self-assembly. Here, we present a facile, programmable strategy for the assembly of discrete aptamer-tagged DNA shapes and nanostructures that can function for molecular recognition and binding in an aqueous environment. These nanostructures, presented here to bind two different protein targets, are easily synthesized in large numbers, and are portable and stable over long periods of time. This construction modality can facilitate on-demand production of libraries of diverse shapes to recognize and bind proteins or catalyze reactions via functional nucleic acid tags. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr11711h

  6. Origins, structures, and functions of circulating DNA in oncology.

    Science.gov (United States)

    Thierry, A R; El Messaoudi, S; Gahan, P B; Anker, P; Stroun, M

    2016-09-01

    While various clinical applications especially in oncology are now in progress such as diagnosis, prognosis, therapy monitoring, or patient follow-up, the determination of structural characteristics of cell-free circulating DNA (cirDNA) are still being researched. Nevertheless, some specific structures have been identified and cirDNA has been shown to be composed of many "kinds." This structural description goes hand-in-hand with the mechanisms of its origins such as apoptosis, necrosis, active release, phagocytosis, and exocytose. There are multiple structural forms of cirDNA depending upon the mechanism of release: particulate structures (exosomes, microparticles, apoptotic bodies) or macromolecular structures (nucleosomes, virtosomes/proteolipidonucleic acid complexes, DNA traps, links with serum proteins or to the cell-free membrane parts). In addition, cirDNA concerns both nuclear and/or mitochondrial DNA with both species exhibiting different structural characteristics that potentially reveal different forms of biological stability or diagnostic significance. This review focuses on the origins, structures and functional aspects that are paradoxically less well described in the literature while numerous reviews are directed to the clinical application of cirDNA. Differentiation of the various structures and better knowledge of the fate of cirDNA would considerably expand the diagnostic power of cirDNA analysis especially with regard to the patient follow-up enlarging the scope of personalized medicine. A better understanding of the subsequent fate of cirDNA would also help in deciphering its functional aspects such as their capacity for either genometastasis or their pro-inflammatory and immunological effects.

  7. Resurrection of DNA function in vivo from an extinct genome.

    Science.gov (United States)

    Pask, Andrew J; Behringer, Richard R; Renfree, Marilyn B

    2008-05-21

    There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine), obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity.

  8. Resurrection of DNA function in vivo from an extinct genome.

    Directory of Open Access Journals (Sweden)

    Andrew J Pask

    Full Text Available There is a burgeoning repository of information available from ancient DNA that can be used to understand how genomes have evolved and to determine the genetic features that defined a particular species. To assess the functional consequences of changes to a genome, a variety of methods are needed to examine extinct DNA function. We isolated a transcriptional enhancer element from the genome of an extinct marsupial, the Tasmanian tiger (Thylacinus cynocephalus or thylacine, obtained from 100 year-old ethanol-fixed tissues from museum collections. We then examined the function of the enhancer in vivo. Using a transgenic approach, it was possible to resurrect DNA function in transgenic mice. The results demonstrate that the thylacine Col2A1 enhancer directed chondrocyte-specific expression in this extinct mammalian species in the same way as its orthologue does in mice. While other studies have examined extinct coding DNA function in vitro, this is the first example of the restoration of extinct non-coding DNA and examination of its function in vivo. Our method using transgenesis can be used to explore the function of regulatory and protein-coding sequences obtained from any extinct species in an in vivo model system, providing important insights into gene evolution and diversity.

  9. Functional interactions of DNA topoisomerases with a human replication origin.

    Science.gov (United States)

    Abdurashidova, Gulnara; Radulescu, Sorina; Sandoval, Oscar; Zahariev, Sotir; Danailov, Miltcho B; Demidovich, Alexander; Santamaria, Laura; Biamonti, Giuseppe; Riva, Silvano; Falaschi, Arturo

    2007-02-21

    The human DNA replication origin, located in the lamin B2 gene, interacts with the DNA topoisomerases I and II in a cell cycle-modulated manner. The topoisomerases interact in vivo and in vitro with precise bonds ahead of the start sites of bidirectional replication, within the pre-replicative complex region; topoisomerase I is bound in M, early G1 and G1/S border and topoisomerase II in M and the middle of G1. The Orc2 protein competes for the same sites of the origin bound by either topoisomerase in different moments of the cell cycle; furthermore, it interacts on the DNA with topoisomerase II during the assembly of the pre-replicative complex and with DNA-bound topoisomerase I at the G1/S border. Inhibition of topoisomerase I activity abolishes origin firing. Thus, the two topoisomerases are closely associated with the replicative complexes, and DNA topology plays an essential functional role in origin activation.

  10. Structure and Function Study of Phi29 DNA packaging motor

    Science.gov (United States)

    Fang, Huaming

    molecules were required to bind to one short dsDNA molecule. The inhibitive curve of Walker B mutant gp16 analyzed by binomial distribution model showed that one inactive mutant gp16 in the gp16 ring could block the function of the motor and the stoichiometry of gp16 was six. These findings facilitate our understanding of the molecular mechanism of viral DNA packaging: a novel viral DNA packaging model "push through a one-way valve" was proposed. In this model, the connector functioned as a valve to allow DNA to enter but prevented it from sliding out during DNA packaging; the six subunits in the gp16 ring acted sequentially to push DNA into the connector channel. ATP binding of gp16 induced a conformation change with a high affinity for dsDNA. Then, the ATP was hydrolyzed which resulted in the movement of subdomains in this individual gp16 subunit and DNA was pushed forward, followed by the double helix of dsDNA being brought forward to the adjacent subunit in the gp16 ring. The elucidation of the viral DNA packaging mechanism holds great potential for developing artificial motors for delivering drugs and other molecular cargos.

  11. Structure and function of the DNA ligases encoded by the mammalian LIG3 gene

    OpenAIRE

    Tomkinson, Alan E.; Sallmyr, Annahita

    2013-01-01

    Among the mammalian genes encoding DNA ligases (LIG), the LIG3 gene is unique in that it encodes multiple DNA ligase polypeptides with different cellular functions. Notably, this nuclear gene encodes the only mitochondrial DNA ligase and so is essential for this organelle. In the nucleus, there is significant functional redundancy between DNA ligase IIIα and DNA ligase I in excision repair. In addition, DNA ligase IIIα is essential for DNA replication in the absence of the replicative DNA lig...

  12. Specificity and function of Archaeal DNA replication initiator proteins

    DEFF Research Database (Denmark)

    Samson, Rachel Y.; Xu, Yanqun; Gadelha, Catarina

    2013-01-01

    to investigate the role of ATP binding and hydrolysis in initiator function in vivo and in vitro. We find that the ATP-bound form of Orc1-1 is proficient for replication and implicates hydrolysis of ATP in downregulation of origin activity. Finally, we reveal that ATP and DNA binding by Orc1-1 remodels...... the protein's structure rather than that of the DNA template....

  13. Beyond the dna: a prototype for functional genomics

    Energy Technology Data Exchange (ETDEWEB)

    Albala, J

    2000-03-02

    A prototype oligonucleotide ''functional chip'' has been developed to screen novel DNA repair proteins for their ability to bind or alter different forms of DNA. This chip has been developed as a functional genomics screen for analysis of protein-DNA interactions for novel proteins identified from the Human Genome Project The process of novel gene identification that has ensued as a consequence of available sequence information is remarkable. The challenge how lies in determining the function of newly identified gene products in a time-and cost-effective high-throughput manner. The functional chip is generated by the robotic application of DNA spotted in a microarray format onto a glass slide. Individual proteins are then analyzed against the different form of DNA bound to the slide. Several prototype functional chips were designed to contain various DNA fragments tethered to a glass slide for analysis of protein-DNA binding or enzymatic activity of known proteins. The technology has been developed to screen novel, putative DNA repair proteins for their ability to bind various types of DNA alone and in concert with protein partners. An additional scheme has been devised to screen putative repair enzymes for their ability to process different types of DNA molecules. Current methods to analyze gene expression primarily utilize either of two technologies. The oligonucleotide chip, pioneered by Fodor and co-workers and Affymetrix, Inc., consists of greater than 64,000 oligonucleotides attached in situ to a glass support. The oligonucleotide chip has been used primarily to identify specific mutations in a given gene by hybridization against a fluorescently-labeled substrate. The second method is the microarray, whereby DNA targets are systematically arranged on a glass slide and then hybridized with fluorescently-labeled complex targets for gene expression analysis (Jordan, 1998). By this technique, a large amount of information can be obtained

  14. Indirect readout of DNA sequence by p22 repressor: roles of DNA and protein functional groups in modulating DNA conformation.

    Science.gov (United States)

    Harris, Lydia-Ann; Watkins, Derrick; Williams, Loren Dean; Koudelka, Gerald B

    2013-01-09

    The repressor of bacteriophage P22 (P22R) discriminates between its various DNA binding sites by sensing the identity of non-contacted base pairs at the center of its binding site. The "indirect readout" of these non-contacted bases is apparently based on DNA's sequence-dependent conformational preferences. The structures of P22R-DNA complexes indicate that the non-contacted base pairs at the center of the binding site are in the B' state. This finding suggests that indirect readout and therefore binding site discrimination depend on P22R's ability to either sense and/or impose the B' state on the non-contacted bases of its binding sites. We show here that the affinity of binding sites for P22R depends on the tendency of the central bases to assume the B'-DNA state. Furthermore, we identify functional groups in the minor groove of the non-contacted bases as the essential modulators of indirect readout by P22R. In P22R-DNA complexes, the negatively charged E44 and E48 residues are provocatively positioned near the negatively charged DNA phosphates of the non-contacted nucleotides. The close proximity of the negatively charged groups on protein and DNA suggests that electrostatics may play a key role in the indirect readout process. Changing either of two negatively charged residues to uncharged residues eliminates the ability of P22R to impose structural changes on DNA and to recognize non-contacted base sequence. These findings suggest that these negatively charged amino acids function to force the P22R-bound DNA into the B' state and therefore play a key role in indirect readout by P22R.

  15. Functionalization of DNA Nanostructures for Cell Signaling Applications

    Science.gov (United States)

    Pedersen, Ronnie O.

    Transforming growth factor beta (TGF-beta) is an important cytokine responsible for a wide range of different cellular functions including extracellular matrix formation, angiogenesis and epithelial-mesenchymal transition. We have sought to use self-assembling DNA nanostructures to influence TGF-beta signaling. The predictable Watson Crick base pairing allows for designing self-assembling nanoscale structures using oligonucleotides. We have used the method of DNA origami to assemble structures functionalized with multiple peptides that bind TGF-beta receptors outside the ligand binding domain. This allows the nanostructures to cluster TGF-beta receptors and lower the energy barrier of ligand binding thus sensitizing the cells to TGF-beta stimulation. To prove efficacy of our nanostructures we have utilized immunofluorescent staining of Smad2/4 in order to monitor TGF-beta mediated translocation of Smad2/4 to the cell nucleus. We have also utilized Smad2/4 responsive luminescence constructs that allows us to quantify TGF-beta stimulation with and without nanostructures. To functionalize our nanostructures we relied on biotin-streptavidin linkages. This introduces a multivalency that is not necessarily desirable in all designs. Therefore we have investigated alternative means of functionalization. The first approach is based on targeting DNA nanostructure by using zinc finger binding proteins. Efficacy of zinc finger binding proteins was assayed by the use of enzyme-linked immunosorbent (ELISA) assay and atomic force microscopy (AFM). While ELISA indicated a relative specificity of zinc finger proteins for target DNA sequences AFM showed a high degree of non-specific binding and insufficient affinity. The second approach is based on using peptide nucleic acid (PNA) incorporated in the nanostructure through base pairing. PNA is a synthetic DNA analog consisting of a backbone of repeating N-(2-aminoethyl)-glycine units to which purine and pyrimidine bases are linked by

  16. DNA Modifications: Function and Applications in Normal and Disease States

    Directory of Open Access Journals (Sweden)

    Vichithra R. B. Liyanage

    2014-10-01

    Full Text Available Epigenetics refers to a variety of processes that have heritable effects on gene expression programs without changes in DNA sequence. Key players in epigenetic control are chemical modifications to DNA, histone, and non-histone chromosomal proteins, which establish a complex regulatory network that controls genome function. Methylation of DNA at the fifth position of cytosine in CpG dinucleotides (5-methylcytosine, 5mC, which is carried out by DNA methyltransferases, is commonly associated with gene silencing. However, high resolution mapping of DNA methylation has revealed that 5mC is enriched in exonic nucleosomes and at intron-exon junctions, suggesting a role of DNA methylation in the relationship between elongation and RNA splicing. Recent studies have increased our knowledge of another modification of DNA, 5-hydroxymethylcytosine (5hmC, which is a product of the ten-eleven translocation (TET proteins converting 5mC to 5hmC. In this review, we will highlight current studies on the role of 5mC and 5hmC in regulating gene expression (using some aspects of brain development as examples. Further the roles of these modifications in detection of pathological states (type 2 diabetes, Rett syndrome, fetal alcohol spectrum disorders and teratogen exposure will be discussed.

  17. Structural and functional interaction between the human DNA repair proteins DNA ligase IV and XRCC4.

    Science.gov (United States)

    Wu, Peï-Yu; Frit, Philippe; Meesala, SriLakshmi; Dauvillier, Stéphanie; Modesti, Mauro; Andres, Sara N; Huang, Ying; Sekiguchi, JoAnn; Calsou, Patrick; Salles, Bernard; Junop, Murray S

    2009-06-01

    Nonhomologous end-joining represents the major pathway used by human cells to repair DNA double-strand breaks. It relies on the XRCC4/DNA ligase IV complex to reseal DNA strands. Here we report the high-resolution crystal structure of human XRCC4 bound to the carboxy-terminal tandem BRCT repeat of DNA ligase IV. The structure differs from the homologous Saccharomyces cerevisiae complex and reveals an extensive DNA ligase IV binding interface formed by a helix-loop-helix structure within the inter-BRCT linker region, as well as significant interactions involving the second BRCT domain, which induces a kink in the tail region of XRCC4. We further demonstrate that interaction with the second BRCT domain of DNA ligase IV is necessary for stable binding to XRCC4 in cells, as well as to achieve efficient dominant-negative effects resulting in radiosensitization after ectopic overexpression of DNA ligase IV fragments in human fibroblasts. Together our findings provide unanticipated insight for understanding the physical and functional architecture of the nonhomologous end-joining ligation complex.

  18. Structural and Functional Interaction Between the Human DNA Repair Proteins DNA ligase IV and XRCC4

    Energy Technology Data Exchange (ETDEWEB)

    Wu, P.; Meesala, S; Dauvillier, S; Modesti, M; Andres, S; Huang, Y; Sekiguchi, J; Calsou, P; Salles, B; Junop, M

    2009-01-01

    Nonhomologous end-joining represents the major pathway used by human cells to repair DNA double-strand breaks. It relies on the XRCC4/DNA ligase IV complex to reseal DNA strands. Here we report the high-resolution crystal structure of human XRCC4 bound to the carboxy-terminal tandem BRCT repeat of DNA ligase IV. The structure differs from the homologous Saccharomyces cerevisiae complex and reveals an extensive DNA ligase IV binding interface formed by a helix-loop-helix structure within the inter-BRCT linker region, as well as significant interactions involving the second BRCT domain, which induces a kink in the tail region of XRCC4. We further demonstrate that interaction with the second BRCT domain of DNA ligase IV is necessary for stable binding to XRCC4 in cells, as well as to achieve efficient dominant-negative effects resulting in radiosensitization after ectopic overexpression of DNA ligase IV fragments in human fibroblasts. Together our findings provide unanticipated insight for understanding the physical and functional architecture of the nonhomologous end-joining ligation complex.

  19. Concentration-dependent thermophoretic accumulation for the detection of DNA using DNA-functionalized nanoparticles.

    Science.gov (United States)

    Yu, Li-Hsien; Chen, Yih-Fan

    2015-03-03

    Thermophoresis is a phenomenon about the migration of particles along a temperature gradient and is sensitive to the properties of particles and the surrounding medium. While a few studies have investigated its mechanisms and effects on particle motion in recent years, the applications of thermophoresis in biosensing has not been well explored. In this study, we demonstrate a thermophoresis-based method for detecting DNA. We use DNA-functionalized gold nanoparticles and fluorescent DNA probes to capture target DNA in free solution, and we demonstrate that the hybridization between the specially designed capture probes and the target DNA significantly changes the thermophoretic properties of the fluorescent probes. As a result, the target DNA can be specifically detected in serum-containing buffers based on the spatial distribution of the fluorescent probes in a laser-induced temperature gradient. The optical setup consists of only a laser and an epifluorescence microscope, and the detection does not rely on any micro- or nanofabricated devices. In addition, because the detection is based on the thermophoretic motion of molecules in free solution, no capture probes need to be immobilized on a fixed surface before detection, and no channels or pumps are needed for washing away unbound molecules. The thermophoresis-based biosensing method is found to be simple and effective for detecting DNA.

  20. Functional DNA: Teaching Infinite Series through Genetic Analogy

    Science.gov (United States)

    Kowalski, R. Travis

    2011-01-01

    This article presents an extended analogy that connects infinite sequences and series to the science of genetics, by identifying power series as "DNA for a function." This analogy allows standard topics such as convergence tests or Taylor approximations to be recast in a "forensic" light as mathematical analogs of genetic concepts such as DNA…

  1. Establishment and functions of DNA methylation in the germline

    DEFF Research Database (Denmark)

    Stewart-Morgan, Kathleen; Veselovska, Lenka; Kelsey, Gavin

    2016-01-01

    Epigenetic modifications established during gametogenesis regulate transcription and other nuclear processes in gametes, but also have influences in the zygote, embryo and postnatal life. This is best understood for DNA methylation which, established at discrete regions of the oocyte and sperm...... the fate and function of gametic methylation and other epigenetic modifications after fertilization....

  2. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    Science.gov (United States)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  3. NAD+ Modulates p53 DNA Binding Specificity and Function

    Science.gov (United States)

    McLure, Kevin G.; Takagi, Masatoshi; Kastan, Michael B.

    2004-01-01

    DNA damage induces p53 DNA binding activity, which affects tumorigenesis, tumor responses to therapies, and the toxicities of cancer therapies (B. Vogelstein, D. Lane, and A. J. Levine, Nature 408:307-310, 2000; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Both transcriptional and transcription-independent activities of p53 contribute to DNA damage-induced cell cycle arrest, apoptosis, and aneuploidy prevention (M. B. Kastan et al., Cell 71:587-597, 1992; K. H. Vousden and X. Lu, Nat. Rev. Cancer 2:594-604, 2002). Small-molecule manipulation of p53 DNA binding activity has been an elusive goal, but here we show that NAD+ binds to p53 tetramers, induces a conformational change, and modulates p53 DNA binding specificity in vitro. Niacinamide (vitamin B3) increases the rate of intracellular NAD+ synthesis, alters radiation-induced p53 DNA binding specificity, and modulates activation of a subset of p53 transcriptional targets. These effects are likely due to a direct effect of NAD+ on p53, as a molecule structurally related to part of NAD+, TDP, also inhibits p53 DNA binding, and the TDP precursor, thiamine (vitamin B1), inhibits intracellular p53 activity. Niacinamide and thiamine affect two p53-regulated cellular responses to ionizing radiation: rereplication and apoptosis. Thus, niacinamide and thiamine form a novel basis for the development of small molecules that affect p53 function in vivo, and these results suggest that changes in cellular energy metabolism may regulate p53. PMID:15509798

  4. Defining functional DNA elements in the human genome.

    Science.gov (United States)

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P; Bernstein, Bradley E; Kundaje, Anshul; Marinov, Georgi K; Ward, Lucas D; Birney, Ewan; Crawford, Gregory E; Dekker, Job; Dunham, Ian; Elnitski, Laura L; Farnham, Peggy J; Feingold, Elise A; Gerstein, Mark; Giddings, Morgan C; Gilbert, David M; Gingeras, Thomas R; Green, Eric D; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D; Myers, Richard M; Pazin, Michael J; Ren, Bing; Stamatoyannopoulos, John A; Weng, Zhiping; White, Kevin P; Hardison, Ross C

    2014-04-29

    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease.

  5. What cost mitochondria? The maintenance of functional mitochondrial DNA within and across generations

    NARCIS (Netherlands)

    Aanen, D.K.; Spelbrink, J.N.; Beekman, M.

    2014-01-01

    The peculiar biology of mitochondrial DNA (mtDNA) potentially has detrimental consequences for organismal health and lifespan. Typically, eukaryotic cells contain multiple mitochondria, each with multiple mtDNA genomes. The high copy number of mtDNA implies that selection on mtDNA functionality is r

  6. What cost mitochondria? The maintenance of functional mitochondrial DNA within and across generations

    NARCIS (Netherlands)

    Aanen, D.K.; Spelbrink, J.N.; Beekman, M.

    2014-01-01

    The peculiar biology of mitochondrial DNA (mtDNA) potentially has detrimental consequences for organismal health and lifespan. Typically, eukaryotic cells contain multiple mitochondria, each with multiple mtDNA genomes. The high copy number of mtDNA implies that selection on mtDNA functionality is

  7. Amine-functionalized magnetic mesoporous silica nanoparticles for DNA separation

    Science.gov (United States)

    Sheng, Wei; Wei, Wei; Li, Junjian; Qi, Xiaoliang; Zuo, Gancheng; Chen, Qi; Pan, Xihao; Dong, Wei

    2016-11-01

    We report a modified approach for the functionalized magnetic mesoporous silica nanoparticles (MMSN) using polymer microspheres incorporated with magnetic nanoparticles in the presence of cetyltrimethylammonium bromide (CTAB) and the core-shell magnetic silica nanoparticles (MSN). These particles were functionalized with amino groups via the addition of aminosilane directly to the particle sol. We then evaluate their DNA separation abilities and find the capacity of DNA binding significantly increased (210.22 μg/mg) compared with normal magnetic silica spheres (138.44 μg/mg) by using an ultraviolet and visible spectrophotometer (UV). The morphologies, magnetic properties, particle size, pore size, core-shell structure and Zeta potential are characterized by Fourier transform infrared spectroscopy (FT-IR), vibrating sample magnetometer (VSM), Transmission electron microscopy (TEM), Powder X-ray diffraction (XRD), and dynamic light scattering (DLS). This work demonstrates that our MMSN own an excellent potential application in bioseparation and drug delivery.

  8. DNA-functionalized solid state nanopore for biosensing

    Energy Technology Data Exchange (ETDEWEB)

    Mussi, V; Fanzio, P; Repetto, L; Firpo, G; Valbusa, U [Nanomed Labs, Physics Department, University of Genova, Advanced Biotechnology Center, Largo R. Benzi, 10 Genova, 16132 (Italy); Scaruffi, P; Stigliani, S; Tonini, G P, E-mail: mussi@fisica.unige.it [Translational Pediatric Oncology, National Institute for Cancer Research (IST), Largo R. Benzi, 10 Genova, 16132 (Italy)

    2010-04-09

    The possible use of nanopores for single DNA molecules biosensing has been demonstrated, but much remains to do in order to develop advanced engineered devices with enhanced stability, and controlled geometry and surface properties. Here we present morphological and electrical characterization of solid state silicon nitride nanopores fabricated by focused ion beam direct milling and chemically functionalized by probe oligonucleotides, with the final aim of developing a versatile tool for biosensing and gene expression profiling.

  9. Androgen receptor function links human sexual dimorphism to DNA methylation.

    Directory of Open Access Journals (Sweden)

    Ole Ammerpohl

    Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.

  10. Two novel temperate bacteriophages co-existing in Aeromonas sp. ARM81 - characterization of their genomes, proteomes and DNA methyltransferases.

    Science.gov (United States)

    Dziewit, Lukasz; Radlinska, Monika

    2016-08-01

    Aeromonas species are causative agents of a wide spectrum of diseases in animals and humans. Although these bacteria are commonly found in various environments, little is known about their phages. Thus far, only one temperate Aeromonas phage has been characterized. Whole-genome sequencing of an Aeromonas sp. strain ARM81 revealed the presence of two prophage clusters. One of them is integrated into the chromosome and the other was maintained as an extrachromosomal, linear plasmid-like prophage encoding a protelomerase. Both prophages were artificially and spontaneously inducible. We separately isolated both phages and compared their genomes with other known viruses. The novel phages show no similarity to the previously characterized Aeromonas phages and might represent new evolutionary lineages of viruses infecting Aeromonadaceae. Apart from the comparative genomic analyses of these phages, complemented with their structural and molecular characterization, a functional analysis of four DNA methyltransferases encoded by these viruses was conducted. One of the investigated N6-adenine-modifying enzymes shares sequence specificity with a Dam-like methyltransferase of its bacterial host, while another one is non-specific, as it catalyzes adenine methylation in various sequence contexts. The presented results shed new light on the diversity of Aeromonas temperate phages.

  11. DNA block copolymers: functional materials for nanoscience and biomedicine.

    Science.gov (United States)

    Schnitzler, Tobias; Herrmann, Andreas

    2012-09-18

    We live in a world full of synthetic materials, and the development of new technologies builds on the design and synthesis of new chemical structures, such as polymers. Synthetic macromolecules have changed the world and currently play a major role in all aspects of daily life. Due to their tailorable properties, these materials have fueled the invention of new techniques and goods, from the yogurt cup to the car seat belts. To fulfill the requirements of modern life, polymers and their composites have become increasingly complex. One strategy for altering polymer properties is to combine different polymer segments within one polymer, known as block copolymers. The microphase separation of the individual polymer components and the resulting formation of well defined nanosized domains provide a broad range of new materials with various properties. Block copolymers facilitated the development of innovative concepts in the fields of drug delivery, nanomedicine, organic electronics, and nanoscience. Block copolymers consist exclusively of organic polymers, but researchers are increasingly interested in materials that combine synthetic materials and biomacromolecules. Although many researchers have explored the combination of proteins with organic polymers, far fewer investigations have explored nucleic acid/polymer hybrids, known as DNA block copolymers (DBCs). DNA as a polymer block provides several advantages over other biopolymers. The availability of automated synthesis offers DNA segments with nucleotide precision, which facilitates the fabrication of hybrid materials with monodisperse biopolymer blocks. The directed functionalization of modified single-stranded DNA by Watson-Crick base-pairing is another key feature of DNA block copolymers. Furthermore, the appropriate selection of DNA sequence and organic polymer gives control over the material properties and their self-assembly into supramolecular structures. The introduction of a hydrophobic polymer into DBCs

  12. Functionalized nanopore-embedded electrodes for rapid DNA sequencing

    CERN Document Server

    He, Haiying; Pandey, Ravindra; Rocha, Alexandre Reily; Sanvito, Stefano; Grigoriev, Anton; Ahuja, Rajeev; Karna, Shashi P

    2007-01-01

    The determination of a patient's DNA sequence can, in principle, reveal an increased risk to fall ill with particular diseases [1,2] and help to design "personalized medicine" [3]. Moreover, statistical studies and comparison of genomes [4] of a large number of individuals are crucial for the analysis of mutations [5] and hereditary diseases, paving the way to preventive medicine [6]. DNA sequencing is, however, currently still a vastly time-consuming and very expensive task [4], consisting of pre-processing steps, the actual sequencing using the Sanger method, and post-processing in the form of data analysis [7]. Here we propose a new approach that relies on functionalized nanopore-embedded electrodes to achieve an unambiguous distinction of the four nucleic acid bases in the DNA sequencing process. This represents a significant improvement over previously studied designs [8,9] which cannot reliably distinguish all four bases of DNA. The transport properties of the setup investigated by us, employing state-o...

  13. The Saccharomyces cerevisiae Dna2 can function as a sole nuclease in the processing of Okazaki fragments in DNA replication.

    Science.gov (United States)

    Levikova, Maryna; Cejka, Petr

    2015-09-18

    During DNA replication, synthesis of the lagging strand occurs in stretches termed Okazaki fragments. Before adjacent fragments are ligated, any flaps resulting from the displacement of the 5' DNA end of the Okazaki fragment must be cleaved. Previously, Dna2 was implicated to function upstream of flap endonuclease 1 (Fen1 or Rad27) in the processing of long flaps bound by the replication protein A (RPA). Here we show that Dna2 efficiently cleaves long DNA flaps exactly at or directly adjacent to the base. A fraction of the flaps cleaved by Dna2 can be immediately ligated. When coupled with DNA replication, the flap processing activity of Dna2 leads to a nearly complete Okazaki fragment maturation at sub-nanomolar Dna2 concentrations. Our results indicate that a subsequent nucleolytic activity of Fen1 is not required in most cases. In contrast Dna2 is completely incapable to cleave short flaps. We show that also Dna2, like Fen1, interacts with proliferating cell nuclear antigen (PCNA). We propose a model where Dna2 alone is responsible for cleaving of RPA-bound long flaps, while Fen1 or exonuclease 1 (Exo1) cleave short flaps. Our results argue that Dna2 can function in a separate, rather than in a Fen1-dependent pathway.

  14. Amine-functionalized magnetic mesoporous silica nanoparticles for DNA separation

    Energy Technology Data Exchange (ETDEWEB)

    Sheng, Wei; Wei, Wei; Li, Junjian; Qi, Xiaoliang; Zuo, Gancheng; Chen, Qi; Pan, Xihao; Dong, Wei, E-mail: weidong@njust.edu.cn

    2016-11-30

    Highlights: • Fe{sub 3}O{sub 4}@SiO{sub 2}@EDPS with uniform size and good dispersity is prepared. • We fabricated MMSN@EDPS with distinct core-shell–shell triple-layer composition. • DNA adsorption capacity of MMSN@EDPS is considerable. - Abstract: We report a modified approach for the functionalized magnetic mesoporous silica nanoparticles (MMSN) using polymer microspheres incorporated with magnetic nanoparticles in the presence of cetyltrimethylammonium bromide (CTAB) and the core-shell magnetic silica nanoparticles (MSN). These particles were functionalized with amino groups via the addition of aminosilane directly to the particle sol. We then evaluate their DNA separation abilities and find the capacity of DNA binding significantly increased (210.22 μg/mg) compared with normal magnetic silica spheres (138.44 μg/mg) by using an ultraviolet and visible spectrophotometer (UV). The morphologies, magnetic properties, particle size, pore size, core-shell structure and Zeta potential are characterized by Fourier transform infrared spectroscopy (FT-IR), vibrating sample magnetometer (VSM), Transmission electron microscopy (TEM), Powder X-ray diffraction (XRD), and dynamic light scattering (DLS). This work demonstrates that our MMSN own an excellent potential application in bioseparation and drug delivery.

  15. Functional characterization of 8-oxoguanine DNA glycosylase of Trypanosoma cruzi.

    Directory of Open Access Journals (Sweden)

    Carolina Furtado

    Full Text Available The oxidative lesion 8-oxoguanine (8-oxoG is removed during base excision repair by the 8-oxoguanine DNA glycosylase 1 (Ogg1. This lesion can erroneously pair with adenine, and the excision of this damaged base by Ogg1 enables the insertion of a guanine and prevents DNA mutation. In this report, we identified and characterized Ogg1 from the protozoan parasite Trypanosoma cruzi (TcOgg1, the causative agent of Chagas disease. Like most living organisms, T. cruzi is susceptible to oxidative stress, hence DNA repair is essential for its survival and improvement of infection. We verified that the TcOGG1 gene encodes an 8-oxoG DNA glycosylase by complementing an Ogg1-defective Saccharomyces cerevisiae strain. Heterologous expression of TcOGG1 reestablished the mutation frequency of the yeast mutant ogg1(-/- (CD138 to wild type levels. We also demonstrate that the overexpression of TcOGG1 increases T. cruzi sensitivity to hydrogen peroxide (H(2O(2. Analysis of DNA lesions using quantitative PCR suggests that the increased susceptibility to H(2O(2 of TcOGG1-overexpressor could be a consequence of uncoupled BER in abasic sites and/or strand breaks generated after TcOgg1 removes 8-oxoG, which are not rapidly repaired by the subsequent BER enzymes. This hypothesis is supported by the observation that TcOGG1-overexpressors have reduced levels of 8-oxoG both in the nucleus and in the parasite mitochondrion. The localization of TcOgg1 was examined in parasite transfected with a TcOgg1-GFP fusion, which confirmed that this enzyme is in both organelles. Taken together, our data indicate that T. cruzi has a functional Ogg1 ortholog that participates in nuclear and mitochondrial BER.

  16. Boosting functionality of synthetic DNA circuits with tailored deactivation.

    Science.gov (United States)

    Montagne, Kevin; Gines, Guillaume; Fujii, Teruo; Rondelez, Yannick

    2016-11-15

    Molecular programming takes advantage of synthetic nucleic acid biochemistry to assemble networks of reactions, in vitro, with the double goal of better understanding cellular regulation and providing information-processing capabilities to man-made chemical systems. The function of molecular circuits is deeply related to their topological structure, but dynamical features (rate laws) also play a critical role. Here we introduce a mechanism to tune the nonlinearities associated with individual nodes of a synthetic network. This mechanism is based on programming deactivation laws using dedicated saturable pathways. We demonstrate this approach through the conversion of a single-node homoeostatic network into a bistable and reversible switch. Furthermore, we prove its generality by adding new functions to the library of reported man-made molecular devices: a system with three addressable bits of memory, and the first DNA-encoded excitable circuit. Specific saturable deactivation pathways thus greatly enrich the functional capability of a given circuit topology.

  17. Functional demonstration of adaptive immunity in zebrafish using DNA vaccination

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    studies have documented existence of a classical innate immune response, there is mainly indirect evidence of functional adaptive immunity. To address this aspect, groups of zebrafish were vaccinated with DNA-vaccines against the rhabdoviruses VHSV, IHNV and SVCV. Seven weeks later, the fish were...... challenged with SVCV by immersion. Despite some variability between replicate aquaria, there was a protective effect of the homologous vaccine and no effect of the heterologous vaccines. The results therefore confirm the existence of not only a well developed but also a fully functional adaptive immune......Due to the well characterized genome, overall highly synteny with the human genome and its suitability for functional genomics studies, the zebrafish is considered to be an ideal animal model for basic studies of mechanisms of diseases and immunity in vertebrates including humans. While several...

  18. Novel tools for the functional expression of metagenomic DNA.

    Science.gov (United States)

    Troeschel, Sonja Christina; Drepper, Thomas; Leggewie, Christian; Streit, Wolfgang R; Jaeger, Karl-Erich

    2010-01-01

    The functional expression of environmental genes in a particular host bacterium is hampered by various limitations including inefficient transcription of target genes as well as improper assembly of the corresponding enzymes. Therefore, the identification of novel enzymes from metagenomic libraries by activity-based screening requires efficient expression and screening systems. In the following chapter, we present two novel tools to improve the functional expression of metagenomic genes. (1) Comparative screenings of metagenomic libraries demonstrated that different enzymes were detected when phylogenetically distinct expression host strains were used. Thus, we have developed a strategy, which comprises library construction using a shuttle vector that allows comparative expression and screening of metagenomic DNA in Escherichia coli, Pseudomonas putida, and Bacillus subtilis. (2) Expression studies have revealed that functional expression of environmental genes in heterologous expression hosts is often limited by insufficient promoter recognition. Therefore, a method is described allowing to enhance the expression capacity of E. coli by using the transposon MuExpress. This recombinant transposon is able to insert randomly into environmental DNA fragments thereby facilitating gene expression from its two inducible promoters.

  19. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Akari, E-mail: akari_yo@stu.musashino-u.ac.jp [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Kobayashi, Yume [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Tada, Shusuke [Department of Medical Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi-shi, Chiba 274-8510 (Japan); Seki, Masayuki [Department of Biochemistry, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai-shi, Miyagi 981-8558 (Japan); Enomoto, Takemi [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan)

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  20. Distinguishing Functional DNA Words; A Method for Measuring Clustering Levels

    Science.gov (United States)

    Moghaddasi, Hanieh; Khalifeh, Khosrow; Darooneh, Amir Hossein

    2017-01-01

    Functional DNA sub-sequences and genome elements are spatially clustered through the genome just as keywords in literary texts. Therefore, some of the methods for ranking words in texts can also be used to compare different DNA sub-sequences. In analogy with the literary texts, here we claim that the distribution of distances between the successive sub-sequences (words) is q-exponential which is the distribution function in non-extensive statistical mechanics. Thus the q-parameter can be used as a measure of words clustering levels. Here, we analyzed the distribution of distances between consecutive occurrences of 16 possible dinucleotides in human chromosomes to obtain their corresponding q-parameters. We found that CG as a biologically important two-letter word concerning its methylation, has the highest clustering level. This finding shows the predicting ability of the method in biology. We also proposed that chromosome 18 with the largest value of q-parameter for promoters of genes is more sensitive to dietary and lifestyle. We extended our study to compare the genome of some selected organisms and concluded that the clustering level of CGs increases in higher evolutionary organisms compared to lower ones. PMID:28128320

  1. Distinguishing Functional DNA Words; A Method for Measuring Clustering Levels

    Science.gov (United States)

    Moghaddasi, Hanieh; Khalifeh, Khosrow; Darooneh, Amir Hossein

    2017-01-01

    Functional DNA sub-sequences and genome elements are spatially clustered through the genome just as keywords in literary texts. Therefore, some of the methods for ranking words in texts can also be used to compare different DNA sub-sequences. In analogy with the literary texts, here we claim that the distribution of distances between the successive sub-sequences (words) is q-exponential which is the distribution function in non-extensive statistical mechanics. Thus the q-parameter can be used as a measure of words clustering levels. Here, we analyzed the distribution of distances between consecutive occurrences of 16 possible dinucleotides in human chromosomes to obtain their corresponding q-parameters. We found that CG as a biologically important two-letter word concerning its methylation, has the highest clustering level. This finding shows the predicting ability of the method in biology. We also proposed that chromosome 18 with the largest value of q-parameter for promoters of genes is more sensitive to dietary and lifestyle. We extended our study to compare the genome of some selected organisms and concluded that the clustering level of CGs increases in higher evolutionary organisms compared to lower ones.

  2. What cost mitochondria? The maintenance of functional mitochondrial DNA within and across generations.

    Science.gov (United States)

    Aanen, Duur K; Spelbrink, Johannes N; Beekman, Madeleine

    2014-07-05

    The peculiar biology of mitochondrial DNA (mtDNA) potentially has detrimental consequences for organismal health and lifespan. Typically, eukaryotic cells contain multiple mitochondria, each with multiple mtDNA genomes. The high copy number of mtDNA implies that selection on mtDNA functionality is relaxed. Furthermore, because mtDNA replication is not strictly regulated, within-cell selection may favour mtDNA variants with a replication advantage, but a deleterious effect on cell fitness. The opportunities for selfish mtDNA mutations to spread are restricted by various organism-level adaptations, such as uniparental transmission, germline mtDNA bottlenecks, germline selection and, during somatic growth, regular alternation between fusion and fission of mitochondria. These mechanisms are all hypothesized to maintain functional mtDNA. However, the strength of selection for maintenance of functional mtDNA progressively declines with age, resulting in age-related diseases. Furthermore, organismal adaptations that most probably evolved to restrict the opportunities for selfish mtDNA create secondary problems. Owing to predominantly maternal mtDNA transmission, recombination among mtDNA from different individuals is highly restricted or absent, reducing the scope for repair. Moreover, maternal inheritance precludes selection against mtDNA variants with male-specific effects. We finish by discussing the consequences of life-history differences among taxa with respect to mtDNA evolution and make a case for the use of microorganisms to experimentally manipulate levels of selection.

  3. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response.

    Science.gov (United States)

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH(-/-)) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  4. New Insights into DNA Polymerase Function Revealed by Phosphonoacetic Acid-Sensitive T4 DNA Polymerases.

    Science.gov (United States)

    Zhang, Likui

    2017-09-15

    The bacteriophage T4 DNA polymerase (pol) and the closely related RB69 DNA pol have been developed into model enzymes to study family B DNA pols. While all family B DNA pols have similar structures and share conserved protein motifs, the molecular mechanism underlying natural drug resistance of nonherpes family B DNA pols and drug sensitivity of herpes DNA pols remains unknown. In the present study, we constructed T4 phages containing G466S, Y460F, G466S/Y460F, P469S, and V475W mutations in DNA pol. These amino acid substitutions replace the residues in drug-resistant T4 DNA pol with residues found in drug-sensitive herpes family DNA pols. We investigated whether the T4 phages expressing the engineered mutant DNA pols were sensitive to the antiviral drug phosphonoacetic acid (PAA) and characterized the in vivo replication fidelity of the phage DNA pols. We found that G466S substitution marginally increased PAA sensitivity, whereas Y460F substitution conferred resistance. The phage expressing a double mutant G466S/Y460F DNA pol was more PAA-sensitive. V475W T4 DNA pol was highly sensitive to PAA, as was the case with V478W RB69 DNA pol. However, DNA replication was severely compromised, which resulted in the selection of phages expressing more robust DNA pols that have strong ability to replicate DNA and contain additional amino acid substitutions that suppress PAA sensitivity. Reduced replication fidelity was observed in all mutant phages expressing PAA-sensitive DNA pols. These observations indicate that PAA sensitivity and fidelity are balanced in DNA pols that can replicate DNA in different environments.

  5. Dynamical model for biological functions of DNA molecules

    Institute of Scientific and Technical Information of China (English)

    PANGXiao-fengI; YANGYao

    2004-01-01

    We proposed a dynamic model of DNA to study its nonlinear excitation and duplication and transcription in the basis of molecular structure and changes of conformation of DNA under influence of bioenergy.

  6. High-Density Noncovalent Functionalization of DNA by Electrostatic Interactions

    NARCIS (Netherlands)

    Chen, Wei; Gerasimov, Jennifer Y; Zhao, Pei; Liu, Kai; Herrmann, Andreas

    2015-01-01

    Preserving DNA hybridization in organic solvents could someday serve to significantly extend the applicability of DNA-based technologies. Here, we present a method that can be used to solubilize double-stranded DNA at high concentrations in organic media. This method requires first precipitating a

  7. Molecular architecture and function of adenovirus DNA polymerase

    NARCIS (Netherlands)

    Brenkman, A.B. (Arjan Bernard)

    2003-01-01

    Central to this thesis is the role of adenovirus DNA polymerase (Ad pol) in adenovirus DNA replication. Ad pol is a member of the family B DNA polymerases but belongs to a distinct subclass of polymerases that use a protein as primer. As Ad pol catalyses both the initiation and elongation phases and

  8. Near-atomic structural model for bacterial DNA replication initiation complex and its functional insights.

    Science.gov (United States)

    Shimizu, Masahiro; Noguchi, Yasunori; Sakiyama, Yukari; Kawakami, Hironori; Katayama, Tsutomu; Takada, Shoji

    2016-12-13

    Upon DNA replication initiation in Escherichia coli, the initiator protein DnaA forms higher-order complexes with the chromosomal origin oriC and a DNA-bending protein IHF. Although tertiary structures of DnaA and IHF have previously been elucidated, dynamic structures of oriC-DnaA-IHF complexes remain unknown. Here, combining computer simulations with biochemical assays, we obtained models at almost-atomic resolution for the central part of the oriC-DnaA-IHF complex. This complex can be divided into three subcomplexes; the left and right subcomplexes include pentameric DnaA bound in a head-to-tail manner and the middle subcomplex contains only a single DnaA. In the left and right subcomplexes, DnaA ATPases associated with various cellular activities (AAA+) domain III formed helices with specific structural differences in interdomain orientations, provoking a bend in the bound DNA. In the left subcomplex a continuous DnaA chain exists, including insertion of IHF into the DNA looping, consistent with the DNA unwinding function of the complex. The intervening spaces in those subcomplexes are crucial for DNA unwinding and loading of DnaB helicases. Taken together, this model provides a reasonable near-atomic level structural solution of the initiation complex, including the dynamic conformations and spatial arrangements of DnaA subcomplexes.

  9. The electrokinetic characterization of gold nanoparticles, functionalized with cationic functional groups, and its' interaction with DNA.

    Science.gov (United States)

    Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli

    2014-09-01

    Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery.

  10. Functional cooperation of the dnaE and dnaN gene products in Escherichia coli.

    OpenAIRE

    Kuwabara, N; Uchida, H.

    1981-01-01

    A system was designed to isolate second-site intergenic suppressors of a thermosensitive mutation of the dnaE gene of Escherichia coli. The dnaE gene codes for the alpha subunit of DNA polymerase III [McHenry, C. S. & Crow, W. (1979) J. Biol. Chem. 254, 1748-1753]. One such suppressor, named sueA77, was finely mapped and found to be located at 82 min on the E. coli chromosome, between dnaA and recF, and within the dnaN gene [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553]....

  11. Functional cooperation of the dnaE and dnaN gene products in Escherichia coli.

    Science.gov (United States)

    Kuwabara, N; Uchida, H

    1981-09-01

    A system was designed to isolate second-site intergenic suppressors of a thermosensitive mutation of the dnaE gene of Escherichia coli. The dnaE gene codes for the alpha subunit of DNA polymerase III [McHenry, C. S. & Crow, W. (1979) J. Biol. Chem. 254, 1748-1753]. One such suppressor, named sueA77, was finely mapped and found to be located at 82 min on the E. coli chromosome, between dnaA and recF, and within the dnaN gene [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553]. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme [Burgers, P. M. J., Kornberg, A. & Sakakibara, Y. (1981) Proc. Natl. Acad. Sci. USA 78, 5391-5395]. The sueA77 mutation was trans-dominant over its wild-type allele, and it suppressed different thermosensitive mutations of dnaE with different maximal permissive temperature. These properties were interpreted as providing genetic evidence for interaction of the dnaE and dnaN gene products in E. coli.

  12. Extrachromosomal recombination in vaccinia-infected cells requires a functional DNA polymerase participating at a level other than DNA replication.

    Science.gov (United States)

    Colinas, R J; Condit, R C; Paoletti, E

    1990-12-01

    Homologous recombination was measured in vaccinia-infected cells cotransfected with two plasmid recombination substrates. One plasmid contains a vaccinia protein lacZ coding region bearing a 1.1 kb 3' terminal deletion while the other plasmid contains a non-promoted lacZ coding region bearing a 1.1 kb 5' terminal deletion. Homologous recombination occurring between the 825 bp of lacZ common to both plasmids regenerates a functional lacZ gene from which B-galactosidase expression was measured. The entire 3 kb lacZ gene was used as a positive control. A panel of thermosensitive mutants was screened in cells either transfected with the positive control plasmid or cotransfected with the recombination substrates. A DNA - mutant, ts42, known to map to the viral DNA polymerase gene was found to be defective in recombination. Significantly, other DNA - mutants, ts17 or ts25, or other DNA polymerase mutants did not exhibit a defect in recombination similar to ts42. Inhibitors of viral DNA synthesis did not uniformly affect recombination. Cytosine arabinoside and aphidicolin inhibited B-galactosidase expression from the recombination substrates but not from the positive control plasmid, whereas hydroxyurea enhanced expression from both. Marker rescue with the cloned wildtype DNA polymerase gene repaired the defect in ts42. Southern and western analyses demonstrated that B-galactosidase activity was consistent with a recombined lacZ gene and unit size 116 kDa protein. Measurement of plasmid and viral DNA replication in cells infected with the different DNA - mutants indicated that recombination was independent of plasmid and viral DNA replication. Together these results suggest that the vaccinia DNA polymerase participates in homologous recombination at a level other than that of DNA replication.

  13. Functions and Malfunctions of Mammalian DNA-Cytosine Deaminases.

    Science.gov (United States)

    Siriwardena, Sachini U; Chen, Kang; Bhagwat, Ashok S

    2016-10-26

    The AID/APOBEC family enzymes convert cytosines in single-stranded DNA to uracils, causing base substitutions and strand breaks. They are induced by cytokines produced during the body's inflammatory response to infections, and they help combat infections through diverse mechanisms. AID is essential for the maturation of antibodies and causes mutations and deletions in antibody genes through somatic hypermutation (SHM) and class-switch recombination (CSR) processes. One member of the APOBEC family, APOBEC1, edits mRNA for a protein involved in lipid transport. Members of the APOBEC3 subfamily in humans (APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, and APOBEC3H) inhibit infections of viruses such as HIV-1, HBV, and HCV, and retrotransposition of endogenous retroelements through mutagenic and nonmutagenic mechanisms. There is emerging consensus that these enzymes can cause mutations in the cellular genome at replication forks or within transcription bubbles depending on the physiological state of the cell and the phase of the cell cycle during which they are expressed. We describe here the state of knowledge about the structures of these enzymes, regulation of their expression, and both the advantageous and deleterious consequences of their expression, including carcinogenesis. We highlight similarities among them and present a holistic view of their regulation and function.

  14. Utilization of DNA as functional materials: preparation of filters containing DNA insolubilized with alginic acid gel.

    Science.gov (United States)

    Iwata, K; Sawadaishi, T; Nishimura, S I; Tokura, S; Nishi, N

    1996-02-01

    Thin films composed of DNA and alginic acid were prepared by casting their mixed solution on glass plate followed by coagulation with aqueous solution of calcium chloride. DNA could be conveniently insolubilized by this method. DNA in the films adsorbed intercalating materials, such as ethidium bromide. This phenomenon was successfully applied to the preparation of filters for the selective removal or accumulation of harmful intercalating pollutants.

  15. Sequential strand displacement beacon for detection of DNA coverage on functionalized gold nanoparticles.

    Science.gov (United States)

    Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris

    2014-06-17

    Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.

  16. Nucleic acid chemistry in the organic phase: from functionalized oligonucleotides to DNA side chain polymers.

    Science.gov (United States)

    Liu, Kai; Zheng, Lifei; Liu, Qing; de Vries, Jan Willem; Gerasimov, Jennifer Y; Herrmann, Andreas

    2014-10-08

    DNA-incorporating hydrophobic moieties can be synthesized by either solid-phase or solution-phase coupling. On a solid support the DNA is protected, and hydrophobic units are usually attached employing phosphoramidite chemistry involving a DNA synthesizer. On the other hand, solution coupling in aqueous medium results in low yields due to the solvent incompatibility of DNA and hydrophobic compounds. Hence, the development of a general coupling method for producing amphiphilic DNA conjugates with high yield in solution remains a major challenge. Here, we report an organic-phase coupling strategy for nucleic acid modification and polymerization by introducing a hydrophobic DNA-surfactant complex as a reactive scaffold. A remarkable range of amphiphile-DNA structures (DNA-pyrene, DNA-triphenylphosphine, DNA-hydrocarbon, and DNA block copolymers) and a series of new brush-type DNA side-chain homopolymers with high DNA grafting density are produced efficiently. We believe that this method is an important breakthrough in developing a generalized approach to synthesizing functional DNA molecules for self-assembly and related technological applications.

  17. Preparation of fosmid libraries and functional metagenomic analysis of microbial community DNA.

    Science.gov (United States)

    Martínez, Asunción; Osburne, Marcia S

    2013-01-01

    One of the most important challenges in contemporary microbial ecology is to assign a functional role to the large number of novel genes discovered through large-scale sequencing of natural microbial communities that lack similarity to genes of known function. Functional screening of metagenomic libraries, that is, screening environmental DNA clones for the ability to confer an activity of interest to a heterologous bacterial host, is a promising approach for bridging the gap between metagenomic DNA sequencing and functional characterization. Here, we describe methods for isolating environmental DNA and constructing metagenomic fosmid libraries, as well as methods for designing and implementing successful functional screens of such libraries.

  18. Functions and Dynamics of DNA Repair Proteins in Mitosis and Meiosis

    NARCIS (Netherlands)

    E.J. Uringa

    2005-01-01

    textabstractMy PhD project encompassed studies on the functions of several different proteins, all involved in DNA repair, in somatic and germ-line cells. Hr6b and Rad18Sc are involved in a DNA repair mechanism called ‘Replicative Damage Bypass’ (RDB), and function as ubiquitin conjugating enzym

  19. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders;

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  20. A baculovirus photolyase with DNA repair activity and circadian clock regulatory function

    NARCIS (Netherlands)

    Biernat, M.A.; Eker, A.P.M.; Oers, van M.M.; Vlak, J.M.; Horst, van der G.T.J.; Chaves, I.

    2012-01-01

    Cryptochromes and photolyases belong to the same family of flavoproteins but, despite being structurally conserved, display distinct functions. Photolyases use visible light to repair ultraviolet-induced DNA damage. Cryptochromes, however, function as blue-light receptors, circadian photoreceptors,

  1. Conformation of nanoconfined DNA as a function of ATP, AMP, CTP, Mg2+, and dye binding

    Science.gov (United States)

    Roushan, Maedeh; Riehn, Robert

    2014-03-01

    DNA molecules stretch in nanochannels with a channel cross-section of 100x100 nm2, thereby allowing analysis by observation of a fluorescent dye. The length and configuration of DNA can be directly observed, and the effect of different DNA-binding proteins on DNA configuration can be studied. Recently, we reported on the ability of T4 ligase to transiently manipulate DNA as a function of ATP and magnesium exposure. In this process we have extensively probed the interactions of dyes and enzyme co-factors with DNA under nanoconfinement. We find negligible effects if DNA is visualized using groove-binding dyes such as DAPI. However, if an intercalating dye (YOYO-1) is used, we find a significant shortening of the DNA in the presence of ATP that we attribute to an interaction of dye and ATP (as well as AMP and CTP). We did not record a noticeable effect due to Mg2+.

  2. Optical tweezers studies of viral DNA packaging: Motor function and DNA confinement in Bacteriophages phi29, lambda, and T4

    Science.gov (United States)

    Smith, Douglas

    2007-03-01

    In the assembly of many viruses a powerful molecular motor translocates the genome into a pre-assembled capsid. We use optical tweezers to directly measure translocation of a single DNA molecule into the viral capsid. Improved techniques allow us to measure initiation and early stages of packaging. With phi29 the DNA terminal protein was found to cause large variations in the starting point of packaging. Removal of this protein results in terminal initiation, permitting more accurate assessment of motor function and DNA confinement forces. We investigated the role of electrostatic repulsion by varying ionic screening of the DNA. The observed trends are in accord with those theoretically expected considering counter-ion competition; however the forces are larger than expected in comparison with recent theories and DNA ejection measurements. We have recently succeeded in extending our methods to study two other phages: lambda and T4. These systems have unique structural and functional features, presenting an opportunity for comparative studies in this family of molecular motors. Initial measurements show that lambda and T4 translocate DNA several times faster than the phi29 motor, but are more sensitive to applied load.

  3. DNA structure, binding mechanism and biology functions of polypyridyl complexes in biomedicine

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    There is considerable research interest and vigorous debate about the DNA binding of polypyridyl complexes including the electron transfer involving DNA. In this review, based on the fluorescence quenching experiments, it was proposed that DNA might serve as a conductor. From the time-interval CD spectra, the different binding rates of D- and L-enantiomer to calf thymus DNA were observed. The factors influencing the DNA-binding of polypyridyl complexes, and the potential bio-functions of the complexes are also discussed.

  4. Left-handed Z-DNA: structure and function

    Science.gov (United States)

    Herbert, A.; Rich, A.

    1999-01-01

    Z-DNA is a high energy conformer of B-DNA that forms in vivo during transcription as a result of torsional strain generated by a moving polymerase. An understanding of the biological role of Z-DNA has advanced with the discovery that the RNA editing enzyme double-stranded RNA adenosine deaminase type I (ADAR1) has motifs specific for the Z-DNA conformation. Editing by ADAR1 requires a double-stranded RNA substrate. In the cases known, the substrate is formed by folding an intron back onto the exon that is targeted for modification. The use of introns to direct processing of exons requires that editing occurs before splicing. Recognition of Z-DNA by ADAR1 may allow editing of nascent transcripts to be initiated immediately after transcription, ensuring that editing and splicing are performed in the correct sequence. Structural characterization of the Z-DNA binding domain indicates that it belongs to the winged helix-turn-helix class of proteins and is similar to the globular domain of histone-H5.

  5. Functional amyloids as inhibitors of plasmid DNA replication

    Science.gov (United States)

    Molina-García, Laura; Gasset-Rosa, Fátima; Moreno-del Álamo, María; Fernández-Tresguerres, M. Elena; Moreno-Díaz de la Espina, Susana; Lurz, Rudi; Giraldo, Rafael

    2016-01-01

    DNA replication is tightly regulated to constrain the genetic material within strict spatiotemporal boundaries and copy numbers. Bacterial plasmids are autonomously replicating DNA molecules of much clinical, environmental and biotechnological interest. A mechanism used by plasmids to prevent over-replication is ‘handcuffing’, i.e. inactivating the replication origins in two DNA molecules by holding them together through a bridge built by a plasmid-encoded initiator protein (Rep). Besides being involved in handcuffing, the WH1 domain in the RepA protein assembles as amyloid fibres upon binding to DNA in vitro. The amyloid state in proteins is linked to specific human diseases, but determines selectable and epigenetically transmissible phenotypes in microorganisms. Here we have explored the connection between handcuffing and amyloidogenesis of full-length RepA. Using a monoclonal antibody specific for an amyloidogenic conformation of RepA-WH1, we have found that the handcuffed RepA assemblies, either reconstructed in vitro or in plasmids clustering at the bacterial nucleoid, are amyloidogenic. The replication-inhibitory RepA handcuff assembly is, to our knowledge, the first protein amyloid directly dealing with DNA. Built on an amyloid scaffold, bacterial plasmid handcuffs can bring a novel molecular solution to the universal problem of keeping control on DNA replication initiation. PMID:27147472

  6. Glom Is a Novel Mitochondrial DNA Packaging Protein in Physarum polycephalum and Causes Intense Chromatin Condensation without Suppressing DNA Functions

    Science.gov (United States)

    Sasaki, Narie; Kuroiwa, Haruko; Nishitani, Chikako; Takano, Hiroyoshi; Higashiyama, Tetsuya; Kobayashi, Tamaki; Shirai, Yuki; Sakai, Atsushi; Kawano, Shigeyuki; Murakami-Murofushi, Kimiko; Kuroiwa, Tsuneyoshi

    2003-01-01

    Mitochondrial DNA (mtDNA) is packed into highly organized structures called mitochondrial nucleoids (mt-nucleoids). To understand the organization of mtDNA and the overall regulation of its genetic activity within the mt-nucleoids, we identified and characterized a novel mtDNA packaging protein, termed Glom (a protein inducing agglomeration of mitochondrial chromosome), from highly condensed mt-nucleoids of the true slime mold, Physarum polycephalum. This protein could bind to the entire mtDNA and package mtDNA into a highly condensed state in vitro. Immunostaining analysis showed that Glom specifically localized throughout the mt-nucleoid. Deduced amino acid sequence revealed that Glom has a lysine-rich region with proline-rich domain in the N-terminal half and two HMG boxes in C-terminal half. Deletion analysis of Glom revealed that the lysine-rich region was sufficient for the intense mtDNA condensation in vitro. When the recombinant Glom proteins containing the lysine-rich region were expressed in Escherichia coli, the condensed nucleoid structures were observed in E. coli. Such in vivo condensation did not interfere with transcription or replication of E. coli chromosome and the proline-rich domain was essential to keep those genetic activities. The expression of Glom also complemented the E. coli mutant lacking the bacterial histone-like protein HU and the HMG-boxes region of Glom was important for the complementation. Our results suggest that Glom is a new mitochondrial histone-like protein having a property to cause intense DNA condensation without suppressing DNA functions. PMID:12960433

  7. Evaluation of Fluorescent Analogs of Deoxycytidine for Monitoring DNA Transitions from Duplex to Functional Structures

    Directory of Open Access Journals (Sweden)

    Yogini P. Bhavsar

    2011-01-01

    Full Text Available Topological variants of single-strand DNA (ssDNA structures, referred to as “functional DNA,” have been detected in regulatory regions of many genes and are thought to affect gene expression. Two fluorescent analogs of deoxycytidine, Pyrrolo-dC (PdC and 1,3-diaza-2-oxophenoxazine (tC∘, can be incorporated into DNA. Here, we describe spectroscopic studies of both analogs to determine fluorescent properties that report on structural transitions from double-strand DNA (dsDNA to ssDNA, a common pathway in the transition to functional DNA structures. We obtained fluorescence-detected circular dichroism (FDCD spectra, steady-state fluorescence spectra, and fluorescence lifetimes of the fluorophores in DNA. Our results show that PdC is advantageous in fluorescence lifetime studies because of a distinct ~2 ns change between paired and unpaired bases. However, tC∘ is a better probe for FDCD experiments that report on the helical structure of DNA surrounding the fluorophore. Both fluorophores provide complementary data to measure DNA structural transitions.

  8. Viral and cellular SOS-regulated motor proteins: dsDNA translocation mechanisms with divergent functions.

    Science.gov (United States)

    Wolfe, Annie; Phipps, Kara; Weitao, Tao

    2014-01-01

    DNA damage attacks on bacterial cells have been known to activate the SOS response, a transcriptional response affecting chromosome replication, DNA recombination and repair, cell division and prophage induction. All these functions require double-stranded (ds) DNA translocation by ASCE hexameric motors. This review seeks to delineate the structural and functional characteristics of the SOS response and the SOS-regulated DNA translocases FtsK and RuvB with the phi29 bacteriophage packaging motor gp16 ATPase as a prototype to study bacterial motors. While gp16 ATPase, cellular FtsK and RuvB are similarly comprised of hexameric rings encircling dsDNA and functioning as ATP-driven DNA translocases, they utilize different mechanisms to accomplish separate functions, suggesting a convergent evolution of these motors. The gp16 ATPase and FtsK use a novel revolution mechanism, generating a power stroke between subunits through an entropy-DNA affinity switch and pushing dsDNA inward without rotation of DNA and the motor, whereas RuvB seems to employ a rotation mechanism that remains to be further characterized. While FtsK and RuvB perform essential tasks during the SOS response, their roles may be far more significant as SOS response is involved in antibiotic-inducible bacterial vesiculation and biofilm formation as well as the perspective of the bacteria-cancer evolutionary interaction.

  9. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-07-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  10. DNA-carbon dots function as fluorescent vehicles for drug delivery.

    Science.gov (United States)

    Ding, Han; Du, Feiyue; Liu, Pengchang; Chen, Zhijun; Shen, Jiacong

    2015-04-01

    Carbon dots (CDs) are a new representative in the carbon-based material family, attracting tremendous interest in a large variety of fields, including biomedicine. In this report, we described a facile and green system for synthesizing DNA-CDs using genomic DNA isolated from Escherichia coli. DNA-CDs can be purified using a simple column centrifugation-based system. During DNA-CD synthesis, ribose was collapsed, accompanied by the release of nitrogen, and several new bonds (C-OH, N-O, and N-P) were formed, while the other covalent bonds of DNA were largely maintained. The presence of abundant chemical groups, such as amino or hydroxyl groups on DNA-CDs, may facilitate their future functionalization. These highly biocompatible DNA-CDs can serve as a new type of fluorescent vehicle for cell imaging and drug delivery studies. Our research may hasten the development of CDs for prominent future biomedical applications.

  11. Non-redundant Functions of ATM and DNA-PKcs in Response to DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Pierre Caron

    2015-11-01

    Full Text Available DNA double-strand breaks (DSBs elicit the so-called DNA damage response (DDR, largely relying on ataxia telangiectasia mutated (ATM and DNA-dependent protein kinase (DNA-PKcs, two members of the PI3K-like kinase family, whose respective functions during the sequential steps of the DDR remains controversial. Using the DIvA system (DSB inducible via AsiSI combined with high-resolution mapping and advanced microscopy, we uncovered that both ATM and DNA-PKcs spread in cis on a confined region surrounding DSBs, independently of the pathway used for repair. However, once recruited, these kinases exhibit non-overlapping functions on end joining and γH2AX domain establishment. More specifically, we found that ATM is required to ensure the association of multiple DSBs within “repair foci.” Our results suggest that ATM acts not only on chromatin marks but also on higher-order chromatin organization to ensure repair accuracy and survival.

  12. Structural and Functional Regulation of DNA: Geometry, Topology and Methylation

    Science.gov (United States)

    Auclair, C.

    The work of Rosalind Franklin, then Watson and Crick [1], established the architecture of deoxyribose nucleic acid (DNA), carrier of all genetic information. The idea that DNA was structurally organised in the form of a double helix comprising two antiparallel and complementary polymer chains was one of the great scientific discoveries of the twentieth century. It revealed not only the way in which genetic information is stored, but also the mechanism by which the genetic code is read, and the way this code can be faultlessly copied from one cell to another during cell division.

  13. Reverse gyrase functions in genome integrity maintenance by protecting DNA breaks in vivo

    DEFF Research Database (Denmark)

    Han, Wenyuan; Feng, Xu; She, Qunxin

    2017-01-01

    Reverse gyrase introduces positive supercoils to circular DNA and is implicated in genome stability maintenance in thermophiles. The extremely thermophilic crenarchaeon Sulfolobus encodes two reverse gyrase proteins, TopR1 (topoisomerase reverse gyrase 1) and TopR2, whose functions in thermophili...... genomic DNA degradation during MMS treatment, accompanied by a higher rate of cell death. Taken together, these results indicate that TopR1 probably facilitates genome integrity maintenance by protecting DNA breaks from thermo-degradation in vivo....

  14. Benchmark investigation of diamondoid-functionalized electrodes for nanopore DNA sequencing

    Science.gov (United States)

    Sivaraman, Ganesh; Amorim, Rodrigo G.; Scheicher, Ralph H.; Fyta, Maria

    2016-10-01

    Small diamond-like particles, diamondoids, have been shown to effectively functionalize gold electrodes in order to sense DNA units passing between the nanopore-embedded electrodes. In this work, we present a comparative study of Au(111) electrodes functionalized with different derivatives of lower diamondoids. Focus is put on the electronic and transport properties of such electrodes for different DNA nucleotides placed within the electrode gap. The functionalization promotes a specific binding to DNA leading to different properties for the system, which provides a tool set to systematically improve the signal-to-noise ratio of the electronic measurements across the electrodes. Using quantum transport calculations, we compare the effectiveness of the different functionalized electrodes in distinguishing the four DNA nucleotides. Our results point to the most effective diamondoid functionalization of gold electrodes in view of biosensing applications.

  15. Molecular and cellular functions of the FANCJ DNA helicase defective in cancer and in Fanconi Anemia

    Directory of Open Access Journals (Sweden)

    Robert M. Brosh

    2014-10-01

    Full Text Available The FANCJ DNA helicase is mutated in hereditary breast and ovarian cancer as well as the progressive bone marrow failure disorder Fanconi anemia (FA. FANCJ is linked to cancer suppression and DNA double strand break (DSB repair through its direct interaction with the hereditary breast cancer associated gene product, BRCA1. FANCJ also operates in the FA pathway of interstrand cross-link (ICL repair and contributes to homologous recombination (HR. FANCJ collaborates with a number of DNA metabolizing proteins implicated in DNA damage detection and repair, and plays an important role in cell cycle checkpoint control. In addition to its role in the classical FA pathway, FANCJ is believed to have other functions that are centered on alleviating replication stress. FANCJ resolves G-quadruplex (G4 DNA structures that are known to affect cellular replication and transcription, and potentially plays a role in the preservation and functionality of chromosomal structures such as telomeres. Recent studies suggest that FANCJ helps to maintain chromatin structure and preserve epigenetic stability by facilitating smooth progression of the replication fork when it encounters DNA damage or an alternate DNA structure such as a G4. Ongoing studies suggest a prominent but still not well-understood role of FANCJ in transcriptional regulation, chromosomal structure and function, and DNA damage repair to maintain genomic stability. This review will synthesize our current understanding of the molecular and cellular functions of FANCJ that are critical for chromosomal integrity.

  16. Therapeutic modulation of endogenous gene function by agents with designed DNA-sequence specificities

    NARCIS (Netherlands)

    Uil, T.G.; Haisma, H.J.; Rots, Marianne

    2003-01-01

    Designer molecules that can specifically target pre-determined DNA sequences provide a means to modulate endogenous gene function. Different classes of sequence-specific DNA-binding agents have been developed, including triplex-forming molecules, synthetic polyamides and designer zinc finger protein

  17. Functional DNA-containing nanomaterials: cellular applications in biosensing, imaging, and targeted therapy.

    Science.gov (United States)

    Liang, Hao; Zhang, Xiao-Bing; Lv, Yifan; Gong, Liang; Wang, Ruowen; Zhu, Xiaoyan; Yang, Ronghua; Tan, Weihong

    2014-06-17

    CONSPECTUS: DNA performs a vital function as a carrier of genetic code, but in the field of nanotechnology, DNA molecules can catalyze chemical reactions in the cell, that is, DNAzymes, or bind with target-specific ligands, that is, aptamers. These functional DNAs with different modifications have been developed for sensing, imaging, and therapeutic systems. Thus, functional DNAs hold great promise for future applications in nanotechnology and bioanalysis. However, these functional DNAs face challenges, especially in the field of biomedicine. For example, functional DNAs typically require the use of cationic transfection reagents to realize cellular uptake. Such reagents enter the cells, increasing the difficulty of performing bioassays in vivo and potentially damaging the cell's nucleus. To address this obstacle, nanomaterials, such as metallic, carbon, silica, or magnetic materials, have been utilized as DNA carriers or assistants. In this Account, we describe selected examples of functional DNA-containing nanomaterials and their applications from our recent research and those of others. As models, we have chosen to highlight DNA/nanomaterial complexes consisting of gold nanoparticles, graphene oxides, and aptamer-micelles, and we illustrate the potential of such complexes in biosensing, imaging, and medical diagnostics. Under proper conditions, multiple ligand-receptor interactions, decreased steric hindrance, and increased surface roughness can be achieved from a high density of DNA that is bound to the surface of nanomaterials, resulting in a higher affinity for complementary DNA and other targets. In addition, this high density of DNA causes a high local salt concentration and negative charge density, which can prevent DNA degradation. For example, DNAzymes assembled on gold nanoparticles can effectively catalyze chemical reactions even in living cells. And it has been confirmed that DNA-nanomaterial complexes can enter cells more easily than free single

  18. Genetic and Functional Studies of Genes That Regulate DNA-Damage-Induced Cell Death

    Science.gov (United States)

    2005-11-01

    library analysis indicated that the BRCT domains from BRCA1, MDC1, BARD1, and DNA Ligase IV preferred distinct phosphoserine-containing peptides. In...Heterodimerization between single BRCT domains (e.g. XRCC1 and DNA Ligase III) has been reported (9, 10). In addition, BRCT domains of 53BP1 can...pS-[DE]-[DE]-E. DNA Ligase IV functions to join single-strand breaks in double- stranded DNA (28, 29). It plays a major role in V(D)J recombina- tion

  19. Biological Sensors Using DNA Functionalized Multiwalled Carbon Nanotubes

    Science.gov (United States)

    2009-10-01

    out using potassium ferro cyanide as the redox electrolyte. Cyclic voltammetry gave well-defined quasi-reversible voltammetric responses, flat and...performance studies have been carried out using potassium ferro cyanide as the redox electrolyte and DNA-MWNT film electrode and results have been discussed...for the synthesis of MWNT in large quantities using Mischmetal (Bharat Rare Earths Metals, India; composition:- Ce 50%, La 35%, Pr 8 %, Nd 5%, Fe

  20. DNA damage-dependent regulation of MyoD function

    OpenAIRE

    Simonatto, Marta

    1980-01-01

    Durante la rigenerazione muscolare, le cellule progenitrici sono esposte ad una serie di stimoli extracellulari che coordinano la loro attivazione, proliferazione e differenziamento. Al tempo stesso, tuttavia, l’ambiente rigenerativo, stimolando la sintesi del DNA e aumentando lo stato di ossidazione intracellulare, costituisce una fonte di stress genotossico, come mostriamo in vivo in questo lavoro. Uno studio svolto in precedenza nel nostro laboratorio ha identificato e ca...

  1. Hepatitis viruses exploitation of host DNA methyltransferases functions.

    Science.gov (United States)

    Pazienza, Valerio; Panebianco, Concetta; Andriulli, Angelo

    2016-08-01

    Hepatitis B virus (HBV), hepatitis C virus (HCV) and Delta (HDV) infections are a global health burden. With different routes of infection and biology, HBV, HCV and HDV are capable to induce liver cirrhosis and cancer by impinging on epigenetic mechanisms altering host cell's pathways. In the present manuscript, we reviewed the published studies taking into account the relationship between the hepatitis viruses and the DNA methyltransferases proteins.

  2. DNA-Damage-Induced Type I Interferon Promotes Senescence and Inhibits Stem Cell Function

    Directory of Open Access Journals (Sweden)

    Qiujing Yu

    2015-05-01

    Full Text Available Expression of type I interferons (IFNs can be induced by DNA-damaging agents, but the mechanisms and significance of this regulation are not completely understood. We found that the transcription factor IRF3, activated in an ATM-IKKα/β-dependent manner, stimulates cell-autonomous IFN-β expression in response to double-stranded DNA breaks. Cells and tissues with accumulating DNA damage produce endogenous IFN-β and stimulate IFN signaling in vitro and in vivo. In turn, IFN acts to amplify DNA-damage responses, activate the p53 pathway, promote senescence, and inhibit stem cell function in response to telomere shortening. Inactivation of the IFN pathway abrogates the development of diverse progeric phenotypes and extends the lifespan of Terc knockout mice. These data identify DNA-damage-response-induced IFN signaling as a critical mechanism that links accumulating DNA damage with senescence and premature aging.

  3. Single-stranded DNA-binding proteins: multiple domains for multiple functions.

    Science.gov (United States)

    Dickey, Thayne H; Altschuler, Sarah E; Wuttke, Deborah S

    2013-07-01

    The recognition of single-stranded DNA (ssDNA) is integral to myriad cellular functions. In eukaryotes, ssDNA is present stably at the ends of chromosomes and at some promoter elements. Furthermore, it is formed transiently by several cellular processes including telomere synthesis, transcription, and DNA replication, recombination, and repair. To coordinate these diverse activities, a variety of proteins have evolved to bind ssDNA in a manner specific to their function. Here, we review the recognition of ssDNA through the analysis of high-resolution structures of proteins in complex with ssDNA. This functionally diverse set of proteins arises from a limited set of structural motifs that can be modified and arranged to achieve distinct activities, including a range of ligand specificities. We also investigate the ways in which these domains interact in the context of large multidomain proteins/complexes. These comparisons reveal the structural features that define the range of functions exhibited by these proteins.

  4. Function of ZFAND3 in the DNA Damage Response

    Science.gov (United States)

    2013-06-01

    by flow-cytometry. Figure 2. ZFAND3 silencing does not hypersensitize cells to HU. Sensitivity to HU was determined after depletion of ZFAND3 (using...proteins cause hypersensitivity to replication DDR Kinase-Dependent Regulation of DNA Repair Advanced Online Article. Cite this article as Cold Spring...heat inactivated fetal bovine serum (FBS), 50 U/ml penicillin , 50 mg/ml streptomycin, and 2 mM L-glutamine. Hut78 (Sézary Syndrome) cells (ATCC) were

  5. Non-DSB clustered DNA lesions induced by ionizing radiation are largely responsible for the loss of plasmid DNA functionality in the presence of cisplatin.

    Science.gov (United States)

    Kouass Sahbani, S; Rezaee, M; Cloutier, P; Sanche, L; Hunting, D J

    2014-06-25

    The combination of cisplatin and ionizing radiation (IR) increases cell toxicity by both enhancing DNA damage and inhibiting repair mechanisms. Although the formation of cluster DNA lesions, particularly double-strand breaks (DSB) at the site of cisplatin-DNA-adducts has been reported to induce cell death, the contribution of DSB and non-DSB cluster lesions to the cellular toxicity is still unknown. Although both lesions are toxic, it is not always possible to measure their frequency and cell survival in the same model system. To overcome this problem, here, we investigate the effect of cisplatin-adducts on the induction of DSB and non-DSB cluster DNA lesions by IR and determine the impact of such lesions on plasmid functionality. Cluster lesions are two or more lesions on opposite DNA strands with a short distance such that error free repair is difficult or impossible. At a ratio of two cisplatin per plasmid, irradiation of platinated DNA in solution with (137)Cs γ-rays shows enhancements in the formation of DNA DSB and non-DSB cluster lesions by factors of 2.6 and 2.1, respectively, compared to unmodified DNA. However, in absolute terms, the yield for non-DSB cluster lesions is far larger than that for DSB, by a factor of 26. Unmodified and cisplatin-modified DNA were irradiated and subsequently transformed into Escherichia coli to give survival curves representing the functionality of the plasmid DNA as a function of radiation dose. Our results demonstrate that non-DSB cluster lesions are the only toxic lesions present at a sufficient frequency to account for the loss of DNA functionality. Our data also show that Frank-DSB lesions are simply too infrequent to account for the loss of DNA functionality. In conclusion, non-DSB cluster DNA damage is known to be difficult to repair and is probably the lesion responsible for the loss of functionality of DNA modified by cisplatin.

  6. Epigenetic features in the oyster Crassostrea gigas suggestive of functionally relevant promoter DNA methylation in invertebrates.

    Directory of Open Access Journals (Sweden)

    Guillaume eRiviere

    2014-04-01

    Full Text Available DNA methylation is evolutionarily conserved. Vertebrates exhibit high, widespread DNA methylation whereas invertebrate genomes are less methylated, predominantly within gene bodies. DNA methylation in invertebrates is associated with transcription level, alternative splicing and genome evolution, but functional outcomes of DNA methylation remain poorly described in lophotrochozoans. Recent genome-wide approaches improve understanding in distant taxa such as molluscs, where the phylogenetic position and life traits of Crassostrea gigas make this bivalve an ideal model to study the physiological and evolutionary implications of DNA methylation. We review the literature about DNA methylation in invertebrates and focus on DNA methylation features in the oyster. Indeed, though our MeDIP-seq results confirm predominant intragenic methylation, the profiles depend on the oyster’s developmental and reproductive stage. We discuss the perspective that oyster DNA methylation could be biased toward the 5’-end of some genes, depending on physiological status, suggesting important functional outcomes of putative promoter methylation from cell differentiation during early development to sustained adaptation of the species to the environment.

  7. Construction of DNA damage response gene pprI function-deficient and function-complementary mutants in Deinococcus radiodurans

    Institute of Scientific and Technical Information of China (English)

    GAO Guanjun; LU Huiming; HUANG Lifen; HUA Yuejin

    2005-01-01

    PprI, a DNA damage response factor from the extraordinary radioresistant bacterium Deinococcus radiodurans, plays a central regulatory role in multiple DNA damage repair. In this study, a fusion DNA fragment carrying kanamycin resistance gene with the D. Radiodurans groEL promoter was cloned by PCR amplification and reversely inserted into the pprI locus in the genome of the wild-type strain R1. The resulting pprI-deficient strain, designated YR1, was very sensitive to ionizing radiation. Meanwhile, the re- combinant DNA fragment was cloned into the shuttle vector pRADZ3, and resulted in plasmid pRADK with kanamycin resistance in D. Radiodurans. The fragments containing complete pprI gene and 3'-terminal deletion pprI△ were cloned into plasmid pRADK. The resulted plasmids designated pRADKpprI and pRADKpprI△ were then transformed to YR1. Results show that YR1 carrying pRADKpprI was able to fully restore the extreme radioresistance to the same level as the wild-type D. Raiodurans R1, whereas YR1 pRADKpprI△ failed to do so. Construction of DNA repair switch PprI function-deficient and function-complementary mutants in D. Radiodurans is not only useful to elucidating the relationship between domains and functions of PprI protein, but also opens the door to the further studies of the biological functions of PprI protein in vivo.

  8. Extracellular DNA facilitates the formation of functional amyloids in Staphylococcus aureus biofilms.

    Science.gov (United States)

    Schwartz, Kelly; Ganesan, Mahesh; Payne, David E; Solomon, Michael J; Boles, Blaise R

    2016-01-01

    Persistent staphylococcal infections often involve surface-associated communities called biofilms. Staphylococcus aureus biofilm development is mediated by the co-ordinated production of the biofilm matrix, which can be composed of polysaccharides, extracellular DNA (eDNA) and proteins including amyloid fibers. The nature of the interactions between matrix components, and how these interactions contribute to the formation of matrix, remain unclear. Here we show that the presence of eDNA in S. aureus biofilms promotes the formation of amyloid fibers. Conditions or mutants that do not generate eDNA result in lack of amyloids during biofilm growth despite the amyloidogeneic subunits, phenol soluble modulin peptides, being produced. In vitro studies revealed that the presence of DNA promotes amyloid formation by PSM peptides. Thus, this work exposes a previously unacknowledged interaction between biofilm matrix components that furthers our understanding of functional amyloid formation and S. aureus biofilm biology.

  9. Genetic analysis of yeast RPA1 reveals its multiple functions in DNA metabolism.

    Science.gov (United States)

    Umezu, K; Sugawara, N; Chen, C; Haber, J E; Kolodner, R D

    1998-03-01

    Replication protein A (RPA) is a single-stranded DNA-binding protein identified as an essential factor for SV40 DNA replication in vitro. To understand the in vivo functions of RPA, we mutagenized the Saccharomyces cerevisiae RFA1 gene and identified 19 ultraviolet light (UV) irradiation- and methyl methane sulfonate (MMS)-sensitive mutants and 5 temperature-sensitive mutants. The UV- and MMS-sensitive mutants showed up to 10(4) to 10(5) times increased sensitivity to these agents. Some of the UV- and MMS-sensitive mutants were killed by an HO-induced double-strand break at MAT. Physical analysis of recombination in one UV- and MMS-sensitive rfa1 mutant demonstrated that it was defective for mating type switching and single-strand annealing recombination. Two temperature-sensitive mutants were characterized in detail, and at the restrictive temperature were found to have an arrest phenotype and DNA content indicative of incomplete DNA replication. DNA sequence analysis indicated that most of the mutations altered amino acids that were conserved between yeast, human, and Xenopus RPA1. Taken together, we conclude that RPA1 has multiple roles in vivo and functions in DNA replication, repair, and recombination, like the single-stranded DNA-binding proteins of bacteria and phages.

  10. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  11. DNA biosensors implemented on PNA-functionalized microstructured optical fibers Bragg gratings

    Science.gov (United States)

    Candiani, A.; Giannetti, S.; Cucinotta, A.; Bertucci, A.; Manicardi, A.; Konstantaki, M.; Margulis, W.; Pissadakis, S.; Corradini, R.; Selleri, S.

    2013-05-01

    A novel DNA sensing platform based on a Peptide Nucleic Acid - functionalized Microstructured Optical Fibers gratings has been demonstrated. The inner surface of different MOFs has been functionalized using PNA probes, OligoNucleotides mimic that are well suited for specific DNA target sequences detection. The hybrid sensing systems were tested for optical DNA detection of targets of relevance in biomedical application, using the cystic fibrosis gene mutation, and food-analysis, using the genomic DNA from genetic modified organism soy flour. After the solutions of DNA molecules has been infiltrated inside the fibers capillaries and hybridization has occurred, oligonucleotidefunctionalized gold nanoparticles were infiltrated and used to form a sandwich-like system to achieve signal amplification. Spectral measurements of the reflected signal reveal a clear wavelength shift of the reflected modes when the infiltrated complementary DNA matches with the PNA probes placed on the inner fiber surface. Measurements have also been made using the mismatched DNA solution for the c, containing a single nucleotide polymorphism, showing no significant changes in the reflected spectrum. Several experiments have been carried out demonstrating the reproducibility of the results and the high selectivity of the sensors, showing the simplicity and the potential of this approach.

  12. Tcf4 Regulates Synaptic Plasticity, DNA Methylation, and Memory Function

    Directory of Open Access Journals (Sweden)

    Andrew J. Kennedy

    2016-09-01

    Full Text Available Human haploinsufficiency of the transcription factor Tcf4 leads to a rare autism spectrum disorder called Pitt-Hopkins syndrome (PTHS, which is associated with severe language impairment and development delay. Here, we demonstrate that Tcf4 haploinsufficient mice have deficits in social interaction, ultrasonic vocalization, prepulse inhibition, and spatial and associative learning and memory. Despite learning deficits, Tcf4(+/− mice have enhanced long-term potentiation in the CA1 area of the hippocampus. In translationally oriented studies, we found that small-molecule HDAC inhibitors normalized hippocampal LTP and memory recall. A comprehensive set of next-generation sequencing experiments of hippocampal mRNA and methylated DNA isolated from Tcf4-deficient and WT mice before or shortly after experiential learning, with or without administration of vorinostat, identified “memory-associated” genes modulated by HDAC inhibition and dysregulated by Tcf4 haploinsufficiency. Finally, we observed that Hdac2 isoform-selective knockdown was sufficient to rescue memory deficits in Tcf4(+/− mice.

  13. RAD50 and NBS1 form a stable complex functional in DNA binding and tethering.

    Science.gov (United States)

    van der Linden, Eddy; Sanchez, Humberto; Kinoshita, Eri; Kanaar, Roland; Wyman, Claire

    2009-04-01

    The RAD50/MRE11/NBS1 protein complex (RMN) plays an essential role during the early steps of DNA double-strand break (DSB) repair by homologous recombination. Previous data suggest that one important role for RMN in DSB repair is to provide a link between DNA ends. The striking architecture of the complex, a globular domain from which two extended coiled coils protrude, is essential for this function. Due to its DNA-binding activity, ability to form dimers and interact with both RAD50 and NBS1, MRE11 is considered to be crucial for formation and function of RMN. Here, we show the successful expression and purification of a stable complex containing only RAD50 and NBS1 (RN). The characteristic architecture of the complex was not affected by absence of MRE11. Although MRE11 is a DNA-binding protein it was not required for DNA binding per se or DNA-tethering activity of the complex. The stoichiometry of NBS1 in RMN and RN complexes was estimated by SFM-based volume analysis. These data show that in vitro, R, M and N form a variety of stable complexes with variable subunit composition and stoichiometry, which may be physiologically relevant in different aspects of RMN function.

  14. DNA methylation and cognitive functioning in healthy older adults

    NARCIS (Netherlands)

    Schiepers, O.J.G.; Boxtel, van M.P.J.; Groot, R.H.M.; Jolles, J.; Kok, F.J.; Verhoef, P.; Durga, J.

    2012-01-01

    Long-term supplementation with folic acid may improve cognitive performance in older individuals. The relationship between folate status and cognitive performance might be mediated by changes in methylation capacity, as methylation reactions are important for normal functioning of the brain. Althoug

  15. How to Relate Complex DNA Repair Genotypes to Pathway Function and, Ultimately, Health Risk

    Energy Technology Data Exchange (ETDEWEB)

    Jones, IM

    2002-01-09

    Exposure to ionizing radiation increases the incidence of cancer. However, predicting which individuals are at most risk from radiation exposure is a distant goal. Predictive ability is needed to guide policies that regulate radiation exposure and ensure that medical treatments have maximum benefit and minimum risk. Differences between people in susceptibility to radiation are largely based on their genotype, the genes inherited from their parents. Among the important genes are those that produce proteins that repair DNA damaged by radiation. Base Excision Repair (BER) proteins repair single strand breaks and oxidized bases in DNA. Double Strand Break Repair proteins repair broken chromosomes. Using technologies and information from the Human Genome Project, we have previously determined that the DNA sequence of DNA repair genes varies within the human population. An average of 3-4 different variants were found that affect the protein for each of 37 genes studied. The average frequency of these variants is 5%. Given the many genes in each DNA repair pathway and their many variants, technical ability to determine an individual's repair genotype greatly exceeds ability to interpret the information. A long-term goal is to relate DNA repair genotypes to health risk from radiation. This study focused on the BER pathway. The BER genes are known, variants of the genes have been identified at LLNL, and LLNL had recently developed an assay for BER function using white blood cells. The goal of this initial effort was to begin developing data that could be used to test the hypothesis that many different genotypes have similar DNA repair capacity phenotypes (function). Relationships between genotype and phenotype could then be used to group genotypes with similar function and ultimately test the association of groups of genotypes with health risk from radiation. Genotypes with reduced repair function are expected to increase risk of radiation-induced health effects. The

  16. Inhibition of the mitochondrial respiratory chain function abrogates quartz induced DNA damage in lung epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Li Hui [Institut fuer umweltmedizinische Forschung (IUF) at the Heinrich-Heine-University, Auf' m Hennekamp 50, D-40225 Duesseldorf (Germany); Haberzettl, Petra [Institut fuer umweltmedizinische Forschung (IUF) at the Heinrich-Heine-University, Auf' m Hennekamp 50, D-40225 Duesseldorf (Germany); Albrecht, Catrin [Institut fuer umweltmedizinische Forschung (IUF) at the Heinrich-Heine-University, Auf' m Hennekamp 50, D-40225 Duesseldorf (Germany); Hoehr, Doris [Institut fuer umweltmedizinische Forschung (IUF) at the Heinrich-Heine-University, Auf' m Hennekamp 50, D-40225 Duesseldorf (Germany); Knaapen, Ad M. [Department of Health Risk Analysis and Toxicology, Nutrition and Toxicology Research Institute Maastricht (NUTRIM), University of Maastricht (Netherlands); Borm, Paul J.A. [Institut fuer umweltmedizinische Forschung (IUF) at the Heinrich-Heine-University, Auf' m Hennekamp 50, D-40225 Duesseldorf (Germany); Hogeschool Zuyd Heerlen (Netherlands); Schins, Roel P.F. [Institut fuer umweltmedizinische Forschung (IUF) at the Heinrich-Heine-University, Auf' m Hennekamp 50, D-40225 Duesseldorf (Germany)]. E-mail: roel.schins@uni-duesseldorf.de

    2007-04-01

    Respirable quartz dust has been classified as a human carcinogen by the International Agency for Research on Cancer. The aim of our study was to investigate the mechanisms of DNA damage by DQ12 quartz in RLE-6TN rat lung epithelial type II cells (RLE). Transmission electron microscopy and flow-cytometry analysis showed a rapid particle uptake (30 min to 4 h) of quartz by the RLE cells, but particles were not found within the cell nuclei. This suggests that DNA strand breakage and induction of 8-hydroxydeoxyguanosine - as also observed in these cells during these treatment intervals - did not result from direct physical interactions between particles and DNA, or from short-lived particle surface-derived reactive oxygen species. DNA damage by quartz was significantly reduced in the presence of the mitochondrial inhibitors rotenone and antimycin-A. In the absence of quartz, these inhibitors did not affect DNA damage, but they reduced cellular oxygen consumption. No signs of apoptosis were observed by quartz. Flow-cytometry analysis indicated that the reduced DNA damage by rotenone was not due to a possible mitochondria-mediated reduction of particle uptake by the RLE cells. Further proof of concept for the role of mitochondria was shown by the failure of quartz to elicit DNA damage in mitochondria-depleted 143B (rho-0) osteosarcoma cells, at concentrations where it elicited DNA damage in the parental 143B cell line. In conclusion, our data show that respirable quartz particles can elicit oxidative DNA damage in vitro without entering the nuclei of type II cells, which are considered to be important target cells in quartz carcinogenesis. Furthermore, our observations indicate that such indirect DNA damage involves the mitochondrial electron transport chain function, by an as-yet-to-be elucidated mechanism.

  17. A comprehensive analysis of radiosensitization targets; functional inhibition of DNA methyltransferase 3B radiosensitizes by disrupting DNA damage regulation

    OpenAIRE

    Fujimori, Hiroaki; Sato, Akira; Kikuhara, Sota; Wang, Junhui; Hirai, Takahisa; Sasaki, Yuka; Murakami, Yasufumi; Okayasu, Ryuichi; Masutani, Mitsuko

    2015-01-01

    A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ-irradiation and carbon-ion beam irradiation. DNMT3B RNAi reduced the activation of DNA damage responses induced by γ-irradiation, including HP1β-, γH2AX- and Rad51-foci formation. DNMT3B RNAi impaired damage-dependent H2AX acc...

  18. A comprehensive analysis of radiosensitization targets; functional inhibition of DNA methyltransferase 3B radiosensitizes by disrupting DNA damage regulation

    OpenAIRE

    Fujimori, Hiroaki; Sato, Akira; Kikuhara, Sota; Wang, Junhui; Hirai, Takahisa; Sasaki, Yuka; Murakami, Yasufumi; Okayasu, Ryuichi; Masutani, Mitsuko

    2015-01-01

    A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ3-irradiation and carbon-ion beam irradiation. DNMT3B RNAi reduced the activation of DNA damage responses induced by γ3-irradiation, including HP1β-, γ3H2AX- and Rad51-foci formation. DNMT3B RNAi impaired damage-dependent H2AX ...

  19. Recent Advances in the Synthesis and Functions of Reconfigurable Interlocked DNA Nanostructures.

    Science.gov (United States)

    Lu, Chun-Hua; Cecconello, Alessandro; Willner, Itamar

    2016-04-27

    Interlocked circular DNA nanostructures, e.g., catenanes or rotaxanes, provide functional materials within the area of DNA nanotechnology. Specifically, the triggered reversible reconfiguration of the catenane or rotaxane structures provides a means to yield new DNA switches and to use them as dynamic scaffolds for controlling chemical functions and positioning functional cargoes. The synthesis of two-ring catenanes and their switchable reconfiguration by pH, metal ions, or fuel/anti-fuel stimuli are presented, and the functions of these systems, as pendulum or rotor devices or as switchable catalysts, are described. Also, the synthesis of three-, five-, and seven-ring catenanes is presented, and their switchable reconfiguration using fuel/anti-fuel strands is addressed. Implementation of the dynamically reconfigured catenane structures for the programmed organization of Au nanoparticle (NP) assemblies, which allows the plasmonic control of the fluorescence properties of Au NP/fluorophore loads associated with the scaffold, and for the operation of logic gates is discussed. Interlocked DNA rotaxanes and their different synthetic approaches are presented, and their switchable reconfiguration by means of fuel/anti-fuel strands or photonic stimuli is described. Specifically, the use of the rotaxane as a scaffold to organize Au NP assemblies, and the control of the fluorescence properties with Au NP/fluorophore hybrids loaded on the rotaxane scaffold, are introduced. The future prospectives and challenges in the field of interlocked DNA nanostructures and the possible applications are discussed.

  20. Functionalization of Poly- (methyl methacrylate) (PMMA) as a substrate for DNA microarrays

    DEFF Research Database (Denmark)

    Fixe, A.F.; Dufva, Hans Martin; Telleman, Pieter

    2004-01-01

    amines was confirmed by the immobilization of DNA probes and hybridization with a complementary DNA strand. The hybridization signal and the hybridization efficiency of the chemically aminated PMMA slides were comparable to the hybridization signal and the hybridization efficiency obtained from...... since the hybridization performance of microarrays subjected to 20 PCR heat cycles was only reduced by 4%. In conclusion, this new strategy to modify PMMA provides a robust procedure to immobilize DNA, which is a very useful substrate for fabricating single use diagnostics devices with integrated......A chemical procedure was developed to functionalize poly(methyl methacrylate) (PMMA) substrates. PMMA is reacted with hexamethylene diamine to yield an aminated surface for immobilizing DNA in microarrays. The density of primary NH2 groups was 0.29 nmol/cm(2). The availability of these primary...

  1. STN1 OB Fold Mutation Alters DNA Binding and Affects Selective Aspects of CST Function

    Science.gov (United States)

    Bhattacharjee, Anukana; Stewart, Jason; Chaiken, Mary; Price, Carolyn M.

    2016-01-01

    Mammalian CST (CTC1-STN1-TEN1) participates in multiple aspects of telomere replication and genome-wide recovery from replication stress. CST resembles Replication Protein A (RPA) in that it binds ssDNA and STN1 and TEN1 are structurally similar to RPA2 and RPA3. Conservation between CTC1 and RPA1 is less apparent. Currently the mechanism underlying CST action is largely unknown. Here we address CST mechanism by using a DNA-binding mutant, (STN1 OB-fold mutant, STN1-OBM) to examine the relationship between DNA binding and CST function. In vivo, STN1-OBM affects resolution of endogenous replication stress and telomere duplex replication but telomeric C-strand fill-in and new origin firing after exogenous replication stress are unaffected. These selective effects indicate mechanistic differences in CST action during resolution of different replication problems. In vitro binding studies show that STN1 directly engages both short and long ssDNA oligonucleotides, however STN1-OBM preferentially destabilizes binding to short substrates. The finding that STN1-OBM affects binding to only certain substrates starts to explain the in vivo separation of function observed in STN1-OBM expressing cells. CST is expected to engage DNA substrates of varied length and structure as it acts to resolve different replication problems. Since STN1-OBM will alter CST binding to only some of these substrates, the mutant should affect resolution of only a subset of replication problems, as was observed in the STN1-OBM cells. The in vitro studies also provide insight into CST binding mechanism. Like RPA, CST likely contacts DNA via multiple OB folds. However, the importance of STN1 for binding short substrates indicates differences in the architecture of CST and RPA DNA-protein complexes. Based on our results, we propose a dynamic DNA binding model that provides a general mechanism for CST action at diverse forms of replication stress. PMID:27690379

  2. DNA--a molecule in search of additional functions: recipient of pool wave emissions? A hypothesis.

    Science.gov (United States)

    Doerfler, Walter

    2010-09-01

    Almost the entire nucleotide sequence of human DNA is functionally unaccounted for, although large parts of the human genome are transcribed. The genes, as defined by current molecular biology, comprise about 1.5-2% of the DNA molecule. It is proposed that DNA encodes additional, hitherto unrecognized functions. In this discussion, the total information inside and outside the universe we live in is termed the pool or the sum total, known or unknown, of all laws, matter, energy, concepts and events. In a hypothetical model, a Gedankenexperiment, it is suggested that the total of all information emits pool waves of an unknown physical nature. They could be related to black energy or have completely different qualities. The designation pool waves should not imply any similarity to electromagnetism. Further, DNA is suggested to have the capability of interacting with the pool waves and thus permit humans - to some partly genetically determined and yet very limited extent - to perceive information from the pool. Pool emissions might be one of the forces that have been instrumental in and are still driving evolution from simple oligonucleotides to DNA with ever more complex recipient capacities. It will be a major challenge for researchers in the field to unravel these and less hypothetical undetected coding principles in DNA. It is uncertain whether the current trend to search the available DNA sequences with ever more refined computer technology on the basis of our present understanding of biology will detect unknown coding systems. For molecular medicine, research into the genetics of the most common human diseases could profit from the elucidation of presently still ephemeral codes in human DNA. Young scientists with a proven record of original research deserve support for the pursuit of unconventional ideas. This concept of granting priorities will be of the utmost importance in advancing the field beyond current concepts in molecular biology.

  3. DNA damage response and spindle assembly checkpoint function throughout the cell cycle to ensure genomic integrity.

    Directory of Open Access Journals (Sweden)

    Katherine S Lawrence

    2015-04-01

    Full Text Available Errors in replication or segregation lead to DNA damage, mutations, and aneuploidies. Consequently, cells monitor these events and delay progression through the cell cycle so repair precedes division. The DNA damage response (DDR, which monitors DNA integrity, and the spindle assembly checkpoint (SAC, which responds to defects in spindle attachment/tension during metaphase of mitosis and meiosis, are critical for preventing genome instability. Here we show that the DDR and SAC function together throughout the cell cycle to ensure genome integrity in C. elegans germ cells. Metaphase defects result in enrichment of SAC and DDR components to chromatin, and both SAC and DDR are required for metaphase delays. During persistent metaphase arrest following establishment of bi-oriented chromosomes, stability of the metaphase plate is compromised in the absence of DDR kinases ATR or CHK1 or SAC components, MAD1/MAD2, suggesting SAC functions in metaphase beyond its interactions with APC activator CDC20. In response to DNA damage, MAD2 and the histone variant CENPA become enriched at the nuclear periphery in a DDR-dependent manner. Further, depletion of either MAD1 or CENPA results in loss of peripherally associated damaged DNA. In contrast to a SAC-insensitive CDC20 mutant, germ cells deficient for SAC or CENPA cannot efficiently repair DNA damage, suggesting that SAC mediates DNA repair through CENPA interactions with the nuclear periphery. We also show that replication perturbations result in relocalization of MAD1/MAD2 in human cells, suggesting that the role of SAC in DNA repair is conserved.

  4. Functional diversification of paralogous transcription factors via divergence in DNA binding site motif and in expression.

    Directory of Open Access Journals (Sweden)

    Larry N Singh

    Full Text Available BACKGROUND: Gene duplication is a major driver of evolutionary innovation as it allows for an organism to elaborate its existing biological functions via specialization or diversification of initially redundant gene paralogs. Gene function can diversify in several ways. Transcription factor gene paralogs in particular, can diversify either by changes in their tissue-specific expression pattern or by changes in the DNA binding site motif recognized by their protein product, which in turn alters their gene targets. The relationship between these two modes of functional diversification of transcription factor paralogs has not been previously investigated, and is essential for understanding adaptive evolution of transcription factor gene families. FINDINGS: Based on a large set of human paralogous transcription factor pairs, we show that when the DNA binding site motifs of transcription factor paralogs are similar, the expressions of the genes that encode the paralogs have diverged, so in general, at most one of the paralogs is highly expressed in a tissue. Moreover, paralogs with diverged DNA binding site motifs tend to be diverged in their function. Conversely, two paralogs that are highly expressed in a tissue tend to have dissimilar DNA binding site motifs. We have also found that in general, within a paralogous family, tissue-specific decrease in gene expression is more frequent than what is expected by chance. CONCLUSIONS: While previous investigations of paralogous gene diversification have only considered coding sequence divergence, by explicitly quantifying divergence in DNA binding site motif, our work presents a new paradigm for investigating functional diversification. Consistent with evolutionary expectation, our quantitative analysis suggests that paralogous transcription factors have survived extinction in part, either through diversification of their DNA binding site motifs or through alterations in their tissue-specific expression

  5. Uncoupling of satellite DNA and centromeric function in the genus Equus.

    Directory of Open Access Journals (Sweden)

    Francesca M Piras

    2010-02-01

    Full Text Available In a previous study, we showed that centromere repositioning, that is the shift along the chromosome of the centromeric function without DNA sequence rearrangement, has occurred frequently during the evolution of the genus Equus. In this work, the analysis of the chromosomal distribution of satellite tandem repeats in Equus caballus, E. asinus, E. grevyi, and E. burchelli highlighted two atypical features: 1 several centromeres, including the previously described evolutionary new centromeres (ENCs, seem to be devoid of satellite DNA, and 2 satellite repeats are often present at non-centromeric termini, probably corresponding to relics of ancestral now inactive centromeres. Immuno-FISH experiments using satellite DNA and antibodies against the kinetochore protein CENP-A demonstrated that satellite-less primary constrictions are actually endowed with centromeric function. The phylogenetic reconstruction of centromere repositioning events demonstrates that the acquisition of satellite DNA occurs after the formation of the centromere during evolution and that centromeres can function over millions of years and many generations without detectable satellite DNA. The rapidly evolving Equus species gave us the opportunity to identify different intermediate steps along the full maturation of ENCs.

  6. Nucleolar organization, ribosomal DNA array stability, and acrocentric chromosome integrity are linked to telomere function.

    Directory of Open Access Journals (Sweden)

    Kaitlin M Stimpson

    Full Text Available The short arms of the ten acrocentric human chromosomes share several repetitive DNAs, including ribosomal RNA genes (rDNA. The rDNA arrays correspond to nucleolar organizing regions that coalesce each cell cycle to form the nucleolus. Telomere disruption by expressing a mutant version of telomere binding protein TRF2 (dnTRF2 causes non-random acrocentric fusions, as well as large-scale nucleolar defects. The mechanisms responsible for acrocentric chromosome sensitivity to dysfunctional telomeres are unclear. In this study, we show that TRF2 normally associates with the nucleolus and rDNA. However, when telomeres are crippled by dnTRF2 or RNAi knockdown of TRF2, gross nucleolar and chromosomal changes occur. We used the controllable dnTRF2 system to precisely dissect the timing and progression of nucleolar and chromosomal instability induced by telomere dysfunction, demonstrating that nucleolar changes precede the DNA damage and morphological changes that occur at acrocentric short arms. The rDNA repeat arrays on the short arms decondense, and are coated by RNA polymerase I transcription binding factor UBF, physically linking acrocentrics to one another as they become fusogenic. These results highlight the importance of telomere function in nucleolar stability and structural integrity of acrocentric chromosomes, particularly the rDNA arrays. Telomeric stress is widely accepted to cause DNA damage at chromosome ends, but our findings suggest that it also disrupts chromosome structure beyond the telomere region, specifically within the rDNA arrays located on acrocentric chromosomes. These results have relevance for Robertsonian translocation formation in humans and mechanisms by which acrocentric-acrocentric fusions are promoted by DNA damage and repair.

  7. Diamondoid-functionalized gold nanogaps as sensors for natural, mutated, and epigenetically modified DNA nucleotides.

    Science.gov (United States)

    Sivaraman, Ganesh; Amorim, Rodrigo G; Scheicher, Ralph H; Fyta, Maria

    2016-05-21

    Modified tiny hydrogen-terminated diamond structures, known as diamondoids, show a high efficiency in sensing DNA molecules. These diamond cages, as recently proposed, could offer functionalization possibilities for gold junction electrodes. In this investigation, we report on diamondoid-functionalized electrodes, showing that such a device would have a high potential in sensing and sequencing DNA. The smallest diamondoid including an amine modification was chosen for the functionalization. Here, we report on the quantum tunneling signals across diamondoid-functionalized Au(111) electrodes. Our work is based on quantum-transport calculations and predicts the expected signals arising from different DNA units within the break junctions. Different gating voltages are proposed in order to tune the sensitivity of the functionalized electrodes with respect to specific nucleotides. The relation of this sensitivity to the coupling or decoupling of the electrodes is discussed. Our results also shed light on the sensing capability of such a device in distinguishing the DNA nucleotides, in their natural and mutated forms.

  8. Construction of heteroduplex DNA and in vitro model for functional analysis of mismatch repair

    Institute of Scientific and Technical Information of China (English)

    WANG Yi; Clark Alan; WANG Jiaxun; SUN Menghong; SHI Daren

    2004-01-01

    Functional deficiency of mismatch repair (MMR) system is one of the mechanisms of tumorigenesis. With the development of the investigation and the requirement from the clinical diagnosis and treatment it is necessary to build up a method to evaluate the functional status of the whole MMR system in the concerned tumors. The original ssDNA and dsDNA from wild type (wt) bacteriophage M13mp2 and its three derivates with mutation points in the lacZα Gene have been used to construct two kinds of heteroduplex DNA molecules. One named del(2) has two bases deleted in the negative strand, the other has a G·G mismatch base pair in the negative strand too. Introducing this heteroduplex DNA into E. Coli NR9162 (mutS-) without the MMR ability on the indicator plate with x-gal and IPTG, there are three kinds of plaques, mixture plaque as the characteristic phenotype of heteroduplex DNA, blue and clear plaques. If the cell extract is mismatch repair competent the percentage of the mixture plaque will decrease after incubation with these heteroduplex DNA, the repair efficiency is expressed in percentage as 100× (1 minus the ratio of percentages of mixture plaque obtained from the extract-treated sample and untreated samples), which can imply the functional status of MMR system of certain samples. After large T-antigen-dependent SV-40 DNA replication assay cell extract from TK6, a human lymphoblastoid B-cell lymphoma cell line with MMR ability, and Lovo, a human colonic carcinoma cell line with MMR deficiency have incubated with these heteroduplex DNA. The repair efficiency of TK6 to del(2) is more than 60%, to G·G is more than 50%. The Lovo efficiency to del(2) is less than 10%, to G·G is less than 20%. Therefore, in this in vitro model used for functional analysis of mismatch repair of heteroduplex DNA as the repair target, TK6 can serve as the control for MMR proficiency and Lovo as the control for MMR deficiency. Using this model the tumor tissue from a case of hereditary

  9. Multi-scale coding of genomic information: From DNA sequence to genome structure and function

    Energy Technology Data Exchange (ETDEWEB)

    Arneodo, Alain, E-mail: alain.arneodo@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Vaillant, Cedric, E-mail: cedric.vaillant@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Audit, Benjamin, E-mail: benjamin.audit@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); Argoul, Francoise, E-mail: francoise.argoul@ens-lyon.f [Universite de Lyon, F-69000 Lyon (France); Laboratoire Joliot-Curie and Laboratoire de Physique, CNRS, Ecole Normale Superieure de Lyon, F-69007 Lyon (France); D' Aubenton-Carafa, Yves, E-mail: daubenton@cgm.cnrs-gif.f [Centre de Genetique Moleculaire, CNRS, Allee de la Terrasse, 91198 Gif-sur-Yvette (France); Thermes, Claude, E-mail: claude.thermes@cgm.cnrs-gif.f [Centre de Genetique Moleculaire, CNRS, Allee de la Terrasse, 91198 Gif-sur-Yvette (France)

    2011-02-15

    Understanding how chromatin is spatially and dynamically organized in the nucleus of eukaryotic cells and how this affects genome functions is one of the main challenges of cell biology. Since the different orders of packaging in the hierarchical organization of DNA condition the accessibility of DNA sequence elements to trans-acting factors that control the transcription and replication processes, there is actually a wealth of structural and dynamical information to learn in the primary DNA sequence. In this review, we show that when using concepts, methodologies, numerical and experimental techniques coming from statistical mechanics and nonlinear physics combined with wavelet-based multi-scale signal processing, we are able to decipher the multi-scale sequence encoding of chromatin condensation-decondensation mechanisms that play a fundamental role in regulating many molecular processes involved in nuclear functions.

  10. DNA

    Science.gov (United States)

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  11. A conserved physical and functional interaction between the cell cycle checkpoint clamp loader and DNA ligase I of eukaryotes.

    Science.gov (United States)

    Song, Wei; Levin, David S; Varkey, Johnson; Post, Sean; Bermudez, Vladimir P; Hurwitz, Jerard; Tomkinson, Alan E

    2007-08-03

    DNA ligase I joins Okazaki fragments during DNA replication and completes certain excision repair pathways. The participation of DNA ligase I in these transactions is directed by physical and functional interactions with proliferating cell nuclear antigen, a DNA sliding clamp, and, replication factor C (RFC), the clamp loader. Here we show that DNA ligase I also interacts with the hRad17 subunit of the hRad17-RFC cell cycle checkpoint clamp loader, and with each of the subunits of its DNA sliding clamp, the heterotrimeric hRad9-hRad1-hHus1 complex. In contrast to the inhibitory effect of RFC, hRad17-RFC stimulates joining by DNA ligase I. Similar results were obtained with the homologous Saccharomyces cerevisiae proteins indicating that the interaction between the replicative DNA ligase and checkpoint clamp is conserved in eukaryotes. Notably, we show that hRad17 preferentially interacts with and specifically stimulates dephosphorylated DNA ligase I. Moreover, there is an increased association between DNA ligase I and hRad17 in S phase following DNA damage and replication blockage that occurs concomitantly with DNA damage-induced dephosphorylation of chromatin-associated DNA ligase I. Thus, our results suggest that the in vivo interaction between DNA ligase I and the checkpoint clamp loader is regulated by post-translational modification of DNA ligase I.

  12. Photoligation of self-assembled DNA constructs containing anthracene-functionalized 2'-amino-LNA monomers

    DEFF Research Database (Denmark)

    Pasternak, Karol; Pasternak, Anna; Gupta, Pankaj

    2011-01-01

    Efficient synthesis of a novel anthracene-functionalized 2'-amino-LNA phosphoramidite derivative is described together with its incorporation into oligodeoxynucleotides. Two DNA strands with the novel 2'-N-anthracenylmethyl-2'-amino-LNA monomers can be effectively cross-linked by photoligation...

  13. Functions of FUS/TLS From DNA Repair to Stress Response: Implications for ALS

    Directory of Open Access Journals (Sweden)

    Reddy Ranjith Kumar Sama

    2014-08-01

    Full Text Available Fused in sarcoma/translocated in liposarcoma (FUS/TLS or FUS is a multifunctional DNA-/RNA-binding protein that is involved in a variety of cellular functions including transcription, protein translation, RNA splicing, and transport. FUS was initially identified as a fusion oncoprotein, and thus, the early literature focused on the role of FUS in cancer. With the recent discoveries revealing the role of FUS in neurodegenerative diseases, namely amyotrophic lateral sclerosis and frontotemporal lobar degeneration, there has been a renewed interest in elucidating the normal functions of FUS. It is not clear which, if any, endogenous functions of FUS are involved in disease pathogenesis. Here, we review what is currently known regarding the normal functions of FUS with an emphasis on DNA damage repair, RNA processing, and cellular stress response. Further, we discuss how ALS-causing mutations can potentially alter the role of FUS in these pathways, thereby contributing to disease pathogenesis.

  14. CMG helicase and DNA polymerase ε form a functional 15-subunit holoenzyme for eukaryotic leading-strand DNA replication.

    Science.gov (United States)

    Langston, Lance D; Zhang, Dan; Yurieva, Olga; Georgescu, Roxana E; Finkelstein, Jeff; Yao, Nina Y; Indiani, Chiara; O'Donnell, Mike E

    2014-10-28

    DNA replication in eukaryotes is asymmetric, with separate DNA polymerases (Pol) dedicated to bulk synthesis of the leading and lagging strands. Pol α/primase initiates primers on both strands that are extended by Pol ε on the leading strand and by Pol δ on the lagging strand. The CMG (Cdc45-MCM-GINS) helicase surrounds the leading strand and is proposed to recruit Pol ε for leading-strand synthesis, but to date a direct interaction between CMG and Pol ε has not been demonstrated. While purifying CMG helicase overexpressed in yeast, we detected a functional complex between CMG and native Pol ε. Using pure CMG and Pol ε, we reconstituted a stable 15-subunit CMG-Pol ε complex and showed that it is a functional polymerase-helicase on a model replication fork in vitro. On its own, the Pol2 catalytic subunit of Pol ε is inefficient in CMG-dependent replication, but addition of the Dpb2 protein subunit of Pol ε, known to bind the Psf1 protein subunit of CMG, allows stable synthesis with CMG. Dpb2 does not affect Pol δ function with CMG, and thus we propose that the connection between Dpb2 and CMG helps to stabilize Pol ε on the leading strand as part of a 15-subunit leading-strand holoenzyme we refer to as CMGE. Direct binding between Pol ε and CMG provides an explanation for specific targeting of Pol ε to the leading strand and provides clear mechanistic evidence for how strand asymmetry is maintained in eukaryotes.

  15. CMG helicase and DNA polymerase ε form a functional 15-subunit holoenzyme for eukaryotic leading-strand DNA replication

    Science.gov (United States)

    Langston, Lance D.; Zhang, Dan; Yurieva, Olga; Georgescu, Roxana E.; Finkelstein, Jeff; Yao, Nina Y.; Indiani, Chiara; O’Donnell, Mike E.

    2014-01-01

    DNA replication in eukaryotes is asymmetric, with separate DNA polymerases (Pol) dedicated to bulk synthesis of the leading and lagging strands. Pol α/primase initiates primers on both strands that are extended by Pol ε on the leading strand and by Pol δ on the lagging strand. The CMG (Cdc45-MCM-GINS) helicase surrounds the leading strand and is proposed to recruit Pol ε for leading-strand synthesis, but to date a direct interaction between CMG and Pol ε has not been demonstrated. While purifying CMG helicase overexpressed in yeast, we detected a functional complex between CMG and native Pol ε. Using pure CMG and Pol ε, we reconstituted a stable 15-subunit CMG–Pol ε complex and showed that it is a functional polymerase–helicase on a model replication fork in vitro. On its own, the Pol2 catalytic subunit of Pol ε is inefficient in CMG-dependent replication, but addition of the Dpb2 protein subunit of Pol ε, known to bind the Psf1 protein subunit of CMG, allows stable synthesis with CMG. Dpb2 does not affect Pol δ function with CMG, and thus we propose that the connection between Dpb2 and CMG helps to stabilize Pol ε on the leading strand as part of a 15-subunit leading-strand holoenzyme we refer to as CMGE. Direct binding between Pol ε and CMG provides an explanation for specific targeting of Pol ε to the leading strand and provides clear mechanistic evidence for how strand asymmetry is maintained in eukaryotes. PMID:25313033

  16. The functions of DNA methylation by CcrM in Caulobacter crescentus: a global approach.

    Science.gov (United States)

    Gonzalez, Diego; Kozdon, Jennifer B; McAdams, Harley H; Shapiro, Lucy; Collier, Justine

    2014-04-01

    DNA methylation is involved in a diversity of processes in bacteria, including maintenance of genome integrity and regulation of gene expression. Here, using Caulobacter crescentus as a model, we exploit genome-wide experimental methods to uncover the functions of CcrM, a DNA methyltransferase conserved in most Alphaproteobacteria. Using single molecule sequencing, we provide evidence that most CcrM target motifs (GANTC) switch from a fully methylated to a hemi-methylated state when they are replicated, and back to a fully methylated state at the onset of cell division. We show that DNA methylation by CcrM is not required for the control of the initiation of chromosome replication or for DNA mismatch repair. By contrast, our transcriptome analysis shows that >10% of the genes are misexpressed in cells lacking or constitutively over-expressing CcrM. Strikingly, GANTC methylation is needed for the efficient transcription of dozens of genes that are essential for cell cycle progression, in particular for DNA metabolism and cell division. Many of them are controlled by promoters methylated by CcrM and co-regulated by other global cell cycle regulators, demonstrating an extensive cross talk between DNA methylation and the complex regulatory network that controls the cell cycle of C. crescentus and, presumably, of many other Alphaproteobacteria.

  17. High resolution mapping of Twist to DNA in Drosophila embryos: Efficient functional analysis and evolutionary conservation

    OpenAIRE

    Ozdemir, Anil; Fisher-Aylor, Katherine I.; Pepke, Shirley; Samanta, Manoj; Dunipace, Leslie; McCue, Kenneth; Zeng, Lucy; Ogawa, Nobuo; Wold, Barbara J; Stathopoulos, Angelike

    2011-01-01

    Cis-regulatory modules (CRMs) function by binding sequence specific transcription factors, but the relationship between in vivo physical binding and the regulatory capacity of factor-bound DNA elements remains uncertain. We investigate this relationship for the well-studied Twist factor in Drosophila melanogaster embryos by analyzing genome-wide factor occupancy and testing the functional significance of Twist occupied regions and motifs within regions. Twist ChIP-seq data efficiently identif...

  18. Microscopic insight into the DNA condensation process of a zwitterion-functionalized polycation.

    Science.gov (United States)

    Sun, Hui; Zhou, Li; Chen, Xiaolu; Han, Xia; Wang, Rui; Liu, Honglai

    2016-11-01

    Zwitterion-functionalized polycations are ideal gene carriers with long circulation, high cellular uptaking and low cell viability. However, the trade-off between the DNA condensation efficiency and the cell viability must be addressed. The purpose of this study is to provide a microscopic insight into the DNA condensation process and to explore the effect of a zwitterionic block of zwitterion-functionalized polycation, which is of great significance in designing novel gene delivery systems. Poly[2-(dimethylamino)ethyl methacrylate-b-(sulfobetaine methacrylate)] (PDMAEMA-b-PSBMA) copolymers were synthesized and used as the model systems. Different from the conventional concept that the PSBMA zwitterionic block act only as the "stealthy" groups, the subtle differences in physical and colloidal characteristics between the polycation/DNA polyplexes show that the PSBMA segment is capable of wrapping DNA attributed to the quaternary ammonium cations, without compromising the DNA condensation capability. On the other hand, the incorporation of PSBMA block reduces the surface charge of the polyplexes, which substantially result in the inefficient transfection and the reduced cytotoxicity.

  19. Mitochondrial DNA and Functional Investigations into the Radiosensitivity of Four Mouse Strains

    Directory of Open Access Journals (Sweden)

    Steven B. Zhang

    2014-01-01

    Full Text Available We investigated whether genetic radiosensitivity-related changes in mtDNA/nDNA ratios are significant to mitochondrial function and if a material effect on mtDNA content and function exists. BALB/c (radiosensitive, C57BL/6 (radioresistant, and F1 hybrid mouse strains were exposed to total body irradiation. Hepatic genomic DNA was extracted, and mitochondria were isolated. Mitochondrial oxygen consumption, ROS, and calcium-induced mitochondrial swelling were measured. Radiation influenced strain-specific survival in vivo. F1 hybrid survival was influenced by maternal input. Changes in mitochondrial content corresponded to survival in vivo among the 4 strains. Calcium-induced mitochondrial swelling was strain dependent. Isolated mitochondria from BALB/c mice were significantly more sensitive to calcium overload than mitochondria from C57BL/6 mice. Maternal input partially influenced the recovery effect of radiation on calcium-induced mitochondrial swelling in F1 hybrids; the hybrid with a radiosensitive maternal lineage exhibited a lower rate of recovery. Hybrids had a survival rate that was biased toward maternal input. mtDNA content and mitochondrial permeability transition pores (MPTP measured in these strains before irradiation reflected a dominant input from the parent. After irradiation, the MPTP opened sooner in radiosensitive and hybrid strains, likely triggering intrinsic apoptotic pathways. These findings have important implications for translation into predictors of radiation sensitivity/resistance.

  20. Nanoparticles and DNA - a powerful and growing functional combination in bionanotechnology

    Science.gov (United States)

    Samanta, Anirban; Medintz, Igor L.

    2016-04-01

    Functionally integrating DNA and other nucleic acids with nanoparticles in all their different physicochemical forms has produced a rich variety of composite nanomaterials which, in many cases, display unique or augmented properties due to the synergistic activity of both components. These capabilities, in turn, are attracting greater attention from various research communities in search of new nanoscale tools for diverse applications that include (bio)sensing, labeling, targeted imaging, cellular delivery, diagnostics, therapeutics, theranostics, bioelectronics, and biocomputing to name just a few amongst many others. Here, we review this vibrant and growing research area from the perspective of the materials themselves and their unique capabilities. Inorganic nanocrystals such as quantum dots or those made from gold or other (noble) metals along with metal oxides and carbon allotropes are desired as participants in these hybrid materials since they can provide distinctive optical, physical, magnetic, and electrochemical properties. Beyond this, synthetic polymer-based and proteinaceous or viral nanoparticulate materials are also useful in the same role since they can provide a predefined and biocompatible cargo-carrying and targeting capability. The DNA component typically provides sequence-based addressability for probes along with, more recently, unique architectural properties that directly originate from the burgeoning structural DNA field. Additionally, DNA aptamers can also provide specific recognition capabilities against many diverse non-nucleic acid targets across a range of size scales from ions to full protein and cells. In addition to appending DNA to inorganic or polymeric nanoparticles, purely DNA-based nanoparticles have recently surfaced as an excellent assembly platform and have started finding application in areas like sensing, imaging and immunotherapy. We focus on selected and representative nanoparticle-DNA materials and highlight their

  1. Structure/Function Analysis of DNA-glycosylases That Repair Oxidized Purines and Pyrimidines and the Influence of Surrounding DNA Sequence on Their Interactions

    Energy Technology Data Exchange (ETDEWEB)

    Wallace, Susan S.

    2005-08-22

    The overall goal of this project was to elucidate the structure/function relationships between oxidized DNA bases and the DNA repair enzymes that recognize and remove them. The NMR solution structure of formamidopyrimidine DNA glycosylase (Fpg) that recognizes oxidized DNA purines was to be determined. Furthermore, the solution structures of DNA molecules containing specific lesions recognized by Fpg was to be determined in sequence contexts that either facilitate or hinder this recognition. These objectives were in keeping with the long-term goals of the Principal Investigator's laboratory, that is, to understand the basic mechanisms that underpin base excision repair processing of oxidative DNA lesions and to elucidate the interactions of unrepaired lesions with DNA polymerases. The results of these two DNA transactions can ultimately determine the fate of the cell. These objectives were also in keeping with the goals of our collaborator, Dr. Michael Kennedy, who is studying the repair and recognition of damaged DNA. Overall the goals of this project were congruent with those of the Department of Energy's Health Effects and Life Sciences Research Program, especially to the Structural Biology, the Human Genome and the Health Effects Programs. The mission of the latter Program includes understanding the biological effects and consequences of DNA damages produced by toxic agents in the many DOE waste sites so that cleanup can be accomplished in a safe, effective and timely manner.

  2. High-density DNA functionalization by a combination of Cu-catalyzed and cu-free click chemistry.

    Science.gov (United States)

    Gutsmiedl, Katrin; Fazio, Danila; Carell, Thomas

    2010-06-18

    We report the regioselective Cu-free click modification of styrene functionalized DNA with nitrile oxides. A series of modified oligodeoxynucleotides (nine base pairs) was prepared with increasing styrene density. 1,3-Dipolar cycloaddition with nitrile oxides allows the high density functionalization of the styrene modified DNA directly on the DNA solid support and in solution. This click reaction proceeds smoothly even directly in the DNA synthesizer and gives exclusively 3,5-disubstituted isoxazolines. Additionally, PCR products (300 and 900 base pairs) were synthesized with a styrene triphosphate and KOD XL polymerase. The click reaction on the highly modified PCR fragments allows functionalization of hundreds of styrene units on these large DNA fragments simultaneously. Even sequential Cu-free and Cu-catalyzed click reaction of PCR amplicons containing styrene and alkyne carrying nucleobases was achieved. This new approach towards high-density functionalization of DNA is simple, modular, and efficient.

  3. The Caenorhabditis elegans Werner syndrome protein functions upstream of ATR and ATM in response to DNA replication inhibition and double-strand DNA breaks.

    Directory of Open Access Journals (Sweden)

    Se-Jin Lee

    2010-01-01

    Full Text Available WRN-1 is the Caenorhabditis elegans homolog of the human Werner syndrome protein, a RecQ helicase, mutations of which are associated with premature aging and increased genome instability. Relatively little is known as to how WRN-1 functions in DNA repair and DNA damage signaling. Here, we take advantage of the genetic and cytological approaches in C. elegans to dissect the epistatic relationship of WRN-1 in various DNA damage checkpoint pathways. We found that WRN-1 is required for CHK1 phosphorylation induced by DNA replication inhibition, but not by UV radiation. Furthermore, WRN-1 influences the RPA-1 focus formation, suggesting that WRN-1 functions in the same step or upstream of RPA-1 in the DNA replication checkpoint pathway. In response to ionizing radiation, RPA-1 focus formation and nuclear localization of ATM depend on WRN-1 and MRE-11. We conclude that C. elegans WRN-1 participates in the initial stages of checkpoint activation induced by DNA replication inhibition and ionizing radiation. These functions of WRN-1 in upstream DNA damage signaling are likely to be conserved, but might be cryptic in human systems due to functional redundancy.

  4. Multiple Functions of Nuclear DNA Helicase Ⅱ (RNA helicase A) in Nucleic Acid Metabolism

    Institute of Scientific and Technical Information of China (English)

    Suisheng ZHANG; Frank GROSSE

    2004-01-01

    Nuclear DNA helicase Ⅱ(NDH Ⅱ),or RNA helicase A(RHA),was initially discovered in mammals by conventional protein purification methods.Molecular cloning identified apparent sequence homologies between NDH Ⅱ and a Drosophila protein named maleless(MLE),the latter being essential for the Drosophila X-chromosome dosage compensation.Increasing amounts of evidence suggest that NDH Ⅱ is involved in multiple aspects of cellular and viral DNA and RNA metabolism.Moreover the functions of NDH Ⅱ may have potential clinical implications related to viral infection,autoimmune diseases,or even tumorigenesis.

  5. Increasing the specificity and function of DNA microarrays by processing arrays at different stringencies

    DEFF Research Database (Denmark)

    Dufva, Martin; Petersen, Jesper; Poulsen, Lena

    2009-01-01

    DNA microarrays have for a decade been the only platform for genome-wide analysis and have provided a wealth of information about living organisms. DNA microarrays are processed today under one condition only, which puts large demands on assay development because all probes on the array need...... to function optimally under one condition only. Microarrays are often burdened with a significant degree of cross-hybridization, because of a poor combination of assay conditions and probe choice. As reviewed here, a number of promising microfluidics-based technologies can provide automatic processing...

  6. The impact of arginine-modified chitosan-DNA nanoparticles on the function of macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Liu Lanxia; Bai Yuanyuan; Song Chunni; Zhu Dunwan; Song Liping; Zhang Hailing; Dong Xia; Leng Xigang, E-mail: lengxg@bme.org.c [Tianjin Key Laboratory of Biomedical Materials, Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Laboratory of Bioengineering (China)

    2010-06-15

    It has been demonstrated that incorporation of arginine moieties into chitosan significantly elevates the transgenic efficacy of the chitosan. However, little is known about the impact of arginine-modified chitosan on the function of macrophages, which play a vitally important role in the inflammatory response of the body to foreign substances, especially particulate substances. This study was designed to investigate the impact of arginine-modified chitosan/DNA nanoparticles on the function of the murine macrophage through observation of phagocytic activity and production of pro-inflammatory cytokines (IL-1{beta}, IL-6, IL-10, IL-12, and TNF-{alpha}). Results showed that both chitosan/DNA nanoparticles and arginine-modified chitosan/DNA nanoparticles, containing 20 {mu}g/mL DNA, were internalized by almost all the macrophages in contact. This led to no significant changes, compared to the non-exposure group, in production of cytokines and phagocytic activity of the macrophages 24 h post co-incubation, whereas exposure to LPS induced obviously elevated cytokine production and phagocytic activity, suggesting that incorporation of arginine moieties into chitosan does not have a negative impact on the function of the macrophages.

  7. The impact of arginine-modified chitosan-DNA nanoparticles on the function of macrophages

    Science.gov (United States)

    Liu, Lanxia; Bai, Yuanyuan; Song, Chunni; Zhu, Dunwan; Song, Liping; Zhang, Hailing; Dong, Xia; Leng, Xigang

    2010-06-01

    It has been demonstrated that incorporation of arginine moieties into chitosan significantly elevates the transgenic efficacy of the chitosan. However, little is known about the impact of arginine-modified chitosan on the function of macrophages, which play a vitally important role in the inflammatory response of the body to foreign substances, especially particulate substances. This study was designed to investigate the impact of arginine-modified chitosan/DNA nanoparticles on the function of the murine macrophage through observation of phagocytic activity and production of pro-inflammatory cytokines (IL-1β, IL-6, IL-10, IL-12, and TNF-α). Results showed that both chitosan/DNA nanoparticles and arginine-modified chitosan/DNA nanoparticles, containing 20 μg/mL DNA, were internalized by almost all the macrophages in contact. This led to no significant changes, compared to the non-exposure group, in production of cytokines and phagocytic activity of the macrophages 24 h post co-incubation, whereas exposure to LPS induced obviously elevated cytokine production and phagocytic activity, suggesting that incorporation of arginine moieties into chitosan does not have a negative impact on the function of the macrophages.

  8. Chemical grafting of a DNA intercalator probe onto functional iron oxide nanoparticles: a physicochemical study.

    Science.gov (United States)

    Bouffier, Laurent; Yiu, Humphrey H P; Rosseinsky, Matthew J

    2011-05-17

    Spherical magnetite nanoparticles (MNPs, ∼ 24 nm in diameter) were sequentially functionalized with trimethoxysilylpropyldiethylenetriamine (TMSPDT) and a synthetic DNA intercalator, namely, 9-chloro-4H-pyrido[4,3,2-kl]acridin-4-one (PyAcr), in order to promote DNA interaction. The designed synthetic pathway allowed control of the chemical grafting efficiency to access MNPs either partially or fully functionalized with the intercalator moiety. The newly prepared nanomaterials were characterized by a range of physicochemical techniques: FTIR, TEM, PXRD, and TGA. The data were consistent with a full surface coverage by immobilized silylpropyldiethylenetriamine (SPDT) molecules, which corresponds to ∼22,300 SPDT molecules per MNP and a subsequent (4740-2940) PyAcr after the chemical grafting step (i.e., ∼ 2.4 PyAcr/nm(2)). A greater amount of PyAcr (30,600) was immobilized by the alternative strategy of binding a fully prefunctionalized shell to the MNPs with up to 16.1 PyAcr/nm(2). We found that the extent of PyAcr functionalization strongly affects the resulting properties and, particularly, the colloidal stability as well as the surface charge estimated by ζ-potential measurement. The intercalator grafting generates a negative charge contribution which counterbalances the positive charge of the single SPDT shell. The DNA binding capability was measured by titration assay and increases from 15 to 21.5 μg of DNA per mg of MNPs after PyAcr grafting (14-20% yield) but then drops to only ∼2 μg for the fully functionalized MNPs. This highlights that even if the size of the MNPs is obviously a determining factor to promote surface DNA interaction, it is not the only limiting parameter, as the mode of binding and the interfacial charge density are essential to improve loading capability.

  9. Synthesis of a drug delivery vehicle for cancer treatment utilizing DNA-functionalized gold nanoparticles

    Science.gov (United States)

    Brann, Tyler

    The treatment of cancer with chemotherapeutic agents has made great strides in the last few decades but still introduces major systemic side effects. The potent drugs needed to kill cancer cells often cause irreparable damage to otherwise healthy organs leading to further morbidity and mortality. A therapy with intrinsic selective properties and/or an inducible activation has the potential to change the way cancer can be treated. Gold nanoparticles (GNPs) are biocompatible and chemically versatile tools that can be readily functionalized to serve as molecular vehicles. The ability of these particles to strongly absorb light with wavelengths in the therapeutic window combined with the heating effect of surface plasmon resonance makes them uniquely suited for noninvasive heating in biologic applications. Specially designed DNA aptamers have shown their ability to serve as drug carriers through intercalation as well as directly acting as therapeutic agents. By combining these separate molecules a multifaceted drug delivery vehicle can be created with great potential as a selective and controllable treatment for cancer. Oligonucleotide-coated GNPs have been created using spherical GNPs but little work has been reported using gold nanoplates in this way. Using the Diasynth method gold nanoplates were produced to absorb strongly in the therapeutic near infrared (nIR) window. These particles were functionalized with two DNA oligonucleotides: one serving as an intercalation site for doxorubicin, and another, AS1411, serving directly as an anticancer targeting/therapeutic agent. These functional particles were fully synthesized and processed along with confirmation of DNA functionalization and doxorubicin intercalation. Doxorubicin is released via denaturation of the DNA structure into which doxorubicin is intercalated upon the heating of the gold nanoplate well above the DNA melting temperature. This temperature increase, due to light stimulation of surface plasmon

  10. New function of exonuclease and highly sensitive label-free colorimetric DNA detection.

    Science.gov (United States)

    Li, Hongbo; Wang, Suqin; Wu, Zaisheng; Xu, Jianguo; Shen, Guoli; Yu, Ruqin

    2016-03-15

    Enzymatic manipulation and modulation of nucleic acids are a central part of cellular function, protection, and reproduction, while rapid and accurate detection of ultralow amount of nucleic acids remains a major challenge in molecular biology research and clinic diagnosis of genetic diseases. Herein, we reported that exonuclease III can degrade the G-quadruplex structure, indicating the new exonuclease's function. Basing on the function of exonuclease III, a novel G-quadruplex-hemin DNAzyme-based colorimetric detection of tumor suppressor gene p53 was successfully developed. Although only one oligonucleotide probe was involved, the sensing strategy could suppress the optical background and achieve an efficient G-quadruplex-hemin DNAzyme-based signal amplification. Specifically, a label-free functional nucleic acid probe (called THzyme probe) was designed via introducing target DNA probe-contained hairpin structure into G-quadruplex DNAzyme. Even if this probe can fold into G-quadruplex structure in the presence of hemin very different from the double-stranded DNA, it is easily degraded by exonuclease III. Thus, no change in UV-vis absorption intensity is detected in the absence of target DNA. However, the hybridization of target DNA can protect the integrity and catalytic activity of THzyme probe, producing the DNAzyme-amplified colorimetric signal. As a result, the p53 gene was able to be detected down to 1.0 pM (final concentration in the signal-generating solution: 50.0 fM) and mismatched target DNAs were easily distinguished. It is expected that this simple sensing methodology for DNA detection can find its utility in point-of-care applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Charge-Transfer Excited States in Aqueous DNA: Insights from Many-Body Green's Function Theory

    Science.gov (United States)

    Yin, Huabing; Ma, Yuchen; Mu, Jinglin; Liu, Chengbu; Rohlfing, Michael

    2014-06-01

    Charge-transfer (CT) excited states play an important role in the excited-state dynamics of DNA in aqueous solution. However, there is still much controversy on their energies. By ab initio many-body Green's function theory, together with classical molecular dynamics simulations, we confirm the existence of CT states at the lower energy side of the optical absorption maximum in aqueous DNA as observed in experiments. We find that the hydration shell can exert strong effects (˜1 eV) on both the electronic structure and CT states of DNA molecules through dipole electric fields. In this case, the solvent cannot be simply regarded as a macroscopic screening medium as usual. The influence of base stacking and base pairing on the CT states is also discussed.

  12. Highly Sensitive Functionalized Conducting Copolypyrrole Film for DNA Sensing and Protein-resistant%Highly Sensitive Functionalized Conducting Copolypyrrole Film for DNA Sensing and Protein-resistant

    Institute of Scientific and Technical Information of China (English)

    Zhang, Zhihong; Li, Guijuan; Yan, Fufeng; Zhang, Zhonghou; Fang, Shaoming

    2012-01-01

    In order to exploit the applications ofpolypyrrole (PPy) derivatives in biosensors and bioelectronics, the different immobilization mechanisms of biomolecules onto differently functionalized conducting PPy films are investigated. Pyrrole and pyrrole derivatives with carboxyl and amino groups were copolymerized with ω-(N-pyrrolyl)-octylthiol self-assembled on Au surface by the method of the chemical polymerization to form a layer of the copolymer film, i.e., poly[pyrrole-co-(N-pyrrolyl)-caproic acid] (poly(Py-co-PyCA)) and poly[pyrrole-co-(N-pyrrolyl)-hexylamine] (poly(Py-co-PyHA)), in which the carboxyl groups in poly(Py-co-PyCA) were activated to the ester groups. Based on the structure characteristics, the immobilization/hybridization of DNA molecules on PPy, poly(Py-co-PyCA) and poly(Py-co-PyHA) were surveyed by cyclic voltammograms measurements. For differently functionalized copolymers, the immobilization mechanisms of DNA are various. Besides the electrochemical properties of the composite electrodes of PPy and its copolymers being detected before and after bovine serum albumin (BSA) adsorption, the kinetic process of protein binding was determined by surface plasmon resonance of spectroscopy. Since few BSA molecules could anchor onto the PPy and its copolymers surfaces, it suggests this kind of conducting polymers can be applied as the protein-resistant material.

  13. Emerging Molecular and Biological Functions of MBD2, a Reader of DNA Methylation

    Directory of Open Access Journals (Sweden)

    Kathleen H Wood

    2016-05-01

    Full Text Available DNA methylation is an epigenetic mark that is essential for many biological processes and is linked to diseases such as cancer. Methylation is usually associated with transcriptional silencing, but new research has challenged this model. Both transcriptional activation and repression have recently been found to be associated with DNA methylation in a context-specific manner. How DNA methylation patterns are interpreted into different functional output remains poorly understood. One mechanism involves the protein ‘readers’ of methylation, which includes the methyl-CpG binding domain (MBD family of proteins. This review examines the molecular and biological functions of MBD2, which binds to CpG methylation and is an integral part of the nucleosome remodeling and histone deacetylation (NuRD complex. MBD2 has been linked to immune system function and tumorigenesis, yet little is known about its functions in vivo. Recent studies have found the MBD2 protein is ubiquitously expressed, with relatively high levels in the lung, liver and colon. Mbd2 null mice surprisingly show relatively mild phenotypes compared to mice with loss of function of other MBD proteins. This evidence has previously been interpreted as functional redundancy between the MBD proteins. Here we examine and contextualize research that suggests MBD2 has unique properties and functions among the MBD proteins. These functions translate to recently described roles in the development and differentiation of multiple cell lineages, including pluripotent stem cells and various cell types of the immune system, as well as in tumorigenesis. We also consider possible models for the dynamic interactions between MBD2 and NuRD in different tissues in vivo. The functions of MBD2 may have direct therapeutic implications for several areas of human disease, including autoimmune conditions and cancer, in addition to providing insights into the actions of NuRD and chromatin regulation.

  14. Cloning, expression, and functional characterization of the equine herpesvirus 1 DNA polymerase and its accessory subunit.

    Science.gov (United States)

    Loregian, Arianna; Case, Alessandro; Cancellotti, Enrico; Valente, Carlo; Marsden, Howard S; Palù, Giorgio

    2006-07-01

    We report the expression and characterization of the putative catalytic subunit (pORF30) and accessory protein (pORF18) of equine herpesvirus 1 DNA polymerase, which are encoded by open reading frames 30 and 18 and are homologous to herpes simplex virus type 1 UL30 and UL42, respectively. In vitro transcription-translation of open reading frames 30 and 18 generated proteins of 136 and 45 kDa, respectively. In vitro-expressed pORF30 possessed basal DNA polymerase activity that was stimulated by pORF18, as measured by DNA polymerase assays in vitro. Purified baculovirus-expressed pORF30 exhibited DNA polymerase activity similar to that of the in vitro-expressed protein, and baculovirus-expressed pORF18 could stimulate both nucleotide incorporation and long-chain DNA synthesis by pORF30 in a dose- and time-dependent manner. The salt optima for activity of both pORF30 and the holoenzyme were substantially different from those for other herpesvirus DNA polymerases. As demonstrated by yeast two-hybrid assays, pORF30 and pORF18 could physically interact, most likely with a 1:1 stoichiometry. Finally, by mutational analysis of the 1,220-residue pORF30, we demonstrated that the extreme C terminus of pORF30 is important for physical and functional interaction with the accessory protein, as reported for UL30 and other herpesvirus DNA polymerases. In addition, a C-proximal region of pORF30, corresponding to residues 1114 to 1172, is involved in binding to, and stimulation by, pORF18. Taken together, the results indicate that pORF30 and pORF18 are the equine herpesvirus 1 counterparts of herpes simplex virus type 1 UL30 and UL42 and share many, but not all, of their characteristics.

  15. Z-DNA and its biological function%Z-DNA及其生物学功能

    Institute of Scientific and Technical Information of China (English)

    汤雅男; 杨攀; 胡成钰

    2009-01-01

    Z-DNA是一种处于高能状态、不稳定的DNA分子构象.形成Z-DNA的原因有很多:首先,转录过程中,移动的RNA聚合酶在模板DNA的5'端产生负超螺旋扭曲力,导致Z-DNA的形成;其次,含有d(GC)_n序列的核酸分子在高浓度的NaCl、[Co(NH_3)_6]~(2+)盐溶液中也能够形成Z-DNA;最后,化学修饰也可以使DNA产生稳定的Z-DNA.Z-DNA是在体外首先发现的,但随着研究的不断深入,发现Z-DNA在体内也广泛存在并可能具有功能的多样性,包括参与基因表达调控、染色体断裂、基因重组、抗病毒、病毒发生等生物学过程.%Z-DNA is an instable and high energy DNA conformation in vivo and it can be formed in many conditions.Firstly,when RNA polymerase is moving on a DNA template,transcription can result in negative supercoiling behind the polymerase,thus facilitating Z-DNA conformation at permissive regions.Secondly,the Z-DNA-conformation which is formed by d(GC)_n sequence can also be stabled in high-salt solution of NaCl or [Co(NH_3)_6]~(2+) and lastly,the Z-DNA can be formed by covalent modifications.Though Z-DNA was firstly discovered in vitro,recently many evidences revealed that Z-DNA was widely existed and may possessed diversity of function in vivo,including gene expression and regulation,chromosomal breaks,recombination,antivirus defense and virus generation and so on.

  16. Histone-DNA contacts in structure/function relationships of nucleosomes as revealed by crosslinking

    Energy Technology Data Exchange (ETDEWEB)

    Usachenko, S.I. [Univ. of California, Davis, CA (United States); Bradbury, E.M. [Los Alamos National Lab., NM (United States). Life Science Div.]|[Univ. of California, Davis, CA (United States)

    1998-12-31

    The magnitude of the problem of understanding the structure/function relationships of eukaryotic chromosomes can be appreciated from the fact that the human diploid genome contains more than 2 meters of DNA packaged into 46 chromosomes, each at metaphase being several microns in length. Each chromatid of a chromosome contains a single DNA molecule several centimeters in length. In addition to the DNA, chromosomes contain an equal weight of histones and an equal weight of non-histone chromosomal proteins. These histones are the major chromosomal structural proteins. The non-histone chromosomal proteins are involved in the DNA processes of transcription and replication, in chromosome organization and in nuclear architecture. Polytene chromosomes with their bands and interbands and puffs of active genetic loci provide visual evidence for long range order as do the bands and interbands of mammalian metaphase chromosomes. The gentle removal of histones and all but the most tightly bound 2--3% of non-histone proteins from metaphase chromosomes revealed by electron microscopy a residual protein scaffold constraining a halo of DNA loops extending out from the scaffold.

  17. mtDNA Mutagenesis Disrupts Pluripotent Stem Cell Function by Altering Redox Signaling

    Directory of Open Access Journals (Sweden)

    Riikka H. Hämäläinen

    2015-06-01

    Full Text Available mtDNA mutagenesis in somatic stem cells leads to their dysfunction and to progeria in mouse. The mechanism was proposed to involve modification of reactive oxygen species (ROS/redox signaling. We studied the effect of mtDNA mutagenesis on reprogramming and stemness of pluripotent stem cells (PSCs and show that PSCs select against specific mtDNA mutations, mimicking germline and promoting mtDNA integrity despite their glycolytic metabolism. Furthermore, mtDNA mutagenesis is associated with an increase in mitochondrial H2O2, reduced PSC reprogramming efficiency, and self-renewal. Mitochondria-targeted ubiquinone, MitoQ, and N-acetyl-L-cysteine efficiently rescued these defects, indicating that both reprogramming efficiency and stemness are modified by mitochondrial ROS. The redox sensitivity, however, rendered PSCs and especially neural stem cells sensitive to MitoQ toxicity. Our results imply that stem cell compartment warrants special attention when the safety of new antioxidants is assessed and point to an essential role for mitochondrial redox signaling in maintaining normal stem cell function.

  18. Structure-function analysis of ribonucleotide bypass by B family DNA replicases

    Energy Technology Data Exchange (ETDEWEB)

    Clausen, Anders R.; Murray, Michael S.; Passer, Andrew R.; Pedersen, Lars C.; Kunkel, Thomas A. [NIH

    2013-11-01

    Ribonucleotides are frequently incorporated into DNA during replication, they are normally removed, and failure to remove them results in replication stress. This stress correlates with DNA polymerase (Pol) stalling during bypass of ribonucleotides in DNA templates. Here we demonstrate that stalling by yeast replicative Pols δ and ε increases as the number of consecutive template ribonucleotides increases from one to four. The homologous bacteriophage RB69 Pol also stalls during ribonucleotide bypass, with a pattern most similar to that of Pol ε. Crystal structures of an exonuclease-deficient variant of RB69 Pol corresponding to multiple steps in single ribonucleotide bypass reveal that increased stalling is associated with displacement of Tyr391 and an unpreferred C2´-endo conformation for the ribose. Even less efficient bypass of two consecutive ribonucleotides in DNA correlates with similar movements of Tyr391 and displacement of one of the ribonucleotides along with the primer-strand DNA backbone. These structure–function studies have implications for cellular signaling by ribonucleotides, and they may be relevant to replication stress in cells defective in ribonucleotide excision repair, including humans suffering from autoimmune disease associated with RNase H2 defects.

  19. Across-Platform Imputation of DNA Methylation Levels Incorporating Nonlocal Information Using Penalized Functional Regression.

    Science.gov (United States)

    Zhang, Guosheng; Huang, Kuan-Chieh; Xu, Zheng; Tzeng, Jung-Ying; Conneely, Karen N; Guan, Weihua; Kang, Jian; Li, Yun

    2016-05-01

    DNA methylation is a key epigenetic mark involved in both normal development and disease progression. Recent advances in high-throughput technologies have enabled genome-wide profiling of DNA methylation. However, DNA methylation profiling often employs different designs and platforms with varying resolution, which hinders joint analysis of methylation data from multiple platforms. In this study, we propose a penalized functional regression model to impute missing methylation data. By incorporating functional predictors, our model utilizes information from nonlocal probes to improve imputation quality. Here, we compared the performance of our functional model to linear regression and the best single probe surrogate in real data and via simulations. Specifically, we applied different imputation approaches to an acute myeloid leukemia dataset consisting of 194 samples and our method showed higher imputation accuracy, manifested, for example, by a 94% relative increase in information content and up to 86% more CpG sites passing post-imputation filtering. Our simulated association study further demonstrated that our method substantially improves the statistical power to identify trait-associated methylation loci. These findings indicate that the penalized functional regression model is a convenient and valuable imputation tool for methylation data, and it can boost statistical power in downstream epigenome-wide association study (EWAS).

  20. A closed parameterization of DNA-damage by charged particles as a function of energy

    CERN Document Server

    D, Frank Van den Heuvel Ph

    2013-01-01

    Purpose: To present a closed formalism calculating charged particle radiation damage induced in DNA, based on a simplified molecular model. The formalism is valid for all types of charged particles and due to its closed nature is suited to provide fast conversion of dose to DNA-damage. Methods: The induction of complex DNA--damaged is modelled using the standard scattering theory with a simplified effective potential. This leads to a proposal to use the Breit-Wigner expression to model the probability of the complex damage inelastic scatter as a function of kinetic energy of the scattered particle. A microscopic phenomenological Monte Carlo code is used to predict the damage to a DNA molecule embedded in a cell. The model is fit to the result of the simulation for four particles: electrons, protons, alpha--particles, and Carbon ions. The model is then used to predict the damage in a cell as a function of kinetic energy. Finally, a framework is proposed and implemented to provide data that can be assessed expe...

  1. Coumestan inhibits radical-induced oxidation of DNA: is hydroxyl a necessary functional group?

    Science.gov (United States)

    Xi, Gao-Lei; Liu, Zai-Qun

    2014-06-18

    Coumestan is a natural tetracycle with a C═C bond shared by a coumarin moiety and a benzofuran moiety. In addition to the function of the hydroxyl group on the antioxidant activity of coumestan, it is worth exploring the influence of the oxygen-abundant scaffold on the antioxidant activity as well. In this work, seven coumestans containing electron-withdrawing and electron-donating groups were synthesized to evaluate the abilities to trap 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) cationic radical (ABTS(•+)), 2,2'-diphenyl-1-picrylhydrazyl radical (DPPH), and galvinoxyl radical, respectively, and to inhibit the oxidations of DNA mediated by (•)OH, Cu(2+)/glutathione (GSH), and 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH), respectively. It was found that all of the coumestans used herein can quench the aforementioned radicals and can inhibit (•)OH-, Cu(2+)/GSH-, and AAPH-induced oxidations of DNA. In particular, substituent-free coumestan exhibits higher ability to quench DPPH and to inhibit AAPH-induced oxidation of DNA than Trolox. In addition, nonsubstituted coumestan shows a similar ability to inhibit (•)OH- and Cu(2+)/GSH-induced oxidations of DNA relative to that of Trolox. The antioxidant effectiveness of the coumestan can be attributed to the lactone in the coumarin moiety and, therefore, a hydroxyl group may not be a necessary functional group for coumestan to be an antioxidant.

  2. Modeling structure-function relationships in synthetic DNA sequences using attribute grammars.

    Directory of Open Access Journals (Sweden)

    Yizhi Cai

    2009-10-01

    Full Text Available Recognizing that certain biological functions can be associated with specific DNA sequences has led various fields of biology to adopt the notion of the genetic part. This concept provides a finer level of granularity than the traditional notion of the gene. However, a method of formally relating how a set of parts relates to a function has not yet emerged. Synthetic biology both demands such a formalism and provides an ideal setting for testing hypotheses about relationships between DNA sequences and phenotypes beyond the gene-centric methods used in genetics. Attribute grammars are used in computer science to translate the text of a program source code into the computational operations it represents. By associating attributes with parts, modifying the value of these attributes using rules that describe the structure of DNA sequences, and using a multi-pass compilation process, it is possible to translate DNA sequences into molecular interaction network models. These capabilities are illustrated by simple example grammars expressing how gene expression rates are dependent upon single or multiple parts. The translation process is validated by systematically generating, translating, and simulating the phenotype of all the sequences in the design space generated by a small library of genetic parts. Attribute grammars represent a flexible framework connecting parts with models of biological function. They will be instrumental for building mathematical models of libraries of genetic constructs synthesized to characterize the function of genetic parts. This formalism is also expected to provide a solid foundation for the development of computer assisted design applications for synthetic biology.

  3. Kinetic control of the coverage of oil droplets by DNA-functionalized colloids

    OpenAIRE

    Joshi, Darshana; Bargteil, Dylan; Caciagli, Alessio; Burelbach, Jerome; Xing, Zhongyang; Nunes, André S.; Pinto, Diogo E. P.; Araújo, Nuno A. M.; Brujic, Jasna; Eiser, Erika

    2016-01-01

    We report a study of reversible adsorption of DNA-coated colloids on complementary functionalized oil droplets. We show that it is possible to control the surface coverage of oil droplets by colloidal particles, by exploiting the fact that during slow adsorption, compositional arrest takes place well before structural arrest occurs. As a consequence, we can prepare colloid-coated oil droplets with a `frozen' degree of loading, but with fully ergodic colloidal dynamics on the droplets. We illu...

  4. E. coli chaperones DnaK, Hsp33 and Spy inhibit bacterial functional amyloid assembly.

    Science.gov (United States)

    Evans, Margery L; Schmidt, Jens C; Ilbert, Marianne; Doyle, Shannon M; Quan, Shu; Bardwell, James C A; Jakob, Ursula; Wickner, Sue; Chapman, Matthew R

    2011-01-01

    Amyloid formation is an ordered aggregation process, where β-sheet rich polymers are assembled from unstructured or partially folded monomers. We examined how two Escherichia coli cytosolic chaperones, DnaK and Hsp33, and a more recently characterized periplasmic chaperone, Spy, modulate the aggregation of a functional amyloid protein, CsgA. We found that DnaK, the Hsp70 homologue in E. coli, and Hsp33, a redox-regulated holdase, potently inhibited CsgA amyloidogenesis. The Hsp33 anti-amyloidogenesis activity was oxidation dependent, as oxidized Hsp33 was significantly more efficient than reduced Hsp33 at preventing CsgA aggregation. When soluble CsgA was seeded with preformed amyloid fibers, neither Hsp33 nor DnaK were able to efficiently prevent soluble CsgA from adopting the amyloid conformation. Moreover, both DnaK and Hsp33 increased the time that CsgA was reactive with the amyloid oligomer conformation-specific A11 antibody. Since CsgA must also pass through the periplasm during secretion, we assessed the ability of the periplasmic chaperone Spy to inhibit CsgA polymerization. Like DnaK and Hsp33, Spy also inhibited CsgA polymerization in vitro. Overexpression of Spy resulted in increased chaperone activity in periplasmic extracts and in reduced curli biogenesis in vivo. We propose that DnaK, Hsp33 and Spy exert their effects during the nucleation stages of CsgA fibrillation. Thus, both housekeeping and stress induced cytosolic and periplasmic chaperones may be involved in discouraging premature CsgA interactions during curli biogenesis.

  5. Assessing the function of homologous recombination DNA repair in malignant pleural effusion (MPE) samples.

    Science.gov (United States)

    Patterson, M J; Sutton, R E; Forrest, I; Sharrock, R; Lane, M; Kaufmann, A; O'Donnell, R; Edmondson, R J; Wilson, B T; Curtin, N J

    2014-07-08

    Patients with malignant pleural effusions (MPEs) generally have advanced disease with poor survival and few therapeutic options. Cells within MPEs may be used to stratify patients for targeted therapy. Targeted therapy with poly(ADP ribose) polymerase inhibitors (PARPi) depends on identifying homologous recombination DNA repair (HRR)-defective cancer cells. We aimed to determine the feasibility of assaying HRR status in MPE cells. A total of 15 MPE samples were collected from consenting patients with non-small-cell lung cancer (NSCLC), mesothelioma and ovarian and breast cancer. Primary cultures were confirmed as epithelial by pancytokeratin, and HRR status was determined by the detection of γH2AX and RAD51 foci following a 24-h exposure to rucaparib, by immunofluorescence microscopy. Massively parallel next-generation sequencing of DNA repair genes was performed on cultured MPE cells. From 15 MPE samples, 13 cultures were successfully established, with HRR function successfully determined in 12 cultures. Four samples - three NSCLC and one mesothelioma - were HRR defective and eight samples - one NSCLC, one mesothelioma, one sarcomatoid, one breast and four ovarian cancers - were HRR functional. No mutations in DNA repair genes were associated with HRR status, but there was probable loss of heterozygosity of FANCG, RPA1 and PARP1. HRR function can be successfully detected in MPE cells demonstrating the potential to stratify patients for targeted therapy with PARPi.

  6. HCV NS5A abrogates p53 protein function by interfering with p53-DNA binding

    Institute of Scientific and Technical Information of China (English)

    Guo-Zhong Gong; Yong-Fang Jiang; Yan He; Li-Ying Lai; Ying-Hua Zhu; Xian-Shi Su

    2004-01-01

    AIM: To evaluate the inhibition effect of HCV NS5A on p53 transactivation on p21 promoter and explore its possible mechanism for influencing p53 function.METHODS: p53 function of transactivation on p21 promoter was studied with a luciferase reporter system in which the luciferase gene is driven by p21 promoter, and the p53-DNA binding ability was observed with the use of electrophoretic mobility-shift assay (EMSA). Lipofectin mediated p53 or HCV NS5A expression vectors were used to transfect hepatoma cell lines to observe whether HCV NS5A could abrogate the binding ability of p53 to its specific DNA sequence and p53 transactivation on p21 promoter.Western blot experiment was used for detection of HCV NS5A and p53 proteins expression.RESULTS: Relative luciferase activity driven by p21 promoter increased significantly in the presence of endogenous p53 protein. Compared to the control group, exogenous p53 protein also stimulated p21 promoter driven luciferase gene expression in a dose-dependent way. HCV NS5A protein gradually inhibited both endogenous and exogenous p53 transactivation on p21 promoter with increase of the dose of HCV NS5A expression plasmid. By the experiment of EMSA, we could find p53 binding to its specific DNA sequence and, when co-transfected with increased dose of HCV NS5A expression vector, the p53 binding affinity to its DNA gradually decreased and finally disappeared. Between the Huh 7 cells transfected with p53 expression vector alone or co-transfected with HCV NS5A expression vector, there was no difference in the p53 protein expression.CONCLUSION: HCV NS5A inhibits p53 transactivation on p21 promoter through abrogating p53 binding affinity to its specific DNA sequence. It does not affect p53 protein expression.

  7. Preliminary investigation of sequence-independent DNA binding proteins in rat skeletal muscle sarcoplasmic reticulum and their function

    Institute of Scientific and Technical Information of China (English)

    赵文; 姜志胜; 倪菊华; 陈光慧; 刘乃奎; 汤健; 贾弘褆; 唐朝枢

    2000-01-01

    To observe the binding of plasmid DNA to non-nuclear DNA binding proteins in sar-coplasmic reticulum (SR) and the effects of this binding on SR function, sarcoplasmic reticulum proteins in rat skeletal muscle were isolated by differential centrifuge and sucrose density-gradient centrifuge. The results showed that there are two sequence-independent DNA binding proteins in SR proteins, the molecular weights of which are 83 and 58 ku, respectively. Ca2+ uptake and release of SR were remarkably promoted by the binding of plasmid DNA to DNA binding proteins in SR, the mechanism is probably through increasing of Ca2+-ATPase activity in SR and changing of character of Ca2+ release channel ryanodine receptors induced by the binding. These results suggest that there exist DNA binding proteins in SR and its binding to DNA may affect Ca2+ transport of SR.

  8. Preliminary investigation of sequence-independent DNA binding proteins in rat skeletal muscle sarcoplasmic reticulum and their function

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    To observe the binding of plasmid DNA to non-nuclear DNA binding proteins in sarcoplasmic reticulum (SR) and the effects of this binding on SR function, sarcoplasmic reticulum proteins in rat skeletal muscle were isolated by differential centrifuge and sucrose density-gradient centrifuge. The results showed that there are two sequence-independent DNA binding proteins in SR proteins, the molecular weights of which are 83 and 58 ku, respectively. Ca2+ uptake and release of SR were remarkably promoted by the binding of plasmid DNA to DNA binding proteins in SR, the mechanism is probably through increasing of Ca2+-ATPase activity in SR and changing of character of Ca2+ release channel ryanodine receptors induced by the binding. These results suggest that there exist DNA binding proteins in SR and its binding to DNA may affect Ca2+ transport of SR.

  9. ATP- and NAD+-dependent DNA ligases share an essential function in the halophilic archaeon Haloferax volcanii

    DEFF Research Database (Denmark)

    Zhao, A.; Gray, F. C; MacNeill, S. A.

    2006-01-01

    DNA ligases join the ends of DNA molecules during replication, repair and recombination. ATP-dependent ligases are found predominantly in the eukarya and archaea whereas NAD+-dependent DNA ligases are found only in the eubacteria and in entomopoxviruses. Using the genetically tractable halophile...... Haloferax volcanii as a model system, we describe the first genetic analysis of archaeal DNA ligase function. We show that the Hfx. volcanii ATP-dependent DNA ligase family member, LigA, is non-essential for cell viability, raising the question of how DNA strands are joined in its absence. We show that Hfx....... volcanii also encodes an NAD+-dependent DNA ligase family member, LigN, the first such enzyme to be identified in the archaea, and present phylogenetic analysis indicating that the gene encoding this protein has been acquired by lateral gene transfer (LGT) from eubacteria. As with LigA, we show that Lig...

  10. Critical functions of Rpa3/Ssb3 in S-phase DNA damage responses in fission yeast.

    Directory of Open Access Journals (Sweden)

    Santiago Cavero

    2010-09-01

    Full Text Available Replication Protein A (RPA is a heterotrimeric, single-stranded DNA (ssDNA-binding complex required for DNA replication and repair, homologous recombination, DNA damage checkpoint signaling, and telomere maintenance. Whilst the larger RPA subunits, Rpa1 and Rpa2, have essential interactions with ssDNA, the molecular functions of the smallest subunit Rpa3 are unknown. Here, we investigate the Rpa3 ortholog Ssb3 in Schizosaccharomyces pombe and find that it is dispensable for cell viability, checkpoint signaling, RPA foci formation, and meiosis. However, increased spontaneous Rad11Rpa1 and Rad22Rad52 nuclear foci in ssb3Δ cells indicate genome maintenance defects. Moreover, Ssb3 is required for resistance to genotoxins that disrupt DNA replication. Genetic interaction studies indicate that Ssb3 has a close functional relationship with the Mms1-Mms22 protein complex, which is required for survival after DNA damage in S-phase, and with the mitotic functions of Mus81-Eme1 Holliday junction resolvase that is required for recovery from replication fork collapse. From these studies we propose that Ssb3 plays a critical role in mediating RPA functions that are required for repair or tolerance of DNA lesions in S-phase. Rpa3 orthologs in humans and other species may have a similar function.

  11. Protein ruthenation and DNA alkylation: chlorambucil-functionalized RAPTA complexes and their anticancer activity.

    Science.gov (United States)

    Nazarov, Alexey A; Meier, Samuel M; Zava, Olivier; Nosova, Yulia N; Milaeva, Elena R; Hartinger, Christian G; Dyson, Paul J

    2015-02-28

    Chemotherapeutics for the treatment of tumorigenic conditions that feature novel modes of action are highly sought after to overcome the limitations of current chemotherapies. Herein, we report the conjugation of the alkylating agent chlorambucil to the RAPTA scaffold, a well-established pharmacophore. While chlorambucil is known to alkylate DNA, the RAPTA complexes are known to coordinate to amino acid side chains of proteins. Therefore, such a molecule combines DNA and protein targeting properties in a single molecule. Several chlorambucil-tethered RAPTA derivatives were prepared and tested for their cytotoxicity, stability in water and reactivity to protein and DNA substrates. The anticancer activity of the complexes is widely driven by the cytotoxicity of the chlorambucil moiety. However, especially in the cisplatin-resistant A2780R cells, the chlorambucil-functionalized RAPTA derivatives are in general more cytotoxic than chlorambucil and also a mixture of chlorambucil and the parent organoruthenium RAPTA compound. In a proof-of-principle experiment, the cross-linking of DNA and protein fragments by a chlorambucil-RAPTA derivative was observed.

  12. Molecular Dynamics Studies of Self-Assembling Biomolecules and DNA-functionalized Gold Nanoparticles

    Science.gov (United States)

    Cho, Vince Y.

    This thesis is organized as following. In Chapter 2, we use fully atomistic MD simulations to study the conformation of DNA molecules that link gold nanoparticles to form nanoparticle superlattice crystals. In Chapter 3, we study the self-assembly of peptide amphiphiles (PAs) into a cylindrical micelle fiber by using CGMD simulations. Compared to fully atomistic MD simulations, CGMD simulations prove to be computationally cost-efficient and reasonably accurate for exploring self-assembly, and are used in all subsequent chapters. In Chapter 4, we apply CGMD methods to study the self-assembly of small molecule-DNA hybrid (SMDH) building blocks into well-defined cage-like dimers, and reveal the role of kinetics and thermodynamics in this process. In Chapter 5, we extend the CGMD model for this system and find that the assembly of SMDHs can be fine-tuned by changing parameters. In Chapter 6, we explore superlattice crystal structures of DNA-functionalized gold nanoparticles (DNA-AuNP) with the CGMD model and compare the hybridization.

  13. The effects of proliferation and DNA damage on hematopoietic stem cell function determine aging.

    Science.gov (United States)

    Khurana, Satish

    2016-07-01

    In most of the mammalian tissues, homeostasis as well as injury repair depend upon a small number of resident adult stem cells. The decline in tissue/organ function in aged organisms has been directly linked with poorly functioning stem cells. Altered function of hematopoietic stem cells (HSCs) is at the center of an aging hematopoietic system, a tissue with high cellular turnover. Poorly engrafting, myeloid-biased HSCs with higher levels of DNA damage accumulation are the hallmark features of an aged hematopoietic system. These cells show a higher proliferation rate than their younger counterparts. It was proposed that quiescence of these cells over long period of time leads to accumulation of DNA damage, eventually resulting in poor function/pathological conditions in hematopoietic system. However, various mouse models with premature aging phenotype also show highly proliferative HSCs. This review examines the evidence that links proliferation of HSCs with aging, which leads to functional changes in the hematopoietic system. Developmental Dynamics 245:739-750, 2016. © 2016 Wiley Periodicals, Inc.

  14. Dual functions of ASCIZ in the DNA base damage response and pulmonary organogenesis.

    Directory of Open Access Journals (Sweden)

    Sabine Jurado

    2010-10-01

    Full Text Available Zn²(+-finger proteins comprise one of the largest protein superfamilies with diverse biological functions. The ATM substrate Chk2-interacting Zn²(+-finger protein (ASCIZ; also known as ATMIN and ZNF822 was originally linked to functions in the DNA base damage response and has also been proposed to be an essential cofactor of the ATM kinase. Here we show that absence of ASCIZ leads to p53-independent late-embryonic lethality in mice. Asciz-deficient primary fibroblasts exhibit increased sensitivity to DNA base damaging agents MMS and H2O2, but Asciz deletion knock-down does not affect ATM levels and activation in mouse, chicken, or human cells. Unexpectedly, Asciz-deficient embryos also exhibit severe respiratory tract defects with complete pulmonary agenesis and severe tracheal atresia. Nkx2.1-expressing respiratory precursors are still specified in the absence of ASCIZ, but fail to segregate properly within the ventral foregut, and as a consequence lung buds never form and separation of the trachea from the oesophagus stalls early. Comparison of phenotypes suggests that ASCIZ functions between Wnt2-2b/ß-catenin and FGF10/FGF-receptor 2b signaling pathways in the mesodermal/endodermal crosstalk regulating early respiratory development. We also find that ASCIZ can activate expression of reporter genes via its SQ/TQ-cluster domain in vitro, suggesting that it may exert its developmental functions as a transcription factor. Altogether, the data indicate that, in addition to its role in the DNA base damage response, ASCIZ has separate developmental functions as an essential regulator of respiratory organogenesis.

  15. Fabrication and functionalization of PCB gold electrodes suitable for DNA-based electrochemical sensing.

    Science.gov (United States)

    Salvo, P; Henry, O Y F; Dhaenens, K; Acero Sanchez, J L; Gielen, A; Werne Solnestam, B; Lundeberg, J; O'Sullivan, C K; Vanfleteren, J

    2014-01-01

    The request of high specificity and selectivity sensors suitable for mass production is a constant demand in medical research. For applications in point-of-care diagnostics and therapy, there is a high demand for low cost and rapid sensing platforms. This paper describes the fabrication and functionalization of gold electrodes arrays for the detection of deoxyribonucleic acid (DNA) in printed circuit board (PCB) technology. The process can be implemented to produce efficiently a large number of biosensors. We report an electrolytic plating procedure to fabricate low-density gold microarrays on PCB suitable for electrochemical DNA detection in research fields such as cancer diagnostics or pharmacogenetics, where biosensors are usually targeted to detect a small number of genes. PCB technology allows producing high precision, fast and low cost microelectrodes. The surface of the microarray is functionalized with self-assembled monolayers of mercaptoundodecanoic acid or thiolated DNA. The PCB microarray is tested by cyclic voltammetry in presence of 5 mM of the redox probe K3Fe(CN6) in 0.1 M KCl. The voltammograms prove the correct immobilization of both the alkanethiol systems. The sensor is tested for detecting relevant markers for breast cancer. Results for 5 nM of the target TACSTD1 against the complementary TACSTD1 and non-complementary GRP, MYC, SCGB2A1, SCGB2A2, TOP2A probes show a remarkable detection limit of 0.05 nM and a high specificity.

  16. Functional analysis of Borrelia burgdorferi uvrA in DNA damage protection

    Science.gov (United States)

    Sambir, Mariya; Ivanova, Larisa B.; Bryksin, Anton V.; Godfrey, Henry P.; Cabello, Felipe C.

    2012-01-01

    Bacterial pathogens face constant challenges from DNA-damaging agents generated by host phagocytes. Although Borrelia burgdorferi appears to have many fewer DNA repair enzymes than pathogens with larger genomes, it does contain homologues of uvrA and uvrB (subunits A and B of excinuclease ABC). As a first step to exploring the physiologic function of uvrABbu and its possible role in survival in the host in the face of DNA damaging agents, a partially deleted uvrA mutant was isolated by targeted inactivation. While growth of this mutant was markedly inhibited by UV irradiation, mitomycin C (MMC) and hydrogen peroxide at doses which lacked effect on wild-type B. burgdorferi, its response to pH 6.0 – 6.8 and reactive nitrogen intermediates was similar to that of the wild-type parental strain. The sensitivity of the inactivation mutant to UV irradiation, MMC and peroxide was complemented by an extrachromosomal copy of uvrABbu. We conclude that uvrABbu is functional in B. burgdorferi. PMID:21272060

  17. The relationship between mitochondrial DNA copy number and stallion sperm function.

    Science.gov (United States)

    Darr, Christa R; Moraes, Luis E; Connon, Richard E; Love, Charles C; Teague, Sheila; Varner, Dickson D; Meyers, Stuart A

    2017-05-01

    Mitochondrial DNA (mtDNA) copy number has been utilized as a measure of sperm quality in several species including mice, dogs, and humans, and has been suggested as a potential biomarker of fertility in stallion sperm. The results of the present study extend this recent discovery using sperm samples from American Quarter Horse stallions of varying age. By determining copy number of three mitochondrial genes, cytochrome b (CYTB), NADH dehydrogenase 1 (ND1) and NADH dehydrogenase 4 (ND4), instead of a single gene, we demonstrate an improved understanding of mtDNA fate in stallion sperm mitochondria following spermatogenesis. Sperm samples from 37 stallions ranging from 3 to 24 years old were collected at four breeding ranches in north and central Texas during the 2015 breeding season. Samples were analyzed for sperm motion characteristics, nuclear DNA denaturability and mtDNA copy number. Mitochondrial DNA content in individual sperm was determined by real-time qPCR and normalized with a single copy nuclear gene, Beta actin. Exploratory correlation analysis revealed that total motility was negatively correlated with CYTB copy number and sperm chromatin structure. Stallion age did not have a significant effect on copy number for any of the genes. Copy number differences existed between the three genes with CYTB having the greatest number of copies (20.6 ± 1.2 copies, range: 6.0 to 41.1) followed by ND4 (15.5 ± 0.8 copies, range: 6.7 to 27.8) and finally ND1 (12.0 ± 1.0 copies, range: 0.4 to 26.6) (P copy number across mitochondrial genes is likely to be a result of mtDNA fragmentation and degradation since downregulation of sperm mtDNA occurs during spermatogenesis and may be important for normal sperm function. Beta regression analysis suggested that for every unit increase in mtDNA copy number of CYTB, there was a 4% decrease in the odds of sperm movement (P = 0.001). Influential analysis suggested that results are robust and not highly influenced by

  18. RAD50, an SMC family member with multiple roles in DNA break repair: How does ATP affect function?

    NARCIS (Netherlands)

    E. Kinoshita (Eri); E. van der Linden (Eddy); H. Sanchez (Humberto); C. Wyman (Claire)

    2009-01-01

    textabstractThe protein complex including Mre11, Rad50, and Nbs1 (MRN) functions in DNA double-strand break repair to recognize and process DNA ends as well as signal for cell cycle arrest. Amino acid sequence similarity and overall architecture make Rad50 a member of the structural maintenance of c

  19. The repertoire of DNA-binding transcription factors in prokaryotes: functional and evolutionary lessons.

    Science.gov (United States)

    Perez-Rueda, Ernesto; Martinez-Nuñez, Mario Alberto

    2012-01-01

    The capabilities of organisms to contend with environmental changes depend on their genes and their ability to regulate their expression. DNA-binding transcription factors (TFs) play a central role in this process, because they regulate gene expression positively and/or negatively, depending on the operator context and ligand-binding status. In this review, we summarise recent findings regarding the function and evolution of TFs in prokaryotes. We consider the abundance of TFs in bacteria and archaea, the role of DNA-binding domains and their partner domains, and the effects of duplication events in the evolution of regulatory networks. Finally, a comprehensive picture for how regulatory networks have evolved in prokaryotes is provided.

  20. Functionalized Nanostructures: Redox-Active Porphyrin Anchors for Supramolecular DNA Assemblies

    KAUST Repository

    Börjesson, Karl

    2010-09-28

    We have synthesized and studied a supramolecular system comprising a 39-mer DNA with porphyrin-modified thymidine nucleosides anchored to the surface of large unilamellar vesicles (liposomes). Liposome porphyrin binding characteristics, such as orientation, strength, homogeneity, and binding site size, was determined, suggesting that the porphyrin is well suited as a photophysical and redox-active lipid anchor, in comparison to the inert cholesterol anchor commonly used today. Furthermore, the binding characteristics and hybridization capabilities were studied as a function of anchor size and number of anchoring points, properties that are of importance for our future plans to use the addressability of these redox-active nodes in larger DNA-based nanoconstructs. Electron transfer from photoexcited porphyrin to a lipophilic benzoquinone residing in the lipid membrane was characterized by steady-state and time-resolved fluorescence and verified by femtosecond transient absorption. © 2010 American Chemical Society.

  1. A 7872 cDNA microarray and its use in bovine functional genomics.

    Science.gov (United States)

    Everts, Robin E; Band, Mark R; Liu, Z Lewis; Kumar, Charu G; Liu, Lei; Loor, Juan J; Oliveira, Rosane; Lewin, Harris A

    2005-05-15

    The strategy used to create and annotate a 7872 cDNA microarray from cattle placenta and spleen cDNA sequences is described. This microarray contains approximately 6300 unique genes, as determined by BLASTN and TBLASTX similarity search against the human and mouse UniGene and draft human genome sequence databases (build 34). Sequences on the array were annotated with gene ontology (GO) terms, thereby facilitating data analysis and interpretation. A total of 3244 genes were annotated with GO terms. The array is rich in sequences encoding transcription factors, signal transducers and cell cycle regulators. Current research being conducted with this array is described, and an overview of planned improvements in our microarray platform for cattle functional genomics is presented.

  2. [Duplication of DNA--a mechanism for the development of new functionality of genes].

    Science.gov (United States)

    Maślanka, Roman; Zadrąg-Tęcza, Renata

    2015-01-01

    The amplification of DNA is considered as a mechanism for rapid evolution of organisms. Duplication can be especially advantageous in the case of changing environmental conditions. Whole genome duplication maintains the proper balance between gene expression. This seems to be the main reason why WGD is more favorable than duplication of the fragments of DNA. The polyploidy status disappear as a result of the loss of the majority of duplicated genes. The preservation of duplicated genes is associated with the development of their new functions. Polyploidization is often noted for plants. However due to sequencing technique, the duplications episodes are more frequently reports also for the other systematic taxa, including animals. The occurrence of ancient genome duplication is also considered for yeast Saccharomyces cerevisiae. The existence of two active copies of ribosomal protein genes can be a confirmation of this process. Development of the fermentation process might be one of the probable causes of the yeast genome duplication.

  3. In vitro transcription and translation inhibition via DNA functionalized gold nanoparticles

    Science.gov (United States)

    Conde, J.; de la Fuente, J. M.; Baptista, P. V.

    2010-12-01

    The use of gold nanoparticles (AuNPs) has been gaining momentum as vectors for gene silencing strategies, combining the AuNPs' ease of functionalization with DNA and/or siRNA, high loading capacity and fast uptake by target cells. Here, we used AuNP functionalized with thiolated oligonucleotides to specifically inhibit transcription in vitro, demonstrating the synergetic effect between AuNPs and a specific antisense sequence that blocks the T7 promoter region. Also, AuNPs efficiently protect the antisense oligonucleotide against nuclease degradation, which can thus retain its inhibitory potential. In addition, we demonstrate that AuNPs functionalized with a thiolated oligonucleotide complementary to the ribosome binding site and the start codon, effectively shut down in vitro translation. Together, these two approaches can provide for a simple yet robust experimental set up to test for efficient gene silencing of AuNP-DNA conjugates. What is more, these results show that appropriate functionalization of AuNPs can be used as a dual targeting approach to an enhanced control of gene expression—inhibition of both transcription and translation.

  4. In vitro transcription and translation inhibition via DNA functionalized gold nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Conde, J; Baptista, P V [Centro de Investigacao em Genetica Molecular Humana (CIGMH), Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); De la Fuente, J M, E-mail: pmvb@fct.unl.pt [Instituto de Nanociencia de Aragon, Universidad de Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza (Spain)

    2010-12-17

    The use of gold nanoparticles (AuNPs) has been gaining momentum as vectors for gene silencing strategies, combining the AuNPs' ease of functionalization with DNA and/or siRNA, high loading capacity and fast uptake by target cells. Here, we used AuNP functionalized with thiolated oligonucleotides to specifically inhibit transcription in vitro, demonstrating the synergetic effect between AuNPs and a specific antisense sequence that blocks the T7 promoter region. Also, AuNPs efficiently protect the antisense oligonucleotide against nuclease degradation, which can thus retain its inhibitory potential. In addition, we demonstrate that AuNPs functionalized with a thiolated oligonucleotide complementary to the ribosome binding site and the start codon, effectively shut down in vitro translation. Together, these two approaches can provide for a simple yet robust experimental set up to test for efficient gene silencing of AuNP-DNA conjugates. What is more, these results show that appropriate functionalization of AuNPs can be used as a dual targeting approach to an enhanced control of gene expression-inhibition of both transcription and translation.

  5. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  6. Scaffold functions of 14-3-3 adaptors in B cell immunoglobulin class switch DNA recombination.

    Science.gov (United States)

    Lam, Tonika; Thomas, Lisa M; White, Clayton A; Li, Guideng; Pone, Egest J; Xu, Zhenming; Casali, Paolo

    2013-01-01

    Class switch DNA recombination (CSR) of the immunoglobulin heavy chain (IgH) locus crucially diversifies antibody biological effector functions. CSR involves the induction of activation-induced cytidine deaminase (AID) expression and AID targeting to switch (S) regions by 14-3-3 adaptors. 14-3-3 adaptors specifically bind to 5'-AGCT-3' repeats, which make up for the core of all IgH locus S regions. They selectively target the upstream and downstream S regions that are set to undergo S-S DNA recombination. We hypothesized that 14-3-3 adaptors function as scaffolds to stabilize CSR enzymatic elements on S regions. Here we demonstrate that all seven 14-3-3β, 14-3-3ε, 14-3-3γ, 14-3-3η, 14-3-3σ, 14-3-3τ and 14-3-3ζ adaptors directly interacted with AID, PKA-Cα (catalytic subunit) and PKA-RIα (regulatory inhibitory subunit) and uracil DNA glycosylase (Ung). 14-3-3 adaptors, however, did not interact with AID C-terminal truncation mutant AIDΔ(180-198) or AIDF193A and AIDL196A point-mutants (which have been shown not to bind to S region DNA and fail to mediate CSR). 14-3-3 adaptors colocalized with AID and replication protein A (RPA) in B cells undergoing CSR. 14-3-3 and AID binding to S region DNA was disrupted by viral protein R (Vpr), an accessory protein of human immunodeficiency virus type-1 (HIV-1), which inhibited CSR without altering AID expression or germline IH-CH transcription. Accordingly, we demonstrated that 14-3-3 directly interact with Vpr, which in turn, also interact with AID, PKA-Cα and Ung. Altogether, our findings suggest that 14-3-3 adaptors play important scaffold functions and nucleate the assembly of multiple CSR factors on S regions. They also show that such assembly can be disrupted by a viral protein, thereby allowing us to hypothesize that small molecule compounds that specifically block 14-3-3 interactions with AID, PKA and/or Ung can be used to inhibit unwanted CSR.

  7. Scaffold functions of 14-3-3 adaptors in B cell immunoglobulin class switch DNA recombination.

    Directory of Open Access Journals (Sweden)

    Tonika Lam

    Full Text Available Class switch DNA recombination (CSR of the immunoglobulin heavy chain (IgH locus crucially diversifies antibody biological effector functions. CSR involves the induction of activation-induced cytidine deaminase (AID expression and AID targeting to switch (S regions by 14-3-3 adaptors. 14-3-3 adaptors specifically bind to 5'-AGCT-3' repeats, which make up for the core of all IgH locus S regions. They selectively target the upstream and downstream S regions that are set to undergo S-S DNA recombination. We hypothesized that 14-3-3 adaptors function as scaffolds to stabilize CSR enzymatic elements on S regions. Here we demonstrate that all seven 14-3-3β, 14-3-3ε, 14-3-3γ, 14-3-3η, 14-3-3σ, 14-3-3τ and 14-3-3ζ adaptors directly interacted with AID, PKA-Cα (catalytic subunit and PKA-RIα (regulatory inhibitory subunit and uracil DNA glycosylase (Ung. 14-3-3 adaptors, however, did not interact with AID C-terminal truncation mutant AIDΔ(180-198 or AIDF193A and AIDL196A point-mutants (which have been shown not to bind to S region DNA and fail to mediate CSR. 14-3-3 adaptors colocalized with AID and replication protein A (RPA in B cells undergoing CSR. 14-3-3 and AID binding to S region DNA was disrupted by viral protein R (Vpr, an accessory protein of human immunodeficiency virus type-1 (HIV-1, which inhibited CSR without altering AID expression or germline IH-CH transcription. Accordingly, we demonstrated that 14-3-3 directly interact with Vpr, which in turn, also interact with AID, PKA-Cα and Ung. Altogether, our findings suggest that 14-3-3 adaptors play important scaffold functions and nucleate the assembly of multiple CSR factors on S regions. They also show that such assembly can be disrupted by a viral protein, thereby allowing us to hypothesize that small molecule compounds that specifically block 14-3-3 interactions with AID, PKA and/or Ung can be used to inhibit unwanted CSR.

  8. Bio-bar-code functionalized magnetic nanoparticle label for ultrasensitive flow injection chemiluminescence detection of DNA hybridization.

    Science.gov (United States)

    Bi, Sai; Zhou, Hong; Zhang, Shusheng

    2009-10-07

    A signal amplification strategy based on bio-bar-code functionalized magnetic nanoparticles as labels holds promise to improve the sensitivity and detection limit of the detection of DNA hybridization and single-nucleotide polymorphisms by flow injection chemiluminescence assays.

  9. Doping Level of Boron-Doped Diamond Electrodes Controls the Grafting Density of Functional Groups for DNA Assays.

    Science.gov (United States)

    Švorc, Ĺubomír; Jambrec, Daliborka; Vojs, Marian; Barwe, Stefan; Clausmeyer, Jan; Michniak, Pavol; Marton, Marián; Schuhmann, Wolfgang

    2015-09-02

    The impact of different doping levels of boron-doped diamond on the surface functionalization was investigated by means of electrochemical reduction of aryldiazonium salts. The grafting efficiency of 4-nitrophenyl groups increased with the boron levels (B/C ratio from 0 to 20,000 ppm). Controlled grafting of nitrophenyldiazonium was used to adjust the amount of immobilized single-stranded DNA strands at the surface and further on the hybridization yield in dependence on the boron doping level. The grafted nitro functions were electrochemically reduced to the amine moieties. Subsequent functionalization with a succinic acid introduced carboxyl groups for subsequent binding of an amino-terminated DNA probe. DNA hybridization significantly depends on the probe density which is in turn dependent on the boron doping level. The proposed approach opens new insights for the design and control of doped diamond surface functionalization for the construction of DNA hybridization assays.

  10. Isolation and characterization of a sucrose carrier cDNA from spinach by functional expression in yeast

    National Research Council Canada - National Science Library

    Riesmeier, J.W; Willmitzer, L; Frommer, W.B

    1992-01-01

    ...‐symport, but so far no sucrose carrier gene has been identified. Using an engineered Saccharomyces cerevisiae strain, a cDNA from spinach encoding a sucrose carrier was identified by functional expression...

  11. T-T mismatch-driven biosensor using triple functional DNA-protein conjugates for facile detection of Hg2+.

    Science.gov (United States)

    Wang, Ruoyu; Zhou, Xiaohong; Shi, Hanchang; Luo, Yi

    2016-04-15

    We report herein a T-T mismatch-driven biosensor using triple functional DNA-protein conjugates for facile detection of mercury ions (Hg(2+)) based on evanescent wave fluorescence excitation. Fluorescein-labeled DNA strands and streptavidin molecules were conjugated using heterobifunctional crosslinkers, and the obtained conjugates were named as "Hg(2+) dependent conjugates, HDCs". Initially hybridized with quencher-labeled DNA (Q-DNA) strands, HDCs showed low evanescent wave-induced fluorescence emission signals; however, in the presence of Hg(2+), the DNA moieties of HDCs tended to form hairpin structures stabilized by T-T mismatches, releasing Q-DNA strands, which was accompanied by increases in the fluorescent signals. The novel detection strategy enables the fluorescent detection of mercury ions with high specificity and a low detection limit of 1.06 nM in a facile way.

  12. First-principles photoemission spectroscopy of DNA and RNA nucleobases from Koopmans-compliant functionals

    CERN Document Server

    Nguyen, Ngoc Linh; Ferretti, Andrea; Marzari, Nicola

    2016-01-01

    The need to interpret ultraviolet photoemission data strongly motivates the refinement of first-principles techniques able to accurately predict spectral properties. In this work we employ Koopmans-compliant functionals, constructed to enforce piecewise linearity in approximate density functionals, to calculate the structural and electronic properties of DNA and RNA nucleobases. Our results show that not only ionization potentials and electron affinities are accurately predicted with mean absolute errors < 0.1 eV, but also that calculated photoemission spectra are in excellent agreement with experimental ultraviolet photoemission spectra. In particular, the role and contribution of different tautomers to the photoemission spectra are highlighted and discussed in detail. The structural properties of nucleobases are also investigated, showing an improved description with respect to local and semilocal density-functional theory. Methodologically, our results further consolidate the role of Koopmans-compliant ...

  13. Functional cDNA expression cloning: Pushing it to the limit

    Science.gov (United States)

    OKAYAMA, Hiroto

    2012-01-01

    The 1970s and the following decade are the era of the birth and early development of recombinant DNA technologies, which have entirely revolutionized the modern life science by providing tools that enable us to know the structures of genes and genomes and to dissect their components and understand their functions at the molecular and submolecular levels. One major objective of the life sciences is to achieve molecular and chemical understandings of the functions of genes and their encoded proteins, which are responsible for the manifestation of all biological phenomena in organisms. In the early 1980s, I developed, together with Paul Berg, a new technique that enables the cloning of full-length complementary DNAs (cDNAs) on the basis of their functional expression in a given cell of interest. I review the development, application and future implications in the life sciences of this gene-cloning technique. PMID:22450538

  14. Non-homologous end joining-mediated functional marker selection for DNA cloning in the yeast Kluyveromyces marxianus.

    Science.gov (United States)

    Hoshida, Hisashi; Murakami, Nobutada; Suzuki, Ayako; Tamura, Ryoko; Asakawa, Jun; Abdel-Banat, Babiker M A; Nonklang, Sanom; Nakamura, Mikiko; Akada, Rinji

    2014-01-01

    The cloning of DNA fragments into vectors or host genomes has traditionally been performed using Escherichia coli with restriction enzymes and DNA ligase or homologous recombination-based reactions. We report here a novel DNA cloning method that does not require DNA end processing or homologous recombination, but that ensures highly accurate cloning. The method exploits the efficient non-homologous end-joining (NHEJ) activity of the yeast Kluyveromyces marxianus and consists of a novel functional marker selection system. First, to demonstrate the applicability of NHEJ to DNA cloning, a C-terminal-truncated non-functional ura3 selection marker and the truncated region were PCR-amplified separately, mixed and directly used for the transformation. URA3(+) transformants appeared on the selection plates, indicating that the two DNA fragments were correctly joined by NHEJ to generate a functional URA3 gene that had inserted into the yeast chromosome. To develop the cloning system, the shortest URA3 C-terminal encoding sequence that could restore the function of a truncated non-functional ura3 was determined by deletion analysis, and was included in the primers to amplify target DNAs for cloning. Transformation with PCR-amplified target DNAs and C-terminal truncated ura3 produced numerous transformant colonies, in which a functional URA3 gene was generated and was integrated into the chromosome with the target DNAs. Several K. marxianus circular plasmids with different selection markers were also developed for NHEJ-based cloning and recombinant DNA construction. The one-step DNA cloning method developed here is a relatively simple and reliable procedure among the DNA cloning systems developed to date.

  15. Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function.

    Directory of Open Access Journals (Sweden)

    Sugith Babu Badugu

    Full Text Available The eukaryotic Meiotic Recombination protein 11 (Mre11 plays pivotal roles in the DNA damage response (DDR. Specifically, Mre11 senses and signals DNA double strand breaks (DSB and facilitates their repair through effector proteins belonging to either homologous recombination (HR or non-homologous end joining (NHEJ repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11 that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11. Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N. PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium.

  16. Identification of Plasmodium falciparum DNA Repair Protein Mre11 with an Evolutionarily Conserved Nuclease Function.

    Science.gov (United States)

    Badugu, Sugith Babu; Nabi, Shaik Abdul; Vaidyam, Pratap; Laskar, Shyamasree; Bhattacharyya, Sunanda; Bhattacharyya, Mrinal Kanti

    2015-01-01

    The eukaryotic Meiotic Recombination protein 11 (Mre11) plays pivotal roles in the DNA damage response (DDR). Specifically, Mre11 senses and signals DNA double strand breaks (DSB) and facilitates their repair through effector proteins belonging to either homologous recombination (HR) or non-homologous end joining (NHEJ) repair mechanisms. In the human malaria parasite Plasmodium falciparum, HR and alternative-NHEJ have been identified; however, little is known about the upstream factors involved in the DDR of this organism. In this report, we identify a putative ortholog of Mre11 in P. falciparum (PfalMre11) that shares 22% sequence similarity to human Mre11. Homology modeling reveals striking structural resemblance of the predicted PfalMre11 nuclease domain to the nuclease domain of Saccharomyces cerevisiae Mre11 (ScMre11). Complementation analyses reveal functional conservation of PfalMre11 nuclease activity as demonstrated by the ability of the PfalMre11 nuclease domain, in conjunction with the C-terminal domain of ScMre11, to functionally complement an mre11 deficient yeast strain. Functional complementation was virtually abrogated by an amino acid substitution in the PfalMre11 nuclease domain (D398N). PfalMre11 is abundant in the mitotically active trophozoite and schizont stages of P. falciparum and is up-regulated in response to DNA damage, suggesting a role in the DDR. PfalMre11 exhibits physical interaction with PfalRad50. In addition, yeast 2-hybrid studies show that PfalMre11 interacts with ScRad50 and ScXrs2, two important components of the well characterized Mre11-Rad50-Xrs2 complex which is involved in DDR signaling and repair in S. cerevisiae, further supporting a role for PfalMre11 in the DDR. Taken together, these findings provide evidence that PfalMre11 is an evolutionarily conserved component of the DDR in Plasmodium.

  17. Bmi1 regulates mitochondrial function and the DNA damage response pathway.

    Science.gov (United States)

    Liu, Jie; Cao, Liu; Chen, Jichun; Song, Shiwei; Lee, In Hye; Quijano, Celia; Liu, Hongjun; Keyvanfar, Keyvan; Chen, Haoqian; Cao, Long-Yue; Ahn, Bong-Hyun; Kumar, Neil G; Rovira, Ilsa I; Xu, Xiao-Ling; van Lohuizen, Maarten; Motoyama, Noboru; Deng, Chu-Xia; Finkel, Toren

    2009-05-21

    Mice deficient in the Polycomb repressor Bmi1 develop numerous abnormalities including a severe defect in stem cell self-renewal, alterations in thymocyte maturation and a shortened lifespan. Previous work has implicated de-repression of the Ink4a/Arf (also known as Cdkn2a) locus as mediating many of the aspects of the Bmi1(-/-) phenotype. Here we demonstrate that cells derived from Bmi1(-/-) mice also have impaired mitochondrial function, a marked increase in the intracellular levels of reactive oxygen species and subsequent engagement of the DNA damage response pathway. Furthermore, many of the deficiencies normally observed in Bmi1(-/-) mice improve after either pharmacological treatment with the antioxidant N-acetylcysteine or genetic disruption of the DNA damage response pathway by Chk2 (also known as Chek2) deletion. These results demonstrate that Bmi1 has an unexpected role in maintaining mitochondrial function and redox homeostasis and indicate that the Polycomb family of proteins can coordinately regulate cellular metabolism with stem and progenitor cell function.

  18. Genetic and functional diversity of ubiquitous DNA viruses in selected Chinese agricultural soils

    Science.gov (United States)

    Han, Li-Li; Yu, Dan-Ting; Zhang, Li-Mei; Shen, Ju-Pei; He, Ji-Zheng

    2017-01-01

    Viral community structures in complex agricultural soils are largely unknown. Electron microscopy and viromic analyses were conducted on six typical Chinese agricultural soil samples. Tailed bacteriophages, spherical and filamentous viral particles were identified by the morphological analysis. Based on the metagenomic analysis, single-stranded DNA viruses represented the largest viral component in most of the soil habitats, while the double-stranded DNA viruses belonging to the Caudovirales order were predominanted in Jiangxi-maize soils. The majority of functional genes belonged to the subsystem “phages, prophages, transposable elements, and plasmids”. Non-metric multidimensional analysis of viral community showed that the environment medium type was the most important driving factor for the viral community structure. For the major viral groups detected in all samples (Microviridae and Caudovirales), the two groups gathered viruses from different sites and similar genetic composition, indicating that viral diversity was high on a local point but relatively limited on a global scale. This is a novel report of viral diversity in Chinese agricultural soils, and the abundance, taxonomic, and functional diversity of viruses that were observed in different types of soils will aid future soil virome studies and enhance our understanding of the ecological functions of soil viruses. PMID:28327667

  19. ELK1 uses different DNA binding modes to regulate functionally distinct classes of target genes.

    Directory of Open Access Journals (Sweden)

    Zaneta Odrowaz

    Full Text Available Eukaryotic transcription factors are grouped into families and, due to their similar DNA binding domains, often have the potential to bind to the same genomic regions. This can lead to redundancy at the level of DNA binding, and mechanisms are required to generate specific functional outcomes that enable distinct gene expression programmes to be controlled by a particular transcription factor. Here we used ChIP-seq to uncover two distinct binding modes for the ETS transcription factor ELK1. In one mode, other ETS transcription factors can bind regulatory regions in a redundant fashion; in the second, ELK1 binds in a unique fashion to another set of genomic targets. Each binding mode is associated with different binding site features and also distinct regulatory outcomes. Furthermore, the type of binding mode also determines the control of functionally distinct subclasses of genes and hence the phenotypic response elicited. This is demonstrated for the unique binding mode where a novel role for ELK1 in controlling cell migration is revealed. We have therefore uncovered an unexpected link between the type of binding mode employed by a transcription factor, the subsequent gene regulatory mechanisms used, and the functional categories of target genes controlled.

  20. African swine fever virus ORF P1192R codes for a functional type II DNA topoisomerase.

    Science.gov (United States)

    Coelho, João; Martins, Carlos; Ferreira, Fernando; Leitão, Alexandre

    2015-01-01

    Topoisomerases modulate the topological state of DNA during processes, such as replication and transcription, that cause overwinding and/or underwinding of the DNA. African swine fever virus (ASFV) is a nucleo-cytoplasmic double-stranded DNA virus shown to contain an OFR (P1192R) with homology to type II topoisomerases. Here we observed that pP1192R is highly conserved among ASFV isolates but dissimilar from other viral, prokaryotic or eukaryotic type II topoisomerases. In both ASFV/Ba71V-infected Vero cells and ASFV/L60-infected pig macrophages we detected pP1192R at intermediate and late phases of infection, cytoplasmically localized and accumulating in the viral factories. Finally, we used a Saccharomyces cerevisiae temperature-sensitive strain in order to demonstrate, through complementation and in vitro decatenation assays, the functionality of P1192R, which we further confirmed by mutating its predicted catalytic residue. Overall, this work strengthens the idea that P1192R constitutes a target for studying, and possibly controlling, ASFV transcription and replication.

  1. An Integrated Microfluidic Processor for DNA-Encoded Combinatorial Library Functional Screening

    Science.gov (United States)

    2017-01-01

    DNA-encoded synthesis is rekindling interest in combinatorial compound libraries for drug discovery and in technology for automated and quantitative library screening. Here, we disclose a microfluidic circuit that enables functional screens of DNA-encoded compound beads. The device carries out library bead distribution into picoliter-scale assay reagent droplets, photochemical cleavage of compound from the bead, assay incubation, laser-induced fluorescence-based assay detection, and fluorescence-activated droplet sorting to isolate hits. DNA-encoded compound beads (10-μm diameter) displaying a photocleavable positive control inhibitor pepstatin A were mixed (1920 beads, 729 encoding sequences) with negative control beads (58 000 beads, 1728 encoding sequences) and screened for cathepsin D inhibition using a biochemical enzyme activity assay. The circuit sorted 1518 hit droplets for collection following 18 min incubation over a 240 min analysis. Visual inspection of a subset of droplets (1188 droplets) yielded a 24% false discovery rate (1166 pepstatin A beads; 366 negative control beads). Using template barcoding strategies, it was possible to count hit collection beads (1863) using next-generation sequencing data. Bead-specific barcodes enabled replicate counting, and the false discovery rate was reduced to 2.6% by only considering hit-encoding sequences that were observed on >2 beads. This work represents a complete distributable small molecule discovery platform, from microfluidic miniaturized automation to ultrahigh-throughput hit deconvolution by sequencing. PMID:28199790

  2. Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2014-08-01

    Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150-400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as "tuning knobs" in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.

  3. DNA and protein change in tissues probed by Kubelka-Munk spectral function

    Science.gov (United States)

    Yang, Yuanlong; Celmer, Edward J.; Koutcher, Jason A.; Alfano, Robert R.

    2000-04-01

    Normal, fibroadenoma, malignant, and adipose breast tissues were investigated using Kubelka-Munk Spectral Function (KMSF). The spectral features in KMSF were identified and compared with absorption spectra determined by transmission measurements. A specified spectral feature measured in adipose tissue was assigned to (beta) -carotene, which can be used to separate fat form other molecular components in breast tissues. The peaks of (KMF) at 260nm and 280nm were attributed to DNA and proteins. The signal amplitude over 255nm to 265nm and 275nm to 285nm were found to be different for malignant fibroadenoma, and normal tissues.

  4. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), bot...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair.......The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), both...... encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U...

  5. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities.

    Science.gov (United States)

    Guo, Yang; Kragelund, Birthe B; White, Malcolm F; Peng, Xu

    2015-06-19

    The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), both encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5' → 3' ssDNA exonuclease activity, in addition to the previously demonstrated ssDNA endonuclease activity. Further, in vitro pull-down assay demonstrated interactions between gp17 and gp18 and between gp18 and gp19 with the former being mediated by the intrinsically disordered C-terminus of gp17. The strand-displacement replication mode proposed previously for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair.

  6. Cytotoxicity and DNA cleavage with core-shell nanocomposites functionalized by a KH domain DNA binding peptide

    Science.gov (United States)

    Bazak, Remon; Ressl, Jan; Raha, Sumita; Doty, Caroline; Liu, William; Wanzer, Beau; Salam, Seddik Abdel; Elwany, Samy; Paunesku, Tatjana; Woloschak, Gayle E.

    2013-11-01

    A nanoconjugate was composed of metal oxide nanoparticles decorated with peptides and fluorescent dye and tested for DNA cleavage following UV light activation. The peptide design was based on a DNA binding domain, the so called KH domain of the hnRNPK protein. This ``KH peptide'' enabled cellular uptake of nanoconjugates and their entry into cell nuclei. The control nanoconjugate carried no peptide; it consisted only of the metal oxide nanoparticle prepared as Fe3O4@TiO2 nanocomposite and the fluorescent dye alizarin red S. These components of either construct are responsible for nanoconjugate activation by UV light and the resultant production of reactive oxygen species (ROS). Production of ROS at different subcellular locations causes damage to different components of cells: only nanoconjugates inside cell nuclei can be expected to cause DNA cleavage. Degradation of cellular DNA with KH peptide decorated nanoconjugates exceeded the DNA damage obtained from control, no-peptide nanoconjugate counterparts. Moreover, caspase activation and cell death were more extensive in the same cells.A nanoconjugate was composed of metal oxide nanoparticles decorated with peptides and fluorescent dye and tested for DNA cleavage following UV light activation. The peptide design was based on a DNA binding domain, the so called KH domain of the hnRNPK protein. This ``KH peptide'' enabled cellular uptake of nanoconjugates and their entry into cell nuclei. The control nanoconjugate carried no peptide; it consisted only of the metal oxide nanoparticle prepared as Fe3O4@TiO2 nanocomposite and the fluorescent dye alizarin red S. These components of either construct are responsible for nanoconjugate activation by UV light and the resultant production of reactive oxygen species (ROS). Production of ROS at different subcellular locations causes damage to different components of cells: only nanoconjugates inside cell nuclei can be expected to cause DNA cleavage. Degradation of cellular DNA

  7. cDNA cloning and function analysis of two novel erythroid differentiation related genes

    Institute of Scientific and Technical Information of China (English)

    WANG; Xin; (王鑫); WANG; Duncheng; (王敦成); CHEN; Xing; (陈兴),; HU; Meiru; (胡美茹); WANG; Jian'an; (王建安); LI; Yan; (黎燕); GUO; Ning; (郭宁); SHEN; Beifen; (沈倍奋)

    2001-01-01

    Our previous studies showed that some nuclear proteins that were expressed especially during terminal differentiation of erythroid cells might interact directly or indirectly with HS2 sequence to form the HS2-protein complexes and thus play an important role in the globin gene regulation and erythroid differentiation. Monoclonal antibodies against the nuclear proteins of terminal differentiated erythroid cells, including intermediate and late erythroblasts of human fetal liver and hemin induced K562 cells, were prepared by hybridoma technique. The monoclonal antibodies were used to screen l-gtll human cDNA expression library of fetal liver in order to obtain the rele-vant cDNA clones. By the analysis of their cDNA clones and the identification of the proteins' func-tions, the regulation mechanism of the HS2 binding proteins might be better understood. Two cDNA clones (GenBank accession number AF040247 and AF040248 respectively) were obtained and one of them owns a full length and the other encodes a protein characterized by a leucine-zipper domain. Both of them were expressed differentially in K562 cells and hemin-induced K562 cells. The evidence suggested that both of them were involved in erythroid differentiation. We investigat-ed the expression pattern of EDRF1 and EDRF2 by RT-PCR technique. The results of RT-PCR suggested that EDRF1 and EDRF2 might play a critical role in early stage of organ development and histological differentiation. EDRF1 and EDRF2 might start the program of erythroid develop-ment, and also regulate the development of erythroid tissue and the expression of globin gene at different stage of the development.

  8. cDNA cloning and function analysis of two novel erythroid differentiation related genes

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Our previous studies showed that some nuclear proteins that wereexpressed especially during terminal differentiation of erythroid cells might interact directly or indirectly with HS2 sequence to form the HS2-protein complexes and thus play an important role in the globin gene regulation and erythroid differentiation. Monoclonal antibodies against the nuclear proteins of terminal differentiated erythroid cells, including intermediate and late erythroblasts of human fetal liver and hemin induced K562 cells, were prepared by hybridoma technique. The monoclonal antibodies were used to screen l-gtll human cDNA expression library of fetal liver in order to obtain the rele-vant cDNA clones. By the analysis of their cDNA clones and the identification of the proteins' func-tions, the regulation mechanism of the HS2 binding proteins might be better understood. Two cDNA clones (GenBank accession number AF040247 and AF040248 respectively) were obtained and one of them owns a full length and the other encodes a protein characterized by a leucine-zipper domain. Both of them were expressed differentially in K562 cells and hemin-induced K562 cells. The evidence suggested that both of them were involved in erythroid differentiation. We investigat-ed the expression pattern of EDRF1 and EDRF2 by RT-PCR technique. The results of RT-PCR suggested that EDRF1 and EDRF2 might play a critical role in early stage of organ development and histological differentiation. EDRF1 and EDRF2 might start the program of erythroid develop-ment, and also regulate the development of erythroid tissue and the expression of globin gene at different stage of the development.

  9. Development of the DNA-methylase system as a function of the HeLa cell cycle

    Energy Technology Data Exchange (ETDEWEB)

    Delfini, C.; Lo Presti, E.; Eremenko, T.; Volpe, P.

    1986-01-01

    The major part of DNA-methylation occurs during the S-phase, semiconservatively involving the newly synthesized chains. Such methylation was thought to be performed by a maintenance enzyme. However, the existence of at least two DNA-methylases was suggested functioning in early S on GC-rich and in late S on AT-rich sequences, correspondingly. Moreover, some extra-S-phase DNA-methylation was found. An investigation was thus undertaken to ascertain whether the DNA-methylase activity is due always to the same enzyme in synchronized cells or may belong to different DNA-methylases appearing at given cell cycle stages. The data reported here suggested that two peaks of DNA-methylase activity (the first small, the second large) appear in S. Anomain S- and G/sub 1/-methylation reactions follow different patterns against pH. This supports the hypothesis that the corresponding methylases might accompany during interphase the DNA-polymerases alpha or beta; accumulation of a specific DNA-methylase in late G/sub 1/ might account for complection of the DNA repair-modification enzyme system before replication.

  10. DnaA and the timing of chromosome replication in Es-cherichia coli as a function of growth rate

    Directory of Open Access Journals (Sweden)

    Grant Matthew AA

    2011-12-01

    Full Text Available Abstract Background In Escherichia coli, overlapping rounds of DNA replication allow the bacteria to double in faster times than the time required to copy the genome. The precise timing of initiation of DNA replication is determined by a regulatory circuit that depends on the binding of a critical number of ATP-bound DnaA proteins at the origin of replication, resulting in the melting of the DNA and the assembly of the replication complex. The synthesis of DnaA in the cell is controlled by a growth-rate dependent, negatively autoregulated gene found near the origin of replication. Both the regulatory and initiation activity of DnaA depend on its nucleotide bound state and its availability. Results In order to investigate the contributions of the different regulatory processes to the timing of initiation of DNA replication at varying growth rates, we formulate a minimal quantitative model of the initiator circuit that includes the key ingredients known to regulate the activity of the DnaA protein. This model describes the average-cell oscillations in DnaA-ATP/DNA during the cell cycle, for varying growth rates. We evaluate the conditions under which this ratio attains the same threshold value at the time of initiation, independently of the growth rate. Conclusions We find that a quantitative description of replication initiation by DnaA must rely on the dependency of the basic parameters on growth rate, in order to account for the timing of initiation of DNA replication at different cell doubling times. We isolate two main possible scenarios for this, depending on the roles of DnaA autoregulation and DnaA ATP-hydrolysis regulatory process. One possibility is that the basal rate of regulatory inactivation by ATP hydrolysis must vary with growth rate. Alternatively, some parameters defining promoter activity need to be a function of the growth rate. In either case, the basal rate of gene expression needs to increase with the growth rate, in

  11. Methamidophos alters sperm function and DNA at different stages of spermatogenesis in mice

    Energy Technology Data Exchange (ETDEWEB)

    Urióstegui-Acosta, Mayrut; Hernández-Ochoa, Isabel [Departamento de Toxicología, CINVESTAV-IPN, D.F. (Mexico); Sánchez-Gutiérrez, Manuel [Instituto de Ciencias de la Salud, Universidad Autónoma del Estado de Hidalgo, Hidalgo (Mexico); Piña-Guzmán, Belem [Instituto Politécnico Nacional-UPIBI, D.F. (Mexico); Rafael-Vázquez, Leticia; Solís-Heredia, M.J.; Martínez-Aguilar, Gerardo [Departamento de Toxicología, CINVESTAV-IPN, D.F. (Mexico); Quintanilla-Vega, Betzabet, E-mail: mquintan@cinvestav.mx [Departamento de Toxicología, CINVESTAV-IPN, D.F. (Mexico)

    2014-09-15

    Methamidophos (MET) is a highly toxic organophosphate (OP) pesticide that is widely used in developing countries. MET has male reproductive effects, including decreased fertility. We evaluated MET effects on sperm quality, fertilization and DNA integrity, exploring the sensitivity of different stages of spermatogenesis. Adult male mice received MET (3.75 or 5 mg/kg-bw/ip/day/4 days) and were euthanized 1, 28 or 45 days post-treatment (dpt) to evaluate MET's effects on epididymal maturation, meiosis or mitosis, respectively. Spermatozoa were obtained from the cauda epididymis–vas deferens and were evaluated for sperm quality, acrosome reaction (AR; Coomassie staining), mitochondrial membrane potential (by JC-1), DNA damage (comet assay), oxidative damage (malondialdehyde (MDA) production), in vitro fertilization and protein phosphorylation (immunodetection), and erythrocyte acetylcholinesterase (AChE) activity. At 1-dpt, MET inhibited AChE (43–57%) and increased abnormal cells (6%). While at 28- and 45-dpt, sperm motility and viability were significantly reduced with an increasing MET dose, and abnormal morphology increased at 5 mg/kg/day/4 days. MDA and mitochondrial activity were not affected at any dose or time. DNA damage (OTM and %DNA) was observed at 5 mg/kg/day/4 days in a time-dependent manner, whereas both parameters were altered in cells from mice exposed to 3.75 mg/kg/day/4 days only at 28-dpt. Depending on the time of collection, initial-, spontaneous- and induced-AR were altered at 5 mg/kg/day/4 days, and the fertilization capacity also decreased. Sperm phosphorylation (at serine and tyrosine residues) was observed at all time points. Data suggest that meiosis and mitosis are the more sensitive stages of spermatogenesis for MET reproductive toxicity compared to epididymal maturation. - Highlights: • Methamidophos alters sperm cell function at different stages of spermatogenesis. • Testicular stages of spermatogenesis are more sensitive to

  12. Effects of Trypanocidal Drugs on the Replication and Function of Kinetoplast (Mitochondrial) DNA in Trypanosomes

    Science.gov (United States)

    1975-08-20

    E., Riou, G. , and Festy, B. 1972. Molecular Organization of the Kinetoplast DNA in Trypanosoma cruzi Treated with Berenil, a DNA Interacting Drug...8). A detailed examination of klnetoplast DNA isolated from berenil- treated T. cruzi has shown that many of the small circular DNA

  13. Structural and functional studies of a large winged Z-DNA-binding domain of Danio rerio protein kinase PKZ.

    Science.gov (United States)

    Subramani, Vinod Kumar; Kim, Doyoun; Yun, Kyunghee; Kim, Kyeong Kyu

    2016-07-01

    The Z-DNA-binding domain of PKZ from zebrafish (Danio rerio; drZαPKZ ) contains the largest β-wing among known Z-DNA-binding domains. To elucidate the functional implication of the β-wing, we solved the crystal structure of apo-drZαPKZ . Structural comparison with its Z-DNA-bound form revealed a large conformational change within the β-wing during Z-DNA binding. Biochemical studies of protein mutants revealed that two basic residues in the β-wing are responsible for Z-DNA recognition as well as fast B-Z transition. Therefore, the extra basic residues in the β-wing of drZαPKZ are necessary for the fast B-Z transition activity.

  14. Rapid Non-Crosslinking Aggregation of DNA-Functionalized Gold Nanorods and Nanotriangles for Colorimetric Single-Nucleotide Discrimination.

    Science.gov (United States)

    Wang, Guoqing; Akiyama, Yoshitsugu; Takarada, Tohru; Maeda, Mizuo

    2016-01-01

    Gold nanoparticles modified with DNA duplexes are rapidly and spontaneously aggregated at high ionic strength. In contrast, this aggregation is greatly suppressed when the DNA duplex has a single-base mismatch or a single-nucleotide overhang located at the outermost surface of the particle. These colloidal features emerge irrespective of the size and composition of the particle core; however, the effects of the shape remain unexplored. Using gold nanorods and nanotriangles (nanoplatelets), we show herein that both remarkable rapidity in colloidal aggregation and extreme susceptibility to DNA structural perturbations are preserved, regardless of the shape and aspect ratio of the core. It is also demonstrated that the DNA-modified gold nanorods and nanotriangles are applicable to naked-eye detection of a single-base difference in a gene model. The current study corroborates the generality of the unique colloidal properties of DNA-functionalized nanoparticles, and thus enhances the feasibility of their practical use.

  15. DNA barcoding of life: a classification of uses according to function and scale after ten years of development

    Directory of Open Access Journals (Sweden)

    Nancai Pei

    2013-09-01

    Full Text Available DNA barcoding technology provides molecular information, standard dataset platforms, and universal technical regulations for modern biological research. We briefly review the history of DNA barcoding between 2003 and 2012, and classify DNA barcoding into three types of biological function: basic function (e.g., storing data, and identifying species, extending function (e.g., building phylogenies, serving specific subjects, and compiling biological atlas and potential function (e.g., revealing cryptic species. We sort DNA barcoding studies at three levels: clade scale (e.g., familial and/or generic taxa, community scale (e.g., biotic communities in nature reserves and permanent forest dynamics plots, and regional scale (e.g., biodiversity hotpots. We further list ten major research programs proposed by the International Barcode of Life, which are related to DNA barcoding approaches from the prospective of systematics and taxonomy, biodiversity conservation, evolutionary ecology and phylogenetics, and the construction of digital platforms. We appreciate the huge capability of barcoding technology in the field of biological sciences, and also realize the challenges of DNA barcoding utilizations in multidisciplinary studies and the essential to add more tests before the large-scale applications.

  16. mtDNA Mutagenesis Disrupts Pluripotent Stem Cell Function by Altering Redox Signaling

    OpenAIRE

    Hämäläinen, Riikka H.; Ahlqvist, Kati J.; Ellonen, Pekka; Lepistö, Maija; Logan, Angela; Otonkoski, Timo; Murphy, Michael P.; Suomalainen, Anu

    2015-01-01

    Summary mtDNA mutagenesis in somatic stem cells leads to their dysfunction and to progeria in mouse. The mechanism was proposed to involve modification of reactive oxygen species (ROS)/redox signaling. We studied the effect of mtDNA mutagenesis on reprogramming and stemness of pluripotent stem cells (PSCs) and show that PSCs select against specific mtDNA mutations, mimicking germline and promoting mtDNA integrity despite their glycolytic metabolism. Furthermore, mtDNA mutagenesis is associate...

  17. Electrochemical functionalization of polypyrrole through amine oxidation of poly(amidoamine) dendrimers: Application to DNA biosensor.

    Science.gov (United States)

    Miodek, Anna; Mejri-Omrani, Nawel; Khoder, Rabih; Korri-Youssoufi, Hafsa

    2016-07-01

    Electrochemical patterning method has been developed to fabricate composite based on polypyrrole (PPy) film and poly(amidoamine) dendrimers of fourth generation (PAMAM G4). PPy layer was generated using electrochemical polymerization of pyrrole on a gold electrode. PPy film was then modified with PAMAM G4 using amines electro-oxidation method. Covalent bonding of PAMAM G4 and the formation of PPy-PAMAM composite was characterized using Fourier Transform Infrared Spectroscopy (FT-IR) and X-ray Photoelectron Spectroscopy (XPS). Ferrocenyl groups were then attached to such surface as a redox marker. Electrochemical properties of the modified nanomaterial (PPy-PAMAM-Fc) were studied using both amperometric and impedimetric methods to demonstrate the efficiency of electron transfer through the modified PPy layer. The obtained electrical and electrochemical properties were compared to a composite where PPy bearing carboxylic acid functions was chemically modified with PAMAM G4 by covalent attachment through formation of amid bond (PPy-CONH-PAMAM). The above mentioned studies showed that electrochemical patterning does not disturb the electronic properties of PPy. The effect of the number of functional groups introduced by the electrochemical patterning was demonstrated through the association of various compounds (ethylenediamine, PAMAM G2 and PAMAM G6). We demonstrated that such compounds could be applied in the biosensors technology. The modified PPy-PAMAM-Fc was evaluated as a platform for DNA sensing. High performance in the DNA detection by variation of the electrochemical signal of ferrocene was obtained with detection limit of 0.4 fM. Furthermore, such approach of electrochemical patterning by oxidation of amines could be applied for chemical modification of PPy and open a new way in various biosensing application involving functionalized PPy.

  18. A Novel Aspect of Tumorigenesis—BMI1 Functions in Regulating DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Xiaozeng Lin

    2015-12-01

    Full Text Available BMI1 plays critical roles in maintaining the self-renewal of hematopoietic, neural, intestinal stem cells, and cancer stem cells (CSCs for a variety of cancer types. BMI1 promotes cell proliferative life span and epithelial to mesenchymal transition (EMT. Upregulation of BMI1 occurs in multiple cancer types and is associated with poor prognosis. Mechanistically, BMI1 is a subunit of the Polycomb repressive complex 1 (PRC1, and binds the catalytic RING2/RING1b subunit to form a functional E3 ubiquitin ligase. Through mono-ubiquitination of histone H2A at lysine 119 (H2A-K119Ub, BMI1 represses multiple gene loci; among these, the INK4A/ARF locus has been most thoroughly investigated. The locus encodes the p16INK4A and p14/p19ARF tumor suppressors that function in the pRb and p53 pathways, respectively. Its repression contributes to BMI1-derived tumorigenesis. BMI1 also possesses other oncogenic functions, specifically its regulative role in DNA damage response (DDR. In this process, BMI1 ubiquitinates histone H2A and γH2AX, thereby facilitating the repair of double-stranded DNA breaks (DSBs through stimulating homologous recombination and non-homologous end joining. Additionally, BMI1 compromises DSB-induced checkpoint activation independent of its-associated E3 ubiquitin ligase activity. We review the emerging role of BMI1 in DDR regulation and discuss its impact on BMI1-derived tumorigenesis.

  19. Plasticity of BRCA2 function in homologous recombination: genetic interactions of the PALB2 and DNA binding domains.

    Directory of Open Access Journals (Sweden)

    Nicolas Siaud

    2011-12-01

    Full Text Available The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR. Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations.

  20. Global DNA hypomethylation has no impact on lung function or serum inflammatory and fibrosis cytokines in asbestos-exposed population.

    Science.gov (United States)

    Yu, Min; Lou, Jianlin; Xia, Hailing; Zhang, Min; Zhang, Yixiao; Chen, Junqiang; Zhang, Xing; Ying, Shibo; Zhu, Lijin; Liu, Lihong; Jia, Guang

    2017-04-01

    To examine the effect of asbestos exposure on global DNA methylation and determine whether lung function and inflammatory and fibrosis biomarkers are correlated with the methylation state. A total of 26 healthy subjects without asbestos exposure (Group 1), 47 healthy subjects with exposure (Group 2), and 52 subjects with benign asbestos-related disorders (ARDs) (Group 3) participated in this cross-sectional study. Blood global 5-methylcytosine (5mC) and serum TNF-α, collagen IV, CCL5 and CC16 concentrations were analyzed using enzyme-linked immunosorbent assay-like assays. Spirometric maneuvers were performed to assess lung function. Decreased 5mC levels were observed in Groups 2 and 3 compared to Group 1, irrespective of lung function (p asbestos exposure. Asbestos exposure causes global DNA hypomethylation. DNA hypomethylation has no influence on serum biomarkers and lung function in asbestos-exposed population with or without pleural and pulmonary parenchymal abnormalities.

  1. Relations between the loop transposition of DNA G-quadruplex and the catalytic function of DNAzyme.

    Science.gov (United States)

    Cheng, Mingpan; Zhou, Jun; Jia, Guoqing; Ai, Xuanjun; Mergny, Jean-Louis; Li, Can

    2017-08-01

    The structures of DNA G-quadruplexes are essential for their functions in vivo and in vitro. Our present study revealed that sequential order of the three G-quadruplex loops, that is, loop transposition, could be a critical factor to determinate the G-quadruplex conformation and consequently improved the catalytic function of G-quadruplex based DNAzyme. In the presence of 100mM K(+), loop transposition induced one of the G-quadruplex isomers which shared identical loops but differed in the sequential order of loops into a hybrid topology while the others into predominately parallel topologies. (1)D NMR spectroscopy and mutation analysis suggested that the hydrogen bonding from loops residues with nucleotides in flanking sequences may be responsible for the stabilization of the different conformations. A well-known DNAzyme consisting of G-quadruplex and hemin (Ferriprotoporphyrin IX chloride) was chosen to test the catalytic function. We found that the loop transposition could enhance the reaction rate obviously by increasing the hemin binding affinity to G-quadruplex. These findings disclose the relations between the loop transposition, G-quadruplex conformation and catalytic function of DNAzyme. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Structure-Function Analysis of the DNA Translocating Portal of the Bacteriophage T4 Packaging Machine

    Science.gov (United States)

    Padilla-Sanchez, Victor; Gao, Song; Kim, Hyung Rae; Kihara, Daisuke; Sun, Lei; Rossmann, Michael G.; Rao, Venigalla B.

    2013-01-01

    Tailed bacteriophages and herpesviruses consist of a structurally well conserved dodecameric portal at a special five-fold vertex of the capsid. The portal plays critical roles in head assembly, genome packaging, neck/tail attachment, and genome ejection. Although the structures of portals from phages φ29, SPP1 and P22 have been determined, their mechanistic roles have not been well understood. Structural analysis of phage T4 portal (gp20) has been hampered because of its unusual interaction with the E. coli inner membrane. Here, we predict atomic models for the T4 portal monomer and dodecamer, and fit the dodecamer into the cryoEM density of the phage portal vertex. The core structure, like that from other phages, is cone-shaped with the wider end containing the “wing” and “crown” domains inside the phage head. A long “stem” encloses a central channel, and a narrow “stalk” protrudes outside the capsid. A biochemical approach was developed to analyze portal function by incorporating plasmid-expressed portal protein into phage heads and determining the effect of mutations on head assembly, DNA translocation, and virion production. We found that the protruding loops of the stalk domain are involved in assembling the DNA packaging motor. A loop that connects the stalk to the channel might be required for communication between the motor and portal. The “tunnel” loops that project into the channel are essential for sealing the packaged head. These studies established that the portal is required throughout the DNA packaging process, with different domains participating at different stages of genome packaging. PMID:24126213

  3. Integral parametrization of the Kinetics of Crosslink production in plasmid DNA as a function of 8-methoxypsoralen concentration

    Energy Technology Data Exchange (ETDEWEB)

    Vidania, R. de; Paramio, J. M.; Bauluz, C.

    1986-07-01

    In this paper we present results of crosslink production in pBR322 DNA along a wide range of 8-methoxypsoralen (8-MOP) concentration. Experimental data were obtained as DNA renaturation percentages, from the shift in hyperchromicity after a temperature-dependent denaturation-renaturation process. the experimental results showed a three-stage profile when represented as a function of the natural logarithms of 8-MOP concentration. an integral parametrization which allows a simultaneous fit of the three observed stages is presented here. the theoretical values of crosslink production determined from the fit are useful to asses the genotoxicity of psoralen-induced crosslinks in plasmid DNA. (Author) 24 refs.

  4. A facile approach to prepare a dual functionalized DNA based material in a bio-deep eutectic solvent.

    Science.gov (United States)

    Mondal, Dibyendu; Bhatt, Jitkumar; Sharma, Mukesh; Chatterjee, Shruti; Prasad, Kamalesh

    2014-04-18

    DNA (Salmon testes) was functionalized by Fe3O4 nanoparticles and protonated layered dititanate sheets (H2·Ti2O5·H2O) in a mixture of choline chloride and ethylene glycol (a deep eutectic solvent) to yield a hybrid material having magnetic and antibacterial properties. Ti sheets were found to interact with the phosphate moieties, while Fe interacted with the base pair of DNA in the hybrid material.

  5. Induction of DNA synthesis and apoptosis are separable functions of E2F-1

    DEFF Research Database (Denmark)

    Phillips, A C; Bates, S; Ryan, K M;

    1997-01-01

    The family of E2F transcription factors have an essential role in mediating cell cycle progression, and recently, one of the E2F protein family, E2F-1, has been shown to participate in the induction of apoptosis. Cooperation between E2F and the p53 tumor suppressor protein in this apoptotic...... response had led to the suggestion that cell cycle progression induced by E2F-1 expression provides an apoptotic signal when placed in conflict with an arrest to cell cycle progression, such as provided by p53. We show here that although apoptosis is clearly enhanced by p53, E2F-1 can induce significant...... apoptosis in the absence of p53. Furthermore, this apoptotic function of E2F-1 is separable from the ability to accelerate entry into DNA synthesis. Analysis of E2F-1 mutants indicates that although DNA-binding is required, transcriptional transactivation is not necessary for the induction of apoptosis by E...

  6. Reusable DNA-functionalized-graphene for ultrasensitive mercury (II) detection and removal.

    Science.gov (United States)

    Liu, Yanchen; Wang, Xiangqing; Wu, Hui

    2017-01-15

    Mercury is a bioaccumulative and highly toxic heavy metal. Thus, the removal and detection of Hg(2+) from the environment is a major challenge. This paper reports a novel bio-nanomaterial for the simultaneous determination and removal of Hg(2+) with the use of rGO-Fe3O4 functionalized with Hg(2+)-specific thymine oligonucleotide (T-DNA). T-DNA interacts with Hg(2+) and changes from having a random coil into a hairpin structure, thereby increasing the fluorescence of SYBR Green I. Such fluorescence turn-on process allows the detection of Hg(2+) in the concentration range of 1-20ng/mL, with a detection limit of 0.82ng/mL. Removal is achieved by exploiting the T-Hg(2+)-T base pairs and the large surface area of graphene; these bio-nanocomposites exhibit excellent removal efficiency (over 80%) and rapid separation from the aqueous solution. Moreover, bio-nanomaterials can be regenerated after a simple treatment. The proposed method also demonstrates the evident practicability of the simultaneous detection and removal of Hg(2+) in lake water samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. The C-Terminal Domain of Yeast PCNA Is Required for Physical And Functional Interactions With Cdc9 DNA Ligase

    Energy Technology Data Exchange (ETDEWEB)

    Vijayakumar, S.; Chapados, B.R.; Schmidt, K.H.; Kolodner, R.D.; Tainer, J.A.; Tomkinson, A.E.

    2007-07-13

    There is compelling evidence that proliferating cell nuclear antigen (PCNA), a DNA sliding clamp, co-ordinates the processing and joining of Okazaki fragments during eukaryotic DNA replication. However, a detailed mechanistic understanding of functional PCNA:ligase I interactions has been incomplete. Here we present the co-crystal structure of yeast PCNA with a peptide encompassing the conserved PCNA interaction motif of Cdc9, yeast DNA ligase I. The Cdc9 peptide contacts both the inter-domain connector loop (IDCL) and residues near the C-terminus of PCNA. Complementary mutational and biochemical results demonstrate that these two interaction interfaces are required for complex formation both in the absence of DNA and when PCNA is topologically linked to DNA. Similar to the functionally homologous human proteins, yeast RFC interacts with and inhibits Cdc9 DNA ligase whereas the addition of PCNA alleviates inhibition by RFC. Here we show that the ability of PCNA to overcome RFC-mediated inhibition of Cdc9 is dependent upon both the IDCL and the C-terminal interaction interfaces of PCNA. Together these results demonstrate the functional significance of the {beta}-zipper structure formed between the C-terminal domain of PCNA and Cdc9 and reveal differences in the interactions of FEN-1 and Cdc9 with the two PCNA interfaces that may contribute to the coordinated, sequential action of these enzymes.

  8. Regulation of the activity of the dual-function DnaA protein in Caulobacter crescentus.

    Science.gov (United States)

    Fernandez-Fernandez, Carmen; Gonzalez, Diego; Collier, Justine

    2011-01-01

    DnaA is a conserved essential bacterial protein that acts as the initiator of chromosomal replication as well as a master transcriptional regulator in Caulobacter crescentus. Thus, the intracellular levels of active DnaA need to be tightly regulated during the cell cycle. Our previous work suggested that DnaA may be regulated at the level of its activity by the replisome-associated protein HdaA. Here, we describe the construction of a mutant DnaA protein [DnaA(R357A)]. The R357 residue in the AAA+ domain of the C. crescentus DnaA protein is equivalent to the R334 residue of the E. coli DnaA protein, which is required for the Regulatory Inactivation of DnaA (RIDA). We found that the expression of the DnaA(R357A) mutant protein in C. crescentus, but not the expression of the wild-type DnaA protein at similar levels, causes a severe phenotype of over-initiation of chromosomal replication and that it blocks cell division. Thus, the mutant DnaA(R357A) protein is hyper-active to promote the initiation of DNA replication, compared to the wild-type DnaA protein. DnaA(R357A) could not replace DnaA in vivo, indicating that the switch in DnaA activity once chromosomal replication has started may be an essential process in C. crescentus. We propose that the inactivation of DnaA is the main mechanism ensuring that chromosomal replication starts only once per cell cycle. We further observed that the R357A substitution in DnaA does not promote the activity of DnaA as a direct transcriptional activator of four important genes, encoding HdaA, the GcrA master cell cycle regulator, the FtsZ cell division protein and the MipZ spatial regulator of cell division. Thus, the AAA+ domain of DnaA may play a role in temporally regulating the bifunctionality of DnaA by reallocating DnaA molecules from initiating DNA replication to transcribing genes within the unique DnaA regulon of C. crescentus.

  9. Regulation of the activity of the dual-function DnaA protein in Caulobacter crescentus.

    Directory of Open Access Journals (Sweden)

    Carmen Fernandez-Fernandez

    Full Text Available DnaA is a conserved essential bacterial protein that acts as the initiator of chromosomal replication as well as a master transcriptional regulator in Caulobacter crescentus. Thus, the intracellular levels of active DnaA need to be tightly regulated during the cell cycle. Our previous work suggested that DnaA may be regulated at the level of its activity by the replisome-associated protein HdaA. Here, we describe the construction of a mutant DnaA protein [DnaA(R357A]. The R357 residue in the AAA+ domain of the C. crescentus DnaA protein is equivalent to the R334 residue of the E. coli DnaA protein, which is required for the Regulatory Inactivation of DnaA (RIDA. We found that the expression of the DnaA(R357A mutant protein in C. crescentus, but not the expression of the wild-type DnaA protein at similar levels, causes a severe phenotype of over-initiation of chromosomal replication and that it blocks cell division. Thus, the mutant DnaA(R357A protein is hyper-active to promote the initiation of DNA replication, compared to the wild-type DnaA protein. DnaA(R357A could not replace DnaA in vivo, indicating that the switch in DnaA activity once chromosomal replication has started may be an essential process in C. crescentus. We propose that the inactivation of DnaA is the main mechanism ensuring that chromosomal replication starts only once per cell cycle. We further observed that the R357A substitution in DnaA does not promote the activity of DnaA as a direct transcriptional activator of four important genes, encoding HdaA, the GcrA master cell cycle regulator, the FtsZ cell division protein and the MipZ spatial regulator of cell division. Thus, the AAA+ domain of DnaA may play a role in temporally regulating the bifunctionality of DnaA by reallocating DnaA molecules from initiating DNA replication to transcribing genes within the unique DnaA regulon of C. crescentus.

  10. Preventing mitochondrial fission impairs mitochondrial function and leads to loss of mitochondrial DNA.

    Directory of Open Access Journals (Sweden)

    Philippe A Parone

    Full Text Available Mitochondria form a highly dynamic tubular network, the morphology of which is regulated by frequent fission and fusion events. However, the role of mitochondrial fission in homeostasis of the organelle is still unknown. Here we report that preventing mitochondrial fission, by down-regulating expression of Drp1 in mammalian cells leads to a loss of mitochondrial DNA and a decrease of mitochondrial respiration coupled to an increase in the levels of cellular reactive oxygen species (ROS. At the cellular level, mitochondrial dysfunction resulting from the lack of fission leads to a drop in the levels of cellular ATP, an inhibition of cell proliferation and an increase in autophagy. In conclusion, we propose that mitochondrial fission is required for preservation of mitochondrial function and thereby for maintenance of cellular homeostasis.

  11. Kinetic control of the coverage of oil droplets by DNA-functionalized colloids.

    Science.gov (United States)

    Joshi, Darshana; Bargteil, Dylan; Caciagli, Alessio; Burelbach, Jerome; Xing, Zhongyang; Nunes, André S; Pinto, Diogo E P; Araújo, Nuno A M; Brujic, Jasna; Eiser, Erika

    2016-08-01

    We report a study of reversible adsorption of DNA-coated colloids on complementary functionalized oil droplets. We show that it is possible to control the surface coverage of oil droplets using colloidal particles by exploiting the fact that, during slow adsorption, compositional arrest takes place well before structural arrest occurs. As a consequence, we can prepare colloid-coated oil droplets with a "frozen" degree of loading but with fully ergodic colloidal dynamics on the droplets. We illustrate the equilibrium nature of the adsorbed colloidal phase by exploring the quasi-two-dimensional phase behavior of the adsorbed colloids under the influence of depletion interactions and present simulations of a simple model that illustrates the nature of the compositional arrest and the structural ergodicity.

  12. New Insights into 5hmC DNA Modification: Generation, Distribution and Function

    Directory of Open Access Journals (Sweden)

    Dong-Qiao Shi

    2017-07-01

    Full Text Available Dynamic DNA modifications, such as methylation/demethylation on cytosine, are major epigenetic mechanisms to modulate gene expression in both eukaryotes and prokaryotes. In addition to the common methylation on the 5th position of the pyrimidine ring of cytosine (5mC, other types of modifications at the same position, such as 5-hydroxymethyl (5hmC, 5-formyl (5fC, and 5-carboxyl (5caC, are also important. Recently, 5hmC, a product of 5mC demethylation by the Ten-Eleven Translocation family proteins, was shown to regulate many cellular and developmental processes, including the pluripotency of embryonic stem cells, neuron development, and tumorigenesis in mammals. Here, we review recent advances on the generation, distribution, and function of 5hmC modification in mammals and discuss its potential roles in plants.

  13. Structure and function of dioxygenases in histone demethylation and DNA/RNA demethylation

    Directory of Open Access Journals (Sweden)

    Cheng Dong

    2014-11-01

    Full Text Available Iron(II and 2-oxoglutarate (2OG-dependent dioxygenases involved in histone and DNA/RNA demethylation convert the cosubstrate 2OG and oxygen to succinate and carbon dioxide, resulting in hydroxylation of the methyl group of the substrates and subsequent demethylation. Recent evidence has shown that these 2OG dioxygenases play vital roles in a variety of biological processes, including transcriptional regulation and gene expression. In this review, the structure and function of these dioxygenases in histone and nucleic acid demethylation will be discussed. Given the important roles of these 2OG dioxygenases, detailed analysis and comparison of the 2OG dioxygenases will guide the design of target-specific small-molecule chemical probes and inhibitors.

  14. C-terminal fluorescent labeling impairs functionality of DNA mismatch repair proteins.

    Directory of Open Access Journals (Sweden)

    Angela Brieger

    Full Text Available The human DNA mismatch repair (MMR process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2. Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency.

  15. Coupling between Histone Conformations and DNA Geometry in Nucleosomes on a Microsecond Timescale: Atomistic Insights into Nucleosome Functions.

    Science.gov (United States)

    Shaytan, Alexey K; Armeev, Grigoriy A; Goncearenco, Alexander; Zhurkin, Victor B; Landsman, David; Panchenko, Anna R

    2016-01-16

    An octamer of histone proteins wraps about 200bp of DNA into two superhelical turns to form nucleosomes found in chromatin. Although the static structure of the nucleosomal core particle has been solved, details of the dynamic interactions between histones and DNA remain elusive. We performed extensively long unconstrained, all-atom microsecond molecular dynamics simulations of nucleosomes including linker DNA segments and full-length histones in explicit solvent. For the first time, we were able to identify and characterize the rearrangements in nucleosomes on a microsecond timescale including the coupling between the conformation of the histone tails and the DNA geometry. We found that certain histone tail conformations promoted DNA bulging near its entry/exit sites, resulting in the formation of twist defects within the DNA. This led to a reorganization of histone-DNA interactions, suggestive of the formation of initial nucleosome sliding intermediates. We characterized the dynamics of the histone tails upon their condensation on the core and linker DNA and showed that tails may adopt conformationally constrained positions due to the insertion of "anchoring" lysines and arginines into the DNA minor grooves. Potentially, these phenomena affect the accessibility of post-translationally modified histone residues that serve as important sites for epigenetic marks (e.g., at H3K9, H3K27, H4K16), suggesting that interactions of the histone tails with the core and linker DNA modulate the processes of histone tail modifications and binding of the effector proteins. We discuss the implications of the observed results on the nucleosome function and compare our results to different experimental studies.

  16. From Structure-Function Analyses to Protein Engineering for Practical Applications of DNA Ligase.

    Science.gov (United States)

    Tanabe, Maiko; Ishino, Yoshizumi; Nishida, Hirokazu

    2015-01-01

    DNA ligases are indispensable in all living cells and ubiquitous in all organs. DNA ligases are broadly utilized in molecular biology research fields, such as genetic engineering and DNA sequencing technologies. Here we review the utilization of DNA ligases in a variety of in vitro gene manipulations, developed over the past several decades. During this period, fewer protein engineering attempts for DNA ligases have been made, as compared to those for DNA polymerases. We summarize the recent progress in the elucidation of the DNA ligation mechanisms obtained from the tertiary structures solved thus far, in each step of the ligation reaction scheme. We also present some examples of engineered DNA ligases, developed from the viewpoint of their three-dimensional structures.

  17. From Structure-Function Analyses to Protein Engineering for Practical Applications of DNA Ligase

    Directory of Open Access Journals (Sweden)

    Maiko Tanabe

    2015-01-01

    Full Text Available DNA ligases are indispensable in all living cells and ubiquitous in all organs. DNA ligases are broadly utilized in molecular biology research fields, such as genetic engineering and DNA sequencing technologies. Here we review the utilization of DNA ligases in a variety of in vitro gene manipulations, developed over the past several decades. During this period, fewer protein engineering attempts for DNA ligases have been made, as compared to those for DNA polymerases. We summarize the recent progress in the elucidation of the DNA ligation mechanisms obtained from the tertiary structures solved thus far, in each step of the ligation reaction scheme. We also present some examples of engineered DNA ligases, developed from the viewpoint of their three-dimensional structures.

  18. One-end immobilization of individual DNA molecules on a functional hydrophobic glass surface.

    Science.gov (United States)

    Matsuura, Shun-ichi; Kurita, Hirofumi; Nakano, Michihiko; Komatsu, Jun; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2002-12-01

    We demonstrate an effective method for DNA immobilization on a hydrophobic glass surface. The new DNA immobilizing technique is extremely simple compared with conventional techniques that require heterobifunctional crosslinking reagent between DNA and substrate surface that are both modified chemically. In the first process, a coverslip was treated with dichlorodimethylsilane resulting in hydrophobic surface. lambda DNA molecules were ligated with 3'-terminus disulfide-modified 14 mer oligonucleotides at one cohesive end. After reduction of the disulfide to sulfhydryl (thiol) groups the resulting thiol-modified lambda DNA molecules were reacted on silanized coverslip. Fluorescent observation showed that the thiol-modified lambda DNA molecules were anchored specifically to the hydrophobic surface at one terminus, although non-specific binding of the DNA molecules was suppressed. It was observed that the one-end-attached DNA molecule was bound firmly to the surface and stretched reversibly in one direction when a d.c. electric field was applied.

  19. Self-Assembled Functional Nanostructure of Plasmid DNA with Ionic Liquid [Bmim][PF₆]: Enhanced Efficiency in Bacterial Gene Transformation.

    Science.gov (United States)

    Soni, Sarvesh K; Sarkar, Sampa; Mirzadeh, Nedaossadat; Selvakannan, P R; Bhargava, Suresh K

    2015-04-28

    The electrostatic interaction between the negatively charged phosphate groups of plasmid DNA and the cationic part of hydrophobic ionic liquid 1-butyl-3-methylimidazolium hexafluorophosphate ([Bmim][PF6]), initiates spontaneous self-assembly to form the functional nanostructures made up of DNA and ionic liquid (IL). These functional nanostructures were demonstrated as promising synthetic nonviral vectors for the efficient bacterial pGFP gene transformation in cells. In particular, the functional nanostructures that were made up of 1 μL of IL ([Bmim][PF6]) and 1 μg of plasmid DNA can increase the transformation efficiency by 300-400% in microbial systems, without showing any toxicity for E. coli DH5α cells. (31)P nuclear magnetic resonance (NMR), Fourier transform infrared (FTIR) spectroscopy, and X-ray photoelectron (XPS) spectroscopic analysis revealed that the electrostatic interaction between negatively charged phosphate oxygen and cationic Bmim(+) tends to initiate the self-assembly process. Thermogravimetric analysis of the DNA-IL functional nanostructures showed that these nanostructures consist of ∼16 wt % ionic liquid, which is considered to provide the stability to the plasmid DNA that eventually enhanced the transformation efficiency.

  20. The fission yeast inhibitor of growth (ING) protein Png1p functions in response to DNA damage.

    Science.gov (United States)

    Chen, Jian-Qiang; Li, Yang; Pan, Xian; Lei, Bing-Kun; Chang, Cheng; Liu, Zheng-Xun; Lu, Hong

    2010-05-21

    In budding yeast and human cells, ING (inhibitor of growth) tumor suppressor proteins play important roles in response to DNA damage by modulating chromatin structure through collaborating with histone acetyltransferase or histone deacetylase complexes. However, the biological functions of ING family proteins in fission yeast are poorly defined. Here, we report that Png1p, a fission yeast ING homolog protein, is required for cell growth under normal and DNA-damaged conditions. Png1p was further confirmed to regulate histone H4 acetylation through collaboration with the MYST family histone acetyltransferase 1 (Mst1). Additionally, both fission yeast PNG1 and MST1 can functionally complement their budding yeast correspondence homologs YNG2 and ESA1, respectively. These results suggest that ING proteins in fission yeast might also conserve function, similar to ING proteins in budding yeast and human cells. We also showed that decreased acetylation in Deltapng1 cells resulted in genome-wide down-regulation of 756 open reading frames, including the central DNA repair gene RAD22. Overexpression of RAD22 partially rescued the png1 mutant phenotype under both normal and DNA-damaged conditions. Furthermore, decreased expression of RAD22 in Deltapng1 cells was confirmed to be caused by decreased H4 acetylation at its promoter. Altogether, these results indicate that Png1p is required for histone H4 acetylation and functions upstream of RAD22 in the DNA damage response pathway.

  1. Sperm nuclear DNA fragmentation rate is associated with differential protein expression and enriched functions in human seminal plasma.

    Science.gov (United States)

    Intasqui, Paula; Camargo, Mariana; Del Giudice, Paula T; Spaine, Deborah M; Carvalho, Valdemir M; Cardozo, Karina H M; Zylbersztejn, Daniel S; Bertolla, Ricardo P

    2013-10-01

    To analyse the proteomic profile of seminal plasma with the aim of identifying the proteins and post-genomic pathways associated with sperm DNA fragmentation. A cross-sectional study including 89 subjects from a human reproduction service was carried out. All semen samples were assessed for sperm DNA fragmentation using a comet assay. Results from 60 sperm were analysed using Komet 6.0.1 software and the 'Olive tail moment' variable was used to stratify these into low and high sperm DNA fragmentation groups. Seminal plasma proteins from the two groups were pooled and used for proteomic analysis. Quantitative data were used for functional enrichment studies. Seventy-two proteins were identified or quantified in seminal plasma. Of these, nine were differentially expressed in the low group and 21 in the high group. Forty-two proteins were conserved between these groups. Functional enrichment analysis indicated that sperm DNA fragmentation was related to functions such as lipoprotein particle remodelling and regulation, fatty acid binding and immune response. Proteins found exclusively in the low group may be involved in correcting spermatogenesis and/or improving sperm function. Proteins in the high group were associated with increased innate immune response, sperm motility and/or maturation and inhibition of mitochondrial apoptosis. Protein expression and post-genomic pathways of seminal plasma differ according to the rate of sperm DNA integrity. © 2013 The Authors. BJU International © 2013 BJU International.

  2. Chromatin Remodeling Function of BRCA1 and its Implication in Regulation of DNA Replication

    Science.gov (United States)

    2000-09-01

    different structural module. For example, the BRCT domains present in DNA ligase III and XRCC 1, two mammalian DNA repair proteins, interact with each...in mediating protein-protein interactions with another BRCT domain or a different structural module. For example, the BRCT domains present in DNA ... ligase IEd and XRCCI, two mammalian DNA repair proteins, interact with each other strongly (19). In addition, the BRCT domain of BRCA1 binds CtIP, a

  3. A DNA nanocapsule with aptamer-controlled open-closure function for targeted delivery

    DEFF Research Database (Denmark)

    Bentin, Thomas

    2012-01-01

    A DNA capsule fitted with aptamer controlled target sensing has been "woven" using a 7308-base single-stranded DNA "thread" and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces.......A DNA capsule fitted with aptamer controlled target sensing has been "woven" using a 7308-base single-stranded DNA "thread" and 196 staple oligonucleotides. The capsule enables logic-gated molecular cargo delivery to targeted cell surfaces....

  4. Dimer monomer transition and dimer re-formation play important role for ATM cellular function during DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Du, Fengxia [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); Zhang, Minjie [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Li, Xiaohua; Yang, Caiyun [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); Meng, Hao; Wang, Dong; Chang, Shuang [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Xu, Ye [Department of Radiation Oncology, Division of Genomic Stability, Dana Farber Cancer Institute, Harvard Medical School, MA 02134 (United States); Price, Brendan, E-mail: Brendan_Price@dfci.harvard.edu [Department of Radiation Oncology, Division of Genomic Stability, Dana Farber Cancer Institute, Harvard Medical School, MA 02134 (United States); Sun, Yingli, E-mail: sunyl@big.ac.cn [Laboratory of Genome Variations and Precision Bio-Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101 (China)

    2014-10-03

    Highlights: • ATM phosphorylates the opposite strand of the dimer in response to DNA damage. • The PETPVFRLT box of ATM plays a key role in its dimer dissociation in DNA repair. • The dephosphorylation of ATM is critical for dimer re-formation after DNA repair. - Abstract: The ATM protein kinase, is a serine/threonine protein kinase that is recruited and activated by DNA double-strand breaks, mediates responses to ionizing radiation in mammalian cells. Here we show that ATM is held inactive in unirradiated cells as a dimer and phosphorylates the opposite strand of the dimer in response to DNA damage. Cellular irradiation induces rapid intermolecular autophosphorylation of serine 1981 that causes dimer dissociation and initiates cellular ATM kinase activity. ATM cannot phosphorylate the substrates when it could not undergo dimer monomer transition. After DNA repair, the active monomer will undergo dephosphorylation to form dimer again and dephosphorylation is critical for dimer re-formation. Our work reveals novel function of ATM dimer monomer transition and explains why ATM dimer monomer transition plays such important role for ATM cellular activity during DNA repair.

  5. Functional Relationship of ATP Hydrolysis, Presynaptic Filament Stability, and Homologous DNA Pairing Activity of the Human Meiotic Recombinase DMC1.

    Science.gov (United States)

    Chang, Hao-Yen; Liao, Chia-Yu; Su, Guan-Chin; Lin, Sheng-Wei; Wang, Hong-Wei; Chi, Peter

    2015-08-07

    DMC1 and RAD51 are conserved recombinases that catalyze homologous recombination. DMC1 and RAD51 share similar properties in DNA binding, DNA-stimulated ATP hydrolysis, and catalysis of homologous DNA strand exchange. A large body of evidence indicates that attenuation of ATP hydrolysis leads to stabilization of the RAD51-ssDNA presynaptic filament and enhancement of DNA strand exchange. However, the functional relationship of ATPase activity, presynaptic filament stability, and DMC1-mediated homologous DNA strand exchange has remained largely unexplored. To address this important question, we have constructed several mutant variants of human DMC1 and characterized them biochemically to gain mechanistic insights. Two mutations, K132R and D223N, that change key residues in the Walker A and B nucleotide-binding motifs ablate ATP binding and render DMC1 inactive. On the other hand, the nucleotide-binding cap D317K mutant binds ATP normally but shows significantly attenuated ATPase activity and, accordingly, forms a highly stable presynaptic filament. Surprisingly, unlike RAD51, presynaptic filament stabilization achieved via ATP hydrolysis attenuation does not lead to any enhancement of DMC1-catalyzed homologous DNA pairing and strand exchange. This conclusion is further supported by examining wild-type DMC1 with non-hydrolyzable ATP analogues. Thus, our results reveal an important mechanistic difference between RAD51 and DMC1. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Pretreatment with mixed-function oxidase inducers increases the sensitivity of the hepatocyte/DNA repair assay

    Energy Technology Data Exchange (ETDEWEB)

    Shaddock, J.G.; Heflich, R.H.; McMillan, D.C.; Hinson, J.A.; Casciano, D.A. (National Center for Toxicological Research, Jefferson, AK (USA) Univ. of Arkansas for Medical Sciences, Little Rock (USA))

    1989-01-01

    A recent National Toxicology Program evaluation indicates that the rat hepatocyte/DNA repair assay has a high false-negative rate and that it is insensitive to some genotoxic hepatocarcinogens as well as other species and organ-specific carcinogens. In this study, the authors examined whether the sensitivity of the hepatocyte/DNA repair assay might be increased through animal pretreatment with various hepatic mixed-function oxidase inducers, i.e., Aroclor 1254, phenobarbital, and 3,3{prime},4,4{prime}-tetrachloroazobenzene (TCAB). The effects on unscheduled DNA synthesis (UDS), a measured of DNA damage and repair, were studied in cultures exposed to known and/or potential carcinogens that had been evaluated as negative or questionable or that produced conflicting results with hepatocytes isolated from uninduced animals. 4,4{prime}-Oxydianiline, 1-nitropy-rene, and TCAB produced concentration-dependent increases in UDS in hepatocytes from rats pretreated with Aroclor 1254. 4,4{prime}-Oxydianiline and TCAB also induced a dose-dependent increase in DNA repair in hepatocytes from rats pretreated with phenobarbital, whereas 1-nitropyrene was negative. These data indicate that the limited sensitivity to chemical carcinogens displayed by the hepatocyte/DNA repair assay may be increased by using hepatocytes isolated from animals exposed to hepatic mixed-function oxidase inducers.

  7. Dual functions of α-ketoglutarate dehydrogenase E2 in the Krebs cycle and mitochondrial DNA inheritance in Trypanosoma brucei.

    Science.gov (United States)

    Sykes, Steven E; Hajduk, Stephen L

    2013-01-01

    The dihydrolipoyl succinyltransferase (E2) of the multisubunit α-ketoglutarate dehydrogenase complex (α-KD) is an essential Krebs cycle enzyme commonly found in the matrices of mitochondria. African trypanosomes developmentally regulate mitochondrial carbohydrate metabolism and lack a functional Krebs cycle in the bloodstream of mammals. We found that despite the absence of a functional α-KD, bloodstream form (BF) trypanosomes express α-KDE2, which localized to the mitochondrial matrix and inner membrane. Furthermore, α-KDE2 fractionated with the mitochondrial genome, the kinetoplast DNA (kDNA), in a complex with the flagellum. A role for α-KDE2 in kDNA maintenance was revealed in α-KDE2 RNA interference (RNAi) knockdowns. Following RNAi induction, bloodstream trypanosomes showed pronounced growth reduction and often failed to equally distribute kDNA to daughter cells, resulting in accumulation of cells devoid of kDNA (dyskinetoplastic) or containing two kinetoplasts. Dyskinetoplastic trypanosomes lacked mitochondrial membrane potential and contained mitochondria of substantially reduced volume. These results indicate that α-KDE2 is bifunctional, both as a metabolic enzyme and as a mitochondrial inheritance factor necessary for the distribution of kDNA networks to daughter cells at cytokinesis.

  8. Efimov effect of triple-stranded DNA: real-space renormalization group and zeros of the partition function.

    Science.gov (United States)

    Maji, Jaya; Bhattacharjee, Somendra M

    2012-10-01

    We study the melting of three-stranded DNA by using the real-space renormalization group and exact recursion relations. The prediction of an unusual Efimov-analog three-chain bound state, that appears at the critical melting of two-chain DNA, is corroborated by the zeros of the partition function. The distribution of the zeros has been studied in detail for various situations. We show that the Efimov DNA can occur even if the three-chain (i.e., three-monomer) interaction is repulsive in nature. In higher dimensions, a striking result that emerged in this repulsive zone is a continuous transition from the critical state to the Efimov DNA.

  9. Dimer monomer transition and dimer re-formation play important role for ATM cellular function during DNA repair.

    Science.gov (United States)

    Du, Fengxia; Zhang, Minjie; Li, Xiaohua; Yang, Caiyun; Meng, Hao; Wang, Dong; Chang, Shuang; Xu, Ye; Price, Brendan; Sun, Yingli

    2014-10-03

    The ATM protein kinase, is a serine/threonine protein kinase that is recruited and activated by DNA double-strand breaks, mediates responses to ionizing radiation in mammalian cells. Here we show that ATM is held inactive in unirradiated cells as a dimer and phosphorylates the opposite strand of the dimer in response to DNA damage. Cellular irradiation induces rapid intermolecular autophosphorylation of serine 1981 that causes dimer dissociation and initiates cellular ATM kinase activity. ATM cannot phosphorylate the substrates when it could not undergo dimer monomer transition. After DNA repair, the active monomer will undergo dephosphorylation to form dimer again and dephosphorylation is critical for dimer re-formation. Our work reveals novel function of ATM dimer monomer transition and explains why ATM dimer monomer transition plays such important role for ATM cellular activity during DNA repair.

  10. Preparation of polysulfone hollow microspheres encapsulating DNA and their functional utilization.

    Science.gov (United States)

    Zhao, C; Liu, X D; Nomizu, M; Nishi, N

    2004-05-01

    Polysulfone hollow microspheres encapsulating DNA were prepared using a liquid-liquid phase separation technique. The microspheres were then used to absorb a DNA-binding intercalating material--ethidium bromide. The amount of DNA encapsulated in the microspheres depended on the concentration of the DNA solution used to prepare the microspheres, and the microsphere morphology depended on both the polymer concentration and the preparation conditions. The amount of ethidium bromide in the microspheres depended mainly on the amount of encapsulated DNA, and the microsphere morphology also affected the removal of the ethidium bromide. The new method of DNA encapsulation is proposed, and the microspheres encapsulating the DNA have the potential to be used in environmental applications.

  11. Grating inscription in picosecond regime in thin films of functionalized DNA.

    Science.gov (United States)

    Czaplicki, R; Krupka, O; Essaidi, Z; El-Ghayoury, A; Kajzar, F; Grote, J G; Sahraoui, B

    2007-11-12

    Polymers containing azo-benzene groups are useful holographic recording materials. In these materials the efficient mixed amplitude and phase gratings, frequently accompanied with photoinduced-surface relief gratings, can be inscribed with polarized laser light. The light-induced trans-cis-trans photoisomerization of azo-benzene groups is responsible for optical anisotropy in such systems. The aim of the present work is to study the dynamics of grating inscription in Disperse Red 1 doped deoxyrbonucleic acid- hexadecyltrimethylammonium material (DR1-DNACTMA) using 16 ps laser pulses (532 nm, 1.3 mJ). Results are compared with that obtained for other polymeric matrices loaded with DR1. The dynamics of the grating growth, due to repeated pulses from picosecond laser with 10 Hz repetition rate, was probed by measuring the intensity of the first order of diffraction of a cw He-Ne. We report results in function of the light polarization of writing beams. In this paper we present the first results of the grating inscription in functionalized DNA (in the picosecond pulse regime).

  12. Novel and functional DNA sequence variants within the GATA5 gene promoter in ventricular septal defects

    Institute of Scientific and Technical Information of China (English)

    Ji-Ping Shan; Xiao-Li Wang; Yuan-Gang Qiao; Hong-Xin Wan Yan; Wen-Hui Huang; Shu-Chao Pang; Bo Yan

    2014-01-01

    Background: Congenital heart disease (CHD) is the most common human birth defect. Genetic causes for CHD remain largely unknown. GATA transcription factor 5 (GATA 5) is an essential regulator for the heart development. Mutations in the GATA5 gene have been reported in patients with a variety of CHD. Since misregulation of gene expression have been associated with human diseases, we speculated that changed levels of cardiac transcription factors, GATA5, may mediate the development of CHD. Methods: In this study, GATA5 gene promoter was genetically and functionally analyzed in large cohorts of patients with ventricular septal defect (VSD) (n=343) and ethnic-matched healthy controls (n=348). Results: Two novel and heterozygous DNA sequence variants (DSVs), g.61051165A>G and g.61051463delC, were identified in three VSD patients, but not in the controls. In cultured cardiomyocytes, GATA5 gene promoter activities were significantly decreased by DSV g.61051165A>G and increased by DSV g.61051463delC. Moreover, fathers of the VSD patients carrying the same DSVs had reduced diastolic function of left ventricles. Three SNPs, g.61051279C>T (rs77067995), g.61051327A>C (rs145936691) and g.61051373G>A (rs80197101), and one novel heterozygous DSV, g.61051227C>T, were found in both VSD patients and controls with similar frequencies. Conclusion: Our data suggested that the DSVs in the GATA5 gene promoter may increase the susceptibility to the development of VSD as a risk factor.

  13. Electrochemical Characterization of O2 Plasma Functionalized Multi-Walled Carbon Nanotube Electrode for Legionella pneumophila DNA Sensor

    Science.gov (United States)

    Park, Eun Jin; Lee, Jun-Yong; Hyup Kim, Jun; Kug Kim, Sun; Lee, Cheol Jin; Min, Nam Ki

    2010-08-01

    An electrochemical DNA sensor for Legionella pneumophila detection was constructed using O2 plasma functionalized multi-walled carbon nanotube (MWCNT) film as a working electrode (WE). The cyclic voltammetry (CV) results revealed that the electrocatalytic activity of plasma functionalized MWCNT (pf-MWCNT) significantly changed depending on O2 plasma treatment time due to some oxygen containing functional groups on the pf-MWCNT surface. Scanning electron microscope (SEM) images and X-ray photoelectron spectroscopy (XPS) spectra were also presented the changes of their surface morphologies and oxygen composition before and after plasma treatment. From a comparison study, it was found that the pf-MWCNT WEs had higher electrocatalytic activity and more capability of probe DNA immobilization: therefore, electrochemical signal changes by probe DNA immobilization and hybridization on pf-MWCNT WEs were larger than on Au WEs. The pf-MWCNT based DNA sensor was able to detect a concentration range of 10 pM-100 nM of target DNA to detect L. pneumophila.

  14. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jason A Hilton

    Full Text Available Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision, up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption

  15. Identification of functional DNA variants in the constitutive promoter region of MDM2.

    Science.gov (United States)

    Lalonde, Marie-Eve; Ouimet, Manon; Larivière, Mathieu; Kritikou, Ekaterini A; Sinnett, Daniel

    2012-09-01

    Although mutations in the oncoprotein murine double minute 2 (MDM2) are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2), which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1), which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP) SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (-1494 G > A; indel 40 bp; and -182 C > G). Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309). Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  16. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Science.gov (United States)

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  17. DNA methylation restricts lineage-specific functions of transcription factor Gata4 during embryonic stem cell differentiation.

    Directory of Open Access Journals (Sweden)

    Masaaki Oda

    2013-06-01

    Full Text Available DNA methylation changes dynamically during development and is essential for embryogenesis in mammals. However, how DNA methylation affects developmental gene expression and cell differentiation remains elusive. During embryogenesis, many key transcription factors are used repeatedly, triggering different outcomes depending on the cell type and developmental stage. Here, we report that DNA methylation modulates transcription-factor output in the context of cell differentiation. Using a drug-inducible Gata4 system and a mouse embryonic stem (ES cell model of mesoderm differentiation, we examined the cellular response to Gata4 in ES and mesoderm cells. The activation of Gata4 in ES cells is known to drive their differentiation to endoderm. We show that the differentiation of wild-type ES cells into mesoderm blocks their Gata4-induced endoderm differentiation, while mesoderm cells derived from ES cells that are deficient in the DNA methyltransferases Dnmt3a and Dnmt3b can retain their response to Gata4, allowing lineage conversion from mesoderm cells to endoderm. Transcriptome analysis of the cells' response to Gata4 over time revealed groups of endoderm and mesoderm developmental genes whose expression was induced by Gata4 only when DNA methylation was lost, suggesting that DNA methylation restricts the ability of these genes to respond to Gata4, rather than controlling their transcription per se. Gata4-binding-site profiles and DNA methylation analyses suggested that DNA methylation modulates the Gata4 response through diverse mechanisms. Our data indicate that epigenetic regulation by DNA methylation functions as a heritable safeguard to prevent transcription factors from activating inappropriate downstream genes, thereby contributing to the restriction of the differentiation potential of somatic cells.

  18. Structure-function studies of DNA binding domain of response regulator KdpE reveals equal affinity interactions at DNA half-sites.

    Directory of Open Access Journals (Sweden)

    Anoop Narayanan

    Full Text Available Expression of KdpFABC, a K(+ pump that restores osmotic balance, is controlled by binding of the response regulator KdpE to a specific DNA sequence (kdpFABC(BS via the winged helix-turn-helix type DNA binding domain (KdpE(DBD. Exploration of E. coli KdpE(DBD and kdpFABC(BS interaction resulted in the identification of two conserved, AT-rich 6 bp direct repeats that form half-sites. Despite binding to these half-sites, KdpE(DBD was incapable of promoting gene expression in vivo. Structure-function studies guided by our 2.5 Å X-ray structure of KdpE(DBD revealed the importance of residues R193 and R200 in the α-8 DNA recognition helix and T215 in the wing region for DNA binding. Mutation of these residues renders KdpE incapable of inducing expression of the kdpFABC operon. Detailed biophysical analysis of interactions using analytical ultracentrifugation revealed a 2∶1 stoichiometry of protein to DNA with dissociation constants of 200±100 and 350±100 nM at half-sites. Inactivation of one half-site does not influence binding at the other, indicating that KdpE(DBD binds independently to the half-sites with approximately equal affinity and no discernable cooperativity. To our knowledge, these data are the first to describe in quantitative terms the binding at half-sites under equilibrium conditions for a member of the ubiquitous OmpR/PhoB family of proteins.

  19. Respiratory function in cybrid cell lines carrying European mtDNA haplogroups: implications for Leber's hereditary optic neuropathy.

    Science.gov (United States)

    Carelli, Valerio; Vergani, Lodovica; Bernazzi, Barbara; Zampieron, Claudia; Bucchi, Laura; Valentino, Maria; Rengo, Chiara; Torroni, Antonio; Martinuzzi, Andrea

    2002-10-09

    The possibility that some combinations of mtDNA polymorphisms, previously associated with Leber's hereditary optic neuropathy (LHON), may affect mitochondrial respiratory function was tested in osteosarcoma-derived transmitochondrial cytoplasmic hybrids (cybrids). In this cellular system, in the presence of the same nuclear background, different exogenous mtDNAs are used to repopulate a parental cell line previously devoid of its original mtDNA. No detectable differences in multiple parameters exploring respiratory function were observed when mtDNAs belonging to European haplogroups X, H, T and J were used. Different possible explanations for the previously established association between haplogroup J and LHON 11778/ND4 and 14484/ND6 pathogenic mutations are discussed, including the unconventional proposal that mtDNA haplogroup J may exert a protective rather than detrimental effect.

  20. Ubiquitinated Sirtuin 1 (SIRT1) Function Is Modulated during DNA Damage-induced Cell Death and Survival*

    Science.gov (United States)

    Peng, Lirong; Yuan, Zhigang; Li, Yixuan; Ling, Hongbo; Izumi, Victoria; Fang, Bin; Fukasawa, Kenji; Koomen, John; Chen, Jiandong; Seto, Edward

    2015-01-01

    Downstream signaling of physiological and pathological cell responses depends on post-translational modification such as ubiquitination. The mechanisms regulating downstream DNA damage response (DDR) signaling are not completely elucidated. Sirtuin 1 (SIRT1), the founding member of Class III histone deacetylases, regulates multiple steps in DDR and is closely associated with many physiological and pathological processes. However, the role of post-translational modification or ubiquitination of SIRT1 during DDR is unclear. We show that SIRT1 is dynamically and distinctly ubiquitinated in response to DNA damage. SIRT1 was ubiquitinated by the MDM2 E3 ligase in vitro and in vivo. SIRT1 ubiquitination under normal conditions had no effect on its enzymatic activity or rate of degradation; hypo-ubiquitination, however, reduced SIRT1 nuclear localization. Ubiquitination of SIRT1 affected its function in cell death and survival in response to DNA damage. Our results suggest that ubiquitination is required for SIRT1 function during DDR. PMID:25670865

  1. Scientific publications about DNA structure-function and PCR technique in Costa Rica: a historic view (1953-2003).

    Science.gov (United States)

    Albertazzi, Federico J

    2004-09-01

    The spreading of knowledge depends on the access to the information and its immediate use. Models are useful to explain specific phenomena. The scientific community accepts some models in Biology after a period of time, once it has evidence to support it. The model of the structure and function of the DNA proposed by Watson & Crick (1953) was not the exception, since a few years later the DNA model was finally accepted. In Costa Rica, DNA function was first mentioned in 1970, in the magazine Biologia Tropical (Tropical Biology Magazine), more than 15 years after its first publication in a scientific journal. An opposite situation occurs with technical innovations. If the efficiency of a new scientific technique is proved in a compelling way, then the acceptance by the community comes swiftly. This was the case of the polymerase chain reaction, or PCR. The first PCR machine in Costa Rica arrived in 1991, only three years after its publication.

  2. Dual function of Ixr1 in transcriptional regulation and recognition of cisplatin-DNA adducts is caused by differential binding through its two HMG-boxes.

    Science.gov (United States)

    Vizoso-Vázquez, A; Lamas-Maceiras, M; Fernández-Leiro, R; Rico-Díaz, A; Becerra, M; Cerdán, M E

    2017-02-01

    Ixr1 is a transcriptional factor involved in the response to hypoxia, which is also related to DNA repair. It binds to DNA through its two in-tandem high mobility group box (HMG-box) domains. Each function depends on recognition of different DNA structures, B-form DNA at specific consensus sequences for transcriptional regulation, or distorted DNA, like cisplatin-DNA adducts, for DNA repair. However, the contribution of the HMG-box domains in the Ixr1 protein to the formation of different protein-DNA complexes is poorly understood. We have biophysically and biochemically characterized these interactions with specific DNA sequences from the promoters regulated by Ixr1, or with cisplatin-DNA adducts. Both HMG-boxes are necessary for transcriptional regulation, and they are not functionally interchangeable. The in-tandem arrangement of their HMG-boxes is necessary for functional folding and causes sequential cooperative binding to specific DNA sequences, with HMG-box A showing a higher contribution to DNA binding and bending than the HMG-box B. Binding of Ixr1 HMG boxes to specific DNA sequences is entropy driven, whereas binding to platinated DNA is enthalpy driven for HMG-box A and entropy driven for HMG-box B. This is the first proof that HMG-box binding to different DNA structures is associated with predictable thermodynamic differences. Based on our study, we present a model to explain the dual function of Ixr1 in the regulation of gene expression and recognition of distorted DNA structures caused by cisplatin treatment.

  3. Comparative analysis of different methods of Hedera helix DNA extraction and molecular evidence of the functionality in PCR

    Directory of Open Access Journals (Sweden)

    Danka Bošeľová

    2016-12-01

    Full Text Available The most suitable method of total DNA extraction still remains the crucial step for many plant species, although there are many different protocols and commercial kits for DNA isolation. In this study, five different extraction protocols were analysed to find out the most appropriate method for DNA extraction from Hedera helix L. This species has numerous medical and pharmaceutical uses and is also characterized by antioxidant effects on human body. In spite of its wide medical utilization, it belongs to those plant species, where the genomic information is very limited. Comparing of different protocols resulted in the yield of extracted DNA that has ranged from 6.3 to 487 ng μl-1. The purity of extracted DNA has ranged from 1.4 up to 2.0 A260/A280. All the extraction methods used in this study were evaluated not only in term of quantity and purity of DNA but also its functionality in the restriction endonuclease digestion and polymerase chain reaction based downstream analysis was performed.

  4. Formation of functional CENP-B boxes at diverse locations in repeat units of centromeric DNA in New World monkeys.

    Science.gov (United States)

    Kugou, Kazuto; Hirai, Hirohisa; Masumoto, Hiroshi; Koga, Akihiko

    2016-06-13

    Centromere protein B, which is involved in centromere formation, binds to centromeric repetitive DNA by recognizing a nucleotide motif called the CENP-B box. Humans have large numbers of CENP-B boxes in the centromeric repetitive DNA of their autosomes and X chromosome. The current understanding is that these CENP-B boxes are located at identical positions in the repeat units of centromeric DNA. Great apes also have CENP-B boxes in locations that are identical to humans. The purpose of the present study was to examine the location of CENP-B box in New World monkeys. We recently identified CENP-B box in one species of New World monkeys (marmosets). In this study, we found functional CENP-B boxes in CENP-A-assembled repeat units of centromeric DNA in 2 additional New World monkeys (squirrel monkeys and tamarins) by immunostaining and ChIP-qPCR analyses. The locations of the 3 CENP-B boxes in the repeat units differed from one another. The repeat unit size of centromeric DNA of New World monkeys (340-350 bp) is approximately twice that of humans and great apes (171 bp). This might be, associated with higher-order repeat structures of centromeric DNA, a factor for the observed variation in the CENP-B box location in New World monkeys.

  5. The preparation of functionalized single walled carbon nanotubes as high efficiency DNA carriers

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The positively charged single walled carbon nanotubes (SWNTs+) were prepared by conjugating with -CONH-C6H12-NH3+.The double strand DNA (dsDNA) chains were loaded onto SWNTs+ via the electrostatic interactions. SWNTs+ shows improved loading efficiency (353.5 μg/mg) toward dsDNA compared with that of charged free single walled carbon nanotubes (SWNTs)(82.9 μg/mg).

  6. The application of psoralens to the study of DNA structure, function and dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Spielmann, P.H. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry]|[Lawrence Berkeley Lab., CA (United States)

    1991-04-01

    A series of six nitroxide spin-labeled psoralens were designed, synthesized and tested as probes for DNA dynamics. The synthesis of these spin-labeled psoralen derivatives and their photoreactivity with double-stranded DNA fragments is described. The spin labels (nitroxides) were demonstrated to survive the uv irradiation required to bind the probe to the target DNA. EPR spectra of the photobound spin-labels indicate that they do not wobble with respect to the DNA on the time-scales investigated. The author has used psoralen modified DNA as a model for the study of DNA repair enzyme systems in human cell free extracts. He has shown that damage-induced DNA synthesis is associated with removal of psoralen adducts and therefore is {open_quotes}repair synthesis{close_quotes} and not an aberrant DNA synthesis reaction potentiated by deformation of the DNA by adducts. He has found that all DNA synthesis induced by psoralen monoadducts is the consequence of removal of these adducts. By the same approach he has obtained evidence that this in vitro system is capable of removing psoralen cross-links as well. Reported here are synthetic methods that make use of high intensity lasers coupled with HPLC purification to make homogeneous and very pure micromole quantities of furan-side monoadducted, cross-linked, and pyrone-side monoadducted DNA oligonucleotide. These molecules are currently being studied by NMR and X-ray crystallography. The application of the site-specifically psoralen modified oligonucleotide synthesized by these methods to the construction of substrates for the investigation of DNA repair is also discussed.

  7. Structure and function of the small terminase component of the DNA packaging machine in T4-like bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Siyang; Gao, Song; Kondabagil, Kiran; Xiang, Ye; Rossmann, Michael G.; Rao, Venigalla B. (CUA); (Purdue)

    2012-04-04

    Tailed DNA bacteriophages assemble empty procapsids that are subsequently filled with the viral genome by means of a DNA packaging machine situated at a special fivefold vertex. The packaging machine consists of a 'small terminase' and a 'large terminase' component. One of the functions of the small terminase is to initiate packaging of the viral genome, whereas the large terminase is responsible for the ATP-powered translocation of DNA. The small terminase subunit has three domains, an N-terminal DNA-binding domain, a central oligomerization domain, and a C-terminal domain for interacting with the large terminase. Here we report structures of the central domain in two different oligomerization states for a small terminase from the T4 family of phages. In addition, we report biochemical studies that establish the function for each of the small terminase domains. On the basis of the structural and biochemical information, we propose a model for DNA packaging initiation.

  8. A pair of transposon-derived proteins function in a histone acetyltransferase complex for active DNA demethylation

    Science.gov (United States)

    Duan, Cheng-Guo; Wang, Xingang; Xie, Shaojun; Pan, Li; Miki, Daisuke; Tang, Kai; Hsu, Chuan-Chih; Lei, Mingguang; Zhong, Yingli; Hou, Yueh-Ju; Wang, Zhijuan; Zhang, Zhengjing; Mangrauthia, Satendra K; Xu, Huawei; Zhang, Heng; Dilkes, Brian; Tao, W Andy; Zhu, Jian-Kang

    2017-01-01

    Transposons are generally kept silent by epigenetic mechanisms including DNA methylation. Here, we identified a pair of Harbinger transposon-derived proteins (HDPs), HDP1 and HDP2, as anti-silencing factors in Arabidopsis. hdp1 and hdp2 mutants displayed an enhanced silencing of transgenes and some transposons. Phylogenetic analyses revealed that HDP1 and HDP2 were co-domesticated from the Harbinger transposon-encoded transposase and DNA-binding protein, respectively. HDP1 interacts with HDP2 in the nucleus, analogous to their transposon counterparts. Moreover, HDP1 and HDP2 are associated with IDM1, IDM2, IDM3 and MBD7 that constitute a histone acetyltransferase complex functioning in DNA demethylation. HDP2 and the methyl-DNA-binding protein MBD7 share a large set of common genomic binding sites, indicating that they jointly determine the target specificity of the histone acetyltransferase complex. Thus, our data revealed that HDP1 and HDP2 constitute a functional module that has been recruited to a histone acetyltransferase complex to prevent DNA hypermethylation and epigenetic silencing. PMID:27934869

  9. DNA homologous recombination factor SFR1 physically and functionally interacts with estrogen receptor alpha.

    Directory of Open Access Journals (Sweden)

    Yuxin Feng

    Full Text Available Estrogen receptor alpha (ERα, a ligand-dependent transcription factor, mediates the expression of its target genes by interacting with corepressors and coactivators. Since the first cloning of SRC1, more than 280 nuclear receptor cofactors have been identified, which orchestrate target gene transcription. Aberrant activity of ER or its accessory proteins results in a number of diseases including breast cancer. Here we identified SFR1, a protein involved in DNA homologous recombination, as a novel binding partner of ERα. Initially isolated in a yeast two-hybrid screen, the interaction of SFR1 and ERα was confirmed in vivo by immunoprecipitation and mammalian one-hybrid assays. SFR1 co-localized with ERα in the nucleus, potentiated ER's ligand-dependent and ligand-independent transcriptional activity, and occupied the ER binding sites of its target gene promoters. Knockdown of SFR1 diminished ER's transcriptional activity. Manipulating SFR1 expression by knockdown and overexpression revealed a role for SFR1 in ER-dependent and -independent cancer cell proliferation. SFR1 differs from SRC1 by the lack of an intrinsic activation function. Taken together, we propose that SFR1 is a novel transcriptional modulator for ERα and a potential target in breast cancer therapy.

  10. Transcriptional profiling in C. elegans suggests DNA damage dependent apoptosis as an ancient function of the p53 family

    Directory of Open Access Journals (Sweden)

    Rothblatt Jonathan

    2008-07-01

    Full Text Available Abstract Background In contrast to the three mammalian p53 family members, p53, which is generally involved in DNA damage responses, and p63 and p73 which are primarily needed for developmental regulation, cep-1 encodes for the single C. elegans p53-like gene. cep-1 acts as a transcription activator in a primordial p53 pathway that involves CEP-1 activation and the CEP-1 dependent transcriptional induction of the worm BH3 only domain encoding genes egl-1 and ced-13 to induce germ cell apoptosis. EGL-1 and CED-13 proteins inactivate Bcl-2 like CED-9 to trigger CED-4 and CED-3 caspase dependent germ cell apoptosis. To address the function of p53 in global transcriptional regulation we investigate genome-wide transcriptional responses upon DNA damage and cep-1 deficiency. Results Examining C. elegans expression profiles using whole genome Affymetrix GeneChip arrays, we found that 83 genes were induced more than two fold upon ionizing radiation (IR. None of these genes, with exception of an ATP ribosylase homolog, encode for known DNA repair genes. Using two independent cep-1 loss of function alleles we did not find genes regulated by cep-1 in the absence of IR. Among the IR-induced genes only three are dependent on cep-1, namely egl-1, ced-13 and a novel C. elegans specific gene. The majority of IR-induced genes appear to be involved in general stress responses, and qRT-PCR experiments indicate that they are mainly expressed in somatic tissues. Interestingly, we reveal an extensive overlap of gene expression changes occurring in response to DNA damage and in response to bacterial infection. Furthermore, many genes induced by IR are also transcriptionally regulated in longevity mutants suggesting that DNA damage and aging induce an overlapping stress response. Conclusion We performed genome-wide gene expression analyses which indicate that only a surprisingly small number of genes are regulated by CEP-1 and that DNA damage induced apoptosis via the

  11. RAD50 and NBS1 form a stable complex functional in DNA binding and tethering

    NARCIS (Netherlands)

    E. van der Linden (Eddy); H. Sanchez (Humberto); E. Kinoshita (Eri); R. Kanaar (Roland); C. Wyman (Claire)

    2009-01-01

    textabstractThe RAD50/MRE11/NBS1 protein complex (RMN) plays an essential role during the early steps of DNA double-strand break (DSB) repair by homologous recombination. Previous data suggest that one important role for RMN in DSB repair is to provide a link between DNA ends. The striking architect

  12. Applications of Statistical Physics to Understanding the Properties and Function of Noncoding DNA

    Science.gov (United States)

    Stanley, H. Eugene

    2003-03-01

    One of the most remarkable features of human DNA is that 97 percent is not coding for proteins [1]. Studying this noncoding DNA is important both for practical reasons (to distinguish it from the coding DNA as the human genome is sequenced), and for scientific reasons (why is the noncoding DNA present at all, if it appears to have little if any purpose?). In this talk we discuss new methods of analyzing coding and noncoding DNA in parallel, with a view to uncovering different statistical properties of the two kinds of DNA. We also speculate on possible roles of noncoding DNA. The work reported here was carried out in collaboration with P. Bernaola-Galvan, S. V. Buldyrev, P. Carpena, N. Dokholyan, A. L. Goldberger, A. L. Goldberger, I. Grosse, S. Havlin, H. Herzel, R. N. Mantegna, C.-K. Peng, M. Simons, R. H. R. Stanley, and G. M. Viswanathan. [1] For a brief overview in language that physicists can understand, see H. E. Stanley, S. V. Buldyrev, A. L. Goldberger, S. Havlin, C.-K. Peng, and M. Simons, "Scaling Features of Noncoding DNA" [Proc. XII Max Born Symposium, Wroclaw], Physica A 273, 1-18 (1999).

  13. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F;

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assay...

  14. Mammalian RAD52 Functions in Break-Induced Replication Repair of Collapsed DNA Replication Forks

    DEFF Research Database (Denmark)

    Sotiriou, Sotirios K; Kamileri, Irene; Lugli, Natalia

    2016-01-01

    Human cancers are characterized by the presence of oncogene-induced DNA replication stress (DRS), making them dependent on repair pathways such as break-induced replication (BIR) for damaged DNA replication forks. To better understand BIR, we performed a targeted siRNA screen for genes whose depl...

  15. Correspondence between radioactive and functional methods in the quality control of DNA restriction and modifying enzymes

    DEFF Research Database (Denmark)

    Trujillo, L E; Pupo, E; Miranda, F

    1996-01-01

    We evaluated the use of two radiolabeled lambda DNA/Hpa II substrates to detect 5'-->3', 3'-->5' single and double stranded DNA dependent exonuclease and phosphatase activities found as contaminants in restriction and modifying enzyme preparations. Looking for the meaning of the radioactive assay...

  16. Adsorption and desorption characteristics of DNA onto the surface of amino functional mesoporous silica with various particle morphologies.

    Science.gov (United States)

    Hikosaka, Ryouichi; Nagata, Fukue; Tomita, Masahiro; Kato, Katsuya

    2016-04-01

    Recently, deoxyribonucleic acid (DNA) adsorption on solid materials has been reported for applications such as genetic diagnosis of diseases, gene delivery, and biosensors. Mesoporous silica (MPS) is an excellent carrier because of its high surface area and large pore volume. Functionalization of the MPS surface can be controlled by silane coupling reagents, and the MPS particle morphology can be easily changed by the synthetic conditions. In this study, to evaluate the ability of DNA adsorption on MPS, the MPS surface was functionalized using four reagents, 3-aminopropyltriethoxysilane (-NH2), N-(2-aminoethyl)-3-aminopropyltriethoxysilane (-2ENH2), N-(6-aminohexyl)aminopropyltrimethoxysilane (-2HNH2), and (3-trimethoxysilylpropyl)diethylenetriamine (-3NH2), each having a different number of amino groups and alkyl chain lengths. Moreover, we prepared three types of MPSs with different particle morphologies: sheet-type structure (MPS sheet), spherical MPS (MCM-41s), and nonporous spherical silica. A high adsorption capacity was observed in MPS sheets with -2HNH2 (sheet-2HNH2) and -3NH2 (sheet-3NH2), as well as MCM-41s with -3NH2 (41s-3NH2). The adsorption and desorption rates of DNA on these three MPSs were then examined and the best results were obtained with 41s-3NH2. These results demonstrate that the amino functionalized MPS materials are useful DNA adsorbents.

  17. Kub5-Hera, the human Rtt103 homolog, plays dual functional roles in transcription termination and DNA repair.

    Science.gov (United States)

    Morales, Julio C; Richard, Patricia; Rommel, Amy; Fattah, Farjana J; Motea, Edward A; Patidar, Praveen L; Xiao, Ling; Leskov, Konstantin; Wu, Shwu-Yuan; Hittelman, Walter N; Chiang, Cheng-Ming; Manley, James L; Boothman, David A

    2014-04-01

    Functions of Kub5-Hera (In Greek Mythology Hera controlled Artemis) (K-H), the human homolog of the yeast transcription termination factor Rtt103, remain undefined. Here, we show that K-H has functions in both transcription termination and DNA double-strand break (DSB) repair. K-H forms distinct protein complexes with factors that repair DSBs (e.g. Ku70, Ku86, Artemis) and terminate transcription (e.g. RNA polymerase II). K-H loss resulted in increased basal R-loop levels, DSBs, activated DNA-damage responses and enhanced genomic instability. Significantly lowered Artemis protein levels were detected in K-H knockdown cells, which were restored with specific K-H cDNA re-expression. K-H deficient cells were hypersensitive to cytotoxic agents that induce DSBs, unable to reseal complex DSB ends, and showed significantly delayed γ-H2AX and 53BP1 repair-related foci regression. Artemis re-expression in K-H-deficient cells restored DNA-repair function and resistance to DSB-inducing agents. However, R loops persisted consistent with dual roles of K-H in transcription termination and DSB repair.

  18. The Free Energy of dsDNA Basepair Triplets Bound to an ssDNA/RecA Filament May be a Non-Linear Function of the Number of Contiguous Bound Triplets

    CERN Document Server

    Feinstein, Efraim; Prentiss, Mara

    2011-01-01

    The homology search process depends on the free energy of double stranded DNA (dsDNA) triplets bound to pre-synaptic filaments. It has been assumed that the total free energy is a linear function of the number of bound dsDNA triplets. We present an analytical model using a simplified version of the known structure of dsDNA bound to ssDNA/RecA filaments. This model predicts that the mechanical energy stored in dsDNA bound to RecA increases non-linearly with the number of contiguous bound dsDNA triplets. We suggest that the free energy increase for the homology searching state is much more rapid than the increase for the post-strand exchange state and propose that this difference may play a vital role in the homology search/strand exchange process.

  19. Associations among Cognitive Functions, Plasma DNA, and White Matter Integrity in Patients with Early-Onset Parkinson's Disease

    Science.gov (United States)

    Chen, Yueh-Sheng; Chen, Meng-Hsiang; Lu, Cheng-Hsien; Chen, Pei-Chin; Chen, Hsiu-Ling; Yang, I-Hsiao; Tsai, Nai-Wen; Lin, Wei-Che

    2017-01-01

    Early-onset Parkinson's disease (EOPD) patients are symptomatic at a relatively young age, and the impacts of the disease on both the patients and their caregivers are dramatic. Few studies have reported on the cognitive impairments seen in EOPD, and the results of these studies have been diverse. Furthermore, it is still unclear what microstructural white matter (WM) changes are present in EOPD patients. As such, we conducted this study to investigate the microstructural WM changes experienced by EOPD patients and their association with cognitive function and plasma DNA levels. We enrolled 24 EOPD patients and 33 sex- and age-matched healthy volunteers who underwent complete neuro-psychological testing (NPT) to evaluate their cognitive function and diffusion tensor imaging (DTI) scanning to determine their fiber integrity. The plasma DNA measurements included measurements of nuclear and mitochondrial DNA levels. Fractional anisotropy (FA) maps were compared using voxel-based statistics to determine differences between the two groups. The differences in DTI indices and NPT scores were correlated after adjusting for age, sex, and education. Our results demonstrate that patients with EOPD have elevated nuclear DNA levels and wide spectrums of impairments in NPT, especially in the executive function and visuospatial function domains. Exploratory group-wise comparisons of the DTI indices revealed that the patients with EOPD exhibited lower DTI parameters in several brain locations. These poorer DTI parameters were associated with worse cognitive performances and elevated plasma nuclear DNA levels, especially in the anterior thalamic radiation region. Our findings suggest that the thalamus and its adjacent anterior thalamic radiation may be important in the pathogenesis of EOPD, as they appear to become involved in the disease process at an early stage. PMID:28174514

  20. A ssDNA Aptamer That Blocks the Function of the Anti-FLAG M2 Antibody

    Directory of Open Access Journals (Sweden)

    Amanda S. Lakamp

    2011-01-01

    Full Text Available Using SELEX (systematic evolution of ligands by exponential enrichment, we serendipitously discovered a ssDNA aptamer that binds selectively to the anti-FLAG M2 antibody. The aptamer consisted of two motifs (CCTTA and TGTCTWCC separated by 2-3 bases, and the elimination of one or the other motif abrogated binding. The DNA aptamer and FLAG peptide competed for binding to the antigen-binding pocket of the M2 antibody. In addition, the aptamer eluted FLAG-tagged proteins from the antibody, suggesting a commercial application in protein purification. These findings demonstrate the feasibility of using SELEX to develop ssDNA aptamers that block the function of a specific antibody, a capability that could lead to the development of novel therapeutic modalities for patients with systemic lupus erythematosus, rheumatoid arthritis, and other autoimmune diseases.

  1. Probing the functional impact of sequence variation on p53-DNA interactions using a novel microsphere assay for protein-DNA binding with human cell extracts.

    Directory of Open Access Journals (Sweden)

    Maher A Noureddine

    2009-05-01

    Full Text Available The p53 tumor suppressor regulates its target genes through sequence-specific binding to DNA response elements (REs. Although numerous p53 REs are established, the thousands more identified by bioinformatics are not easily subjected to comparative functional evaluation. To examine the relationship between RE sequence variation -- including polymorphisms -- and p53 binding, we have developed a multiplex format microsphere assay of protein-DNA binding (MAPD for p53 in nuclear extracts. Using MAPD we measured sequence-specific p53 binding of doxorubicin-activated or transiently expressed p53 to REs from established p53 target genes and p53 consensus REs. To assess the sensitivity and scalability of the assay, we tested 16 variants of the p21 target sequence and a 62-multiplex set of single nucleotide (nt variants of the p53 consensus sequence and found many changes in p53 binding that are not captured by current computational binding models. A group of eight single nucleotide polymorphisms (SNPs was examined and binding profiles closely matched transactivation capability tested in luciferase constructs. The in vitro binding characteristics of p53 in nuclear extracts recapitulated the cellular in vivo transactivation capabilities for eight well-established human REs measured by luciferase assay. Using a set of 26 bona fide REs, we observed distinct binding patterns characteristic of transiently expressed wild type and mutant p53s. This microsphere assay system utilizes biologically meaningful cell extracts in a multiplexed, quantitative, in vitro format that provides a powerful experimental tool for elucidating the functional impact of sequence polymorphism and protein variation on protein/DNA binding in transcriptional networks.

  2. Functional characterization of a rice de novo DNA methyltransferase, OsDRM2, expressed in Escherichia coli and yeast

    Energy Technology Data Exchange (ETDEWEB)

    Pang, Jinsong, E-mail: pangjs542@nenu.edu.cn [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China); Dong, Mingyue; Li, Ning; Zhao, Yanli [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China); Liu, Bao, E-mail: baoliu@nenu.edu.cn [Key Laboratory of Molecular Epigenetics of the Ministry of Education, Northeast Normal University, Changchun, Jilin 130024 (China)

    2013-03-01

    Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo and maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA

  3. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    Science.gov (United States)

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  4. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  5. Sequence information encoded in DNA that may influence long-range chromatin structure correlates with human chromosome functions.

    Directory of Open Access Journals (Sweden)

    Taichi E Takasuka

    Full Text Available Little is known about the possible function of the bulk of the human genome. We have recently shown that long-range regular oscillation in the motif non-T, A/T, G (VWG existing at ten-nucleotide multiples influences large-scale nucleosome array formation. In this work, we have determined the locations of all 100 kb regions that are predicted to form distinctive chromatin structures throughout each human chromosome (except Y. Using these data, we found that a significantly greater fraction of 300 kb sequences lacked annotated transcripts in genomic DNA regions > or = 300 kb that contained nearly continuous chromatin organizing signals than in control regions. We also found a relationship between the meiotic recombination frequency and the presence of strong VWG chromatin organizing signals. Large (> or = 300 kb genomic DNA regions having low average recombination frequency are enriched in chromatin organizing signals. As additional controls, we show using chromosome 1 that the VWG motif signals are not enriched in randomly selected DNA regions having the mean size of the recombination coldspots, and that non-VWG motif sets do not generate signals that are enriched in recombination coldspots. We also show that tandemly repeated alpha satellite DNA contains strong VWG signals for the formation of distinctive nucleosome arrays, consistent with the low recombination activity of centromeres. Our correlations cannot be explained simply by variations in the GC content. Our findings suggest that a specific set of periodic DNA motifs encoded in genomic DNA, which provide signals for chromatin organization, influence human chromosome function.

  6. Differential nuclease sensitivity profiling of chromatin reveals biochemical footprints coupled to gene expression and functional DNA elements in maize.

    Science.gov (United States)

    Vera, Daniel L; Madzima, Thelma F; Labonne, Jonathan D; Alam, Mohammad P; Hoffman, Gregg G; Girimurugan, S B; Zhang, Jinfeng; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W

    2014-10-01

    The eukaryotic genome is organized into nucleosomes, the fundamental units of chromatin. The positions of nucleosomes on DNA regulate protein-DNA interactions and in turn influence DNA-templated events. Despite the increasing number of genome-wide maps of nucleosome position, how global changes in gene expression relate to changes in nucleosome position is poorly understood. We show that in nucleosome occupancy mapping experiments in maize (Zea mays), particular genomic regions are highly susceptible to variation introduced by differences in the extent to which chromatin is digested with micrococcal nuclease (MNase). We exploited this digestion-linked variation to identify protein footprints that are hypersensitive to MNase digestion, an approach we term differential nuclease sensitivity profiling (DNS-chip). Hypersensitive footprints were enriched at the 5' and 3' ends of genes, associated with gene expression levels, and significantly overlapped with conserved noncoding sequences and the binding sites of the transcription factor KNOTTED1. We also found that the tissue-specific regulation of gene expression was linked to tissue-specific hypersensitive footprints. These results reveal biochemical features of nucleosome organization that correlate with gene expression levels and colocalize with functional DNA elements. This approach to chromatin profiling should be broadly applicable to other species and should shed light on the relationships among chromatin organization, protein-DNA interactions, and genome regulation.

  7. RNA polymerase II transcriptional fidelity control and its functional interplay with DNA modifications

    Science.gov (United States)

    Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong

    2016-01-01

    Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149

  8. Embryonic caffeine exposure acts via A1 adenosine receptors to alter adult cardiac function and DNA methylation in mice.

    Directory of Open Access Journals (Sweden)

    Daniela L Buscariollo

    Full Text Available Evidence indicates that disruption of normal prenatal development influences an individual's risk of developing obesity and cardiovascular disease as an adult. Thus, understanding how in utero exposure to chemical agents leads to increased susceptibility to adult diseases is a critical health related issue. Our aim was to determine whether adenosine A1 receptors (A1ARs mediate the long-term effects of in utero caffeine exposure on cardiac function and whether these long-term effects are the result of changes in DNA methylation patterns in adult hearts. Pregnant A1AR knockout mice were treated with caffeine (20 mg/kg or vehicle (0.09% NaCl i.p. at embryonic day 8.5. This caffeine treatment results in serum levels equivalent to the consumption of 2-4 cups of coffee in humans. After dams gave birth, offspring were examined at 8-10 weeks of age. A1AR+/+ offspring treated in utero with caffeine were 10% heavier than vehicle controls. Using echocardiography, we observed altered cardiac function and morphology in adult mice exposed to caffeine in utero. Caffeine treatment decreased cardiac output by 11% and increased left ventricular wall thickness by 29% during diastole. Using DNA methylation arrays, we identified altered DNA methylation patterns in A1AR+/+ caffeine treated hearts, including 7719 differentially methylated regions (DMRs within the genome and an overall decrease in DNA methylation of 26%. Analysis of genes associated with DMRs revealed that many are associated with cardiac hypertrophy. These data demonstrate that A1ARs mediate in utero caffeine effects on cardiac function and growth and that caffeine exposure leads to changes in DNA methylation.

  9. Embryonic Caffeine Exposure Acts via A1 Adenosine Receptors to Alter Adult Cardiac Function and DNA Methylation in Mice

    Science.gov (United States)

    Greenwood, Victoria; Xue, Huiling; Rivkees, Scott A.; Wendler, Christopher C.

    2014-01-01

    Evidence indicates that disruption of normal prenatal development influences an individual's risk of developing obesity and cardiovascular disease as an adult. Thus, understanding how in utero exposure to chemical agents leads to increased susceptibility to adult diseases is a critical health related issue. Our aim was to determine whether adenosine A1 receptors (A1ARs) mediate the long-term effects of in utero caffeine exposure on cardiac function and whether these long-term effects are the result of changes in DNA methylation patterns in adult hearts. Pregnant A1AR knockout mice were treated with caffeine (20 mg/kg) or vehicle (0.09% NaCl) i.p. at embryonic day 8.5. This caffeine treatment results in serum levels equivalent to the consumption of 2–4 cups of coffee in humans. After dams gave birth, offspring were examined at 8–10 weeks of age. A1AR+/+ offspring treated in utero with caffeine were 10% heavier than vehicle controls. Using echocardiography, we observed altered cardiac function and morphology in adult mice exposed to caffeine in utero. Caffeine treatment decreased cardiac output by 11% and increased left ventricular wall thickness by 29% during diastole. Using DNA methylation arrays, we identified altered DNA methylation patterns in A1AR+/+ caffeine treated hearts, including 7719 differentially methylated regions (DMRs) within the genome and an overall decrease in DNA methylation of 26%. Analysis of genes associated with DMRs revealed that many are associated with cardiac hypertrophy. These data demonstrate that A1ARs mediate in utero caffeine effects on cardiac function and growth and that caffeine exposure leads to changes in DNA methylation. PMID:24475304

  10. DanQ: a hybrid convolutional and recurrent deep neural network for quantifying the function of DNA sequences.

    Science.gov (United States)

    Quang, Daniel; Xie, Xiaohui

    2016-06-20

    Modeling the properties and functions of DNA sequences is an important, but challenging task in the broad field of genomics. This task is particularly difficult for non-coding DNA, the vast majority of which is still poorly understood in terms of function. A powerful predictive model for the function of non-coding DNA can have enormous benefit for both basic science and translational research because over 98% of the human genome is non-coding and 93% of disease-associated variants lie in these regions. To address this need, we propose DanQ, a novel hybrid convolutional and bi-directional long short-term memory recurrent neural network framework for predicting non-coding function de novo from sequence. In the DanQ model, the convolution layer captures regulatory motifs, while the recurrent layer captures long-term dependencies between the motifs in order to learn a regulatory 'grammar' to improve predictions. DanQ improves considerably upon other models across several metrics. For some regulatory markers, DanQ can achieve over a 50% relative improvement in the area under the precision-recall curve metric compared to related models. We have made the source code available at the github repository http://github.com/uci-cbcl/DanQ.

  11. Functional Characterization of Three Concomitant MtDNA LHON Mutations Shows No Synergistic Effect on Mitochondrial Activity.

    Directory of Open Access Journals (Sweden)

    Alberto Cruz-Bermúdez

    Full Text Available The presence of more than one non-severe pathogenic mutation in the same mitochondrial DNA (mtDNA molecule is very rare. Moreover, it is unclear whether their co-occurrence results in an additive impact on mitochondrial function relative to single mutation effects. Here we describe the first example of a mtDNA molecule harboring three Leber's hereditary optic neuropathy (LHON-associated mutations (m.11778G>A, m.14484T>C, m.11253T>C and the analysis of its genetic, biochemical and molecular characterization in transmitochondrial cells (cybrids. Extensive characterization of cybrid cell lines harboring either the 3 mutations or the single classic m.11778G>A and m.14484T>C mutations revealed no differences in mitochondrial function, demonstrating the absence of a synergistic effect in this model system. These molecular results are in agreement with the ophthalmological characteristics found in the triple mutant patient, which were similar to those carrying single mtDNA LHON mutations.

  12. Functional Characterization of Three Concomitant MtDNA LHON Mutations Shows No Synergistic Effect on Mitochondrial Activity

    Science.gov (United States)

    Cruz-Bermúdez, Alberto; Vicente-Blanco, Ramiro J.; Hernández-Sierra, Rosana; Montero, Mayte; Alvarez, Javier; González Manrique, Mar; Blázquez, Alberto; Martín, Miguel Angel; Ayuso, Carmen; Garesse, Rafael; Fernández-Moreno, Miguel A.

    2016-01-01

    The presence of more than one non-severe pathogenic mutation in the same mitochondrial DNA (mtDNA) molecule is very rare. Moreover, it is unclear whether their co-occurrence results in an additive impact on mitochondrial function relative to single mutation effects. Here we describe the first example of a mtDNA molecule harboring three Leber's hereditary optic neuropathy (LHON)-associated mutations (m.11778G>A, m.14484T>C, m.11253T>C) and the analysis of its genetic, biochemical and molecular characterization in transmitochondrial cells (cybrids). Extensive characterization of cybrid cell lines harboring either the 3 mutations or the single classic m.11778G>A and m.14484T>C mutations revealed no differences in mitochondrial function, demonstrating the absence of a synergistic effect in this model system. These molecular results are in agreement with the ophthalmological characteristics found in the triple mutant patient, which were similar to those carrying single mtDNA LHON mutations. PMID:26784702

  13. Functional Characterization of Three Concomitant MtDNA LHON Mutations Shows No Synergistic Effect on Mitochondrial Activity.

    Science.gov (United States)

    Cruz-Bermúdez, Alberto; Vicente-Blanco, Ramiro J; Hernández-Sierra, Rosana; Montero, Mayte; Alvarez, Javier; González Manrique, Mar; Blázquez, Alberto; Martín, Miguel Angel; Ayuso, Carmen; Garesse, Rafael; Fernández-Moreno, Miguel A

    2016-01-01

    The presence of more than one non-severe pathogenic mutation in the same mitochondrial DNA (mtDNA) molecule is very rare. Moreover, it is unclear whether their co-occurrence results in an additive impact on mitochondrial function relative to single mutation effects. Here we describe the first example of a mtDNA molecule harboring three Leber's hereditary optic neuropathy (LHON)-associated mutations (m.11778G>A, m.14484T>C, m.11253T>C) and the analysis of its genetic, biochemical and molecular characterization in transmitochondrial cells (cybrids). Extensive characterization of cybrid cell lines harboring either the 3 mutations or the single classic m.11778G>A and m.14484T>C mutations revealed no differences in mitochondrial function, demonstrating the absence of a synergistic effect in this model system. These molecular results are in agreement with the ophthalmological characteristics found in the triple mutant patient, which were similar to those carrying single mtDNA LHON mutations.

  14. DNA Hydroxymethylation Profiling Reveals that WT1 Mutations Result in Loss of TET2 Function in Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Raajit Rampal

    2014-12-01

    Full Text Available Somatic mutations in IDH1/IDH2 and TET2 result in impaired TET2-mediated conversion of 5-methylcytosine (5mC to 5-hydroxymethylcytosine (5hmC. The observation that WT1 inactivating mutations anticorrelate with TET2/IDH1/IDH2 mutations in acute myeloid leukemia (AML led us to hypothesize that WT1 mutations may impact TET2 function. WT1 mutant AML patients have reduced 5hmC levels similar to TET2/IDH1/IDH2 mutant AML. These mutations are characterized by convergent, site-specific alterations in DNA hydroxymethylation, which drive differential gene expression more than alterations in DNA promoter methylation. WT1 overexpression increases global levels of 5hmC, and WT1 silencing reduced 5hmC levels. WT1 physically interacts with TET2 and TET3, and WT1 loss of function results in a similar hematopoietic differentiation phenotype as observed with TET2 deficiency. These data provide a role for WT1 in regulating DNA hydroxymethylation and suggest that TET2 IDH1/IDH2 and WT1 mutations define an AML subtype defined by dysregulated DNA hydroxymethylation.

  15. Evidence for a functional dimeric form of the PcrA helicase in DNA unwinding

    National Research Council Canada - National Science Library

    Yang, Ye; Dou, Shuo-Xing; Ren, Hua; Wang, Peng-Ye; Zhang, Xing-Dong; Qian, Min; Pan, Bing-Yi; Xi, Xu Guang

    2008-01-01

    .... The first crystal structures of helicases were obtained with PcrA. Based on structural and biochemical studies, it was proposed and then generally believed that PcrA is a monomeric helicase that unwinds DNA by an inchworm mechanism...

  16. On the "barcode" functionality of the DNA, or The phenomenon of Life in the physical Universe

    CERN Document Server

    Berkovich, S Y

    2001-01-01

    The information contained in the genome is insufficient for the control of organism development. Thus, the whereabouts of actual operational directives and workings of the genome remain obscure. In this work, it is suggested that the genome information plays a role of a "barcode". The DNA structure presents a pseudo-random number(PRN)with classification tags, so organisms are characterized by DNA as library books are characterized by catalogue numbers. Elaboration of the "barcode" interpretation of DNA implicates the infrastructure of the physical Universe as a seat of biological information processing. Thanks to the PRNs provided by DNA, biological objects can share these facilities in the Code Division Multiple Access (CDMA) mode, similarly to cellular phone communications. Figuratively speaking, populations of biological objects in the physical Universe can be seen as a community of users on the Internet with a wireless CDMA connection. The phenomenon of Life as a collective information processing activity...

  17. Structure and function of dioxygenases in histone demethylation and DNA/RNA demethylation

    National Research Council Canada - National Science Library

    Dong, Cheng; Zhang, Heng; Xu, Chao; Arrowsmith, Cheryl H; Min, Jinrong

    2014-01-01

    Iron(II) and 2-oxoglutarate (2OG)-dependent dioxygenases involved in histone and DNA/RNA demethylation convert the cosubstrate 2OG and oxygen to succinate and carbon dioxide, resulting in hydroxylation of the methyl group...

  18. Predicting functionality of protein-DNA interactions by integrating diverse evidence

    DEFF Research Database (Denmark)

    Ucar, Duygu; Beyer, A.; Parthasarathy, S.

    2009-01-01

    Chromatin immunoprecipitation (ChIP-chip) experiments enable capturing physical interactions between regulatory proteins and DNA in vivo. However, measurement of chromatin binding alone is not sufficient to detect regulatory interactions. A detected binding event may not be biologically relevant...

  19. Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

    NARCIS (Netherlands)

    Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

    1991-01-01

    Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

  20. Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

    NARCIS (Netherlands)

    Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

    1991-01-01

    Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from p

  1. DNA Recombinase Proteins, their Function and Structure in the Active Form, a Computational Study

    Science.gov (United States)

    Carra, Claudio; Cucinotta, Francis A.

    2007-01-01

    Homologous recombination is a crucial sequence of reactions in all cells for the repair of double strand DNA (dsDNA) breaks. While it was traditionally considered as a means for generating genetic diversity, it is now known to be essential for restart of collapsed replication forks that have met a lesion on the DNA template (Cox et al., 2000). The central stage of this process requires the presence of the DNA recombinase protein, RecA in bacteria, RadA in archaea, or Rad51 in eukaryotes, which leads to an ATP-mediated DNA strand-exchange process. Despite many years of intense study, some aspects of the biochemical mechanism, and structure of the active form of recombinase proteins are not well understood. Our theoretical study is an attempt to shed light on the main structural and mechanistic issues encountered on the RecA of the e-coli, the RecA of the extremely radio resistant Deinococcus Radiodurans (promoting an inverse DNA strand-exchange repair), and the homolog human Rad51. The conformational changes are analyzed for the naked enzymes, and when they are linked to ATP and ADP. The average structures are determined over 2ns time scale of Langevian dynamics using a collision frequency of 1.0 ps(sup -1). The systems are inserted in an octahedron periodic box with a 10 Angstrom buffer of water molecules explicitly described by the TIP3P model. The corresponding binding free energies are calculated in an implicit solvent using the Poisson-Boltzmann solvent accessible surface area, MM-PBSA model. The role of the ATP is not only in stabilizing the interaction RecA-DNA, but its hydrolysis is required to allow the DNA strand-exchange to proceed. Furthermore, we extended our study, using the hybrid QM/MM method, on the mechanism of this chemical process. All the calculations were performed using the commercial code Amber 9.

  2. Induction of Cullin 7 by DNA damage attenuates p53 function

    OpenAIRE

    2007-01-01

    The p53 tumor suppressor gene encodes a transcription factor, which is translationally and posttranslationally activated after DNA damage. In a proteomic screen for p53 interactors, we found that the cullin protein Cul7 efficiently associates with p53. After DNA damage, the level of Cul7 protein increased in a caffeine-sensitive, but p53-independent, manner. Down-regulation of Cul7 by conditional microRNA expression augmented p53-mediated inhibition of cell cycle progression. Ectopic expressi...

  3. Functional expression and characterization of the Epstein-Barr virus DNA polymerase catalytic subunit.

    OpenAIRE

    1993-01-01

    A recombinant baculovirus containing the complete sequence for the Epstein-Barr virus (EBV) DNA polymerase catalytic subunit, BALF5 gene product, under the control of the baculovirus polyhedrin promoter was constructed. Insect cells infected with the recombinant virus produced a protein of 110 kDa, recognized by anti-BALF5 protein-specific polyclonal antibody. The expressed EBV DNA polymerase catalytic polypeptide was purified from the cytosolic fraction of the recombinant virus-infected inse...

  4. Better estimation of protein-DNA interaction parameters improve prediction of functional sites

    Directory of Open Access Journals (Sweden)

    O'Flanagan Ruadhan A

    2008-12-01

    Full Text Available Abstract Background Characterizing transcription factor binding motifs is a common bioinformatics task. For transcription factors with variable binding sites, we need to get many suboptimal binding sites in our training dataset to get accurate estimates of free energy penalties for deviating from the consensus DNA sequence. One procedure to do that involves a modified SELEX (Systematic Evolution of Ligands by Exponential Enrichment method designed to produce many such sequences. Results We analyzed low stringency SELEX data for E. coli Catabolic Activator Protein (CAP, and we show here that appropriate quantitative analysis improves our ability to predict in vitro affinity. To obtain large number of sequences required for this analysis we used a SELEX SAGE protocol developed by Roulet et al. The sequences obtained from here were subjected to bioinformatic analysis. The resulting bioinformatic model characterizes the sequence specificity of the protein more accurately than those sequence specificities predicted from previous analysis just by using a few known binding sites available in the literature. The consequences of this increase in accuracy for prediction of in vivo binding sites (and especially functional ones in the E. coli genome are also discussed. We measured the dissociation constants of several putative CAP binding sites by EMSA (Electrophoretic Mobility Shift Assay and compared the affinities to the bioinformatics scores provided by methods like the weight matrix method and QPMEME (Quadratic Programming Method of Energy Matrix Estimation trained on known binding sites as well as on the new sites from SELEX SAGE data. We also checked predicted genome sites for conservation in the related species S. typhimurium. We found that bioinformatics scores based on SELEX SAGE data does better in terms of prediction of physical binding energies as well as in detecting functional sites. Conclusion We think that training binding site detection

  5. Genotoxic stress and DNA repair in plants: emerging functions and tools for improving crop productivity.

    Science.gov (United States)

    Balestrazzi, Alma; Confalonieri, Massimo; Macovei, Anca; Donà, Mattia; Carbonera, Daniela

    2011-03-01

    Crop productivity is strictly related to genome stability, an essential requisite for optimal plant growth/development. Genotoxic agents (e.g., chemical agents, radiations) can cause both chemical and structural damage to DNA. In some cases, they severely affect the integrity of plant genome by inducing base oxidation, which interferes with the basal processes of replication and transcription, eventually leading to cell death. The cell response to oxidative stress includes several DNA repair pathways, which are activated to remove the damaged bases and other lesions. Information concerning DNA repair in plants is still limited, although results from gene profiling and mutant analysis suggest possible differences in repair mechanisms between plants and other eukaryotes. The present review focuses on the base- and nucleotide excision repair (BER, NER) pathways, which operate according to the most common DNA repair rule (excision of damaged bases and replacement by the correct nucleotide), highlighting the most recent findings in plants. An update on DNA repair in organelles, chloroplasts and mitochondria is also provided. Finally, it is generally acknowledged that DNA repair plays a critical role during seed imbibition, preserving seed vigor. Despite this, only a limited number of studies, described here, dedicated to seeds are currently available.

  6. 利用DNA折纸术构建功能纳米材料%Organizing Functional Nanomaterials with DNA Origami

    Institute of Scientific and Technical Information of China (English)

    王金业; 宋晨; 徐景坤; 丁宝全

    2012-01-01

    DNA origami, an efficient self-assembly technique, has shown great potential for applications in biomedicine, biosensing, nanooptoelectronic device and nanophotonics. It has received strong attention from researchers in a wide range of fields. The programmability and three dimensional addressability of DNA origami architectures have been utilized to precisely organize various functional groups, such as metallic nanoparticles, semiconducting nanoparticles, protein molecules and single-wall carbon nanotubes. Meanwhile, DNA origami structures have also been employed to investigate single molecule reactions on them, such as label-free RNA hybridization, formation and break of a chemical bond and distance-dependent multivalent ligand-protein binding. In the present paper, the research progress of organizing functional nanomaterials with DNA origami are reviewed, and the challenges and application prospects are discussed.%DNA折纸术(DNA origami)作为一种精确高效的自组装技术,自2006年Rothemund发明以来在生物医药、高灵敏度检测、纳米光电子器件、等离子体光子学等领域展现出巨大的应用潜力,近年来受到广大研究者的高度关注。利用DNA折纸术构建纳米材料是以DNA origami结构为载体,通过碱基互补配对的原则及三维结构上可程序化设计和可寻址的特点精确地组装很多功能基团如金属及半导体纳米颗粒,蛋白质和单壁碳纳米管等,并应用于研究无标记的RNA杂交检测、单分子的化学反应、检测间距对多价态的配位体.蛋白质之间键合的影响等。本文对近几年来DNA origami构建功能纳米材料的研究进展加以系统综述,并对DNA origami的发展方向和应用前景进行了展望。

  7. DNA Nanotechnology

    Science.gov (United States)

    Taniguchi, Masateru; Kawai, Tomoji

    2002-11-01

    DNA is one candidate of promising molecules for molecular electronic devices, since it has the double helix structure with pi-electron bases for electron transport, the address at 0.4 nm intervals, and the self-assembly. Electrical conductivity and nanostructure of DNA and modified DNA molecules are investigated in order to research the application of DNA in nanoelectronic devices. It has been revealed that DNA is a wide-gap semiconductor in the absence of doping. The conductivity of DNA has been controlled by chemical doping, electric field doping, and photo-doping. It has found that Poly(dG)[middle dot]Poly(dC) has the best conductivity and can function as a conducting nanowire. The pattern of DNA network is controlled by changing the concentration of the DNA solution.

  8. Persistent DNA damage-induced premature senescence alters the functional features of human bone marrow mesenchymal stem cells.

    Science.gov (United States)

    Minieri, Valentina; Saviozzi, Silvia; Gambarotta, Giovanna; Lo Iacono, Marco; Accomasso, Lisa; Cibrario Rocchietti, Elisa; Gallina, Clara; Turinetto, Valentina; Giachino, Claudia

    2015-04-01

    Human mesenchymal stem cells (hMSCs) are adult multipotent stem cells located in various tissues, including the bone marrow. In contrast to terminally differentiated somatic cells, adult stem cells must persist and function throughout life to ensure tissue homeostasis and repair. For this reason, they must be equipped with DNA damage responses able to maintain genomic integrity while ensuring their lifelong persistence. Evaluation of hMSC response to genotoxic insults is of great interest considering both their therapeutic potential and their physiological functions. This study aimed to investigate the response of human bone marrow MSCs to the genotoxic agent Actinomycin D (ActD), a well-known anti-tumour drug. We report that hMSCs react by undergoing premature senescence driven by a persistent DNA damage response activation, as hallmarked by inhibition of DNA synthesis, p21 and p16 protein expression, marked Senescent Associated β-galactosidase activity and enlarged γH2AX foci co-localizing with 53BP1 protein. Senescent hMSCs overexpress several senescence-associated secretory phenotype (SASP) genes and promote motility of lung tumour and osteosarcoma cell lines in vitro. Our findings disclose a multifaceted consequence of ActD treatment on hMSCs that on the one hand helps to preserve this stem cell pool and prevents damaged cells from undergoing neoplastic transformation, and on the other hand alters their functional effects on the surrounding tissue microenvironment in a way that might worsen their tumour-promoting behaviour.

  9. Structure-function investigations of DNA condensing agents with application to gene delivery

    Science.gov (United States)

    Evans, Heather Marie

    Lipid-based systems are notoriously poor for gene delivery, and their use has been primarily empirical. In order to improve these systems, it is imperative to obtain a greater understanding of molecular interactions between DNA and positively charged molecules. A variety of cationic molecules have been studied with DNA, in an attempt to correlate structural properties of these assemblies (using x-ray diffraction) with their efficiency as DNA carriers for gene delivery (using a luciferase assay). Several systems have been studied, some of which use the same charged amine moieties presented in three distinct morphologies: the multivalent salts spermine and spermidine, dendrimers, and dendrimeric lipids. The dendrimers somewhat approximate the properties of histories, cylindrical proteins that condense intracellular DNA. Structural studies of histone and DNA have also been conducted in order to better understand these interactions and their possible relevance to the gene delivery pathway. In addition, empirical evidence suggests that for successful in vivo gene delivery, cholesterol should be used as a helper lipid. The delivery efficiency and structural behavior of cholesterol and other sterol molecules have been studied in ternary lipid mixtures.

  10. Origins and functional consequences of somatic mitochondrial DNA mutations in human cancer.

    Science.gov (United States)

    Ju, Young Seok; Alexandrov, Ludmil B; Gerstung, Moritz; Martincorena, Inigo; Nik-Zainal, Serena; Ramakrishna, Manasa; Davies, Helen R; Papaemmanuil, Elli; Gundem, Gunes; Shlien, Adam; Bolli, Niccolo; Behjati, Sam; Tarpey, Patrick S; Nangalia, Jyoti; Massie, Charles E; Butler, Adam P; Teague, Jon W; Vassiliou, George S; Green, Anthony R; Du, Ming-Qing; Unnikrishnan, Ashwin; Pimanda, John E; Teh, Bin Tean; Munshi, Nikhil; Greaves, Mel; Vyas, Paresh; El-Naggar, Adel K; Santarius, Tom; Collins, V Peter; Grundy, Richard; Taylor, Jack A; Hayes, D Neil; Malkin, David; Foster, Christopher S; Warren, Anne Y; Whitaker, Hayley C; Brewer, Daniel; Eeles, Rosalind; Cooper, Colin; Neal, David; Visakorpi, Tapio; Isaacs, William B; Bova, G Steven; Flanagan, Adrienne M; Futreal, P Andrew; Lynch, Andy G; Chinnery, Patrick F; McDermott, Ultan; Stratton, Michael R; Campbell, Peter J

    2014-10-01

    Recent sequencing studies have extensively explored the somatic alterations present in the nuclear genomes of cancers. Although mitochondria control energy metabolism and apoptosis, the origins and impact of cancer-associated mutations in mtDNA are unclear. In this study, we analyzed somatic alterations in mtDNA from 1675 tumors. We identified 1907 somatic substitutions, which exhibited dramatic replicative strand bias, predominantly C > T and A > G on the mitochondrial heavy strand. This strand-asymmetric signature differs from those found in nuclear cancer genomes but matches the inferred germline process shaping primate mtDNA sequence content. A number of mtDNA mutations showed considerable heterogeneity across tumor types. Missense mutations were selectively neutral and often gradually drifted towards homoplasmy over time. In contrast, mutations resulting in protein truncation undergo negative selection and were almost exclusively heteroplasmic. Our findings indicate that the endogenous mutational mechanism has far greater impact than any other external mutagens in mitochondria and is fundamentally linked to mtDNA replication.

  11. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    Science.gov (United States)

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Human DNA (cytosine-5)-methyltransferases: a functional and structural perspective for epigenetic cancer therapy.

    Science.gov (United States)

    Rondelet, Grégoire; Wouters, Johan

    2017-08-01

    Epigenetic modifications modulate chromatin states to regulate gene expression. Among them, DNA methylation and histone modifications play a crucial role in the establishment of the epigenome. In cancer, these epigenetic events may act in concert to repress tumor suppressor genes or promote oncogenic pathways. In the context of cancer initiation and progression, recruitment of DNA (cytosine-5)-methyltransferases to specific genomic regions is mainly mediated by histone epigenetic marks, transcription factors and co-regulators as part of a dynamic process. Herein, we will review these mechanisms and present state-of-the-art of DNA methylation, treatment and development of epigenetic cancer therapies targeting this epigenetic modification. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  13. Improved DNA condensation, stability, and transfection with alkyl sulfonyl-functionalized PAMAM G2

    Energy Technology Data Exchange (ETDEWEB)

    Rata-Aguilar, Azahara, E-mail: azahara@ugr.es; Maldonado-Valderrama, Julia; Jódar-Reyes, Ana Belén; Ortega-Vinuesa, Juan Luis [University of Granada, Biocolloid and Fluid Physics Group, Department of Applied Physics (Spain); Santoyo-Gonzalez, Francisco [University of Granada, Organic Chemistry Department, Institute of Biotechnology (Spain); Martín-Rodríguez, Antonio [University of Granada, Biocolloid and Fluid Physics Group, Department of Applied Physics (Spain)

    2015-04-15

    In this work, we have used a second-generation PAMAM grafted with octadecyl sulfonyl chains to condense plasmid DNA. The influence of this modification at different levels was investigated by comparison with original PAMAM G2. The condensation process and temporal stability of the complexes was studied with DLS, finding that the aliphatic chains influence DNA compaction via hydrophobic forces and markedly improve the formation and temporal stability of a single populated system with a hydrodynamic diameter below 100 nm. Interaction with a cell membrane model was also evaluated with a pendant drop tensiometer, resulting in further incorporation of the C18-PAMAM dendriplexes onto the interface. The improvement observed in transfection with our C18 grafted PAMAM is ascribed to the size, stability, and interfacial behavior of the complexes, which in turn are consequence of the DNA condensation process and the interactions involved.

  14. Antiviral immunity in fish – functional analysis using DNA vaccination as a tool

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2013-01-01

    CpG motifs in the plasmid backbone sequence might play a role, the viral G protein appears to have an inherent ability to stimulate innate immune mechanisms by receptors and pathways that still remain to be characterized in detail. Immunity to VHS in rainbow trout can be induced by DNA vaccination......In fish, DNA vaccines encoding the glycoproteins (G proteins) of the salmonid rhabdoviruses VHSV and IHNV have proved very efficient under experimental conditions. Nano-gram amounts of plasmid DNA can induce long-lasting protective immunity when delivered by intramuscular injection in rainbow trout...... fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...

  15. Exploring function of conserved non-coding DNA in its chromosomal context

    Directory of Open Access Journals (Sweden)

    Delores J. Grant

    2015-11-01

    Full Text Available There is renewed interest in understanding expression of vertebrate genes in their chromosomal context because regulatory sequences that confer tissue-specific expression are often distributed over large distances along the DNA from the gene. One approach inserts a universal sensor/reporter-gene into the mouse or zebrafish genome to identify regulatory sequences in highly conserved non-coding DNA in the vicinity of the integrated reporter-gene. However detailed mechanisms of interaction of these regulatory elements among themselves and/or with the genes they influence remain elusive with the strategy. The inability to associate distant regulatory elements with the genes they regulate makes it difficult to examine the contribution of sequence changes in regulatory DNA to human disease. Such associations have been obtained in favorable circumstances by testing the regulatory potential of highly conserved non-coding DNA individually in small reporter-gene-containing plasmids. Alternative approaches use tiny fragments of chromosomes in Bacterial Artificial Chromosomes, BACs, where the gene of interest is tagged in vitro with a reporter/sensor gene and integrated into the germ-line of animals for expression. Mutational analysis of the BAC DNA identifies regulatory sequences. A recent approach inserts a sensor/reporter-gene into a BAC that is also truncated progressively from an end of genomic insert, and the end-deleted BAC carrying the sensor is then integrated into the genome of a developing animal for expression. The approach allows mechanisms of tissue-specific gene expression to be explored in much greater detail, although the chromosomal context of such mechanisms is limited to the length of the BAC. Here we discuss the relative strengths of the various approaches and explore how the integrated-sensor in the BACs method applied to a contig of BACs spanning a chromosomal region is likely to address mechanistic questions on interactions between

  16. APOBEC3G is a single-stranded DNA cytidine deaminase and functions independently of HIV reverse transcriptase

    Science.gov (United States)

    Suspène, Rodolphe; Sommer, Peter; Henry, Michel; Ferris, Stéphane; Guétard, Denise; Pochet, Sylvie; Chester, Ann; Navaratnam, Naveenan; Wain-Hobson, Simon; Vartanian, Jean-Pierre

    2004-01-01

    In the absence of the viral vif gene, human immunodeficiency virus (HIV) may be restricted by the APOBEC3G gene on chromosome 22. The role of the HIV Vif protein is to exclude host cell APOBEC3G from the budding virion. As APOBEC3G shows sequence homology to cytidine deaminases, it is presumed that in the absence of Vif, cytidine residues in the cDNA are deaminated yielding uracil. It is not known if additional proteins mediate APOBEC3G function or if deamination occurs in concert with reverse transcription. This report describes an in vitro assay showing that Baculovirus derived APOBEC3G alone extensively deaminates cDNA independently of reverse transcriptase. It reproduces the dinucleotide context typical of G → A hypermutants derived from a Δvif virus. By using an RNaseH– form of reverse transcriptase, it was shown that the cDNA has to be free of its RNA template to allow deamination. APOBEC3G deamination of dC or dCTP was not detected. In short, APOBEC3G is a single-stranded DNA cytidine deaminase capable of restricting retroviral replication. PMID:15121899

  17. Biological function and regulation of histone and non-histone lysine methylation in response to DNA damage

    Institute of Scientific and Technical Information of China (English)

    Yongcan Chen; Wei-Guo Zhu

    2016-01-01

    DNA damage response (DDR) signaling network is initiated to protect cells from various exogenous and endogenous damage resources.Timely and accurate regulation of DDR proteins is required for distinct DNA damage repair pathways.Post-translational modifications of histone and non-histone proteins play a vital role in the DDR factor foci formation and signaling pathway.Phosphorylation,ubiquitylation,SUMOylation,neddylation,poly(ADP-ribosyl)ation,acetylation,and methylation are all involved in the spatial-temporal regulation of DDR,among which phosphorylation and ubiquitylation are well studied.Studies in the past decade also revealed extensive roles of lysine methylation in response to DNA damage.Lysine methylation is finely regulated by plenty of lysine methyltransferases,lysine demethylases,and can be recognized by proteins with chromodomain,plant homeodomain,Tudor domain,malignant brain tumor domain,or prolinetryptophan-tryptophan-proline domain.In this review,we outline the dynamics and regulation of histone lysine methylation at canonical (H3K4,H3K9,H3K27,H3K36,H3K79,and H4K20) and non-canonical sites after DNA damage,and discuss their context-specific functions in DDR protein recruitment or extraction,chromatin environment establishment,and transcriptional regulation.We also present the emerging advances of lysine methylation in non-histone proteins during DDR.

  18. Functional intron+ and intron- rDNA in the same macronucleus of the ciliate Tetrahymena pigmentosa

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    alleles was followed in the total culture and in single cells during their vegetative segregation and it was observed that replication was non-preferential with respect to the two alleles. The diallelic clones were also used to demonstrate that intron-containing rDNA was transcribed and the transcript......Diallelic clones of Tetrahymena pigmentosa containing equal amounts of intron+ and intron- rDNA in the macronucleus were constructed. The macronucleus of the resulting strains divides amitotically during vegetative growth and the diallelic genotype is therefore unstable. The coexistence of the two...

  19. Ubiquitous late competence genes in Bacillus species indicate the presence of functional DNA uptake machineries

    NARCIS (Netherlands)

    Kovacs, Akos T.; Smits, Wiep Klaas; Mironczuk, Aleksandra M.; Kuipers, Oscar P.; Mirończuk, Aleksandra M.

    P>Natural competence for genetic transformation, i.e. the ability to take up DNA and stably integrate it in the genome, has so far only been observed in the bacterial kingdom (both in Gram-negative and Gram-positive species) and may contribute to survival under adverse growth conditions. Bacillus

  20. Functionalization of Fatty Acid Vesicles through Newly Synthesized Bolaamphiphile-DNA Conjugates

    DEFF Research Database (Denmark)

    Wamberg, M. C.; Wieczorek, R.; Brier, S. B.

    2014-01-01

    of these structures, only one novel bola-amphiphile DNA conjugate could interact efficiently with or spontaneously pierce into the vesicle bilayers without jeopardizing their self-assembly or stability. This molecule was synthesized via a Cu(I)-catalyzed [3 + 2] azide-alkyne cycloaddition (click reaction...

  1. Structural and functional conservation of two human homologs of the yeast DNA repair gene RAD6.

    NARCIS (Netherlands)

    M.H.M. Koken (Marcel); P. Reynolds (Paul); I. Jaspers-Dekker (Iris); L. Prakash; S. Prakash; D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)

    1991-01-01

    textabstractThe RAD6 gene of Saccharomyces cerevisiae encodes a ubiquitin-conjugating enzyme (E2) that is required for DNA repair, damage-induced mutagenesis, and sporulation. We have cloned the two human RAD6 homologs, designated HHR6A and HHR6B. The two 152-amino acid human proteins share 95% sequ

  2. DNA-binding specificity and molecular functions of NAC transcription factors

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila;

    2005-01-01

    The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites f...

  3. Meiotic and mitotic functions of mammalian RAD 18 in DNA double-strand break repair

    NARCIS (Netherlands)

    A. Inagaki (Akiko)

    2010-01-01

    textabstractThis thesis focuses on the role of RAD 18 in DNA double-strand break (DSB ) repair. Much is known about the role of RAD 18, and its critical substrate PCNA in replication damage bypass (RDB ) repair. However, the roles of RAD 18 in DSB repair are still elusive, although several

  4. Rapid DNA Library Construction for Functional Genomic and Metagenomic Screening▿ †

    OpenAIRE

    2007-01-01

    A rapid protocol was developed for constructing plasmid libraries from small quantities of genomic/metagenomic DNA. The technique utilizes linker amplification with topoisomerase cloning and allows for inducible transcription in Escherichia coli. As proof of principle, several anti-Bacillus lysins were cloned from bacteriophage genomes and an aerolysin was cloned from a metagenomic sample.

  5. Meiotic and mitotic functions of mammalian RAD 18 in DNA double-strand break repair

    NARCIS (Netherlands)

    A. Inagaki (Akiko)

    2010-01-01

    textabstractThis thesis focuses on the role of RAD 18 in DNA double-strand break (DSB ) repair. Much is known about the role of RAD 18, and its critical substrate PCNA in replication damage bypass (RDB ) repair. However, the roles of RAD 18 in DSB repair are still elusive, although several interacti

  6. Ubiquitous late competence genes in Bacillus species indicate the presence of functional DNA uptake machineries

    NARCIS (Netherlands)

    Kovacs, Akos T.; Smits, Wiep Klaas; Mironczuk, Aleksandra M.; Kuipers, Oscar P.; Mirończuk, Aleksandra M.

    2009-01-01

    P>Natural competence for genetic transformation, i.e. the ability to take up DNA and stably integrate it in the genome, has so far only been observed in the bacterial kingdom (both in Gram-negative and Gram-positive species) and may contribute to survival under adverse growth conditions. Bacillus su

  7. DNA origami nanopores for controlling DNA translocation.

    Science.gov (United States)

    Hernández-Ainsa, Silvia; Bell, Nicholas A W; Thacker, Vivek V; Göpfrich, Kerstin; Misiunas, Karolis; Fuentes-Perez, Maria Eugenia; Moreno-Herrero, Fernando; Keyser, Ulrich F

    2013-07-23

    We combine DNA origami structures with glass nanocapillaries to reversibly form hybrid DNA origami nanopores. Trapping of the DNA origami onto the nanocapillary is proven by imaging fluorescently labeled DNA origami structures and simultaneous ionic current measurements of the trapping events. We then show two applications highlighting the versatility of these DNA origami nanopores. First, by tuning the pore size we can control the folding of dsDNA molecules ("physical control"). Second, we show that the specific introduction of binding sites in the DNA origami nanopore allows selective detection of ssDNA as a function of the DNA sequence ("chemical control").

  8. Actin polymerization negatively regulates p53 function by impairing its nuclear import in response to DNA damage.

    Directory of Open Access Journals (Sweden)

    Ling Wang

    Full Text Available Actin, one of the most evolutionarily conservative proteins in eukaryotes, is distributed both in the cytoplasm and the nucleus, and its dynamics plays important roles in numerous cellular processes. Previous evidence has shown that actin interacts with p53 and this interaction increases in the process of p53 responding to DNA damage, but the physiological significance of their interaction remains elusive. Here, we show that DNA damage induces both actin polymerization and p53 accumulation. To further understand the implication of actin polymerization in p53 function, cells were treated with actin aggregation agent. We find that the protein level of p53 decrease. The change in p53 is a consequence of the polymeric actin anchoring p53 in the cytoplasm, thus impairing p53 nuclear import. Analysis of phosphorylation and ubiquitination of p53 reveals that actin polymerization promotes the p53 phosphorylation at Ser315 and reduces the stabilization of p53 by recruiting Aurora kinase A. Taken together, our results suggest that the actin polymerization serves as a negative modulator leading to the impairment of nuclear import and destabilization of p53. On the basis of our results, we propose that actin polymerization might be a factor participating in the process of orchestrating p53 function in response to DNA damage.

  9. Molecular and functional diversity of PGPR fluorescent Pseudomonads based on 16S rDNA-RFLP and RAPD markers.

    Science.gov (United States)

    Singh, Bhim Pratap

    2015-09-01

    The genetic and functional diversity of plant growth promoting rhizobacterial (PGPR) fluorescent pseudomonads associated with chickpea (Cicer arietinum L.) rhizosphere was analyzed. In total, 34 isolates along with two reference isolates were screened for various plant growth promoting traits (phosphorous solubilization, ACC deaminase, HCN, IAA and siderophore productions) and antagonist activity against four fungal phytopathogens and three bacterial pathogens. Most of the isolates, that showed PGPR activity, also showed antagonistic activity against all the three fungal pathogens. The genetic relationship was assessed by using random amplification of polymorphic DNA (RAPD) and PCR-restriction fragment length polymorphism (16S rDNA-RFLP). Relationship between both the markers was analyzed based on mantel test and a negative correlation was observed. The study concluded that PGPR traits appeared to be strain specific rather than specific to any phylogenetic group. The study also reported that 16S rDNA based profiling differentiated PGPR fluorescent Pseudomonas on the basis of location rather than biological trait. RAPD profiling could be useful to differentiate among the closely related isolates. The genetic and functional diversity of fluorescent pseudomonads, associated with the chickpea rhizosphere, has useful ecological role and potential utilization in sustainable agriculture.

  10. Tel1 and Rif2 Regulate MRX Functions in End-Tethering and Repair of DNA Double-Strand Breaks.

    Directory of Open Access Journals (Sweden)

    Corinne Cassani

    2016-02-01

    Full Text Available The cellular response to DNA double-strand breaks (DSBs is initiated by the MRX/MRN complex (Mre11-Rad50-Xrs2 in yeast; Mre11-Rad50-Nbs1 in mammals, which recruits the checkpoint kinase Tel1/ATM to DSBs. In Saccharomyces cerevisiae, the role of Tel1 at DSBs remains enigmatic, as tel1Δ cells do not show obvious hypersensitivity to DSB-inducing agents. By performing a synthetic phenotype screen, we isolated a rad50-V1269M allele that sensitizes tel1Δ cells to genotoxic agents. The MRV1269MX complex associates poorly to DNA ends, and its retention at DSBs is further reduced by the lack of Tel1. As a consequence, tel1Δ rad50-V1269M cells are severely defective both in keeping the DSB ends tethered to each other and in repairing a DSB by either homologous recombination (HR or nonhomologous end joining (NHEJ. These data indicate that Tel1 promotes MRX retention to DSBs and this function is important to allow proper MRX-DNA binding that is needed for end-tethering and DSB repair. The role of Tel1 in promoting MRX accumulation to DSBs is counteracted by Rif2, which is recruited to DSBs. We also found that Rif2 enhances ATP hydrolysis by MRX and attenuates MRX function in end-tethering, suggesting that Rif2 can regulate MRX activity at DSBs by modulating ATP-dependent conformational changes of Rad50.

  11. Zebrafish lacking functional DNA polymerase gamma survive to juvenile stage, despite rapid and sustained mitochondrial DNA depletion, altered energetics and growth.

    Science.gov (United States)

    Rahn, Jennifer J; Bestman, Jennifer E; Stackley, Krista D; Chan, Sherine S L

    2015-12-02

    DNA polymerase gamma (POLG) is essential for replication and repair of mitochondrial DNA (mtDNA). Mutations in POLG cause mtDNA instability and a diverse range of poorly understood human diseases. Here, we created a unique Polg animal model, by modifying polg within the critical and highly conserved polymerase domain in zebrafish. polg(+/-) offspring were indistinguishable from WT siblings in multiple phenotypic and biochemical measures. However, polg(-/-) mutants developed severe mtDNA depletion by one week post-fertilization (wpf), developed slowly and had regenerative defects, yet surprisingly survived up to 4 wpf. An in vivo mtDNA polymerase activity assay utilizing ethidium bromide (EtBr) to deplete mtDNA, showed that polg(+/-) and WT zebrafish fully recover mtDNA content two weeks post-EtBr removal. EtBr further reduced already low levels of mtDNA in polg(-/-) animals, but mtDNA content did not recover following release from EtBr. Despite significantly decreased respiration that corresponded with tissue-specific levels of mtDNA, polg(-/-) animals had WT levels of ATP and no increase in lactate. This zebrafish model of mitochondrial disease now provides unique opportunities for studying mtDNA instability from multiple angles, as polg(-/-) mutants can survive to juvenile stage, rather than lose viability in embryogenesis as seen in Polg mutant mice.

  12. Improved method for Mica functionalization used in single molecule imaging of DNA with atomic force microscopy

    Directory of Open Access Journals (Sweden)

    Hana Zapletalová

    2016-07-01

    Full Text Available The modified procedure of 1-(3-aminopropylsilatrane (APS compound synthesis based on a new derivative (3‑aminopropyltrimethoxysilane for the purpose of DNA immobilization for AFM single imaging is described. New reaction pathway based on kinetically driven reaction approach is described. Necessity of two‑step purification process is proved; ability of purified APS to provide four times smoother surfaces in comparison with a crude product is demonstrated. Various analytical methods such mass spectroscopy and 1H NMR were used to show structure and enhanced purity of the APS product. APS mediates fixation of DNA molecules to mica substrates to be used for DNA imaging under Atomic Force Microscope. The use of an APS compound for simple and rapid silanization of mica surface is demonstrated. The advantages of APS‑based method are based mainly on low roughness of modified mica and homogeneous surface coverage by short sequence dsDNA (246 bp. The product obtained by the condensation reaction was purified in a two step process whose effectiveness was demonstrated not only by reduction of the silanized surface roughness, but also by mass spectroscopy (MS‑ESi, MALDI‑TOF method and proton magnetic resonance spectroscopy. Experiments demonstrate that 1‑(3‑aminopropylsilatrane can be used to fix dsDNA molecules to a mica surface to be visualized by either the tapping mode or the force‑volume mode of AFM microscopy, as demonstrated by experiments. Moreover, necessity of advanced purification protocol is demonstrated by AFM based roughness measurements – pure vs crude APS product. The kinetics of APS‑layer aging, caused by silicon oxide growth on silanized layers, was studied by water contact angle measurements and is discussed.

  13. Repeated oral administration of chitosan/DNA nanoparticles delivers functional FVIII with the absence of antibodies in hemophilia A mice.

    Science.gov (United States)

    Dhadwar, S S; Kiernan, J; Wen, J; Hortelano, G

    2010-12-01

    Current treatment of hemophilia A is expensive and involves regular infusions of factor (F)VIII concentrates. The supply of functional FVIII is further compromised by the generation of neutralizing antibodies. Thus, the development of an alternative safe, cost effective, non-invasive treatment that circumvents immune response induction is desirable. To evaluate the feasibility of oral administration of chitosan nanoparticles containing FVIII DNA to provide sustainable FVIII activity in hemophilia A mice. Nanoparticles were characterized for morphology, DNA protection and transfection efficiency. Oral administration of nanoparticles containing canine FVIII in C57Bl/6 FVIII(-/-) hemophilia A mice was evaluated for biodistribution, plasma FVIII activity and phenotypic correction. Sustainable FVIII expression was elucidated after repeated nanoparticle administration. Immune responses to repeated oral nanoparticle administration were also investigated. Chitosan nanoparticles had a particle size range of 200-400 nm and protected DNA from endonuclease and pH degradation. In addition, nanoparticles transfected HEK 293 cells resulted in expression of eGFP, luciferase and FVIII. Hemophilia A mice that ingested chitosan nanoparticles demonstrated transient canine FVIII expression reaching > 100 mU 1 day after treatment, together with partial phenotypic correction. The delivered FVIII plasmid DNA was detected in the intestine and, to a lesser extent, in the liver. Importantly, repeated weekly administrations restored FVIII activity. Furthermore, inhibitors and non-neutralizing FVIII antibodies were not detectable. Repeat oral administration of FVIII DNA formulated in chitosan nanoparticles resulted in sustained FVIII activity in hemophilic mice, and thus may provide a non-invasive alternative treatment for hemophilia A. © 2010 International Society on Thrombosis and Haemostasis.

  14. Identification of novel gene targets and functions of p21-activated kinase 1 during DNA damage by gene expression profiling.

    Directory of Open Access Journals (Sweden)

    Mona Motwani

    Full Text Available P21-activated kinase 1 (PAK1, a serine/threonine protein kinase, modulates many cellular processes by phosphorylating its downstream substrates. In addition to its role in the cytoplasm, PAK1 also affects gene transcription due to its nuclear localization and association with chromatin. It is now recognized that PAK1 kinase activity and its nuclear translocation are rapidly stimulated by ionizing radiation (IR, and that PAK1 activation is a component of the DNA damage response. Owing to the role of PAK1 in the cell survival, its association with the chromatin, and now, stimulation by ionizing radiation, we hypothesize that PAK1 may be contributing to modulation of genes with roles in cellular processes that might be important in the DNA damage response. The purpose of this study was to identify new PAK1 targets in response to ionizing radiation with putative role in the DNA damage response. We examined the effect of IR on the gene expression patterns in the murine embryonic fibroblasts with or without Pak1 using microarray technology. Differentially expressed transcripts were identified using Gene Spring GX 10.0.2. Pathway, network, functional analyses and gene family classification were carried out using Kyoto Encyclopedia of Genes and Genomes (KEGG, Ingenuity Pathway, Gene Ontology and PANTHER respectively. Selective targets of PAK1 were validated by RT-qPCR. For the first time, we provide a genome-wide analysis of PAK1 and identify its targets with potential roles in the DNA damage response. Gene Ontology analysis identified genes in the IR-stimulated cells that were involved in cell cycle arrest and cell death. Pathway analysis revealed p53 pathway being most influenced by IR responsive, PAK1 targets. Gene family of transcription factors was over represented and gene networks involved in DNA replication, repair and cellular signaling were identified. In brief, this study identifies novel PAK1 dependent IR responsive genes which reveal new

  15. Staining-free gel electrophoresis-based multiplex enzyme assay using DNA and peptide dual-functionalized gold nanoparticles.

    Science.gov (United States)

    Zhao, Wenting; Yao, Chunlei; Luo, Xiaoteng; Lin, Li; Hsing, I-Ming

    2012-04-01

    We report a simple staining-free gel electrophoresis method to simultaneously probe protease and nuclease. Utilizing gold nanoparticles (Au-NPs) dual-functionalized with DNA and peptide, the presence and concentration of nuclease and protease are determined concurrently from the relative position and intensity of the bands in the staining-free gel electrophoresis. The use of Au-NPs eliminates the need for staining processes and enables naked eye detection, while a mononucleotide-mediated approach facilitates the synthesis of DNA/peptide conjugated Au-NPs and simplifies the operation procedures. Multiplex detection and quantification of DNase I and trypsin are successfully demonstrated. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. DNA sequence functionalized with heterogeneous core-satellite nanoassembly for novel energy-transfer-based photoelectrochemical bioanalysis.

    Science.gov (United States)

    Zhu, Yuan-Cheng; Xu, Fei; Zhang, Nan; Zhao, Wei-Wei; Xu, Jing-Juan; Chen, Hong-Yuan

    2017-05-15

    This work reports the use of compositionally heterogeneous asymmetric Ag@Au core-satellite nanoassembly functionalized with DNA sequence as unique signaling nanoprobes for the realization of new energy-transfer-based photoelectrochemical (PEC) immunoassay of prostate- specific antigen (PSA). Specifically, the Ag@Au asymmetric core-satellite nanoassemblies (Ag@Au ACS) were fabricated on a two-dimensional glass substrate by a modified controlled assembly technique, and then functionalized with DNA sequences containing PSA aptamers as signaling nanoprobes. Then, the sandwich complexing between the PSA, its antibodies, and the signaling nanoprobes was performed on a CdS QDs modified indium tin oxide (ITO) electrode. The single stranded DNA can server as a facile mediator that place the Ag@Au ACS in proximity of CdS QDs, stimulating the interparticle exciton-plasmon interactions between Ag@Au ACS and CdS QDs and thus quenching the excitonic states in the latter. Since the damping effect is closely related to the target concentration, a novel energy-transfer-based PEC bioanalysis could be achieved for the sensitive and specific PSA assay. The developed biosensor displayed a linear range from 1.0×10(-11)gmL(-1) to 1.0×10(-7)gmL(-1) and the detection limit was experimentally found to be of 0.3×10(-13)gmL(-1). This strategy used the Ag@Au ACS-DNA signaling nanoprobes and overcame the deficiency of short operating distance of the energy transfer process for feasible PEC immunoassay. More significantly, it provided a way to couple the plasmonic properties of the Ag NPs and Au NPs in a single PEC bioanalytical system. We expected this work could inspire more interests and further investigations on the advanced engineering of the core-satellite or other judiciously designed nanostructures for new PEC bioanalytical uses with novel properties.

  17. DNA double strand break repair enzymes function at multiple steps in retroviral infection

    Directory of Open Access Journals (Sweden)

    Agematsu Kazunaga

    2009-12-01

    Full Text Available Abstract Background DNA double strand break (DSB repair enzymes are thought to be necessary for retroviral infection, especially for the post-integration repair and circularization of viral cDNA. However, the detailed roles of DSB repair enzymes in retroviral infection remain to be elucidated. Results A GFP reporter assay showed that the infectivity of an HIV-based vector decreased in ATM- and DNA-PKcs-deficient cells when compared with their complemented cells, while that of an MLV-based vector was diminished in Mre11- and DNA-PKcs-deficient cells. By using a method based on inverse- and Alu-PCR, we analyzed sequences around 3' HIV-1 integration sites in ATM-, Mre11- and NBS1- deficient cells. Increased abnormal junctions between the HIV-1 provirus and the host DNA were found in these mutant cell lines compared to the complemented cell lines and control MRC5SV cells. The abnormal junctions contained two types of insertions: 1 GT dinucleotides, which are normally removed by integrase during integration, and 2 inserted nucleotides of unknown origin. Artemis-deficient cells also showed such abnormalities. In Mre11-deficient cells, part of a primer binding site sequence was also detected. The 5' host-virus junctions in the mutant cells also contained these types of abnormal nucleotides. Moreover, the host-virus junctions of the MLV provirus showed similar abnormalities. These findings suggest that DSB repair enzymes play roles in the 3'-processing reaction and protection of the ends of viral DNA after reverse transcription. We also identified both 5' and 3' junctional sequences of the same provirus by inverse PCR and found that only the 3' junctions were abnormal with aberrant short repeats, indicating that the integration step was partially impaired in these cells. Furthermore, the conserved base preferences around HIV-1 integration sites were partially altered in ATM-deficient cells. Conclusions These results suggest that DSB repair enzymes are

  18. The PD-(D/EXK superfamily revisited: identification of new members among proteins involved in DNA metabolism and functional predictions for domains of (hitherto unknown function

    Directory of Open Access Journals (Sweden)

    Bujnicki Janusz M

    2005-07-01

    Full Text Available Abstract Background The PD-(D/EXK nuclease superfamily, initially identified in type II restriction endonucleases and later in many enzymes involved in DNA recombination and repair, is one of the most challenging targets for protein sequence analysis and structure prediction. Typically, the sequence similarity between these proteins is so low, that most of the relationships between known members of the PD-(D/EXK superfamily were identified only after the corresponding structures were determined experimentally. Thus, it is tempting to speculate that among the uncharacterized protein families, there are potential nucleases that remain to be discovered, but their identification requires more sensitive tools than traditional PSI-BLAST searches. Results The low degree of amino acid conservation hampers the possibility of identification of new members of the PD-(D/EXK superfamily based solely on sequence comparisons to known members. Therefore, we used a recently developed method HHsearch for sensitive detection of remote similarities between protein families represented as profile Hidden Markov Models enhanced by secondary structure. We carried out a comparison of known families of PD-(D/EXK nucleases to the database comprising the COG and PFAM profiles corresponding to both functionally characterized as well as uncharacterized protein families to detect significant similarities. The initial candidates for new nucleases were subsequently verified by sequence-structure threading, comparative modeling, and identification of potential active site residues. Conclusion In this article, we report identification of the PD-(D/EXK nuclease domain in numerous proteins implicated in interactions with DNA but with unknown structure and mechanism of action (such as putative recombinase RmuC, DNA competence factor CoiA, a DNA-binding protein SfsA, a large human protein predicted to be a DNA repair enzyme, predicted archaeal transcription regulators, and the head

  19. A Novel Rrm3 Function in Restricting DNA Replication via an Orc5-Binding Domain Is Genetically Separable from Rrm3 Function as an ATPase/Helicase in Facilitating Fork Progression

    DEFF Research Database (Denmark)

    Syed, Salahuddin; Madsen, Claus Desler; Rasmussen, Lene J.;

    2016-01-01

    In response to replication stress cells activate the intra-S checkpoint, induce DNA repair pathways, increase nucleotide levels, and inhibit origin firing. Here, we report that Rrm3 associates with a subset of replication origins and controls DNA synthesis during replication stress. The N......-terminal domain required for control of DNA synthesis maps to residues 186–212 that are also critical for binding Orc5 of the origin recognition complex. Deletion of this domain is lethal to cells lacking the replication checkpoint mediator Mrc1 and leads to mutations upon exposure to the replication stressor......-dependent error-free DNA damage bypass act as independent mechanisms on DNA lesions that arise when Rrm3 catalytic activity is disrupted whereas these mechanisms are dispensable for DNA damage tolerance when the replication function is disrupted, indicating that the DNA lesions generated by the loss of each...

  20. Carboxyl-functionalized magnetic microparticle carrier for isolation and identification of DNA in dairy products

    Science.gov (United States)

    Horák, Daniel; Rittich, Bohuslav; Španová, Alena

    2007-04-01

    Magnetite nanoparticles about 14 nm in diameter were obtained by chemical coprecipitation of Fe(II) and Fe(III) salts with aqueous ammonia in the presence of poly(ethylene glycol) (PEG). Magnetic poly(glycidyl methacrylate) (PGMA) microspheres about 1 μm in diameter were prepared by dispersion polymerization of GMA in aqueous ethanol in the presence of PEG-coated magnetite nanoparticles. The microspheres were hydrolyzed and carboxyl groups introduced by oxidation with KMnO4. The particles reversibly bound bacterial DNA of Bifidobacterium and Lactobacillus genera in the presence of high concentrations of PEG 6000 and sodium chloride from crude cell lysates of various dairy products (butter milk, cheese, yoghurt, probiotic tablets) or from cell lyophilisates. The presence of Bifidobacterium and Lactobacillus DNA in samples was confirmed by PCR amplification.

  1. Carboxyl-functionalized magnetic microparticle carrier for isolation and identification of DNA in dairy products

    Energy Technology Data Exchange (ETDEWEB)

    Horak, Daniel [Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovskeho Sq. 2, 162 06 Prague 6 (Czech Republic)]. E-mail: horak@imc.cas.cz; Rittich, Bohuslav [Masaryk University Brno, Tvrdeho 14, 602 00 Brno (Czech Republic)]. E-mail: rittich@sci.muni.cz; Spanova, Alena [Masaryk University Brno, Tvrdeho 14, 602 00 Brno (Czech Republic)]. E-mail: spanova@sci.muni.cz

    2007-04-15

    Magnetite nanoparticles about 14nm in diameter were obtained by chemical coprecipitation of Fe(II) and Fe(III) salts with aqueous ammonia in the presence of poly(ethylene glycol) (PEG). Magnetic poly(glycidyl methacrylate) (PGMA) microspheres about 1{mu}m in diameter were prepared by dispersion polymerization of GMA in aqueous ethanol in the presence of PEG-coated magnetite nanoparticles. The microspheres were hydrolyzed and carboxyl groups introduced by oxidation with KMnO{sub 4}. The particles reversibly bound bacterial DNA of Bifidobacterium and Lactobacillus genera in the presence of high concentrations of PEG 6000 and sodium chloride from crude cell lysates of various dairy products (butter milk, cheese, yoghurt, probiotic tablets) or from cell lyophilisates. The presence of Bifidobacterium and Lactobacillus DNA in samples was confirmed by PCR amplification.

  2. Blood DNA methylation age is not associated with cognitive functioning in middle-aged monozygotic twins

    DEFF Research Database (Denmark)

    Starnawska, A; Tan, Q; Lenart, A

    2016-01-01

    reported in a recent intrapair twin study where epigenetically older twins had increased mortality risk in comparison to their co-twins. In the study presented here, we hypothesize that DNAmAge in blood is associated with cross-sectional and longitudinal cognitive abilities in middle-aged individuals......The epigenetic clock, also known as DNA methylation age (DNAmAge), represents age-related changes of DNA methylation at multiple sites of the genome and is suggested to be a biomarker for biological age. Elevated blood DNAmAge is associated with all-cause mortality, with the strongest effects....... In 486 monozygotic twins, we investigated the association of DNAmAge, difference between DNAmAge and chronological age and age acceleration with cognition. Despite using a powerful paired twin design, we found no evidence for association of blood DNAmAge with cognitive abilities. This observation...

  3. Preventing Mitochondrial Fission Impairs Mitochondrial Function and Leads to Loss of Mitochondrial DNA

    OpenAIRE

    Parone, Philippe A.; Sandrine Da Cruz; Daniel Tondera; Yves Mattenberger; James, Dominic I.; Pierre Maechler; François Barja; Jean-Claude Martinou

    2008-01-01

    Mitochondria form a highly dynamic tubular network, the morphology of which is regulated by frequent fission and fusion events. However, the role of mitochondrial fission in homeostasis of the organelle is still unknown. Here we report that preventing mitochondrial fission, by down-regulating expression of Drp1 in mammalian cells leads to a loss of mitochondrial DNA and a decrease of mitochondrial respiration coupled to an increase in the levels of cellular reactive oxygen species (ROS). At t...

  4. Two-dimensional self-assembly of DNA-functionalized gold nanoparticles

    Science.gov (United States)

    Wang, Wenjie; Zhang, Honghu; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David

    2D superlattices of nanoparticles (NPs) are promising candidates for nano-devices. It is still challenging to develop a simple yet efficient protocol to assemble NPs in a controlled manner. Here, we report on formation of 2D Gibbs monolayers of single-stranded DNA-coated gold nanoparticles (ssDNA-AuNPs) at the air-water interface by manipulation of salts contents. MgCl2 and CaCl2 in solutions facilitate the accumulation of the non-complementary ssDNA-AuNPs on aqueous surfaces. Grazing-incidence small-angle X-ray scattering (GISAXS) and X-ray reflectivity show that the surface AuNPs assembly forms a mono-particle layer and undergoes a transformation from short-range to long-range (hexagonal) order above a threshold of [MgCl2] or [CaCl2]. For solutions that include two kinds of ssDNA-AuNPs with complementary base-pairing, the surface AuNPs form a thicker film and only in-plane short-range order is observed. By using other salts (NaCl or LaCl3) at concentrations of similar ionic strength to those of MgCl2 or CaCl2, we find that surface adsorbed NPs lack any orders. X-ray fluorescence measurements provide direct evidence of surface enrichment of AuNPs and divalent ions (Ca2 +) . The work was supported by the Office of Basic Energy Sciences, USDOE under Contract No. DE-AC02-07CH11358 and DE-AC02-06CH11357.

  5. Functional analysis of CedA based on its structure: residues important in binding of DNA and RNA polymerase and in the cell division regulation.

    Science.gov (United States)

    Abe, Yoshito; Fujisaki, Naoki; Miyoshi, Takanori; Watanabe, Noriko; Katayama, Tsutomu; Ueda, Tadashi

    2016-02-01

    DnaAcos, a mutant of the initiator DnaA, causes overinitiation of chromosome replication in Escherichia coli, resulting in inhibition of cell division. CedA was found to be a multi-copy suppressor which represses the dnaAcos inhibition of cell division. However, functional mechanism of CedA remains elusive except for previously indicated possibilities in binding to DNA and RNA polymerase. In this study, we searched for the specific sites of CedA in binding of DNA and RNA polymerase and in repression of cell division inhibition. First, DNA sequence to which CedA preferentially binds was determined. Next, the several residues and β4 region in CedA C-terminal domain was suggested to specifically interact with the DNA. Moreover, we found that the flexible N-terminal region was required for tight binding to longer DNA as well as interaction with RNA polymerase. Based on these results, several cedA mutants were examined in ability for repressing dnaAcos cell division inhibition. We found that the N-terminal region was dispensable and that Glu32 in the C-terminal domain was required for the repression. These results suggest that CedA has multiple roles and residues with different functions are positioned in the two regions.

  6. Predicting the function of eukaryotic scaffold/matrix attachment regions via DNA mechanics

    Science.gov (United States)

    Li, Ming; Ou-Yang, Zhong-can

    2005-08-01

    Eukaryotic chromatin undergoes a few steps of compaction to form a chromosome. Among the several levels of chromatin assembly, successive chromatin loops (5-100 kb) demarcated by the nuclear matrix are of primary importance since they behave as topologically independent domains for coordinate regulation of harboured genes. The bases of the loops are called SMARs (scaffold/matrix attachment regions). On one hand, this chromosome structure imposes stress on the DNA molecule since the double-stranded DNA is actually unwound and bent by histones and other proteins. On the other hand, the stressed DNA itself affects chromatin assembly inversely, e.g., the unwinding stress may promote SMAR binding to the matrix. The interplay between chromosome structure and unwinding stress contributes significantly to eukaryotic gene regulation. In this paper, we investigate two issues: how torsional stress may promote SMAR anchorage to the matrix; and how the formation of chromatin loops may affect basic biochemical processes. We employ the Benham model for these purposes. Our analysis gives theoretical evidence that at least some SMARs are unwound under torsional stress and at the same time could serve as topological barriers for retaining the torsional stress on the chromatin loop which may be necessary for gene transcription.

  7. DNA methylation functions as a critical regulator of Kir4.1 expression during CNS development.

    Science.gov (United States)

    Nwaobi, Sinifunanya E; Lin, Erica; Peramsetty, Sasank R; Olsen, Michelle L

    2014-03-01

    Kir4.1, a glial-specific K+ channel, is critical for normal CNS development. Studies using both global and glial-specific knockout of Kir4.1 reveal abnormal CNS development with the loss of the channel. Specifically, Kir4.1 knockout animals are characterized by ataxia, severe hypomyelination, and early postnatal death. Additionally, Kir4.1 has emerged as a key player in several CNS diseases. Notably, decreased Kir4.1 protein expression occurs in several human CNS pathologies including CNS ischemic injury, spinal cord injury, epilepsy, ALS, and Alzheimer's disease. Despite the emerging significance of Kir4.1 in normal and pathological conditions, its mechanisms of regulation are unknown. Here, we report the first epigenetic regulation of a K+ channel in the CNS. Robust developmental upregulation of Kir4.1 expression in rats is coincident with reductions in DNA methylation of the Kir4.1 gene, KCNJ10. Chromatin immunoprecipitation reveals a dynamic interaction between KCNJ10 and DNA methyltransferase 1 during development. Finally, demethylation of the KCNJ10 promoter is necessary for transcription. These findings indicate DNA methylation is a key regulator of Kir4.1 transcription. Given the essential role of Kir4.1 in normal CNS development, understanding the regulation of this K+ channel is critical to understanding normal glial biology.

  8. Bacteriophage Nf DNA region controlling late transcription: structural and functional homology with bacteriophage phi 29.

    Science.gov (United States)

    Nuez, B; Salas, M

    1993-06-25

    The putative region for the control of late transcription of the Bacillus subtilis phage Nf has been identified by DNA sequence homology with the equivalent region of the evolutionary related phage phi 29. A similar arrangement of early and late promoters has been detected in the two phages, suggesting that viral transcription could be regulated in a similar way at late times of the infection. Transcription of late genes requires the presence of a viral early protein, gpF in phage Nf and p4 in phage phi 29, being the latter known to bind to a DNA region located upstream from the phage phi 29 late promoter. We have identified a DNA region located upstream from the putative late promoter of phage Nf that is probably involved in binding protein gpF. Furthermore, we show that the phage phi 29 protein p4 is able to bind to this region and activate transcription from the phage Nf putative late promoter. Sequence alignment has also revealed the existence of significant internal homology between the two early promoters contained in this region of each phage.

  9. Molecular cloning and functional identification of a plant ornithine decarboxylase cDNA.

    Science.gov (United States)

    Michael, A J; Furze, J M; Rhodes, M J; Burtin, D

    1996-02-15

    A cDNA for a plant ornithine decarboxylase (ODC), a key enzyme in putrescine and polyamine biosynthesis, has been isolated from root cultures of the solanaceous plant Datura stramonium. Reverse transcription-PCR employing degenerate oligonucleotide primers representing conserved motifs from other eukaryotic ODCs was used to isolate the cDNA. The longest open reading frame potentially encodes a peptide of 431 amino acids and exhibits similarity to other eukaryotic ODCs, prokaryotic and eukaryotic arginine decarboxylases (ADCs), prokaryotic meso-diaminopimelate decarboxylases and the product of the tabA gene of Pseudomonas syringae cv. tabaci. Residues involved at the active site of the mouse ODC are conserved in the plant enzyme. The plant ODC does not possess the C-terminal extension found in the mammalian enzyme, implicated in rapid turnover of the protein, suggesting that the plant ODC may have a longer half-life. Expression of the plant ODC in Escherichia coli and demonstration of ODC activity confirmed that the cDNA encodes an active ODC enzyme. This is the first description of the primary structure of a eukaryotic ODC isolated from an organism where the alternative ADC routine to putrescine is present.

  10. Screening for plant transporter function by expressing a normalized Arabidopsis full-length cDNA library in Xenopus oocytes

    Directory of Open Access Journals (Sweden)

    Halkier Barbara A

    2006-10-01

    Full Text Available Abstract Background We have developed a functional genomics approach based on expression cloning in Xenopus oocytes to identify plant transporter function. We utilized the full-length cDNA databases to generate a normalized library consisting of 239 full-length Arabidopsis thaliana transporter cDNAs. The genes were arranged into a 96-well format and optimized for expression in Xenopus oocytes by cloning each coding sequence into a Xenopus expression vector. Results Injection of 96 in vitro transcribed cRNAs from the library in pools of columns and rows into oocytes and subsequent screening for glucose uptake activity identified three glucose transporters. One of these, AtSTP13, had not previously been experimentally characterized. Conclusion Expression of the library in Xenopus oocytes, combined with uptake assays, has great potential in assignment of plant transporter function and for identifying membrane transporters for the many plant metabolites where a transporter has not yet been identified.

  11. Chronic Exposure to Water-Pipe Smoke Induces Alveolar Enlargement, DNA Damage and Impairment of Lung Function

    Directory of Open Access Journals (Sweden)

    Abderrahim Nemmar

    2016-03-01

    Full Text Available Background/Aim: Epidemiological evidence indicates that water-pipe smoking (WPS adversely affects the respiratory system. However, the mechanisms underlying its effects are not well understood. Recent experimental studies reported the occurrence of lung inflammation and oxidative stress following acute and subacute exposure to WPS. Here, we wanted to verify the extent of inflammation and oxidative stress in mice chronically-exposed to WPS and to evaluate, for the first time, its effect on alveolar injury and DNA damage and their association with impairment of lung function. Methods: Mice were nose-only exposed to mainstream WPS (30 min/day; 5 days/week for 6 consecutive months. Control mice were exposed using the same protocol to atmospheric air only. At the end of the exposure period, several respiratory parameters were assessed. Results: In bronchoalveolar lavage fluid, WPS increased neutrophil and lymphocyte numbers, lactate dehydrogenase, myeloperoxidase and matrix metallopeptidase 9 activities, as well as several proinflammatory cytokines. In lung tissue, lipid peroxidation, reactive oxygen species, superoxide dismutase activity and reduced glutathione were all increased by WPS exposure. Along with oxidative stress, WPS exposure significantly increased lung DNA damage index. Histologically the lungs of WPS-exposed mice had foci of mixed inflammatory cells infiltration in the interalveolar interstitium which consisted of neutrophils, lymphocytes and macrophages. Interestingly, we found dilated alveolar spaces and alveolar ducts with damaged interalveolar septae, and impairment of lung function following WPS exposure. Conclusion: We show the persistence of lung inflammation and oxidative stress in mice chronically-exposed to WPS and demonstrate, for the first time, the occurrence of DNA damage and enlargement of alveolar spaces and ducts associated with impairment of lung function. Our findings provide novel mechanistic elucidation for the

  12. Challenge assay: A functional biomarker for exposure-induced DNA repair deficiency and for risk of cancer.

    Science.gov (United States)

    Au, William W; Giri, Ashok K; Ruchirawat, Mathuros

    2010-01-01

    A variety of biomarkers have been used to monitor exposed populations to determine potential health hazards from their exposure to environmental toxic agents. However, the majority of these biomarkers have been focused onto the identification of biological damage from the exposure. Therefore, there is a need to develop functional biomarkers that can identify exposure-induced functional deficiencies. More importantly, these deficiencies should be positioned along pathways that are responsible for the development of specific diseases. One of such pathways belongs to the extensive and complex DNA-repair machinery. The machinery thus becomes a large target for damage from environmental toxic agents. The hypothesis is that damage to any component of a repair pathway will interfere with the pathway-specific repair activities. Therefore, when cells from exposed populations are challenged with a DNA-damaging agent in vitro, the in vivo exposure-induced repair deficiency will be dramatically amplified and the deficiency will be detectable in a challenge assay as increased chromosome aberrations, micronuclei or un-repaired DNA strand breaks. The challenge assay has been used in different laboratories to show that a variety of exposed populations (with exposure to air pollutants, arsenic, benzene, butadiene, cigarette smoke, incense smoke, lead, mercury, pesticides, uranium or xylene but not to low concentrations of air pollutants or butadiene) expressed abnormal challenge response. The predicted health consequences of some of these studies have also been validated. Therefore, the challenge assay is a useful functional biomarker for population studies. Details of the challenge assay and its application will be presented in this review.

  13. SVD identifies transcript length distribution functions from DNA microarray data and reveals evolutionary forces globally affecting GBM metabolism.

    Science.gov (United States)

    Bertagnolli, Nicolas M; Drake, Justin A; Tennessen, Jason M; Alter, Orly

    2013-01-01

    To search for evolutionary forces that might act upon transcript length, we use the singular value decomposition (SVD) to identify the length distribution functions of sets and subsets of human and yeast transcripts from profiles of mRNA abundance levels across gel electrophoresis migration distances that were previously measured by DNA microarrays. We show that the SVD identifies the transcript length distribution functions as "asymmetric generalized coherent states" from the DNA microarray data and with no a-priori assumptions. Comparing subsets of human and yeast transcripts of the same gene ontology annotations, we find that in both disparate eukaryotes, transcripts involved in protein synthesis or mitochondrial metabolism are significantly shorter than typical, and in particular, significantly shorter than those involved in glucose metabolism. Comparing the subsets of human transcripts that are overexpressed in glioblastoma multiforme (GBM) or normal brain tissue samples from The Cancer Genome Atlas, we find that GBM maintains normal brain overexpression of significantly short transcripts, enriched in transcripts that are involved in protein synthesis or mitochondrial metabolism, but suppresses normal overexpression of significantly longer transcripts, enriched in transcripts that are involved in glucose metabolism and brain activity. These global relations among transcript length, cellular metabolism and tumor development suggest a previously unrecognized physical mode for tumor and normal cells to differentially regulate metabolism in a transcript length-dependent manner. The identified distribution functions support a previous hypothesis from mathematical modeling of evolutionary forces that act upon transcript length in the manner of the restoring force of the harmonic oscillator.

  14. A functional deficiency of TERA/VCP/p97 contributes to impaired DNA repair in multiple polyglutamine diseases.

    Science.gov (United States)

    Fujita, Kyota; Nakamura, Yoko; Oka, Tsutomu; Ito, Hikaru; Tamura, Takuya; Tagawa, Kazuhiko; Sasabe, Toshikazu; Katsuta, Asuka; Motoki, Kazumi; Shiwaku, Hiroki; Sone, Masaki; Yoshida, Chisato; Katsuno, Masahisa; Eishi, Yoshinobu; Murata, Miho; Taylor, J Paul; Wanker, Erich E; Kono, Kazuteru; Tashiro, Satoshi; Sobue, Gen; La Spada, Albert R; Okazawa, Hitoshi

    2013-01-01

    It is hypothesized that a common underlying mechanism links multiple neurodegenerative disorders. Here we show that transitional endoplasmic reticulum ATPase (TERA)/valosin-containing protein (VCP)/p97 directly binds to multiple polyglutamine disease proteins (huntingtin, ataxin-1, ataxin-7 and androgen receptor) via polyglutamine sequence. Although normal and mutant polyglutamine proteins interact with TERA/VCP/p97, only mutant proteins affect dynamism of TERA/VCP/p97. Among multiple functions of TERA/VCP/p97, we reveal that functional defect of TERA/VCP/p97 in DNA double-stranded break repair is critical for the pathology of neurons in which TERA/VCP/p97 is located dominantly in the nucleus in vivo. Mutant polyglutamine proteins impair accumulation of TERA/VCP/p97 and interaction of related double-stranded break repair proteins, finally causing the increase of unrepaired double-stranded break. Consistently, the recovery of lifespan in polyglutamine disease fly models by TERA/VCP/p97 corresponds well to the improvement of double-stranded break in neurons. Taken together, our results provide a novel common pathomechanism in multiple polyglutamine diseases that is mediated by DNA repair function of TERA/VCP/p97.

  15. Valproic acid alters the content and function of the cell-free DNA released by hepatocellular carcinoma (HepG2) cells in vitro.

    Science.gov (United States)

    Aucamp, Janine; Van Dyk, Hayley C; Bronkhorst, Abel J; Pretorius, Piet J

    2017-09-01

    It has long been believed that cell-free DNA (cfDNA) actively released into circulation can serve as intercellular messengers, and their involvement in processes such as the bystander effect strongly support this. However, this intercellular messaging function of cfDNA may have clinical implications that have not yet been considered. CfDNA was isolated from the growth medium of HepG2 cells treated with valproic acid (VPA). This cfDNA was then administered to untreated cells and cellular metabolic activity was measured. VPA altered the characteristics of cfDNA released by treated HepG2 cells in vitro. When administered to untreated cells, the cfDNA from cells treated with VPA resulted in the dose-dependent induction of glycolytic activity within 36 min of administration, but little to no alterations in oxidative phosphorylation. The glycolytic activity lasted for 4-6 h, whereas changes in subsequent cfDNA release and characteristics were found to remain persistent after two 24 h treatments. Fragmented genomic DNA from VPA-treated cells did not induce the effects observed for cfDNA obtained VPA-treated cells. It is possible for cfDNA to, under in vitro conditions, transfer pharmaceutically-induced effects to untreated recipient cells. Further investigation regarding this occurrence under in vivo conditions is, therefore, strongly encouraged. The intercellular messaging functions of cfDNA present in donated biological fluids has potential clinical implications that require urgent attention. These implications may, however, also have potential as new forms of treatment that can circumvent pharmacological barriers. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  16. Functional Recovery of Human Cells Harbouring the Mitochondrial DNA Mutation MERRF A8344G via Peptide-Mediated Mitochondrial Delivery

    Directory of Open Access Journals (Sweden)

    Jui-Chih Chang

    2012-09-01

    Full Text Available We explored the feasibility of mitochondrial therapy using the cell-penetrating peptide Pep-1 to transfer mitochondrial DNA (mtDNA between cells and rescue a cybrid cell model of the mitochondrial disease myoclonic epilepsy with ragged-red fibres (MERRF syndrome. Pep-1-conjugated wild-type mitochondria isolated from parent cybrid cells incorporating a mitochondria-specific tag were used as donors for mitochondrial delivery into MERRF cybrid cells (MitoB2 and mtDNA-depleted Rho-zero cells (Mitoρ°. Forty-eight hours later, translocation of Pep-1-labelled mitochondria into the mitochondrial regions of MitoB2 and Mitoρ° host cells was observed (delivery efficiencies of 77.48 and 82.96%, respectively. These internalized mitochondria were maintained for at least 15 days in both cell types and were accompanied by mitochondrial function recovery and cell survival by preventing mitochondria-dependent cell death. Mitochondrial homeostasis analyses showed that peptide-mediated mitochondrial delivery (PMD also increased mitochondrial biogenesis in both cell types, but through distinct regulatory pathways involving mitochondrial dynamics. Dramatic decreases in mitofusin-2 (MFN2 and dynamin-related protein 1/fission 1 were observed in MitoB2 cells, while Mitoρ° cells showed a significant increase in optic atrophy 1 and MFN2. These findings suggest that PMD can be used as a potential therapeutic intervention for mitochondrial disorders.

  17. Redundant function of DNA ligase 1 and 3 in alternative end-joining during immunoglobulin class switch recombination.

    Science.gov (United States)

    Masani, Shahnaz; Han, Li; Meek, Katheryn; Yu, Kefei

    2016-02-02

    Nonhomologous end-joining (NHEJ) is the major DNA double-strand break (DSB) repair pathway in mammals and resolves the DSBs generated during both V(D)J recombination in developing lymphocytes and class switch recombination (CSR) in antigen-stimulated B cells. In contrast to the absolute requirement for NHEJ to resolve DSBs associated with V(D)J recombination, DSBs associated with CSR can be resolved in NHEJ-deficient cells (albeit at a reduced level) by a poorly defined alternative end-joining (A-EJ) pathway. Deletion of DNA ligase IV (Lig4), a core component of the NHEJ pathway, reduces CSR efficiency in a mouse B-cell line capable of robust cytokine-stimulated CSR in cell culture. Here, we report that CSR levels are not further reduced by deletion of either of the two remaining DNA ligases (Lig1 and nuclear Lig3) in Lig4(-/-) cells. We conclude that in the absence of Lig4, Lig1, and Lig3 function in a redundant manner in resolving switch region DSBs during CSR.

  18. Surface functionalized Cu2Zn1- x Cd x SnS4 quinternary alloyed nanostructure for DNA sensing

    Science.gov (United States)

    Ibraheam, A. S.; Al-Douri, Y.; Voon, C. H.; Foo, K. L.; Azizah, N.; Gopinath, S. C. B.; Ameri, M.; Ibrahim, Sattar S.

    2017-03-01

    A sensing plate of extended Cu2Zn1- x Cd x SnS4 quinternary alloy nanostructures, fabricated on an oxidized silicon substrate by the sol-gel method, is reported in this paper. The fabricated device was characterized and analyzed via field emission-scanning electron microscopy, X-ray diffraction (XRD), and photoluminescence (PL). The XRD peaks shifted towards the lower angle side alongside increasing concentration of cadmium. The average diameter of the Cu2Zn1- x Cd x SnS4 quinternary alloy nanostructures falls between 21.55 and 43.12 nm, while the shift of the PL bandgap was from 1.81 eV ( x = 0) to 1.72 eV ( x = 1). The resulting Cu2Zn1- x Cd x SnS4 quinternary alloy nanostructures components were functionalized with oligonucleotides probe DNA molecules and interacted with the target, exhibiting good sensing capabilities due to its large surface-to-volume ratio. The fabrication, immobilization, and hybridization processes were analyzed via representative current-voltage ( I- V) plots. Its electrical profile shows that the device is capable to distinguish biomolecules. Its high performance was evident from the linear relationship between the probe DNA from cervical cancer and the target DNA, showing its applicability for medical applications.

  19. Epigenetics in schizophrenia: a pilot study of global DNA methylation in different brain regions associated with higher cognitive functions.

    Directory of Open Access Journals (Sweden)

    Raúl Alelú-Paz

    2016-09-01

    Full Text Available Attempts to discover genes that are involved in the pathogenesis of major psychiatric disorders have been frustrating and often fruitless. Concern is building about the need to understand the complex ways in which nature and nurture interact to produce mental illness. We analyze the epigenome in several brain regions from schizophrenic patients with severe cognitive impairment using high-resolution (450k DNA methylation array. We identified 159 differentially methylated CpG sites included in known and novel candidate genes sequences as well as in and intergenic sequences wich functions remain unknown. We found that altered DNA methylation is not restricted to a particular region, but includes others such as CpG shelves and gene bodies, indicating the presence of different DNA methylation signatures depending on the brain area analyzed. Our findings suggest that epimutations are not relatables between different tissues or even between tissues’ regions, highlighting the need to adqueately study brain samples to obtain reliable data concerning the epigenetics of schizophrenia.

  20. Functional analysis of DNA 4 coding region from a Chinese Zhangzhou isolate of banana bunchy top virus

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The DNA 4 coding region of banana bunchy top virus from a Chinese Zhangzhou isolate (BBTV-ZZ) is cloned by PCR. The sequencing analysis shows that it is 351 nucleotides long and it putatively encodes a protein of 116 amino acids. On the basis of a plant binary vector pBin438, the plant expression vector pBBTV-4B harboring the BBTV-ZZ DNA 4 coding region has been constructed and then transferred to tobacco (Nicotiana tobacum cv. Xanthi nc) by a Agrobacterium-mediated procedure. Under insect-free condition, movement-defective mutant of CMV-Fny strain (CMV-Fny-△MP) is mechanically inoculated on the lower leaves of transgenic plants. Systemic symptoms with different degrees of severity are developed in the upper uninoculated leaves of transgenic plants at 12 days postinoculation (dpi), while no symptoms can be seen in the uninoculated leaves of untransformed plants at any time. Accumulation of CMV-Fny is detected on the upper uninoculated leaves of transgenic plants, but is not on that of untransformed plants by indirect double antibody sandwich enzyme-link immunosorbent assay (DAS-ELISA). The results reveal that transgenic plants have acquired the property of cell-to-cell movement and systemic spread of CMV-Fny-△MP. This suggests that the protein encoded by BBTV-ZZ DNA 4 might have function of viral movement protein.

  1. Gestational exposure to diethylstilbestrol alters cardiac structure/function, protein expression and DNA methylation in adult male mice progeny

    Energy Technology Data Exchange (ETDEWEB)

    Haddad, Rami, E-mail: rami.haddad@mail.mcgill.ca [Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 chemin Cote Ste Catherine, Montréal, Québec, Canada H3T 1E2 (Canada); Division of Experimental Medicine, Department of Medicine, McGill University, 850 Sherbrooke Street, Montréal, Québec, Canada H3A 1A2 (Canada); Kasneci, Amanda, E-mail: amanda.kasneci@mail.mcgill.ca [Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 chemin Cote Ste Catherine, Montréal, Québec, Canada H3T 1E2 (Canada); Mepham, Kathryn, E-mail: katherine.mepham@mail.mcgill.ca [Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 chemin Cote Ste Catherine, Montréal, Québec, Canada H3T 1E2 (Canada); Division of Experimental Medicine, Department of Medicine, McGill University, 850 Sherbrooke Street, Montréal, Québec, Canada H3A 1A2 (Canada); Sebag, Igal A., E-mail: igal.sebag@mcgill.ca [Division of Cardiology, Jewish General Hospital, 3755 chemin Cote Ste Catherine, Montréal, Québec, Canada H3T 1E2 (Canada); and others

    2013-01-01

    Pregnant women, and thus their fetuses, are exposed to many endocrine disruptor compounds (EDCs). Fetal cardiomyocytes express sex hormone receptors making them potentially susceptible to re-programming by estrogenizing EDCs. Diethylstilbestrol (DES) is a proto-typical, non-steroidal estrogen. We hypothesized that changes in adult cardiac structure/function after gestational exposure to the test compound DES would be a proof in principle for the possibility of estrogenizing environmental EDCs to also alter the fetal heart. Vehicle (peanut oil) or DES (0.1, 1.0 and 10.0 μg/kg/da.) was orally delivered to pregnant C57bl/6n dams on gestation days 11.5–14.5. At 3 months, male progeny were left sedentary or were swim trained for 4 weeks. Echocardiography of isoflurane anesthetized mice revealed similar cardiac structure/function in all sedentary mice, but evidence of systolic dysfunction and increased diastolic relaxation after swim training at higher DES doses. The calcium homeostasis proteins, SERCA2a, phospholamban, phospho-serine 16 phospholamban and calsequestrin 2, are important for cardiac contraction and relaxation. Immunoblot analyses of ventricle homogenates showed increased expression of SERCA2a and calsequestrin 2 in DES mice and greater molecular remodeling of these proteins and phospho-serine 16 phospholamban in swim trained DES mice. DES increased cardiac DNA methyltransferase 3a expression and DNA methylation in the CpG island within the calsequestrin 2 promoter in heart. Thus, gestational DES epigenetically altered ventricular DNA, altered cardiac function and expression, and reduced the ability of adult progeny to cardiac remodel when physically challenged. We conclude that gestational exposure to estrogenizing EDCs may impact cardiac structure/function in adult males. -- Highlights: ► Gestational DES changes cardiac SERCA2a and CASQ2 expression. ► Echocardiography identified systolic dysfunction and increased diastolic relaxation. ► DES

  2. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  3. 8-Oxoguanine DNA glycosylase 1 (ogg1) maintains the function of cardiac progenitor cells during heart formation in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Lifeng [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Zhou, Yong [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Yu, Shanhe [Shanghai Institute of Hematology, RuiJin Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025 (China); Ji, Guixiang [Nanjing Institute of Environmental Sciences/Key Laboratory of Pesticide Environmental Assessment and Pollution Control, Ministry of Environmental Protection, Nanjing 210042 (China); Wang, Lei [Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai 200025 (China); Liu, Wei [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China); Gu, Aihua, E-mail: aihuagu@njmu.edu.cn [State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 210029 (China); Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 210029 (China)

    2013-11-15

    Genomic damage may devastate the potential of progenitor cells and consequently impair early organogenesis. We found that ogg1, a key enzyme initiating the base-excision repair, was enriched in the embryonic heart in zebrafish. So far, little is known about DNA repair in cardiogenesis. Here, we addressed the critical role of ogg1 in cardiogenesis for the first time. ogg1 mainly expressed in the anterior lateral plate mesoderm (ALPM), the primary heart tube, and subsequently the embryonic myocardium by in situ hybridisation. Loss of ogg1 resulted in severe cardiac morphogenesis and functional abnormalities, including the short heart length, arrhythmia, decreased cardiomyocytes and nkx2.5{sup +} cardiac progenitor cells. Moreover, the increased apoptosis and repressed proliferation of progenitor cells caused by ogg1 deficiency might contribute to the heart phenotype. The microarray analysis showed that the expression of genes involved in embryonic heart tube morphogenesis and heart structure were significantly changed due to the lack of ogg1. Among those, foxh1 is an important partner of ogg1 in the cardiac development in response to DNA damage. Our work demonstrates the requirement of ogg1 in cardiac progenitors and heart development in zebrafish. These findings may be helpful for understanding the aetiology of congenital cardiac deficits. - Highlights: • A key DNA repair enzyme ogg1 is expressed in the embryonic heart in zebrafish. • We found that ogg1 is essential for normal cardiac morphogenesis in zebrafish. • The production of embryonic cardiomyocytes requires appropriate ogg1 expression. • Ogg1 critically regulated proliferation of cardiac progenitor cells in zebrafish. • foxh1 is a partner of ogg1 in the cardiac development in response to DNA damage.

  4. Regulation of BRCA1 Function by DNA Damage-Induced Site-Specific Phosphorylation

    Science.gov (United States)

    2007-06-01

    19b. TELEPHONE NUMBER (include area code) Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 DAMD17-03-1-0272 Final Report Boyer...characterization of DBC-1 and its role in the regulation of ER expression and survival funcion in breast cancer cells. Dr. Trauernicht authored a manuscript on DBC...is an impor- tant area for future investigation. Tumor Susceptibility Is Tissue-Specific DNA damage response pathways that converge on BRCA-1 and 2

  5. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    phosphorylation, ubiquitylation, SUMOylation, and acetylation. Over the last decade, insight into the identity of proteins residing in IRIF and the molecular underpinnings of their retention at these structures has been vastly expanded. Despite such advances, however, our understanding of the biological relevance...... of such DNA repair foci still remains limited. In this review, we focus on recent discoveries on the mechanisms that govern the formation of IRIF, and discuss the implications of such findings in light of our understanding of the physiological importance of these structures....

  6. Transcription-independent functions of MYC: regulation of translation and DNA replication

    Science.gov (United States)

    Cole, Michael D.; Cowling, Victoria H.

    2013-01-01

    MYC is a potent oncogene that drives unrestrained cell growth and proliferation. Shortly after its discovery as an oncogene, the MYC protein was recognized as a sequence-specific transcription factor. Since that time, MYC oncogene research has focused on the mechanism of MYC-induced transcription and on the identification of MYC transcriptional target genes. Recently, MYC was shown to control protein expression through mRNA translation and to directly regulate DNA replication, thus initiating exciting new areas of oncogene research. PMID:18698328

  7. Excited states of DNA base pairs using long-range corrected time-dependent density functional theory.

    Science.gov (United States)

    Jensen, Lasse; Govind, Niranjan

    2009-09-10

    In this work, we present a study of the excitation energies of adenine, cytosine, guanine, thymine, and the adenine-thymine (AT) and guanine-cytosine (GC) base pairs using long-range corrected (LC) density functional theory. We compare three recent LC functionals, BNL, CAM-B3LYP, and LC-PBE0, with B3LYP and coupled cluster results from the literature. We find that the best overall performance is for the BNL functional based on LDA. However, in order to achieve this good agreement, a smaller attenuation parameter is needed, which leads to nonoptimum performance for ground-state properties. B3LYP, on the other hand, severely underestimates the charge-transfer (CT) transitions in the base pairs. Surprisingly, we also find that the CAM-B3LYP functional also underestimates the CT excitation energy for the GC base pair but correctly describes the AT base pair. This illustrates the importance of retaining the full long-range exact exchange even at distances as short as that of the DNA base pairs. The worst overall performance is obtained with the LC-PBE0 functional, which overestimates the excitations for the individual bases as well as the base pairs. It is therefore crucial to strike a good balance between the amount of local and long-range exact exchange. Thus, this work highlights the difficulties in obtained LC functionals, which provides a good description of both ground- and excited-state properties.

  8. Reproductive function of the male obese Zucker rats: alteration in sperm production and sperm DNA damage.

    Science.gov (United States)

    Vendramini, V; Cedenho, A P; Miraglia, S M; Spaine, D M

    2014-02-01

    Obesity has been considered a public health issue in many countries and is of increasing concern for authorities over the past 6 years. The Zucker rat is a good experimental model for obesity and diabetes studies due to its metabolic characteristics that are similar to those developed by humans. A total of 12 obese Zucker rats and their lean littermates were killed in pubertal and young adult phases for assessing organ weights (testis and epididymis), testicular histomorphometric and stereological analyses, daily sperm production, and transit time in the epididymis. Sperm integrity was also investigated in the adult animals using the Comet assay. Alterations in organ weights, seminiferous epithelium architecture, sperm production, and transit time were noticed in the pubertal fatty rats. The volume density of the lymphatic space was decreased in both the ages. Adult animals had a significant increase in the extent of damage found in sperm DNA. Our results show for the first time that leptin receptor deficiency compromises sperm production during puberty and that genetic obese Zucker rats have increased sperm DNA fragmentation.

  9. The Function of DNA Ligase Ⅲ in Maintenance of Mitochondrial DNA Integrity%DNA连接酶Ⅲ在线粒体基因组完整性保持中的作用

    Institute of Scientific and Technical Information of China (English)

    郭晓强; 沈永青; 郭振清; 常彦忠; 段相林

    2012-01-01

    Eukaryotic DNA ligases play vital roles in DNA replication, recombination and repair through catalyzing ligation of nick in double-stranded DNA with an ATP-dependent reaction. DNA ligase IH (Lig3) is a unique ligase which is located in both nucleus and mitochondrion. Lig3 plays important roles in base excision repair and other single-stranded break repairs with its DNA repair protein XRCC1. But Lig3 is more important in maintenance of mitochondrial DNA (mtDNA) integrity without XRCC1-dependent DNA repair. These researches provide new perspective for Lig3 function and DNA repair.%真核DNA连接酶(DNA ligase)通过催化ATP依赖的双链DNA切口连接而在DNA复制、重组和修复过程中发挥了重要作用.DNA连接酶Ⅲ(Lig3)是一种独特性的连接酶,既可定位于细胞核,又可定位于线粒体.Lig3通过与DNA修复蛋白XRCC1作用而参与了碱基切除修复和其他单链断裂修复.但Lig3以XRCC1不依赖方式在线粒体DNA完整性保持方面发挥了更为重要的作用.这些研究为Lig3功能和DNA修复研究提供了新的视野.

  10. A Network Partition Algorithm for Mining Gene Functional Modules of Colon Cancer from DNA Microarray Data

    Institute of Scientific and Technical Information of China (English)

    Xiao-Gang Ruan; Jin-Lian Wang; Jian-Geng Li

    2006-01-01

    Computational analysis is essential for transforming the masses of microarray data into a mechanistic understanding of cancer. Here we present a method for finding gene functional modules of cancer from microarray data and have applied it to colon cancer. First, a colon cancer gene network and a normal colon tissue gene network were constructed using correlations between the genes. Then the modules that tended to have a homogeneous functional composition were identified by splitting up the network. Analysis of both networks revealed that they are scale-free.Comparison of the gene functional modules for colon cancer and normal tissues showed that the modules' functions changed with their structures.

  11. Many amino acid substitution variants identified in DNA repair genes during human population screenings are predicted to impact protein function

    Energy Technology Data Exchange (ETDEWEB)

    Xi, T; Jones, I M; Mohrenweiser, H W

    2003-11-03

    Over 520 different amino acid substitution variants have been previously identified in the systematic screening of 91 human DNA repair genes for sequence variation. Two algorithms were employed to predict the impact of these amino acid substitutions on protein activity. Sorting Intolerant From Tolerant (SIFT) classified 226 of 508 variants (44%) as ''Intolerant''. Polymorphism Phenotyping (PolyPhen) classed 165 of 489 amino acid substitutions (34%) as ''Probably or Possibly Damaging''. Another 9-15% of the variants were classed as ''Potentially Intolerant or Damaging''. The results from the two algorithms are highly associated, with concordance in predicted impact observed for {approx}62% of the variants. Twenty one to thirty one percent of the variant proteins are predicted to exhibit reduced activity by both algorithms. These variants occur at slightly lower individual allele frequency than do the variants classified as ''Tolerant'' or ''Benign''. Both algorithms correctly predicted the impact of 26 functionally characterized amino acid substitutions in the APE1 protein on biochemical activity, with one exception. It is concluded that a substantial fraction of the missense variants observed in the general human population are functionally relevant. These variants are expected to be the molecular genetic and biochemical basis for the associations of reduced DNA repair capacity phenotypes with elevated cancer risk.

  12. Chronic mucocutaneous candidiasis caused by a gain-of-function mutation in the STAT1 DNA-binding domain.

    Science.gov (United States)

    Takezaki, Shunichiro; Yamada, Masafumi; Kato, Masahiko; Park, Myoung-Ja; Maruyama, Kenichi; Yamazaki, Yasuhiro; Chida, Natsuko; Ohara, Osamu; Kobayashi, Ichiro; Ariga, Tadashi

    2012-08-01

    Chronic mucocutaneous candidiasis (CMC) is a heterogeneous group of primary immunodeficiency diseases characterized by chronic and recurrent Candida infections of the skin, nails, and oropharynx. Gain-of-function mutations in STAT1 were very recently shown to be responsible for autosomal-dominant or sporadic cases of CMC. The reported mutations have been exclusively localized in the coiled-coil domain, resulting in impaired dephosphorylation of STAT1. However, recent crystallographic analysis and direct mutagenesis experiments indicate that mutations affecting the DNA-binding domain of STAT1 could also lead to persistent phosphorylation of STAT1. To our knowledge, this study shows for the first time that a DNA-binding domain mutation of c.1153C>T in exon 14 (p.T385M) is the genetic cause of sporadic CMC in two unrelated Japanese patients. The underlying mechanisms involve a gain of STAT1 function due to impaired dephosphorylation as observed in the coiled-coil domain mutations.

  13. Coupled-cluster and density functional theory studies of the electronic 0-0 transitions of the DNA bases.

    Science.gov (United States)

    Ovchinnikov, Vasily A; Sundholm, Dage

    2014-04-21

    The 0-0 transitions of the electronic excitation spectra of the lowest tautomers of the four nucleotide (DNA) bases have been studied using linear-response approximate coupled-cluster singles and doubles (CC2) calculations. Excitation energies have also been calculated at the linear-response time-dependent density functional theory (TDDFT) level using the B3LYP functional. Large basis sets have been employed for ensuring that the obtained excitation energies are close to the basis-set limit. Zero-point vibrational energy corrections have been calculated at the B3LYP and CC2 levels for the ground and excited states rendering direct comparisons with high-precision spectroscopy measurements feasible. The obtained excitation energies for the 0-0 transitions of the first excited states of guanine tautomers are in good agreement with experimental values confirming the experimental assignment of the energetic order of the tautomers of the DNA bases. For the experimentally detected guanine tautomers, the first excited state corresponds to a π→π* transition, whereas for the tautomers of adenine, thymine, and the lowest tautomer of cytosine the transition to the first excited state has n →π* character. The calculations suggest that the 0-0 transitions of adenine, thymine, and cytosine are not observed in the absorption spectrum due to the weak oscillator strength of the formally symmetry-forbidden transitions, while 0-0 transitions of thymine have been detected in fluorescence excitation spectra.

  14. Ultrasensitive electrochemical DNA biosensor based on functionalized gold clusters/graphene nanohybrids coupling with exonuclease III-aided cascade target recycling.

    Science.gov (United States)

    Wang, Wei; Bao, Ting; Zeng, Xi; Xiong, Huayu; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

    2017-05-15

    In this work, a novel and ultrasensitive electrochemical biosensor was constructed for DNA detection based on functionalized gold clusters/graphene nanohybrids (AuNCs/GR nanobybrids) and exonuclease III (Exo III)-aided cascade target recycling. By utilizing the capacity of GR as universal template, different metal nanoclusters including AuNCs/GR nanobybrids and PtNCs/GR nanohybrids were synthesized through convenient ultrasonic method. Exo III-aided cascade recycling was initiated by target DNA, generating the final cleavage product (S2), which acted as a linkage between capture probe and the functionalized metal nanoclusters/GR conjugates in the construction of the biosensor. The AuNCs/GR-DNA-enzyme conjugates acted as interfaces of enzyme-catalyzed silver deposition reaction, achieving DNA detection ranging from 0.02 fM to 20 pM with a detection limit of 0.057 fM. In addition, PtNCs/GR-DNA conjugates presented peroxidase-like activity and the functionalized PtNCs/GR nanohybrids-based electrochemical biosensor also realized DNA detection by catalyzing the 3,3',5,5'-tetramethylbenzidine-hydrogen peroxide (TMB-H2O2) system to produce electrochemical signal. This metal clusters/GR-based multiple-amplified electrochemical biosensor provided an universal method for DNA detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Structural and functional analysis of DNA sequences with potential for forming G-quadruplex

    OpenAIRE

    Luciana Souto Mofatto

    2013-01-01

    Resumo: Os G-quadruplexes são estruturas secundárias de DNA altamente organizadas, constituídas por sequências ricas em guaninas capazes de formar tétrades ligadas por pontes de hidrogênio. Essas sequências são capazes de modular a transcrição gênica e o splicing alternativo de éxons. Além disso, estudos também mostraram que os G-quadruplexes estão presentes na região promotora de oncogenes (como c-MYC) e nas regiões terminais dos telômeros, indicando que o G-quadruplex pode ser um possível a...

  16. Resistant starch: a functional food that prevents DNA damage and chemical carcinogenesis.

    Science.gov (United States)

    Navarro, S D; Mauro, M O; Pesarini, J R; Ogo, F M; Oliveira, R J

    2015-03-06

    Resistant starch is formed from starch and its degradation products and is not digested or absorbed in the intestine; thus, it is characterized as a fiber. Because fiber intake is associated with the prevention of DNA damage and cancer, the potential antigenotoxic, antimutagenic, and anticarcinogenic capabilities of resistant starch from green banana flour were evaluated. Animals were treated with 1,2-dimethylhydrazine and their diet was supplemented with 10% green banana flour according to the following resistant starch protocols: pretreatment, simultaneous treatment, post-treatment, and pre + continuous treatment. The results demonstrated that resistant starch is not genotoxic, mutagenic, or carcinogenic. The results suggest that resistant starch acts through desmutagenesis and bio-antimutagenesis, as well as by reducing aberrant crypt foci, thereby improving disease prognosis. These findings imply that green banana flour has therapeutic properties that should be explored for human dietary applications.

  17. Structure-function studies of DNA damage using AB INITIO quantum mechanics and molecular dynamics simulation

    Energy Technology Data Exchange (ETDEWEB)

    Miller, J.; Miaskiewicz, K. [Pacific Northwest Lab., Richland, WA (United States); Osman, R. [Mount Sinai School of Medicine, New York, NY (United States). Dept. of Physiology and Biophysics

    1993-12-01

    Studies of ring-saturated pyrimidine base lesions are used to illustrate an integrated modeling approach that combines quantum-chemical calculations with molecular dynamics simulation. Electronic-structure calculations on the lesions in Isolation reveal strong conformational preferences due to interactions between equatorial substituents to the pyrimidine ring. Large distortions of DNA should result when these interactions force the methyl group of thymine to assume an axial orientation, as is the case for thymine glycol but not for dihydrothymine. Molecular dynamics simulations of the dodecamer d(CGCGAATTCGCG){sub 2} with and without a ring-saturated thymine lesion at position T7 support this conclusion. Implications of these studies for recognition of thymine lesions by endonuclease III are also discussed.

  18. 真核生物DNA连接酶Ⅲ的功能演化%Functional evolution of Eukaryote DNA ligase Ⅲ

    Institute of Scientific and Technical Information of China (English)

    靳春艳; 盛自章; 黄京飞

    2012-01-01

    DNA连接酶Ⅲ被认为只存在于脊椎动物,并在细胞核DNA的修复和线粒体DNA的复制和修复过程中发挥功能.虽然近来有关于无脊椎动物中存在着DNA连接酶Ⅲ的报道,但其功能演化及在无脊椎动物中的分布仍不清楚.为进一步探讨DNA连接酶Ⅲ的功能演化,进行了数据库搜索、线粒体定位信号(MLS)预测和功能位点保守性分析等.研究结果显示:DNA连接酶Ⅲ在变形虫、动物界和领鞭毛虫中广泛存在,但其在真菌界等发生整个蛋白或部分结构域的丢失;很多物种的DNA连接酶Ⅲ不含线粒体定位信号,因此,它们不太可能在线粒体中发挥作用,而参与细胞核DNA的修复是DNA连接酶Ⅲ较为古老和保守的功能.%Previous studies revealed that DNA ligase III was restricted to vertebrates and functioned in nucleus DNA repair and mitochondria DNA replication and repair. Although recent researches have reported that DNA ligase m is also found in non-vertebrates, little attention has been devoted to the distribution and functional evolution of DNA ligase III. To probe the functional evolution of DNA ligase III , database searches, mitochondrial localization signal prediction (MLS) and functional conservation analysis were performed. The results show that, DNA ligase III can be observed in amoebozoa, metazoa and choanoflagellates, but the whole protein or some domains are lost in some species including fungi. The MLS prediction analysis suggests that, the DNA ligase III in many species can not function in mitochondria, and is consequently less likely to play a role for DNA ligase III in mitochondria. The conservation analyses of functional site demonstrate that nucleus DNA repair is an ancient and conserved function of DNA ligase III.

  19. Towards understanding the evolution and functional diversification of DNA-containing plant organelles

    DEFF Research Database (Denmark)

    Leister, Dario Michael

    2016-01-01

    direct way to reconstruct the evolutionary history of plastids and mitochondria is to sequence and analyze their relatively small genomes. However, understanding the functional diversification of these organelles requires the identification of their complete protein repertoires - which is the ultimate...

  20. SVD identifies transcript length distribution functions from DNA microarray data and reveals evolutionary forces globally affecting GBM metabolism.

    Directory of Open Access Journals (Sweden)

    Nicolas M Bertagnolli

    Full Text Available To search for evolutionary forces that might act upon transcript length, we use the singular value decomposition (SVD to identify the length distribution functions of sets and subsets of human and yeast transcripts from profiles of mRNA abundance levels across gel electrophoresis migration distances that were previously measured by DNA microarrays. We show that the SVD identifies the transcript length distribution functions as "asymmetric generalized coherent states" from the DNA microarray data and with no a-priori assumptions. Comparing subsets of human and yeast transcripts of the same gene ontology annotations, we find that in both disparate eukaryotes, transcripts involved in protein synthesis or mitochondrial metabolism are significantly shorter than typical, and in particular, significantly shorter than those involved in glucose metabolism. Comparing the subsets of human transcripts that are overexpressed in glioblastoma multiforme (GBM or normal brain tissue samples from The Cancer Genome Atlas, we find that GBM maintains normal brain overexpression of significantly short transcripts, enriched in transcripts that are involved in protein synthesis or mitochondrial metabolism, but suppresses normal overexpression of significantly longer transcripts, enriched in transcripts that are involved in glucose metabolism and brain activity. These global relations among transcript length, cellular metabolism and tumor development suggest a previously unrecognized physical mode for tumor and normal cells to differentially regulate metabolism in a transcript length-dependent manner. The identified distribution functions support a previous hypothesis from mathematical modeling of evolutionary forces that act upon transcript length in the manner of the restoring force of the harmonic oscillator.

  1. CDK2 and PKA mediated-sequential phosphorylation is critical for p19INK4d function in the DNA damage response.

    Directory of Open Access Journals (Sweden)

    Mariela C Marazita

    Full Text Available DNA damage triggers a phosphorylation-based signaling cascade known as the DNA damage response. p19INK4d, a member of the INK4 family of CDK4/6 inhibitors, has been reported to participate in the DNA damage response promoting DNA repair and cell survival. Here, we provide mechanistic insight into the activation mechanism of p19INK4d linked to the response to DNA damage. Results showed that p19INK4d becomes phosphorylated following UV radiation, β-amyloid peptide and cisplatin treatments. ATM-Chk2/ATR-Chk1 signaling pathways were found to be differentially involved in p19INK4d phosphorylation depending on the type of DNA damage. Two sequential phosphorylation events at serine 76 and threonine 141 were identified using p19INK4d single-point mutants in metabolic labeling assays with (32P-orthophosphate. CDK2 and PKA were found to participate in p19INK4d phosphorylation process and that they would mediate serine 76 and threonine 141 modifications respectively. Nuclear translocation of p19INK4d induced by DNA damage was shown to be dependent on serine 76 phosphorylation. Most importantly, both phosphorylation sites were found to be crucial for p19INK4d function in DNA repair and cell survival. In contrast, serine 76 and threonine 141 were dispensable for CDK4/6 inhibition highlighting the independence of p19INK4d functions, in agreement with our previous findings. These results constitute the first description of the activation mechanism of p19INK4d in response to genotoxic stress and demonstrate the functional relevance of this activation following DNA damage.

  2. Relationship of Structure and Function of DNA-Binding Domain in Vitamin D Receptor

    Directory of Open Access Journals (Sweden)

    Lin-Yan Wan

    2015-07-01

    Full Text Available While the structure of the DNA-binding domain (DBD of the vitamin D receptor (VDR has been determined in great detail, the roles of its domains and how to bind the motif of its target genes are still under debate. The VDR DBD consists of two zinc finger modules and a C-terminal extension (CTE, at the end of the C-terminal of each structure presenting α-helix. For the first zinc finger structure, N37 and S-box take part in forming a dimer with 9-cis retinoid X receptor (RXR, while V26, R50, P-box and S-box participate in binding with VDR response elements (VDRE. For the second zinc finger structure, P61, F62 and H75 are essential in the structure of the VDR homodimer with the residues N37, E92 and F93 of the downstream of partner VDR, which form the inter-DBD interface. T-box of the CTE, especially the F93 and I94, plays a critical role in heterodimerization and heterodimers–VDRE binding. Six essential residues (R102, K103, M106, I107, K109, and R110 of the CTE α-helix of VDR construct one interaction face, which packs against the DBD core of the adjacent symmetry mate. In 1,25(OH2D3-activated signaling, the VDR-RXR heterodimer may bind to DR3-type VDRE and ER9-type VDREs of its target gene directly resulting in transactivation and also bind to DR3-liked nVDRE of its target gene directly resulting in transrepression. Except for this, 1α,25(OH2D3 ligand VDR-RXR may bind to 1αnVDRE indirectly through VDIR, resulting in transrepression of the target gene. Upon binding of 1α,25(OH2D3, VDR can transactivate and transrepress its target genes depending on the DNA motif that DBD binds.

  3. Synthesis and Characterisation of Copper(II Complexes with Tridentate NNO Functionalized Ligand: Density Function Theory Study, DNA Binding Mechanism, Optical Properties, and Biological Application

    Directory of Open Access Journals (Sweden)

    Madhumita Hazra

    2014-01-01

    Full Text Available The photo physical properties of two mononuclear pentacoordinated copper(II complexes formulated as [Cu(L(Cl(H2O] (1 and [Cu(L(Br(H2O] (2 HL = (1-[(3-methyl-pyridine-2-ylimino-methyl]-naphthalen-2-ol were synthesized and characterized by elemental, physicochemical, and spectroscopic methods. The density function theory calculations are used to investigate the electronic structures and the electronic properties of ligand and complex. The interactions of copper(II complexes towards calf thymus DNA were examined with the help of absorption, viscosity, and fluorescence spectroscopic techniques at pH 7.40. All spectroscopy's result indicates that complexes show good binding activity to calf thymus DNA through groove binding. The optical absorption and fluorescence emission properties of microwires were characterized by fluorescence microscope. From a spectroscopic viewpoint, all compounds strongly emit green light in the solid state. The microscopy investigation suggested that microwires exhibited optical waveguide behaviour which are applicable as fluorescent nanomaterials and can be used as building blocks for miniaturized photonic devices. Antibacterial study reveals that complexes are better antimicrobial agents than free Schiff base due to bacterial cell penetration by chelation. Moreover, the antioxidant study of the ligand and complexes is evaluated by using 1,1-diphenyl-2-picrylhydrazyl (DPPH free-radical assays, which demonstrate that the complexes are of higher antioxidant activity than free ligand.

  4. Functional variants of human APE1 rescue the DNA repair defects of the yeast AP endonuclease/3'-diesterase-deficient strain.

    Science.gov (United States)

    Wang, Zhiqiang; Ayoub, Emily; Mazouzi, Abdelghani; Grin, Inga; Ishchenko, Alexander A; Fan, Jinjiang; Yang, Xiaoming; Harihar, Taramatti; Saparbaev, Murat; Ramotar, Dindial

    2014-10-01

    Human APE1 is an essential enzyme performing functions in DNA repair and transcription. It possesses four distinct repair activities acting on a variety of base and sugar derived DNA lesions. APE1 has seven cysteine residues and Cys65, and to a lesser extent Cys93 and Cys99, is uniquely involved in maintaining a subset of transcription factors in the reduced and active state. Four of the cysteines Cys93, 99, 208 and 310 of APE1 are located proximal to its active site residues Glu96, Asp210 and His309 involved in processing damaged DNA, raising the possibility that missense mutation of these cysteines could alter the enzyme DNA repair functions. An earlier report documented that serine substitution of the individual cysteine residues did not affect APE1 ability to cleave an abasic site oligonucleotide substrate in vitro, except for Cys99Ser, although any consequences of these variants in the repair of in vivo DNA lesions were not tested. Herein, we mutated all seven cysteines of APE1, either singly or in combination, to alanine and show that none of the resulting variants interfered with the enzyme DNA repair functions. Cross-specie complementation analysis reveals that these APE1 cysteine variants fully rescued the yeast DNA repair deficient strain YW778, lacking AP endonucleases and 3'-diesterases, from toxicities caused by DNA damaging agents. Moreover, the elevated spontaneous mutations arising in strain YW778 from the lack of the DNA repair activities were completely suppressed by the APE1 cysteine variants. These findings suggest that the cysteine residues of APE1 are unlikely to play a role in the DNA repair functions of the enzyme in vivo. We also examine other APE1 missense mutations and provide the first evidence that the variant Asp308Ala with normal AP endonuclease, but devoid of 3'→5' exonuclease, displays hypersensitivity to the anticancer drug bleomycin, and not to other agents, suggesting that it has a defect in processing unique DNA lesions

  5. A microcantilever-based silver ion sensor using DNA-functionalized gold nanoparticles as mass amplifier.

    Science.gov (United States)

    You, Juneseok; Song, Yeongjin; Park, Chanho; Jang, Kuewhan; Na, Sungsoo

    2017-04-13

    Silver ions have been used to sterilize many products, however, it has recently been demonstrated that silver ions can be toxic. This toxicity has been researched over many years with the lethal concentration at 10 μM. Silver ions can accumulate through the food chain, causing serious health problems in species. Hence, there is a need for a commercially available silver ion sensor, with high detection sensitivity. In this work, we develop an ultra-sensitive silver ion sensor platform, using cytosine-based DNA and gold nanoparticle as the mass amplifier. We achieve a lower detection limit for silver ions of 10 pM; this detection limit is one million times lower than the toxic concentration. Using our sensor platform we examine highly selective characteristics of other typical ions in water from natural sources. Furthermore, our sensor platform is able to detect silver ions in a real practical sample of commercially available drinking water. Our sensor platform, which we have termed a 'MAIS' (Mass Amplifier Ion Sensor), with the simple detection procedure, high sensitivity, selectivity and real practical applicability has shown potential as an early toxicity assessment of silver ions for the environment.

  6. Electrical characterization of DNA-functionalized solid state nanopores for bio-sensing

    Energy Technology Data Exchange (ETDEWEB)

    Mussi, V; Fanzio, P; Repetto, L; Firpo, G; Valbusa, U [Nanomed Labs, Physics Department, University of Genova, and Nanobiotechnologies, National Institute of Cancer Research (IST), Largo R Benzi, 10 Genova, 16132 (Italy); Scaruffi, P; Stigliani, S; Tonini, G P [Translational Pediatric Oncology, National Institute for Cancer Research (IST), Largo R Benzi, 10 Genova, 16132 (Italy); Menotta, M; Magnani, M, E-mail: mussi@fisica.unige.i [Department of Biomolecular Sciences, University of Urbino ' Carlo Bo' , Via Saffi 2, 61029 Urbino (Italy)

    2010-11-17

    We present data concerning the electrical properties of a class of biosensor devices based on bio-functionalized solid state nanopores able to detect different kinds of interactions between probe molecules, chemically attached to the pore surface, and target molecules present in solution and electrophoretically drawn through the nanometric channel. The great potentiality of this approach resides in the fact that the functionalization of a quite large pore (up to 50-60 nm) allows a sufficient diameter reduction for the attainment of a single molecule sensing dimension and selective activation, without the need for further material deposition, such as metal or oxides, or localized surface modification. The results indicate that it will be possible, in the near future, to conceive and design devices for parallel analysis of biological samples made of arrays of nanopores differently functionalized, fabricated by standard lithographic techniques, with important applications in the field of molecular diagnosis.

  7. Electrical characterization of DNA-functionalized solid state nanopores for bio-sensing

    Science.gov (United States)

    Mussi, V.; Fanzio, P.; Repetto, L.; Firpo, G.; Scaruffi, P.; Stigliani, S.; Menotta, M.; Magnani, M.; Tonini, G. P.; Valbusa, U.

    2010-11-01

    We present data concerning the electrical properties of a class of biosensor devices based on bio-functionalized solid state nanopores able to detect different kinds of interactions between probe molecules, chemically attached to the pore surface, and target molecules present in solution and electrophoretically drawn through the nanometric channel. The great potentiality of this approach resides in the fact that the functionalization of a quite large pore (up to 50-60 nm) allows a sufficient diameter reduction for the attainment of a single molecule sensing dimension and selective activation, without the need for further material deposition, such as metal or oxides, or localized surface modification. The results indicate that it will be possible, in the near future, to conceive and design devices for parallel analysis of biological samples made of arrays of nanopores differently functionalized, fabricated by standard lithographic techniques, with important applications in the field of molecular diagnosis.

  8. Identification of DNA-binding protein target sequences by physical effective energy functions: free energy analysis of lambda repressor-DNA complexes.

    Directory of Open Access Journals (Sweden)

    Caselle Michele

    2007-09-01

    Full Text Available Abstract Background Specific binding of proteins to DNA is one of the most common ways gene expression is controlled. Although general rules for the DNA-protein recognition can be derived, the ambiguous and complex nature of this mechanism precludes a simple recognition code, therefore the prediction of DNA target sequences is not straightforward. DNA-protein interactions can be studied using computational methods which can complement the current experimental methods and offer some advantages. In the present work we use physical effective potentials to evaluate the DNA-protein binding affinities for the λ repressor-DNA complex for which structural and thermodynamic experimental data are available. Results The binding free energy of two molecules can be expressed as the sum of an intermolecular energy (evaluated using a molecular mechanics forcefield, a solvation free energy term and an entropic term. Different solvation models are used including distance dependent dielectric constants, solvent accessible surface tension models and the Generalized Born model. The effect of conformational sampling by Molecular Dynamics simulations on the computed binding energy is assessed; results show that this effect is in general negative and the reproducibility of the experimental values decreases with the increase of simulation time considered. The free energy of binding for non-specific complexes, estimated using the best energetic model, agrees with earlier theoretical suggestions. As a results of these analyses, we propose a protocol for the prediction of DNA-binding target sequences. The possibility of searching regulatory elements within the bacteriophage λ genome using this protocol is explored. Our analysis shows good prediction capabilities, even in absence of any thermodynamic data and information on the naturally recognized sequence. Conclusion This study supports the conclusion that physics-based methods can offer a completely complementary

  9. Nucleobase-functionalized grapheme nanoribbons for accurate high-speed DNA sequencing

    NARCIS (Netherlands)

    Paulechka, Eugene; Wassenaar, Tsjerk; Kroenlein, Kenneth; Kazakov, Andrei; Smolyanitsky, Alex

    2016-01-01

    We propose a water-immersed nucleobase-functionalized suspended graphene nanoribbon as an intrinsically selective device for nucleotide detection. The proposed sensing method combines Watson–Crick selective base pairing with graphene's capacity for converting anisotropic lattice strain to changes in

  10. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

    2016-06-14

    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  11. Function of DNA methyltransferase 3a in lead (Pb(2+) )-Induced Cyclooxygenase-2 gene.

    Science.gov (United States)

    Tsai, Yao-Ting; Chang, Che-Mai; Wang, Jaw-Yuan; Hou, Ming-Feng; Wang, Ju-Ming; Shiurba, Robert; Chang, Wen-Chang; Chang, Wei-Chiao

    2015-09-01

    Lead ions (Pb(2+) ) are toxic industrial pollutants associated with chronic inflammatory diseases in humans and animals. Previously, we found that Pb(2+) ions induce COX-2 gene expression via the EGF receptor/nuclear factor-κB signal transduction pathway in epidermoid carcinoma cell line A431. In this study, to see whether Pb(2+) ions affect COX-2 expression by epigenetic mechanisms, we looked at the mRNAs of DNA methyltransferases (DNMTs) using real-time PCR of total RNA from these cells. Cells exposed to Pb(2+) had low levels of DNMT3a mRNA, whereas the levels of DNMT1 and DNMT3b mRNAs remained unchanged. Pretreatment of cells with DNMT inhibitor 5-aza-2'-deoxycytidine (5 μM) followed by Pb(2+) (1 μM) significantly increased levels of COX-2 mRNA compared with cells treated with Pb(2+) alone. Overexpression of tumor suppressor gene Rb correlated with an increase in COX-2 mRNA and a decrease in DNMT3a mRNA. Conversely, overexpression of transcription factor E2F1 correlated with a decrease in COX-2 mRNA and an increase in DMNT3a mRNA. Pretreatment with EGFR inhibitors AG1478 and PD153035 significantly limited Pb(2+) -induced reduction in DNMT3a mRNA. In addition, gene knockdown of DNMT3a with short hairpin RNA correlated with increased COX-2 mRNA induced by Pb(2+) . Our findings suggest Pb(2+) ions induce COX-2 expression indirectly by reducing DNMT3a methylation of the COX-2 promoter via transcription factors Rb and E2F1. © 2014 Wiley Periodicals, Inc.

  12. Arabidopsis ZDP DNA 3'-phosphatase and ARP endonuclease function in 8-oxoG repair initiated by FPG and OGG1 DNA glycosylases.

    Science.gov (United States)

    Córdoba-Cañero, Dolores; Roldán-Arjona, Teresa; Ariza, Rafael R

    2014-09-01

    Oxidation of guanine in DNA generates 7,8-dihydro-8-oxoguanine (8-oxoG), an ubiquitous lesion with mutagenic properties. 8-oxoG is primarily removed by DNA glycosylases distributed in two families, typified by bacterial Fpg proteins and eukaryotic Ogg1 proteins. Interestingly, plants possess both Fpg and Ogg1 homologs but their relative contributions to 8-oxoG repair remain uncertain. In this work we used Arabidopsis cell-free extracts to monitor 8-oxoG repair in wild-type and mutant plants. We found that both FPG and OGG1 catalyze excision of 8-oxoG in Arabidopsis cell extracts by a DNA glycosylase/lyase mechanism, and generate repair intermediates with blocked 3'-termini. An increase in oxidative damage is detected in both nuclear and mitochondrial DNA from double fpg ogg1 mutants, but not in single mutants, which suggests that a single deficiency in one of these DNA glycosylases may be compensated by the other. We also found that the DNA 3'-phosphatase ZDP (zinc finger DNA 3'-phosphoesterase) and the AP(apurinic/apyirmidinic) endonuclease ARP(apurinic endonuclease redox protein) are required in the 8-oxoG repair pathway to process the 3'-blocking ends generated by FPG and OGG1. Furthermore, deficiencies in ZDP and/or ARP decrease germination ability after seed deteriorating conditions. Altogether, our results suggest that Arabidopsis cells use both FPG and OGG1 to repair 8-oxoG in a pathway that requires ZDP and ARP in downstream steps.

  13. Stimuli-Responsive DNA-Functionalized Metal-Organic Frameworks (MOFs).

    Science.gov (United States)

    Kahn, Jason S; Freage, Lina; Enkin, Natalie; Garcia, Miguel Angel Aleman; Willner, Itamar

    2017-02-01

    The synthesis of nucleic acid-functionalized metal-organic frameworks (MOFs) is described. The metal-organic frameworks are loaded with a dye being locked in the structures by means of stimuli-responsive nucleic acid caps. The pH and K(+) -ion-triggered release, and switchable release, are demonstrated. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Hybridization State Detection of DNA-Functionalized Gold Nanoparticles Using Hyperspectral Imaging

    Directory of Open Access Journals (Sweden)

    Richard C. Murdock

    2017-01-01

    Full Text Available Hyperspectral imaging has the unique ability of capturing spectral data for multiple wavelengths at each pixel in an image. This gives the ability to distinguish, with certainty, different nanomaterials and/or distinguish nanomaterials from biological materials. In this study, 4 nm and 13 nm gold nanoparticles (Au NPs were synthesized, functionalized with complimentary oligonucleotides, and hybridized to form large networks of NPs. Scattering spectra were collected from each sample (unfunctionalized, functionalized, and hybridized and evaluated. The spectra showed unique peaks for each size of Au NP sample and also exhibited narrowing and intensifying of the spectra as the NPs were functionalized and then subsequently hybridized. These spectra are different from normal aggregation effects where the LSPR and reflected spectrum broaden and are red-shifted. Rather, this appears to be dependent on the ability to control the interparticle distance through oligonucleotide length, which is also investigated through the incorporation of a poly-A spacer. Also, hybridized Au NPs were exposed to cells with no adverse effects and retained their unique spectral signatures. With the ability to distinguish between hybridization states at nearly individual NP levels, this could provide a new method of tracking the intracellular actions of nanomaterials as well as extracellular biosensing applications.

  15. Scientific publications about DNA structure-function and PCR technique in Costa Rica: A historic view (1953-2003

    Directory of Open Access Journals (Sweden)

    Federico J Albertazzi

    2004-09-01

    Full Text Available The spreading of knowledge depends on the access to the information and its immediate use. Models are useful to explain specific phenomena. The scientific community accepts some models in Biology after a period of time, once it has evidence to support it. The model of the structure and function of the DNA proposed by Watson & Crick (1953 was not the exception, since a few years later the DNA model was finally accepted. In Costa Rica, DNA function was first mentioned in 1970, in the magazine Biología Tropical (Tropical Biology Magazine, more than 15 years after its first publication in a scientific journal. An opposite situation occurs with technical innovations. If the efficiency of a new scientific technique is proved in a compelling way, then the acceptance by the community comes swiftly. This was the case of the polymerase chain reaction, or PCR. The first PCR machine in Costa Rica arrived in 1991, only three years after its publication. Rev. Biol. Trop. 52(3: 417-421. Epub 2004 Dic 15.La diseminación del conocimiento depende de la disponibilidad de la información y aplicar dicha información para resolver una problema. Los modelos sirvan para explicar fenómenos determinados. En Biología los modelos son aceptados por la comunidad científica después de cierto tiempo si ha probado su validez y reconocido la evidencia para apoyar dicho modelo. El modelo estructural y función de la molécula de ADN propuesto por Watson y Crick (1953 no fue la excepción pues tardó varios años en ser completamente aceptado por la comunidad científica. En Costa Rica la primera publicación relacionada con la función del ADN fue en la Revista Biología Tropical fue en 1970, más de 15 años después de ser propuesta. La situación contraria se presenta cuando son innovaciones técnicas. Si la eficiencia es demostrada, rápidamente se incorpora dentro de la comunidad. Este fue el caso de la reacción en cadena de la polimerasa, abreviado en inglés como

  16. A seven-year storage report of good manufacturing practice-grade naked plasmid DNA: stability, topology, and in vitro/in vivo functional analysis.

    Science.gov (United States)

    Walther, Wolfgang; Schmeer, Marco; Kobelt, Dennis; Baier, Ruth; Harder, Alexander; Walhorn, Volker; Anselmetti, Dario; Aumann, Jutta; Fichtner, Iduna; Schleef, Martin

    2013-12-01

    The great interest for naked plasmid DNA in gene therapy studies is reflected by the fact that it is currently used in 18% of all gene therapy trials. Therefore, validation of topology and functionality of DNA resulting from its long-term stability is an essential requirement for safe and effective gene transfer. To this aim, we analyzed the stability of good manufacturing practice-grade pCMVβ reporter plasmid DNA by capillary gel electrophoresis, agarose gel electrophoresis, and atomic force microscopy. The plasmid DNA was produced for a clinical gene transfer study started in 2005 and was stored for meanwhile 7 years under continuously monitored conditions at -20 °C. The stability of plasmid DNA was monitored by LacZ transgene expression functional assays performed in vitro and in vivo on the 7-year-old plasmid DNA samples compared with plasmid batches newly produced in similar experimental conditions and quality standards. The analyses revealed that during the overall storage time and conditions, the proportion of open circular and supercoiled or covalently closed circular forms is conserved without linearization or degradation of the plasmid. The in vitro transfection and the in vivo jet-injection of DNA showed unaltered functionality of the long-stored plasmid. In summary, the 7-year-old and the newly produced plasmid samples showed similar topology and expression performance. Therefore, our stable storage conditions are effective to preserve the integrity of the DNA to be used in clinical studies. This is an important prerequisite for the long-term performance of gene transfer materials used in trials of long duration as well as of the reference material used in standardization procedures and assays.

  17. Activation of the DNA Damage Response Is a Conserved Function of HIV-1 and HIV-2 Vpr That Is Independent of SLX4 Recruitment

    Directory of Open Access Journals (Sweden)

    Oliver I. Fregoso

    2016-09-01

    Full Text Available There has been extraordinary progress in understanding the roles of lentiviral accessory proteins in antagonizing host antiviral defense proteins. However, the precise primary function of the accessory gene Vpr remains elusive. Here we suggest that engagement with the DNA damage response is an important function of primate lentiviral Vpr proteins because of its conserved function among diverse lentiviral lineages. In contrast, we show that, for HIV-1, HIV-2, and related Vpr isolates and orthologs, there is a lack of correlation between DNA damage response activation and interaction with the host SLX4 protein complex of structure specific endonucleases; some Vpr proteins are able to interact with SLX4, but the majority are not. Using the clustered regularly interspaced short palindromic repeat (CRISPR/Cas9 method to knock out SLX4, we formally showed that HIV-1 and HIV-2 Vpr orthologs can still activate the DNA damage response and cell cycle arrest in the absence of SLX4. Together, our data suggest that activation of the DNA damage response, but not SLX4 interaction, is conserved and therefore indicative of an important function of Vpr. Our data also indicate that Vpr activates the DNA damage response through an SLX4-independent mechanism that remains uncharacterized.

  18. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    OpenAIRE

    Alamar Santiago; Arribas Raquel; Forment Javier; Alonso-Cantabrana Hugo; Marques M Carmen; Conejero Vicente; Perez-Amador Miguel A

    2009-01-01

    Abstract Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information an...

  19. Functional annotation of a full-length mouse cDNA collection

    Energy Technology Data Exchange (ETDEWEB)

    Kawai, J.; Shinagawa, A.; Shibata, K.; Yoshino, M.; Itoh, M.; Ishii, Y.; Arakawa, T.; Hara, A.; Fukunishi, Y.; Konno, H.; Adachi, J.; Fukuda, S.; Aizawa, K.; Izawa, M.; Nishi, K.; Kiyosawa, H.; Kondo, S.; Yamanaka, I.; Saito, T.; Okazaki, Y.; Gojobori, T.; Bono, H.; Kasukawa, T.; Saito, R.; Kadota, K.; Matsuda, H.; Ashburner, M.; Batalov, S.; Casavant, T.; Fleischmann, W.; Gaasterland, T.; Gissi, C.; King, B.; Kochiwa, H.; Kuehl, P.; Lewis, S.; Matsuo, Y.; Nikaido, I.; Pesole, G.; Quackenbush, J.; Schriml, L.M.; Staubli, F.; Suzuki, R.; Tomita, M.; Wagner, L.; Washio, T.; Sakai, K.; Okido, T.; Furuno, M.; Aono, H.; Baldarelli, R.; Barsh, G.; Blake, J.; Boffelli, D.; Bojunga, N.; Carninci, P.; de Bonaldo, M.F.; Brownstein, M.J.; Bult, C.; Fletcher, C.; Fujita, M.; Gariboldi, M.; Gustincich, S.; Hill, D.; Hofmann, M.; Hume, D.A.; Kamiya, M.; Lee, N.H.; Lyons, P.; Marchionni, L.; Mashima, J.; Mazzarelli, J.; Mombaerts, P.; Nordone, P.; Ring, B.; Ringwald, M.; Rodriguez, I.; Sakamoto, N.; Sasaki, H.; Sato, K.; Schonbach, C.; Seya, T.; Shibata, Y.; Storch, K.-F.; Suzuki, H.; Toyo-oka, K.; Wang, K.H.; Weitz, C.; Whittaker, C.; Wilming, L.; Wynshaw-Boris, A.; Yoshida, K.; Hasegawa, Y.; Kawaji, H.; Kohtsuki, S.; Hayashizaki, Y.; RIKEN Genome Exploration Research Group Phase II T; FANTOM Consortium

    2001-01-01

    The RIKEN Mouse Gene Encyclopedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analyzed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.

  20. Phylogenetic and functional analysis of the bacteriophage P1 single-stranded DNA-binding protein

    DEFF Research Database (Denmark)

    Bendtsen, Jannick Dyrløv; Nilsson, A.S.; Lehnherr, H.

    2002-01-01

    and does not represent a recent acquirement of the phage. The P1 and E. coli SSB proteins are fully functionally interchangeable. SSB-P1 is nonessential for phage growth in an exponentially growing E. coli host, and it is sufficient to promote bacterial growth in the absence of the E. coli SSB protein....... Expression studies showed that the P1 ssb gene is transcribed only, in an rpoS-independent fashion, during stationary-phase growth in E. coli. Mixed infection experiments demonstrated that a wild-type phage has a selective advantage over an ssb-null mutant when exposed to a bacterial host in the stationary...

  1. Reactivity of monofunctional cis-platinum adducts as a function of DNA sequence.

    OpenAIRE

    Malinge, J M; Leng, M

    1988-01-01

    The purpose of this work was to study the chemical reactivity of monofunctional cis-platinum-nucleic acid adducts as a function of nucleic acid sequence. The first part of the paper deals with the formation of these adducts. It is shown that the ternary nucleic acid-cis-platinum-ethidium bromide complexes in which ethidium bromide and nucleotide residues are cross-linked by cis-platinum, are relatively unstable at 37 degrees C. In the presence of acridine, ethidium bromide (but not cis-platin...

  2. Addressing RNA Integrity to Determine the Impact of Mitochondrial DNA Mutations on Brain Mitochondrial Function with Age

    Science.gov (United States)

    Wang, Wei; Scheffler, Katja; Esbensen, Ying; Strand, Janne M.; Stewart, James B.; Bjørås, Magnar; Eide, Lars

    2014-01-01

    Mitochondrial DNA (mtDNA) mutations can result in mitochondrial dysfunction, but emerging experimental data question the fundamental role of mtDNA mutagenesis in age-associated mitochondrial impairment. The multicopy nature of mtDNA renders the impact of a given mtDNA mutation unpredictable. In this study, we compared mtDNA stability and mtRNA integrity during normal aging. Seven distinct sites in mouse brain mtDNA and corresponding mtRNA were analyzed. Accumulation of mtDNA mutations during aging was highly site-specific. The variation in mutation frequencies overrode the age-mediated increase by more than 100-fold and aging generally did not influence mtDNA mutagenesis. Errors introduced by mtRNA polymerase were also site-dependent and up to two hundred-fold more frequent than mtDNA mutations, and independent of mtDNA mutation frequency. We therefore conclude that mitochondrial transcription fidelity limits the impact of mtDNA mutations. PMID:24819950

  3. Colorimetric and Fluorescent Biosensors Based on Directed Assembly of Nanomaterials with Functional DNA

    Science.gov (United States)

    Liu, Juewen; Lu, Yi

    This chapter reviews recent progress in the interface between functional nucleic acids and nanoscale science and technology, and its analytical applications. In particular, the use of metallic nanoparticles as the color reporting groups for the action (binding, catalysis, or both) of aptamers, DNAzymes, and aptazymes is described in detail. Because metallic nanoparticles possess high extinction coefficients and distance-dependent optical properties, they allow highly sensitive detections with minimal consumption of materials. The combination of quantum dots (QDs) with functional nucleic acids as fluorescent sensors is also described. The chapter starts with the design of colorimetric and fluorescent sensors responsive to single analytes, followed by sensors responsive to multiple analytes with controllable cooperativity and multiplex detection using both colorimetric and fluorescent signals in one pot, and ends by transferring solution-based detections into litmus paper type of tests, making them generally applicable and usable for a wide range of on-site and real-time analytical applications such as household tests, environmental monitoring, and clinical diagnostics.

  4. A leucine zipper motif determines different functions in a DNA replication protein.

    Science.gov (United States)

    Garcia de Viedma, D; Giraldo, R; Rivas, G; Fernández-Tresguerres, E; Diaz-Orejas, R

    1996-01-01

    RepA is the replication initiator protein of the Pseudomonas plasmid pPS10 and is also able to autoregulate its own synthesis. Here we report a genetic and functional analysis of a leucine zipper-like (LZ) motif located at the N-terminus of RepA. It is shown that the LZ motif modulates the equilibrium between monomeric and dimeric forms of the protein and that monomers of RepA interact with sequences at the origin of replication, oriV, while dimers are required for interactions of RepA at the repA promoter. Further, different residues of the LZ motif are seen to have different functional roles. Leucines at the d positions of the putative alpha-helix are relevant in the formation of RepA dimers required for transcriptional autoregulation. They also modulate other RepA-RepA interactions that result in cooperative binding of protein monomers to the origin of replication. The residues at the b/f positions of the putative helix play no relevant role in RepA-RepA interactions. These residues do not affect RepA autoregulation but do influence replication, as demonstrated by mutants that, without affecting binding to oriV, either increase the host range of the plasmid or are inactive in replication. It is proposed that residues in b/f positions play a relevant role in interactions between RepA and host replication factors. Images PMID:8631313

  5. Crystal structure of the WOPR-DNA complex and implications for Wor1 function in white-opaque switching of Candida albicans.

    Science.gov (United States)

    Zhang, Shicheng; Zhang, Tianlong; Yan, Minghui; Ding, Jianping; Chen, Jiangye

    2014-09-01

    Wor1 (white-opaque switching regulator 1) is a master regulator of the white-opaque switching in Candida albicans, an opportunistic human fungal pathogen, and is associated with its pathogenicity and commensality. Wor1 contains a conserved DNA-binding region at the N-terminus, consisting of two conserved segments (WOPRa and WOPRb) connected by a non-conserved linker that can bind to specific DNA sequences of the promoter regions and then regulates the transcription. Here, we report the crystal structure of the C. albicans Wor1 WOPR segments in complex with a double-stranded DNA corresponding to one promoter region of WOR1. The sequentially separated WOPRa and WOPRb are structurally interwound together to form a compact globular domain that we term the WOPR domain. The WOPR domain represents a new conserved fungal-specific DNA-binding domain which uses primarily a conserved loop to recognize and interact specifically with a conserved 6-bp motif of the DNA in both minor and major grooves. The protein-DNA interactions are essential for WOR1 transcriptional regulation and white-to-opaque switching. The structural and biological data together reveal the molecular basis for the recognition and binding specificity of the WOPR domain with its specific DNA sequences and the function of Wor1 in the activation of transcription.

  6. Chronic carriers of hepatitis B virus in Bangladesh: a comparative analysis of HBV-DNA, HBeAg/anti-HBe, and liver function tests.

    Science.gov (United States)

    Hasan, K N; Rumi, M A K; Hasanat, M A; Azam, M G; Ahmed, S; Salam, M A; Islam, L N; Hassan, M S

    2002-03-01

    Serological markers of hepatitis B virus (HBV), liver function tests and quantitative estimation of HBV-DNA are important in the assessment of the state of infection and prognosis following treatment for hepatitis B. This study aimed to determine whether low-cost assays, eg hepatitis B e antigen (HBeAg) and liver function tests, could be used for the assessment of infectivity as an alternative to HBV-DNA estimation. We tested 125 hepatitis B carriers for HBeAg, antibody to HBeAg (anti-HBe), and serum HBV-DNA; we also carried out a range of standard liver function tests. Seventy-three subjects were positive and 52 were negative for HBeAg. Of the HBeAg positive cases, 3 were also positive for anti-HBe; of the HBeAg negative cases, 5 were also negative for anti-HBe. Of these 8 cases, 7 had no detectable HBV-DNA. Most of the HBeAg positive but anti-HBe negative subjects were positive for HBV-DNA (74.3%; 52/ 70) whereas most of the HBeAg negative and anti-HBe positive subjects (93.6%; 44/47) were also negative for HBV-DNA. Of 56 HBV-DNA positive individuals, alanine transaminase (ALT) was found to be raised in 69.6% (p=0.066) and aspartate transaminase (AST) was raised in 66.1% (p=0.011), while 67.9% had normal alkaline phosphatase (ALP) (p=0.054). HBeAg (p=0.018) and raised ALT (p=0.008) were found to be independent predictors for HBV-DNA positivity among HBV carriers. This study suggests that HBeAg positive and anti-HBe negative hepatitis B carriers with raised ALT and AST are likely to be positive for HBV-DNA; the combination of routine serology and biochemical tests may be considered as an alternative to HBV-DNA in evaluating the state of chronic HBV infection. However, HBV-DNA should be specifically assessed if discordance is observed between seromarkers and transaminases.

  7. PprA Protein Is Involved in Chromosome Segregation via Its Physical and Functional Interaction with DNA Gyrase in Irradiated Deinococcus radiodurans Bacteria.

    Science.gov (United States)

    Devigne, Alice; Guérin, Philippe; Lisboa, Johnny; Quevillon-Cheruel, Sophie; Armengaud, Jean; Sommer, Suzanne; Bouthier de la Tour, Claire; Servant, Pascale

    2016-01-01

    PprA, a radiation-induced Deinococcus-specific protein, was previously shown to be required for cell survival and accurate chromosome segregation after exposure to ionizing radiation. Here, we used an in vivo approach to determine, by shotgun proteomics, putative PprA partners coimmunoprecipitating with PprA when cells were exposed to gamma rays. Among them, we found the two subunits of DNA gyrase and, thus, chose to focus our work on characterizing the activities of the deinococcal DNA gyrase in the presence or absence of PprA. Loss of PprA rendered cells hypersensitive to novobiocin, an inhibitor of the B subunit of DNA gyrase. We showed that treatment of bacteria with novobiocin resulted in induction of the radiation desiccation response (RDR) regulon and in defects in chromosome segregation that were aggravated by the absence of PprA. In vitro, the deinococcal DNA gyrase, like other bacterial DNA gyrases, possesses DNA negative supercoiling and decatenation activities. These two activities are inhibited in vitro by novobiocin and nalidixic acid, whereas PprA specifically stimulates the decatenation activity of DNA gyrase. Together, these results suggest that PprA plays a major role in chromosome decatenation via its interaction with the deinococcal DNA gyrase when D. radiodurans cells are recovering from exposure to ionizing radiation. IMPORTANCE D. radiodurans is one of the most radiation-resistant organisms known. This bacterium is able to cope with high levels of DNA lesions generated by exposure to extreme doses of ionizing radiation and to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Here, we identified partners of PprA, a radiation-induced Deinococcus-specific protein, previously shown to be required for radioresistance. Our study leads to three main findings: (i) PprA interacts with DNA gyrase after irradiation, (ii) treatment of cells with novobiocin results in defects in chromosome segregation that are

  8. NUC-1, a caenorhabditis elegans DNase II homolog, functions in an intermediate step of DNA degradation during apoptosis.

    Science.gov (United States)

    Wu, Y C; Stanfield, G M; Horvitz, H R

    2000-03-01

    One hallmark of apoptosis is the degradation of chromosomal DNA. We cloned the Caenorhabditis elegans gene nuc-1, which is involved in the degradation of the DNA of apoptotic cells, and found that nuc-1 encodes a homolog of mammalian DNase II. We used the TUNEL technique to assay DNA degradation in nuc-1 and other mutants defective in programmed cell death and discovered that TUNEL labels apoptotic cells only during a transient intermediate stage. Mutations in nuc-1 allowed the generation of TUNEL-reactive DNA but blocked the conversion of TUNEL-reactive DNA to a subsequent TUNEL-unreactive state. Completion of DNA degradation did not occur in the absence of cell-corpse engulfment. Our data suggest that the process of degradation of the DNA of a cell corpse occurs in at least three distinct steps and requires activities provided by both the dying and the engulfing cell.

  9. Functional and mechanistic studies of XPC DNA-repair complex as transcriptional coactivator in embryonic stem cells.

    Science.gov (United States)

    Cattoglio, Claudia; Zhang, Elisa T; Grubisic, Ivan; Chiba, Kunitoshi; Fong, Yick W; Tjian, Robert

    2015-05-01

    The embryonic stem cell (ESC) state is transcriptionally controlled by OCT4, SOX2, and NANOG with cofactors, chromatin regulators, noncoding RNAs, and other effectors of signaling pathways. Uncovering components of these regulatory circuits and their interplay provides the knowledge base to deploy ESCs and induced pluripotent stem cells. We recently identified the DNA-repair complex xeroderma pigmentosum C (XPC)-RAD23B-CETN2 as a stem cell coactivator (SCC) required for OCT4/SOX2 transcriptional activation. Here we investigate the role of SCC genome-wide in murine ESCs by mapping regions bound by RAD23B and analyzing transcriptional profiles of SCC-depleted ESCs. We establish OCT4 and SOX2 as the primary transcription factors recruiting SCC to regulatory regions of pluripotency genes and identify the XPC subunit as essential for interaction with the two proteins. The present study reveals new mechanistic and functional aspects of SCC transcriptional activity, and thus underscores the diversified functions of this regulatory complex.

  10. Regions of common inter-individual DNA methylation differences in human monocytes: genetic basis and potential function.

    Science.gov (United States)

    Schröder, Christopher; Leitão, Elsa; Wallner, Stefan; Schmitz, Gerd; Klein-Hitpass, Ludger; Sinha, Anupam; Jöckel, Karl-Heinz; Heilmann-Heimbach, Stefanie; Hoffmann, Per; Nöthen, Markus M; Steffens, Michael; Ebert, Peter; Rahmann, Sven; Horsthemke, Bernhard

    2017-07-26

    There is increasing evidence for inter-individual methylation differences at CpG dinucleotides in the human genome, but the regional extent and function of these differences have not yet been studied in detail. For identifying regions of common methylation differences, we used whole genome bisulfite sequencing data of monocytes from five donors and a novel bioinformatic strategy. We identified 157 differentially methylated regions (DMRs) with four or more CpGs, almost none of which has been described before. The DMRs fall into different chromatin states, where methylation is inversely correlated with active, but not repressive histone marks. However, methylation is not correlated with the expression of associated genes. High-resolution single nucleotide polymorphism (SNP) genotyping of the five donors revealed evidence for a role of cis-acting genetic variation in establishing methylation patterns. To validate this finding in a larger cohort, we performed genome-wide association studies (GWAS) using SNP genotypes and 450k array methylation data from blood samples of 1128 individuals. Only 30/157 (19%) DMRs include at least one 450k CpG, which shows that these arrays miss a large proportion of DNA methylation variation. In most cases, the GWAS peak overlapped the CpG position, and these regions are enriched for CREB group, NF-1, Sp100 and CTCF binding motifs. In two cases, there was tentative evidence for a trans-effect by KRAB zinc finger proteins. Allele-specific DNA methylation occurs in discrete chromosomal regions and is driven by genetic variation in cis and trans, but in general has little effect on gene expression.

  11. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Directory of Open Access Journals (Sweden)

    Caroline Chénard

    2016-06-01

    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  12. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F.

    2016-01-01

    ABSTRACT   Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. PMID:27302758

  13. Ag nanocluster/DNA hybrids: functional modules for the detection of nitroaromatic and RDX explosives.

    Science.gov (United States)

    Enkin, Natalie; Sharon, Etery; Golub, Eyal; Willner, Itamar

    2014-08-13

    Luminescent Ag nanoclusters (NCs) stabilized by nucleic acids are implemented as optical labels for the detection of the explosives picric acid, trinitrotoluene (TNT), and hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). The sensing modules consist of two parts, a nucleic acid with the nucleic acid-stabilized Ag NCs and a nucleic acid functionalized with electron-donating units, including L-DOPA, L-tyrosine and 6-hydroxy-L-DOPA, self-assembled on a nucleic acid scaffold. The formation of donor-acceptor complexes between the nitro-substituted explosives, exhibiting electron-acceptor properties, and the electron-donating sites, associated with the sensing modules, concentrates the explosives in close proximity to the Ag NCs. This leads to the electron-transfer quenching of the luminescence of the Ag NCs by the explosive molecule. The quenching of the luminescence of the Ag NCs provides a readout signal for the sensing process. The sensitivities of the analytical platforms are controlled by the electron-donating properties of the donor substituents, and 6-hydroxy-L-DOPA was found to be the most sensitive donor. Picric acid, TNT, and RDX are analyzed with detection limits corresponding to 5.2 × 10(-12) M, 1.0 × 10(-12) M, and 3.0 × 10(-12) M, respectively, using the 6-hydroxy-L-DOPA-modified Ag NCs sensing module.

  14. Reactivity of monofunctional cis-platinum adducts as a function of DNA sequence.

    Science.gov (United States)

    Malinge, J M; Leng, M

    1988-08-11

    The purpose of this work was to study the chemical reactivity of monofunctional cis-platinum-nucleic acid adducts as a function of nucleic acid sequence. The first part of the paper deals with the formation of these adducts. It is shown that the ternary nucleic acid-cis-platinum-ethidium bromide complexes in which ethidium bromide and nucleotide residues are cross-linked by cis-platinum, are relatively unstable at 37 degrees C. In the presence of acridine, ethidium bromide (but not cis-platinum) is slowly released which leads to the formation of monofunctional cis-platinum-nucleic acid adducts. After removal of acridine, the monofunctional adducts react further to become bifunctional. The second part of the paper deals with the kinetics of disappearance of the monofunctional adducts in several polynucleotides but not in poly(dG).poly(dC). When the adducts possess a chloride ligand, the limiting step in the cross-linking is the rate of aquation reaction of the chloride ligand. The rate constants are an order of magnitude larger when the monofunctional adducts do not possess a chloride ligand. In both the cases, the rate constants are apparently independent of the nucleic acid sequence.

  15. Mesenchymal stem cells transfer mitochondria to the cells with virtually no mitochondrial function but not with pathogenic mtDNA mutations.

    Science.gov (United States)

    Cho, Young Min; Kim, Ju Han; Kim, Mingoo; Park, Su Jin; Koh, Sang Hyeok; Ahn, Hyo Seop; Kang, Gyeong Hoon; Lee, Jung-Bin; Park, Kyong Soo; Lee, Hong Kyu

    2012-01-01

    It has been reported that human mesenchymal stem cells (MSCs) can transfer mitochondria to the cells with severely compromised mitochondrial function. We tested whether the reported intercellular mitochondrial transfer could be replicated in different types of cells or under different experimental conditions, and tried to elucidate possible mechanism. Using biochemical selection methods, we found exponentially growing cells in restrictive media (uridine(-) and bromodeoxyuridine [BrdU](+)) during the coculture of MSCs (uridine-independent and BrdU-sensitive) and 143B-derived cells with severe mitochondrial dysfunction induced by either long-term ethidium bromide treatment or short-term rhodamine 6G (R6G) treatment (uridine-dependent but BrdU-resistant). The exponentially growing cells had nuclear DNA fingerprint patterns identical to 143B, and a sequence of mitochondrial DNA (mtDNA) identical to the MSCs. Since R6G causes rapid and irreversible damage to mitochondria without the removal of mtDNA, the mitochondrial function appears to be restored through a direct transfer of mitochondria rather than mtDNA alone. Conditioned media, which were prepared by treating mtDNA-less 143B ρ(0) cells under uridine-free condition, induced increased chemotaxis in MSC, which was also supported by transcriptome analysis. Cytochalasin B, an inhibitor of chemotaxis and cytoskeletal assembly, blocked mitochondrial transfer phenomenon in the above condition. However, we could not find any evidence of mitochondrial transfer to the cells harboring human pathogenic mtDNA mutations (A3243G mutation or 4,977 bp deletion). Thus, the mitochondrial transfer is limited to the condition of a near total absence of mitochondrial function. Elucidation of the mechanism of mitochondrial transfer will help us create a potential cell therapy-based mitochondrial restoration or mitochondrial gene therapy for human diseases caused by mitochondrial dysfunction.

  16. Mesenchymal stem cells transfer mitochondria to the cells with virtually no mitochondrial function but not with pathogenic mtDNA mutations.

    Directory of Open Access Journals (Sweden)

    Young Min Cho

    Full Text Available It has been reported that human mesenchymal stem cells (MSCs can transfer mitochondria to the cells with severely compromised mitochondrial function. We tested whether the reported intercellular mitochondrial transfer could be replicated in different types of cells or under different experimental conditions, and tried to elucidate possible mechanism. Using biochemical selection methods, we found exponentially growing cells in restrictive media (uridine(- and bromodeoxyuridine [BrdU](+ during the coculture of MSCs (uridine-independent and BrdU-sensitive and 143B-derived cells with severe mitochondrial dysfunction induced by either long-term ethidium bromide treatment or short-term rhodamine 6G (R6G treatment (uridine-dependent but BrdU-resistant. The exponentially growing cells had nuclear DNA fingerprint patterns identical to 143B, and a sequence of mitochondrial DNA (mtDNA identical to the MSCs. Since R6G causes rapid and irreversible damage to mitochondria without the removal of mtDNA, the mitochondrial function appears to be restored through a direct transfer of mitochondria rather than mtDNA alone. Conditioned media, which were prepared by treating mtDNA-less 143B ρ(0 cells under uridine-free condition, induced increased chemotaxis in MSC, which was also supported by transcriptome analysis. Cytochalasin B, an inhibitor of chemotaxis and cytoskeletal assembly, blocked mitochondrial transfer phenomenon in the above condition. However, we could not find any evidence of mitochondrial transfer to the cells harboring human pathogenic mtDNA mutations (A3243G mutation or 4,977 bp deletion. Thus, the mitochondrial transfer is limited to the condition of a near total absence of mitochondrial function. Elucidation of the mechanism of mitochondrial transfer will help us create a potential cell therapy-based mitochondrial restoration or mitochondrial gene therapy for human diseases caused by mitochondrial dysfunction.

  17. Recognition of double-stranded DNA using energetically activated duplexes with interstrand zippers of 1-, 2-or 4-pyrenyl-functionalized O2 '-alkylated RNA monomers

    DEFF Research Database (Denmark)

    Karmakar, Saswata; Madsen, Andreas Stahl; Guenther, Dale C.

    2014-01-01

    Despite advances with triplex-forming oligonucleotides, peptide nucleic acids, polyamides and more recently engineered proteins, there remains an urgent need for synthetic ligands that enable specific recognition of double-stranded (ds) DNA to accelerate studies aiming at detecting, regulating...... and modifying genes. Invaders, i.e., energetically activated DNA duplexes with interstrand zipper arrangements of intercalator-functionalized nucleotides, are emerging as an attractive approach toward this goal. Here, we characterize and compare Invaders based on 1-, 2- and 4-pyrenyl-functionalized O2...... hairpins with single nucleotide fidelity. Intercalator-mediated unwinding and activation of the double-stranded probe, coupled with extraordinary stabilization of probe target duplexes (Delta T-m/modification up to +14.0 degrees C), provides the driving force for dsDNA recognition. In contrast, Z...

  18. Gold Nanorods, DNA Origami, and Porous Silicon Nanoparticle-functionalized Biocompatible Double Emulsion for Versatile Targeted Therapeutics and Antibody Combination Therapy.

    Science.gov (United States)

    Kong, Feng; Zhang, Hongbo; Qu, Xiangmeng; Zhang, Xu; Chen, Dong; Ding, Ruihua; Mäkilä, Ermei; Salonen, Jarno; Santos, Hélder A; Hai, Mingtan

    2016-12-01

    Gold nanorods, DNA origami, and porous silicon nanoparticle-functionalized biocompatible double emulsion are developed for versatile molecular targeted therapeutics and antibody combination therapy. This advanced photothermal responsive all-in-one biocompatible platform can be easily formed with great therapeutics loading capacity for different cancer treatments with synergism and multidrug resistance inhibition, which has great potential in advancing biomedical applications.

  19. Electrochemiluminescent biosensor of ATP using tetrahedron structured DNA and a functional oligonucleotide for Ru(phen)3(2+) intercalation and target identification.

    Science.gov (United States)

    Bu, Nan-Nan; Gao, Ai; He, Xi-Wen; Yin, Xue-Bo

    2013-05-15

    Restricted target accessibility and surface-induced perturbation of the aptamer structure are the main limitations in single-stranded DNA aptamer-based electrochemical sensors. Chemical labeling of the aptamer with a probe at the end of aptamer is inefficient and time-consuming. In this work, tetrahedron-structured DNA (ts-DNA) and a functionalized oligonucleotide (FO) were used to develop an electrochemiluminescence (ECL) aptasensor with adenosine triphosphate (ATP) as a model target. The ts-DNA was formed with three thiolated oligonucleotides and one oligonucleotide containing anti-ATP aptamer. The FO contained a complementary strand to the anti-ATP aptamer and an intermolecular duplex for Ru(phen)3(2+) intercalation. After the ts-DNA was immobilized on the electrode surface through gold-thiol interactions, hybridization between the anti-ATP aptamer and its complementary strand introduced the intercalated Ru(phen)3(2+) to the electrode. ECL emission from Ru(phen)3(2+) was observed with tripropylamine as a co-reactant. Once ATP reacted with its aptamer, the aptamer-complimentary strand duplex dissociated and the intermolecular duplex containing Ru(phen)3(2+) was released. The difference in emission before and after reaction with ATP was used to quantify ATP with a detection limit of 0.2nM. The ts-DNA increased the sensitivity compared to conventional methods, and the intercalation strategy avoided a complex chemical labeling procedure.

  20. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  1. Functional complementation of Leishmania (Leishmania) amazonensis AP endonuclease gene (lamap) in Escherichia coli mutant strains challenged with DNA damage agents.

    Science.gov (United States)

    Verissimo-Villela, Erika; Kitahara-Oliveira, Milene Yoko; Reis, Ana Beatriz de Bragança Dos; Albano, Rodolpho Mattos; Da-Cruz, Alda Maria; Bello, Alexandre Ribeiro

    2016-05-01

    During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins.

  2. Functional complementation of Leishmania (Leishmania) amazonensis AP endonuclease gene (lamap) in Escherichia coli mutant strains challenged with DNA damage agents

    Science.gov (United States)

    Verissimo-Villela, Erika; Kitahara-Oliveira, Milene Yoko; dos Reis, Ana Beatriz de Bragança; Albano, Rodolpho Mattos; Da-Cruz, Alda Maria; Bello, Alexandre Ribeiro

    2016-01-01

    During its life cycle Leishmania spp. face several stress conditions that can cause DNA damages. Base Excision Repair plays an important role in DNA maintenance and it is one of the most conserved mechanisms in all living organisms. DNA repair in trypanosomatids has been reported only for Old World Leishmania species. Here the AP endonuclease from Leishmania (L.) amazonensis was cloned, expressed in Escherichia coli mutants defective on the DNA repair machinery, that were submitted to different stress conditions, showing ability to survive in comparison to the triple null mutant parental strain BW535. Phylogenetic and multiple sequence analyses also confirmed that LAMAP belongs to the AP endonuclease class of proteins. PMID:27223868

  3. Redox regulation of human sperm function: from the physiological control of sperm capacitation to the etiology of infertility and DNA damage in the germ line.

    Science.gov (United States)

    Aitken, Robert J; Curry, Benjamin J

    2011-02-01

    Defective sperm function is the largest single defined cause of human infertility and one of the major reasons we are witnessing an exponential increase in the uptake of assisted conception therapy in the developed world. A major characteristic of defective human spermatozoa is the presence of large amounts of DNA damage, which is, in turn, associated with reduced fertility, increased rates of miscarriage, and an enhanced risk of disease in the offspring. This DNA damage is largely oxidative and is closely associated with defects in spermiogenesis. To explain the origins of this DNA damage, we postulate that spermiogenesis is disrupted by oxidative stress, leading to the creation of defective gametes with poorly remodeled chromatin that are particularly susceptible to free radical attack. To compound the problem, these defective cells have a tendency to undergo an unusual truncated form of apoptosis associated with high amounts of superoxide generation by the sperm mitochondria. This leads to significant oxidative DNA damage that eventually culminates in the DNA fragmentation we see in infertile patients. In light of the significance of oxidative stress in the etiology of defective sperm function, a variety of antioxidant therapies are now being assessed for their therapeutic potential.

  4. Ultraviolet-B-induced DNA damage and ultraviolet-B tolerance mechanisms in species with different functional groups coexisting in subalpine moorlands.

    Science.gov (United States)

    Wang, Qing-Wei; Kamiyama, Chiho; Hidema, Jun; Hikosaka, Kouki

    2016-08-01

    High doses of ultraviolet-B (UV-B; 280-315 nm) radiation can have detrimental effects on plants, and especially damage their DNA. Plants have DNA repair and protection mechanisms to prevent UV-B damage. However, it remains unclear how DNA damage and tolerance mechanisms vary among field species. We studied DNA damage and tolerance mechanisms in 26 species with different functional groups coexisting in two moorlands at two elevations. We collected current-year leaves in July and August, and determined accumulation of cyclobutane pyrimidine dimer (CPD) as UV-B damage and photorepair activity (PRA) and concentrations of UV-absorbing compounds (UACs) and carotenoids (CARs) as UV-B tolerance mechanisms. DNA damage was greater in dicot than in monocot species, and higher in herbaceous than in woody species. Evergreen species accumulated more CPDs than deciduous species. PRA was higher in Poaceae than in species of other families. UACs were significantly higher in woody than in herbaceous species. The CPD level was not explained by the mechanisms across species, but was significantly related to PRA and UACs when we ignored species with low CPD, PRA and UACs, implying the presence of another effective tolerance mechanism. UACs were correlated negatively with PRA and positively with CARs. Our results revealed that UV-induced DNA damage significantly varies among native species, and this variation is related to functional groups. DNA repair, rather than UV-B protection, dominates in UV-B tolerance in the field. Our findings also suggest that UV-B tolerance mechanisms vary among species under evolutionary trade-off and synergism.

  5. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    Directory of Open Access Journals (Sweden)

    Cora S Thiel

    Full Text Available Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP and an antibiotic resistance cassette (kanamycin/neomycin was attached on different positions of rocket exterior; (i circular every 90 degree on the outer surface concentrical of the payload, (ii in the grooves of screw heads located in between the surface application sites, and (iii on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  6. Identification and functional analysis of a new glyphosate resistance gene from a fungus cDNA library.

    Science.gov (United States)

    Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan

    2017-08-01

    Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. [Genomic DNA sequences and functional expression, purification of BmalphaTX14 neurotoxin from scorpion Buthus martensii Karsch].

    Science.gov (United States)

    Lü, Meng; Wang, Kun; Cao, Zhi-Jian; Jiang, Da-He; Mao, Xin; Li, Wen-Xin

    2005-11-01

    Based on the full-length cDNA of BmalphaTX14 from Chinese scorpion Buthus martensii Karsch (BmK), gene of the mature peptide of BmalphaTX14 was cloned into the yeast expression vector pPIC9K. After transforming, screening and inducing, tricine-SDS-PAGE and Western blot proved that rBmalphaTX14 protein was expressed in the medium for up to 84 hours, getting nearly 120 mg/L. Recombinant BmalphaTX14 was purified rapidly and efficiently through Ni-NTA-agarose, polyethylene glycol precipitation and gel filtration chromatography. The purified rBmalphaTX14 proved to have the anti-insect activity by toxicity assay. Meanwhile, genomic gene of BmalphaTX14 was cloned and sequenced by PCR method, sequence analysis of this gene showed that BmalphaTX14 had an intron of 408 base pairs located at the signal peptide encoding region, which was similar with the characteristic of other alpha-type sodium ion-channel toxin. Considering both the genomic organization and the peptide function, BmaTX14 proved to be a membership belonging to alpha-type sodium ion-channel toxin.

  8. Structural Determinants of Human FANCF Protein That Function in the Assembly of a DNA Damage Signaling Complex

    Energy Technology Data Exchange (ETDEWEB)

    Kowal,P.; Gurtan, A.; Stuckert, P.; D' Andrea, A.; Ellenberger, T.

    2007-01-01

    Fanconi anemia (FA) is a rare autosomal recessive and X-linked chromosomal instability disorder. At least eight FA proteins (FANCA, B, C, E, F, G, L, and M) form a nuclear core complex required for monoubiquitination of a downstream protein, FANCD2. The human FANCF protein reportedly functions as a molecular adaptor within the FA nuclear complex, bridging between the subcomplexes A:G and C:E. Our x-ray crystallographic studies of the C-terminal domain of FANCF reveal a helical repeat structure similar to the Cand1 regulator of the Cul1-Rbx1-Skp1-Fbox(Skp2) ubiquitin ligase complex. Two C-terminal loops of FANCF are essential for monoubiquitination of FANCD2 and normal cellular resistance to the DNA cross-linking agent mitomycin C. FANCF mutants bearing amino acid substitutions in this C-terminal surface fail to interact with other components of the FA complex, indicating that this surface is critical for the proper assembly of the FA core complex.

  9. Altered localization and functionality of TAR DNA Binding Protein 43 (TDP-43) in niemann- pick disease type C.

    Science.gov (United States)

    Dardis, A; Zampieri, S; Canterini, S; Newell, K L; Stuani, C; Murrell, J R; Ghetti, B; Fiorenza, M T; Bembi, B; Buratti, E

    2016-05-18

    Niemann-Pick type C (NPC) disease is a lysosomal storage disorder characterized by the occurrence of visceral and neurological symptoms. At present, the molecular mechanisms causing neurodegeneration in this disease are unknown. Here we report the altered expression and/or mislocalization of the TAR-DNA binding protein 43 (TDP-43) in both NPC mouse and in a human neuronal model of the disease. We also report the neuropathologic study of a NPC patient's brain, showing that while TDP-43 is below immunohistochemical detection in nuclei of cerebellar Purkinje cells, it has a predominant localization in the cytoplasm of these cells. From a functional point of view, the TDP-43 mislocalization, that occurs in a human experimental neuronal model system, is associated with specific alterations in TDP-43 controlled genes. Most interestingly, treatment with N-Acetyl-cysteine (NAC) or beta-cyclodextrin (CD) can partially restore TDP-43 nuclear localization. Taken together, the results of these studies extend the role of TDP-43 beyond the Amyotrophic lateral sclerosis (ALS)/frontotemporal dementia (FTD)/Alzheimer disease (AD) spectrum. These findings may open novel research/therapeutic avenues for a better understanding of both NPC disease and the TDP-43 proteinopathy disease mechanism.

  10. Functional genomics indicates yeast requires Golgi/ER transport, chromatin remodeling, and DNA repair for low dose DMSO tolerance

    Directory of Open Access Journals (Sweden)

    Brandon David Gaytán

    2013-08-01

    Full Text Available Dimethyl sulfoxide (DMSO is frequently utilized as a solvent in toxicological and pharmaceutical investigations. It is therefore important to establish the cellular and molecular targets of DMSO in order to differentiate its intrinsic effects from those elicited by a compound of interest. We performed a genome-wide functional screen in Saccharomyces cerevisiae to identify deletion mutants exhibiting sensitivity to 1% DMSO, a concentration standard to yeast chemical profiling studies. We report that mutants defective in Golgi/ER transport are sensitive to DMSO, including those lacking components of the conserved oligomeric Golgi (COG complex. Moreover, strains deleted for members of the SWR1 histone exchange complex are hypersensitive to DMSO, with additional chromatin remodeling mutants displaying a range of growth defects. We also identify DNA repair genes important for DMSO tolerance. Finally, we demonstrate that overexpression of histone H2A.Z, which replaces chromatin-associated histone H2A in a SWR1-catalyzed reaction, confers resistance to DMSO. Many yeast genes described in this study have homologs in more complex organisms, and the data provided is applicable to future investigations into the cellular and molecular mechanisms of DMSO toxicity.

  11. Distinct mechanisms for opposite functions of homeoproteins Cdx2 and HoxB7 in double-strand break DNA repair in colon cancer cells.

    Science.gov (United States)

    Soret, Christine; Martin, Elisabeth; Duluc, Isabelle; Dantzer, Françoise; Vanier, Marie; Gross, Isabelle; Freund, Jean-Noël; Domon-Dell, Claire

    2016-05-01

    Homeobox genes, involved in embryonic development and tissues homeostasis in adults, are often deregulated in cancer, but their relevance in pathology is far from being fully elucidated. In colon cancers, we report that the homeoproteins HoxB7 and Cdx2 exhibit different heterogeneous patterns, Cdx2 being localized in moderately altered neoplasic glands in contrast to HoxB7 which predominates in poorly-differentiated areas; they are coexpressed in few cancer cells. In human colon cancer cells, both homeoproteins interact with the DNA repair factor KU70/80, but functional studies reveal opposite effects: HoxB7 stimulates DNA repair and cell survival upon etoposide treatment, whereas Cdx2 inhibits both processes. The stimulatory effect of HoxB7 on DNA repair requires the transactivation domain linked to the homeodomain involved in the interaction with KU70/80, whereas the transactivation domain of Cdx2 is dispensable for its inhibitory function, which instead needs the homeodomain to interact with KU70/80 and the C-terminal domain. Thus, HoxB7 and Cdx2 respectively use transcription-dependent and -independent mechanisms to stimulate and inhibit DNA repair. In addition, in cells co-expressing both homeoproteins, Cdx2 lessens DNA repair activity through a novel mechanism of inhibition of the transcriptional function of HoxB7, whereby Cdx2 forms a molecular complex with HoxB7 and prevents it to recognize its target in the chromatin. These results point out the complex interplay between the DSB DNA repair activity and the homeoproteins HoxB7 and Cdx2 in colon cancer cells, making the balance between these factors a determinant and a potential indicator of the efficacy of genotoxic drugs.

  12. Detecting variants with Metabolic Design, a new software tool to design probes for explorative functional DNA microarray development

    Directory of Open Access Journals (Sweden)

    Gravelat Fabrice

    2010-09-01

    Full Text Available Abstract Background Microorganisms display vast diversity, and each one has its own set of genes, cell components and metabolic reactions. To assess their huge unexploited metabolic potential in different ecosystems, we need high throughput tools, such as functional microarrays, that allow the simultaneous analysis of thousands of genes. However, most classical functional microarrays use specific probes that monitor only known sequences, and so fail to cover the full microbial gene diversity present in complex environments. We have thus developed an algorithm, implemented in the user-friendly program Metabolic Design, to design efficient explorative probes. Results First we have validated our approach by studying eight enzymes involved in the degradation of polycyclic aromatic hydrocarbons from the model strain Sphingomonas paucimobilis sp. EPA505 using a designed microarray of 8,048 probes. As expected, microarray assays identified the targeted set of genes induced during biodegradation kinetics experiments with various pollutants. We have then confirmed the identity of these new genes by sequencing, and corroborated the quantitative discrimination of our microarray by quantitative real-time PCR. Finally, we have assessed metabolic capacities of microbial communities in soil contaminated with aromatic hydrocarbons. Results show that our probe design (sensitivity and explorative quality can be used to study a complex environment efficiently. Conclusions We successfully use our microarray to detect gene expression encoding enzymes involved in polycyclic aromatic hydrocarbon degradation for the model strain. In addition, DNA microarray experiments performed on soil polluted by organic pollutants without prior sequence assumptions demonstrate high specificity and sensitivity for gene detection. Metabolic Design is thus a powerful, efficient tool that can be used to design explorative probes and monitor metabolic pathways in complex environments

  13. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  14. Gain of Cellular Adaptation Due to Prolonged p53 Impairment Leads to Functional Switchover from p53 to p73 during DNA Damage in Acute Myeloid Leukemia Cells*

    OpenAIRE

    2010-01-01

    Tumor suppressor p53 plays the central role in regulating apoptosis in response to genotoxic stress. From an evolutionary perspective, the activity of p53 has to be backed up by other protein(s) in case of any functional impairment of this protein, to trigger DNA damage-induced apoptosis in cancer cells. We adopted multiple experimental approaches to demonstrate that in p53-impaired cancer cells, DNA damage caused accumulation of p53 paralogue p73 via Chk-1 that strongly impacted Bax expressi...

  15. Engineering of DNA templated tri-functional nano-chain of Fecore–Aushell and a preliminary study for cancer cell labeling and treatment

    Directory of Open Access Journals (Sweden)

    Madhuri Mandal

    2012-10-01

    Full Text Available Here DNA has been used as templating and self-assembling reagent to grow the chain like nanostructure. We have designed the composite in such a fashion that we obtained optical and magnetic properties together in a single biological material. Optical properties characterized by UV–visible absorption, Circular Dichroism (CD and their analysis show no denaturization of DNA. Transmission electron micrographs (TEM indicate formation of chain like structure of the nanoparticles. Particles were functionalized with folic acid for labeling and treatment of cancer cell.

  16. "Giant Surfactants" Created by the Fast and Efficient Functionalization of a DNA Tetrahedron with a Temperature-Responsive Polymer

    NARCIS (Netherlands)

    Wilks, Thomas R.; Bath, Jonathan; de Vries, Jan Willem; Raymond, Jeffery E.; Herrmann, Andreas; Turberfield, Andrew J.; O'Reilly, Rachel K.; O’Reilly, Rachel K.

    2013-01-01

    Copper catalyzed azide-alkyne cycloaddition (CuAAC) was employed to synthesize DNA block copolymers (DBCs) with a range of polymer blocks including temperature-responsive poly(N-isoproylacrylamide) (poly(NIPAM)) and highly hydrophobic poly(styrene). Exceptionally high yields were achieved at low DNA

  17. Functions that Protect Escherichia coli from Tightly Bound DNA-Protein Complexes Created by Mutant EcoRII Methyltransferase.

    Directory of Open Access Journals (Sweden)

    Morgan L Henderson

    Full Text Available Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs, located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs. Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation: RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA. In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.

  18. An improved method for TAL effectors DNA-binding sites prediction reveals functional convergence in TAL repertoires of Xanthomonas oryzae strains.

    Directory of Open Access Journals (Sweden)

    Alvaro L Pérez-Quintero

    Full Text Available Transcription Activators-Like Effectors (TALEs belong to a family of virulence proteins from the Xanthomonas genus of bacterial plant pathogens that are translocated into the plant cell. In the nucleus, TALEs act as transcription factors inducing the expression of susceptibility genes. A code for TALE-DNA binding specificity and high-resolution three-dimensional structures of TALE-DNA complexes were recently reported. Accurate prediction of TAL Effector Binding Elements (EBEs is essential to elucidate the biological functions of the many sequenced TALEs as well as for robust design of artificial TALE DNA-binding domains in biotechnological applications. In this work a program with improved EBE prediction performances was developed using an updated specificity matrix and a position weight correction function to account for the matching pattern observed in a validation set of TALE-DNA interactions. To gain a systems perspective on the large TALE repertoires from X. oryzae strains, this program was used to predict rice gene targets for 99 sequenced family members. Integrating predictions and available expression data in a TALE-gene network revealed multiple candidate transcriptional targets for many TALEs as well as several possible instances of functional convergence among TALEs.

  19. Functional studies of ssDNA binding ability of MarR family protein TcaR from Staphylococcus epidermidis.

    Directory of Open Access Journals (Sweden)

    Yu-Ming Chang

    Full Text Available The negative transcription regulator of the ica locus, TcaR, regulates proteins involved in the biosynthesis of poly-N-acetylglucosamine (PNAG. Absence of TcaR increases PNAG production and promotes biofilm formation in Staphylococci. Previously, the 3D structure of TcaR in its apo form and its complex structure with several antibiotics have been analyzed. However, the detailed mechanism of multiple antibiotic resistance regulator (MarR family proteins such as TcaR is unclear and only restricted on the binding ability of double-strand DNA (dsDNA. Here we show by electrophoretic mobility shift assay (EMSA, electron microscopy (EM, circular dichroism (CD, and Biacore analysis that TcaR can interact strongly with single-stranded DNA (ssDNA, thereby identifying a new role in MarR family proteins. Moreover, we show that TcaR preferentially binds 33-mer ssDNA over double-stranded DNA and inhibits viral ssDNA replication. In contrast, such ssDNA binding properties were not observed for other MarR family protein and TetR family protein, suggesting that the results from our studies are not an artifact due to simple charge interactions between TcaR and ssDNA. Overall, these results suggest a novel role for TcaR in regulation of DNA replication. We anticipate that the results of this work will extend our understanding of MarR family protein and broaden the development of new therapeutic strategies for Staphylococci.

  20. Microcalorimetric Studies on Gene Promoter Function of Cloned DNA Fragements from Halobacterium halobium J7 Plasmid pHH205 in Escherichia coli TG1

    Institute of Scientific and Technical Information of China (English)

    LEI,Ke-Lin; HOU,Han-Na; LIU,Yi; YE,Xue-Cheng; SHEN,Ping

    2007-01-01

    Halobacterium halobium is a typical kind of extremely halophilic bacterium. Combined with the antibiotic resistance assay, the microcalorimetric method was used to study the promoter function of the cloned DNA fragments from Halobacterium halobium J7 plasmid pHH205 in Escherichia coli TG1. The promoter probe vector, plasmid pKK232-8, was used to form the recombinants. The DNA fragment, which is the promoter for the chloramphenicol acetyl transferase (CAT) gene in plasmid pKK232-8, is about 800 bp, and the chloramphenicol resistance level presented by IC50 is about 200 μg·mL-1, which suggests a high promoter activity. The conclusions show that there probably exist double-function or trinary-function gene promoters in Halobacterium halobium, and Archaea may contain rich genetic resources.

  1. Characterization of recombinase DMC1B and its functional role as Rad51 in DNA damage repair in Giardia duodenalis trophozoites.

    Science.gov (United States)

    Torres-Huerta, Ana Laura; Martínez-Miguel, Rosa María; Bazán-Tejeda, María Luisa; Bermúdez-Cruz, Rosa María

    2016-08-01

    Homologous recombination (HR) is a highly conserved pathway for the repair of chromosomes that harbor DNA double-stranded breaks (DSBs). The recombinase RAD51 plays a key role by catalyzing the pairing of homologous DNA molecules and the exchange of information between them. Two putative DMC1 homologs (DMC1A and DMC1B) have been identified in Giardia duodenalis. In terms of sequences, GdDMC1A and GdDMC1B bear all of the characteristic recombinase domains: DNA binding domains (helix-turn-helix motif, loops 1 and 2), an ATPcap and Walker A and B motifs associated with ATP binding and hydrolysis. Because GdDMC1B is expressed at the trophozoite stage and GdDMC1A is expressed in the cyst stage, we cloned the giardial dmc1B gene and expressed and purified its protein to determine its activities, including DNA binding, ATP hydrolysis, and DNA strand exchange. Our results revealed that it possessed these activities, and they were modulated by divalent metal ions in different manners. GdDMC1B expression at the protein and transcript levels, as well as its subcellular localization in trophozoites upon DNA damage, was assessed. We found a significant increase in GdDMC1B transcript and protein levels after ionizing radiation treatment. Additionally, GdDMC1B protein was mostly located in the nucleus of trophozoites after DNA damage. These results indicate that GdDMC1B is the recombinase responsible for DSBs repair in the trophozoite; therefore, a functional Rad51 role is proposed for GdDMC1B.

  2. Unstabilized DNA breaks in HTLV-1 Tax expressing cells correlate with functional targeting of Ku80, not PKcs, XRCC4, or H2AX

    Directory of Open Access Journals (Sweden)

    Majone Franca

    2012-04-01

    Full Text Available Abstract Background Expression of the human T-cell leukemia virus type 1 (HTLV-1 Tax oncoprotein rapidily induces a significant increase of micronuclei (MN and unstabilized DNA breaks in cells. Unstabilized DNA breaks can have free 3′-OH ends accessible to in situ addition of digoxygenin (DIG-labeled dUTP using terminal deoxynucleotidyl transferase. In the present work, we used a GFP-Tax (green fluorescent protein plasmid, which produces a functionally active GFP-tagged Tax protein, to detect the cellular target(s for Tax which might mechanistically explain the clastogenic phenomenon. We examined the induction of MN and unstabilized DNA breaks in wild type cells and cells individually knocked out for Ku80, PKcs, XRCC4, and H2AX proteins. We also assessed in the same cells, the signal strengths produced by DIG-dUTP incorporation at the unstable DNA breaks in the presence and absence of Tax. Results Cells mutated for PKcs, XRCC4 and H2AX showed increased frequency of MN and unstabilized DNA breaks in response to the expression of Tax, while cells genetically mutated for Ku80 were refractory to Tax’s induction of these cytogenetic effects. Moreover, by measuring the size of DIG-dUTP incorporation signal, which indicates the extent of unstable DNA ends, we found that Tax induces larger signals than those in control cells. However, in xrs-6 cells deficient for Ku80, this Tax effect was not seen. Conclusions The data here demonstrate that clastogenic DNA damage in Tax expressing cells is explained by Tax targeting of Ku80, but not PKcs, XRCC4 or H2AX, which are all proteins directly or indirectly related to the non-homologous end-joining (NHEJ repair system. Of note, the Ku80 protein plays an important role at the initial stage of the NHEJ repair system, protecting and stabilizing DNA-breaks. Accordingly, HTLV-1 Tax is shown to interfere with a normal cellular protective mechanism for stabilizing DNA breaks. These DNA breaks, unprotected by Ku80

  3. The CcrM DNA methyltransferase is widespread in the alpha subdivision of proteobacteria, and its essential functions are conserved in Rhizobium meliloti and Caulobacter crescentus.

    Science.gov (United States)

    Wright, R; Stephens, C; Shapiro, L

    1997-09-01

    The Caulobacter crescentus DNA methyltransferase CcrM (M.CcrMI) methylates the adenine residue in the sequence GANTC. The CcrM DNA methyltransferase is essential for viability, but it does not appear to be part of a DNA restriction-modification system. CcrM homologs are widespread in the alpha subdivision of gram-negative bacteria. We have amplified and sequenced a 258-bp region of the cerM gene from several of these bacteria, including Rhizobium meliloti, Brucella abortus, Agrobacterium tumefaciens, and Rhodobacter capsulatus. Alignment of the deduced amino acid sequences revealed that these proteins constitute a highly conserved DNA methyltransferase family. Isolation of the full-length ccrM genes from the aquatic bacterium C. crescentus, the soil bacterium R. meliloti, and the intracellular pathogen B. abortus showed that this sequence conservation extends over the entire protein. In at least two alpha subdivision bacteria, R. meliloti and C. crescentus, CcrM-mediated methylation has important cellular functions. In both organisms, CcrM is essential for viability. Overexpression of CcrM in either bacterium results in defects in cell division and cell morphology and in the initiation of DNA replication. Finally, the C. crescentus and R. meliloti ccrM genes are functionally interchangeable, as the complemented strains are viable and the chromosomes are methylated. Thus, in both R. meliloti and C. crescentus, CcrM methylation is an integral component of the cell cycle. We speculate that CcrM-mediated DNA methylation is likely to have similar roles among alpha subdivision bacteria.

  4. Function of IHF in lambda DNA packaging. II. Effects of mutations altering the IHF binding site and the intrinsic bend in cosB on lambda development.

    Science.gov (United States)

    Xin, W; Cai, Z H; Feiss, M

    1993-03-20

    cosB is the binding site on lambda DNA for terminase, the phage DNA packaging protein. cosB contains three binding sites for gpNu1, the small subunit of terminase, and a site for integration host factor (IHF). IHF plays an accessory role in lambda DNA packaging, and IHF stimulates the burst size of lambda several-fold, presumably by assisting the interaction of terminase with cosB. The present work includes a study of the effect on lambda development of a mutation, called I1A-, which consists of three adjacent base-pair changes in the IHF binding site. The I1A- mutation was found to abolish IHF stimulation of the lambda burst size, indicating that IHF is unable to bind to the mutant I1A site. A second mutation, called I1B- and also consisting of three adjacent base-pair changes, is a mutation that reduces an intrinsic bend found in cosB. lambda I1B- was more dependent on IHF than lambda+, raising the possibility that the intrinsic bend in cosB plays a role in cos function for lambda+ under the IHF- conditions. In vitro DNA packaging experiments established that the I1 mutations affect DNA packaging per se. A series of Nu1 mutations that create terminases able to suppress a variety of cosB defects were found to suppress the defects of the I1A- and I1B- mutations under IHF- conditions.

  5. The alkaline single cell electrophoresis assay with eight mouse organs: results with 22 mono-functional alkylating agents (including 9 dialkyl N-nitrosoamines) and 10 DNA crosslinkers.

    Science.gov (United States)

    Tsuda, S; Matsusaka, N; Madarame, H; Miyamae, Y; Ishida, K; Satoh, M; Sekihashi, K; Sasaki, Y F

    2000-04-13

    The genotoxicity of 22 mono-functional alkylating agents (including 9 dialkyl N-nitrosoamines) and 10 DNA crosslinkers selected from IARC (International Agency for Research on Cancer) groups 1, 2A, and 2B was evaluated in eight mouse organs with the alkaline single cell gel electrophoresis (SCGE) (comet) assay. Groups of four mice were treated once intraperitoneally at the dose at which micronucleus tests had been conducted, and the stomach, colon, liver, kidney, bladder, lung, brain, and bone marrow were sampled 3, 8, and/or 24 h later. All chemicals were positive in the SCGE assay in at least one organ. Of the 22 mono-functional alkylating agents, over 50% were positive in all organs except the brain and bone marrow. The two subsets of mono-functional alkylating agents differed in their bone marrow genotoxicity: only 1 of the 9 dialkyl N-nitrosoamines was positive in bone marrow as opposed to 8 of the 13 other alkylating agents, reflecting the fact that dialkyl N-nitrosoamines are poor micronucleus inducers in hematopoietic cells. The two groups of mono-functional alkylating agents also differ in hepatic carcinogenicity in spite of the fact that they are similar in hepatic genotoxicity. While dialkyl N-nitrosoamines produce tumors primarily in mouse liver, only one (styrene-7,8-oxide) out of 10 of the other type of mono-functional alkylating agents is a mouse hepatic carcinogen. Taking into consideration our previous results showing high concordance between hepatic genotoxicity and carcinogenicity for aromatic amines and azo compounds, a possible explanation for the discrepancy might be that chemicals that require metabolic activation show high concordance between genotoxicity and carcinogenicity in the liver. A high percent of the 10 DNA crosslinkers were positive in the SCGE assay in the gastrointestinal mucosa, but less than 50% were positive in the liver and lung. In this study, we allowed 10 min alkali-unwinding to obtain low and stable control values

  6. Two Divergent Members of 4-Coumarate: Coenzyme A Ligase from Salvia miltiorrhiza Bunge: cDNA Cloning and Functional Study

    Institute of Scientific and Technical Information of China (English)

    Shu-Juan Zhao; Zhi-Bi Hu; Di Liu; Frederick C. C. Leung

    2006-01-01

    4-Coumarate: coenzyme A ligase (4CL) is one of the key enzymes in phenylpropanoid metabolism leading to series of phenolics, including water-soluble phenolic acids, which are important compounds determining the medicinal quality of Danshen (Salvia miltiorrhiza Bunge), a traditional Chinese medicinal herb. To investigate the function of 4CL in the biosynthesis of water-soluble phenolic acid in Danshen, we have cloned two cDNAs (Sm4CL1 and Sm4CL2) encoding divergent 4CL members by applying nested reverse transcription-polymerase chain reaction (RT-PCR) with degenerate primers followed by 5'/3' rapid amplification of cDNA ends (RACE) (Note, these sequence data have been submitted to the GenBank database under accession numbers AY237163 and AY237164). Either of the coding regions was inserted into a pRSET vector and a kinetic assay was performed with purified recombinant proteins. The substrate utilization profile of Sm4CL1 was distinct from that of Sm4CL2. The Km values of Sm4CL1 and Sm4CL2 to 4-coumaric acid were (72.20±4.10) and (6.50±1.45) μmol/L, respectively. These results, in conjunction with Northern blotting and other information, imply that Sm4CL2 may play an important role in the biosynthesis of water-soluble phenolic compounds, whereas Sm4CL1 may play a minor role in the pathway. Southern blotting analysis suggested that both Sm4CL1 and Sm4CL2 genes are present as a single copy and are located at different sites in the genome.

  7. Functional DNA methylation in a transcript specific 3′UTR region of TrkB associates with suicide

    Science.gov (United States)

    Maussion, Gilles; Yang, Jennie; Suderman, Matthew; Diallo, Alpha; Nagy, Corina; Arnovitz, Mitchell; Mechawar, Naguib; Turecki, Gustavo

    2014-01-01

    Previous studies indicate that a subgroup of suicide completers has low cortical brain expression levels of TrkB-T1, a TrkB gene transcript that is highly expressed in astrocytes. Epigenetic modifications, including methylation changes in the TrkB promoter, partially explain TrkB-T1 low expression levels in brain tissue from suicide completers. The aim of this study was to investigate whether methylation changes in other regions of the TrkB gene could also contribute to the significant downregulation of the TrkB-T1 transcript observed in the brain of suicide completers. Methylation levels were assessed on BA8/9 from suicide completers expressing low TrkB-T1 transcript levels and controls, using custom-made Agilent arrays tiling the whole TrkB gene. After statistical correction for multiple testing, five probes located in the TrkB-T1 3′UTR region were found hypermethylated in the frontal cortex of suicide completers. These results were validated for four CpGs spanning a 150 bp sequence by cloning and Sanger sequencing bisulfite treated DNA. We found a significant correlation between the methylation level at these four CpGs and TrkB-T1 expression in BA8/9. Site-specific hypermethylation on this 3′UTR sequence induced decreased luciferase activity in reporter gene cell assays. Site-specific differential methylation in the TrkB-T1 3′UTR region associates with functional changes in TrkB-T1 expression and may play a significant role in the important decrease of cortical TrkB-T1 expression observed among suicide completers. PMID:24802768

  8. The adjuvant effects of high-molecule-weight polysaccharides purified from Antrodia cinnamomea on dendritic cell function and DNA vaccines.

    Directory of Open Access Journals (Sweden)

    Chi-Chen Lin

    Full Text Available The biological activity of the edible basidiomycete Antrodia cinnamomea (AC has been studied extensively. Many effects, such as anti-cancer, anti-inflammatory, and antioxidant activities, have been reported from either crude extracts or compounds isolated from AC. However, research addressing the function of AC in enhancing immunity is rare. The aim of the present study is to investigate the active components and the mechanism involved in the immunostimulatory effect of AC. We found that polysaccharides (PS in the water extract of AC played a major role in dendritic cell (DC activation, which is a critical leukocyte in initiating immune responses. We further size purified and identified that the high-molecular weight PS fraction (greater than 100 kDa exhibited the activating effect. The AC high-molecular weight PSs (AC hmwPSs promoted pro-inflammatory cytokine production by DCs and the maturation of DCs. In addition, DC-induced antigen-specific T cell activation and Th1 differentiation were increased by AC hmwPSs. In studying the molecular mechanism, we confirmed the activation of the MAPK and NF-κB pathways in DCs after AC hmwPSs treatment. Furthermore, we demonstrated that TLR2 and TLR4 are required for the stimulatory activity of AC hmwPSs on DCs. In a mouse tumor model, we demonstrated that AC hmwPSs enhanced the anti-tumor efficacy of the HER-2/neu DNA vaccine by facilitating specific Th1 responses. Thus, we conclude that hmwPSs are the major components of AC that stimulate DCs via the TLR2/TLR4 and NF-κB/MAPK signaling pathways. The AC hmwPSs have potential to be applied as adjuvants.

  9. K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features.

    Science.gov (United States)

    Sievers, Aaron; Bosiek, Katharina; Bisch, Marc; Dreessen, Chris; Riedel, Jascha; Froß, Patrick; Hausmann, Michael; Hildenbrand, Georg

    2017-04-19

    In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers) was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4) on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B) of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs), which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST) and the high pace of

  10. Convenient and efficient approach to the permanent or reversible conjugation of RNA and DNA sequences with functional groups.

    Science.gov (United States)

    Cieślak, Jacek; Ausín, Cristina; Grajkowski, Andrzej; Beaucage, Serge L

    2012-09-01

    The conversion of 3',5'-disilylated 2'-O-(methylthiomethyl)ribonucleosides to 2'-O-(phthalimidooxymethyl)ribonucleosides is achieved in yields of 66% to 94%. Desilylation and dephtalimidation of these ribonucleosides by treatment with NH(4)F in MeOH produce 2'-O-aminooxymethylated ribonucleosides, which are efficient in producing stable and yet reversible 2'-conjugates upon reaction with 1-pyrenecarboxaldehyde. Exposure of 2'-pyrenylated ribonucleosides to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF or DMSO results in the cleavage of their iminoether functions to give the native ribonucleosides along with an innocuous nitrile side product. Conversely, the reaction of 2'-O-(aminooxymethyl)uridine with 5-cholesten-3-one leads to a permanent uridine 2'-conjugate, which is left unreacted when treated with TBAF. The versatility and uniqueness of 2'-O-(aminooxymethyl)ribonucleosides is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence. Furthermore, the conjugation of 2'-O-(aminooxymethyl)ribonucleosides with various aldehydes, including those generated from their acetals, is also presented. The preparation of 5'-O-(aminooxymethyl)thymidine is also achieved, albeit in modest yields, from the conversion of 5'-O-methylthiomethyl-3'-O-(levulinyl)thymidine to 5'-O-phthalimidooxymethyl-3'-O-(levuliny)lthymidine followed by hydrazinolysis of both 5'-phthalimido and 3'-levulinyl groups. Pyrenylation of the 5'-O-(aminooxymethyl)deoxyribonucleoside also provides a reversible 5'-conjugate that is sensitive to TBAF, thereby further demonstrating the usefulness of 5'-O-(aminooxymethyl)deoxyribonucleosides for permanent or reversible modification of DNA sequences. Curr. Protoc. Nucleic Acid Chem. 50:4.52.1-4.52.36. © 2012 by John Wiley & Sons, Inc.

  11. The DNA repair endonuclease XPG interacts directly and functionally with the WRN helicase defective in Werner syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Trego, Kelly S.; Chernikova, Sophia B.; Davalos, Albert R.; Perry, J. Jefferson P.; Finger, L. David; Ng, Cliff; Tsai, Miaw-Sheue; Yannone, Steven M.; Tainer, John A.; Campisi, Judith; Cooper, Priscilla K.

    2011-04-20

    XPG is a structure-specific endonuclease required for nucleotide excision repair (NER). XPG incision defects result in the cancer-prone syndrome xeroderma pigmentosum, whereas truncating mutations of XPG cause the severe postnatal progeroid developmental disorder Cockayne syndrome. We show that XPG interacts directly with WRN protein, which is defective in the premature aging disorder Werner syndrome, and that the two proteins undergo similar sub-nuclear redistribution in S-phase and co-localize in nuclear foci. The co-localization was observed in mid- to late-S-phase, when WRN moves from nucleoli to nuclear foci that have been shown to contain protein markers of both stalled replication forks and telomeric proteins. We mapped the interaction between XPG and WRN to the C-terminal domains of each and show that interaction with the C-terminal domain of XPG strongly stimulates WRN helicase activity. WRN also possesses a competing DNA single-strand annealing activity that, combined with unwinding, has been shown to coordinate regression of model replication forks to form Holliday junction/chicken foot intermediate structures. We tested whether XPG stimulated WRN annealing activity and found that XPG itself has intrinsic strand annealing activity that requires the unstructured R- and C-terminal domains, but not the conserved catalytic core or endonuclease activity. Annealing by XPG is cooperative, rather than additive, with WRN annealing. Taken together, our results suggest a novel function for XPG in S-phase that is at least in part carried out coordinately with WRN, and which may contribute to the severity of the phenotypes that occur upon loss of XPG.

  12. Multiple genes for functional 6 fatty acyl desaturases (Fad) in Atlantic salmon (Salmo salar L.): gene and cDNA characterization, functional expression, tissue distribution and nutritional regulation.

    Science.gov (United States)

    Monroig, Oscar; Zheng, Xiaozhong; Morais, Sofia; Leaver, Michael J; Taggart, John B; Tocher, Douglas R

    2010-09-01

    Fish are the primary source in the human food basket of the n-3 long-chain polyunsaturated fatty acids, eicosapentaenoate (EPA; 20:5n-3) and docosahexaenoate (DHA; 22:6n-3), that are crucial to the health of higher vertebrates. Atlantic salmon are able to synthesize EPA and DHA from 18:3n-3 through reactions catalyzed by fatty acyl desaturases (Fad) and elongases of very long chain fatty acids. Previously, two cDNAs encoding functionally distinct Delta5 and Delta6 Fads were isolated, but screening of a genomic DNA library revealed the existence of more putative fad genes in the Atlantic salmon genome. In the present study, we show that there are at least four genes encoding putative Fad proteins in Atlantic salmon. Two genes, Delta6fad_a and Delta5fad, corresponded to the previously cloned Delta6 and Delta5 Fad cDNAs. Functional characterization by heterologous expression in yeast showed that the cDNAs for both the two further putative fad genes, Delta6fad_b and Delta6fad_c, had only Delta6 activity, converting 47 % and 12 % of 18:3n-3 to 18:4n-3, and 25 and 7 % of 18:2n-6 to 18:3n-6, for 6Fad_b and Delta6fad_c, respectively. Both 6fad_a and 6fad_b genes were highly expressed in intestine (pyloric caeca), liver and brain, with 6fad_b also highly expressed in gill, whereas 6fad_c transcript was found predominantly in brain, with lower expression levels in all other tissues. The expression levels of the 6fad_a gene in liver and the 6fad_b gene in intestine were significantly higher in fish fed diets containing vegetable oil compared to fish fed fish oil suggesting up-regulation in response to reduced dietary EPA and DHA. In contrast, no significant differences were found between transcript levels for 6fad_a in intestine, 6fad_b in liver, or 6fad_c in liver or intestine of fish fed vegetable oil compared to fish fed fish oil. The observed differences in tissue expression and nutritional regulation of the fad genes are discussed in relation to gene structures and fish

  13. Improved description of the structural and optoelectronic properties of DNA/RNA nucleobase anhydrous crystals: Experiment and dispersion-corrected density functional theory calculations

    Science.gov (United States)

    da Silva, M. B.; Francisco, T. S.; Maia, F. F.; Caetano, E. W. S.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.

    2017-08-01

    The development of low cost and environmentally friendly organic electronic/optoelectronic devices has attracted a lot of interest. The integration of DNA and RNA nucleobases to improve the performance of organic light-emitting diodes has been proposed recently [Gomez et al., Sci. Rep. 4, 7105 (2014), 10.1038/srep07105], notwithstanding limited experimental and theoretical information on the optoelectronic properties of DNA/RNA thin films. As a contribution to an improved understanding of DNA/RNA-based devices in the solid state, we have performed in this paper dispersion corrected density functional theory (DFT) and time-dependent DFT (TDDFT) calculations to obtain the optimized geometries, Kohn-Sham band structures and orbitals, charge distribution, optical absorption, Frenkel exciton binding energies, and complex dielectric functions of the five DNA/RNA nucleobase anhydrous crystals, namely cytosine, guanine, adenine, thymine, and uracil. Optical absorption measurements on DNA/RNA nucleobase powders were also performed for comparison with the simulations. An improvement on the local density approximation (LDA) description of the lattice parameter estimates was achieved considering the generalized gradient approach (GGA) with a semiempirical dispersion correction scheme in comparison with structural x-ray data found in the literature. Energy gap correction using the Δ-sol methodology provided a good agreement between theory and experimental estimates from our optical absorption data, greatly surpassing the quality of previous simulations. Effective masses for the carriers were also found, indicating that the guanine crystal as well as the cytosine one (although with some drawbacks) has potential applications in optoelectronics as a direct gap semiconductor, with the other nucleobases presenting either a semiconductor or an insulator character depending on the carrier type. The complex dielectric function exhibits a high degree of anisotropy for different states

  14. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Directory of Open Access Journals (Sweden)

    Alamar Santiago

    2009-09-01

    Full Text Available Abstract Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new

  15. Rapid identification of genes encoding DNA polymerases by function-based screening of metagenomic libraries derived from glacial ice.

    Science.gov (United States)

    Simon, Carola; Herath, Judith; Rockstroh, Stephanie; Daniel, Rolf

    2009-05-01

    Small-insert and large-insert metagenomic libraries were constructed from glacial ice of the Northern Schneeferner, which is located on the Zugspitzplatt in Germany. Subsequently, these libraries were screened for the presence of DNA polymerase-encoding genes by complementation of an Escherichia coli polA mutant. Nine novel genes encoding complete DNA polymerase I proteins or domains typical of these proteins were recovered.

  16. Rapid Identification of Genes Encoding DNA Polymerases by Function-Based Screening of Metagenomic Libraries Derived from Glacial Ice▿

    OpenAIRE

    2009-01-01

    Small-insert and large-insert metagenomic libraries were constructed from glacial ice of the Northern Schneeferner, which is located on the Zugspitzplatt in Germany. Subsequently, these libraries were screened for the presence of DNA polymerase-encoding genes by complementation of an Escherichia coli polA mutant. Nine novel genes encoding complete DNA polymerase I proteins or domains typical of these proteins were recovered.

  17. Researches of repairing function of mitochondrial DNA in aging process%衰老过程中线粒体DNA修复功能的研究

    Institute of Scientific and Technical Information of China (English)

    易军

    2011-01-01

    With the research method of literature study, the paper discusses the current researches of repairing function of mitochondrial DNA and its development. The paper analyses the repairing function of mitochondrial DNA in the aging process and its possible m%对衰老过程中线粒体DNA修复功能的研究现状及进展进行探讨,分析了线粒体DNA修复在衰老过程中的作用和可能机制,包括衰老过程中活性氧生成及线粒体抗氧化体系的变化,线粒体DNA修复酶OGGl的可能作用机制。

  18. Structure-function studies of an unusual 3-methyladenine DNA glycosylase II (AlkA) from Deinococcus radiodurans.

    Science.gov (United States)

    Moe, Elin; Hall, David R; Leiros, Ingar; Monsen, Vivi Talstad; Timmins, Joanna; McSweeney, Sean

    2012-06-01

    3-Methyladenine DNA glycosylase II (AlkA) is a DNA-repair enzyme that removes alkylated bases in DNA via the base-excision repair (BER) pathway. The enzyme belongs to the helix-hairpin-helix (HhH) superfamily of DNA glycosylases and possesses broad substrate specificity. In the genome of Deinococcus radiodurans, two genes encoding putative AlkA have been identified (Dr_2074 and Dr_2584). Dr_2074 is a homologue of human AlkA (MPG or AAG) and Dr_2584 is a homologue of bacterial AlkAs. Here, the three-dimensional structure of Dr_2584 (DrAlkA2) is presented and compared with the previously determined structure of Escherichia coli AlkA (EcAlkA). The results show that the enzyme consists of two helical-bundle domains separated by a wide DNA-binding cleft and contains an HhH motif. Overall, the protein fold is similar to the two helical-bundle domains of EcAlkA, while the third N-terminal mixed α/β domain observed in EcAlkA is absent. Substrate-specificity analyses show that DrAlkA2, like EcAlkA, is able to remove both 3-methyladenine (3meA) and 7-methylguanine (7meG) from DNA; however, the enzyme possesses no activity towards 1,N(6)-ethenoadenine (ℇA) and hypoxanthine (Hx). In addition, it shows activity towards the AlkB dioxygenase substrates 3-methylcytosine (3meC) and 1-methyladenine (1meA). Thus, the enzyme seems to preferentially repair methylated bases with weakened N-glycosidic bonds; this is an unusual specificity for a bacterial AlkA protein and is probably dictated by a combination of the wide DNA-binding cleft and a highly accessible specificity pocket.

  19. Cardiac Myocyte De Novo DNA Methyltransferases 3a/3b Are Dispensable for Cardiac Function and Remodeling after Chronic Pressure Overload in Mice.

    Directory of Open Access Journals (Sweden)

    Thomas G Nührenberg

    Full Text Available Recent studies reported altered DNA methylation in failing human hearts. This may suggest a role for de novo DNA methylation in the development of heart failure. Here, we tested whether cardiomyocyte-specific loss of de novo DNA methyltransferases Dnmt3a and Dnmt3b altered cardiac function and remodeling after chronic left ventricular pressure overload.Mice with specific ablation of Dnmt3a and Dnmt3b expression in cardiomyocytes were generated by crossing floxed Dnmt3afl and Dnmt3bfl alleles with mice expressing Cre recombinase under control of the atrial myosin light chain gene promoter. The efficacy of combined Dnmt3a/3b ablation (DKO was characterized on cardiomyocyte-specific genomic DNA and mRNA levels. Cardiac phenotyping was carried out without (sham or with left ventricular pressure overload induced by transverse aortic constriction (TAC. Under similar conditions, cardiac genome-wide transcriptional profiling was performed and DNA methylation levels of promoters of differentially regulated genes were assessed by pyrosequencing.DKO cardiomyocytes showed virtual absence of targeted Dnmt3a and Dnmt3b mRNA transcripts. Cardiac phenotyping revealed no significant differences between DKO and control mice under sham and TAC conditions. Transcriptome analyses identified upregulation of 44 and downregulation of 9 genes in DKO as compared with control sham mice. TAC mice showed similar changes with substantial overlap of regulated genes compared to sham. Promoters of upregulated genes were largely unmethylated in DKO compared to control mice.The absence of cardiac pathology in the presence of the predicted molecular phenotype suggests that de novo DNA methylation in cardiomyocytes is dispensable for adaptive mechanisms after chronic cardiac pressure overload.

  20. Benchmark quantum-chemical calculations on a complete set of rotameric families of the DNA sugar-phosphate backbone and their comparison with modern density functional theory.

    Science.gov (United States)

    Mládek, Arnošt; Krepl, Miroslav; Svozil, Daniel; Cech, Petr; Otyepka, Michal; Banáš, Pavel; Zgarbová, Marie; Jurečka, Petr; Sponer, Jiří

    2013-05-21

    The DNA sugar-phosphate backbone has a substantial influence on the DNA structural dynamics. Structural biology and bioinformatics studies revealed that the DNA backbone in experimental structures samples a wide range of distinct conformational substates, known as rotameric DNA backbone conformational families. Their correct description is essential for methods used to model nucleic acids and is known to be the Achilles heel of force field computations. In this study we report the benchmark database of MP2 calculations extrapolated to the complete basis set of atomic orbitals with aug-cc-pVTZ and aug-cc-pVQZ basis sets, MP2(T,Q), augmented by ΔCCSD(T)/aug-cc-pVDZ corrections. The calculations are performed in the gas phase as well as using a COSMO solvent model. This study includes a complete set of 18 established and biochemically most important families of DNA backbone conformations and several other salient conformations that we identified in experimental structures. We utilize an electronically sufficiently complete DNA sugar-phosphate-sugar (SPS) backbone model system truncated to prevent undesired intramolecular interactions. The calculations are then compared with other QM methods. The BLYP and TPSS functionals supplemented with Grimme's D3(BJ) dispersion term provide the best tradeoff between computational demands and accuracy and can be recommended for preliminary conformational searches as well as calculations on large model systems. Among the tested methods, the best agreement with the benchmark database has been obtained for the double-hybrid DSD-BLYP functional in combination with a quadruple-ζ basis set, which is, however, computationally very demanding. The new hybrid density functionals PW6B95-D3 and MPW1B95-D3 yield outstanding results and even slightly outperform the computationally more demanding PWPB95 double-hybrid functional. B3LYP-D3 is somewhat less accurate compared to the other hybrids. Extrapolated MP2(D,T) calculations are not as

  1. Cloning and expression of the cDNA encoding the FXPRL family of peptides and a functional analysis of their effect on breaking pupal diapause in Helicoverpa armigera.

    Science.gov (United States)

    Zhang, Tian-Yi; Sun, Jiu-Song; Zhang, Liu-Bin; Shen, Jin-Liang; Xu, Wei-Hua

    2004-01-01

    Diapause hormone (DH) and pheromone biosynthesis activating neuropeptide (PBAN) are encoded by a single mRNA in the suboesophegeal ganglion (SG) and are responsible for induction of embryonic diapause in Bombyx mori and sex pheromone biosynthesis in lepidopteran insects. PBAN cDNA analyses revealed that the DH-like peptide is present in several species that have a pupal diapause. However, the function of the DH-like peptide remains unknown. In the present study, we cloned the cDNA encoding DH-PBAN in Helicoverpa armigera utilizing the rapid amplification of the cDNA ends method. The nucleotide se quence analysis revealed that the longest open reading frame of this cDNA encodes a 194-amino acid precursor protein that con tains a 33-aa PBAN, a 24-aa DH-like peptide, and three other neuropeptides, all of which have a common C-terminal pentapeptide motif FXPR/KL ( X=G, T, S). A homology search showed that H. armigera DH-like and PBAN are highly homologous to those from other insects. Northern blot analysis demonstrated a single message RNA corresponding to the size of Har-DH-PBAN cDNA from pupal SG with significantly higher expression in the SG of nondiapause pupae than diapausing pupae. Western blot analysis showed DH-like peptide expression from SG of both males and females. When DH-like peptide was injected into nondiapause larvae and pupae, it did not induce diapause, but rather efficiently broke pupal diapause in H. armigera. The ED(50) of DH to terminate pupal diapause is 20 pmol/pupae. The other four FXPRLamide neuropeptides from the DH-PBAN polyprotein precursor have cross activity for diapause termination. These observations therefore suggest a potential role for these FXPRL family peptides in promoting continuous development in several noctuid species. The high expression of this gene in pharate adults and adults indicates that the FXPRL family peptides may have multiple physiological functions.

  2. High-density functionalization and cross-linking of DNA: "click" and "bis-click" cycloadditions performed on alkynylated oligonucleotides with fluorogenic anthracene azides.

    Science.gov (United States)

    Pujari, Suresh S; Ingale, Sachin A; Seela, Frank

    2014-10-15

    High density functionalization of DNA with ethynyl and octadiynyl side chains followed by CuAAC "click labeling" with 9-azidomethylanthracene was performed. Alkynyl DNA was also cross-linked with fluorogenic 9,10-bis-azidomethylanthracene employing the "bis-click" reaction. By this means the fluorescence of the anthracene moiety was imparted to the virtually nonfluorescent DNA. Phosphoramidites of 8-aza-7-deaza-2'-deoxyadenosine with short and long linker arms in a steric nondemanding 7-position were utilized in solid phase oligodeoxynucleotide synthesis. High density alkynylated DNA-without anthracene residues-was found to be of comparable stability with both long and short linker arms. High density anthracene functionalized DNA became less stable with the short linker compared to that with the long linker connectivity. Interstrand cross-linked homodimers constructed from alkynylated oligonucleotides with fluorogenic 9,10-bis-azidomethylanthracene were hybridized with complementary strands to form double helices. They are more stable when the linker was located at a terminus than in a central position. Short linker anthracene adducts were destabilizing compared to long linker adducts. The fluorogenic anthracene residues not only have a significant effect on the duplex stability, but also impart fluorescence to the species. Fluorescence of cross-linked double helices with long linker connectivity was quenched when the cross-link was in a terminal position and was dequenched when the linker was connecting the two double helices at the center of the molecule. The fluorescence of the anthracene cross-linked double helices was strongly increased (dequenched) when the correct base pair was formed, while no change occurred upon mismatch formation.

  3. Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA using boric acid-functionalized nano-microsphere fluorescent probes.

    Science.gov (United States)

    Chen, Hua-Yan; Wei, Jing-Ru; Pan, Jiong-Xiu; Zhang, Wei; Dang, Fu-Quan; Zhang, Zhi-Qi; Zhang, Jing

    2017-05-15

    5-hydroxymethylcytosine (5hmC) is the sixth base of DNA. It is involved in active DNA demethylation and can be a marker of diseases such as cancer. In this study, we developed a simple and sensitive 2-(4-boronophenyl)quinoline-4-carboxylic acid modified poly (glycidyl methacrylate (PBAQA-PGMA) fluorescent probe to detect the 5hmC content of genomic DNA based on T4 β-glucosyltransferase-catalyzed glucosylation of 5hmC. The fluorescence-enhanced intensity recorded from the DNA sample was proportional to its 5-hydroxymethylcytosine content and could be quantified by fluorescence spectrophotometry. The developed probe showed good detection sensitivity and selectivity and a good linear relationship between the fluorescence intensity and the concentration of 5 hmC within a 0-100nM range. Compared with other fluorescence detection methods, this method not only could determine trace amounts of 5 hmC from genomic DNA but also could eliminate the interference of fluorescent dyes and the need for purification. It also could avoid multiple labeling. Because the PBAQA-PGMA probe could enrich the content of glycosyl-5-hydroxymethyl-2-deoxycytidine from a complex ground substance, it will broaden the linear detection range and improve sensitivity. The limit of detection was calculated to be 0.167nM after enrichment. Furthermore, the method was successfully used to detect 5-hydroxymethylcytosine from mouse tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Function and horizontal transfer of the small terminase subunit of the tailed bacteriophage Sf6 DNA packaging nanomotor

    Science.gov (United States)

    Leavitt, Justin C.; Gilcrease, Eddie B.; Wilson, Kassandra; Casjens, Sherwood R.

    2013-01-01

    Bacteriophage Sf6 DNA packaging series initiate at many locations across a 2 kbp region. Our in vivo studies that show that Sf6 small terminase subunit (TerS) protein recognizes a specific packaging (pac) site near the center of this region, that this site lies within the portion of the Sf6 gene that encodes the DNA-binding domain of TerS protein, that this domain of the TerS protein is responsible for the imprecision in Sf6 packaging initiation, and that the DNA-binding domain of TerS must be covalently attached to the domain that interacts with the rest of the packaging motor. The TerS DNA-binding domain is self-contained in that it apparently does not interact closely with the rest of the motor and it binds to a recognition site that lies within the DNA that encodes the domain. This arrangement has allowed the horizontal exchange of terS genes among phages to be very successful. PMID:23562538

  5. SETD2 loss-of-function promotes renal cancer branched evolution through replication stress and impaired DNA repair

    DEFF Research Database (Denmark)

    Kanu, N.; Grönroos, E.; Martinez, P.

    2015-01-01

    Defining mechanisms that generate intratumour heterogeneity and branched evolution may inspire novel therapeutic approaches to limit tumour diversity and adaptation. SETD2 (Su(var), Enhancer of zeste, Trithorax-domain containing 2) trimethylates histone-3 lysine-36 (H3K36me3) at sites of active...... proteins minichromosome maintenance complex component (MCM7) and DNA polymerase δ hindering replication fork progression, and failure to load lens epithelium-derived growth factor and the Rad51 homologous recombination repair factor at DNA breaks. Consistent with these data, we observe chromosomal...... breakpoint locations are biased away from H3K36me3 sites in SETD2 wild-type ccRCCs relative to tumours with bi-allelic SETD2 aberrations and that H3K36me3-negative ccRCCs display elevated DNA damage in vivo. These data suggest a role for SETD2 in maintaining genome integrity through nucleosome stabilization...

  6. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  7. [Function of flow cytometry on the dosage of antibodies against double stranded DNA in systemic lupus erythematosus].

    Science.gov (United States)

    Ferrero, Paola V; Drenkard, Cristina; Collino, César; Cabral, María José; Gamron, Susana; Barberis, Gloria; Onetti, Carlos M; Menso de Ezcurra, Emilia M

    2005-01-01

    Among the diverse number of antibodies observed in systemic lupus erythematosus, antibodies against double stranded DNA (anti-dsDNA) represent important serologic markers for the disease diagnosis and the follow-up of the disease activity. To evaluate the role of a new quantitative methodology to detect antibodies against double stranded DNA in systemic lupus erythematosus and its association with the disease activity. The performance of the indirect immunofluorescence flow cytometry with Crithidia luciliae as substrate was compared with the Crithidia luciliae indirect immunofluorescence assay and the ELISA technique in order to detect antibodies against double stranded DNA in 54 sera from 47 patient with systemic lupus erythematosus and 100 sera from normal controls. The new method showed a sensitivity of 78% and a specificity of 81% when the Crithidia luciliae indirect immunofluorescence assay was the gold standard. Compared with the ELISA technique, the flow cytometry showed a sensitivity of 78% and a specificity of 86%. No correlation was found among antibodies against double stranded DNA values detected with flow cytometry and the MEX-SLEDAI activity scores. However, the flow cytometry showed a sensitivity of 70% and a specificity of 42% to distinguish patients with systemic lupus erythematosus with and without activity (MEX-SLEDAI score > or = 5). The Rho intra-observer coefficient was 0.61 (p < 0.0001). In spite of the fact that this new method might represent an interesting advance for antibodies against double stranded DNA quantitative testing, a clear superiority does not emerge when it was compared with more traditional assays. Difficulties related with its reproducibility might represent a limitation in the routine use of this new method.

  8. Functional interaction of CCAAT/enhancer-binding-protein-α basic region mutants with E2F transcription factors and DNA.

    Science.gov (United States)

    Kowenz-Leutz, Elisabeth; Schuetz, Anja; Liu, Qingbin; Knoblich, Maria; Heinemann, Udo; Leutz, Achim

    2016-07-01

    The transcription factor CCAAT/enhancer-binding protein α (C/EBPα) regulates cell cycle arrest and terminal differentiation of neutrophils and adipocytes. Mutations in the basic leucine zipper domain (bZip) of C/EBPα are associated with acute myeloid leukemia. A widely used murine transforming C/EBPα basic region mutant (BRM2) entails two bZip point mutations (I294A/R297A). BRM2 has been discordantly described as defective for DNA binding or defective for interaction with E2F. We have separated the two BRM2 mutations to shed light on the intertwined reciprocity between C/EBPα-E2F-DNA interactions. Both, C/EBPα I294A and R297A retain transactivation capacity and interaction with E2F-DP. The C/EBPα R297A mutation destabilized DNA binding, whereas the C/EBPα I294A mutation enhanced binding to DNA. The C/EBPα R297A mutant, like BRM2, displayed enhanced interaction with E2F-DP but failed to repress E2F-dependent transactivation although both mutants were readily suppressed by E2F1 for transcription through C/EBP cis-regulatory sites. In contrast, the DNA binding enhanced C/EBPα I294A mutant displayed increased repression of E2F-DP mediated transactivation and resisted E2F-DP mediated repression. Thus, the efficient repression of E2F dependent S-phase genes and the activation of differentiation genes reside in the balanced DNA binding capacity of C/EBPα.

  9. DnaK dependence of mutant ethanol oxidoreductases evolved for aerobic function and protective role of the chaperone against protein oxidative damage in Escherichia coli

    Science.gov (United States)

    Echave, Pedro; Esparza-Cerón, M. Angel; Cabiscol, Elisa; Tamarit, Jordi; Ros, Joaquim; Membrillo-Hernández, Jorge; Lin, E. C. C.

    2002-01-01

    The adhE gene of Escherichia coli encodes a multifunctional ethanol oxidoreductase (AdhE) that catalyzes successive reductions of acetyl-CoA to acetaldehyde and then to ethanol reversibly at the expense of NADH. Mutant JE52, serially selected for acquired and improved ability to grow aerobically on ethanol, synthesized an AdhEA267T/E568K with two amino acid substitutions that sequentially conferred improved catalytic properties and stability. Here we show that the aerobic growth ability on ethanol depends also on protection of the mutant AdhE against metal-catalyzed oxidation by the chaperone DnaK (a member of the Hsp70 family). No DnaK protection of the enzyme is evident during anaerobic growth on glucose. Synthesis of DnaK also protected E. coli from H2O2 killing under conditions when functional AdhE is not required. Our results therefore suggest that, in addition to the known role of protecting cells against heat stress, DnaK also protects numerous kinds of proteins from oxidative damage. PMID:11917132

  10. Altered Function of the DnaJ Family Cochaperone DNJ-17 Modulates Locomotor Circuit Activity in a Caenorhabditis elegans Seizure Model

    Science.gov (United States)

    Takayanagi-Kiya, Seika; Jin, Yishi

    2016-01-01

    The highly conserved cochaperone DnaJ/Hsp40 family proteins are known to interact with molecular chaperone Hsp70, and can regulate many cellular processes including protein folding, translocation, and degradation. In studies of Caenorhabditis elegans locomotion mutants, we identified a gain-of-function (gf) mutation in dnj-17 closely linked to the widely used e156 null allele of C. elegans GAD (glutamic acid decarboxylase) unc-25. dnj-17 encodes a DnaJ protein orthologous to human DNAJA5. In C. elegans DNJ-17 is a cytosolic protein and is broadly expressed in many tissues. dnj-17(gf) causes a single amino acid substitution in a conserved domain, and behaves as a hypermorphic mutation. The effect of this dnj-17(gf) is most prominent in mutants lacking GABA synaptic transmission. In a seizure model caused by a mutation in the ionotropic acetylcholine receptor acr-2(gf), dnj-17(gf) exacerbates the convulsion phenotype in conjunction with absence of GABA. Null mutants of dnj-17 show mild resistance to aldicarb, while dnj-17(gf) is hypersensitive. These results highlight the importance of DnaJ proteins in regulation of C. elegans locomotor circuit, and provide insights into the in vivo roles of DnaJ proteins in humans. PMID:27185401

  11. Locked nucleic acid (LNA) induced effect on the hybridization and fluorescence properties of oligodeoxyribonucleotides modified with nucleobase-functionalized DNA monomers.

    Science.gov (United States)

    Kaura, Mamta; Hrdlicka, Patrick J

    2015-07-14

    LNA and nucleobase-modified DNA monomers are two types of building blocks that are used extensively in oligonucleotide chemistry. However, there are only very few reports in which these two monomer families are used alongside each other. In the present study we set out to characterize the biophysical properties of oligodeoxyribonucleotides in which C5-modified 2'-deoxyuridine or C8-modified 2'-deoxyadenosine monomers are flanked by LNA nucleotides. We hypothesized that the LNA monomers would alter the sugar rings of the modified DNA monomers toward more RNA-like North-type conformations for maximal DNA/RNA affinity and specificity. Indeed, the incorporation of LNA monomers almost invariably results in increased target affinity and specificity relative to the corresponding LNA-free ONs, but the magnitude of the stabilization varies greatly. Introduction of LNA nucleotides as direct neighbors into C5-pyrene-functionalized pyrimidine DNA monomers yields oligonucleotide probes with more desirable photophysical properties as compared to the corresponding LNA-free probes, including more intense fluorescence emission upon target binding and improved discrimination of single nucleotide polymorphisms (SNPs). These hybrid oligonucleotides are therefore promising probes for diagnostic applications.

  12. Molecular cloning and analysis of functional cDNA and genomic clones encoding bovine cellular retinoic acid-binding protein.

    OpenAIRE

    Shubeita, H E; Sambrook, J F; McCormick, A M

    1987-01-01

    A recombinant cDNA clone, pCRABP-HS1, encoding cellular retinoic acid-binding protein was isolated from a bovine adrenal cDNA library. COS-7 cells transfected with pCRABP-HS1 produced a biologically active retinoic acid-binding protein molecule of the expected molecular mass (15.5 kDa). RNA blot hybridization analysis using pCRABP-HS1 as a probe revealed a single 1050-nucleotide mRNA species in bovine adrenal, uterus, and testis, tissues that contain the highest levels of retinoic acid-bindin...

  13. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  14. Human and mouse homologs of the Saccharomyces cerevisiae RAD54 DNA repair gene: evidence for functional conservation.

    NARCIS (Netherlands)

    R. Kanaar (Roland); C. Troelstra (Christine); S.M.A. Swagemakers (Sigrid); J. Essers (Jeroen); B. Smit (Bep); J.H. Franssen; A. Pastink (Albert); O.Y. Bezzubova (Olga); J-M. Buerstedde; B. Clever (Beate); W-D. Heyer (Wolf-Dietrich); J.H.J. Hoeijmakers (Jan)

    1996-01-01

    textabstractBACKGROUND: Homologous recombination is of eminent importance both in germ cells, to generate genetic diversity during meiosis, and in somatic cells, to safeguard DNA from genotoxic damage. The genetically well-defined RAD52 pathway is required for these processes in the yeast Saccharomy

  15. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

  16. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; El Tamer, M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the pe

  17. "Giant surfactants" created by the fast and efficient functionalization of a DNA tetrahedron with a temperature-responsive polymer.

    Science.gov (United States)

    Wilks, Thomas R; Bath, Jonathan; de Vries, Jan Willem; Raymond, Jeffery E; Herrmann, Andreas; Turberfield, Andrew J; O'Reilly, Rachel K

    2013-10-22

    Copper catalyzed azide-alkyne cycloaddition (CuAAC) was employed to synthesize DNA block copolymers (DBCs) with a range of polymer blocks including temperature-responsive poly(N-isoproylacrylamide) (poly(NIPAM)) and highly hydrophobic poly(styrene). Exceptionally high yields were achieved at low DNA concentrations, in organic solvents, and in the absence of any solid support. The DNA segment of the DBC remained capable of sequence-specific hybridization